Higgs pair production at NLO QCD for CP-violating Higgs sectors
Gröber, R.; Mühlleitner, M.; Spira, M.
2017-12-01
Higgs pair production through gluon fusion is an important process at the LHC to test the dynamics underlying electroweak symmetry breaking. Higgs sectors beyond the Standard Model (SM) can substantially modify this cross section through novel couplings not present in the SM or the on-shell production of new heavy Higgs bosons that subsequently decay into Higgs pairs. CP violation in the Higgs sector is important for the explanation of the observed matter-antimatter asymmetry through electroweak baryogenesis. In this work we compute the next-to-leading order (NLO) QCD corrections in the heavy top quark limit, including the effects of CP violation in the Higgs sector. We choose the effective theory (EFT) approach, which provides a rather model-independent way to explore New Physics (NP) effects by adding dimension-6 operators, both CP-conserving and CP-violating ones, to the SM Lagrangian. Furthermore, we perform the computation within a specific UV-complete model and choose as benchmark model the general 2-Higgs-Doublet Model with CP violation, the C2HDM. Depending on the dimension-6 coefficients, the relative NLO QCD corrections are affected by several per cent through the new CP-violating operators. This is also the case for SM-like Higgs pair production in the C2HDM, while the relative QCD corrections in the production of heavier C2HDM Higgs boson pairs deviate more strongly from the SM case. The absolute cross sections both in the EFT and the C2HDM can be modified by more than an order of magnitude. In particular, in the C2HDM the resonant production of Higgs pairs can by far exceed the SM cross section.
Directory of Open Access Journals (Sweden)
Lenka Maršálková
2014-07-01
Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.
Higgs pair production at NLO QCD for CP-violating Higgs sectors
Directory of Open Access Journals (Sweden)
R. Gröber
2017-12-01
Full Text Available Higgs pair production through gluon fusion is an important process at the LHC to test the dynamics underlying electroweak symmetry breaking. Higgs sectors beyond the Standard Model (SM can substantially modify this cross section through novel couplings not present in the SM or the on-shell production of new heavy Higgs bosons that subsequently decay into Higgs pairs. CP violation in the Higgs sector is important for the explanation of the observed matter-antimatter asymmetry through electroweak baryogenesis. In this work we compute the next-to-leading order (NLO QCD corrections in the heavy top quark limit, including the effects of CP violation in the Higgs sector. We choose the effective theory (EFT approach, which provides a rather model-independent way to explore New Physics (NP effects by adding dimension-6 operators, both CP-conserving and CP-violating ones, to the SM Lagrangian. Furthermore, we perform the computation within a specific UV-complete model and choose as benchmark model the general 2-Higgs-Doublet Model with CP violation, the C2HDM. Depending on the dimension-6 coefficients, the relative NLO QCD corrections are affected by several per cent through the new CP-violating operators. This is also the case for SM-like Higgs pair production in the C2HDM, while the relative QCD corrections in the production of heavier C2HDM Higgs boson pairs deviate more strongly from the SM case. The absolute cross sections both in the EFT and the C2HDM can be modified by more than an order of magnitude. In particular, in the C2HDM the resonant production of Higgs pairs can by far exceed the SM cross section.
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
CP violation in top pair production at an e^+e^- collider
Chang, Darwin; Phillips, Ivan
1992-01-01
We investigate a possible CP violating effect in $e^+e^-$ annihilation into $t\\bar t$ top quark pairs. As an illustrative example, we assume the source of the CP nonconservation is in the Yukawa couplings of a neutral Higgs boson which contain both scalar and pseudoscalar pieces. One of the interesting observable effects is the difference in production rates between the two CP conjugate polarized $t\\bar t$ states.
Higgs pair production in the CP-violating two-Higgs-doublet model
Bian, Ligong; Chen, Ning; Jiang, Yun
2017-12-01
The SM-like Higgs pair production is discussed in the framework of the general CP-violating two-Higgs-doublet model, where we find that the CP-violating mixing angles can be related to the Higgs self-couplings. Therefore, the future experimental searches for Higgs boson pairs can be constrained by the improved precision of the electric dipole moment measurements. Based on a series of constraints of the SM-like Higgs boson signal fits, the perturbative unitarity and stability bounds to the Higgs potential, and the most recent LHC searches for heavy Higgs bosons, we suggest a set of benchmark models for the future high-energy collider searches for Higgs pair production. The e+e- colliders operating at s = (500GeV,1 TeV) are capable of measuring the Higgs cubic self-couplings of the benchmark models directly. We also estimate the cross sections of the resonance contributions to the Higgs pair productions for the benchmark models at the future LHC and SppC/FCC-hh runs.
Measuring the CP state of tau lepton pairs from Higgs decay at the ILC
Jeans, D.; Wilson, G. W.
2018-01-01
In the Standard Model, the Higgs boson is a CP even state with CP conserving couplings; any deviations from this would be a sign of new physics. These CP properties can be probed by measuring Higgs decays to tau lepton pairs: the transverse correlation between the tau spins depends on CP. This paper develops such an analysis, using full simulation of signal and background events in the International Large Detector concept for the International Linear Collider. We consider Higgs-strahlung even...
A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.
Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin
2005-06-01
Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
CP violation in b-hadron decays using top-pair events in 8 TeV ATLAS data
D'onofrio, Adelina; The ATLAS collaboration
2017-01-01
CP violation in weak interactions is a well-established evidence in Particle Physics. Nevertheless, the most recent combination of all CP violation measurements is found to be insufficient to explain the size of the matter anti-matter asymmetry present in the Universe. The large number of top- antitop pair events produced in pp colllisions at the Large Hadron Collider (LHC) provides a unique source of b-quarks that can be used to probe the CP violation in heavy-flavour mixing and decay. This measurement focu- ses on semileptonic top-antitop events where one of the W-bosons decays hadronically and the other one decays leptonically. The charge of the lep- ton (electron or muon) from the W-boson tags the charge of the b-quark at production. In events where a muon is associated to the semileptonic decay of the b-quark (either directly or after a b → c hadronic transition), two charge asymmetries (CA) and several CP asymmetries, based on the charges of the lepton from the W-boson and this muon, can be measured. ...
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.
Higgs pair production in the MSSM with explicit CP violation
International Nuclear Information System (INIS)
Demir, D.A.
1999-07-01
In the minimal supersymmetric standard model with explicit CP violation, associated production of the lightest Higgs boson with heavier ones is analyzed. Due to explicit CP violation, the Higgs bosons are no longer CP eigenstates so that both of the heavy Higgs bosons contribute to the process. While the radiative corrections in the Higgs sector turn out to be quite important, the vertex radiative corrections remain small as in the CP conserving theory. (author)
Directory of Open Access Journals (Sweden)
Dunn Sade N
2008-06-01
Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi
2018-01-01
Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Basler, P.; Mühlleitner, M.; Wittbrodt, J.
2018-03-01
We investigate the strength of the electroweak phase transition (EWPT) within the CP-violating 2-Higgs-Doublet Model (C2HDM). The 2HDM is a simple and well-studied model, which can feature CP violation at tree level in its extended scalar sector. This makes it, in contrast to the Standard Model (SM), a promising candidate for explaining the baryon asymmetry of the universe through electroweak baryogenesis. We apply a renormalisation scheme which allows efficient scans of the C2HDM parameter space by using the loop-corrected masses and mixing matrix as input parameters. This procedure enables us to investigate the possibility of a strong first order EWPT required for baryogenesis and study its phenomenological implications for the LHC. Like in the CP-conserving (real) 2HDM (R2HDM) we find that a strong EWPT favours mass gaps between the non-SM-like Higgs bosons. These lead to prominent final states comprised of gauge+Higgs bosons or pairs of Higgs bosons. In contrast to the R2HDM, the CP-mixing of the C2HDM also favours approximately mass degenerate spectra with dominant decays into SM particles. The requirement of a strong EWPT further allows us to distinguish the C2HDM from the R2HDM using the signal strengths of the SM-like Higgs boson. We additionally find that a strong EWPT requires an enhancement of the SM-like trilinear Higgs coupling at next-to-leading order (NLO) by up to a factor of 2.4 compared to the NLO SM coupling, establishing another link between cosmology and collider phenomenology. We provide several C2HDM benchmark scenarios compatible with a strong EWPT and all experimental and theoretical constraints. We include the dominant branching ratios of the non-SM-like Higgs bosons as well as the Higgs pair production cross section of the SM-like Higgs boson for every benchmark point. The pair production cross sections can be substantially enhanced compared to the SM and could be observable at the high-luminosity LHC, allowing access to the trilinear
International Nuclear Information System (INIS)
Lipkin, H. J.
1989-11-01
The Einstein-Podolsky-Rosen effect arises in particle physics when pairs of neutral K, D or B mesons are created in a definite quantum state, and the decays of the two mesons are correlated. Choosing the decay mode to be detected for one of the two mesons creates a 'polarized beam' on the other side which has interesting and usfull properties. Application to nvestigations of CP violation are discussed. (author)
Cloning and transformation of SCMV CP gene and regeneration of ...
African Journals Online (AJOL)
The coated protein gene of sugarcane mosaic virus ( SCMV CP gene) was cloned from maize (Zea mays L.) leaves showing dwarf mosaic symptoms by reverse-transcription polymerase chain reaction (RTPCR) with degraded primers. The results of sequencing and homologous comparison indicated that the cloned gene ...
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic
Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers
Pair formation models for sexually transmitted infections: A primer
Directory of Open Access Journals (Sweden)
Mirjam Kretzschmar
2017-08-01
Full Text Available For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward transmission of the infection as long as they persist. In addition, for curable infections re-infection from an infected partner may occur. Furthermore, interventions based on contact tracing rely on the possibility of identifying and treating partners of infected individuals. To reflect these features in a mathematical model, pair formation models were introduced to mathematical epidemiology in the 1980's. They have since been developed into a widely used tool in modelling sexually transmitted infections and the impact of interventions. Here we give a basic introduction to the concepts of pair formation models for a susceptible-infected-susceptible (SIS epidemic. We review some results and applications of pair formation models mainly in the context of chlamydia infection. Keywords: Pair formation, Mathematical model, Partnership duration, Sexually transmitted infections, Basic reproduction number
CP asymmetries in the supersymmetric trilepton signal at the LHC
International Nuclear Information System (INIS)
Bornhauser, S.; Drees, M.; Dreiner, H.; Eboli, O.J.P.; Kim, J.S.; Kittel, O.
2012-01-01
In the CP-violating Minimal Supersymmetric Standard Model, we study the production of a neutralino-chargino pair at the LHC. For their decays into three leptons, we analyze CP asymmetries which are sensitive to the CP phases of the neutralino and chargino sector. We present analytical formulas for the entire production and decay process, and identify the CP-violating contributions in the spin correlation terms. This allows us to define the optimal CP asymmetries. We present a detailed numerical analysis of the cross sections, branching ratios, and the CP observables. For light neutralinos, charginos, and squarks, the asymmetries can reach several 10%. We estimate the discovery potential for the LHC to observe CP violation in the trilepton channel. (orig.)
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants
Directory of Open Access Journals (Sweden)
Aleksić Jelena M.
2016-01-01
Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005
Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S
2015-06-01
Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Directory of Open Access Journals (Sweden)
Li Kelvin
2012-11-01
Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus
Universal primers that amplify RNA from all three flavivirus subgroups
Directory of Open Access Journals (Sweden)
Barnard Ross T
2008-01-01
Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.
Abdesselam, A; Adachi, I; Adametz, A; Adye, T; Ahmed, H; Aihara, H; Akar, S; Alam, M S; Albert, J; Al Said, S; Andreassen, R; Angelini, C; Anulli, F; Arinstein, K; Arnaud, N; Asner, D M; Aston, D; Aulchenko, V; Aushev, T; Ayad, R; Babu, V; Badhrees, I; Bahinipati, S; Bakich, A M; Band, H R; Banerjee, Sw; Barberio, E; Bard, D J; Barlow, R J; Batignani, G; Beaulieu, A; Bellis, M; Ben-Haim, E; Bernard, D; Bernlochner, F U; Bettarini, S; Bettoni, D; Bevan, A J; Bhardwaj, V; Bhuyan, B; Bianchi, F; Biasini, M; Biswal, J; Blinov, V E; Bloom, P C; Bobrov, A; Bomben, M; Bondar, A; Bonneaud, G R; Bonvicini, G; Bozek, A; Bozzi, C; Bračko, M; Briand, H; Browder, T E; Brown, D N; Brown, D N; Bünger, C; Burchat, P R; Buzykaev, A R; Calabrese, R; Calcaterra, A; Calderini, G; Carpinelli, M; Cartaro, C; Casarosa, G; Cenci, R; Červenkov, D; Chang, P; Chao, D S; Chauveau, J; Cheaib, R; Chekelian, V; Chen, A; Chen, C; Cheng, C H; Cheon, B G; Chilikin, K; Chistov, R; Cho, K; Chobanova, V; Choi, H H F; Choi, S-K; Chrzaszcz, M; Cibinetto, G; Cinabro, D; Cochran, J; Coleman, J P; Contri, R; Convery, M R; Cowan, G; Cowan, R; Cremaldi, L; Dalseno, J; Dasu, S; Davier, M; Davis, C L; De Mori, F; De Nardo, G; Denig, A G; Derkach, D; de Sangro, R; Dey, B; Di Lodovico, F; Dingfelder, J; Dittrich, S; Doležal, Z; Dorfan, J; Drásal, Z; Drutskoy, A; Druzhinin, V P; Dubois-Felsmann, G P; Dunwoodie, W; Dutta, D; Ebert, M; Echenard, B; Eidelman, S; Eigen, G; Eisner, A M; Emery, S; Ernst, J A; Faccini, R; Farhat, H; Fast, J E; Feindt, M; Ferber, T; Ferrarotto, F; Ferroni, F; Field, R C; Filippi, A; Finocchiaro, G; Fioravanti, E; Flood, K T; Ford, W T; Forti, F; Franco Sevilla, M; Fritsch, M; Fry, J R; Fulsom, B G; Gabathuler, E; Gabyshev, N; Gamba, D; Garmash, A; Gary, J W; Garzia, I; Gaspero, M; Gaur, V; Gaz, A; Gershon, T J; Getzkow, D; Gillard, R; Li Gioi, L; Giorgi, M A; Glattauer, R; Godang, R; Goh, Y M; Goldenzweig, P; Golob, B; Golubev, V B; Gorodeisky, R; Gradl, W; Graham, M T; Grauges, E; Griessinger, K; Gritsan, A V; Grosdidier, G; Grünberg, O; Guttman, N; Haba, J; Hafner, A; Hamilton, B; Hara, T; Harrison, P F; Hast, C; Hayasaka, K; Hayashii, H; Hearty, C; He, X H; Hess, M; Hitlin, D G; Hong, T M; Honscheid, K; Hou, W-S; Hsiung, Y B; Huard, Z; Hutchcroft, D E; Iijima, T; Inguglia, G; Innes, W R; Ishikawa, A; Itoh, R; Iwasaki, Y; Izen, J M; Jaegle, I; Jawahery, A; Jessop, C P; Joffe, D; Joo, K K; Julius, T; Kang, K H; Kass, R; Kawasaki, T; Kerth, L T; Khan, A; Kiesling, C; Kim, D Y; Kim, J B; Kim, J H; Kim, K T; Kim, P; Kim, S H; Kim, Y J; King, G J; Kinoshita, K; Ko, B R; Koch, H; Kodyš, P; Kolomensky, Yu G; Korpar, S; Kovalskyi, D; Kowalewski, R; Kravchenko, E A; Križan, P; Krokovny, P; Kuhr, T; Kumar, R; Kuzmin, A; Kwon, Y-J; Lacker, H M; Lafferty, G D; Lanceri, L; Lange, D J; Lankford, A J; Latham, T E; Leddig, T; Le Diberder, F; Lee, D H; Lee, I S; Lee, M J; Lees, J P; Leith, D W G S; Leruste, Ph; Lewczuk, M J; Lewis, P; Libby, J; Lockman, W S; Long, O; Lopes Pegna, D; LoSecco, J M; Lou, X C; Lueck, T; Luitz, S; Lukin, P; Luppi, E; Lusiani, A; Luth, V; Lutz, A M; Lynch, G; MacFarlane, D B; Malaescu, B; Mallik, U; Manoni, E; Marchiori, G; Margoni, M; Martellotti, S; Martinez-Vidal, F; Masuda, M; Mattison, T S; Matvienko, D; McKenna, J A; Meadows, B T; Miyabayashi, K; Miyashita, T S; Miyata, H; Mizuk, R; Mohanty, G B; Moll, A; Monge, M R; Moon, H K; Morandin, M; Muller, D R; Mussa, R; Nakano, E; Nakazawa, H; Nakao, M; Nanut, T; Nayak, M; Neal, H; Neri, N; Nisar, N K; Nishida, S; Nugent, I M; Oberhof, B; Ocariz, J; Ogawa, S; Okuno, S; Olaiya, E O; Olsen, J; Ongmongkolkul, P; Onorato, G; Onuchin, A P; Onuki, Y; Ostrowicz, W; Oyanguren, A; Pakhlova, G; Pakhlov, P; Palano, A; Pal, B; Palombo, F; Pan, Y; Panduro Vazquez, W; Paoloni, E; Park, C W; Park, H; Passaggio, S; Patel, P M; Patrignani, C; Patteri, P; Payne, D J; Pedlar, T K; Peimer, D R; Peruzzi, I M; Pesántez, L; Pestotnik, R; Petrič, M; Piccolo, M; Piemontese, L; Piilonen, L E; Pilloni, A; Piredda, G; Playfer, S; Poireau, V; Porter, F C; Posocco, M; Prasad, V; Prell, S; Prepost, R; Puccio, E M T; Pulliam, T; Purohit, M V; Pushpawela, B G; Rama, M; Randle-Conde, A; Ratcliff, B N; Raven, G; Ribežl, E; Richman, J D; Ritchie, J L; Rizzo, G; Roberts, D A; Robertson, S H; Röhrken, M; Roney, J M; Roodman, A; Rossi, A; Rostomyan, A; Rotondo, M; Roudeau, P; Sacco, R; Sakai, Y; Sandilya, S; Santelj, L; Santoro, V; Sanuki, T; Sato, Y; Savinov, V; Schindler, R H; Schneider, O; Schnell, G; Schroeder, T; Schubert, K R; Schumm, B A; Schwanda, C; Schwartz, A J; Schwitters, R F; Sciacca, C; Seiden, A; Sekula, S J; Senyo, K; Seon, O; Serednyakov, S I; Sevior, M E; Shapkin, M; Shebalin, V; Shen, C P; Shibata, T-A; Shiu, J-G; Simard, M; Simi, G; Simon, F; Simonetto, F; Skovpen, Yu I; Smith, A J S; Smith, J G; Snyder, A; So, R Y; Sobie, R J; Soffer, A; Sohn, Y-S; Sokoloff, M D; Sokolov, A; Solodov, E P; Solovieva, E; Spaan, B; Spanier, S M; Starič, M; Stocchi, A; Stroili, R; Stugu, B; Su, D; Sullivan, M K; Sumihama, M; Sumisawa, K; Sumiyoshi, T; Summers, D J; Sun, L; Tamponi, U; Taras, P; Tasneem, N; Teramoto, Y; Tisserand, V; Todyshev, K Yu; Toki, W H; Touramanis, C; Trabelsi, K; Tsuboyama, T; Uchida, M; Uglov, T; Unno, Y; Uno, S; Usov, Y; Uwer, U; Vahsen, S E; Van Hulse, C; Vanhoefer, P; Varner, G; Vasseur, G; Va'vra, J; Verderi, M; Vinokurova, A; Vitale, L; Vorobyev, V; Voß, C; Wagner, M N; Wagner, S R; Waldi, R; Walsh, J J; Wang, C H; Wang, M-Z; Wang, P; Watanabe, Y; West, C A; Williams, K M; Wilson, F F; Wilson, J R; Wisniewski, W J; Won, E; Wormser, G; Wright, D M; Wu, S L; Wulsin, H W; Yamamoto, H; Yamaoka, J; Yashchenko, S; Yuan, C Z; Yusa, Y; Zallo, A; Zhang, C C; Zhang, Z P; Zhilich, V; Zhulanov, V; Zupanc, A
2015-09-18
We report a measurement of the time-dependent CP asymmetry of B[over ¯]^{0}→D_{CP}^{(*)}h^{0} decays, where the light neutral hadron h^{0} is a π^{0}, η, or ω meson, and the neutral D meson is reconstructed in the CP eigenstates K^{+}K^{-}, K_{S}^{0}π^{0}, or K_{S}^{0}ω. The measurement is performed combining the final data samples collected at the ϒ(4S) resonance by the BABAR and Belle experiments at the asymmetric-energy B factories PEP-II at SLAC and KEKB at KEK, respectively. The data samples contain (471±3)×10^{6} BB[over ¯] pairs recorded by the BABAR detector and (772±11)×10^{6} BB[over ¯] pairs recorded by the Belle detector. We measure the CP asymmetry parameters -η_{f}S=+0.66±0.10(stat)±0.06(syst) and C=-0.02±0.07(stat)±0.03(syst). These results correspond to the first observation of CP violation in B[over ¯]^{0}→D_{CP}^{(*)}h^{0} decays. The hypothesis of no mixing-induced CP violation is excluded in these decays at the level of 5.4 standard deviations.
Pair formation models for sexually transmitted infections : A primer
Kretzschmar, MEE; Heijne, Janneke C M
For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward
Effects of Higgs sector CP violation in top-quark pair production at the LHC
Bernreuther, W; Flesch, M
1998-01-01
A striking manifestation of CP violation in the electroweak symmetry breaking sector would be the existence of neutral Higgs boson(s) with undefined CP parity. We analyse signatures of such a boson, with a mass of about 300 GeV or larger, produced in high energy proton-proton collisions at LHC energies in its top-quark antitop-quark decay channel. The large irreducible $t\\bar t$ background is taken into account. We propose, both for the dilepton and the lepton + jets decay channels of $t\\bar t$, several correlations and asymmetries with which (Higgs sector) CP violation can be traced. We show that for judiciously chosen cuts on the $t\\bar t$ invariant mass these CP observables yield, for an LHC integrated luminosity of 100 $\\rm{fb}^{-1}$, statistically significant signals for a range of Higgs boson masses and Yukawa couplings.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Surentheran, T; Harwood, C A; Spink, P J; Sinclair, A L; Leigh, I M; Proby, C M; McGregor, J M; Breuer, J
1998-01-01
AIM: To develop a unified diagnostic approach for the detection of human papillomavirus (HPV) DNA in skin and mucosal biopsies from both immunocompetent and immunosuppressed individuals using a degenerate polymerase chain reaction (PCR) method. METHODS: The sensitivity and specificity of three published degenerate primer sets (HVP2/B5 and F14/B15; MY09/MY11; CP62/69 outer and CP65/68 nested primer pairs) were evaluated in PCR reactions with serial dilutions of 12 representative cloned HPV typ...
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Gamper, H.A.; Leuchtmann, A.
2007-01-01
Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking
Directory of Open Access Journals (Sweden)
Douglas de Almeida Pereira
2015-09-01
Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.
Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui
2015-01-01
Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739
Determining the CP nature of spin-0 mediators in associated production of dark matter and tt̄ pairs
Energy Technology Data Exchange (ETDEWEB)
Haisch, Ulrich [Rudolf Peierls Centre for Theoretical Physics, University of Oxford,OX1 3NP Oxford (United Kingdom); CERN, Theoretical Physics Department,CH-1211 Geneva 23 (Switzerland); Pani, Priscilla [Department of Physics, Stockholm University,AlbaNova University Center, 106 91 Stockholm (Sweden); CERN, Experimental Physics Department,CH-1211 Geneva 23 (Switzerland); Polesello, Giacomo [INFN, Sezione di Pavia,Via Bassi 6, 27100 Pavia (Italy); CERN, Experimental Physics Department,CH-1211 Geneva 23 (Switzerland)
2017-02-27
In the framework of spin-0 s-channel simplified models, we explore the possibility of assessing the structure of dark matter interactions through the associate production of dark matter and tt̄ pairs. To this purpose, final states with two leptons are considered and the kinematic properties of the dilepton system is studied. We develop a realistic analysis strategy and provide a detailed evaluation of the achievable sensitivity for the dark matter signal assuming integrated luminosities of 300 fb{sup −1} and 3 ab{sup −1} at the 14 TeV LHC. Furthermore, upper limits on the mediator masses for which the two different CP hypotheses can be distinguished are derived. The obtained limits on the signal strengths are finally translated into constraints on the parameter space of two spin-0 simplified models including a scenario with an extended Higgs sector.
Glennon, Kelsey L; Cron, Glynis V
2016-05-01
Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.
CP-violation and Todd effects at lep-II
International Nuclear Information System (INIS)
Bilal, A.; Masso, E.; Rujula, A. de
1991-01-01
LEP-II will be a tool study CP-violation in processes involving vector bosons, and will test in particular the CP properties of the coupling of photons and Z's to W-pairs. While it is difficult to observe truly CP-odd effects, it is easy to measure T-odd ones. The latter can originate from CP-violation, or from radiative corrections involving the absorptive part of the scattering amplitude. T-odd effects are interesting in themselves, in that they accurately test the standard model and are sensitive to its unmeasured ingredients, such as the WW→WW scattering amplitude of the masses of the top quark and the elementary scalar. The prediction of the standard T-odd effects is a necessary stepping stone in the search for an honest-to-goodness violation of CP in the pure gauge sector. We thoroughly analyse the T-odd observables in the e + e - →W + W - process within the standard model, as well as the extra effects to be expected if the γW + W - and/or ZW + W - vertices were to violate CP in a non-standard fashion. (orig.)
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
CP violation with an unbroken CP transformation
Energy Technology Data Exchange (ETDEWEB)
Ratz, Michael [Department of Physics and Astronomy, University of California,Irvine, California 92697-4575 (United States); Trautner, Andreas [Bethe Center for Theoretical Physics und Physikalisches Institut der Universität Bonn,Nussallee 12, 53115 Bonn (Germany)
2017-02-21
A CP conserving SU(3) gauge theory is spontaneously broken to T{sub 7} by the vacuum expectation value (VEV) of a 15-plet. Even though the SU(3)-CP transformation is not broken by the VEV, the theory exhibits physical CP violation in the broken phase. This is because the SU(3)-CP transformation corresponds to the unique order-two outer automorphism of T{sub 7}, which is not a physical CP transformation for the T{sub 7} states, and there is no other possible CP transformation. We explicitly demonstrate that CP is violated by calculating a CP odd decay asymmetry in the broken phase. This scenario provides us with a natural protection for topological vacuum terms, ensuring that θ G{sub μν}G̃{sup μν} is absent even though CP is violated for the physical states of the model.
Glennon, Kelsey L.; Cron, Glynis V.
2016-01-01
Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125
Energy Technology Data Exchange (ETDEWEB)
Atağ, S. [Department of Physics, Faculty of Sciences, Ankara University,06100 Tandogan, Ankara (Turkey); Gürkanlı, E. [Department of Physics, Sinop University,57000 Sinop (Turkey); Department of Physics, Faculty of Sciences, Ankara University,06100 Tandogan, Ankara (Turkey)
2016-06-21
Pair production of tau leptons in two photon collision γγ→τ{sup +}τ{sup −} is studied at CLIC to test CP violating QED couplings of tau leptons. CP violating effects are investigated using tau pair spin correlations which are observed through the hadronic decay of each τ into πν. Competitive bounds with previous works on the electric dipole moment from CP odd terms have been obtained.
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Prunier, Rachel; Latimer, Andrew
2010-01-01
Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.
ANNIVERSARY: 25 years without CP
International Nuclear Information System (INIS)
Riordan, Michael
1989-01-01
In 1964 a small group of Princeton University physicists led by Jim Cronin and Val Fitch performed a landmark experiment at Brookhaven. Using a double-arm spectrometer, they showed that long-lived neutral kaons occasionally decayed into a pair of pions - violating the hitherto sacrosanct CP symmetry of combined mirror reflection and particle-antiparticle switching. From May 21-26 scientists gathered at the Chateau de Blois, southwest of Paris, to celebrate the 25th anniversary of this achievement
ANNIVERSARY: 25 years without CP
Energy Technology Data Exchange (ETDEWEB)
Riordan, Michael
1989-07-15
In 1964 a small group of Princeton University physicists led by Jim Cronin and Val Fitch performed a landmark experiment at Brookhaven. Using a double-arm spectrometer, they showed that long-lived neutral kaons occasionally decayed into a pair of pions - violating the hitherto sacrosanct CP symmetry of combined mirror reflection and particle-antiparticle switching. From May 21-26 scientists gathered at the Chateau de Blois, southwest of Paris, to celebrate the 25th anniversary of this achievement.
submitter Time-dependent CP violation in charm mesons
Inguglia, Gianluca
CP violation is a well established phenomenon for B and K mesons, but for D0 mesons, bound states made up of a quark-antiquark pair containing a charm quark, a conclusive answer to the question whether there is CP vio- lation or not, has yet to be determined. I show here the phenomenology of time-dependent CP asymmetries in charm decays, and discuss the implica- tions of experimental tests aimed at the measurement of CP violation in the interference between mixing and decays of charm mesons, in particular when studying the decay channels D0 ! h+h (h = K; ). The decay channels considered can also be used to constrain quantities that are poorly measured or still to be investigated, such as MIX and c;eff , provided that the e ects of penguin pollution are ignored. I considered correlated production of D0 mesons at the SuperB experiment and its planned asymmetric run at the charm threshold and performed a study of simulated events, nding that a boost factor = 0:28 would not be su cient to produce competitive re- ...
1989-01-01
Contents: CP Phenomenology: Introduction to CP Violation (C Jarlskog); CP-Violation in the K 0 -K 0 -System (K Kleinknecht); The Quark Mixing Matrix, Charm Decays and B Decays (S Stone); The Question of CP Noninvariance - As Seen through the Eyes of Neutral Beauty (I I Bigi et al.); In Search of CP Noninvariance in Heavy Quark Systems (L-L Chau); CP Violation at High Energy e + e - Colliders (J Bernabéu & M B Gavela); CP Violation in the Standard Model with Four Families (A Datta & E A Paschos); CP Effects When Neutrinos are their Own Antiparticles (B Kayser); On Spontaneous CP Violation Trigg
Frustrated Lewis pairs: Design and reactivity
Indian Academy of Sciences (India)
for FLP systems and their unique reactivity are discussed here. Keywords. Lewis .... we will concentrate on the design principles of such. FLPs and the ... Designs of frustrated Lewis pairs ..... 64 and neutral titanium (III) complex [Cp2TiOC6.
Energy Technology Data Exchange (ETDEWEB)
Abdesselam, A. [Univ. of Tabuk, Tabuk (Kingdom of Saudi Arabia). et al.
2015-09-16
We report a measurement of the time-dependent CP asymmetry of B¯0 → D(*)CPh0 decays, where the light neutral hadron h0 is a π0, η, or ω meson, and the neutral D meson is reconstructed in the CP eigenstates K+K–, K0Sπ0, or K0Sω. The measurement is performed combining the final data samples collected at the Υ(4S) resonance by the BABAR and Belle experiments at the asymmetric-energy B factories PEP-II at SLAC and KEKB at KEK, respectively. The data samples contain (471±3)×106 BB¯ pairs recorded by the BABAR detector and (772±11)×106 BB¯ pairs recorded by the Belle detector. We measure the CP asymmetry parameters –ηfS=+0.66±0.10(stat)±0.06(syst) and C=–0.02±0.07(stat)±0.03(syst). These results correspond to the first observation of CP violation in B¯0 → D(*)CPh0 decays. As a result, the hypothesis of no mixing-induced CP violation is excluded in these decays at the level of 5.4 standard deviations.
Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin
2013-01-01
Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289
Energy Technology Data Exchange (ETDEWEB)
Lillard, V.
2005-04-25
This dissertation presents a measurement of time-dependent CP-violating asymmetries and a measurement of the CP-odd parity fraction in the decay B{sup 0} {yields} D*{sup +} D*{sup -}. The measurements are derived from a data sample of 88 x 10{sup 6} B{bar B} pairs collected by the BABAR detector at the PEP-II asymmetric-energy B Factory located at the Stanford Linear Accelerator Center. A one-dimensional angular analysis of the decay products measures the CP-odd fraction to be 0.063 {+-} 0.055(stat) {+-} 0.009(syst), indicating that the D*{sup +}D*{sup -} final state is mostly CP-even. The time-dependent CP asymmetry parameters Im({lambda}{sub +}) and |{lambda}{sub +}| are determined from an analysis of the time-dependence of flavor-tagged B decays. One neutral B meson is fully reconstructed in a D*{sup +} D*{sup -} final state, while the other B is inclusively reconstructed in order to determine its flavor. The Standard Model predicts the CP asymmetry parameters Im({lambda}{sub +}) and |{lambda}{sub +}| to be sin2{beta} and 1, respectively, in the absence of penguin diagram contributions. They are determined to be 0.05 {+-} 0.29(stat) {+-} 0.10(syst) and 0.75 {+-} 0.19(stat) {+-} 0.02(syst), respectively, which corresponds to a 2.5 sigma deviation from Standard Model predictions with penguin contributions ignored.
Observation of CP violation in the B(0) meson system.
Aubert, B; Boutigny, D; Gaillard, J M; Hicheur, A; Karyotakis, Y; Lees, J P; Robbe, P; Tisserand, V; Palano, A; Chen, G P; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Reinertsen, P L; Stugu, B; Abbott, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Clark, A R; Gill, M S; Gritsan, A V; Groysman, Y; Jacobsen, R G; Kadel, R W; Kadyk, J; Kerth, L T; Kluth, S; Kolomensky, Y G; Kral, J F; LeClerc, C; Levi, M E; Liu, T; Lynch, G; Meyer, A B; Momayezi, M; Oddone, P J; Perazzo, A; Pripstein, M; Roe, N A; Romosan, A; Ronan, M T; Shelkov, V G; Telnov, A V; Wenzel, W A; Zisman, M S; Bright-Thomas, P G; Harrison, T J; Hawkes, C M; Knowles, D J; O'Neale, S W; Penny, R C; Watson, A T; Watson, N K; Deppermann, T; Goetzen, K; Koch, H; Krug, J; Kunze, M; Lewandowski, B; Peters, K; Schmuecker, H; Steinke, M; Andress, J C; Barlow, N R; Bhimji, W; Chevalier, N; Clark, P J; Cottingham, W N; De Groot, N; Dyce, N; Foster, B; McFall, J D; Wallom, D; Wilson, F F; Abe, K; Hearty, C; Mattison, T S; McKenna, J A; Thiessen, D; Jolly, S; McKemey, A K; Tinslay, J; Blinov, V E; Bukin, A D; Bukin, D A; Buzykaev, A R; Golubev, V B; Ivanchenko, V N; Korol, A A; Kravchenko, E A; Onuchin, A P; Salnikov, A A; Serednyakov, S I; Skovpen, Y I; Telnov, V I; Yushkov, A N; Best, D; Lankford, A J; Mandelkern, M; McMahon, S; Stoker, D P; Ahsan, A; Arisaka, K; Buchanan, C; Chun, S; Branson, J G; MacFarlane, D B; Prell, S; Rahatlou, S; Raven, G; Sharma, V; Campagnari, C; Dahmes, B; Hart, P A; Kuznetsova, N; Levy, S L; Long, O; Lu, A; Richman, J D; Verkerke, W; Witherell, M; Yellin, S; Beringer, J; Dorfan, D E; Eisner, A M; Frey, A; Grillo, A A; Grothe, M; Heusch, C A; Johnson, R P; Kroeger, W; Lockman, W S; Pulliam, T; Sadrozinski, H; Schalk, T; Schmitz, R E; Schumm, B A; Seiden, A; Turri, M; Walkowiak, W; Williams, D C; Wilson, M G; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Hitlin, D G; Metzler, S; Oyang, J; Porter, F C; Ryd, A; Samuel, A; Weaver, M; Yang, S; Zhu, R Y; Devmal, S; Geld, T L; Jayatilleke, S; Mancinelli, G; Meadows, B T; Sokoloff, M D; Barillari, T; Bloom, P; Dima, M O; Fahey, S; Ford, W T; Johnson, D R; Nauenberg, U; Olivas, A; Park, H; Rankin, P; Roy, J; Sen, S; Smith, J G; van Hoek, W C; Wagner, D L; Blouw, J; Harton, J L; Krishnamurthy, M; Soffer, A; Toki, W H; Wilson, R J; Zhang, J; Brandt, T; Brose, J; Colberg, T; Dahlinger, G; Dickopp, M; Dubitzky, R S; Hauke, A; Maly, E; Müller-Pfefferkorn, R; Otto, S; Schubert, K R; Schwierz, R; Spaan, B; Wilden, L; Behr, L; Bernard, D; Bonneaud, G R; Brochard, F; Cohen-Tanugi, J; Ferrag, S; Roussot, E; T'Jampens, S; Thiebaux, C; Vasileiadis, G; Verderi, M; Anjomshoaa, A; Bernet, R; Khan, A; Lavin, D; Muheim, F; Playfer, S; Swain, J E; Falbo, M; Borean, C; Bozzi, C; Dittongo, S; Folegani, M; Piemontese, L; Treadwell, E; Anulli, F; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Falciai, D; Finocchiaro, G; Patteri, P; Peruzzi, I M; Piccolo, M; Xie, Y; Zallo, A; Bagnasco, S; Buzzo, A; Contri, R; Crosetti, G; Fabbricatore, P; Farinon, S; Lo Vetere, M; Macri, M; Monge, M R; Musenich, R; Pallavicini, M; Parodi, R; Passaggio, S; Pastore, F C; Patrignani, C; Pia, M G; Priano, C; Robutti, E; Santroni, A; Morii, M; Bartoldus, R; Dignan, T; Hamilton, R; Mallik, U; Cochran, J; Crawley, H B; Fischer, P A; Lamsa, J; Meyer, W T; Rosenberg, E I; Benkebil, M; Grosdidier, G; Hast, C; Höcker, A; Lacker, H M; Laplace, S; Lepeltier, V; Lutz, A M; Plaszczynski, S; Schune, M H; Trincaz-Duvoid, S; Valassi, A; Wormser, G; Bionta, R M; Brigljević, V; Lange, D J; Mugge, M; Shi, X; van Bibber, K; Wenaus, T J; Wright, D M; Wuest, C R; Carroll, M; Fry, J R; Gabathuler, E; Gamet, R; George, M; Kay, M; Payne, D J; Sloane, R J; Touramanis, C; Aspinwall, M L; Bowerman, D A; Dauncey, P D; Egede, U; Eschrich, I; Gunawardane, N J; Nash, J A; Sanders, P; Smith, D; Azzopardi, D E; Back, J J; Dixon, P; Harrison, P F; Potter, R J; Shorthouse, H W; Strother, P; Vidal, P B; Williams, M I; Cowan, G; George, S; Green, M G; Kurup, A; Marker, C E; McGrath, P; McMahon, T R; Ricciardi, S; Salvatore, F; Scott, I; Vaitsas, G; Brown, D; Davis, C L; Allison, J; Barlow, R J; Boyd, J T; Forti, A C; Fullwood, J; Jackson, F; Lafferty, G D; Savvas, N; Simopoulos, E T; Weatherall, J H; Farbin, A; Jawahery, A; Lillard, V; Olsen, J; Roberts, D A; Schieck, J R; Blaylock, G; Dallapiccola, C; Flood, K T; Hertzbach, S S; Kofler, R; Moore, T B; Staengle, H; Willocq, S; Brau, B; Cowan, R; Sciolla, G; Taylor, F; Yamamoto, R K; Milek, M; Patel, P M; Trischuk, J; Lanni, F; Palombo, F; Bauer, J M; Booke, M; Cremaldi, L; Eschenburg, V; Kroeger, R; Reidy, J; Sanders, D A; Summers, D J; Martin, J P; Nief, J Y; Seitz, R; Taras, P; Zacek, V; Nicholson, H; Sutton, C S; Cartaro, C; Cavallo, N; De Nardo, G; Fabozzi, F; Gatto, C; Lista, L; Paolucci, P; Piccolo, D; Sciacca, C; LoSecco, J M; Alsmiller, J R; Gabriel, T A; Handler, T; Brau, J; Frey, R; Iwasaki, M; Sinev, N B; Strom, D; Colecchia, F; Dal Corso, F; Dorigo, A; Galeazzi, F; Margoni, M; Michelon, G; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Torassa, E; Voci, C; Benayoun, M; Briand, H; Chauveau, J; David, P; de La Vaissière, C; Del Buono, L; Hamon, O; Le Diberder, F; Leruste, P; Lory, J; Roos, L; Stark, J; Versillé, S; Manfredi, P F; Re, V; Speziali, V; Frank, E D; Gladney, L; Guo, Q H; Panetta, J H; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Carpinelli, M; Forti, F; Giorgi, M A; Lusiani, A; Martinez-Vidal, F; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Sandrelli, F; Simi, G; Triggiani, G; Walsh, J; Haire, M; Judd, D; Paick, K; Turnbull, L; Wagoner, D E; Albert, J; Bula, C; Elmer, P; Lu, C; McDonald, K T; Miftakov, V; Schaffner, S F; Smith, A J; Tumanov, A; Varnes, E W; Cavoto, G; del Re, D; Faccini, R; Ferrarotto, F; Ferroni, F; Fratini, K; Lamanna, E; Leonardi, E; Mazzoni, M A; Morganti, S; Piredda, G; Safai Tehrani, F; Serra, M; Voena, C; Christ, S; Waldi, R; Adye, T; Franek, B; Geddes, N I; Gopal, G P; Xella, S M; Aleksan, R; De Domenico, G; Emery, S; Gaidot, A; Ganzhur, S F; Giraud, P F; Hamel De Monchenault, G; Kozanecki, W; Langer, M; London, G W; Mayer, B; Serfass, B; Vasseur, G; Yèche, C; Zito, M; Copty, N; Purohit, M V; Singh, H; Yumiceva, F X; Adam, I; Anthony, P L; Aston, D; Baird, K; Berger, J P; Bloom, E; Boyarski, A M; Bulos, F; Calderini, G; Claus, R; Convery, M R; Coupal, D P; Coward, D H; Dorfan, J; Dorser, M; Dunwoodie, W; Field, R C; Glanzman, T; Godfrey, G L; Gowdy, S J; Grosso, P; Himel, T; Hryn'ova, T; Huffer, M E; Innes, W R; Jessop, C P; Kelsey, M H; Kim, P; Kocian, M L; Langennegger, U; Leith, D W; Luitz, S; Luth, V; Lynch, H L; Marsiske, H; Menke, S; Messner, R; Moffeit, K C; Mount, R; Muller, D R; O'Grady, C P; Perl, M; Petrak, S; Quinn, H; Ratcliff, B N; Robertson, S H; Rochester, L S; Roodman, A; Schietinger, T; Schindler, R H; Schwiening, J; Seeman, J T; Serbo, V V; Snyder, S R; Soha, A; Spanier, S M; Stelzer, J; Su, D; Sullivan, M K; Tanaka, H A; Va'vra, J; Wagner, S R; Weinstein, A J; Wienands, U; Wisniewski, W J; Wright, D H; Young, C C; Burchat, P R; Cheng, C H; Kirkby, D; Meyer, T I; Roat, C; Henderson, R; Bugg, W; Cohn, H; Weidemann, A W; Izen, J M; Kitayama, I; Lou, X C; Turcotte, M; Bianchi, F; Bona, M; DiGirolamo, B; Gamba, D; Smol, A; Zanin, D; Bosisio, L; Della Ricci, G; Lanceri, L; Pompili, A; Poropat, P; Vuagnin, G; Panvini, R S; Brown, C M; De Silva, A; Kowalewski, R; Roney, J M; Band, H R; Charles, E; Dasu, S; Di Lodovico, F; Eichenbaum, A M; Hu, H; Johnson, J R; Liu, R; Nielsen, J; Pan, Y; Prepost, R; Scott, I J; Sekula, S J; von Wimmersperg-Toeller, J H; Wu, S L; Zobernig, H; Kordich, T M; Neal, H
2001-08-27
We present an updated measurement of time-dependent CP-violating asymmetries in neutral B decays with the BABAR detector at the PEP-II asymmetric B Factory at SLAC. This result uses an additional sample of Upsilon(4S) decays collected in 2001, bringing the data available to 32 x 10(6) BB macro pairs. We select events in which one neutral B meson is fully reconstructed in a final state containing charmonium and the flavor of the other neutral B meson is determined from its decay products. The amplitude of the CP-violating asymmetry, which in the standard model is proportional to sin2 beta, is derived from the decay time distributions in such events. The result sin2 beta = 0.59+/-0.14(stat)+/-0.05(syst) establishes CP violation in the B(0) meson system. We also determine absolute value of lambda = 0.93+/-0.09(stat)+/-0.03(syst), consistent with no direct CP violation.
Measurement of CP Asymmetry in B0 --> K+K-K0S Decays
International Nuclear Information System (INIS)
Dujmic, D
2004-01-01
The authors present preliminary measurements of the CP asymmetry parameters and CP content in B 0 --> K + K - K s 0 decays, with φK s 0 events excluded. In a sample of 227 M B(bar B) pairs collected by the BABAR detector at the PEP-II B Factory at SLAC, they find the CP parameters to be S = -0.42 ± 0.17 ± 0.04 and C = 0.10 ± 0.14 ± 0.06, where the first error is statistical and the second systematic. Extracting the fraction of CP-even final states from angular moments f even = 0.89 ± 0.08 ± 0.06, and setting C = 0, they determine sin 2β = 0.55 ± 0.22 ± 0.04 ± 0.11, where the last error is due to uncertainty on the CP content
Astrocyte-specific regulation of hMeCP2 expression in Drosophila
Directory of Open Access Journals (Sweden)
David L. Hess-Homeier
2014-10-01
Full Text Available Alterations in the expression of Methyl-CpG-binding protein 2 (MeCP2 either by mutations or gene duplication leads to a wide spectrum of neurodevelopmental disorders including Rett Syndrome and MeCP2 duplication disorder. Common features of Rett Syndrome (RTT, MeCP2 duplication disorder, and neuropsychiatric disorders indicate that even moderate changes in MeCP2 protein levels result in functional and structural cell abnormalities. In this study, we investigated two areas of MeCP2 pathophysiology using Drosophila as a model system: the effects of MeCP2 glial gain-of-function activity on circuits controlling sleep behavior, and the cell-type specific regulation of MeCP2 expression. In this study, we first examined the effects of elevated MeCP2 levels on microcircuits by expressing human MeCP2 (hMeCP2 in astrocytes and distinct subsets of amine neurons including dopamine and octopamine (OA neurons. Depending on the cell-type, hMeCP2 expression reduced sleep levels, altered daytime/nighttime sleep patterns, and generated sleep maintenance deficits. Second, we identified a 498 base pair region of the MeCP2e2 isoform that is targeted for regulation in distinct subsets of astrocytes. Levels of the full-length hMeCP2e2 and mutant RTT R106W protein decreased in astrocytes in a temporally and spatially regulated manner. In contrast, expression of the deletion Δ166 hMeCP2 protein was not altered in the entire astrocyte population. qPCR experiments revealed a reduction in full-length hMeCP2e2 transcript levels suggesting transgenic hMeCP2 expression is regulated at the transcriptional level. Given the phenotypic complexities that are caused by alterations in MeCP2 levels, our results provide insight into distinct cellular mechanisms that control MeCP2 expression and link microcircuit abnormalities with defined behavioral deficits.
Search for nonstandard model CP or T violation at the τ-charm factory
International Nuclear Information System (INIS)
Huang, T.; Lu, W.; Tao, Z.
1997-01-01
We systematically investigate the possibility of finding CP or T violation in the τ sector at the τ-charm factory. CP or T violation may occur in the τ pair production process, expressed as an electric dipole moment, and in τ decay processes. By assuming that an electric dipole moment as large as 10 -19 ecm and CP or T violation effects originating from τ decay as large as 10 -3 are observable at the τ-charm factory, we study all the possible extensions of the SM which are relevant for generating CP or T violation in the τ sector. And we point out, there are a few kinds of models which are hopeful candidates for generating such CP or T violation. For these models we consider all the theoretical and current experimental constraints and find that there exists some parameter space which will result in a measurable CP or T violation. Therefore we conclude that the τ-charm factory is a hopeful place to discover CP or T violation in the τ sector. copyright 1997 The American Physical Society
Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue.
Geybels, Milan S; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L
2015-12-01
Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. © 2015 Wiley Periodicals, Inc.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard
2012-11-01
8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127
Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers
Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li
2017-01-01
Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424
Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.
Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A
2004-09-01
Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.
Cusick, Roland D.
2013-12-17
Power production from microbial reverse electrodialysis cell (MRC) electrodes is substantially improved compared to microbial fuel cells (MFCs) by using ammonium bicarbonate (AmB) solutions in multiple RED cell pair stacks and the cathode chamber. Reducing the number of RED membranes pairs while maintaining enhanced electrode performance could help to reduce capital costs. We show here that using only a single RED cell pair (CP), created by operating the cathode in concentrated AmB, dramatically increased power production normalized to cathode area from both acetate (Acetate: from 0.9 to 3.1 W/m 2-cat) and wastewater (WW: 0.3 to 1.7 W/m2), by reducing solution and charge transfer resistances at the cathode. A second RED cell pair increased RED stack potential and reduced anode charge transfer resistance, further increasing power production (Acetate: 4.2 W/m2; WW: 1.9 W/m2). By maintaining near optimal electrode power production with fewer membranes, power densities normalized to total membrane area for the 1-CP (Acetate: 3.1 W/m2-mem; WW: 1.7 W/m2) and 2-CP (Acetate: 1.3 W/m2-mem; WW: 0.6 W/m2) reactors were much higher than previous MRCs (0.3-0.5 W/m2-mem with acetate). While operating at peak power, the rate of wastewater COD removal, normalized to reactor volume, was 30-50 times higher in 1-CP and 2-CP MRCs than that in a single chamber MFC. These findings show that even a single cell pair AmB RED stack can significantly enhance electrical power production and wastewater treatment. © 2013 American Chemical Society.
Cusick, Roland D.; Hatzell, Marta; Zhang, Fang; Logan, Bruce E.
2013-01-01
Power production from microbial reverse electrodialysis cell (MRC) electrodes is substantially improved compared to microbial fuel cells (MFCs) by using ammonium bicarbonate (AmB) solutions in multiple RED cell pair stacks and the cathode chamber. Reducing the number of RED membranes pairs while maintaining enhanced electrode performance could help to reduce capital costs. We show here that using only a single RED cell pair (CP), created by operating the cathode in concentrated AmB, dramatically increased power production normalized to cathode area from both acetate (Acetate: from 0.9 to 3.1 W/m 2-cat) and wastewater (WW: 0.3 to 1.7 W/m2), by reducing solution and charge transfer resistances at the cathode. A second RED cell pair increased RED stack potential and reduced anode charge transfer resistance, further increasing power production (Acetate: 4.2 W/m2; WW: 1.9 W/m2). By maintaining near optimal electrode power production with fewer membranes, power densities normalized to total membrane area for the 1-CP (Acetate: 3.1 W/m2-mem; WW: 1.7 W/m2) and 2-CP (Acetate: 1.3 W/m2-mem; WW: 0.6 W/m2) reactors were much higher than previous MRCs (0.3-0.5 W/m2-mem with acetate). While operating at peak power, the rate of wastewater COD removal, normalized to reactor volume, was 30-50 times higher in 1-CP and 2-CP MRCs than that in a single chamber MFC. These findings show that even a single cell pair AmB RED stack can significantly enhance electrical power production and wastewater treatment. © 2013 American Chemical Society.
CP violation in neutral B decays to non-CP-eigenstates
International Nuclear Information System (INIS)
Kayser, B.
1992-01-01
If CP violation comes from complex phases in the quark mixing matrix, then neutral B decays to CP eigenstates will exhibit large, cleanly-predicted CP-violating effects. The authors show that the same is true of neutral B decays to several types of ''near-CP-eigenstates.'' By experimentally studying the latter decays as well as those to the CP eigenstates, one will be able to obtain more definitive information on CP violation from a given number of B mesons
Ultrasonic green synthesis of an Ag/CP nanocomposite for enhanced photodegradation effectiveness.
Chang, Hai Ning; Hou, Suo Xia; Hao, Zeng Chuan; Cui, Guang Hua
2018-01-01
A nanoparticle of cobalt(II) coordination polymer (CP), [Co(L)(npht)] n (1) (H 2 npht=4-nitrophthalic acid, L=1,3-bis(5,6-dimethylbenzimidazol-1-ylmethyl)benzene) and its nanocomposite (Ag/CP 1) were obtained by the sonochemical approach and characterized by IR, elemental analysis, thermogravimetric analyses (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), and X-ray powder diffraction (XRPD). CP 1 shows a 1D double chain containing two different helical chains, which is further extended into a two-dimensional supramolecular framework by C-H⋯O hydrogen bonding interactions. The photoluminescence properties and photocatalytic properties of the nanoparticles of CP 1 and Ag/CP 1 on the degradation of methylene blue (MB) were investigated, Ag/CP 1 exhibited excellent photocatalytic activity under UV and visible light, which can be attributed to the strong interactions between Ag nanorods and CP 1, which lead to electron-hole pair separation between Ag nanorods and CP 1. In addition, the photocatalytic mechanism is also carried out by introducing t-butyl alcohol (TBA) as a widely used ·OH scavenger. The influence of ultrasound irradiation time and power on the morphology and size of the nanostructure CP 1 were studied. The results indicated that a decrease in time and an increase in power led to a decrease of particle size. Copyright © 2017 Elsevier B.V. All rights reserved.
Measurements of CP Asymmetries in the Decay B --> {phi}K
Energy Technology Data Exchange (ETDEWEB)
Aubert, B
2004-08-16
The authors present a preliminary measurement of the time-dependent CP asymmetry for the neutral B-meson decay B{sup 0} --> {phi}K{sup 0}. They use a sample of approximately 227 million B-meson pairs recorded at the {Upsilon}(4S) resonance with the BABAR detector at the PEP-II B-meson Factory at SLAC. They reconstruct the CP eigenstates {phi}K{sub s}{sup 0} and {phi}K{sub L}{sup 0} where {phi} --> K{sup +}K{sup -}, K{sub s}{sup 0} --> {pi}{sup +}{pi}{sup -}, and K{sub L}{sup 0} is observed via its hadronic interactions. The other B meson in the event is tagged as either a B{sup 0} or {bar B}{sup 0} from its decay products. The values of the CP-violation parameters deived from the combined {phi}K{sup 0} dataset are S{sub {phi}K} = +0.50 {+-} 0.25(stat.){sub -0.04}{sup +0.07}(syst.) and C{sub {phi}K} = 0.00 {+-} 0.23(stat.) {+-}0.05(syst.). In addition, the authors measure the CP-violating charge asymmetry A{sub CP}(B{sup +} --> {phi}K{sup +}) = 0.054 {+-} 0.056(stat.) {+-} 0.012(syst.). All results are preliminary.
UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes
Directory of Open Access Journals (Sweden)
Nomin Batnyam
2012-01-01
Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.
The effect of various primers on shear bond strength of zirconia ceramic and resin composite.
Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat
2013-11-01
To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.
Sessile oak (Quercus petraea agg. Ehrendorfer 1967) rare ...
African Journals Online (AJOL)
Sessile oak ( Quercus petraea agg. Ehrendorfer 1967) genetic variability in Serbia was estimated applying cpDNA universal primer pairs. Five different haplotypes were detected in the analyzed sample material from populations in Serbia. The areas in West and Southwest Serbia, with all their specificities, represent an ...
International Nuclear Information System (INIS)
Loden, L.O.; Sundman, A.
1989-01-01
This study is part of an investigation of the possibility of using chemically peculiar (CP) stars to map local galactic structure. Correct luminosities of these stars are therefore crucial. CP stars are generally regarded as main-sequence or near-main-sequence objects. However, some CP stars have been classified as giants. A selection of stars, classified in literature as CP giants, are compared to normal stars in the same effective temperature interval and to ordinary 'non giant' CP stars. There is no clear confirmation of a higher luminosity for 'CP giants', than for CP stars in general. In addition, CP characteristics seem to be individual properties not repeated in a component star or other cluster members. (author). 50 refs., 5 tabs., 3 figs
CpG + CpNpG Analysis of Protein-Coding Sequences from Tomato
DEFF Research Database (Denmark)
Hobolth, Asger; Nielsen, Rasmus; Wang, Ying
2006-01-01
We develop codon-based models for simultaneously inferring the mutational effects of CpG and CpNpG methylation in coding regions. In a data set of 369 tomato genes, we show that there is very little effect of CpNpG methylation but a strong effect of CpG methylation affecting almost all genes. We...... further show that the CpNpG and CpG effects are largely uncorrelated. Our results suggest different roles of CpG and CpNpG methylation, with CpNpG methylation possibly playing a specialized role in defense against transposons and RNA viruses....
Cytosine methylation at CpCpG sites triggers accumulation of non-CpG methylation in gene bodies
Zabet, NR; Catoni, Marco; Prischi, F; Paszkowski, Jerzy Waclaw
2017-01-01
Methylation of cytosine is an epigenetic mark involved in the regulation of transcription, usually associated with transcriptional repression. In mammals, methylated cytosines are found predominantly in CpGs but in plants non-CpG methylation (in the CpHpG or CpHpH contexts, where H is A, C or T) is also present and is associated with the transcriptional silencing of transposable elements. In addition, CpG methylation is found in coding regions of active genes. In the absence of the demethylas...
CP asymmetries in Strange Baryon Decays
Bigi, I. I.; Kang, Xian-Wei; Li, Hai-Bo
2018-01-01
While indirect and direct CP violation (CPV) has been established in the decays of strange and beauty mesons, no CPV has yet been found for baryons. There are different paths to finding CP asymmetry in the decays of strange baryons; they are all highly non-trivial. The HyperCP Collaboration has probed CPV in the decays of single Ξ and Λ [1]. We discuss future lessons from {{{e}}}+{{{e}}}- collisions at BESIII/BEPCII: probing decays of pairs of strange baryons, namely Λ, Σ and Ξ. Realistic goals are to learn about non-perturbative QCD. One can hope to find CPV in the decays of strange baryons; one can also dream of finding the impact of New Dynamics. We point out that an important new era will start with the BESIII/BEPCII data accumulated by the end of 2018. This also supports new ideas to trigger {{J}}/{{\\psi }}\\to \\bar{{{Λ }}}{{Λ }} at the LHCb collaboration. Supported by National Science Foundation (PHY-1520966), National Natural Science Foundation of China (11335009, 11125525), Joint Large-Scale Scientific Facility Funds of the NSFC and CAS (U1532257), the National Key Basic Research Program of China (2015CB856700), Key Research Program of Frontier Sciences, CAS, (QYZDJ-SSW-SLH003), XWK’s work is also supported by MOST (Taiwan) (104-2112-M-001-022)
Iseda, Kazuya; Kokado, Kenta; Sada, Kazuki
2018-03-01
In this study, we performed conductometry in various organic solvents to directly detect the transformation from tetrabutylammonium chloride ( TBACl ) ion-pair salt to the free ions through complexation with meso -octamethylcalix[4]pyrrole ( CP ), which is a well-known receptor for chloride anions. In the presence of CP , the conductivity of TBACl increases in various non-polar solvents, indicating that complexation with CP enhances the ionic dissociation of TBACl in such non-polar solvents. In other words, CP recognizes chloride as an ion-paired salt as well as a free anion in non-polar solvents. Additionally, the TBA(CP - Cl ) complex exhibited a considerably lower ion-pairing constant ( K ip ) than TBACl in non-polar solvents, resulting in enhanced conductivity. Based on these findings, we can conclude that complexation of an anion with a hydrophobic anion receptor will be useful for creating functional and stimuli-responsive soft materials in organic solvents using coulombic forces.
CP violation induced by the double resonance for pure annihilation decay process in perturbative QCD
Energy Technology Data Exchange (ETDEWEB)
Lue, Gang; Li, Sheng-Tao; Wang, Yu-Ting [Henan University of Technology, College of Science, Zhengzhou (China); Lu, Ye [Guangxi Normal University, Department of Physics, Guilin (China)
2017-08-15
In a perturbative QCD approach we study the direct CP violation in the pure annihilation decay process of anti B{sup 0}{sub s} → π{sup +}π{sup -}π{sup +}π{sup -} induced by the ρ and ω double resonance effect. Generally, the CP violation is small in the pure annihilation type decay process. However, we find that the CP violation can be enhanced by double ρ-ω interference when the invariant masses of the π{sup +}π{sup -} pairs are in the vicinity of the ω resonance. For the decay process of anti B{sup 0}{sub s} → π{sup +}π{sup -}π{sup +}π{sup -}, the CP violation can reach A{sub CP}(anti B{sup 0}{sub s} → π{sup +}π{sup -}π{sup +}π{sup -}) = 27.20{sup +0.05+0.28+7.13}{sub -0.15-0.31-6.11}%. (orig.)
Impact of CP-violating interference effects on MSSM Higgs searches
International Nuclear Information System (INIS)
Fuchs, Elina
2017-05-01
Interference and mixing effects between neutral Higgs bosons in the MSSM with complex parameters are shown to have a significant impact on the interpretation of LHC searches for additional Higgs bosons. Complex MSSM parameters introduce mixing between the CP-even and CP-odd Higgs states and generate CP-violating interference terms. Both effects are enhanced in the case of almost degenerate states. Employing as an example an extension of a frequently used benchmark scenario by a non-zero phase φ A t , the interference contributions are obtained for the production of neutral Higgs bosons in gluon-fusion and in association with b-quarks followed by the decay into a pair of τ-leptons. While the resonant mixing increases the individual cross sections for the two heavy Higgs bosons h 2 and h 3 , strongly destructive interference effects between the contributions involving h 2 and h 3 leave a considerable parameter region unexcluded that would appear to be ruled out if the interference effects were neglected.
Indirect CP violation and implications for D0-D0 and Bs-Bs mixing
International Nuclear Information System (INIS)
Kagan, Alexander L.; Sokoloff, Michael D.
2009-01-01
The two kinds of indirect CP violation in neutral meson systems are related, in the absence of new weak phases in decay. The result is a model-independent expression relating CP violation in mixing, CP violation in the interference of decays with and without mixing, and the meson mass and width differences. It relates the semileptonic and time-dependent CP asymmetries, and pairs of time-dependent CP asymmetries in D 0 decays to non-CP eigenstates. CP violation in the interference of decays with and without mixing is related to the mixing parameters of relevance to model building: the off-diagonal mixing matrix elements |M 12 |, |Γ 12 |, and φ 12 ≡arg(M 12 /Γ 12 ). Incorporating this relation into a fit to the D 0 -D 0 mixing data implies a level of sensitivity to |φ 12 D | of 0.10 (rad) at 1σ. The formalism is extended to include new weak phases in decay, and in Γ 12 . The phases are highly constrained by direct CP violation measurements. Consequently, the bounds on |φ 12 D | are not significantly altered, and the effects of new weak phases in decay could be difficult to observe at a high luminosity flavor factory (D 0 ) or at the LHC (B s ) via violations of the above relations, unlike in direct CP violation.
Jarausch, W; Saillard, C; Dosba, F; Bové, J M
1994-01-01
A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180
International Nuclear Information System (INIS)
Gronau, M.
1995-01-01
We review the present status of the Standard Model of CP violation, which is based on a complex phase in the Cabibbo-Kobayashi-Maskawa (CKM) matrix. So far CP violation has been observed only in K 0 -K 0 mixing, consistent with a sizable phase. The implications of future CP nonconserving measusrements in K and B decays are discussed within the model. Direct CP violation in K→2π may be observed in the near future, however this would not be a powerful test of the model. B decays provide a wide variety of CP asymmetry measurements, which can serve as precise tests of the Standard Model in cases where the asymmetry is cleanly related to phases of CKM matrix elements. Some of the most promising cases are discussed. ((orig.))
Study of CP asymmetry in B^{0}-B[over ¯]^{0} mixing with inclusive dilepton events.
Lees, J P; Poireau, V; Tisserand, V; Grauges, E; Palano, A; Eigen, G; Stugu, B; Brown, D N; Kerth, L T; Kolomensky, Yu G; Lee, M J; Lynch, G; Koch, H; Schroeder, T; Hearty, C; Mattison, T S; McKenna, J A; So, R Y; Khan, A; Blinov, V E; Buzykaev, A R; Druzhinin, V P; Golubev, V B; Kravchenko, E A; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Todyshev, K Yu; Lankford, A J; Mandelkern, M; Dey, B; Gary, J W; Long, O; Campagnari, C; Franco Sevilla, M; Hong, T M; Kovalskyi, D; Richman, J D; West, C A; Eisner, A M; Lockman, W S; Panduro Vazquez, W; Schumm, B A; Seiden, A; Chao, D S; Cheng, C H; Echenard, B; Flood, K T; Hitlin, D G; Miyashita, T S; Ongmongkolkul, P; Porter, F C; Röhrken, M; Andreassen, R; Huard, Z; Meadows, B T; Pushpawela, B G; Sokoloff, M D; Sun, L; Bloom, P C; Ford, W T; Gaz, A; Smith, J G; Wagner, S R; Ayad, R; Toki, W H; Spaan, B; Bernard, D; Verderi, M; Playfer, S; Bettoni, D; Bozzi, C; Calabrese, R; Cibinetto, G; Fioravanti, E; Garzia, I; Luppi, E; Piemontese, L; Santoro, V; Calcaterra, A; de Sangro, R; Finocchiaro, G; Martellotti, S; Patteri, P; Peruzzi, I M; Piccolo, M; Rama, M; Zallo, A; Contri, R; Lo Vetere, M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Bhuyan, B; Prasad, V; Adametz, A; Uwer, U; Lacker, H M; Dauncey, P D; Mallik, U; Chen, C; Cochran, J; Prell, S; Ahmed, H; Gritsan, A V; Arnaud, N; Davier, M; Derkach, D; Grosdidier, G; Le Diberder, F; Lutz, A M; Malaescu, B; Roudeau, P; Stocchi, A; Wormser, G; Lange, D J; Wright, D M; Coleman, J P; Fry, J R; Gabathuler, E; Hutchcroft, D E; Payne, D J; Touramanis, C; Bevan, A J; Di Lodovico, F; Sacco, R; Cowan, G; Bougher, J; Brown, D N; Davis, C L; Denig, A G; Fritsch, M; Gradl, W; Griessinger, K; Hafner, A; Schubert, K R; Barlow, R J; Lafferty, G D; Cenci, R; Hamilton, B; Jawahery, A; Roberts, D A; Cowan, R; Sciolla, G; Cheaib, R; Patel, P M; Robertson, S H; Neri, N; Palombo, F; Cremaldi, L; Godang, R; Sonnek, P; Summers, D J; Simard, M; Taras, P; De Nardo, G; Onorato, G; Sciacca, C; Martinelli, M; Raven, G; Jessop, C P; LoSecco, J M; Honscheid, K; Kass, R; Feltresi, E; Margoni, M; Morandin, M; Posocco, M; Rotondo, M; Simi, G; Simonetto, F; Stroili, R; Akar, S; Ben-Haim, E; Bomben, M; Bonneaud, G R; Briand, H; Calderini, G; Chauveau, J; Leruste, Ph; Marchiori, G; Ocariz, J; Biasini, M; Manoni, E; Pacetti, S; Rossi, A; Angelini, C; Batignani, G; Bettarini, S; Carpinelli, M; Casarosa, G; Cervelli, A; Chrzaszcz, M; Forti, F; Giorgi, M A; Lusiani, A; Oberhof, B; Paoloni, E; Perez, A; Rizzo, G; Walsh, J J; Lopes Pegna, D; Olsen, J; Smith, A J S; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Li Gioi, L; Pilloni, A; Piredda, G; Bünger, C; Dittrich, S; Grünberg, O; Hess, M; Leddig, T; Voß, C; Waldi, R; Adye, T; Olaiya, E O; Wilson, F F; Emery, S; Vasseur, G; Anulli, F; Aston, D; Bard, D J; Cartaro, C; Convery, M R; Dorfan, J; Dubois-Felsmann, G P; Dunwoodie, W; Ebert, M; Field, R C; Fulsom, B G; Graham, M T; Hast, C; Innes, W R; Kim, P; Leith, D W G S; Lewis, P; Lindemann, D; Luitz, S; Luth, V; Lynch, H L; MacFarlane, D B; Muller, D R; Neal, H; Perl, M; Pulliam, T; Ratcliff, B N; Roodman, A; Salnikov, A A; Schindler, R H; Snyder, A; Su, D; Sullivan, M K; Va'vra, J; Wisniewski, W J; Wulsin, H W; Purohit, M V; White, R M; Wilson, J R; Randle-Conde, A; Sekula, S J; Bellis, M; Burchat, P R; Puccio, E M T; Alam, M S; Ernst, J A; Gorodeisky, R; Guttman, N; Peimer, D R; Soffer, A; Spanier, S M; Ritchie, J L; Ruland, A M; Schwitters, R F; Wray, B C; Izen, J M; Lou, X C; Bianchi, F; De Mori, F; Filippi, A; Gamba, D; Lanceri, L; Vitale, L; Martinez-Vidal, F; Oyanguren, A; Villanueva-Perez, P; Albert, J; Banerjee, Sw; Beaulieu, A; Bernlochner, F U; Choi, H H F; King, G J; Kowalewski, R; Lewczuk, M J; Lueck, T; Nugent, I M; Roney, J M; Sobie, R J; Tasneem, N; Gershon, T J; Harrison, P F; Latham, T E; Band, H R; Dasu, S; Pan, Y; Prepost, R; Wu, S L
2015-02-27
We present a measurement of the asymmetry A_{CP} between same-sign inclusive dilepton samples ℓ^{+}ℓ^{+} and ℓ^{-}ℓ^{-} (ℓ=e, μ) from semileptonic B decays in ϒ(4S)→BB[over ¯] events, using the complete data set recorded by the BABAR experiment near the ϒ(4S) resonance, corresponding to 471×10^{6} BB[over ¯] pairs. The asymmetry A_{CP} allows comparison between the mixing probabilities P(B[over ¯]^{0}→B^{0}) and P(B^{0}→B[over ¯]^{0}), and therefore probes CP and T violation. The result, A_{CP}=[-3.9±3.5(stat)±1.9(syst)]×10^{-3}, is consistent with the standard model expectation.
Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.
2018-01-01
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Hume, Benjamin C.C.
2018-05-23
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer
Directory of Open Access Journals (Sweden)
Helen Hencida Thangamony
2018-01-01
Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.
Measurement of Ratios of Branching Fractions and CP-Violating Asymmetries of B+/- --> D*K +/- decays
International Nuclear Information System (INIS)
Aubert, B.; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; Garra Tico, J.; Grauges, E.; Lopez, L.; Palano, A.; Pappagallo, M.; Eigen, G.; Stugu, B.; Sun, L.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, R.N.; Jacobsen, R.G.
2008-01-01
The authors report a study of B ± → D*K ± decays with D* decaying to Dπ 0 or Dγ, using 383 x 10 6 B(bar B) pairs collected at the Υ(4S) resonance with the BABAR detector at the SLAC PEP-II B-Factory. The D meson decays under study include a non-CP mode (K ± π # -+#), CP-even modes (K ± K # -+#, π ± π # -+#) and CP-odd modes (K S 0 π 0 , K S 0 φ, K S 0 ω). They measure ratios (R* CP± ) of branching fractions of decays to CP eigenmode states and to flavor-specific states as well as CP asymmetries A* CP± = -0.11 ± 0.09 ± 0.01, R* CP+ = 1.31 ± 0.13 ± 0.04, and A* CP- = 0.06 ± 0.10 ± 0.02, R* CP- = 1.10 ± 0.12 ± 0.04, where the first error is statistical and the second error is systematic. Translating the results into an alternative parameterization, widely used for related measurements, they obtain x* + = 0.11 ± 0.06 ± 0.02 and x* - = 0.00 ± 0.06 ± 0.01. No significant CP-violating charge asymmetry is found in either the flavor-specific mode D → K ± π # -+# or in B ± → D*π ± decays
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
CP-violating top quark couplings at future linear $e^+e^-$ colliders
Bernreuther, Werner; Garcia Garcia, Ignacio; Perello Rosello, Martin; Poeschl, Roman; Richard, Francois; Ros, Eduardo; Vos, Marcel
2017-01-01
We study the potential of future lepton colliders to probe violation of the CP symmetry in the top quark sector. In certain extensions of the Standard Model, such as the two-Higgs-doublet model (2HDM), sizeable anomalous top quark dipole moments can arise, that may be revealed by a precise measurement of top quark pair production. We present results from detailed Monte Carlo studies for the ILC at 500 GeV and CLIC at 380 GeV and use parton level simulations to explore the potential of high-energy operation. We find that precise measurements in $e^+e^- \\rightarrow t \\bar{t}$ production with subsequent decay to lepton plus jets final states can provide sufficient sensitivity to detect Higgs-boson-induced CP violation in a viable two-Higgs-doublet model. The potential of a linear $e^+e^-$ collider to detect CP-violating electric and weak dipole form factors of the top quark exceeds the prospects of the HL-LHC by over an order of magnitude.
CP-violating top quark couplings at future linear e^+e^- colliders
Bernreuther, W.; Chen, L.; García, I.; Perelló, M.; Poeschl, R.; Richard, F.; Ros, E.; Vos, M.
2018-02-01
We study the potential of future lepton colliders to probe violation of the CP symmetry in the top quark sector. In certain extensions of the Standard Model, such as the two-Higgs-doublet model (2HDM), sizeable anomalous top quark dipole moments can arise, which may be revealed by a precise measurement of top quark pair production. We present results from detailed Monte Carlo studies for the ILC at 500 GeV and CLIC at 380 GeV and use parton-level simulations to explore the potential of high-energy operation. We find that precise measurements in e^+e^- → t\\bar{t} production with subsequent decay to lepton plus jets final states can provide sufficient sensitivity to detect Higgs-boson-induced CP violation in a viable two-Higgs-doublet model. The potential of a linear e^+e^- collider to detect CP-violating electric and weak dipole form factors of the top quark exceeds the prospects of the HL-LHC by over an order of magnitude.
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
Impact of CP-violating interference effects on MSSM Higgs searches
Energy Technology Data Exchange (ETDEWEB)
Fuchs, Elina [Weizmann Institute of Science, Rehovoth (Israel). Dept. of Particle Physics and Astrophysics; Weiglein, Georg [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)
2017-05-15
Interference and mixing effects between neutral Higgs bosons in the MSSM with complex parameters are shown to have a significant impact on the interpretation of LHC searches for additional Higgs bosons. Complex MSSM parameters introduce mixing between the CP-even and CP-odd Higgs states and generate CP-violating interference terms. Both effects are enhanced in the case of almost degenerate states. Employing as an example an extension of a frequently used benchmark scenario by a non-zero phase φ{sub A{sub t}}, the interference contributions are obtained for the production of neutral Higgs bosons in gluon-fusion and in association with b-quarks followed by the decay into a pair of τ-leptons. While the resonant mixing increases the individual cross sections for the two heavy Higgs bosons h{sub 2} and h{sub 3}, strongly destructive interference effects between the contributions involving h{sub 2} and h{sub 3} leave a considerable parameter region unexcluded that would appear to be ruled out if the interference effects were neglected.
Impact of CP-violating interference effects on MSSM Higgs searches
Fuchs, Elina; Weiglein, Georg
2018-02-01
Interference and mixing effects between neutral Higgs bosons in the MSSM with complex parameters are shown to have a significant impact on the interpretation of LHC searches for additional Higgs bosons. Complex MSSM parameters introduce mixing between the CP-even and CP-odd Higgs states h, H, A into the mass eigenstates h_1, h_2, h_3 and generate CP-violating interference terms. Both effects are enhanced in the case of almost degenerate states. Employing as an example an extension of a frequently used benchmark scenario by a non-zero phase φ _{A_t}, the interference contributions are obtained for the production of neutral Higgs bosons in gluon-fusion and in association with b-quarks followed by the decay into a pair of τ -leptons. While the resonant mixing increases the individual cross sections for the two heavy Higgs bosons h_2 and h_3, strongly destructive interference effects between the contributions involving h_2 and h_3 leave a considerable parameter region unexcluded that would appear to be ruled out if the interference effects were neglected.
Rockne, Karl J; Strand, Stuart E
2003-09-01
Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.
CERN. Geneva HR-RFA
2006-01-01
The lecture introduces the concepts and phenomena of matter-antimatter symmetry violation, so-called "CP" violation. The lecture is organized in four courses, the first being devoted to a historical overview and an introduction into fundamental discrete symmetries. The second course introduces the most compelling CP-violating phenomena, and presents the first experimental discovery of CP violation in the neutral kaon system. The third course discusses how CP violation is beautifully incorporated into the Standard Model of particle interactions, and how modern B-meson "factories" provide precise tests of this picture. Finally, the fourth and last course introduces CP violation and the genesis of our matter world.
Iseda, Kazuya
2018-01-01
Abstract In this study, we performed conductometry in various organic solvents to directly detect the transformation from tetrabutylammonium chloride (TBACl) ion‐pair salt to the free ions through complexation with meso‐octamethylcalix[4]pyrrole (CP), which is a well‐known receptor for chloride anions. In the presence of CP, the conductivity of TBACl increases in various non‐polar solvents, indicating that complexation with CP enhances the ionic dissociation of TBACl in such non‐polar solvents. In other words, CP recognizes chloride as an ion‐paired salt as well as a free anion in non‐polar solvents. Additionally, the TBA(CP–Cl) complex exhibited a considerably lower ion‐pairing constant (K ip) than TBACl in non‐polar solvents, resulting in enhanced conductivity. Based on these findings, we can conclude that complexation of an anion with a hydrophobic anion receptor will be useful for creating functional and stimuli‐responsive soft materials in organic solvents using coulombic forces. PMID:29610717
PHUSER (Primer Help for USER): a novel tool for USER fusion primer design
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads
2011-01-01
containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...
LHCb : Measuring $CP$ violation with $\\Delta A_{CP}$ at LHCb
Pearce, A
2014-01-01
Measurements are presented of direct $CP$ violation in $D^{0}$ meson decays in LHCb, using the $\\Delta A_{CP}$ technique, and a proposal is outlined to make similar measurements in the decays of the charmed baryon $\\Lambda_{c}^{+}$. The motivations for use of the $\\Delta A_{CP}$ method are discussed, along with the current results and future prospects.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Energy Technology Data Exchange (ETDEWEB)
Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)
2012-08-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.
Yamamoto, Hitoshi
2001-01-01
We review the physics of CP violation in B decays. After introducing the CKM matrix and how it causes CP violation, we cover three types of CP violation that can occur in B decays: CP violation in mixing, CP violation by mixing-decay interference, and CP violation in decay.
Effect of oligonucleotide primers in determining viral variability within hosts
Directory of Open Access Journals (Sweden)
Moya Andrés
2004-12-01
Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Effect of oligonucleotide primers in determining viral variability within hosts.
Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando
2004-12-09
Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
CP violation and modular symmetries
International Nuclear Information System (INIS)
Dent, Thomas
2001-01-01
We reconsider the origin of CP violation in fundamental theory. Existing string models of spontaneous CP violation make ambiguous predictions, due to the arbitrariness of CP transformation and the apparent noninvariance of the results under duality. We find a modular CP invariance condition, applicable to any predictive model of spontaneous CP violation, which circumvents these problems; it strongly constrains CP violation by heterotic string moduli. The dilaton is also evaluated as a source of CP violation, but is likely experimentally excluded. We consider the prospects for explaining CP violation in strongly coupled strings and brane worlds
Direct CP violation in τ± → K± ρ0 (ω)ντ → K± π+π-ντ
International Nuclear Information System (INIS)
Wang, Chao; Guo, Xin-Heng; Liu, Ying; Li, Rui-Cheng
2014-01-01
We study the direct CP violation in the τ ± → K ± ρ 0 (ω)ν τ → K ± π + π - ν τ decay process in the standard model. An interesting mechanism involving the charge symmetry violating mixing between ρ 0 and ω is applied to enlarge the CP asymmetry. We find that the CP-violating asymmetry can be enhanced greatly via this ρ-ω mixing mechanism when the invariant mass of the π + π - pair is in the vicinity of the ω resonance. With this mechanism, the maximum differential and localized integrated CP asymmetries can reach -(5.6 -1.7 +2.9 ) @ x 10 -12 and 6.3 -3.3 +2.4 @ x 10 -11 , respectively, which is still negligible. (orig.)
Liu, Cui; Chen, Jin; Li, Entao; Fan, Qiang; Wang, Deyun; Li, Peng; Li, Xiuping; Chen, Xingying; Qiu, Shulei; Gao, Zhenzhen; Li, Hongquan; Hu, Yuanliang
2015-02-01
Codonopsis pilosula polysaccharide (CP) was extracted, purified and modified by chlorosulfonic acid-pyridine method to obtain a sulfated CP (sCP). Their antioxidative activities in vitro were compared through the free radical-scavenging test. The results demonstrated that the scavenging capabilities of sCP were significantly stronger than those of CP. In vivo test, the mice hepatic injury model was prepared by BCG/LPS method, then administrated respectively with sCP and CP at three dosages, the biochemical indexes in serum, antioxidative indexes in liver homogenate and histopathological change in liver of the mice were compared. The results showed that in high (200mg/kg) and middle (150mg/kg) dosages of sCP groups, the contents of ALT, AST and TNF-α in serum and MDA in liver homogenate were significantly lower than those in the model group and numerically lower than those in the CP groups, the activities of SOD and GSH-Px in liver homogenate were significantly higher than those in the model group and numerically higher than those in the CP groups. In the model group there were obvious pathological changes in the liver, while in the sCP groups were near normal. These results indicate that sCP and CP possess antioxidative activity in vitro and in vivo, the activity of sCP is stronger than that of CP and sulfation modification can enhance the antioxidative and hepatoprotective activities of Codonopsis pilosula polysaccharide. Copyright © 2014 Elsevier B.V. All rights reserved.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Impact of CP-violating interference effects on MSSM Higgs searches
Energy Technology Data Exchange (ETDEWEB)
Fuchs, Elina [Weizmann Institute of Science, Department of Particle Physics and Astrophysics, Rehovot (Israel); Weiglein, Georg [DESY, Hamburg (Germany)
2018-02-15
Interference and mixing effects between neutral Higgs bosons in the MSSM with complex parameters are shown to have a significant impact on the interpretation of LHC searches for additional Higgs bosons. Complex MSSM parameters introduce mixing between the CP-even and CP-odd Higgs states h, H, A into the mass eigenstates h{sub 1}, h{sub 2}, h{sub 3} and generate CP-violating interference terms. Both effects are enhanced in the case of almost degenerate states. Employing as an example an extension of a frequently used benchmark scenario by a non-zero phase φ{sub A{sub t}}, the interference contributions are obtained for the production of neutral Higgs bosons in gluon-fusion and in association with b-quarks followed by the decay into a pair of τ-leptons. While the resonant mixing increases the individual cross sections for the two heavy Higgs bosons h{sub 2} and h{sub 3}, strongly destructive interference effects between the contributions involving h{sub 2} and h{sub 3} leave a considerable parameter region unexcluded that would appear to be ruled out if the interference effects were neglected. (orig.)
Carbon monoxide activation via O-bound CO using decamethylscandocinium-hydridoborate ion pairs.
Berkefeld, Andreas; Piers, Warren E; Parvez, Masood; Castro, Ludovic; Maron, Laurent; Eisenstein, Odile
2012-07-04
Ion pairs [Cp*(2)Sc](+)[HB(p-C(6)F(4)R)(3)](-) (R = F, 1-F; R = H, 1-H) were prepared and shown to be unreactive toward D(2) and α-olefins, leading to the conclusion that no back-transfer of hydride from boron to scandium occurs. Nevertheless, reaction with CO is observed to yield two products, both ion pairs of the [Cp*(2)Sc](+) cation with formylborate (2-R) and borataepoxide (3-R) counteranions. DFT calculations show that these products arise from the carbonyl adduct of the [Cp*(2)Sc](+) in which the CO is bonded to scandium through the oxygen atom, not the carbon atom. The formylborate 2-R is formed in a two-step process initiated by an abstraction of the hydride by the carbon end of an O-bound CO, which forms an η(2)-formyl intermediate that adds, in a second step, the borane at the carbon. The borataepoxide 3-R is suggested to result from an isomerization of 2-R. This unprecedented reaction represents a new way to activate CO via a reaction channel emanating from the ephemeral isocarbonyl isomer of the CO adduct.
Unraveling the sequence-dependent polymorphic behavior of d(CpG) steps in B-DNA.
Dans, Pablo Daniel; Faustino, Ignacio; Battistini, Federica; Zakrzewska, Krystyna; Lavery, Richard; Orozco, Modesto
2014-10-01
We have made a detailed study of one of the most surprising sources of polymorphism in B-DNA: the high twist/low twist (HT/LT) conformational change in the d(CpG) base pair step. Using extensive computations, complemented with database analysis, we were able to characterize the twist polymorphism in the d(CpG) step in all the possible tetranucleotide environment. We found that twist polymorphism is coupled with BI/BII transitions, and, quite surprisingly, with slide polymorphism in the neighboring step. Unexpectedly, the penetration of cations into the minor groove of the d(CpG) step seems to be the key element in promoting twist transitions. The tetranucleotide environment also plays an important role in the sequence-dependent d(CpG) polymorphism. In this connection, we have detected a previously unexplored intramolecular C-H···O hydrogen bond interaction that stabilizes the low twist state when 3'-purines flank the d(CpG) step. This work explains a coupled mechanism involving several apparently uncorrelated conformational transitions that has only been partially inferred by earlier experimental or theoretical studies. Our results provide a complete description of twist polymorphism in d(CpG) steps and a detailed picture of the molecular choreography associated with this conformational change. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Fernando L. Mantelatto
Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.
Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P
1996-04-15
A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.
DEFF Research Database (Denmark)
Nyvad, Anne Mette; Christensen, Ken Ramshøj; Vikner, Sten
2017-01-01
Based on data from extraction, embedded V2, and complementizer stacking, this paper proposes a cP/CP-analysis of CP-recursion in Danish. Because extraction can be shown to be possible from relative clauses, wh-islands, and adverbial clauses, and given that long extraction is successive......-cyclic, an extra specifier position has to be available as an escape hatch. Consequently, such extractions require a CP-recursion analysis, as has been argued for embedded V2 and for complementizer stacking. Given that CP-recursion in embedded V2 clauses does not allow extraction, whereas other types of CP......-recursion do, we suggest that embedded V2 is fundamentally different, in that main clause V2 and embedded V2 involve a CP (“big CP”), whereas all other clausal projections above IP are instances of cP (“little cP”). The topmost “little” c° has an occurrence feature that enables extraction but bars spell...
Elevated β-catenin activity contributes to carboplatin resistance in A2780cp ovarian cancer cells
Energy Technology Data Exchange (ETDEWEB)
Barghout, Samir H. [Department of Obstetrics and Gynecology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB (Canada); Zepeda, Nubia; Xu, Zhihua [Department of Oncology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB (Canada); Steed, Helen [Department of Obstetrics and Gynecology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB (Canada); Lee, Cheng-Han [Department of Laboratory Medicine and Pathology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB (Canada); Fu, YangXin, E-mail: yangxin@ualberta.ca [Department of Oncology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB (Canada); Department of Obstetrics and Gynecology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB (Canada)
2015-12-04
Ovarian cancer is the fifth leading cause of cancer-related mortalities in women. Epithelial ovarian cancer (EOC) represents approximately 90% of all ovarian malignancies. Most EOC patients are diagnosed at advanced stages and current chemotherapy regimens are ineffective against advanced EOC due to the development of chemoresistance. It is important to better understand the molecular mechanisms underlying acquired resistance to effectively manage this disease. In this study, we examined the expression of the Wnt/β-catenin signaling components in the paired cisplatin-sensitive (A2780s) and cisplatin-resistant (A2780cp) EOC cell lines. Our results showed that several negative regulators of Wnt signaling are downregulated, whereas a few Wnt ligands and known Wnt/β-catenin target genes are upregulated in A2780cp cells compared to A2780s cells, suggesting that Wnt/β-catenin signaling is more active in A2780cp cells. Further analysis revealed nuclear localization of β-catenin and higher β-catenin transcriptional activity in A2780cp cells compared to A2780s cells. Finally, we demonstrated that chemical inhibition of β-catenin transcriptional activity by its inhibitor CCT036477 sensitized A2780cp cells to carboplatin, supporting a role for β-catenin in carboplatin resistance in A2780cp cells. In conclusion, our data suggest that increased Wnt/β-catenin signaling activity contributes to carboplatin resistance in A2780cp cells. - Highlights: • Wnt ligands and target genes are upregulated in cisplatin resistant A2780cp cells. • Negative regulators of Wnt signaling are down-regulated in A2780cp cells. • β-catenin transcriptional activity is higher in A2780cp cells compared to A2780s cells. • Inhibition of β-catenin activity increases carboplatin cytotoxicity in A2780cp cells.
Elevated β-catenin activity contributes to carboplatin resistance in A2780cp ovarian cancer cells
International Nuclear Information System (INIS)
Barghout, Samir H.; Zepeda, Nubia; Xu, Zhihua; Steed, Helen; Lee, Cheng-Han; Fu, YangXin
2015-01-01
Ovarian cancer is the fifth leading cause of cancer-related mortalities in women. Epithelial ovarian cancer (EOC) represents approximately 90% of all ovarian malignancies. Most EOC patients are diagnosed at advanced stages and current chemotherapy regimens are ineffective against advanced EOC due to the development of chemoresistance. It is important to better understand the molecular mechanisms underlying acquired resistance to effectively manage this disease. In this study, we examined the expression of the Wnt/β-catenin signaling components in the paired cisplatin-sensitive (A2780s) and cisplatin-resistant (A2780cp) EOC cell lines. Our results showed that several negative regulators of Wnt signaling are downregulated, whereas a few Wnt ligands and known Wnt/β-catenin target genes are upregulated in A2780cp cells compared to A2780s cells, suggesting that Wnt/β-catenin signaling is more active in A2780cp cells. Further analysis revealed nuclear localization of β-catenin and higher β-catenin transcriptional activity in A2780cp cells compared to A2780s cells. Finally, we demonstrated that chemical inhibition of β-catenin transcriptional activity by its inhibitor CCT036477 sensitized A2780cp cells to carboplatin, supporting a role for β-catenin in carboplatin resistance in A2780cp cells. In conclusion, our data suggest that increased Wnt/β-catenin signaling activity contributes to carboplatin resistance in A2780cp cells. - Highlights: • Wnt ligands and target genes are upregulated in cisplatin resistant A2780cp cells. • Negative regulators of Wnt signaling are down-regulated in A2780cp cells. • β-catenin transcriptional activity is higher in A2780cp cells compared to A2780s cells. • Inhibition of β-catenin activity increases carboplatin cytotoxicity in A2780cp cells.
Synthesis and oxidation of CpIrIII compounds: functionalization of a Cp methyl group.
Park-Gehrke, Lisa S; Freudenthal, John; Kaminsky, Werner; Dipasquale, Antonio G; Mayer, James M
2009-03-21
[CpIrCl(2)](2) () and new CpIr(III)(L-L)X complexes (L-L = N-O or C-N chelating ligands; X = Cl, I, Me) have been prepared and their reactivity with two-electron chemical oxidants explored. Reaction of with PhI(OAc)(2) in wet solvents yields a new chloro-bridged dimer in which each of the Cp ligands has been singly acetoxylated to form [Cp(OAc)Ir(III)Cl(2)](2) () (Cp(OAc) = eta(5)-C(5)Me(4)CH(2)OAc). Complex and related carboxy- and alkoxy-functionalized Cp(OR) complexes can also be prepared from plus (PhIO)(n) and ROH. [Cp(OAc)Ir(III)Cl(2)](2) () and the methoxy analogue [Cp(OMe)Ir(III)Cl(2)](2) () have been structurally characterized. Treatment of [CpIrCl(2)](2) () with 2-phenylpyridine yields CpIr(III)(ppy)Cl () (ppy = cyclometallated 2-phenylpyridyl) which is readily converted to its iodide and methyl analogues CpIr(III)(ppy)I and CpIr(III)(ppy)Me (). CpIr(III) complexes were also prepared with N-O chelating ligands derived from anthranilic acid (2-aminobenzoic acid) and alpha-aminoisobutyric acid (H(2)NCMe(2)COOH), ligands chosen to be relatively oxidation resistant. These complexes and were reacted with potential two-electron oxidants including PhI(OAc)(2), hexachlorocyclohexadienone (C(6)Cl(6)O), N-fluoro-2,4,6-trimethylpyridinium (Me(3)pyF(+)), [Me(3)O]BF(4) and MeOTf (OTf = triflate, CF(3)SO(3)). Iridium(V) complexes were not observed or implicated in these reactions, despite the similarity of the potential products to known CpIr(V) species. The carbon electrophiles [Me(3)O]BF(4) and MeOTf appear to react preferentially at the N-O ligands, to give methyl esters in some cases. Overall, the results indicate that Cp is not inert under oxidizing conditions and is therefore not a good supporting ligand for oxidizing organometallic complexes.
CP violation and modular symmetries
Dent, Thomas
2001-01-01
We reconsider the origin of CP violation in fundamental theory. Existing string models of spontaneous CP violation make ambiguous predictions, due to the arbitrariness of CP transformation and the apparent non-invariance of the results under duality. We find an unambiguous modular CP invariance condition, applicable to predictive models of spontaneous CP violation, which circumvents these problems; it strongly constrains CP violation by heterotic string moduli. The dilaton is also evaluated a...
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
International Nuclear Information System (INIS)
Kayser, B.
1990-01-01
The study of CP-violating effects in B decays will be a good test of whether CP violation is caused by the known weak interaction. If this is its origin, then large, cleanly-predicted CP-violating effects are expected in certain neutral B decays to hadronic CP eigenstates. The phenomenology of CP violation in the B system is reviewed, and the genesis of these large effects is explained. In this it is shown that large, cleanly-predicted effects are also expected in some decays to states which are not CP eigenstates. The combined study of the latter decays and those to CP eigenstates may make it possible to obtain a statistically-significant CP-violating signal with fewer B mesons that would otherwise be required
The structure of completely positive matrices according to their CP-rank and CP-plus-rank
Dickinson, Peter James Clair; Bomze, Immanuel M.; Still, Georg J.
2015-01-01
We study the topological properties of the cp-rank operator $\\mathrm{cp}(A)$ and the related cp-plus-rank operator $\\mathrm{cp}^+(A)$ (which is introduced in this paper) in the set $\\mathcal{S}^n$ of symmetric $n\\times n$-matrices. For the set of completely positive matrices, $\\mathcal{CP}^n$, we
CP and CP-PGN protect mice against MRSA infection by inducing M1 macrophages.
Zhang, Yang; Li, Xiang-Xiang; Ma, Yuan; Xu, Jie; Zhao, Li-Na; Qian, Xue-Feng; Zhang, Xian-Feng; Shi, Jin-Fang; Han, Qing-Zhen
2017-12-04
Corynebacterium pyruviciproducens (C. pyruviciproducens, CP), as a newly discovered immunomodulator, has been confirmed to have a stronger immunoregulation than Propionibacterium acnes (P. acnes) of the traditional immune adjuvant, by previous experiments with model antigen ovalbumin and sheep red blood cells. Here, it was designed to assess its ability to resist methicillin-resistant Staphylococcus aureus (MRSA), since MRSA as a vital gram positive pathogen is characterized by high morbidity and mortality. In this report, it was indicated that C. pyruviciproducens and its peptidoglycan (CP-PGN) could help to be against bloodstream infection of MRSA with raised survival rate, decreased bacteria load and alleviated systemic inflammation, and these effects of CP-PGN were more pronounced. However, the whole CP was inclined to prevent localized abdominal infection of MRSA from progressing to a systemic infection. And they showed the potential as a therapeutic drug alone or combined with vancomycin. The diversity of capacity of activating macrophages induced by CP and CP-PGN may result in distinct resistance to MRSA in different infection models. Furthermore, both CP and CP-PGN induced M1 macrophages. In conclusion, CP and its PGN could act as promising immune agents to treat and prevent MRSA infection.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Pyskir, Andrzej
2017-01-01
We present results of searches for the Standard Model Higgs boson decaying to tau lepton pairs at the CMS experiment with data collected during the LHC Run 1. We also present some insight into the analysis with Run 2 data. CP sensitive variables are described and an experimental method of probing CP of the Higgs boson is presented.
Energy Technology Data Exchange (ETDEWEB)
Windorff, Cory J.; MacDonald, Matthew R.; Ziller, Joseph W.; Evans, William J. [Department of Chemistry, University of California, Irvine, CA (United States)
2017-12-13
Cp{sup '}{sub 4}U (Cp{sup '} = C{sub 5}H{sub 4}SiMe{sub 3}) was synthesized from: (a) KCp{sup '} and [Cp{sup '}{sub 3}U(THF)][BPh{sub 4}]; (b) Cp{sup '}{sub 3}U and Cp{sup '}{sub 2}Pb; and (c) [K(2.2.2-cryptand)][Cp{sup '}{sub 4}U] and AgBPh{sub 4}. The compound was identified by X-ray crystallography as a rare example of a structurally-characterized tetrakis(cyclopentadienyl)U{sup IV} complex. For comparison, the corresponding Th complex, Cp{sup '}{sub 4}Th, was isolated from the direct combination of ThBr{sub 4}(THF){sub 4} with excess KCp{sup '}. During the preparation of Cp{sup '}{sub 3}UMe, the precursor of the [Cp{sup '}{sub 3}U(THF)][BPh{sub 4}] reagent used above, it was discovered that the reaction of Cp{sup '}{sub 3}UCl and MeLi gives a mixture of Cp{sup '}{sub 3}UMe and Cp{sup '}{sub 3}UCl that can co-crystallize better than Cp{sup '}{sub 3}UMe in pure form. The Cp'{sub 3}UMe/Cp{sup '}{sub 3}UCl mixture forms single crystals suitable for X-ray crystallography and provides a new way to characterize the oil, Cp{sup '}{sub 3}UMe. Cp{sup '}{sub 3}UCl and Cp{sup '}{sub 3}UI were also crystallographically characterized for comparison with the Cp{sup '}{sub 3}UMe/Cp{sup '}{sub 3}UCl crystals. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Directory of Open Access Journals (Sweden)
Christopher A Gulvik
Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.
Indian Academy of Sciences (India)
We have just entered a period during which we expect considerable progress toward understanding CP violation. Here we review what we have learnt so far, and what is to be expected in the near future. To do this we cover the foundation of CP violation at a level which can be understood by physicists who are not working ...
International Nuclear Information System (INIS)
1993-06-01
Experiments designed to measure CP-violating asymmetries in the B meson system must emphasize exclusive state reconstruction with the highest possible resolution and efficiency. In the case of B 0 mesons produced in pairs at the Υ(4S) resonance at an asymmetric e + e - storage ring, this capability must be accompanied by precise vertex reconstruction in the direction of the e + e - beams (henceforth the z direction). These are difficult requirements, beyond the scope of any existing storage ring detector. The challenge of designing an asymmetric storage ring capable of producing the large number of neutral B meson pairs required to measure CP-violating asymmetries in decays to CP eigenstates has been handsomely met in the PEP-II design. As the first asymmetric e + e - storage ring, PEP-II presents a novel set of experimental challenges to a 4π detector. This Status Report describes the design of a new detector fully capable of exploiting the physics opportunities provided by PEP-II
DEFF Research Database (Denmark)
Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard
2005-01-01
Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylog...
Measurement of the Time-Dependent CP Asymmetry of Partially Reconstructed B0 to D*+D*- Decays
Energy Technology Data Exchange (ETDEWEB)
Lees, J. P.
2012-08-13
We present a new measurement of the time-dependent CP asymmetry of B{sup 0} {yields}D*{sup +}D*{sup -} decays using (471 {+-} 5) million B{bar B} pairs collected with the BABAR detector at the PEP-II B Factory at the SLAC National Accelerator Laboratory. Using the technique of partial reconstruction, we measure the time-dependent CP asymmetry parameters S = -0.34 {+-} 0.12 {+-} 0.05 and C = +0:15 {+-} 0.09 {+-} 0.04. Using the value for the CP-odd fraction R{perpendicular} = 0.158 {+-} 0.028 {+-} 0.006, previously measured by BABAR with fully reconstructed B{sup 0} {yields} D{sup *+}D{sup *-} events, we extract the CP-even components S{sub +} = -0.49 {+-} 0.18 {+-} 0.07 {+-} 0.04 and C{sub +} = +0.15 {+-} 0.09 {+-} 0.04. In each case, the first uncertainty is statistical and the second is systematic; the third uncertainty on S{sub +} is the contribution from the uncertainty on R{perpendicular}. The measured value of the CP-even component S{sub +} is consistent with the value of sin 2{beta} measured in b {yields} (c{bar c})s transitions, and with the Standard Model expectation of small penguin contributions.
International Nuclear Information System (INIS)
Ecker, G.
1987-01-01
A short survey of the theoretical status of CP violation is presented. The Standart Model is confronted with the present experimental situation. Possible future tests of our notions of CP violation are discussed, concentrating on rare K decays. Other promising reactions such as B decays are briefly reviewed. Among alternative models of CP violation, multi-Higgs extensions of the Standart Model, left-right symmetric gauge theories and minimal SUSY models are discussed. Finally, the relevance of generalized CP invariance is emphasized. 64 refs., 7 figs. (Author)
CERN. Geneva
1999-01-01
In the first two lectures, CP violation in the K system is pedagogically reviewed: its manifestations in the neutral K meson systems, in rare K meson decays and in decays of charged K mesons, and results from classical and current experiments, are discussed. In the third lecture, CP Violation in the B system and the forthcoming experimental tests will be discussed.
International Nuclear Information System (INIS)
Gronau, M.
1984-01-01
Two ambiguities are noted in the definition of the concept of maximal CP violation. The phase convention ambiguity is overcome by introducing a CP violating phase in the quark mixing matrix U which is invariant under rephasing transformations. The second ambiguity, related to the parametrization of U, is resolved by finding a single empirically viable definition of maximal CP violation when assuming that U does not single out one generation. Considerable improvement in the calculation of nonleptonic weak amplitudes is required to test the conjecture of maximal CP violation. 21 references
Non-unitary neutrino mixing and CP violation in the minimal inverse seesaw model
International Nuclear Information System (INIS)
Malinsky, Michal; Ohlsson, Tommy; Xing, Zhi-zhong; Zhang He
2009-01-01
We propose a simplified version of the inverse seesaw model, in which only two pairs of the gauge-singlet neutrinos are introduced, to interpret the observed neutrino mass hierarchy and lepton flavor mixing at or below the TeV scale. This 'minimal' inverse seesaw scenario (MISS) is technically natural and experimentally testable. In particular, we show that the effective parameters describing the non-unitary neutrino mixing matrix are strongly correlated in the MISS, and thus, their upper bounds can be constrained by current experimental data in a more restrictive way. The Jarlskog invariants of non-unitary CP violation are calculated, and the discovery potential of such new CP-violating effects in the near detector of a neutrino factory is discussed.
CP violation in gauge theories
International Nuclear Information System (INIS)
Escobar, C.O.
Some aspects of CP violation in gauge theories are reviewed. The topics covered include a discussion of the Kobayashi-Maskawa six-quarks model, models of soft- CP violation (extended Higgs sector), the strong CP problem and finally some speculations relating CP violation and magnetic charges in non-abelian gauge theories. (Author) [pt
CP-even and CP-odd transverse polarization of the electron in muon decay
International Nuclear Information System (INIS)
Kuznetsov, A.
1981-01-01
A model of the weak interaction which contains intermediate vector bosons of the most general form and which admits CP violation in muon decay is used to calculate the CP-even and CP-odd transverse polarization of the μ-decay electrons with inclusion of radiative corrections. It is shown that these corrections are important only at the beginning of the spectrum, and their contribution reduces the observed effects of the transverse polarization. The transverse polarization grows appreciably at electron energies close to the maximum energy and at small emission angles. It is expedient to search for the CP-even and CP-odd transverse polarization of the electrons at energies E/sub e/ = 0.975E/sup max//sub e/ and emission angles theta = 25--35 0
Measuring $CP$ violation with $\\Delta A_{CP}$ at LHCb
Pearce, Alex
2014-01-01
The control of systematic uncertainties is a key component of many analyses performed at the Large Hadron Collider, and will only become more important as more data are taken during Run II. Many of the CP measurements performed using the LHCb detector have statistical precisions below the per cent level, and so particular care must be taken in this area. One technique for dealing with the various production and detection asymmetries which can mask the physics asymmetry of interest, and increase the measurement’s systematic uncertainty, is $\\Delta A_{CP}$ . The application of $\\Delta A_{CP}$ in three separate LHCb analyses of $D^{0}$ and $\\Lambda_{b}^{0}$ decays will be discussed, along with prospects for applying the technique to $\\Lambda_{c}^{+}$ decays.
International Nuclear Information System (INIS)
Quinn, H.
1995-12-01
In this talk the author briefly reviews the cosmological importance of CP violation and the status of calculations of baryogenisis in the context of the Standard Model. The author then turns to a discussion of Standard Model Predictions for CP violation in B decays, stressing the importance of multiple measurements to overconstrain the model parameters and thus search for indications of beyond-Standard-Model physics
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
International Nuclear Information System (INIS)
Dova, Maria Teresa; Ferrari, Sergio
2005-01-01
We present a method to investigate the CP quantum numbers of the Higgs boson in the process e + e - ->Zφ at a future e + e - linear collider (LC), where φ, a generic Higgs boson, is a mixture of CP-even and CP-odd states. The procedure consists of a comparison of the data with predictions obtained from Monte Carlo simulations corresponding to the productions of scalar and pseudoscalar Higgs and the interference term which constitutes a distinctive signal of CP violation. We present estimates of the sensitivity of the method from Monte Carlo studies using hypothetical data samples with a full LC detector simulation taking into account the background signals
Assessment of fungal diversity in deep-sea sediments by multiple primer approach
Digital Repository Service at National Institute of Oceanography (India)
Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.
products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...
CP-violating top quark couplings at future linear e{sup +}e{sup -} colliders
Energy Technology Data Exchange (ETDEWEB)
Bernreuther, W. [RWTH Aachen University, Institut fuer Theoretische Teilchenphysik und Kosmologie, Aachen (Germany); Chen, L. [RWTH Aachen University, Institut fuer Theoretische Teilchenphysik und Kosmologie, Aachen (Germany); Max-Planck-Institut fuer Physik, Muenchen (Germany); Garcia, I. [Instituto de Fisica Corpuscular (IFIC, UVEG/CSIC), Valencia (Spain); CERN, Geneva (Switzerland); Perello, M.; Ros, E.; Vos, M. [Instituto de Fisica Corpuscular (IFIC, UVEG/CSIC), Valencia (Spain); Poeschl, R.; Richard, F. [Centre Scientifique d' Orsay, Laboratoire de l' Accelerateur Lineaire (LAL), Orsay (France)
2018-02-15
We study the potential of future lepton colliders to probe violation of the CP symmetry in the top quark sector. In certain extensions of the Standard Model, such as the two-Higgs-doublet model (2HDM), sizeable anomalous top quark dipole moments can arise, which may be revealed by a precise measurement of top quark pair production. We present results from detailed Monte Carlo studies for the ILC at 500 GeV and CLIC at 380 GeV and use parton-level simulations to explore the potential of high-energy operation. We find that precise measurements in e{sup +}e{sup -} → t anti t production with subsequent decay to lepton plus jets final states can provide sufficient sensitivity to detect Higgs-boson-induced CP violation in a viable two-Higgs-doublet model. The potential of a linear e{sup +}e{sup -} collider to detect CP-violating electric and weak dipole form factors of the top quark exceeds the prospects of the HL-LHC by over an order of magnitude. (orig.)
International Nuclear Information System (INIS)
Aleksan, R.
1993-06-01
The violation of the CP symmetry is a phenomenon, the origin of which is not yet well established and deserves a particular attention since it may be a fundamental property of Nature with very important consequences for the evolution of the universe. We propose in these lectures to have an overview of this phenomenon as we understand it so far. To this end, and after introducing the discrete space-time symmetries, we discuss the observation of the violation of the CP symmetry in the neutral kaon decays. We then derive the general formalism for any neutral system made of a particle and its antiparticle and discuss how CP violation is introduced. We show how this phenomenon is generated in the Standard Model of the electroweak interactions and what are the predictions that can be made. In particular we shall concentrate on the expected effects in the decays of mesons involving the b quark. We review the various possibilities for observing these effects, calculate their magnitudes and show how the consistency of the theory can be tested. Finally, we outline the experimental prospects for studying CP non conservation at an asymmetric B Factory to either verify the Standard Model mechanism or provide evidence for new physics. (author)
Measurement of CP--violating asymmetries in D0 → π+π- and D0 → K+K- decays at CDF
International Nuclear Information System (INIS)
2011-01-01
We report on a measurement of CP-violating asymmetries (A CP ) in the Cabibbo-suppressed D 0 → π + π - and D 0 → K + K - decays reconstructed in a data sample corresponding to 5.9 fb -1 of integrated luminosity collected by the upgraded Collider Detector at Fermilab. We use the strong decay D* + → D 0 π + to identify the flavor of the charmed meson at production and exploit CP-conserving strong c(bar c) pair-production in p(bar p) collisions. High-statistics samples of Cabibbo-favored D 0 → K - π + decays with and without a D* ± tag are used to correct for instrumental effects and significantly reduce systematic uncertainties. We measure A CP (D 0 → π + π - ) = (+0.22 ± 0.24(stat) ± 0.11 (syst))% and A CP (D 0 → K + K - ) = (-0.24 ± 0.22 (stat) ± 0.09 (syst))%, in agreement with CP conservation. These are the most precise determinations from a single experiment to date. Under the assumption of negligible direct CP violation in D 0 → π + π - and D 0 → K + K - decays, the results provide an upper limit to the CP-violating asymmetry in D 0 mixing, |A CP ind (D 0 )| < 0.13% at the 90% confidence level.
CP-even and CP-odd transverse polarization of the electron in the muon decay
International Nuclear Information System (INIS)
Kuznetsov, A.V.
1981-01-01
In the most general weak interaction model with intermediate vector bosons, allowing CP breaking in the muon decay, CP- even and CP-odd transverse polarization of the μ-decay electrons is calculated taking into account the radiative corrections. It is shown that such corrections are essential only at the beginning of the spectrum reducing the observed transverse polarization effects. When the electron energy is close to its maximum and the emission angles are small, the transverse polarization considerably grows. Search for CP-even and CP-odd transverse polarization of the electrons should be carried out at energies Esub(e) approximately equal to O.975 Esub(e)sup(max) and emission angles THETA approximately equal to 25+35 deg [ru
International Nuclear Information System (INIS)
Han, C.G.
1980-01-01
Effects of Yang-Mills instantons on CP-violating strong interactions are studied. Using simplified models of CP-noninvariant weak interactions, we calculate the induced strong CP-violation. Even in the simple examples studied, the CP-violating phase of a vacuum-to-vacuum transition amplitude differs in general from the phase of the determinant of the quark mass matrix multiplied by the topological charge of the background Yang-Mills field. Then several CP-violating phenomena such as eta → 2π decay and neutron electric dipole moment induced by instantons are studied. The result of our explicit calculation of eta → 2π decay strength verifies the current algebraic method used by Crewther et al. We also present a calculation of the instanton contribution, in the dilute gas approximation for instanton gas, to the electric dipole moment of a free quark without using 't Hooft's effective Lagrangian
DEFF Research Database (Denmark)
Hagedorn, C.
2017-01-01
I summarize the status of theoretical predictions for the yet to be measured leptonic CP phases, the Dirac phase δ and the two Majorana phases α and β. I discuss different approaches based on: (a) a flavor symmetry without and with corrections, (b) different types of sum rules and (c) flavor and CP...... symmetries. I show their predictive power with examples. In addition, I present scenarios in which low and high energy CP phases are connected so that predictions for the CP phases α, β and δ become correlated to the sign of the baryon asymmetry YB of the Universe that is generated via leptogenesis....
Measurement of CP-Violating Asymmetries in B0 Decays to CP Eigenstates
Energy Technology Data Exchange (ETDEWEB)
MacFarlane, David B
2001-02-26
We present measurements of time-dependent CP-violating asymmetries in neutral B decays to several CP eigenstates. The measurement uses a data sample of 23 million {Upsilon}(4S) {yields} B{bar B} decays collected by the BABAR detector at the PEP-II asymmetric B Factory at SLAC. In this sample, we find events where one neutral B meson is fully reconstructed in a CP eigenstate containing charmonium and the flavor of the other neutral B meson is determined from its decay products. The amplitude of the CP-violating asymmetry, which in the Standard Model is proportional to sin2{beta}, is derived from the decay time distributions in such events. The result is sin2{beta} = 0.34 {+-} 0.20 (stat) {+-} 0.05 (syst).
Measurement of CP-violating asymmetries in B0 decays to CP eigenstates.
Aubert, B; Boutigny, D; De Bonis, I; Gaillard, J M; Jeremie, A; Karyotakis, Y; Lees, J P; Robbe, P; Tisserand, V; Palano, A; Chen, G P; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Reinertsen, P L; Stugu, B; Abbott, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Clark, A R; Dardin, S; Day, C; Dow, S F; Elioff, T; Fan, Q; Gaponenko, I; Gill, M S; Goozen, F R; Gowdy, S J; Gritsan, A; Groysman, Y; Jacobsen, R G; Jared, R C; Kadel, R W; Kadyk, J; Karcher, A; Kerth, L T; Kipnis, I; Kluth, S; Kolomensky, Y G; Kral, J F; Lafever, R; LeClerc, C; Levi, M E; Lewis, S A; Lionberger, C; Liu, T; Long, M; Lynch, G; Marino, M; Marks, K; Meyer, A B; Mokhtarani, A; Momayezi, M; Nyman, M; Oddone, P J; Ohnemus, J; Oshatz, D; Patton, S; Perazzo, A; Peters, C; Pope, W; Pripstein, M; Quarrie, D R; Rasson, J E; Roe, N A; Romosan, A; Ronan, M T; Shelkov, V G; Stone, R; Telnov, A V; von der Lippe, H; Weber, T; Wenzel, W A; Zisman, M S; Bright-Thomas, P G; Harrison, T J; Hawkes, C M; Kirk, A; Knowles, D J; O'Neale, S W; Watson, A T; Watson, N K; Deppermann, T; Koch, H; Krug, J; Kunze, M; Lewandowski, B; Peters, K; Schmuecker, H; Steinke, M; Andress, J C; Barlow, N R; Bhimji, W; Chevalier, N; Clark, P J; Cottingham, W N; De Groot, N; Dyce, N; Foster, B; Mass, A; McFall, J D; Wallom, D; Wilson, F F; Abe, K; Hearty, C; Mattison, T S; McKenna, J A; Thiessen, D; Camanzi, B; Jolly, S; McKemey, A K; Tinslay, J; Blinov, V E; Bukin, A D; Bukin, D A; Buzykaev, A R; Dubrovin, M S; Golubev, V B; Ivanchenko, V N; Kolachev, G M; Korol, A A; Kravchenko, E A; Onuchin, A P; Salnikov, A A; Serednyakov, S I; Skovpen, Y I; Telnov, V I; Yushkov, A N; Lankford, A J; Mandelkern, M; McMahon, S; Stoker, D P; Ahsan, A; Buchanan, C; Chun, S; MacFarlane, D B; Prell, S; Rahatlou, S; Raven, G; Sharma, V; Burke, S; Campagnari, C; Dahmes, B; Hale, D; Hart, P A; Kuznetsova, N; Kyre, S; Levy, S L; Long, O; Lu, A; Richman, J D; Verkerke, W; Witherell, M; Yellin, S; Beringer, J; Dorfan, D E; Eisner, A M; Frey, A; Grillo, A A; Grothe, M; Heusch, C A; Johnson, R P; Kroeger, W; Lockman, W S; Pulliam, T; Sadrozinski, H; Schalk, T; Schmitz, R E; Schumm, B A; Seiden, A; Spencer, E N; Turri, M; Walkowiak, W; Williams, D C; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Hanson, J E; Hitlin, D G; Metzler, S; Oyang, J; Porter, F C; Ryd, A; Samuel, A; Weaver, M; Yang, S; Zhu, R Y; Devmal, S; Geld, T L; Jayatilleke, S; Jayatilleke, S M; Mancinelli, G; Meadows, B T; Sokoloff, M D; Bloom, P; Fahey, S; Ford, W T; Gaede, F; van Hoek, W C; Johnson, D R; Michael, A K; Nauenberg, U; Olivas, A; Park, H; Rankin, P; Roy, J; Sen, S; Smith, J G; Wagner, D L; Blouw, J; Harton, J L; Krishnamurthy, M; Soffer, A; Toki, W H; Warner, D W; Wilson, R J; Zhang, J; Brandt, T; Brose, J; Colberg, T; Dahlinger, G; Dickopp, M; Dubitzky, R S; Eckstein, P; Futterschneider, H; Krause, R; Maly, E; Müller-Pfefferkorn, R; Otto, S; Schubert, K R; Schwierz, R; Spaan, B; Wilden, L; Behr, L; Bernard, D; Bonneaud, G R; Brochard, F; Cohen-Tanugi, J; Ferrag, S; Fouque, G; Gastaldi, F; Matricon, P; Mora de Freitas, P; Renard, C; Roussot, E; T'Jampens, S; Thiebaux, C; Vasileiadis, G; Verderi, M; Anjomshoaa, A; Bernet, R; Di Lodovico, F; Khan, A; Muheim, F; Playfer, S; Swain, J E; Falbo, M; Bozzi, C; Dittongo, S; Folegani, M; Piemontese, L; Treadwell, E; Anulli, F; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Falciai, D; Finocchiaro, G; Patteri, P; Peruzzi, I M; Piccolo, M; Xie, Y; Zallo, A; Bagnasco, S; Buzzo, A; Contri, R; Crosetti, G; Lo Vetere, M; Macri, M; Monge, M R; Pallavicini, M; Passaggio, S; Pastore, F C; Patrignani, C; Pia, M G; Robutti, E; Santroni, A; Morii, M; Bartoldus, R; Dignan, T; Hamilton, R; Mallik, U; Cochran, J; Crawley, H B; Fischer, P A; Lamsa, J; McKay, R; Meyer, W T; Rosenberg, E I; Albert, J N; Beigbeder, C; Benkebil, M; Breton, D; Cizeron, R; Du, S; Grosdidier, G; Hast, C; Höcker, A; LePeltier, V; Lutz, A M; Plaszczynski, S; Schune, M H; Trincaz-Duvoid, S; Truong, K; Valassi, A; Wormser, G; Bionta, R M; Brigljević, V; Brooks, A; Fackler, O; Fujino, D; Lange, D J; Mugge, M; O'Connor, T G; Pedrotti, B; Shi, X; van Bibber, K; Wenaus, T J; Wright, D M; Wuest, C R; Yamamoto, B; Carroll, M; Fry, J R; Gabathuler, E; Gamet, R; George, M; Kay, M; Payne, D J; Sloane, R J; Touramanis, C; Aspinwall, M L; Bowerman, D A; Dauncey, P D; Egede, U; Eschrich, I; Gunawardane, N J; Martin, R; Nash, J A; Price, D R; Sanders, P; Smith, D; Azzopardi, D E; Back, J J; Dixon, P; Harrison, P F; Newman-Coburn, D; Potter, R J; Shorthouse, H W; Strother, P; Vidal, P B; Williams, M I; Cowan, G; George, S; Green, M G; Kurup, A; Marker, C E; McGrath, P; McMahon, T R; Salvatore, F; Scott, I; Vaitsas, G; Brown, D; Davis, C L; Ford, K; Li, Y; Pavlovich, J; Allison, J; Barlow, R J; Boyd, J T; Fullwood, J; Jackson, F; Lafferty, G D; Savvas, N; Simopoulos, E T; Thompson, R J; Weatherall, J H; Bard, R; Farbin, A; Jawahery, A; Lillard, V; Olsen, J; Roberts, D A; Schieck, J R; Blaylock, G; Dallapiccola, C; Flood, K T; Hertzbach, S S; Kofler, R; Lin, C S; Staengle, H; Willocq, S; Wittlin, J; Brau, B; Cowan, R; Sciolla, G; Taylor, F; Yamamoto, R K; Britton, D I; Milek, M; Patel, P M; Trischuk, J; Lanni, F; Palombo, F; Bauer, J M; Booke, M; Cremaldi, L; Eschenberg, V; Kroeger, R; Reep, M; Reidy, J; Sanders, D A; Summers, D J; Beaulieu, M; Martin, J P; Nief, J Y; Seitz, R; Taras, P; Zacek, V; Nicholson, H; Sutton, C S; Cavallo, N; Cartaro, C; De Nardo, G; Fabozzi, F; Gatto, C; Lista, L; Paolucci, P; Piccolo, D; Sciacca, C; LoSecco, J M; Alsmiller, J R; Gabriel, T A; Handler, T; Heck, J; Brau, J E; Frey, R; Iwasaki, M; Sinev, N B; Strom, D; Borsato, E; Colecchia, F; Dal Corso, F; Galeazzi, F; Margoni, M; Marzolla, M; Michelon, G; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Torassa, E; Voci, C; Bailly, P; Benayoun, M; Briand, H; Chauveau, J; David, P; De La Vaissière, C; Del Buono, L; Genat, J F; Hamon, O; Le Diberder, F; Lebbolo, H; Leruste, P; Lory, J; Martin, L; Roos, L; Stark, J; Versillé, S; Zhang, B; Manfredi, P F; Ratti, L; Re, V; Speziali, V; Frank, E D; Gladney, L; Guo, Q H; Panetta, J H; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Bosi, F; Carpinelli, M; Forti, F; Giorgi, M A; Lusiani, A; Martinez-Vidal, F; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Sandrelli, F; Simi, G; Triggiani, G; Walsh, J; Hairre, M; Judd, D; Paick, K; Turnbull, L; Wagoner, D E; Albert, J; Bula, C; Fernholz, R; Lu, C; McDonald, K T; Miftakov, V; Sands, B; Schaffner, S F; Smith, A J; Tumanov, A; Varnes, E W; Bronzini, F; Buccheri, A; Bulfon, C; Cavoto, G; del Re, D; Faccini, R; Ferrarotto, F; Ferroni, F; Fratini, K; Lamanna, E; Leonardi, E; Mazzoni, M A; Morganti, S; Piredda, G; Safai Tehrani, F; Serra, M; Voena, C; Waldi, R; Jacques, P F; Kalelkar, M; Plano, R J; Adye, T; Claxton, B; Franek, B; Galagedera, S; Geddes, N I; Gopal, G P; Lidbury, J; Xella, S M; Aleksan, R; Besson, P; Bourgeois, P; De Domenico, G; Emery, S; Gaidot, A; Ganzhur, S F; Gosset, L; Hamel de Monchenault, G; Kozanecki, W; Langer, M; London, G W; Mayer, B; Serfass, B; Vasseur, G; Yeche, C; Zito, M; Copty, N; Purohit, M V; Singh, H; Yumiceva, F X; Adam, I; Anthony, P L; Aston, D; Baird, K; Bartelt, J; Becla, J; Bell, R; Bloom, E; Boeheim, C T; Boyarski, A M; Boyce, R F; Bulos, F; Burgess, W; Byers, B; Calderini, G; Claus, R; Convery, M R; Coombes, R; Cottrell, L; Coupal, D P; Coward, D H; Craddock, W W; DeStaebler, H; Dorfan, J; Doser, M; Dunwoodie, W; Ecklund, S; Fieguth, T H; Field, R C; Freytag, D R; Glanzman, T; Godfrey, G L; Grosso, P; Haller, G; Hanushevsky, A; Harris, J; Hasan, A; Hewett, J L; Himel, T; Huffer, M E; Innes, W R; Jessop, C P; Kawahara, H; Keller, L; Kelsey, M H; Kim, P; Klaisner, L A; Kocian, M L; Krebs, H J; Kunz, P F; Langenegger, U; Langeveld, W; Leith, D W; Louie, S K; Luitz, S; Luth, V; Lynch, H L; MacDonald, J; Manzin, G; Mariske, H; McCulloch, M; McShurley, D; Menke, S; Messner, R; Metcalfe, S; Moffeit, K C; Mount, R; Muller, D R; Nelson, D; Nordby, M; O'Grady, C P; O'Neill, F G; Oxoby, G; Pavel, T; Perl, J; Petrak, S; Putallaz, G; Quinn, H; Raines, P E; Ratcliff, B N; Reif, R; Robertson, S H; Rochester, L S; Roodman, A; Russell, J J; Sapozhnikov, L; Saxton, O H; Schietinger, T; Schindler, R H; Schwiening, J; Seeman, J T; Serbo, V V; Skarpass, K; Snyder, A; Soha, A; Spanier, S M; Stahl, A; Stelzer, J; Su, D; Sullivan, M K; Talby, M; Tanaka, H A; Va'vra, J; Wagner, S R; Weinstein, A J; White, J L; Wienands, U; Wisniewski, W J; Young, C C; Zioulas, G; Burchat, P R; Cheng, C H; Kirkby, D; Meyer, T I; Roat, C; De Silva, A; Henderson, R; Berridge, S; Bugg, W; Cohn, H; Hart, E; Weidemann, A W; Benninger, T; Izen, J M; Kitayama, I; Lou, X C; Turcotte, M; Bianchi, F; Bona, M; Di Girolamo, B; Gamba, D; Smol, A; Zanin, D; Bosisio, L; Della Ricca, G; Lanceri, L; Pompili, A; Poropat, P; Vuagnin, G; Panvini, R S; Brown, C M; Kowalewski, R; Roney, J M; Band, H R; Charles, E; Dasu, S; Elmer, P; Hu, H; Johnson, J R; Nielsen, J; Orejudos, W; Pan, Y; Prepost, R; Scott, I J; von Wimmersperg-Toeller, J H; Wu, S L; Yu, Z; Zobernig, H; Kordich, T M; Moore, T B; Neal, H
2001-03-19
We present measurements of time-dependent CP-violating asymmetries in neutral B decays to several CP eigenstates. The measurement uses a data sample of 23x10(6) Upsilon(4S)-->BbarB decays collected by the BABAR detector at the PEP-II asymmetric B Factory at SLAC. In this sample, we find events in which one neutral B meson is fully reconstructed in a CP eigenstate containing charmonium and the flavor of the other neutral B meson is determined from its decay products. The amplitude of the CP-violating asymmetry, which in the standard model is proportional to sin2beta, is derived from the decay time distributions in such events. The result is sin2beta = 0.34+/-0.20 (stat)+/-0.05 (syst).
Exploring CP Violation in the MSSM
Arbey, A.; Godbole, R.M.; Mahmoudi, F.
2015-01-01
We explore the prospects for observing CP violation in the minimal supersymmetric extension of the Standard Model (MSSM) with six CP-violating parameters, three gaugino mass phases and three phases in trilinear soft supersymmetry-breaking parameters, using the CPsuperH code combined with a geometric approach to maximize CP-violating observables subject to the experimental upper bounds on electric dipole moments. We also implement CP-conserving constraints from Higgs physics, flavour physics and the upper limits on the cosmological dark matter density and spin-independent scattering. We study possible values of observables within the constrained MSSM (CMSSM), the non-universal Higgs model (NUHM), the CPX scenario and a variant of the phenomenological MSSM (pMSSM). We find values of the CP-violating asymmetry A_CP in b -> s gamma decay that may be as large as 3%, so future measurements of A_CP may provide independent information about CP violation in the MSSM. We find that CP-violating MSSM contributions to the...
Deviation from bimaximal mixing and leptonic CP phases in S4 family symmetry and generalized CP
International Nuclear Information System (INIS)
Li, Cai-Chang; Ding, Gui-Jun
2015-01-01
The lepton flavor mixing matrix having one row or one column in common with the bimaximal mixing up to permutations is still compatible with the present neutrino oscillation data. We provide a thorough exploration of generating such a mixing matrix from S 4 family symmetry and generalized CP symmetry H CP . Supposing that S 4 ⋊H CP is broken down to Z 2 ST 2 SU ×H CP ν in the neutrino sector and Z 4 TST 2 U ⋊H CP l in the charged lepton sector, one column of the PMNS matrix would be of the form (1/2,1/√2,1/2) T up to permutations, both Dirac CP phase and Majorana CP phases are trivial to accommodate the observed lepton mixing angles. The phenomenological implications of the remnant symmetry K 4 (TST 2 ,T 2 U) ×H CP ν in the neutrino sector and Z 2 SU ×H CP l in the charged lepton sector are studied. One row of PMNS matrix is determined to be (1/2,1/2,−i/√2), and all the three leptonic CP phases can only be trivial to fit the measured values of the mixing angles. Two models based on S 4 family symmetry and generalized CP are constructed to implement these model independent predictions enforced by remnant symmetry. The correct mass hierarchy among the charged leptons is achieved. The vacuum alignment and higher order corrections are discussed.
Directory of Open Access Journals (Sweden)
Andrés Alvarado
Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.
Leptogenesis and residual CP symmetry
International Nuclear Information System (INIS)
Chen, Peng; Ding, Gui-Jun; King, Stephen F.
2016-01-01
We discuss flavour dependent leptogenesis in the framework of lepton flavour models based on discrete flavour and CP symmetries applied to the type-I seesaw model. Working in the flavour basis, we analyse the case of two general residual CP symmetries in the neutrino sector, which corresponds to all possible semi-direct models based on a preserved Z 2 in the neutrino sector, together with a CP symmetry, which constrains the PMNS matrix up to a single free parameter which may be fixed by the reactor angle. We systematically study and classify this case for all possible residual CP symmetries, and show that the R-matrix is tightly constrained up to a single free parameter, with only certain forms being consistent with successful leptogenesis, leading to possible connections between leptogenesis and PMNS parameters. The formalism is completely general in the sense that the two residual CP symmetries could result from any high energy discrete flavour theory which respects any CP symmetry. As a simple example, we apply the formalism to a high energy S 4 flavour symmetry with a generalized CP symmetry, broken to two residual CP symmetries in the neutrino sector, recovering familiar results for PMNS predictions, together with new results for flavour dependent leptogenesis.
Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products
Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam
2013-11-01
This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.
Measurement of the ratio B(B-→D0K-)/B(B-→D0π-) and of the CP asymmetry of B-→DCP+0K- decays
International Nuclear Information System (INIS)
Aubert, B.; Barate, R.; Boutigny, D.; Couderc, F.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Tisserand, V.; Zghiche, A.; Grauges-Pous, E.; Palano, A.; Pompili, A.; Chen, J.C.; Qi, N.D.; Rong, G.; Wang, P.; Zhu, Y.S.; Eigen, G.; Ofte, I.; Stugu, B.
2005-01-01
We study the decays B - →D 0 π - and B - →D 0 K - , where the D 0 decays into D 0 π 0 , with the D 0 reconstructed in the CP-even (CP+) eigenstates K - K + and π - π + and in the (non-CP) channels K - π + , K - π + π + π - , and K - π + π 0 . Using a sample of about 123x10 6 BB pairs, we measure the ratios of decay rates R non-CP ≡ (B(B - →D non-CP 0 K - )/B(B - →D non-CP 0 π - ))=0.0813±0.0040(stat) -0.0031 +0.0042 (syst), and provide the first measurements of R CP+ ≡ (B(B - →D CP+ 0 K - )/B(B - →D CP+ 0 π - ))=0.086±0.021(stat)±0.007(syst), and of the CP asymmetry A CP+ ≡ (B(B - →D CP+ 0 K - )-B(B + →D CP+ 0 K + )/B(B - →D CP+ 0 K - )+B(B + →D CP+ 0 K + ))=-0.10±0.23 (stat) -0.04 +0.03 (syst).
CP violating scalar Dark Matter
Cordero-Cid, A.; Hernández-Sánchez, J.; Keus, V.; King, S. F.; Moretti, S.; Rojas, D.; Sokołowska, D.
2016-12-01
We study an extension of the Standard Model (SM) in which two copies of the SM scalar SU(2) doublet which do not acquire a Vacuum Expectation Value (VEV), and hence are inert, are added to the scalar sector. We allow for CP-violation in the inert sector, where the lightest inert state is protected from decaying to SM particles through the conservation of a Z 2 symmetry. The lightest neutral particle from the inert sector, which has a mixed CP-charge due to CP-violation, is hence a Dark Matter (DM) candidate. We discuss the new regions of DM relic density opened up by CP-violation, and compare our results to the CP-conserving limit and the Inert Doublet Model (IDM). We constrain the parameter space of the CP-violating model using recent results from the Large Hadron Collider (LHC) and DM direct and indirect detection experiments.
DEFF Research Database (Denmark)
Vikner, Sten; Christensen, Ken Ramshøj; Nyvad, Anne Mette
2017-01-01
As in Nyvad et al. (2017), we will explore a particular derivation of (embedded) V2, in terms of a cP/CP-distinction, which may be seen as a version of the CP-recursion analysis (de Haan & Weerman 1986; Vikner 1995 and many others). e idea is that because embedded V2 clauses do not allow extraction......, whereas other types of CP-recursion clauses do (Christensen et al. 2013a; 2013b; Christensen & Nyvad 2014), CP-recursion in embedded V2 is assumed to be fundamentally di erent from other kinds of CP-recursion, in that main clause V2 and embedded V2 involve a CP (“big CP”), whereas other clausal...... projections above IP are instances of cP (“little cP”)....
CP invariance: a point of view
International Nuclear Information System (INIS)
Mohan, Gyan
1983-01-01
That the longlived component L of K 0 has both CP = +1 and CP = -1 modes of decay is often cited as evidence of violation of CP invariance. The careful ones find the compelling evidence to be the non-dilution of the regeneration interference pattern when the incident K 0 beam is mixed even substantially with anti-K 0 . However the two phenomena comprehensively imply that L has a CP = +1 component Lsub(+) and CP = -1 component Lsub(-) and that the longlived component of both K 0 and anti-K 0 are one and the same L. This does not demand abandoning CP invariance. It does imply that anti-K 0 is not the CP conjugate of K 0 . (author)
30 CFR 56.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
International Nuclear Information System (INIS)
Choi, K.; Kaplan, D.B.; Nelson, A.E.
1993-01-01
Conventional solutions to the strong CP problem all require the existence of global symmetries. However, quantum gravity may destroy global symmetries, making it hard to understand why the electric dipole moment of the neutron (EDMN) is so small. We suggest here that CP is actually a discrete gauge symmetry, and is therefore not violated by quantum gravity. We show that four-dimensional CP can arise as a discrete gauge symmetry in theories with dimensional compactification, if the original number of Minkowski dimensions equals 8k+1, 8k+2 or 8k+3, and if there are certain restrictions on the gauge group; these conditions are met by superstrings. CP may then be broken spontaneously below 10 9 GeV, explaining the observed CP violation in the kaon system without inducing a large EDMN. We discuss the phenomenology of such models, as well as the peculiar properties of cosmic 'SP strings' which could be produced at the compactification scale. Such strings have the curious property that a particle carried around the string is turned into its CP conjugate. A single CP string renders four-dimensional space-time nonorientable. (orig.)
Indian Academy of Sciences (India)
Recent results on CP-violation measurements in decays from energy asymmetric -factory experiments are reported. Thanks to large accumulated data samples, CP-violations in decays in mixing-decay interference and direct CP-violation are now firmly established. The measurements of three angles of the unitarity ...
Constraining scalar resonances with top-quark pair production at the LHC
Franzosi, Diogo Buarque; Fabbri, Federica; Schumann, Steffen
2018-03-01
Constraints on models which predict resonant top-quark pair production at the LHC are provided via a reinterpretation of the Standard Model (SM) particle level measurement of the top-anti-top invariant mass distribution, m(t\\overline{t}) . We make use of state-of-the-art Monte Carlo event simulation to perform a direct comparison with measurements of m(t\\overline{t}) in the semi-leptonic channels, considering both the boosted and the resolved regime of the hadronic top decays. A simplified model to describe various scalar resonances decaying into top-quarks is considered, including CP-even and CP-odd, color-singlet and color-octet states, and the excluded regions in the respective parameter spaces are provided.
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
International Nuclear Information System (INIS)
Bowman, Stephen M.
2008-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of
International Nuclear Information System (INIS)
Dunietz, I.
1997-01-01
CP violation is observed to date only in K 0 decays and is parameterizable by a single quantity ε. Because it is one of the least understood phenomena in the Standard Model and holds a clue to baryogenesis, it must be investigated further. Highly specialized searches in K 0 decays are possible. Effects in B decays are much larger. In addition to the traditional B d → J/ψK S , π + π - asymmetries, CP violation could be searched for in already existing inclusive B data samples. The rapid B s --anti B s oscillations cancel in untagged B s data samples, which therefore allow feasibility studies for the observation of CP violation and the extraction of CKM elements with present vertex detectors. The favored method for the extraction of the CKM angle γ is shown to be unfeasible and a solution is presented involving striking direct CP violation in charged B decays. Novel methods for determining the B s mixing parameter Δm are described without the traditional requirement of flavor-specific final states
Energy Technology Data Exchange (ETDEWEB)
1993-06-01
Experiments designed to measure CP-violating asymmetries in the B meson system must emphasize exclusive state reconstruction with the highest possible resolution and efficiency. In the case of B{sup 0} mesons produced in pairs at the {Upsilon}(4S) resonance at an asymmetric e{sup +}e{sup {minus}} storage ring, this capability must be accompanied by precise vertex reconstruction in the direction of the e{sup +}e{sup {minus}} beams (henceforth the z direction). These are difficult requirements, beyond the scope of any existing storage ring detector. The challenge of designing an asymmetric storage ring capable of producing the large number of neutral B meson pairs required to measure CP-violating asymmetries in decays to CP eigenstates has been handsomely met in the PEP-II design. As the first asymmetric e{sup +}e{sup {minus}} storage ring, PEP-II presents a novel set of experimental challenges to a 4{pi} detector. This Status Report describes the design of a new detector fully capable of exploiting the physics opportunities provided by PEP-II.
Probing CP violation in h→γγ with converted photons
Energy Technology Data Exchange (ETDEWEB)
Bishara, Fady [Department of Physics, University of Cincinnati,345 Clifton Ct., Cincinnati, OH 45221 (United States); Theoretical Physics Department, Fermilab,P.O. Box 500, Batavia, IL 60510 (United States); Grossman, Yuval [Department of Physics, LEPP, Cornell University,109 Clark Hall, Ithaca, NY 14853 (United States); Harnik, Roni [Theoretical Physics Department, Fermilab,P.O. Box 500, Batavia, IL 60510 (United States); Robinson, Dean J. [State Key Laboratory of Theoretical Physics andKavli Institute for Theoretical Physics China (KITPC),Institute of Theoretical Physics, Chinese Academy of Sciences,Beijing 100190 (China); Department of Physics, University of California,366 Le Conte Hall #7300, Berkeley, CA 94720 (United States); Shu, Jing [Ernest Orlando Lawrence Berkeley National Laboratory, University of California,1 Cyclotron Road, Berkeley, CA 94720 (United States); Zupan, Jure [Department of Physics, University of Cincinnati,345 Clifton Ct., Cincinnati, OH 45221 (United States)
2014-04-11
We study Higgs diphoton decays, in which both photons undergo nuclear conversion to electron-positron pairs. The kinematic distribution of the two electron-positron pairs may be used to probe the CP violating (CPV) coupling of the Higgs to photons, that may be produced by new physics. Detecting CPV in this manner requires interference between the spin-polarized helicity amplitudes for both conversions. We derive leading order, analytic forms for these amplitudes. In turn, we obtain compact, leading-order expressions for the full process rate. While performing experiments involving photon conversions may be challenging, we use the results of our analysis to construct experimental cuts on certain observables that may enhance sensitivity to CPV. We show that there exist regions of phase space on which sensitivity to CPV is of order unity. The statistical sensitivity of these cuts are verified numerically, using dedicated Monte-Carlo simulations.
Some ideas for learning CP-theories
Fierens, Daan
2008-01-01
Causal Probabilistic logic (CP-logic) is a language for describing complex probabilistic processes. In this talk we consider the problem of learning CP-theories from data. We briefly discuss three possible approaches. First, we review the existing algorithm by Meert et al. Second, we show how simple CP-theories can be learned by using the learning algorithm for Logical Bayesian Networks and converting the result into a CP-theory. Third, we argue that for learning more complex CP-theories, an ...
A search for CP violation in hyperon decays by the hyper-CP experiment at Fermilab
International Nuclear Information System (INIS)
Holmstrom, T.
2002-01-01
The Hyper-CP collaboration is performing a precision search for CP violation in hyperon decays, these decays are sensitive to sources of CP violation to which neutral kaon decays are not. The measured CP observable is proportional to the difference between the product of the Ξ and Λ decay α parameters and that of the CP-conjugate decays. About 2.5 billion fully-reconstructed Ξ - → Λπ - → pπ - π - and Ξ-bar + → Λ-barπ + → p-barπ + π + decays were taken in 2 fixed-target runs at Fermilab, allowing a statistical sensitivity of about 2.10 -4 in the CP asymmetry. These 2 runs gave us the largest sample of Ξ and Ω ever collected. An initial study has been done on a fraction of the data and we have obtained: A ΞΛ equals (-7±12(statistical)±6.2(systematic))*10 -4 . Other preliminary results are also presented in this series of slides
Li, Hui; Li, Defang; Chen, Anguo; Tang, Huijuan; Li, Jianjun; Huang, Siqi
2016-01-01
Kenaf (Hibiscus cannabinus L.) is an economically important natural fiber crop grown worldwide. However, only 20 expressed tag sequences (ESTs) for kenaf are available in public databases. The aim of this study was to develop large-scale simple sequence repeat (SSR) markers to lay a solid foundation for the construction of genetic linkage maps and marker-assisted breeding in kenaf. We used Illumina paired-end sequencing technology to generate new EST-simple sequences and MISA software to mine SSR markers. We identified 71,318 unigenes with an average length of 1143 nt and annotated these unigenes using four different protein databases. Overall, 9324 complementary pairs were designated as EST-SSR markers, and their quality was validated using 100 randomly selected SSR markers. In total, 72 primer pairs reproducibly amplified target amplicons, and 61 of these primer pairs detected significant polymorphism among 28 kenaf accessions. Thus, in this study, we have developed large-scale SSR markers for kenaf, and this new resource will facilitate construction of genetic linkage maps, investigation of fiber growth and development in kenaf, and also be of value to novel gene discovery and functional genomic studies. PMID:26960153
Li, Hui; Li, Defang; Chen, Anguo; Tang, Huijuan; Li, Jianjun; Huang, Siqi
2016-01-01
Kenaf (Hibiscus cannabinus L.) is an economically important natural fiber crop grown worldwide. However, only 20 expressed tag sequences (ESTs) for kenaf are available in public databases. The aim of this study was to develop large-scale simple sequence repeat (SSR) markers to lay a solid foundation for the construction of genetic linkage maps and marker-assisted breeding in kenaf. We used Illumina paired-end sequencing technology to generate new EST-simple sequences and MISA software to mine SSR markers. We identified 71,318 unigenes with an average length of 1143 nt and annotated these unigenes using four different protein databases. Overall, 9324 complementary pairs were designated as EST-SSR markers, and their quality was validated using 100 randomly selected SSR markers. In total, 72 primer pairs reproducibly amplified target amplicons, and 61 of these primer pairs detected significant polymorphism among 28 kenaf accessions. Thus, in this study, we have developed large-scale SSR markers for kenaf, and this new resource will facilitate construction of genetic linkage maps, investigation of fiber growth and development in kenaf, and also be of value to novel gene discovery and functional genomic studies.
Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing
2018-05-12
Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Nelson, C.A.
1984-10-01
Powerful results are tabulated which can be used at modern colliders to make fundamental symmetry tests by analysis of sequential decays of X → V 1 V 2 . By generalization of the phi phi parity test which has recently been used to determine the parity of the eta/sub c/, the P ( or CP) quantum number can always be determined for X of any spin J which decays P (or respectively CP) invariantly into VV or V anti V where each vector meson decays into two spin-0 bosons, or is ω. P can also always be determined from a mode like K* + anti K* 0 . A neutral spin-0 technipion and an elementary Higgs particle, for instance, can be distinguished by such CP invariant decay modes and by phi rho 0 , phi J, J UPSILON, or if sufficiently massive by phi Z 0 or JZ 0 where J/psi and Z 0 go into a lepton-antilepton pair. Generalization to the gZ 0 and gg decay channels, g = gluon jet, which would be relevant to new resonance physics, for example, at the CERN collider is discussed. There are also very simple tests for possible violations of P, of the combination of C plus isospin, of both P and CP, and of both C and CP. 9 references
Analysis list: Cp190 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Cp190 Cell line,Embryo,Larvae + dm3 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/...target/Cp190.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/target/Cp190.5.tsv http://dbarchive.bioscience...dbc.jp/kyushu-u/dm3/target/Cp190.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Cp190.Cell_l...ine.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Cp190.Embryo.tsv,http://dbarchive.bioscience...dbc.jp/kyushu-u/dm3/colo/Cp190.Larvae.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/
Testing New Indirect CP Violation
International Nuclear Information System (INIS)
Grossman, Yuval; Nir, Yosef; Perez, Gilad
2009-01-01
If new CP violating physics contributes to neutral meson mixing, but its contribution to CP violation in decay amplitudes is negligible, then there is a model independent relation between four (generally independent) observables related to the mixing: the mass splitting (x), the width splitting (y), the CP violation in mixing (1-|q/p|), and the CP violation in the interference of decays with and without mixing (φ). For the four neutral meson systems, this relation can be written in a simple approximate form: ytanφ≅x(1-|q/p|). In the K system, all four observables have been measured and obey the relation to excellent accuracy. For the B s and D systems, new predictions are provided. The success or failure of these relations will probe the physics that is responsible for the CP violation.
GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.
Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi
2017-05-24
As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.
Serber, Robert
2018-01-01
Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.
CP -symmetry of order 4 and its consequences
International Nuclear Information System (INIS)
Ivanov, Igor P.
2017-01-01
Extended Higgs sectors offer rich opportunities for various forms of CP -violation. Here, we describe a new form of CP-conservation and discuss its consequences. We give a concrete example of a three-Higgs-doublet model dubbed CP4-3HDM with a CP -symmetry of order 4 and no other other accidental symmetries. If the vacuum conserves this symmetry, the model is CP -conserving with pairwise mass-degenerate extra neutral Higgs bosons. These fields cannot be classified as CP -even or CP -odd but they can be combined into complex physical fields which are CP -half-odd, that is, they pick up the i factor upon CP transformation. These CP -half-odd scalars can be Yukawa-coupled to the fermion bilinears in a CP -conserving way. We discuss fundamental and phenomenological features of the model, and stress a peculiar clash between the CP -symmetry and any convention for the particle-antiparticle assignment. (paper)
AUTHOR|(INSPIRE)INSPIRE-00341004
2016-01-01
Latest LHCb measurements of $CP$ violation in b-hadrons are presented based on $pp$ collision data collected in 2011 and 2012 at centre-of-mass energies of $\\sqrt{s}=7$ $\\rm TeV$ and $8\\ \\rm TeV$ respectively. The total integrated luminosity collected is 3.0 fb$^{-1}$. Results include recent measurements of $CP$ violation in $B_d$ and $B_s$ mixing, along with those of quantifying the effects of $b\\to c\\bar{c} s$ loop pollution. Standard Model $CP$ violation tests in loop transitions are discussed with results consistent with expectations. New decays of b-baryons are presented and preliminary studies of $CP$ violation are performed.
First evidence of direct $C\\!P$ violation in charmless two-body decays of $B^0_s$ mesons
Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amhis, Y; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Arrabito, L; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, C; Bauer, Th; Bay, A; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chiapolini, N; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Corti, G; Couturier, B; Cowan, G A; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Lorenzi, F; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Domingo Bonal, F; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; Elsasser, Ch; Elsby, D; Esperante Pereira, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gascon, D; Gaspar, C; Gauld, R; Gauvin, N; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hampson, T; Hansmann-Menzemer, S; Harji, R; Harnew, N; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Holubyev, K; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Keaveney, J; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Knecht, M; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kruzelecki, K; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li Gioi, L; Lieng, M; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Mac Raighne, A; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Malde, S; Mamunur, R M D; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Maynard, B; Mazurov, A; McGregor, G; McNulty, R; Meissner, M; Merk, M; Merkel, J; Miglioranzi, S; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neufeld, N; Nguyen, A D; Nguyen-Mau, C; Nicol, M; Niess, V; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, B K; Palacios, J; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Paterson, S K; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilař, T; Pinci, D; Plackett, R; Playfer, S; Plo Casasus, M; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodrigues, F; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Rosello, M; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, N A; Smith, E; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urquijo, P; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Viaud, B; Videau, I; Vieira, D; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voss, H; Waldi, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zvyagin, A
2012-01-01
Using a data sample corresponding to an integrated luminosity of 0.35 $\\mathrm{fb}^{-1}$ collected by LHCb in 2011, we report the first evidence of $C\\!P$ violation in the decays of $B^0_s$ mesons to $K^\\pm \\pi^\\mp$ pairs, $A_{C\\!P}(B^0_s \\rightarrow K \\pi)=0.27 \\pm 0.08\\,\\mathrm{(stat)} \\pm 0.02\\,\\mathrm{(syst)}$, with a significance of 3.3$\\sigma$. Furthermore, we report the first observation of $C\\!P$ violation in $B^0$ decays at a hadron collider, $A_{C\\!P}(B^0 \\rightarrow K\\pi)=-0.088 \\pm 0.011\\,\\mathrm{(stat)} \\pm 0.008\\,\\mathrm{(syst)}$, with a significance exceeding 6$\\sigma$.
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M; Lovmand, J
1997-01-01
, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....
Nanotechnology: A Policy Primer
2013-06-24
savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Measurement of the $C\\!P$ asymmetry in $B^0 \\to K^{*0} \\mu^+ \\mu^-$ decays
Aaij, R; Adametz, A; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amhis, Y; Anderlini, L; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, Th; Bay, A; Beddow, J; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Corti, G; Couturier, B; Cowan, G A; Craik, D; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Domingo Bonal, F; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Elsby, D; Esperante Pereira, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Hill, D; Hoballah, M; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, M; Keaveney, J; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Kochebina, O; Komarov, I; Komarov, V; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Mac Raighne, A; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Maino, M; Malde, S; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Mazurov, A; McCarthy, J; McGregor, G; McNulty, R; Meissner, M; Merk, M; Merkel, J; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neufeld, N; Nguyen, A D; Nguyen-Mau, C; Nicol, M; Niess, V; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, N A; Smith, E; Smith, M; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Videau, I; Vieira, D; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voss, H; Voß, C; Waldi, R; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zvyagin, A
2013-01-01
A measurement of the $C\\!P$ asymmetry in $B^0 \\rightarrow K^{*0} \\mu^+ \\mu^-$ decays is presented, based on 1.0$\\mbox{\\,fb}^{-1}$ of $pp$ collision data recorded by the LHCb experiment during 2011. The measurement is performed in six bins of invariant mass squared of the $\\mu^+\\mu^-$ pair, excluding the $\\mathrm{J}\\mskip -3mu/\\mskip -2mu\\psi\\mskip 2mu$ and $\\psi(2S)$ resonance regions. Production and detection asymmetries are removed using the $B^0 \\rightarrow \\mathrm{J}\\mskip -3mu/\\mskip -2mu\\psi\\mskip 2mu K^{*0}$ decay as a control mode. The integrated $C\\!P$ asymmetry is found to be $-0.072 \\pm 0.040 \\,(\\mbox{stat.}) \\pm 0.005 \\,(\\mbox{syst.})$, consistent with the Standard Model.
Structural and Electrochemical Consequences of [Cp*] Ligand Protonation.
Peng, Yun; Ramos-Garcés, Mario V; Lionetti, Davide; Blakemore, James D
2017-09-05
There are few examples of the isolation of analogous metal complexes bearing [η 5 -Cp*] and [η 4 -Cp*H] (Cp* = pentamethylcyclopentadienyl) complexes within the same metal/ligand framework, despite the relevance of such structures to catalytic applications. Recently, protonation of Cp*Rh(bpy) (bpy = 2,2'-bipyridyl) has been shown to yield a complex bearing the uncommon [η 4 -Cp*H] ligand, rather than generating a [Rh III -H] complex. We now report the purification and isolation of this protonated species, as well as characterization of analogous complexes of 1,10-phenanthroline (phen). Specifically, reaction of Cp*Rh(bpy) or Cp*Rh(phen) with 1 equiv of Et 3 NH + Br - affords rhodium compounds bearing endo-η 4 -pentamethylcyclopentadiene (η 4 -Cp*H) as a ligand. NMR spectroscopy and single-crystal X-ray diffraction studies confirm protonation of the Cp* ligand, rather than formation of metal hydride complexes. Analysis of new structural data and electronic spectra suggests that phen is significantly reduced in Cp*Rh(phen), similar to the case of Cp*Rh(bpy). Backbonding interactions with olefinic motifs are activated by formation of [η 4 -Cp*H]; protonation of [Cp*] stabilizes the low-valent metal center and results in loss of reduced character on the diimine ligands. In accord with these changes in electronic structure, electrochemical studies reveal a distinct manifold of redox processes that are accessible in the [Cp*H] complexes in comparison with their [Cp*] analogues; these processes suggest new applications in catalysis for the complexes bearing endo-η 4 -Cp*H.
Exploring CP violation in the MSSM.
Arbey, Alexandre; Ellis, John; Godbole, Rohini M; Mahmoudi, Farvah
We explore the prospects for observing CP violation in the minimal supersymmetric extension of the Standard Model (MSSM) with six CP-violating parameters, three gaugino mass phases and three phases in trilinear soft supersymmetry-breaking parameters, using the CPsuperH code combined with a geometric approach to maximise CP-violating observables subject to the experimental upper bounds on electric dipole moments. We also implement CP-conserving constraints from Higgs physics, flavour physics and the upper limits on the cosmological dark matter density and spin-independent scattering. We study possible values of observables within the constrained MSSM (CMSSM), the non-universal Higgs model (NUHM), the CPX scenario and a variant of the phenomenological MSSM (pMSSM). We find values of the CP-violating asymmetry [Formula: see text] in [Formula: see text] decay that may be as large as 3 %, so future measurements of [Formula: see text] may provide independent information about CP violation in the MSSM. We find that CP-violating MSSM contributions to the [Formula: see text] meson mass mixing term [Formula: see text] are in general below the present upper limit, which is dominated by theoretical uncertainties. If these could be reduced, [Formula: see text] could also provide an interesting and complementary constraint on the six CP-violating MSSM phases, enabling them all to be determined experimentally, in principle. We also find that CP violation in the [Formula: see text] and [Formula: see text] couplings can be quite large, and so may offer interesting prospects for future [Formula: see text], [Formula: see text], [Formula: see text] and [Formula: see text] colliders.
Direct CP violation in B -> pi sup +pi sup -pi. Determination of alpha without discrete ambiguity
Leitner, O; Thomas, A W
2002-01-01
Direct CP violation in the hadronic decays B-bar sup 0 -> pi sup +pi sup -pi sup 0 is investigated near the peak of the rho sup 0 taking into account the effect of rho - omega mixing. Branching ratio for processes B sup+- sup , sup 0 -> rho sup+- sup , sup 0 pi sup+- sup , sup 0 and B sup - -> omega pi sup - are calculated as well. We find that the CP violation asymmetry is strongly dependent on the CKM matrix elements. For a fixed N sub c sup e sup f sup f , the CP violation asymmetry, a, has a maximum of order - 40% to - 70% for B-bar sup 0 -> rho sup 0 (omega)pi sup 0 when the invariant mass of the pi sup +pi sup - pair is in the vicinity of the omega resonance. The sensitivity of the asymmetry to N sub c sup e sup f sup f is small in that case. Moreover, we find that in the range of N sub c sup e sup f sup f which is allowed by the most recent experimental branching ratios from the BABAR, BELLE and CLEO Collaborations, the sign of sin delta is always positive. Thus, a measurement of direct CP violation in...
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex
International Nuclear Information System (INIS)
Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.
1989-01-01
The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed
International Nuclear Information System (INIS)
Barr, S.M.
1992-01-01
Electric dipole moments of large atoms are an excellent tool to search for CP violation beyond the Standard Model. These tell us about the electron EDM but also about CP-violating electron-nucleon dimension-6 operators that arise from Higgs-exchange. Rapid strides are being made in searches for atomic EDMs. Limits on the electron EDM approaching the values which would be expected from Higgs-exchange mediated CP violation have been achieved. It is pointed out that in this same kind of model if tan β is large the effects in atoms of the dimension-6 e - n operators may outweigh the effect of the electron EDM. (author) 21 refs
Aad, G; Abbott, B; Abdinov, O; Abdallah, J; Abeloos, B; Aben, R; Abolins, M; Aben, R; Abolins, M; AbouZeid, O S; Abraham, N L; Abramowicz, H; Abreu, H; Abreu, R; Abulaiti, Y; Acharya, B S; Adamczyk, L; Adams, D L; Adelman, J; Adomeit, S; Adye, T; Affolder, A A; Agatonovic-Jovin, T; Agricola, J; Aguilar-Saavedra, J A; Ahlen, S P; Ahmadov, F; Aielli, G; Akerstedt, H; Åkesson, T P A; Akimov, A V; Alberghi, G L; Albert, J; Albrand, S; Verzini, M J Alconada; Aleksa, M; Aleksandrov, I N; Alexa, C; Alexander, G; Alexopoulos, T; Alhroob, M; Alimonti, G; Alison, J; Alkire, S P; Allbrooke, B M M; Allen, B W; Allport, P P; Aloisio, A; Alonso, A; Alonso, F; Alpigiani, C; Gonzalez, B Alvarez; Piqueras, D Álvarez; Alviggi, M G; Amadio, B T; Amako, K; Coutinho, Y Amaral; Amelung, C; Amidei, D; Santos, S P Amor Dos; Amorim, A; Amoroso, S; Amram, N; Amundsen, G; Anastopoulos, C; Ancu, L S; Andari, N; Andeen, T; Anders, C F; Anders, G; Anders, J K; Anderson, K J; Andreazza, A; Andrei, V; Angelidakis, S; Angelozzi, I; Anger, P; Angerami, A; Anghinolfi, F; Anisenkov, A V; Anjos, N; Annovi, A; Antonelli, M; Antonov, A; Antos, J; Anulli, F; Aoki, M; Bella, L Aperio; Arabidze, G; Arai, Y; Araque, J P; Arce, A T H; Arduh, F A; Arguin, J-F; Argyropoulos, S; Arik, M; Armbruster, A J; Armitage, L J; Arnaez, O; Arnold, H; Arratia, M; Arslan, O; Artamonov, A; Artoni, G; Artz, S; Asai, S; Asbah, N; Ashkenazi, A; Åsman, B; Asquith, L; Assamagan, K; Astalos, R; Atkinson, M; Atlay, N B; Augsten, K; Avolio, G; Axen, B; Ayoub, M K; Azuelos, G; Baak, M A; Baas, A E; Baca, M J; Bachacou, H; Bachas, K; Backes, M; Backhaus, M; Bagiacchi, P; Bagnaia, P; Bai, Y; Baines, J T; Baker, O K; Baldin, E M; Balek, P; Balestri, T; Balli, F; Balunas, W K; Banas, E; Banerjee, Sw; Bannoura, A A E; Barak, L; Barberio, E L; Barberis, D; Barbero, M; Barillari, T; Barisonzi, M; Barklow, T; Barlow, N; Barnes, S L; Barnett, B M; Barnett, R M; Barnovska, Z; Baroncelli, A; Barone, G; Barr, A J; Navarro, L Barranco; Barreiro, F; da Costa, J Barreiro Guimarães; Bartoldus, R; Barton, A E; Bartos, P; Basalaev, A; Bassalat, A; Basye, A; Bates, R L; Batista, S J; Batley, J R; Battaglia, M; Bauce, M; Bauer, F; Bawa, H S; Beacham, J B; Beattie, M D; Beau, T; Beauchemin, P H; Bechtle, P; Beck, H P; Becker, K; Becker, M; Beckingham, M; Becot, C; Beddall, A J; Beddall, A; Bednyakov, V A; Bedognetti, M; Bee, C P; Beemster, L J; Beermann, T A; Begel, M; Behr, J K; Belanger-Champagne, C; Bell, A S; Bell, W H; Bella, G; Bellagamba, L; Bellerive, A; Bellomo, M; Belotskiy, K; Beltramello, O; Belyaev, N L; Benary, O; Benchekroun, D; Bender, M; Bendtz, K; Benekos, N; Benhammou, Y; Noccioli, E Benhar; Benitez, J; Garcia, J A Benitez; Benjamin, D P; Bensinger, J R; Bentvelsen, S; Beresford, L; Beretta, M; Berge, D; Kuutmann, E Bergeaas; Berger, N; Berghaus, F; Beringer, J; Berlendis, S; Bernard, N R; Bernius, C; Bernlochner, F U; Berry, T; Berta, P; Bertella, C; Bertoli, G; Bertolucci, F; Bertram, I A; Bertsche, C; Bertsche, D; Besjes, G J; Bylund, O Bessidskaia; Bessner, M; Besson, N; Betancourt, C; Bethke, S; Bevan, A J; Bhimji, W; Bianchi, R M; Bianchini, L; Bianco, M; Biebel, O; Biedermann, D; Bielski, R; Biesuz, N V; Biglietti, M; De Mendizabal, J Bilbao; Bilokon, H; Bindi, M; Binet, S; Bingul, A; Bini, C; Biondi, S; Bjergaard, D M; Black, C W; Black, J E; Black, K M; Blackburn, D; Blair, R E; Blanchard, J-B; Blanco, J E; Blazek, T; Bloch, I; Blocker, C; Blum, W; Blumenschein, U; Blunier, S; Bobbink, G J; Bobrovnikov, V S; Bocchetta, S S; Bocci, A; Bock, C; Boehler, M; Boerner, D; Bogaerts, J A; Bogavac, D; Bogdanchikov, A G; Bohm, C; Boisvert, V; Bold, T; Boldea, V; Boldyrev, A S; Bomben, M; Bona, M; Boonekamp, M; Borisov, A; Borissov, G; Bortfeldt, J; Bortoletto, D; Bortolotto, V; Bos, K; Boscherini, D; Bosman, M; Sola, J D Bossio; Boudreau, J; Bouffard, J; Bouhova-Thacker, E V; Boumediene, D; Bourdarios, C; Boutle, S K; Boveia, A; Boyd, J; Boyko, I R; Bracinik, J; Brandt, A; Brandt, G; Brandt, O; Bratzler, U; Brau, B; Brau, J E; Braun, H M; Madden, W D Breaden; Brendlinger, K; Brennan, A J; Brenner, L; Brenner, R; Bressler, S; Bristow, T M; Britton, D; Britzger, D; Brochu, F M; Brock, I; Brock, R; Brooijmans, G; Brooks, T; Brooks, W K; Brosamer, J; Brost, E; Broughton, J H; de Renstrom, P A Bruckman; Bruncko, D; Bruneliere, R; Bruni, A; Bruni, G; Brunt, B H; Bruschi, M; Bruscino, N; Bryant, P; Bryngemark, L; Buanes, T; Buat, Q; Buchholz, P; Buckley, A G; Budagov, I A; Buehrer, F; Bugge, M K; Bulekov, O; Bullock, D; Burckhart, H; Burdin, S; Burgard, C D; Burghgrave, B; Burka, K; Burke, S; Burmeister, I; Busato, E; Büscher, D; Büscher, V; Bussey, P; Butler, J M; Butt, A I; Buttar, C M; Butterworth, J M; Butti, P; Buttinger, W; Buzatu, A; Buzykaev, A R; Urbán, S Cabrera; Caforio, D; Cairo, V M; Cakir, O; Calace, N; Calafiura, P; Calandri, A; Calderini, G; Calfayan, P; Caloba, L P; Calvet, D; Calvet, S; Calvet, T P; Toro, R Camacho; Camarda, S; Camarri, P; Cameron, D; Armadans, R Caminal; Camincher, C; Campana, S; Campanelli, M; Campoverde, A; Canale, V; Canepa, A; Bret, M Cano; Cantero, J; Cantrill, R; Cao, T; Garrido, M D M Capeans; Caprini, I; Caprini, M; Capua, M; Caputo, R; Carbone, R M; Cardarelli, R; Cardillo, F; Carli, T; Carlino, G; Carminati, L; Caron, S; Carquin, E; Carrillo-Montoya, G D; Carter, J R; Carvalho, J; Casadei, D; Casado, M P; Casolino, M; Casper, D W; Castaneda-Miranda, E; Castelli, A; Gimenez, V Castillo; Castro, N F; Catinaccio, A; Catmore, J R; Cattai, A; Caudron, J; Cavaliere, V; Cavallaro, E; Cavalli, D; Cavalli-Sforza, M; Cavasinni, V; Ceradini, F; Alberich, L Cerda; Cerio, B C; Cerqueira, A S; Cerri, A; Cerrito, L; Cerutti, F; Cerv, M; Cervelli, A; Cetin, S A; Chafaq, A; Chakraborty, D; Chalupkova, I; Chan, S K; Chan, Y L; Chang, P; Chapman, J D; Charlton, D G; Chatterjee, A; Chau, C C; Barajas, C A Chavez; Che, S; Cheatham, S; Chegwidden, A; Chekanov, S; Chekulaev, S V; Chelkov, G A; Chelstowska, M A; Chen, C; Chen, H; Chen, K; Chen, S; Chen, S; Chen, X; Chen, Y; Cheng, H C; Cheng, H J; Cheng, Y; Cheplakov, A; Cheremushkina, E; Moursli, R Cherkaoui El; Chernyatin, V; Cheu, E; Chevalier, L; Chiarella, V; Chiarelli, G; Chiodini, G; Chisholm, A S; Chitan, A; Chizhov, M V; Choi, K; Chomont, A R; Chouridou, S; Chow, B K B; Christodoulou, V; Chromek-Burckhart, D; Chudoba, J; Chuinard, A J; Chwastowski, J J; Chytka, L; Ciapetti, G; Ciftci, A K; Cinca, D; Cindro, V; Cioara, I A; Ciocio, A; Cirotto, F; Citron, Z H; Ciubancan, M; Clark, A; Clark, B L; Clark, P J; Clarke, R N; Clement, C; Coadou, Y; Cobal, M; Coccaro, A; Cochran, J; Coffey, L; Colasurdo, L; Cole, B; Cole, S; Colijn, A P; Collot, J; Colombo, T; Compostella, G; Muiño, P Conde; Coniavitis, E; Connell, S H; Connelly, I A; Consorti, V; Constantinescu, S; Conta, C; Conti, G; Conventi, F; Cooke, M; Cooper, B D; Cooper-Sarkar, A M; Cornelissen, T; Corradi, M; Corriveau, F; Corso-Radu, A; Cortes-Gonzalez, A; Cortiana, G; Costa, G; Costa, M J; Costanzo, D; Cottin, G; Cowan, G; Cox, B E; Cranmer, K; Crawley, S J; Cree, G; Crépé-Renaudin, S; Crescioli, F; Cribbs, W A; Ortuzar, M Crispin; Cristinziani, M; Croft, V; Crosetti, G; Donszelmann, T Cuhadar; Cummings, J; Curatolo, M; Cúth, J; Cuthbert, C; Czirr, H; Czodrowski, P; D'Auria, S; D'Onofrio, M; De Sousa, M J Da Cunha Sargedas; Via, C Da; Dabrowski, W; Dai, T; Dale, O; Dallaire, F; Dallapiccola, C; Dam, M; Dandoy, J R; Dang, N P; Daniells, A C; Dann, N S; Danninger, M; Hoffmann, M Dano; Dao, V; Darbo, G; Darmora, S; Dassoulas, J; Dattagupta, A; Davey, W; David, C; Davidek, T; Davies, M; Davison, P; Davygora, Y; Dawe, E; Dawson, I; Daya-Ishmukhametova, R K; De, K; de Asmundis, R; De Benedetti, A; De Castro, S; De Cecco, S; De Groot, N; de Jong, P; De la Torre, H; De Lorenzi, F; De Pedis, D; De Salvo, A; De Sanctis, U; De Santo, A; De Regie, J B De Vivie; Dearnaley, W J; Debbe, R; Debenedetti, C; Dedovich, D V; Deigaard, I; Del Peso, J; Del Prete, T; Delgove, D; Deliot, F; Delitzsch, C M; Deliyergiyev, M; Dell'Acqua, A; Dell'Asta, L; Dell'Orso, M; Della Pietra, M; Della Volpe, D; Delmastro, M; Delsart, P A; Deluca, C; DeMarco, D A; Demers, S; Demichev, M; Demilly, A; Denisov, S P; Denysiuk, D; Derendarz, D; Derkaoui, J E; Derue, F; Dervan, P; Desch, K; Deterre, C; Dette, K; Deviveiros, P O; Dewhurst, A; Dhaliwal, S; Di Ciaccio, A; Di Ciaccio, L; Di Clemente, W K; Di Domenico, A; Di Donato, C; Di Girolamo, A; Di Girolamo, B; Di Mattia, A; Di Micco, B; Di Nardo, R; Di Simone, A; Di Sipio, R; Di Valentino, D; Diaconu, C; Diamond, M; Dias, F A; Diaz, M A; Diehl, E B; Dietrich, J; Diglio, S; Dimitrievska, A; Dingfelder, J; Dita, P; Dita, S; Dittus, F; Djama, F; Djobava, T; Djuvsland, J I; do Vale, M A B; Dobos, D; Dobre, M; Doglioni, C; Dohmae, T; Dolejsi, J; Dolezal, Z; Dolgoshein, B A; Donadelli, M; Donati, S; Dondero, P; Donini, J; Dopke, J; Doria, A; Dova, M T; Doyle, A T; Drechsler, E; Dris, M; Du, Y; Duarte-Campderros, J; Duchovni, E; Duckeck, G; Ducu, O A; Duda, D; Dudarev, A; Duflot, L; Duguid, L; Dührssen, M; Dunford, M; Yildiz, H Duran; Düren, M; Durglishvili, A; Duschinger, D; Dutta, B; Dyndal, M; Eckardt, C; Ecker, K M; Edgar, R C; Edson, W; Edwards, N C; Eifert, T; Eigen, G; Einsweiler, K; Ekelof, T; Kacimi, M El; Ellajosyula, V; Ellert, M; Elles, S; Ellinghaus, F; Elliot, A A; Ellis, N; Elmsheuser, J; Elsing, M; Emeliyanov, D; Enari, Y; Endner, O C; Endo, M; Ennis, J S; Erdmann, J; Ereditato, A; Ernis, G; Ernst, J; Ernst, M; Errede, S; Ertel, E; Escalier, M; Esch, H; Escobar, C; Esposito, B; Etienvre, A I; Etzion, E; Evans, H; Ezhilov, A; Fabbri, F; Fabbri, L; Facini, G; Fakhrutdinov, R M; Falciano, S; Falla, R J; Faltova, J; Fang, Y; Fanti, M; Farbin, A; Farilla, A; Farina, C; Farooque, T; Farrell, S; Farrington, S M; Farthouat, P; Fassi, F; Fassnacht, P; Fassouliotis, D; Giannelli, M Faucci; Favareto, A; Fawcett, W J; Fayard, L; Fedin, O L; Fedorko, W; Feigl, S; Feligioni, L; Feng, C; Feng, E J; Feng, H; Fenyuk, A B; Feremenga, L; Martinez, P Fernandez; Perez, S Fernandez; Ferrando, J; Ferrari, A; Ferrari, P; Ferrari, R; de Lima, D E Ferreira; Ferrer, A; Ferrere, D; Ferretti, C; Parodi, A Ferretto; Fiedler, F; Filipčič, A; Filipuzzi, M; Filthaut, F; Fincke-Keeler, M; Finelli, K D; Fiolhais, M C N; Fiorini, L; Firan, A; Fischer, A; Fischer, C; Fischer, J; Fisher, W C; Flaschel, N; Fleck, I; Fleischmann, P; Fletcher, G T; Fletcher, G; Fletcher, R R M; Flick, T; Floderus, A; Castillo, L R Flores; Flowerdew, M J; Forcolin, G T; Formica, A; Forti, A; Foster, A G; Fournier, D; Fox, H; Fracchia, S; Francavilla, P; Franchini, M; Francis, D; Franconi, L; Franklin, M; Frate, M; Fraternali, M; Freeborn, D; Fressard-Batraneanu, S M; Friedrich, F; Froidevaux, D; Frost, J A; Fukunaga, C; Torregrosa, E Fullana; Fusayasu, T; Fuster, J; Gabaldon, C; Gabizon, O; Gabrielli, A; Gabrielli, A; Gach, G P; Gadatsch, S; Gadomski, S; Gagliardi, G; Gagnon, L G; Gagnon, P; Galea, C; Galhardo, B; Gallas, E J; Gallop, B J; Gallus, P; Galster, G; Gan, K K; Gao, J; Gao, Y; Gao, Y S; Walls, F M Garay; García, C; Navarro, J E García; Garcia-Sciveres, M; Gardner, R W; Garelli, N; Garonne, V; Bravo, A Gascon; Gatti, C; Gaudiello, A; Gaudio, G; Gaur, B; Gauthier, L; Gavrilenko, I L; Gay, C; Gaycken, G; Gazis, E N; Gecse, Z; Gee, C N P; Geich-Gimbel, Ch; Geisler, M P; Gemme, C; Genest, M H; Geng, C; Gentile, S; George, S; Gerbaudo, D; Gershon, A; Ghasemi, S; Ghazlane, H; Ghneimat, M; Giacobbe, B; Giagu, S; Giannetti, P; Gibbard, B; Gibson, S M; Gignac, M; Gilchriese, M; Gillam, T P S; Gillberg, D; Gilles, G; Gingrich, D M; Giokaris, N; Giordani, M P; Giorgi, F M; Giorgi, F M; Giraud, P F; Giromini, P; Giugni, D; Giuli, F; Giuliani, C; Giulini, M; Gjelsten, B K; Gkaitatzis, S; Gkialas, I; Gkougkousis, E L; Gladilin, L K; Glasman, C; Glatzer, J; Glaysher, P C F; Glazov, A; Goblirsch-Kolb, M; Godlewski, J; Goldfarb, S; Golling, T; Golubkov, D; Gomes, A; Gonçalo, R; Costa, J Goncalves Pinto Firmino Da; Gonella, L; Gongadze, A; de la Hoz, S González; Parra, G Gonzalez; Gonzalez-Sevilla, S; Goossens, L; Gorbounov, P A; Gordon, H A; Gorelov, I; Gorini, B; Gorini, E; Gorišek, A; Gornicki, E; Goshaw, A T; Gössling, C; Gostkin, M I; Goudet, C R; Goujdami, D; Goussiou, A G; Govender, N; Gozani, E; Graber, L; Grabowska-Bold, I; Gradin, P O J; Grafström, P; Gramling, J; Gramstad, E; Grancagnolo, S; Gratchev, V; Gray, H M; Graziani, E; Greenwood, Z D; Grefe, C; Gregersen, K; Gregor, I M; Grenier, P; Grevtsov, K; Griffiths, J; Grillo, A A; Grimm, K; Grinstein, S; Gris, Ph; Grivaz, J-F; Groh, S; Grohs, J P; Gross, E; Grosse-Knetter, J; Grossi, G C; Grout, Z J; Guan, L; Guan, W; Guenther, J; Guescini, F; Guest, D; Gueta, O; Guido, E; Guillemin, T; Guindon, S; Gul, U; Gumpert, C; Guo, J; Guo, Y; Gupta, S; Gustavino, G; Gutierrez, P; Ortiz, N G Gutierrez; Gutschow, C; Guyot, C; Gwenlan, C; Gwilliam, C B; Haas, A; Haber, C; Hadavand, H K; Haddad, N; Hadef, A; Haefner, P; Hageböck, S; Hajduk, Z; Hakobyan, H; Haleem, M; Haley, J; Hall, D; Halladjian, G; Hallewell, G D; Hamacher, K; Hamal, P; Hamano, K; Hamilton, A; Hamity, G N; Hamnett, P G; Han, L; Hanagaki, K; Hanawa, K; Hance, M; Haney, B; Hanke, P; Hanna, R; Hansen, J B; Hansen, J D; Hansen, M C; Hansen, P H; Hara, K; Hard, A S; Harenberg, T; Hariri, F; Harkusha, S; Harrington, R D; Harrison, P F; Hartjes, F; Hasegawa, M; Hasegawa, Y; Hasib, A; Hassani, S; Haug, S; Hauser, R; Hauswald, L; Havranek, M; Hawkes, C M; Hawkings, R J; Hawkins, A D; Hayden, D; Hays, C P; Hays, J M; Hayward, H S; Haywood, S J; Head, S J; Heck, T; Hedberg, V; Heelan, L; Heim, S; Heim, T; Heinemann, B; Heinrich, J J; Heinrich, L; Heinz, C; Hejbal, J; Helary, L; Hellman, S; Helsens, C; Henderson, J; Henderson, R C W; Heng, Y; Henkelmann, S; Correia, A M Henriques; Henrot-Versille, S; Herbert, G H; Jiménez, Y Hernández; Herten, G; Hertenberger, R; Hervas, L; Hesketh, G G; Hessey, N P; Hetherly, J W; Hickling, R; Higón-Rodriguez, E; Hill, E; Hill, J C; Hiller, K H; Hillier, S J; Hinchliffe, I; Hines, E; Hinman, R R; Hirose, M; Hirschbuehl, D; Hobbs, J; Hod, N; Hodgkinson, M C; Hodgson, P; Hoecker, A; Hoeferkamp, M R; Hoenig, F; Hohlfeld, M; Hohn, D; Holmes, T R; Homann, M; Hong, T M; Hooberman, B H; Hopkins, W H; Horii, Y; Horton, A J; Hostachy, J-Y; Hou, S; Hoummada, A; Howard, J; Howarth, J; Hrabovsky, M; Hristova, I; Hrivnac, J; Hryn'ova, T; Hrynevich, A; Hsu, C; Hsu, P J; Hsu, S-C; Hu, D; Hu, Q; Huang, Y; Hubacek, Z; Hubaut, F; Huegging, F; Huffman, T B; Hughes, E W; Hughes, G; Huhtinen, M; Hülsing, T A; Huseynov, N; Huston, J; Huth, J; Iacobucci, G; Iakovidis, G; Ibragimov, I; Iconomidou-Fayard, L; Ideal, E; Idrissi, Z; Iengo, P; Igonkina, O; Iizawa, T; Ikegami, Y; Ikeno, M; Ilchenko, Y; Iliadis, D; Ilic, N; Ince, T; Introzzi, G; Ioannou, P; Iodice, M; Iordanidou, K; Ippolito, V; Quiles, A Irles; Isaksson, C; Ishino, M; Ishitsuka, M; Ishmukhametov, R; Issever, C; Istin, S; Ito, F; Ponce, J M Iturbe; Iuppa, R; Ivarsson, J; Iwanski, W; Iwasaki, H; Izen, J M; Izzo, V; Jabbar, S; Jackson, B; Jackson, M; Jackson, P; Jain, V; Jakobi, K B; Jakobs, K; Jakobsen, S; Jakoubek, T; Jamin, D O; Jana, D K; Jansen, E; Jansky, R; Janssen, J; Janus, M; Jarlskog, G; Javadov, N; Javůrek, T; Jeanneau, F; Jeanty, L; Jejelava, J; Jeng, G-Y; Jennens, D; Jenni, P; Jentzsch, J; Jeske, C; Jézéquel, S; Ji, H; Jia, J; Jiang, H; Jiang, Y; Jiggins, S; Pena, J Jimenez; Jin, S; Jinaru, A; Jinnouchi, O; Johansson, P; Johns, K A; Johnson, W J; Jon-And, K; Jones, G; Jones, R W L; Jones, S; Jones, T J; Jongmanns, J; Jorge, P M; Jovicevic, J; Ju, X; Rozas, A Juste; Köhler, M K; Kaczmarska, A; Kado, M; Kagan, H; Kagan, M; Kahn, S J; Kajomovitz, E; Kalderon, C W; Kaluza, A; Kama, S; Kamenshchikov, A; Kanaya, N; Kaneti, S; Kantserov, V A; Kanzaki, J; Kaplan, B; Kaplan, L S; Kapliy, A; Kar, D; Karakostas, K; Karamaoun, A; Karastathis, N; Kareem, M J; Karentzos, E; Karnevskiy, M; Karpov, S N; Karpova, Z M; Karthik, K; Kartvelishvili, V; Karyukhin, A N; Kasahara, K; Kashif, L; Kass, R D; Kastanas, A; Kataoka, Y; Kato, C; Katre, A; Katzy, J; Kawade, K; Kawagoe, K; Kawamoto, T; Kawamura, G; Kazama, S; Kazanin, V F; Keeler, R; Kehoe, R; Keller, J S; Kempster, J J; Keoshkerian, H; Kepka, O; Kerševan, B P; Kersten, S; Keyes, R A; Khalil-Zada, F; Khandanyan, H; Khanov, A; Kharlamov, A G; Khoo, T J; Khovanskiy, V; Khramov, E; Khubua, J; Kido, S; Kim, H Y; Kim, S H; Kim, Y K; Kimura, N; Kind, O M; King, B T; King, M; King, S B; Kirk, J; Kiryunin, A E; Kishimoto, T; Kisielewska, D; Kiss, F; Kiuchi, K; Kivernyk, O; Kladiva, E; Klein, M H; Klein, M; Klein, U; Kleinknecht, K; Klimek, P; Klimentov, A; Klingenberg, R; Klinger, J A; Klioutchnikova, T; Kluge, E-E; Kluit, P; Kluth, S; Knapik, J; Kneringer, E; Knoops, E B F G; Knue, A; Kobayashi, A; Kobayashi, D; Kobayashi, T; Kobel, M; Kocian, M; Kodys, P; Koffas, T; Koffeman, E; Kogan, L A; Kohriki, T; Koi, T; Kolanoski, H; Kolb, M; Koletsou, I; Komar, A A; Komori, Y; Kondo, T; Kondrashova, N; Köneke, K; König, A C; Kono, T; Konoplich, R; Konstantinidis, N; Kopeliansky, R; Koperny, S; Köpke, L; Kopp, A K; Korcyl, K; Kordas, K; Korn, A; Korol, A A; Korolkov, I; Korolkova, E V; Kortner, O; Kortner, S; Kosek, T; Kostyukhin, V V; Kotov, V M; Kotwal, A; Kourkoumeli-Charalampidi, A; Kourkoumelis, C; Kouskoura, V; Koutsman, A; Kowalewska, A B; Kowalewski, R; Kowalski, T Z; Kozanecki, W; Kozhin, A S; Kramarenko, V A; Kramberger, G; Krasnopevtsev, D; Krasny, M W; Krasznahorkay, A; Kraus, J K; Kravchenko, A; Kretz, M; Kretzschmar, J; Kreutzfeldt, K; Krieger, P; Krizka, K; Kroeninger, K; Kroha, H; Kroll, J; Kroseberg, J; Krstic, J; Kruchonak, U; Krüger, H; Krumnack, N; Kruse, A; Kruse, M C; Kruskal, M; Kubota, T; Kucuk, H; Kuday, S; Kuechler, J T; Kuehn, S; Kugel, A; Kuger, F; Kuhl, A; Kuhl, T; Kukhtin, V; Kukla, R; Kulchitsky, Y; Kuleshov, S; Kuna, M; Kunigo, T; Kupco, A; Kurashige, H; Kurochkin, Y A; Kus, V; Kuwertz, E S; Kuze, M; Kvita, J; Kwan, T; Kyriazopoulos, D; Rosa, A La; Navarro, J L La Rosa; Rotonda, L La; Lacasta, C; Lacava, F; Lacey, J; Lacker, H; Lacour, D; Lacuesta, V R; Ladygin, E; Lafaye, R; Laforge, B; Lagouri, T; Lai, S; Lammers, S; Lampl, W; Lançon, E; Landgraf, U; Landon, M P J; Lang, V S; Lange, J C; Lankford, A J; Lanni, F; Lantzsch, K; Lanza, A; Laplace, S; Lapoire, C; Laporte, J F; Lari, T; Manghi, F Lasagni; Lassnig, M; Laurelli, P; Lavrijsen, W; Law, A T; Laycock, P; Lazovich, T; Lazzaroni, M; Dortz, O Le; Guirriec, E Le; Menedeu, E Le; Quilleuc, E P Le; LeBlanc, M; LeCompte, T; Ledroit-Guillon, F; Lee, C A; Lee, S C; Lee, L; Lefebvre, G; Lefebvre, M; Legger, F; Leggett, C; Lehan, A; Miotto, G Lehmann; Lei, X; Leight, W A; Leisos, A; Leister, A G; Leite, M A L; Leitner, R; Lellouch, D; Lemmer, B; Leney, K J C; Lenz, T; Lenzi, B; Leone, R; Leone, S; Leonidopoulos, C; Leontsinis, S; Lerner, G; Leroy, C; Lesage, A A J; Lester, C G; Levchenko, M; Levêque, J; Levin, D; Levinson, L J; Levy, M; Leyko, A M; Leyton, M; Li, B; Li, H; Li, H L; Li, L; Li, L; Li, Q; Li, S; Li, X; Li, Y; Liang, Z; Liao, H; Liberti, B; Liblong, A; Lichard, P; Lie, K; Liebal, J; Liebig, W; Limbach, C; Limosani, A; Lin, S C; Lin, T H; Lindquist, B E; Lipeles, E; Lipniacka, A; Lisovyi, M; Liss, T M; Lissauer, D; Lister, A; Litke, A M; Liu, B; Liu, D; Liu, H; Liu, H; Liu, J; Liu, J B; Liu, K; Liu, L; Liu, M; Liu, M; Liu, Y L; Liu, Y; Livan, M; Lleres, A; Merino, J Llorente; Lloyd, S L; Sterzo, F Lo; Lobodzinska, E; Loch, P; Lockman, W S; Loebinger, F K; Loevschall-Jensen, A E; Loew, K M; Loginov, A; Lohse, T; Lohwasser, K; Lokajicek, M; Long, B A; Long, J D; Long, R E; Longo, L; Looper, K A; Lopes, L; Mateos, D Lopez; Paredes, B Lopez; Paz, I Lopez; Solis, A Lopez; Lorenz, J; Martinez, N Lorenzo; Losada, M; Lösel, P J; Lou, X; Lounis, A; Love, J; Love, P A; Lu, H; Lu, N; Lubatti, H J; Luci, C; Lucotte, A; Luedtke, C; Luehring, F; Lukas, W; Luminari, L; Lundberg, O; Lund-Jensen, B; Lynn, D; Lysak, R; Lytken, E; Lyubushkin, V; Ma, H; Ma, L L; Ma, Y; Maccarrone, G; Macchiolo, A; Macdonald, C M; Maček, B; Miguens, J Machado; Madaffari, D; Madar, R; Maddocks, H J; Mader, W F; Madsen, A; Maeda, J; Maeland, S; Maeno, T; Maevskiy, A; Magradze, E; Mahlstedt, J; Maiani, C; Maidantchik, C; Maier, A A; Maier, T; Maio, A; Majewski, S; Makida, Y; Makovec, N; Malaescu, B; Malecki, Pa; Maleev, V P; Malek, F; Mallik, U; Malon, D; Malone, C; Maltezos, S; Malyshev, V M; Malyukov, S; Mamuzic, J; Mancini, G; Mandelli, B; Mandelli, L; Mandić, I; Maneira, J; Andrade Filho, L Manhaes de; Ramos, J Manjarres; Mann, A; Mansoulie, B; Mantifel, R; Mantoani, M; Manzoni, S; Mapelli, L; Marceca, G; March, L; Marchiori, G; Marcisovsky, M; Marjanovic, M; Marley, D E; Marroquim, F; Marsden, S P; Marshall, Z; Marti, L F; Marti-Garcia, S; Martin, B; Martin, T A; Martin, V J; Latour, B Martin Dit; Martinez, M; Martin-Haugh, S; Martoiu, V S; Martyniuk, A C; Marx, M; Marzano, F; Marzin, A; Masetti, L; Mashimo, T; Mashinistov, R; Masik, J; Maslennikov, A L; Massa, I; Massa, L; Mastrandrea, P; Mastroberardino, A; Masubuchi, T; Mättig, P; Mattmann, J; Maurer, J; Maxfield, S J; Maximov, D A; Mazini, R; Mazza, S M; Fadden, N C Mc; Goldrick, G Mc; Kee, S P Mc; McCarn, A; McCarthy, R L; McCarthy, T G; McClymont, L I; McFarlane, K W; Mcfayden, J A; Mchedlidze, G; McMahon, S J; McPherson, R A; Medinnis, M; Meehan, S; Mehlhase, S; Mehta, A; Meier, K; Meineck, C; Meirose, B; Garcia, B R Mellado; Meloni, F; Mengarelli, A; Menke, S; Meoni, E; Mercurio, K M; Mergelmeyer, S; Mermod, P; Merola, L; Meroni, C; Merritt, F S; Messina, A; Metcalfe, J; Mete, A S; Meyer, C; Meyer, C; Meyer, J-P; Meyer, J; Theenhausen, H Meyer Zu; Middleton, R P; Miglioranzi, S; Mijović, L; Mikenberg, G; Mikestikova, M; Mikuž, M; Milesi, M; Milic, A; Miller, D W; Mills, C; Milov, A; Milstead, D A; Minaenko, A A; Minami, Y; Minashvili, I A; Mincer, A I; Mindur, B; Mineev, M; Ming, Y; Mir, L M; Mistry, K P; Mitani, T; Mitrevski, J; Mitsou, V A; Miucci, A; Miyagawa, P S; Mjörnmark, J U; Moa, T; Mochizuki, K; Mohapatra, S; Mohr, W; Molander, S; Moles-Valls, R; Monden, R; Mondragon, M C; Mönig, K; Monk, J; Monnier, E; Montalbano, A; Berlingen, J Montejo; Monticelli, F; Monzani, S; Moore, R W; Morange, N; Moreno, D; Llácer, M Moreno; Morettini, P; Mori, D; Mori, T; Morii, M; Morinaga, M; Morisbak, V; Moritz, S; Morley, A K; Mornacchi, G; Morris, J D; Mortensen, S S; Morvaj, L; Mosidze, M; Moss, J; Motohashi, K; Mount, R; Mountricha, E; Mouraviev, S V; Moyse, E J W; Muanza, S; Mudd, R D; Mueller, F; Mueller, J; Mueller, R S P; Mueller, T; Muenstermann, D; Mullen, P; Mullier, G A; Sanchez, F J Munoz; Quijada, J A Murillo; Murray, W J; Murrone, A; Musheghyan, H; Muskinja, M; Myagkov, A G; Myska, M; Nachman, B P; Nackenhorst, O; Nadal, J; Nagai, K; Nagai, R; Nagano, K; Nagasaka, Y; Nagata, K; Nagel, M; Nagy, E; Nairz, A M; Nakahama, Y; Nakamura, K; Nakamura, T; Nakano, I; Namasivayam, H; Garcia, R F Naranjo; Narayan, R; Villar, D I Narrias; Naryshkin, I; Naumann, T; Navarro, G; Nayyar, R; Neal, H A; Nechaeva, P Yu; Neep, T J; Nef, P D; Negri, A; Negrini, M; Nektarijevic, S; Nellist, C; Nelson, A; Nemecek, S; Nemethy, P; Nepomuceno, A A; Nessi, M; Neubauer, M S; Neumann, M; Neves, R M; Nevski, P; Newman, P R; Nguyen, D H; Nickerson, R B; Nicolaidou, R; Nicquevert, B; Nielsen, J; Nikiforov, A; Nikolaenko, V; Nikolic-Audit, I; Nikolopoulos, K; Nilsen, J K; Nilsson, P; Ninomiya, Y; Nisati, A; Nisius, R; Nobe, T; Nodulman, L; Nomachi, M; Nomidis, I; Nooney, T; Norberg, S; Nordberg, M; Norjoharuddeen, N; Novgorodova, O; Nowak, S; Nozaki, M; Nozka, L; Ntekas, K; Nurse, E; Nuti, F; O'grady, F; O'Neil, D C; O'Rourke, A A; O'Shea, V; Oakham, F G; Oberlack, H; Obermann, T; Ocariz, J; Ochi, A; Ochoa, I; Ochoa-Ricoux, J P; Oda, S; Odaka, S; Ogren, H; Oh, A; Oh, S H; Ohm, C C; Ohman, H; Oide, H; Okawa, H; Okumura, Y; Okuyama, T; Olariu, A; Seabra, L F Oleiro; Pino, S A Olivares; Damazio, D Oliveira; Olszewski, A; Olszowska, J; Onofre, A; Onogi, K; Onyisi, P U E; Oram, C J; Oreglia, M J; Oren, Y; Orestano, D; Orlando, N; Orr, R S; Osculati, B; Ospanov, R; Garzon, G Otero Y; Otono, H; Ouchrif, M; Ould-Saada, F; Ouraou, A; Oussoren, K P; Ouyang, Q; Ovcharova, A; Owen, M; Owen, R E; Ozcan, V E; Ozturk, N; Pachal, K; Pages, A Pacheco; Aranda, C Padilla; Pagáčová, M; Griso, S Pagan; Paige, F; Pais, P; Pajchel, K; Palacino, G; Palestini, S; Palka, M; Pallin, D; Palma, A; Panagiotopoulou, E St; Pandini, C E; Vazquez, J G Panduro; Pani, P; Panitkin, S; Pantea, D; Paolozzi, L; Papadopoulou, Th D; Papageorgiou, K; Paramonov, A; Hernandez, D Paredes; Parker, A J; Parker, M A; Parker, K A; Parodi, F; Parsons, J A; Parzefall, U; Pascuzzi, V; Pasqualucci, E; Passaggio, S; Pastore, F; Pastore, Fr; Pásztor, G; Pataraia, S; Patel, N D; Pater, J R; Pauly, T; Pearce, J; Pearson, B; Pedersen, L E; Pedersen, M; Lopez, S Pedraza; Pedro, R; Peleganchuk, S V; Pelikan, D; Penc, O; Peng, C; Peng, H; Penwell, J; Peralva, B S; Perego, M M; Perepelitsa, D V; Codina, E Perez; Perini, L; Pernegger, H; Perrella, S; Peschke, R; Peshekhonov, V D; Peters, K; Peters, R F Y; Petersen, B A; Petersen, T C; Petit, E; Petridis, A; Petridou, C; Petroff, P; Petrolo, E; Petrov, M; Petrucci, F; Pettersson, N E; Peyaud, A; Pezoa, R; Phillips, P W; Piacquadio, G; Pianori, E; Picazio, A; Piccaro, E; Piccinini, M; Pickering, M A; Piegaia, R; Pilcher, J E; Pilkington, A D; Pin, A W J; Pina, J; Pinamonti, M; Pinfold, J L; Pingel, A; Pires, S; Pirumov, H; Pitt, M; Plazak, L; Pleier, M-A; Pleskot, V; Plotnikova, E; Plucinski, P; Pluth, D; Poettgen, R; Poggioli, L; Pohl, D; Polesello, G; Poley, A; Policicchio, A; Polifka, R; Polini, A; Pollard, C S; Polychronakos, V; Pommès, K; Pontecorvo, L; Pope, B G; Popeneciu, G A; Popovic, D S; Poppleton, A; Pospisil, S; Potamianos, K; Potrap, I N; Potter, C J; Potter, C T; Poulard, G; Poveda, J; Pozdnyakov, V; Astigarraga, M E Pozo; Pralavorio, P; Pranko, A; Prell, S; Price, D; Price, L E; Primavera, M; Prince, S; Proissl, M; Prokofiev, K; Prokoshin, F; Protopopescu, S; Proudfoot, J; Przybycien, M; Puddu, D; Puldon, D; Purohit, M; Puzo, P; Qian, J; Qin, G; Qin, Y; Quadt, A; Quayle, W B; Queitsch-Maitland, M; Quilty, D; Raddum, S; Radeka, V; Radescu, V; Radhakrishnan, S K; Radloff, P; Rados, P; Ragusa, F; Rahal, G; Raine, J A; Rajagopalan, S; Rammensee, M; Rangel-Smith, C; Ratti, M G; Rauscher, F; Rave, S; Ravenscroft, T; Raymond, M; Read, A L; Readioff, N P; Rebuzzi, D M; Redelbach, A; Redlinger, G; Reece, R; Reeves, K; Rehnisch, L; Reichert, J; Reisin, H; Rembser, C; Ren, H; Rescigno, M; Resconi, S; Rezanova, O L; Reznicek, P; Rezvani, R; Richter, R; Richter, S; Richter-Was, E; Ricken, O; Ridel, M; Rieck, P; Riegel, C J; Rieger, J; Rifki, O; Rijssenbeek, M; Rimoldi, A; Rinaldi, L; Ristić, B; Ritsch, E; Riu, I; Rizatdinova, F; Rizvi, E; Rizzi, C; Robertson, S H; Robichaud-Veronneau, A; Robinson, D; Robinson, J E M; Robson, A; Roda, C; Rodina, Y; Perez, A Rodriguez; Rodriguez, D Rodriguez; Roe, S; Rogan, C S; Røhne, O; Romaniouk, A; Romano, M; Saez, S M Romano; Adam, E Romero; Rompotis, N; Ronzani, M; Roos, L; Ros, E; Rosati, S; Rosbach, K; Rose, P; Rosenthal, O; Rossetti, V; Rossi, E; Rossi, L P; Rosten, J H N; Rosten, R; Rotaru, M; Roth, I; Rothberg, J; Rousseau, D; Royon, C R; Rozanov, A; Rozen, Y; Ruan, X; Rubbo, F; Rubinskiy, I; Rud, V I; Rudolph, M S; Rühr, F; Ruiz-Martinez, A; Rurikova, Z; Rusakovich, N A; Ruschke, A; Russell, H L; Rutherfoord, J P; Ruthmann, N; Ryabov, Y F; Rybar, M; Rybkin, G; Ryu, S; Ryzhov, A; Saavedra, A F; Sabato, G; Sacerdoti, S; Sadrozinski, H F-W; Sadykov, R; Tehrani, F Safai; Saha, P; Sahinsoy, M; Saimpert, M; Saito, T; Sakamoto, H; Sakurai, Y; Salamanna, G; Salamon, A; Loyola, J E Salazar; Salek, D; De Bruin, P H Sales; Salihagic, D; Salnikov, A; Salt, J; Salvatore, D; Salvatore, F; Salvucci, A; Salzburger, A; Sammel, D; Sampsonidis, D; Sanchez, A; Sánchez, J; Martinez, V Sanchez; Sandaker, H; Sandbach, R L; Sander, H G; Sanders, M P; Sandhoff, M; Sandoval, C; Sandstroem, R; Sankey, D P C; Sannino, M; Sansoni, A; Santoni, C; Santonico, R; Santos, H; Castillo, I Santoyo; Sapp, K; Sapronov, A; Saraiva, J G; Sarrazin, B; Sasaki, O; Sasaki, Y; Sato, K; Sauvage, G; Sauvan, E; Savage, G; Savard, P; Sawyer, C; Sawyer, L; Saxon, J; Sbarra, C; Sbrizzi, A; Scanlon, T; Scannicchio, D A; Scarcella, M; Scarfone, V; Schaarschmidt, J; Schacht, P; Schaefer, D; Schaefer, R; Schaeffer, J; Schaepe, S; Schaetzel, S; Schäfer, U; Schaffer, A C; Schaile, D; Schamberger, R D; Scharf, V; Schegelsky, V A; Scheirich, D; Schernau, M; Schiavi, C; Schillo, C; Schioppa, M; Schlenker, S; Schmieden, K; Schmitt, C; Schmitt, S; Schmitz, S; Schneider, B; Schnellbach, Y J; Schnoor, U; Schoeffel, L; Schoening, A; Schoenrock, B D; Schopf, E; Schorlemmer, A L S; Schott, M; Schovancova, J; Schramm, S; Schreyer, M; Schuh, N; Schultens, M J; Schultz-Coulon, H-C; Schulz, H; Schumacher, M; Schumm, B A; Schune, Ph; Schwanenberger, C; Schwartzman, A; Schwarz, T A; Schwegler, Ph; Schweiger, H; Schwemling, Ph; Schwienhorst, R; Schwindling, J; Schwindt, T; Sciolla, G; Scuri, F; Scutti, F; Searcy, J; Seema, P; Seidel, S C; Seiden, A; Seifert, F; Seixas, J M; Sekhniaidze, G; Sekhon, K; Sekula, S J; Seliverstov, D M; Semprini-Cesari, N; Serfon, C; Serin, L; Serkin, L; Sessa, M; Seuster, R; Severini, H; Sfiligoj, T; Sforza, F; Sfyrla, A; Shabalina, E; Shaikh, N W; Shan, L Y; Shang, R; Shank, J T; Shapiro, M; Shatalov, P B; Shaw, K; Shaw, S M; Shcherbakova, A; Shehu, C Y; Sherwood, P; Shi, L; Shimizu, S; Shimmin, C O; Shimojima, M; Shiyakova, M; Shmeleva, A; Saadi, D Shoaleh; Shochet, M J; Shojaii, S; Shrestha, S; Shulga, E; Shupe, M A; Sicho, P; Sidebo, P E; Sidiropoulou, O; Sidorov, D; Sidoti, A; Siegert, F; Sijacki, Dj; Silva, J; Silverstein, S B; Simak, V; Simard, O; Simic, Lj; Simion, S; Simioni, E; Simmons, B; Simon, D; Simon, M; Sinervo, P; Sinev, N B; Sioli, M; Siragusa, G; Sivoklokov, S Yu; Sjölin, J; Sjursen, T B; Skinner, M B; Skottowe, H P; Skubic, P; Slater, M; Slavicek, T; Slawinska, M; Sliwa, K; Slovak, R; Smakhtin, V; Smart, B H; Smestad, L; Smirnov, S Yu; Smirnov, Y; Smirnova, L N; Smirnova, O; Smith, M N K; Smith, R W; Smizanska, M; Smolek, K; Snesarev, A A; Snidero, G; Snyder, S; Sobie, R; Socher, F; Soffer, A; Soh, D A; Sokhrannyi, G; Sanchez, C A Solans; Solar, M; Soldatov, E Yu; Soldevila, U; Solodkov, A A; Soloshenko, A; Solovyanov, O V; Solovyev, V; Sommer, P; Son, H; Song, H Y; Sood, A; Sopczak, A; Sopko, V; Sorin, V; Sosa, D; Sotiropoulou, C L; Soualah, R; Soukharev, A M; South, D; Sowden, B C; Spagnolo, S; Spalla, M; Spangenberg, M; Spanò, F; Sperlich, D; Spettel, F; Spighi, R; Spigo, G; Spiller, L A; Spousta, M; Denis, R D St; Stabile, A; Staerz, S; Stahlman, J; Stamen, R; Stamm, S; Stanecka, E; Stanek, R W; Stanescu, C; Stanescu-Bellu, M; Stanitzki, M M; Stapnes, S; Starchenko, E A; Stark, G H; Stark, J; Staroba, P; Starovoitov, P; Staszewski, R; Steinberg, P; Stelzer, B; Stelzer, H J; Stelzer-Chilton, O; Stenzel, H; Stewart, G A; Stillings, J A; Stockton, M C; Stoebe, M; Stoicea, G; Stolte, P; Stonjek, S; Stradling, A R; Straessner, A; Stramaglia, M E; Strandberg, J; Strandberg, S; Strandlie, A; Strauss, M; Strizenec, P; Ströhmer, R; Strom, D M; Stroynowski, R; Strubig, A; Stucci, S A; Stugu, B; Styles, N A; Su, D; Su, J; Subramaniam, R; Suchek, S; Sugaya, Y; Suk, M; Sulin, V V; Sultansoy, S; Sumida, T; Sun, S; Sun, X; Sundermann, J E; Suruliz, K; Susinno, G; Sutton, M R; Suzuki, S; Svatos, M; Swiatlowski, M; Sykora, I; Sykora, T; Ta, D; Taccini, C; Tackmann, K; Taenzer, J; Taffard, A; Tafirout, R; Taiblum, N; Takai, H; Takashima, R; Takeda, H; Takeshita, T; Takubo, Y; Talby, M; Talyshev, A A; Tam, J Y C; Tan, K G; Tanaka, J; Tanaka, R; Tanaka, S; Tannenwald, B B; Araya, S Tapia; Tapprogge, S; Tarem, S; Tartarelli, G F; Tas, P; Tasevsky, M; Tashiro, T; Tassi, E; Delgado, A Tavares; Tayalati, Y; Taylor, A C; Taylor, G N; Taylor, P T E; Taylor, W; Teischinger, F A; Teixeira-Dias, P; Temming, K K; Temple, D; Kate, H Ten; Teng, P K; Teoh, J J; Tepel, F; Terada, S; Terashi, K; Terron, J; Terzo, S; Testa, M; Teuscher, R J; Theveneaux-Pelzer, T; Thomas, J P; Thomas-Wilsker, J; Thompson, E N; Thompson, P D; Thompson, R J; Thompson, A S; Thomsen, L A; Thomson, E; Thomson, M; Tibbetts, M J; Torres, R E Ticse; Tikhomirov, V O; Tikhonov, Yu A; Timoshenko, S; Tipton, P; Tisserant, S; Todome, K; Todorov, T; Todorova-Nova, S; Tojo, J; Tokár, S; Tokushuku, K; Tolley, E; Tomlinson, L; Tomoto, M; Tompkins, L; Toms, K; Tong, B; Torrence, E; Torres, H; Pastor, E Torró; Toth, J; Touchard, F; Tovey, D R; Trefzger, T; Tremblet, L; Tricoli, A; Trigger, I M; Trincaz-Duvoid, S; Tripiana, M F; Trischuk, W; Trocmé, B; Trofymov, A; Troncon, C; Trottier-McDonald, M; Trovatelli, M; Truong, L; Trzebinski, M; Trzupek, A; Tseng, J C-L; Tsiareshka, P V; Tsipolitis, G; Tsirintanis, N; Tsiskaridze, S; Tsiskaridze, V; Tskhadadze, E G; Tsui, K M; Tsukerman, I I; Tsulaia, V; Tsuno, S; Tsybychev, D; Tudorache, A; Tudorache, V; Tuna, A N; Tupputi, S A; Turchikhin, S; Turecek, D; Turgeman, D; Turra, R; Turvey, A J; Tuts, P M; Tyndel, M; Ucchielli, G; Ueda, I; Ueno, R; Ughetto, M; Ukegawa, F; Unal, G; Undrus, A; Unel, G; Ungaro, F C; Unno, Y; Unverdorben, C; Urban, J; Urquijo, P; Urrejola, P; Usai, G; Usanova, A; Vacavant, L; Vacek, V; Vachon, B; Valderanis, C; Santurio, E Valdes; Valencic, N; Valentinetti, S; Valero, A; Valery, L; Valkar, S; Vallecorsa, S; Ferrer, J A Valls; Van Den Wollenberg, W; Van Der Deijl, P C; van der Geer, R; van der Graaf, H; van Eldik, N; van Gemmeren, P; Van Nieuwkoop, J; van Vulpen, I; van Woerden, M C; Vanadia, M; Vandelli, W; Vanguri, R; Vaniachine, A; Vankov, P; Vardanyan, G; Vari, R; Varnes, E W; Varol, T; Varouchas, D; Vartapetian, A; Varvell, K E; Vasquez, J G; Vazeille, F; Schroeder, T Vazquez; Veatch, J; Veloce, L M; Veloso, F; Veneziano, S; Ventura, A; Venturi, M; Venturi, N; Venturini, A; Vercesi, V; Verducci, M; Verkerke, W; Vermeulen, J C; Vest, A; Vetterli, M C; Viazlo, O; Vichou, I; Vickey, T; Boeriu, O E Vickey; Viehhauser, G H A; Viel, S; Vigani, L; Vigne, R; Villa, M; Perez, M Villaplana; Vilucchi, E; Vincter, M G; Vinogradov, V B; Vittori, C; Vivarelli, I; Vlachos, S; Vlasak, M; Vogel, M; Vokac, P; Volpi, G; Volpi, M; von der Schmitt, H; von Toerne, E; Vorobel, V; Vorobev, K; Vos, M; Voss, R; Vossebeld, J H; Vranjes, N; Milosavljevic, M Vranjes; Vrba, V; Vreeswijk, M; Vuillermet, R; Vukotic, I; Vykydal, Z; Wagner, P; Wagner, W; Wahlberg, H; Wahrmund, S; Wakabayashi, J; Walder, J; Walker, R; Walkowiak, W; Wallangen, V; Wang, C; Wang, C; Wang, F; Wang, H; Wang, H; Wang, J; Wang, J; Wang, K; Wang, R; Wang, S M; Wang, T; Wang, T; Wang, X; Wanotayaroj, C; Warburton, A; Ward, C P; Wardrope, D R; Washbrook, A; Watkins, P M; Watson, A T; Watson, I J; Watson, M F; Watts, G; Watts, S; Waugh, B M; Webb, S; Weber, M S; Weber, S W; Webster, J S; Weidberg, A R; Weinert, B; Weingarten, J; Weiser, C; Weits, H; Wells, P S; Wenaus, T; Wengler, T; Wenig, S; Wermes, N; Werner, M; Werner, P; Wessels, M; Wetter, J; Whalen, K; Whallon, N L; Wharton, A M; White, A; White, M J; White, R; White, S; Whiteson, D; Wickens, F J; Wiedenmann, W; Wielers, M; Wienemann, P; Wiglesworth, C; Wiik-Fuchs, L A M; Wildauer, A; Wilk, F; Wilkens, H G; Williams, H H; Williams, S; Willis, C; Willocq, S; Wilson, J A; Wingerter-Seez, I; Winklmeier, F; Winston, O J; Winter, B T; Wittgen, M; Wittkowski, J; Wollstadt, S J; Wolter, M W; Wolters, H; Wosiek, B K; Wotschack, J; Woudstra, M J; Wozniak, K W; Wu, M; Wu, M; Wu, S L; Wu, X; Wu, Y; Wyatt, T R; Wynne, B M; Xella, S; Xu, D; Xu, L; Yabsley, B; Yacoob, S; Yakabe, R; Yamaguchi, D; Yamaguchi, Y; Yamamoto, A; Yamamoto, S; Yamanaka, T; Yamauchi, K; Yamazaki, Y; Yan, Z; Yang, H; Yang, H; Yang, Y; Yang, Z; Yao, W-M; Yap, Y C; Yasu, Y; Yatsenko, E; Wong, K H Yau; Ye, J; Ye, S; Yeletskikh, I; Yen, A L; Yildirim, E; Yorita, K; Yoshida, R; Yoshihara, K; Young, C; Young, C J S; Youssef, S; Yu, D R; Yu, J; Yu, J M; Yu, J; Yuan, L; Yuen, S P Y; Yusuff, I; Zabinski, B; Zaidan, R; Zaitsev, A M; Zakharchuk, N; Zalieckas, J; Zaman, A; Zambito, S; Zanello, L; Zanzi, D; Zeitnitz, C; Zeman, M; Zemla, A; Zeng, J C; Zeng, Q; Zengel, K; Zenin, O; Ženiš, T; Zerwas, D; Zhang, D; Zhang, F; Zhang, G; Zhang, H; Zhang, J; Zhang, L; Zhang, R; Zhang, R; Zhang, X; Zhang, Z; Zhao, X; Zhao, Y; Zhao, Z; Zhemchugov, A; Zhong, J; Zhou, B; Zhou, C; Zhou, L; Zhou, L; Zhou, M; Zhou, N; Zhu, C G; Zhu, H; Zhu, J; Zhu, Y; Zhuang, X; Zhukov, K; Zibell, A; Zieminska, D; Zimine, N I; Zimmermann, C; Zimmermann, S; Zinonos, Z; Zinser, M; Ziolkowski, M; Živković, L; Zobernig, G; Zoccoli, A; Nedden, M Zur; Zurzolo, G; Zwalinski, L
2016-01-01
A test of CP invariance in Higgs boson production via vector-boson fusion using the method of the Optimal Observable is presented. The analysis exploits the decay mode of the Higgs boson into a pair of [Formula: see text] leptons and is based on 20.3 [Formula: see text] of proton-proton collision data at [Formula: see text] = 8 [Formula: see text] collected by the ATLAS experiment at the LHC. Contributions from CP-violating interactions between the Higgs boson and electroweak gauge bosons are described in an effective field theory framework, in which the strength of CP violation is governed by a single parameter [Formula: see text]. The mean values and distributions of CP-odd observables agree with the expectation in the Standard Model and show no sign of CP violation. The CP-mixing parameter [Formula: see text] is constrained to the interval [Formula: see text] at 68% confidence level, consistent with the Standard Model expectation of [Formula: see text].
Energy Technology Data Exchange (ETDEWEB)
Aad, G. [CPPM, Aix-Marseille Univ. et CNRS/IN2P3, Marseille (France); Abbott, B. [Oklahoma Univ., Norman, OK (United States). Homer L. Dodge Dept. of Physics and Astronomy; Abdinov, O. [Azerbaijan Academy of Sciences, Baku (Azerbaijan). Inst. of Physics; Collaboration: ATLAS Collaboration; and others
2016-12-15
A test of CP invariance in Higgs boson production via vector-boson fusion using the method of the Optimal Observable is presented. The analysis exploits the decay mode of the Higgs boson into a pair of τ leptons and is based on 20.3 fb{sup -1} of proton-proton collision data at √(s) = 8 TeV collected by the ATLAS experiment at the LHC. Contributions from CP-violating interactions between the Higgs boson and electroweak gauge bosons are described in an effective field theory framework, in which the strength of CP violation is governed by a single parameter d. The mean values and distributions of CP-odd observables agree with the expectation in the Standard Model and show no sign of CP violation. The CP-mixing parameter d is constrained to the interval (-0.11, 0.05) at 68% confidence level, consistent with the Standard Model expectation of d = 0. (orig.)
Aad, Georges; Abdallah, Jalal; Abdinov, Ovsat; Abeloos, Baptiste; Aben, Rosemarie; Abolins, Maris; AbouZeid, Ossama; Abraham, Nicola; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Affolder, Tony; Agatonovic-Jovin, Tatjana; Agricola, Johannes; Aguilar-Saavedra, Juan Antonio; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alison, John; Alkire, Steven Patrick; Allbrooke, Benedict; Allen, Benjamin William; Allport, Phillip; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Alvarez Gonzalez, Barbara; Άlvarez Piqueras, Damián; Alviggi, Mariagrazia; Amadio, Brian Thomas; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anders, John Kenneth; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Arabidze, Giorgi; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arduh, Francisco Anuar; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Armitage, Lewis James; Arnaez, Olivier; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Artz, Sebastian; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Augsten, Kamil; Avolio, Giuseppe; Axen, Bradley; Ayoub, Mohamad Kassem; Azuelos, Georges; Baak, Max; Baas, Alessandra; Baca, Matthew John; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Baines, John; Baker, Oliver Keith; Baldin, Evgenii; Balek, Petr; Balestri, Thomas; Balli, Fabrice; Balunas, William Keaton; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Barak, Liron; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnes, Sarah Louise; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barranco Navarro, Laura; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Basalaev, Artem; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batista, Santiago Juan; Batley, Richard; Battaglia, Marco; Bauce, Matteo; Bauer, Florian; Bawa, Harinder Singh; Beacham, James Baker; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Bechtle, Philip; Beck, Hans~Peter; Becker, Kathrin; Becker, Maurice; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bednyakov, Vadim; Bedognetti, Matteo; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Janna Katharina; Belanger-Champagne, Camille; Bell, Andrew Stuart; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Belyaev, Nikita; Benary, Odette; Benchekroun, Driss; Bender, Michael; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez, Jose; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Bentvelsen, Stan; Beresford, Lydia; Beretta, Matteo; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Beringer, Jürg; Berlendis, Simon; Bernard, Nathan Rogers; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertram, Iain Alexander; Bertsche, Carolyn; Bertsche, David; Besjes, Geert-Jan; Bessidskaia Bylund, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bevan, Adrian John; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Biedermann, Dustin; Bielski, Rafal; Biesuz, Nicolo Vladi; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Biondi, Silvia; Bjergaard, David Martin; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blanco, Jacobo Ezequiel; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Blunier, Sylvain; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Bock, Christopher; Boehler, Michael; Boerner, Daniela; Bogaerts, Joannes Andreas; Bogavac, Danijela; Bogdanchikov, Alexander; Bohm, Christian; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Bortfeldt, Jonathan; Bortoletto, Daniela; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Bossio Sola, Jonathan David; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Boutle, Sarah Kate; Boveia, Antonio; Boyd, James; Boyko, Igor; Bracinik, Juraj; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Breaden Madden, William Dmitri; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Lydia; Brenner, Richard; Bressler, Shikma; Bristow, Timothy Michael; Britton, Dave; Britzger, Daniel; Brochu, Frederic; Brock, Ian; Brock, Raymond; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Broughton, James; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Bruni, Alessia; Bruni, Graziano; Brunt, Benjamin; Bruschi, Marco; Bruscino, Nello; Bryant, Patrick; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Buchholz, Peter; Buckley, Andrew; Budagov, Ioulian; Buehrer, Felix; Bugge, Magnar Kopangen; Bulekov, Oleg; Bullock, Daniel; Burckhart, Helfried; Burdin, Sergey; Burgard, Carsten Daniel; Burghgrave, Blake; Burka, Klaudia; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Buzykaev, Aleksey; Cabrera Urbán, Susana; Caforio, Davide; Cairo, Valentina; Cakir, Orhan; Calace, Noemi; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Caloba, Luiz; Calvet, David; Calvet, Samuel; Calvet, Thomas Philippe; Camacho Toro, Reina; Camarda, Stefano; Camarri, Paolo; Cameron, David; Caminal Armadans, Roger; Camincher, Clement; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Carbone, Ryne Michael; Cardarelli, Roberto; Cardillo, Fabio; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Casolino, Mirkoantonio; Casper, David William; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Caudron, Julien; Cavaliere, Viviana; Cavallaro, Emanuele; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerda Alberich, Leonor; Cerio, Benjamin; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chan, Stephen Kam-wah; Chan, Yat Long; Chang, Philip; Chapman, John Derek; Charlton, Dave; Chatterjee, Avishek; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Che, Siinn; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Shenjian; Chen, Shion; Chen, Xin; Chen, Ye; Cheng, Hok Chuen; Cheng, Huajie; Cheng, Yangyang; Cheplakov, Alexander; Cheremushkina, Evgenia; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiarelli, Giorgio; Chiodini, Gabriele; Chisholm, Andrew; Chitan, Adrian; Chizhov, Mihail; Choi, Kyungeon; Chomont, Arthur Rene; Chouridou, Sofia; Chow, Bonnie Kar Bo; Christodoulou, Valentinos; Chromek-Burckhart, Doris; Chudoba, Jiri; Chuinard, Annabelle Julia; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Cinca, Diane; Cindro, Vladimir; Cioara, Irina Antonela; Ciocio, Alessandra; Cirotto, Francesco; Citron, Zvi Hirsh; Ciubancan, Mihai; Clark, Allan G; Clark, Brian Lee; Clark, Philip James; Clarke, Robert; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Colasurdo, Luca; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collot, Johann; Colombo, Tommaso; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Connell, Simon Henry; Connelly, Ian; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Crawley, Samuel Joseph; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cribbs, Wayne Allen; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cúth, Jakub; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Dandoy, Jeffrey Rogers; Dang, Nguyen Phuong; Daniells, Andrew Christopher; Dann, Nicholas Stuart; Danninger, Matthias; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Merlin; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Benedetti, Abraham; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dedovich, Dmitri; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Delgove, David; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; DeMarco, David; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Denysiuk, Denys; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Dette, Karola; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Clemente, William Kennedy; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Diaconu, Cristinel; Diamond, Miriam; Dias, Flavia; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Djuvsland, Julia Isabell; Barros do Vale, Maria Aline; Dobos, Daniel; Dobre, Monica; Doglioni, Caterina; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Drechsler, Eric; Dris, Manolis; Du, Yanyan; Duarte-Campderros, Jorge; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Duschinger, Dirk; Dutta, Baishali; Dyndal, Mateusz; Eckardt, Christoph; Ecker, Katharina Maria; Edgar, Ryan Christopher; Edson, William; Edwards, Nicholas Charles; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellajosyula, Venugopal; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Elliot, Alison; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Ennis, Joseph Stanford; Erdmann, Johannes; Ereditato, Antonio; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Fabbri, Federica; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farina, Christian; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Faucci Giannelli, Michele; Favareto, Andrea; Fawcett, William James; Fayard, Louis; Fedin, Oleg; Fedorko, Wojciech; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Feremenga, Last; Fernandez Martinez, Patricia; Fernandez Perez, Sonia; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Adam; Fischer, Cora; Fischer, Julia; Fisher, Wade Cameron; Flaschel, Nils; Fleck, Ivor; Fleischmann, Philipp; Fletcher, Gareth Thomas; Fletcher, Gregory; Fletcher, Rob Roy MacGregor; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Flowerdew, Michael; Forcolin, Giulio Tiziano; Formica, Andrea; Forti, Alessandra; Foster, Andrew Geoffrey; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Francis, David; Franconi, Laura; Franklin, Melissa; Frate, Meghan; Fraternali, Marco; Freeborn, David; Fressard-Batraneanu, Silvia; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fusayasu, Takahiro; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gach, Grzegorz; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Louis Guillaume; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gao, Jun; Gao, Yanyan; Gao, Yongsheng; Garay Walls, Francisca; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gascon Bravo, Alberto; Gatti, Claudio; Gaudiello, Andrea; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Gecse, Zoltan; Gee, Norman; Geich-Gimbel, Christoph; Geisler, Manuel Patrice; Gemme, Claudia; Genest, Marie-Hélène; Geng, Cong; Gentile, Simonetta; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghasemi, Sara; Ghazlane, Hamid; Ghneimat, Mazuza; Giacobbe, Benedetto; Giagu, Stefano; Giannetti, Paola; Gibbard, Bruce; Gibson, Stephen; Gignac, Matthew; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giorgi, Filippo Maria; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giromini, Paolo; Giugni, Danilo; Giuli, Francesco; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gkougkousis, Evangelos Leonidas; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Goblirsch-Kolb, Maximilian; Godlewski, Jan; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; Gongadze, Alexi; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Goudet, Christophe Raymond; Goujdami, Driss; Goussiou, Anna; Govender, Nicolin; Gozani, Eitan; Graber, Lars; Grabowska-Bold, Iwona; Gradin, Per Olov Joakim; Grafström, Per; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Greenwood, Zeno Dixon; Grefe, Christian; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Grevtsov, Kirill; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grivaz, Jean-Francois; Groh, Sabrina; Grohs, Johannes Philipp; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Grout, Zara Jane; Guan, Liang; Guan, Wen; Guenther, Jaroslav; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Guo, Jun; Guo, Yicheng; Gupta, Shaun; Gustavino, Giuliano; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Hadef, Asma; Haefner, Petra; Hageböck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Haley, Joseph; Hall, David; Halladjian, Garabed; Hallewell, Gregory David; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamilton, Andrew; Hamity, Guillermo Nicolas; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Haney, Bijan; Hanke, Paul; Hanna, Remie; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Maike Christina; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Hariri, Faten; Harkusha, Siarhei; Harrington, Robert; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Makoto; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauser, Reiner; Hauswald, Lorenz; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayden, Daniel; Hays, Chris; Hays, Jonathan Michael; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Jochen Jens; Heinrich, Lukas; Heinz, Christian; Hejbal, Jiri; Helary, Louis; Hellman, Sten; Helsens, Clement; Henderson, James; Henderson, Robert; Heng, Yang; Henkelmann, Steffen; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hetherly, Jeffrey Wayne; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hinman, Rachel Reisner; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hohlfeld, Marc; Hohn, David; Holmes, Tova Ray; Homann, Michael; Hong, Tae Min; Hooberman, Benjamin Henry; Hopkins, Walter; Horii, Yasuyuki; Horton, Arthur James; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hrynevich, Aliaksei; Hsu, Catherine; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Qipeng; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Ideal, Emma; Idrissi, Zineb; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikeno, Masahiro; Ilchenko, Iurii; Iliadis, Dimitrios; Ilic, Nikolina; Ince, Tayfun; Introzzi, Gianluca; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Ito, Fumiaki; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Ivarsson, Jenny; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jabbar, Samina; Jackson, Brett; Jackson, Matthew; Jackson, Paul; Jain, Vivek; Jakobi, Katharina Bianca; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansky, Roland; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanneau, Fabien; Jeanty, Laura; Jejelava, Juansher; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Hai; Jiang, Yi; Jiggins, Stephen; Jimenez Pena, Javier; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Johansson, Per; Johns, Kenneth; Johnson, William Joseph; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Sarah; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Jovicevic, Jelena; Ju, Xiangyang; Juste Rozas, Aurelio; Köhler, Markus Konrad; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kahn, Sebastien Jonathan; Kajomovitz, Enrique; Kalderon, Charles William; Kaluza, Adam; Kama, Sami; Kamenshchikov, Andrey; Kanaya, Naoko; Kaneti, Steven; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kaplan, Laser Seymour; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karamaoun, Andrew; Karastathis, Nikolaos; Kareem, Mohammad Jawad; Karentzos, Efstathios; Karnevskiy, Mikhail; Karpov, Sergey; Karpova, Zoya; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kasahara, Kota; Kashif, Lashkar; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Kato, Chikuma; Katre, Akshay; Katzy, Judith; Kawade, Kentaro; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Keeler, Richard; Kehoe, Robert; Keller, John; Kempster, Jacob Julian; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Keyes, Robert; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharlamov, Alexey; Khoo, Teng Jian; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kido, Shogo; Kim, Hee Yeun; Kim, Shinhong; Kim, Young-Kee; Kimura, Naoki; Kind, Oliver Maria; King, Barry; King, Matthew; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kiuchi, Kenji; Kivernyk, Oleh; Kladiva, Eduard; Klein, Matthew Henry; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Knapik, Joanna; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Aine; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Kolb, Mathis; Koletsou, Iro; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Kortner, Oliver; Kortner, Sandra; Kosek, Tomas; Kostyukhin, Vadim; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumeli-Charalampidi, Athina; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewska, Anna Bozena; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Krizka, Karol; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Krumnack, Nils; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kucuk, Hilal; Kuday, Sinan; Kuechler, Jan Thomas; Kuehn, Susanne; Kugel, Andreas; Kuger, Fabian; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kukla, Romain; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunigo, Takuto; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwan, Tony; Kyriazopoulos, Dimitrios; La Rosa, Alessandro; La Rosa Navarro, Jose Luis; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Lammers, Sabine; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lange, J örn Christian; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Lanza, Agostino; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lasagni Manghi, Federico; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Lazovich, Tomo; Lazzaroni, Massimo; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; Le Quilleuc, Eloi; LeBlanc, Matthew Edgar; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leisos, Antonios; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonidopoulos, Christos; Leontsinis, Stefanos; Lerner, Giuseppe; Leroy, Claude; Lesage, Arthur; Lester, Christopher; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Qi; Li, Shu; Li, Xingguo; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Liblong, Aaron; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Lin, Tai-Hua; Lindquist, Brian Edward; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Hao; Liu, Hongbin; Liu, Jian; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanlin; Liu, Yanwen; Livan, Michele; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loew, Kevin Michael; Loginov, Andrey; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Long, Brian Alexander; Long, Jonathan David; Long, Robin Eamonn; Longo, Luigi; Looper, Kristina Anne; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lopez Solis, Alvaro; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Lösel, Philipp Jonathan; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lu, Haonan; Lu, Nan; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luedtke, Christian; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lynn, David; Lysak, Roman; Lytken, Else; Lyubushkin, Vladimir; Ma, Hong; Ma, Lian Liang; Ma, Yanhui; Maccarrone, Giovanni; Macchiolo, Anna; Macdonald, Calum Michael; Maček, Boštjan; Machado Miguens, Joana; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeda, Junpei; Maeland, Steffen; Maeno, Tadashi; Maevskiy, Artem; Magradze, Erekle; Mahlstedt, Joern; Maiani, Camilla; Maidantchik, Carmen; Maier, Andreas Alexander; Maier, Thomas; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mancini, Giada; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Maneira, José; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany; Mann, Alexander; Mansoulie, Bruno; Mantifel, Rodger; Mantoani, Matteo; Manzoni, Stefano; Mapelli, Livio; Marceca, Gino; March, Luis; Marchiori, Giovanni; Marcisovsky, Michal; Marjanovic, Marija; Marley, Daniel; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian Thomas; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Mario; Martin-Haugh, Stewart; Martoiu, Victor Sorin; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massa, Lorenzo; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mättig, Peter; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazza, Simone Michele; Mc Fadden, Neil Christopher; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McClymont, Laurie; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Meyer Zu Theenhausen, Hanno; Middleton, Robin; Miglioranzi, Silvia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Milesi, Marco; Milic, Adriana; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Minaenko, Andrey; Minami, Yuto; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mistry, Khilesh; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Monden, Ryutaro; Mondragon, Matthew Craig; Mönig, Klaus; Monk, James; Monnier, Emmanuel; Montalbano, Alyssa; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Morange, Nicolas; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Mori, Daniel; Mori, Tatsuya; Morii, Masahiro; Morinaga, Masahiro; Morisbak, Vanja; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Mortensen, Simon Stark; Morvaj, Ljiljana; Mosidze, Maia; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Ralph Soeren Peter; Mueller, Thibaut; Muenstermann, Daniel; Mullen, Paul; Mullier, Geoffrey; Munoz Sanchez, Francisca Javiela; Murillo Quijada, Javier Alberto; Murray, Bill; Murrone, Alessia; Musheghyan, Haykuhi; Muskinja, Miha; Myagkov, Alexey; Myska, Miroslav; Nachman, Benjamin Philip; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagano, Kunihiro; Nagasaka, Yasushi; Nagata, Kazuki; Nagel, Martin; Nagy, Elemer; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Naranjo Garcia, Roger Felipe; Narayan, Rohin; Narrias Villar, Daniel Isaac; Naryshkin, Iouri; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Nef, Pascal Daniel; Negri, Andrea; Negrini, Matteo; Nektarijevic, Snezana; Nellist, Clara; Nelson, Andrew; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolopoulos, Konstantinos; Nilsen, Jon Kerr; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Nooney, Tamsin; Norberg, Scarlet; Nordberg, Markus; Norjoharuddeen, Nurfikri; Novgorodova, Olga; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nurse, Emily; Nuti, Francesco; O'grady, Fionnbarr; O'Neil, Dugan; O'Rourke, Abigail Alexandra; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Ochoa-Ricoux, Juan Pedro; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Oide, Hideyuki; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Oleiro Seabra, Luis Filipe; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onogi, Kouta; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Owen, Rhys Edward; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Palma, Alberto; Panagiotopoulou, Evgenia; Pandini, Carlo Enrico; Panduro Vazquez, William; Pani, Priscilla; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Adam Jackson; Parker, Michael Andrew; Parker, Kerry Ann; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pascuzzi, Vincent; Pasqualucci, Enrico; Passaggio, Stefano; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Pauly, Thilo; Pearce, James; Pearson, Benjamin; Pedersen, Lars Egholm; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Penc, Ondrej; Peng, Cong; Peng, Haiping; Penwell, John; Peralva, Bernardo; Perego, Marta Maria; Perepelitsa, Dennis; Perez Codina, Estel; Perini, Laura; Pernegger, Heinz; Perrella, Sabrina; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petroff, Pierre; Petrolo, Emilio; Petrov, Mariyan; Petrucci, Fabrizio; Pettersson, Nora Emilia; Peyaud, Alan; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Pickering, Mark Andrew; Piegaia, Ricardo; Pilcher, James; Pilkington, Andrew; Pin, Arnaud Willy J; Pina, João Antonio; Pinamonti, Michele; Pinfold, James; Pingel, Almut; Pires, Sylvestre; Pirumov, Hayk; Pitt, Michael; Plazak, Lukas; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Pluth, Daniel; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Polesello, Giacomo; Poley, Anne-luise; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pozo Astigarraga, Mikel Eukeni; Pralavorio, Pascal; Pranko, Aliaksandr; Prell, Soeren; Price, Darren; Price, Lawrence; Primavera, Margherita; Prince, Sebastien; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Puddu, Daniele; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Raddum, Silje; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Raine, John Andrew; Rajagopalan, Srinivasan; Rammensee, Michael; Rangel-Smith, Camila; Ratti, Maria Giulia; Rauscher, Felix; Rave, Stefan; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reichert, Joseph; Reisin, Hernan; Rembser, Christoph; Ren, Huan; Rescigno, Marco; Resconi, Silvia; Rezanova, Olga; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Richter, Stefan; Richter-Was, Elzbieta; Ricken, Oliver; Ridel, Melissa; Rieck, Patrick; Riegel, Christian Johann; Rieger, Julia; Rifki, Othmane; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ristić, Branislav; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Rizzi, Chiara; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Rodina, Yulia; Rodriguez Perez, Andrea; Rodriguez Rodriguez, Daniel; Roe, Shaun; Rogan, Christopher Sean; Røhne, Ole; Romaniouk, Anatoli; Romano, Marino; Romano Saez, Silvestre Marino; Romero Adam, Elena; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Peyton; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Jonatan; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Russell, Heather; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryu, Soo; Ryzhov, Andrey; Saavedra, Aldo; Sabato, Gabriele; Sacerdoti, Sabrina; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Saha, Puja; Sahinsoy, Merve; Saimpert, Matthias; Saito, Tomoyuki; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Salazar Loyola, Javier Esteban; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sammel, Dirk; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sannino, Mario; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarrazin, Bjorn; Sasaki, Osamu; Sasaki, Yuichi; Sato, Koji; Sauvage, Gilles; Sauvan, Emmanuel; Savage, Graham; Savard, Pierre; Sawyer, Craig; Sawyer, Lee; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Scarfone, Valerio; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaeffer, Jan; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Schiavi, Carlo; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmieden, Kristof; Schmitt, Christian; Schmitt, Stefan; Schmitz, Simon; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schopf, Elisabeth; Schorlemmer, Andre Lukas; Schott, Matthias; Schovancova, Jaroslava; Schramm, Steven; Schreyer, Manuel; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwarz, Thomas Andrew; Schwegler, Philipp; Schweiger, Hansdieter; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Sciolla, Gabriella; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Seema, Pienpen; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekhon, Karishma; Sekula, Stephen; Seliverstov, Dmitry; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Sessa, Marco; Seuster, Rolf; Severini, Horst; Sfiligoj, Tina; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shaikh, Nabila Wahab; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Shaw, Savanna Marie; Shcherbakova, Anna; Shehu, Ciwake Yusufu; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shiyakova, Mariya; Shmeleva, Alevtina; Shoaleh Saadi, Diane; Shochet, Mel; Shojaii, Seyedruhollah; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Sicho, Petr; Sidebo, Per Edvin; Sidiropoulou, Ourania; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simon, Dorian; Simon, Manuel; Sinervo, Pekka; Sinev, Nikolai; Sioli, Maximiliano; Siragusa, Giovanni; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skinner, Malcolm Bruce; Skottowe, Hugh Philip; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Slawinska, Magdalena; Sliwa, Krzysztof; Slovak, Radim; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Matthew; Smith, Russell; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snyder, Scott; Sobie, Randall; Socher, Felix; Soffer, Abner; Soh, Dart-yin; Sokhrannyi, Grygorii; Solans Sanchez, Carlos; Solar, Michael; Soldatov, Evgeny; Soldevila, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Son, Hyungsuk; Song, Hong Ye; Sood, Alexander; Sopczak, Andre; Sopko, Vit; Sorin, Veronica; Sosa, David; Sotiropoulou, Calliope Louisa; Soualah, Rachik; Soukharev, Andrey; South, David; Sowden, Benjamin; Spagnolo, Stefania; Spalla, Margherita; Spangenberg, Martin; Spanò, Francesco; Sperlich, Dennis; Spettel, Fabian; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spousta, Martin; St Denis, Richard Dante; Stabile, Alberto; Staerz, Steffen; Stahlman, Jonathan; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Giordon; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Strubig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramaniam, Rajivalochan; Suchek, Stanislav; Sugaya, Yorihito; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Shota; Svatos, Michal; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Taccini, Cecilia; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Shuji; Tannenwald, Benjamin Bordy; Tapia Araya, Sebastian; Tapprogge, Stefan; Tarem, Shlomit; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Aaron; Taylor, Geoffrey; Taylor, Pierre Thor Elliot; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira-Dias, Pedro; Temming, Kim Katrin; Temple, Darren; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Tepel, Fabian-Phillipp; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Theveneaux-Pelzer, Timothée; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Ray; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Tibbetts, Mark James; Ticse Torres, Royer Edson; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tipton, Paul; Tisserant, Sylvain; Todome, Kazuki; Todorov, Theodore; Todorova-Nova, Sharka; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tolley, Emma; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Tong, Baojia(Tony); Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Trofymov, Artur; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; Truong, Loan; Trzebinski, Maciej; Trzupek, Adam; Tseng, Jeffrey; Tsiareshka, Pavel; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsui, Ka Ming; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turgeman, Daniel; Turra, Ruggero; Turvey, Andrew John; Tuts, Michael; Tyndel, Mike; Ucchielli, Giulia; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Unverdorben, Christopher; Urban, Jozef; Urquijo, Phillip; Urrejola, Pedro; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valderanis, Chrysostomos; Valdes Santurio, Eduardo; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Den Wollenberg, Wouter; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vankov, Peter; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vasquez, Jared Gregory; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloce, Laurelle Maria; Veloso, Filipe; Veneziano, Stefano; Ventura, Andrea; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigani, Luigi; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Vittori, Camilla; Vivarelli, Iacopo; Vlachos, Sotirios; Vlasak, Michal; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Peter; Wagner, Wolfgang; Wahlberg, Hernan; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wallangen, Veronica; Wang, Chao; Wang, Chao; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Tingting; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Washbrook, Andrew; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; Whallon, Nikola Lazar; Wharton, Andrew Mark; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wildauer, Andreas; Wilk, Fabian; Wilkens, Henric George; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, John; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winston, Oliver James; Winter, Benedict Tobias; Wittgen, Matthias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wu, Mengqing; Wu, Miles; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yakabe, Ryota; Yamaguchi, Daiki; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Shimpei; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Yi; Yang, Zongchang; Yao, Weiming; Yap, Yee Chinn; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yen, Andy L; Yildirim, Eda; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yuen, Stephanie P; Yusuff, Imran; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zakharchuk, Nataliia; Zalieckas, Justas; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zeng, Jian Cong; Zeng, Qi; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Guangyi; Zhang, Huijun; Zhang, Jinlong; Zhang, Lei; Zhang, Rui; Zhang, Ruiqi; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Xiandong; Zhao, Yongke; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Chen; Zhou, Lei; Zhou, Li; Zhou, Mingliang; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Stephanie; Zinonos, Zinonas; Zinser, Markus; Ziolkowski, Michael; Živković, Lidija; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zwalinski, Lukasz
2016-11-29
A test of CP invariance in Higgs boson production via vector-boson fusion using the method of the Optimal Observable is presented. The analysis exploits the decay mode of the Higgs boson into a pair of $\\tau$ leptons and is based on 20.3 fb$^{-1}$ of proton—proton collision data at $\\sqrt{s}$ = 8 TeV collected by the ATLAS experiment at the LHC. Contributions from CP-violating interactions between the Higgs boson and electroweak gauge bosons are described in an effective field theory framework, in which the strength of CP violation is governed by a single parameter $\\tilde{d}$. The mean values and distributions of CP-odd observables agree with the expectation in the Standard Model and show no sign of CP violation. The CP-mixing parameter $\\tilde{d}$ is constrained to the interval [-0.11,0.05] at 68% confidence level, consistent with the Standard Model expectation of $\\tilde{d}=0$.
CpG island mapping by epigenome prediction.
Directory of Open Access Journals (Sweden)
Christoph Bock
2007-06-01
Full Text Available CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1 reliance on arbitrary threshold parameters that bear little biological justification, (2 failure to account for widespread heterogeneity among CpG islands, and (3 apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to
CpG island mapping by epigenome prediction.
Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas
2007-06-01
CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic
Did the CP audits promote the enterprises' CP? A case study in Beijing.
Yu, Gang; Huang, Jun; Chen, Qing
2002-03-09
Seven enterprises that have had recent Cleaner Production (CP) audits in Beijing were interviewed to identify whether these enterprises implemented the audit recommendations. If enterprises did implement the recommendations, their reasons and the results were analyzed. Finally, some suggestions on how to promote enterprise-wide CP were given.
International Nuclear Information System (INIS)
Flude, J.W.; Nicholas, J.R.
1991-04-01
This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs
CP violation and the top quark
International Nuclear Information System (INIS)
Atwood, D.
1994-02-01
We consider signals of CP violation in semi-leptonic decay of the top quark. We show that the transverse polarization asymmetries of the τ-lepton in the decay t → brv is extremely sensitive CP violation. As an illustration we consider CP phases arising from the charged Higgs exchange in the Weinberg three Higgs doublet model. Qualitatively, the polarization asymmetries are enhanced over rate or energy asymmetries by a factor of O(m t /m r ) ∼ 100 with a corresponding increase in sensitivity to CP violating parameters. We also examine τ polarization in b decays via b → cvr and find that may also be very effective in constraining CP violating effects such as those that arise from an extended Higgs sector
Energy Technology Data Exchange (ETDEWEB)
Ni, Chun Chun
2009-11-16
Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.
CP violation without elementary scalar fields
International Nuclear Information System (INIS)
Eichten, E.; Lane, K.; Preskill, J.
1980-04-01
Dynamically broken gauge theories of electroweak interactions provide a natural mechanism for generating CP violation. Even if all vacuum angles are unobservable, strong CP violation is not automatically avoided. In the absence of strong CP violation, the neutron electric dipole moment is expected to be of order 10 -24 e cm
B decays and models for CP violation
International Nuclear Information System (INIS)
He, Xiao Gang
1995-12-01
The decay modes B to π π,υK S , K - D, πK and ηK are promising channels to study the unitarity triangle of the CP violating Cabibbo-Kobayashi-Maskawa (CKM) matrix. The consequences of these measurements in the Weinberg model are discussed. It is shown that measurements of CP violation in B decay can be used to distinguish Standard Model from Weinberg model and that the following different mechanisms for CP violation can be distinguished: 1) CP is violated in the CKM sector only; 2) CP is violated spontaneously in the Higgs sector only; and 3) CP is violated in both the CKM and Higgs sectors. 27 refs., 4 figs
Superweak-like models of CP violation
International Nuclear Information System (INIS)
Lavoura, L.
1992-01-01
I put forward a two-Higgs-doublet model in which CP violation is mediated only by the neutral Higgs bosons, via the mechanism of scalar-pseudoscalar mixing. In this model there is no CP violation in the exchange of either W bosons or of charged Higgs bosons. The model is therefore an approximate realization of the superweak theory of CP violation. It has only two basic CP-violating quantities. I point out that other models of this kind, but with more than two Higgs doublets, may also be built
Sekizuka, Tsuyoshi; Yokoi, Taeko; Murayama, Ohoshi; Millar, B Cherie; Moore, Johne; Matsuda, Motoo
2005-08-01
A newly constructed primer pair (lari-Af/lari-Ar) designed to generate a product of the flagellin (flaA) gene for urease-negative Campylobacter lari produced a PCR amplicon of about 1700 bp for 16 isolates from 7 seagulls, 5 humans, 3 food animals and one mussel in Japan and Northern Ireland. Nucleotide sequencing and alignments of the flaA amplicons from these isolates demonstrated that the deduced amino acid sequences of the possible open reading frame were 564-572 amino acid residues in length with calculated molecular weights of 58,804 to 59,463. The deduced amino acid sequence similarity analysis strongly suggested that the ORF of the flaA from the 16 isolates showed 70-75% sequence similarities to those of Campylobacter jejuni isolates. The approximate Mr of the flagellin purified from some of the isolates of urease-negative C. lari was estimated to range from 59.6 to 61.8 kDa. Thus, flagellin from the isolates of urease-negative C. lari was shown for the first time to have a molecular size similar to those of C. jejuni and Campylobacter coli isolates, but to be different from the shorter flaA and smaller flagellin of urease-positive thermophilic Campylobacter (UPTC) isolates. Flagellins from C. lari spp., consisting of the two representative taxa of urease-negative C. lari and UPTC, thus show genotypic and phenotypic diversity.
Abbiendi, G.; Ainsley, C.; Akesson, P.F.; Alexander, G.; Allison, John; Anderson, K.J.; Arcelli, S.; Asai, S.; Ashby, S.F.; Axen, D.; Azuelos, G.; Bailey, I.; Ball, A.H.; Barberio, E.; Barlow, Roger J.; Baumann, S.; Behnke, T.; Bell, Kenneth Watson; Bella, G.; Bellerive, A.; Benelli, G.; Bentvelsen, S.; Bethke, S.; Biebel, O.; Bloodworth, I.J.; Boeriu, O.; Bock, P.; Bohme, J.; Bonacorsi, D.; Boutemeur, M.; Braibant, S.; Bright-Thomas, P.; Brigliadori, L.; Brown, Robert M.; Burckhart, H.J.; Cammin, J.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Clarke, P.E.L.; Clay, E.; Cohen, I.; Cooke, O.C.; Couchman, J.; Couyoumtzelis, C.; Coxe, R.L.; Csilling, A.; Cuffiani, M.; Dado, S.; Dallavalle, G.Marco; Dallison, S.; de Roeck, A.; de Wolf, E.; Dervan, P.; Desch, K.; Dienes, B.; Dixit, M.S.; Donkers, M.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Estabrooks, P.G.; Etzion, E.; Fabbri, F.; Fanti, M.; Feld, L.; Ferrari, P.; Fiedler, F.; Fleck, I.; Ford, M.; Frey, A.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gaycken, G.; Geich-Gimbel, C.; Giacomelli, G.; Giacomelli, P.; Glenzinski, D.; Goldberg, J.; Grandi, C.; Graham, K.; Gross, E.; Grunhaus, J.; Gruwe, M.; Gunther, P.O.; Hajdu, C.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Harder, K.; Harel, A.; Harin-Dirac, M.; Hauke, A.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Hensel, C.; Herten, G.; Heuer, R.D.; Hill, J.C.; Hocker, James Andrew; Hoffman, Kara Dion; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Igo-Kemenes, P.; Ishii, K.; Jacob, F.R.; Jawahery, A.; Jeremie, H.; Jones, C.R.; Jovanovic, P.; Junk, T.R.; Kanaya, N.; Kanzaki, J.; Karapetian, G.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Kim, D.H.; Klein, K.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Kokott, T.P.; Komamiya, S.; Kowalewski, Robert V.; Kress, T.; Krieger, P.; von Krogh, J.; Kuhl, T.; Kupper, M.; Kyberd, P.; Lafferty, G.D.; Landsman, H.; Lanske, D.; Lawson, I.; Layter, J.G.; Leins, A.; Lellouch, D.; Letts, J.; Levinson, L.; Liebisch, R.; Lillich, J.; List, B.; Littlewood, C.; Lloyd, A.W.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Lu, J.; Ludwig, J.; Macchiolo, A.; Macpherson, A.; Mader, W.; Marcellini, S.; Marchant, T.E.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Mendez-Lorenzo, P.; Menges, W.; Merritt, F.S.; Mes, H.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Mohr, W.; Montanari, A.; Mori, T.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oh, A.; Okpara, A.; Oreglia, M.J.; Orito, S.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poli, B.; Polok, J.; Pooth, O.; Przybycien, M.; Quadt, A.; Rembser, C.; Renkel, P.; Rick, H.; Rodning, N.; Roney, J.M.; Rosati, S.; Roscoe, K.; Rossi, A.M.; Rozen, Y.; Runge, K.; Runolfsson, O.; Rust, D.R.; Sachs, K.; Saeki, T.; Sahr, O.; Sarkisyan, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharff-Hansen, P.; Schroder, Matthias; Schumacher, M.; Schwick, C.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Spagnolo, S.; Sproston, M.; Stahl, A.; Stephens, K.; Stoll, K.; Strom, David M.; Strohmer, R.; Stumpf, L.; Surrow, B.; Talbot, S.D.; Tarem, S.; Taylor, R.J.; Teuscher, R.; Thiergen, M.; Thomas, J.; Thomson, M.A.; Torrence, E.; Towers, S.; Toya, D.; Trefzger, T.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turner-Watson, M.F.; Ueda, I.; Vachon, B.; Vannerem, P.; Verzocchi, M.; Voss, H.; Vossebeld, J.; Waller, D.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wengler, T.; Wermes, N.; Wetterling, D.; White, J.S.; Wilson, G.W.; Wilson, J.A.; Wyatt, T.R.; Yamashita, S.; Zacek, V.; Zer-Zion, D.
2001-01-01
Measurements are presented of the polarisation of W+W- boson pairs produced in e+e- collisions, and of CP-violating WWZ and WWGamma trilinear gauge couplings. The data were recorded by the OPAL experiment at LEP during 1998, where a total integrated luminosity of 183 pb^-1 was obtained at a centre-of-mass energy of 189 GeV. The measurements are performed through a spin density matrix analysis of the W boson decay products. The fraction of W bosons produced with longitudinal polarisation was found to be sigma_L/sigma_total = (21.0 +- 3.3 +- 1.6)% where the first error is statistical and the second systematic. The joint W boson pair production fractions were found to be sigma_TT/sigma_total = (78.1 +- 9.0 +- 3.2) %, sigma_LL/sigma_total = (20.1 +- 7.2 +- 1.8) % and sigma_TL/sigma_total = (1.8 +- 14.7 +- 3.8) %. In the CP-violating trilinear gauge coupling sector we find kappa_z = -0.20 +0.10 -0.07, g^z_4 = -0.02 +0.32 -0.33 and lambda_z = -0.18 +0.24 -0.16, where errors include both statistical and systematic u...
Present status of CP violation
International Nuclear Information System (INIS)
Ng, J.N.
1989-06-01
A review of the status of CP violation in kaons is given. Status of our knowledge of quark mixing angles in the standard six quark model is presented. The role Β d o - Βd o transition plays in this study is examined. A comparison of the estimates of CP violation effects from models beyond the standard one is given. Other experiments that have the capability of testing different CP violation models are also discussed. (Author) 35 refs., 6 figs., tab
International Nuclear Information System (INIS)
Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.
2017-01-01
Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.
Directory of Open Access Journals (Sweden)
Esther Lantero
2017-07-01
Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control
Energy Technology Data Exchange (ETDEWEB)
Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.
2017-07-01
Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.
LHCb: A measurement of the $C\\!P$ asymmetry in $B^0 \\rightarrow K^{*0} \\mu^+ \\mu^-$ decays
Wright, S
2013-01-01
A measurement of the $C\\!P$ asymmetry in $B^0 \\rightarrow K^{*0} \\mu^+ \\mu^-$ decays is presented, based on 1.0 fb$^{-1}$ of $pp$ collision data recorded by the LHCb experiment during 2011. The measurement is performed in six bins of invariant mass squared of the $\\mu^+\\mu^-$ pair, excluding the $\\mathrm{J}\\mskip -3mu/\\mskip -2mu\\psi\\mskip 2mu$ and $\\psi(2S)$ resonance regions. Production and detection asymmetries are removed using the $B^0 \\rightarrow \\mathrm{J}\\mskip -3mu/\\mskip -2mu\\psi\\mskip 2mu K^{*0}$ decay as a control mode. The integrated $C\\!P$ asymmetry is found to be $-0.072 \\pm 0.040 \\mbox{ (stat.)} \\pm 0.005 \\mbox{ (syst.)}$, consistent with the Standard Model.
Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev
2016-02-09
Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.
Constraints on the CP-Violating MSSM
Arbey, A; Godbole, R M; Mahmoudi, F
2016-01-01
We discuss the prospects for observing CP violation in the MSSM with six CP-violating phases, using a geometric approach to maximise CP-violating observables subject to the experimental upper bounds on electric dipole moments. We consider constraints from Higgs physics, flavour physics, the dark matter relic density and spin-independent scattering cross section with matter.
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
Directory of Open Access Journals (Sweden)
Kitchen James L
2012-11-01
Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
Measuring the CP property of Higgs coupling to tau leptons in the VBF channel at the LHC
Energy Technology Data Exchange (ETDEWEB)
Han, Tao [PITT-PACC, Department of Physics and Astronomy, University of Pittsburgh,Pittsburgh, PA 15260 (United States); Department of Physics, Tsinghua University, Collaborative Innovation Center of Quantum Matter,Beijing 100086 (China); Mukhopadhyay, Satyanarayan [PITT-PACC, Department of Physics and Astronomy, University of Pittsburgh,Pittsburgh, PA 15260 (United States); Mukhopadhyaya, Biswarup [Regional Centre for Accelerator-based Particle Physics, Harish-Chandra Research Institute, HBNI,Chhatnag Road, Jhusi, Allahabad 211019 (India); Wu, Yongcheng [Department of Physics, Tsinghua University, Collaborative Innovation Center of Quantum Matter,Beijing 100086 (China); PITT-PACC, Department of Physics and Astronomy, University of Pittsburgh,Pittsburgh, PA 15260 (United States)
2017-05-23
We study the prospects of measuring the CP property of the Higgs (h) coupling to tau leptons using the vector boson fusion (VBF) production mode at the high-luminosity LHC. Utilizing the previously proposed angle between the planes spanned by the momentum vectors of the (π{sup +}π{sup 0}) and (π{sup −}π{sup 0}) pairs originating in τ{sup ±} decays as the CP-odd observable, we perform a detailed Monte Carlo analysis, taking into account the relevant standard model backgrounds, as well as detector resolution effects. We find that excluding a pure CP-odd coupling hypothesis requires O(400 fb{sup −1}) luminosity at the 14 TeV LHC, and values of the CP-mixing angle larger than about 25{sup ∘} can be excluded at 95% confidence level using 3 ab{sup −1} data. It is observed that the uncertainty in the angular resolution of the neutral pion momenta does not constitute a significant hurdle. Achieving a signal to background ratio (S/B) close to one, while keeping a high enough signal yield required to study the angular distributions selects out VBF as a promising mode to probe the CP nature of the hττ coupling, with gluon fusion suffering from a low S/B, and the W{sup ±}h/Zh mode (with leptonically decaying W{sup ±}/Z) having a much smaller signal rate.
Ellis, John R.
2001-01-01
Various developing topics in CP violation are reviewed. There are many theoretical reasons to hope that the CKM paradigm may be incomplete. It is surely too soon to be claiming new physics in \\epsilon^\\prime/\\epsilon or in D^0-\\bar D^0 mixing, but rare K decays offer interesting places to search for new physics. It is probably also premature to see a clash between global CKM fits and current estimates of sin \\beta and \\gamma, where much more precise data will soon be available. There are interesting possibilities to look for CP violation in neutrino oscillations and in Higgs physics. Rapid progress can be expected now that CP violation is moving to the top of the particle physics agenda.
The CpG island searcher: a new WWW resource.
Takai, Daiya; Jones, Peter A
2003-01-01
Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.
International Nuclear Information System (INIS)
Gilman, F.J.
1989-05-01
Recent theoretical and experimental progress on the manifestation of CP violation in K decays, and toward understanding whether CP violation originates in a phase, or phases, in the weak mixing matrix of quarks is reviewed. 23 refs., 10 figs
Directory of Open Access Journals (Sweden)
E. Mahmoudi
2007-08-01
Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.
High-speed measurement of firearm primer blast waves
Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy
2012-01-01
This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...
Measurements of direct CP-violating asymmetries in charmless decays of bottom baryons.
Aaltonen, T; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Butti, P; Buzatu, A; Calamba, A; Camarda, S; Campanelli, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Cho, K; Chokheli, D; Clark, A; Clarke, C; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Cremonesi, M; Cruz, D; Cuevas, J; Culbertson, R; d'Ascenzo, N; Datta, M; de Barbaro, P; Demortier, L; Deninno, M; D'Errico, M; Devoto, F; Di Canto, A; Di Ruzza, B; Dittmann, J R; Donati, S; D'Onofrio, M; Dorigo, M; Driutti, A; Ebina, K; Edgar, R; Elagin, A; Erbacher, R; Errede, S; Esham, B; Farrington, S; Fernández Ramos, J P; Field, R; Flanagan, G; Forrest, R; Franklin, M; Freeman, J C; Frisch, H; Funakoshi, Y; Galloni, C; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González López, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gramellini, E; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Hahn, S R; Han, J Y; Happacher, F; Hara, K; Hare, M; Harr, R F; Harrington-Taber, T; Hatakeyama, K; Hays, C; Heinrich, J; Herndon, M; Hocker, A; Hong, Z; Hopkins, W; Hou, S; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kambeitz, M; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S H; Kim, S B; Kim, Y J; Kim, Y K; Kimura, N; Kirby, M; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Kruse, M; Kuhr, T; Kurata, M; Laasanen, A T; Lammel, S; Lancaster, M; Lannon, K; Latino, G; Lee, H S; Lee, J S; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lipeles, E; Lister, A; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucchesi, D; Lucà, A; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Marchese, L; Margaroli, F; Marino, P; Martínez, M; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M J; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Nigmanov, T; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagliarone, C; Palencia, E; Palni, P; Papadimitriou, V; Parker, W; Pauletta, G; Paulini, M; Paus, C; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Pranko, A; Prokoshin, F; Ptohos, F; Punzi, G; Ranjan, N; Redondo Fernández, I; Renton, P; Rescigno, M; Rimondi, F; Ristori, L; Robson, A; Rodriguez, T; Rolli, S; Ronzani, M; Roser, R; Rosner, J L; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schwarz, T; Scodellaro, L; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sliwa, K; Smith, J R; Snider, F D; Song, H; Sorin, V; St Denis, R; Stancari, M; Stentz, D; Strologas, J; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thomson, E; Thukral, V; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Ukegawa, F; Uozumi, S; Vázquez, F; Velev, G; Vellidis, C; Vernieri, C; Vidal, M; Vilar, R; Vizán, J; Vogel, M; Volpi, G; Wagner, P; Wallny, R; Wang, S M; Waters, D; Wester, W C; Whiteson, D; Wicklund, A B; Wilbur, S; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W-M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Zanetti, A M; Zeng, Y; Zhou, C; Zucchelli, S
2014-12-12
We report final measurements of direct CP-violating asymmetries in charmless decays of neutral bottom hadrons to pairs of charged hadrons with the upgraded Collider Detector at the Fermilab Tevatron. Using the complete √s=1.96 TeV proton-antiproton collisions data set, corresponding to 9.3 fb⁻¹ of integrated luminosity, we measure A(Λ(b)⁰→pπ⁻)=+0.06±0.07(stat)±0.03(syst) and A(Λ(b)⁰→pK⁻)=-0.10±0.08(stat)±0.04(syst), compatible with no asymmetry. In addition we measure the CP-violating asymmetries in B(s)⁰→K⁻π⁺ and B⁰→K⁺π⁻ decays to be A(B(s)⁰→K⁻π⁺)=+0.22±0.07(stat)±0.02(syst) and A(B⁰→K⁺π⁻)=-0.083±0.013(stat)±0.004(syst), respectively, which are significantly different from zero and consistent with current world averages.
Lin, Y.; Gross, A.; Silver, W. L.
2017-12-01
Elemental stoichiometry of microorganisms is intimately related to ecosystem carbon and nutrient fluxes and is ultimately controlled by the chemical (plant tissue, soil, redox) and physical (temperature, moisture, aeration) environment. Previous meta-analyses have shown that the C:P ratio of soil microbial biomass exhibits significant variations among and within biomes. Little is known about the underlying causes of this variability. We examined soil microbial C:P ratios along an elevation gradient in the Luquillo Experimental Forest in Puerto Rico. We analyzed soils from mixed forest paired with monodominant palm forest every 100 m from 300 m to 1000 m a.s.l.. Mean annual precipitation increased with increasing elevation, resulting in stronger reducing conditions and accumulation of soil Fe(II) at higher elevations. The mean value and variability of soil microbial C:P ratios generally increased with increasing elevation except at 1000 m. At high elevations (600-900 m), the average value of microbial C:P ratio (108±10:1) was significantly higher than the global average ( 55:1). We also found that soil organic P increased with increasing elevation, suggesting that an inhibition of organic P mineralization, not decreased soil P availability, may cause the high microbial C:P ratio. The soil microbial C:P ratio was positively correlated with soil HCl-extractable Fe(II), suggesting that reducing conditions may be responsible for the elevational changes observed. In a follow-up experiment, soils from mixed forests at four elevation levels (300, 500, 700, and 1000 m) were incubated under aerobic and anaerobic conditions for two weeks. We found that anaerobic incubation consistently increased the soil microbial C:P ratio relative to the aerobic incubation. Overall, our results indicate that redox conditions can shift the elemental composition of microbial biomass. The high microbial C:P ratios induced under anoxic conditions may reflect inhibition of microbial P
Energy Technology Data Exchange (ETDEWEB)
Sutcliffe, J.S.,; Nakao, M.; Beaudet, A.L. [Baylor College of Medicine, Houston, TX (United States)] [and others
1994-09-01
Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are associated with paternal and maternal deficiencies, respectively, of gene expression within human chromosome 15q11-q13, and are caused by deletion, uniparental disomy, or other mutations. Four transcripts designated PAR-5, PAR-7, PAR-1 and PAR-4 were isolated and localized to a region within 300 kb telomeric to the gene encoding small nuclear ribonucleoprotein-associated polypeptide N (SNRPN). Analysis of the transcripts in cultured fibroblasts and lymphoblasts from deletion patients demonstrated that SNRPN, PAR-5 and PAR-1 are expressed exclusively from the paternal chromosome, defining an imprinted domain that spans at least 200 kb. All three imprinted transcripts were absent in cells from three PWS patients (one pair of sibs and one sporadic case) with small deletions that involve a differentially methylated CpG island containing a previously undescribed 5{prime} untranslated exon ({alpha}) of SNRPN. Methylation of the CpG island is specific for the maternal chromosome consistent with paternal expression of the imprinted domain. One deletion, which is benign when maternally transmitted, extends upstream <30 kb from the CpG island, and is associated with altered methylation centromeric to SNRPN, and loss of transcription telomeric to SNRPN, implying the presence of an imprinting control region around the CpG island containing exon {alpha}.
QCD corrections to decay distributions of neutral Higgs bosons with (in)definite CP parity
International Nuclear Information System (INIS)
Bernreuther, W.; Brandenburg, A.; Flesch, M.
1997-01-01
We compute the order α s QCD corrections to the density matrix for the decay of a neutral Higgs boson var-phi with (in)definite CP parity into a quark-antiquark pair and the QED corrections for the decay into a pair of charged leptons. We classify and calculate single spin asymmetries and spin-spin correlations which are generated by the scalar and pseudoscalar Yukawa couplings. These spin effects can be traced in var-phi →τ - τ + and, for heavy Higgs bosons, in var-phi →t bar t. We also calculate resulting correlations among the final states and estimate, for the respective decay modes, the number of events needed to measure the Yukawa couplings with these correlations at the 3σ level. copyright 1997 The American Physical Society
CP violation conditions in N-Higgs-doublet potentials
International Nuclear Information System (INIS)
Nishi, C. C.
2006-01-01
Conditions for CP violation in the scalar potential sector of general N-Higgs-doublet models are analyzed from a group theoretical perspective. For the simplest two-Higgs-doublet model potential, a minimum set of conditions for explicit and spontaneous CP violation is presented. The conditions can be given a clear geometrical interpretation in terms of quantities in the adjoint representation of the basis transformation group for the two doublets. Such conditions depend on CP-odd pseudoscalar invariants. When the potential is CP invariant, the explicit procedure to reach the real CP-basis and the explicit CP transformation can also be obtained. The procedure to find the real basis and the conditions for CP violation are then extended to general N-Higgs-doublet model potentials. The analysis becomes more involved and only a formal procedure to reach the real basis is found. Necessary conditions for CP invariance can still be formulated in terms of group invariants: the CP-odd generalized pseudoscalars. The problem can be completely solved for three Higgs-doublets
Higgs boson searches in CP-conserving and CP-violating MSSM scenarios with the DELPHI detector
International Nuclear Information System (INIS)
Abdallah, J.; Antilogus, P.; Augustin, J.E.
2008-01-01
This paper presents the final interpretation of the results from DELPHI on the searches for Higgs bosons in the minimal supersymmetric extension of the Standard Model (MSSM). A few representative scenarios are considered, that include CP conservation and explicit CP violation in the Higgs sector. The experimental results encompass the searches for neutral Higgs bosons at LEP1 and LEP2 in final states as expected in the MSSM, as well as LEP2 searches for charged Higgs bosons and for neutral Higgs bosons decaying into hadrons independent of the quark flavour. The data reveal no significant excess with respect to background expectations. The results are translated into excluded regions of the parameter space in the various scenarios. In the CP-conserving case, these lead to limits on the masses of the lightest scalar and pseudoscalar Higgs bosons, h and A, and on tan β. The dependence of these limits on the top quark mass is discussed. Allowing for CP violation reduces the experimental sensitivity to Higgs bosons. It is shown that this effect depends strongly on the values of the parameters responsible for CP violation in the Higgs sector. (orig.)
Strong CP, flavor, and twisted split fermions
International Nuclear Information System (INIS)
Harnik, Roni; Perez, Gilad; Schwartz, Matthew D.; Shirman, Yuri
2005-01-01
We present a natural solution to the strong CP problem in the context of split fermions. By assuming CP is spontaneously broken in the bulk, a weak CKM phase is created in the standard model due to a twisting in flavor space of the bulk fermion wavefunctions. But the strong CP phase remains zero, being essentially protected by parity in the bulk and CP on the branes. As always in models of spontaneous CP breaking, radiative corrections to theta bar from the standard model are tiny, but even higher dimension operators are not that dangerous. The twisting phenomenon was recently shown to be generic, and not to interfere with the way that split fermions naturally weaves small numbers into the standard model. It follows that out approach to strong CP is compatible with flavor, and we sketch a comprehensive model. We also look at deconstructed version of this setup which provides a viable 4D model of spontaneous CP breaking which is not in the Nelson-Barr class. (author)
B decays and models for CP violation
International Nuclear Information System (INIS)
He, X.
1996-01-01
The decay modes B to ππ, ψK S , K - D, πK, and ηK are promising channels to study the unitarity triangle of the CP-violating Cabibbo-Kobayashi-Maskawa (CKM) matrix. In this paper I study the consequences of these measurements in the Weinberg model. I show that using the same set of measurements, the following different mechanisms for CP violation can be distinguished: (1) CP is violated in the CKM sector only; (2) CP is violated spontaneously in the Higgs sector only; and (3) CP is violated in both the CKM and Higgs sectors. copyright 1996 The American Physical Society
International Nuclear Information System (INIS)
Saavedra, A.F.
1995-01-01
Full text: In the standard model CP violation is generated by a non trivial complex phase in the CKM matrix. The Standard Model does not predict the elements of the CKM matrix, they need to be experimentally measured. This will show if all the CP violation phenomena can be accounted by the complex phase or there are other contributing mechanisms which lie beyond the scope of Standard Model. It is of interest to overconstraint the so called unitary triangle by measuring each angle (α, β and γ) from the CP asymmetry that occurs in different decay modes. During the initial low luminosity period of the LHC a large effort will be concentrated in studying B physics, especially CP violation in the B 0 - B-bar 0 system, with the ATLAS detector. The features of the detector which are important for CP studies are: sharp trigger from the muon spectrometer (muons will be identify down to p T ≅ 5GeV, be able to distinguish electrons from hadrons (down to p T ≅ 1 GeV) with the Straw Tracker and Transition detector and high resolution of tracks, secondary vertices with the Semiconductor Tracker (resolution of 10-90 μm. For some decays modes ATLAS is expected to obtain larger sample of events than the B-factories that are being proposed. It has been calculated that the systematic error σ sin (2 α) = 0.06 and σ sin ( 2 β) = 0.027 which is comparable with other future experiments
Flavour Physics and CP Violation
Fleischer, Robert
2006-01-01
The starting point of these lectures is an introduction to the weak interactions of quarks and the Standard-Model description of CP violation, where the central role is played by the Cabibbo-Kobayashi-Maskawa matrix and the corresponding unitarity triangles. Since the B-meson system will govern the stage of (quark) flavour physics and CP violation in this decade, it will be our main focus. We shall classify B-meson decays, introduce the theoretical tools to deal with them, investigate the requirements for non-vanishing CP-violating asymmetries, and discuss the main strategies to explore CP violation and the preferred avenues for physics beyond the Standard Model to enter. This formalism is then applied to discuss the status of important B-factory benchmark modes, where we focus on puzzling patterns in the data that may indicate new-physics effects, as well as the prospects for B-decay studies at the LHC.
Directory of Open Access Journals (Sweden)
Can-Xing Duan
Full Text Available BACKGROUND: The adzuki bean weevil, Callosobruchus chinensis L., is one of the most destructive pests of stored legume seeds such as mungbean, cowpea, and adzuki bean, which usually cause considerable loss in the quantity and quality of stored seeds during transportation and storage. However, a lack of genetic information of this pest results in a series of genetic questions remain largely unknown, including population genetic structure, kinship, biotype abundance, and so on. Co-dominant microsatellite markers offer a great resolving power to determine these events. Here, we report rapid microsatellite isolation from C. chinensis via high-throughput sequencing. PRINCIPAL FINDINGS: In this study, 94,560,852 quality-filtered and trimmed reads were obtained for the assembly of genome using Illumina paired-end sequencing technology. In total, the genome with total length of 497,124,785 bp, comprising 403,113 high quality contigs was generated with de novo assembly. More than 6800 SSR loci were detected and a suit of 6303 primer pair sequences were designed and 500 of them were randomly selected for validation. Of these, 196 pair of primers, i.e. 39.2%, produced reproducible amplicons that were polymorphic among 8 C. chinensis genotypes collected from different geographical regions. Twenty out of 196 polymorphic SSR markers were used to analyze the genetic diversity of 18 C. chinensis populations. The results showed the twenty SSR loci were highly polymorphic among these populations. CONCLUSIONS: This study presents a first report of genome sequencing and de novo assembly for C. chinensis and demonstrates the feasibility of generating a large scale of sequence information and SSR loci isolation by Illumina paired-end sequencing. Our results provide a valuable resource for C. chinensis research. These novel markers are valuable for future genetic mapping, trait association, genetic structure and kinship among C. chinensis.
Hexavalent Chromium IV-Free Primer Development
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
International Nuclear Information System (INIS)
Minakata, Hisakazu; Nunokawa, Hiroshi
2003-01-01
We introduce a 'CP trajectory diagram in bi-probability space' as a powerful tool for a pictorial representation of the genuine CP and the matter effects in neutrino oscillations. The existence of correlated ambiguity in the determination of CP-violating phase δ and the sign of Δm 13 2 is uncovered. The principles of tuning the beam energy for a given baseline distance are proposed to resolve the ambiguity and to maximize the CP-odd effect. We finally point out, quite contrary to what is usually believed, that the ambiguity may be resolved with ∼50% chance in the super-JHF experiment despite its relatively short baseline of 300 km
DEFF Research Database (Denmark)
Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard
2005-01-01
Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....
Theory prospective on leptonic CP violation
International Nuclear Information System (INIS)
Petcov, S.T.
2016-01-01
The phenomenology of 3-neutrino mixing, the current status of our knowledge about the 3-neutrino mixing parameters, including the absolute neutrino mass scale, and of the Dirac and Majorana CP violation in the lepton sector are reviewed. The problems of CP violation in neutrino oscillations and of determining the nature – Dirac or Majorana – of massive neutrinos are discussed. The seesaw mechanism of neutrino mass generation and the related leptogenesis scenario of generation of the baryon asymmetry of the Universe are considered. The results showing that the CP violation necessary for the generation of the baryon asymmetry of the Universe in leptogenesis can be due exclusively to the Dirac and/or Majorana CP-violating phase(s) in the neutrino mixing matrix U are briefly reviewed. The discrete symmetry approach to understanding the observed pattern of neutrino mixing and the related predictions for the leptonic Dirac CP violation are also reviewed.
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
International Nuclear Information System (INIS)
Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh
2013-01-01
To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)
In vivo control of CpG and non-CpG DNA methylation by DNA methyltransferases.
Directory of Open Access Journals (Sweden)
Julia Arand
2012-06-01
Full Text Available The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites. The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position-, cell type-, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM to calculate the relative contribution of DNA methyltransferases (Dnmts for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs.
Brandstetter, Johannes
2018-01-01
This talk summarizes latest ATLAS and CMS results on Higgs boson couplings to fermions. Presented topics include decays into final states of pairs of tau leptons and pairs of bottom quarks as well as results on the ttH production mode. Results are complemented by tests of the CP invariance and searches for lepton flavor violating decays. Finally, prospects of future Higgs boson analyses within the scope of the High Luminosity LHC program are discussed. The presented results mostly use LHC 2016 data collected at a center-of-mass energy of $\\sqrt{\\mathrm{s}}=13~$TeV corresponding to an integrated luminosity of about 36~$\\mathrm{fb^{-1}}$.
Soft CP violation in K-meson systems
International Nuclear Information System (INIS)
Montero, J.C.; Nishi, C.C.; Pleitez, V.; Ravinez, O.; Rodriguez, M.C.
2006-01-01
We consider a model with soft CP violation which accommodates the CP violation in the neutral kaons even if we assume that the Cabibbo-Kobayashi-Maskawa mixing matrix is real and the sources of CP violation are three complex vacuum expectation values and a trilinear coupling in the scalar potential. We show that for some reasonable values of the masses and other parameters the model allows us to explain all the observed CP violation processes in the K 0 -K 0 system
KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input
International Nuclear Information System (INIS)
Busch, R.D.
2003-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a
Schwartz-Neiderman, Anat; Braun, Tali; Fallach, Noga; Schwartz, David; Carmeli, Yehuda; Schechner, Vered
2016-10-01
OBJECTIVE Carbapenemase-producing carbapenem-resistant Enterobacteriaceae (CP-CRE) are extremely drug-resistant pathogens. Screening of contacts of newly identified CP-CRE patients is an important step to limit further transmission. We aimed to determine the risk factors for CP-CRE acquisition among patients exposed to a CP-CRE index patient. METHODS A matched case-control study was performed in a tertiary care hospital in Israel. The study population was comprised of patients who underwent rectal screening for CP-CRE following close contact with a newly identified CP-CRE index patient. Cases were defined as positive tests for CP-CRE. For each case patient, 2 matched controls were randomly selected from the pool of contacts who tested negative for CP-CRE following exposure to the same index case. Bivariate and multivariate analyses were conducted using conditional logistic regression. RESULTS In total, 53 positive contacts were identified in 40 unique investigations (896 tests performed on 735 contacts) between October 6, 2008, and June 7, 2012. bla KPC was the only carbapenemase identified. In multivariate analysis, risk factors for CP-CRE acquisition among contacts were (1) contact with an index patient for ≥3 days (odds ratio [OR], 9.8; 95% confidence interval [CI], 2.0-48.9), (2) mechanical ventilation (OR, 4.1; 95% CI, 1.4-11.9), and (3) carriage or infection with another multidrug-resistant organism (MDRO; OR, 2.6; 95% CI, 1.0-7.1). Among patients who received antibiotics, cephalosporins were associated with a lower risk of acquisition. CONCLUSIONS Patient characteristics (ventilation and carriage of another MDRO) as well as duration of contact are risk factors for CP-CRE acquisition among contacts. The role of cephalosporins requires further study. Infect Control Hosp Epidemiol 2016;1-7.
Primer on spontaneous heating and pyrophoricity
Energy Technology Data Exchange (ETDEWEB)
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.
30 CFR 57.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
MeCP2 regulates ethanol sensitivity and intake.
Repunte-Canonigo, Vez; Chen, Jihuan; Lefebvre, Celine; Kawamura, Tomoya; Kreifeldt, Max; Basson, Oan; Roberts, Amanda J; Sanna, Pietro Paolo
2014-09-01
We have investigated the expression of chromatin-regulating genes in the prefrontal cortex and in the shell subdivision of the nucleus accumbens during protracted withdrawal in mice with increased ethanol drinking after chronic intermittent ethanol (CIE) vapor exposure and in mice with a history of non-dependent drinking. We observed that the methyl-CpG binding protein 2 (MeCP2) was one of the few chromatin-regulating genes to be differentially regulated by a history of dependence. As MeCP2 has the potential of acting as a broad gene regulator, we investigated sensitivity to ethanol and ethanol drinking in MeCP2(308/) (Y) mice, which harbor a truncated MeCP2 allele but have a milder phenotype than MeCP2 null mice. We observed that MeCP2(308/) (Y) mice were more sensitive to ethanol's stimulatory and sedative effects than wild-type (WT) mice, drank less ethanol in a limited access 2 bottle choice paradigm and did not show increased drinking after induction of dependence with exposure to CIE vapors. Alcohol metabolism did not differ in MeCP2(308/) (Y) and WT mice. Additionally, MeCP2(308/) (Y) mice did not differ from WT mice in ethanol preference in a 24-hour paradigm nor in their intake of graded solutions of saccharin or quinine, suggesting that the MeCP2(308/) (Y) mutation did not alter taste function. Lastly, using the Gene Set Enrichment Analysis algorithm, we found a significant overlap in the genes regulated by alcohol and by MeCP2. Together, these results suggest that MeCP2 contributes to the regulation of ethanol sensitivity and drinking. © 2013 The Authors, Addiction Biology © 2013 Society for the Study of Addiction.
CP and other gauge symmetries in string theory
International Nuclear Information System (INIS)
Dine, M.; Leigh, R.G.; MacIntire, D.A.
1992-01-01
We argue that CP is a gauge symmetry in string theory. As a consequence, CP cannot be explicitly broken either perturbatively or nonperturbatively; there can be no nonperturbative CP-violating parameters. String theory is thus an example of a theory where all θ angles arise due to spontaneous CP violation, and are in principle calculable
Invariant approach to CP in unbroken Δ(27
Directory of Open Access Journals (Sweden)
Gustavo C. Branco
2015-10-01
Full Text Available The invariant approach is a powerful method for studying CP violation for specific Lagrangians. The method is particularly useful for dealing with discrete family symmetries. We focus on the CP properties of unbroken Δ(27 invariant Lagrangians with Yukawa-like terms, which proves to be a rich framework, with distinct aspects of CP, making it an ideal group to investigate with the invariant approach. We classify Lagrangians depending on the number of fields transforming as irreducible triplet representations of Δ(27. For each case, we construct CP-odd weak basis invariants and use them to discuss the respective CP properties. We find that CP violation is sensitive to the number and type of Δ(27 representations.
CP determination and tests for CP or P violation by the V1V2 decay mode
International Nuclear Information System (INIS)
Nelson, C.A.
1984-01-01
A decay mode such as phiphi, UPSILONUPSILON, K/sup asterisk+/K/sup asterisk-/, or D/sup asterisk+/D/sup asterisk-/ can be used to distinguish between a neutral spin-0 technipion and a neutral spin-0 Higgs particle. By this generalization of phiphi parity test, the CP eigenvalue γ/sub C/P can be determined for an X particle of any spin J which decays CP invariantly into VV, or VV-bar, where each vector meson either decays into two spin-0 bosons, or is ω. The absence in a VV, or VV-bar, decay channel of sin2phi and sinphi terms in the azimuthal distribution is due to CP invariance and/or P invariance. For a V 1 V 2 decay channel without a V 1 bold-arrow-left-rightV 2 exchange property, and in a mode like K/sup asterisk+/K /sup asterisk0/, such terms would imply that P is violated. For a V 1 V 2 mode such as phiω where each vector meson is its own antiparticle, such terms would imply that both P and CP are violated; when CP invariance holds, the γ/sub C/P(-)/sup J/ eigenvalue of X can be determined provided certain amplitudes do not accidentally vanish
International Nuclear Information System (INIS)
Gilman, F.J.
1989-12-01
Predictions for CP violation in the three generation Standard Model are reviewed based on what is known about the Cabibbo-Kobayashi-Maskawa matrix. Application to the K and B meson systems are emphasized. 43 refs., 13 figs
Arsenic-Rich Polyarsenides Stabilized by Cp*Fe Fragments.
Schmidt, Monika; Konieczny, David; Peresypkina, Eugenia V; Virovets, Alexander V; Balázs, Gabor; Bodensteiner, Michael; Riedlberger, Felix; Krauss, Hannes; Scheer, Manfred
2017-06-12
The redox chemistry of [Cp*Fe(η 5 -As 5 )] (1, Cp*=η 5 -C 5 Me 5 ) has been investigated by cyclic voltammetry, revealing a redox behavior similar to that of its lighter congener [Cp*Fe(η 5 -P 5 )]. However, the subsequent chemical reduction of 1 by KH led to the formation of a mixture of novel As n scaffolds with n up to 18 that are stabilized only by [Cp*Fe] fragments. These include the arsenic-poor triple-decker complex [K(dme) 2 ][{Cp*Fe(μ,η 2:2 -As 2 )} 2 ] (2) and the arsenic-rich complexes [K(dme) 3 ] 2 [(Cp*Fe) 2 (μ,η 4:4 -As 10 )] (3), [K(dme) 2 ] 2 [(Cp*Fe) 2 (μ,η 2:2:2:2 -As 14 )] (4), and [K(dme) 3 ] 2 [(Cp*Fe) 4 (μ 4 ,η 4:3:3:2:2:1:1 -As 18 )] (5). Compound 4 and the polyarsenide complex 5 are the largest anionic As n ligand complexes reported thus far. Complexes 2-5 were characterized by single-crystal X-ray diffraction, 1 H NMR spectroscopy, EPR spectroscopy (2), and mass spectrometry. Furthermore, DFT calculations showed that the intermediate [Cp*Fe(η 5 -As 5 )] - , which is presumably formed first, undergoes fast dimerization to the dianion [(Cp*Fe) 2 (μ,η 4:4 -As 10 )] 2- . © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Robby M Zachariah
Full Text Available Rett Syndrome (RTT is a severe neurological disorder in young females, and is caused by mutations in the X-linked MECP2 gene. MECP2/Mecp2 gene encodes for two protein isoforms; MeCP2E1 and MeCP2E2 that are identical except for the N-terminus region of the protein. In brain, MECP2E1 transcripts are 10X higher, and MeCP2E1 is suggested to be the relevant isoform for RTT. However, due to the unavailability of MeCP2 isoform-specific antibodies, the endogenous expression pattern of MeCP2E1 is unknown. To gain insight into the expression of MeCP2E1 in brain, we have developed an anti-MeCP2E1 antibody and validated its specificity in cells exogenously expressing individual MeCP2 isoforms. This antibody does not show any cross-reactivity with MeCP2E2 and detects endogenous MeCP2E1 in mice brain, with no signal in Mecp2(tm1.1Bird y/- null mice. Additionally, we show the endogenous MeCP2E1 expression throughout different brain regions in adult mice, and demonstrate its highest expression in the brain cortex. Our results also indicate that MeCP2E1 is highly expressed in primary neurons, as compared to primary astrocytes. This is the first report of the endogenous MeCP2E1 expression at the protein levels, providing novel avenues for understanding different aspects of MeCP2 function.
Rust transformation/rust compatible primers
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
Report of the CP-violation working group
International Nuclear Information System (INIS)
Hoffman, C.M.
1982-01-01
The CP-Violation Working Group met twice during the workshop. A nice summary of our present knowledge of CP-violation was presented in the talk by Prof. James W. Cronin. In the final paragraph of his talk, Prof. Cronin argues that higher precision experiments studying CP-violation at LAMPF II will be extremely important no matter what additional knowledge we acquire in the time before LAMPF II is constructed. The crucial issue at present is to uncover the underlying mechanism responsible for CP-violation. The Working Group heard several talks aimed at reviewing the theoretical status of CP-violation and the directions that future experimental efforts might take. These talks included: Kaon Experiments at KEK, T. Yamazaki, University of Tokyo; Mechanisms for CP Violation, P. Herczeg, Los Alamos; and The Experimental Status of eta 00 Experiments, J.W. Cronin, Univ. of Chicago. There were also extended discussions on which experiments appear to be the most important and how to best perform these measurements. A summary of these discussions is given
An iterative method for selecting degenerate multiplex PCR primers.
Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong
2007-01-01
Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.
Flavour Physics and CP Violation
Fleischer, Robert
2005-01-01
The starting point of these lectures is an introduction to the weak interactions of quarks and the Standard-Model description of CP violation, where the key element is the Cabibbo--Kobayashi--Maskawa matrix and the corresponding unitarity triangles. Since the B-meson system will govern the stage of (quark) flavour physics and CP violation in this decade, it will be -- after a brief look at the kaon system -- our main focus. We shall classify B-meson decays, introduce the theoretical tools to deal with them, explore the requirements for non-vanishing CP-violating asymmetries, and discuss B^0_q--B^0_q_bar mixing (q={d,s}). We will then turn to B-factory benchmark modes, discuss the physics potential of B^0_s mesons, which is particularly promising for B-decay experiments at hadron colliders, and emphasize the importance of studies of rare decays, which are absent at the tree level in the Standard Model, complement nicely the studies of CP violation, and provide interesting probes for new physics.
CP violation in the K and B systems
International Nuclear Information System (INIS)
Kayser, B.
1997-01-01
Although CP violation was discovered more than thirty years ago, its origin is still unknown. In these lectures, we describe the CP-violation effects which have been seen in K decays, and explain how CP violation can be caused by the Standard Model weak interaction. The hypothesis that this interaction is indeed the origin of CP violation will be incisively tested by future experiments on B and K decays. We explain what quantities these experiments will try to determine, and how they will be able to determine them in a theoretically clean way. To clarify the physics of the K system, we give a phase-convention-free description of CP violation in this system. We conclude by briefly exploring whether electric dipole moments actually violate CP even if CPT invariance is not assumed. (author)
CP violation in the K and B systems
International Nuclear Information System (INIS)
Kayser, B.
1996-11-01
Although CP violation was discovered more than thirty years ago, its origin is still unknown. In these lectures, we describe the CP- violating effects which have been seen in K decays, and explain how CP violation can be caused by the Standard Model weak interaction. The hypothesis that this interaction is indeed the origin of CP violation will be incisively tested by future experiments on B and K decays. We explain what quantities these experiments will try to determine, and how they will be able to determine them in a theoretically clean way. To clarify the physics of the K system, we give a phase-convention-free description of CP violation in this system. We conclude by briefly exploring whether electric dipole moments actually violate CP even if CPT invariance is not assumed
CP nonconservation in dynamically broken gauge theories
International Nuclear Information System (INIS)
Lane, K.
1981-01-01
The recent proposal of Eichten, Lane, and Preskill for CP nonconservation in electroweak gauge theories with dynamical symmetry breaking is reviewed. Through the alignment of the vacuum with the explicit chiral symmetry breaking Hamiltonian, these theories provide a natural way to understand the dynamical origin of CP nonconservation. Special attention is paid to the problem of strong CP violation. Even through all vacuum angles are zero, this problem is not automatically avoided. In the absence of strong CP violation, the neutron electric dipole moment is expected to be 10 -24 -10 -26 e-cm. A new class of models is proposed in which both strong CP violation and large /ΔS/ = 2 effects may be avoided. In these models, /ΔC/ = 2 processes such as D/sup o/ D/sup -o/ mixing may be large enough to observe
Measurement of branching ratios and CP asymmetries for the decays B0→π+π-, B0→K+π-, B0→K+K-
International Nuclear Information System (INIS)
Prothmann, Kolja Andreas
2013-01-01
We present measurements of the branching fractions and CP violation parameters for the decay channels B 0 →π + π - , B 0 →K + π - and B 0 →K + K - . The final Belle dataset of 772 million B anti B pairs produced at the Υ(4S) resonance at the KEKB asymmetric-energy e + e - collider is used. For the branching fractions, we obtain B(B 0 →π + π - )=(5.63± 0.16(stat)± 0.16(syst)) x 10 -6 , B(B 0 →K ± π -+ )=(18.71±0.25(stat)± 0.37(syst)) x 10 -6 , B(B 0 →K + K - ) -8 at 90% CL. For the CP-asymmetries, we obtain following values: A CP (B 0 →π + π - )=0.33±0.06(stat)±0.03 (syst), S CP (B 0 →π + π - )=-0.64±0.08(stat)±0.03(syst), A CP (B 0 →K ± K -+ )=-0.061±0.014(stat)±0.008 (syst), where A CP and S CP represent direct and mixing-induced CP violation, respectively. For the CP-violating weak phase φ 2 we exclude the region 23.8 2 <66.8 at the 1σ level. A model independent test of new physics using a sum rule in the Kπ system yields a mild deviation from the standard model of -0.289±0.139(stat)±0.064(syst) with a 1.9σ significance.
Higgs boson searches in CP-conserving and CP-violating MSSM scenarios with the DELPHI detector
Abdallah, J.; Adam, W.; Adzic, P.; Albrecht, T.; Alemany-Fernandez, R.; Allmendinger, T.; Allport, P.P.; Amaldi, U.; Amapane, N.; Amato, Sandra F.; Anashkin, E.; Andreazza, A.; Andringa, Sofia; Anjos, N.; Antilogus, Pierre; Apel, W-D.; Arnoud, Y.; Ask, S.; Asman, B.; Augustin, Jean-Eudes; Augustinus, A.; Baillon, P.; Ballestrero, A.; Bambade, P.; Barbier, R.; Bardin, D.; Barker, G.J.; Baroncelli, Antonio; Battaglia, Marco; Baubillier, M.; Becks, K-H.; Begalli, M.; Behrmann, A.; Ben-Haim, Eli; Benekos, N.; Benvenuti, A.; Berat, C.; Berggren, Mikael; Berntzon, L.; Bertrand, D.; Besancon, Marc; Besson, N.; Bloch, Daniel; Blom, M.; Bluj, Michal; Bonesini, Maurizio; Boonekamp, M.; Booth, PSL; Borisov, G.; Botner, Olga; Bouquet, B.; Bowcock, T.J.V.; Boyko, I.; Bracko, Marko; Brenner, R.; Brodet, E.; Bruckman, P.; Brunet, J.M.; Buschbeck, B.; Buschmann, P.; Calvi, M.; Camporesi, Tiziano; Canale, V.; Carena, F.; Castro, Nuno Filipe; Cavallo, F.; Chapkin, M.; Charpentier, Ph.; Checchia, Paolo; Chierici, R.; Chliapnikov, P.; Chudoba, J.; Chung, Suh-Urk; Cieslik, K.; Collins, P.; Contri, Roberto; Cosme, G.; Cossutti, Fabio; Costa, M.J.; Crennell, D.; Cuevas, Javier; D'Hondt, J.; Dalmau, J.; da Silva, T.; Da Silva, W.; Della Ricca, Giuseppe; De Angelis, Alessandro; De Boer, W.; De Clercq, C.; De Lotto, Barbara; De Maria, N.; De Min, A.; de Paula, L.; Di Ciaccio, L.; Di Simone, A.; Doroba, K.; Eigen, G.; Ekelof, Tord; Ellert, Mattias; Elsing, M.; Espirito Santo, Maria Catarina; Fanourakis, George K.; Feindt, Michael; Fernandez, J.; Ferrer, Antonio; Ferro, F.; Flagmeyer, U.; Foeth, H.; Fokitis, E.; Fulda-Quenzer, F.; Fuster, J.; Gandelman, Miriam; Garcia, C.; Gavillet, Philippe; Gazis, Evangelos; Gomez-Ceballos, G.; Goncalves, P.; Graziani, E.; Grosdidier, G.; Grzelak, K.; Guy, J.; Haag, C.; Hallgren, A.; Hamacher, Klaus; Hamilton, K.; Haug, S.; Hauler, F.; Hedberg, Vincent; Hennecke, M.; Herr, H.; Hoffman, J.; Holmgren, S-O.; Holt, P.J.; Houlden, M.A.; Jackson, John Neil; Jarlskog, Goran; Jarry, P.; Jeans, D.; Johansson, Erik Karl; Johansson, P.D.; Jonsson, P.; Joram, C.; Jungermann, L.; Kapusta, Frederic; Katsanevas, S.; Katsoufis, E.; Kernel, Gabrijel; Kerzel, U.; King, B.T.; Kjaer, N.J.; Kluit, Peter; Kokkinias, P.; Kourkoumelis, C.; Kouznetsov, O.; Krumstein, Z.; Kucharczyk, M.; Lamsa, J.; Leder, G.; Ledroit, F.; Leinonen, L.; Leitner, R.; Lemonne, Jacques; Lepeltier, V.; Lesiak, T.; Liebig, W.; Liko, D.; Lipniacka, A.; Lopes, J.H.; Lopez, J.M.; Loukas, D.; Lutz, Pierre; Lyons, Louis; MacNaughton, J.; Malek, A.; Maltezos, S.; Mandl, F.; Marco, J.; Marco, R.; Marechal, B.; Margoni, M.; Marin, J-C.; Mariotti, C.; Markou, A.; Martinez-Rivero, C.; Masik, J.; Mastroyiannopoulos, N.; Matorras, F.; Matteuzzi, C.; Mazzucato, F.; Mazzucato, M.; Nulty, R.Mc; Meroni, C.; Migliore, E.; Mitaroff, W.; Mjoernmark, U.; Moa, T.; Moch, M.; Monge, R.; Montenegro, J.; Moraes, D.; Moreno, S.; Morettini, P.; Muller, Ulrich; Muenich, K.; Mulders, M.; Mundim Filho, Luiz Martins; Murray, W.; Muryn, B.; Myatt, G.; Myklebust, T.; Nassiakou, M.; Navarria, F.; Nawrocki, K.; Nicolaidou, R.; Oblakowska-Mucha, A.; Obraztsov, V.; Olshevski, A.; Onofre, A.; Orava, R.; Osterberg, K.; Ouraou, A.; Oyanguren, A.; Paganoni, M.; Paiano, S.; Palacios, J.P.; Palka, Henryk; Papadopoulou, Th.D.; Pape, L.; Parkes, C.; Parodi, F.; Parzefall, U.; Passeri, A.; Passon, O.; Peralta, L.; Perepelitsa, V.; Perrotta, Andrea; Petrolini, Alessandro; Piedra, Jonatan; Pieri, L.; Pierre, Francois; Pimenta, M.; Piotto, E.; Poireau, V.; Pol, M.E.; Polok, G.; Pozdniakov, V.; Pukhaeva, N.; Pullia, A.; Rames, J.; Read, A.; Rebecchi, P.; Rehn, J.; Reid, D.; Reinhardt, R.; Renton, Peter; Richard, F.; Ridky, Jan; Rivero, M.; Rodriguez, D.; Romero, A.; Ronchese, Paolo; Roudeau, P.; Rovelli, T.; Ruhlmann, Vanina; Ryabtchikov, D.; Sadovsky, A.; Salmi, L.; Salt, J.; Sander, C.; Savoy-Navarro, A.; Schwickerath, U.; Segar, A.; Sekulin, R.; Siebel, Martin; Sisakian, A.; Smadja, G.; Smirnova, O.; Sokolov, Andrei Valerevich; Sopczak, A.; Sosnowski, R.; Spassov, T.; Stanitzki, M.; Stocchi, A.; Strauss, J.; Stugu, B.; Szczekowski, M.; Szeptycka, M.; Szumlak, T.; Tabarelli de Fatis, T.; Taffard, A.C.; Tegenfeldt, F.; Timmermans, Jan; Tkatchev, L.; Tobin, M.; Todorovova, S.; Tome, B.; Tonazzo, A.; Tortosa, P.; Travnicek, Petr; Treille, D.; Tristram, G.; Trochimczuk, M.; Troncon, Clara; Turluer, M-L.; Tyapkin, I.A.; Tyapkin, P.; Tzamarias, S.; Uvarov, V.; Valenti, Giovanni; Van Dam, P.; Van Eldik, J.; van Remortel, N.; Van Vulpen, I.; Vegni, G.; Veloso, Filipe; Venus, W.; Verdier, Patrice; Verzi, V.; Vilanova, D.; Vitale, Lorenzo; Vrba, V.; Wahlen, H.; Washbrook, A.J.; Weiser, C.; Wicke, D.; Wickens, J.; Wilkinson, G.; Winter, M.; Witek, M.; Yushchenko, O.; Zalewska, A.; Zalewski, P.; Zavrtanik, Danilo; Zhuravlov, V.; Zimine, N.I.; Zintchenko, Alexandre
2008-01-01
This paper presents the final interpretation of the results from DELPHI on the searches for Higgs bosons in the Minimal Supersymmetric extension of the Standard Model (MSSM). A few representative scenarios are considered, that include CP conservation and explicit CP violation in the Higgs sector. The experimental results encompass the searches for neutral Higgs bosons at LEP1 and LEP2 in final states as expected in the MSSM, as well as LEP2 searches for charged Higgs bosons and for neutral Higgs bosons decaying into hadrons independent of the quark flavour. The data reveal no significant excess with respect to background expectations. The results are translated into excluded regions of the parameter space in the various scenarios. In the CP-conserving case, these lead to limits on the masses of the lightest scalar and pseudoscalar Higgs bosons, h and A, and on tan(beta). The dependence of these limits on the top quark mass is discussed. Allowing for CP violation reduces the experimental sensitivity to Higgs b...
A very light CP-odd scalar in the Two-Higgs-Doublet Model
Larios, F; Yuan, C P; CERN. Geneva
2001-01-01
We show that a general two-Higgs-doublet model (THDM) with a very light CP-odd scalar (A) can be compatible with the rho parameter, Br(b --> s\\gamma), R_b, A_b, (g-2) of muon, Br(Upsilon --> A gamma), and the direct search via the Yukawa process at LEP. For its mass around 0.2 GeV, the muon (g-2) and Br(Upsilon --> A \\gamma) data require tan(beta) to be about 1. Consequently, A can behave like a fermiophobic CP-odd scalar and predominantly decay into a photon pair ("gamma gamma"), which registers in detectors of high energy collider experiments as a single photon signature when the momentum of A is large. We compute the partial decay width of Z --> A A A and the production rate of f \\bar{f} --> Z A A --> Z +"gamma gamma", f^' {\\bar f} --> W^{\\pm} A A --> W^\\pm + "gamma gamma" and f \\bar f --> H^+ H^- --> W^+ W^- A A --> W^+ W^- + "gamma gamma" at high energy colliders such as LEP, Tevatron, LHC, and future Linear Colliders. Other production mechanisms of a light A, such as gg --> h --> AA --> "gamma gamma", a...
Bioinformatic tools and guideline for PCR primer design | Abd ...
African Journals Online (AJOL)
Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...
Draht, Muriel X G; Smits, Kim M; Jooste, Valérie; Tournier, Benjamin; Vervoort, Martijn; Ramaekers, Chantal; Chapusot, Caroline; Weijenberg, Matty P; van Engeland, Manon; Melotte, Veerle
2016-01-01
Already since the 1990s, promoter CpG island methylation markers have been considered promising diagnostic, prognostic, and predictive cancer biomarkers. However, so far, only a limited number of DNA methylation markers have been introduced into clinical practice. One reason why the vast majority of methylation markers do not translate into clinical applications is lack of independent validation of methylation markers, often caused by differences in methylation analysis techniques. We recently described RET promoter CpG island methylation as a potential prognostic marker in stage II colorectal cancer (CRC) patients of two independent series. In the current study, we analyzed the RET promoter CpG island methylation of 241 stage II colon cancer patients by direct methylation-specific PCR (MSP), nested-MSP, pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM). All primers were designed as close as possible to the same genomic region. In order to investigate the effect of different DNA methylation assays on patient outcome, we assessed the clinical sensitivity and specificity as well as the association of RET methylation with overall survival for three and five years of follow-up. Using direct-MSP and nested-MSP, 12.0 % (25/209) and 29.6 % (71/240) of the patients showed RET promoter CpG island methylation. Methylation frequencies detected by pyrosequencing were related to the threshold for positivity that defined RET methylation. Methylation frequencies obtained by pyrosequencing (threshold for positivity at 20 %) and MS-HRM were 13.3 % (32/240) and 13.8 % (33/239), respectively. The pyrosequencing threshold for positivity of 20 % showed the best correlation with MS-HRM and direct-MSP results. Nested-MSP detected RET promoter CpG island methylation in deceased patients with a higher sensitivity (33.1 %) compared to direct-MSP (10.7 %), pyrosequencing (14.4 %), and MS-HRM (15.4 %). While RET methylation frequencies detected by nested
CP violation in the baryon sector
Smith, Eluned Anne
2017-01-01
The study of CP violation in the baryon sector is still a relatively new field and offers the possibility to make many CP measurements which could complement those performed in the meson sector. This is especially true of late given the large number of baryons currently being produced at the LHC. Such measurements could help further over-constrain the CKM unitary triangle, as well as furthering our understand of baryongenesis. These proceedings will give an overview of the current state of the search for CP violation in the baryon sector.
CP violation in CMS expected performance
Stefanescu, J
1999-01-01
The CMS experiment can contribute significantly to the measurement of the CP violation asymmetries. A recent evaluation of the expected precision on the CP violation parameter sin 2 beta in the channel B /sub d//sup 0/ to J/ psi $9 K/sub s//sup 0/ has been performed using a simulation of the CMS tracker including full pattern recognition. CMS has also studied the possibility to observe CP violation in the decay channel B/sub s//sup 0/ to J/ psi phi . The $9 results of these studies are reviewed. (7 refs).
Testing CP in K/sub μ/3 decays
International Nuclear Information System (INIS)
Leurer, M.
1989-01-01
K factories will open the way for high-precision CP tests in K/sub μ/ 3 decays. The standard model does not predict CP breaking in this process. We consider here the effects of nonstandard interactions mediated by vector and scalar particles and by leptoquarks. We show that, for the only experimentally measurable quantity, vector particles alone never induce CP violation, and give a general expression for the CP breaking induced by scalars and leptoquarks
Robotic dismantlement systems at the CP-5 reactor D and D project
International Nuclear Information System (INIS)
Seifert, L. S.
1998-01-01
The Chicago Pile 5 (CP-5) Research Reactor Facility is currently undergoing decontamination and decommissioning (D and D) at the Argonne National Laboratory (ANL) Illinois site. CP-5 was the principle nuclear reactor used to produce neutrons for scientific research at Argonne from 1954 to 1979. The CP-5 reactor was a heavy-water cooled and moderated, enriched uranium-fueled reactor with a graphite reflector. The CP-5 D and D project includes the disassembly, segmentation and removal of all the radioactive components, equipment and structures associated with the CP-5 facility. The Department of Energy's Robotics Technology Development Program and the Federal Energy Technology Center, Morgantown Office provided teleoperated, remote systems for use in the dismantlement of the CP-5 reactor assembly for tasks requiring remote dismantlement as part of the EM-50 Large-Scale Demonstration Program (LSDP). The teleoperated systems provided were the Dual Arm Work Platform (DAWP), the Rosie Mobile Teleoperated Robot Work System (ROSIE), and a remotely-operated crane control system with installed swing-reduction control system. Another remotely operated apparatus, a Brokk BM250, was loaned to ANL by the Princeton Plasma Physics Laboratory (PPPL). This machine is not teleoperated and was not part of the LSDP, but deserves some mention in this discussion. The DAWP is a robotic dismantlement system that includes a pair of Schilling Robotic Systems Titan III hydraulic manipulator arms mounted to a specially designed support platform: a hydraulic power unit (HPU) and a remote operator console. The DAWP is designed to be crane-suspended for remote positioning. ROSIE, developed by RedZone Robotics, Inc. is a mobile, electro-hydraulic, omnidirectional platform with a heavy-duty telescoping boom mounted to the platform's deck. The work system includes the mobile platform (locomotor), a power distribution unit (PDU) and a remote operator console. ROSIE moves about the reactor building
Search for CP-violation in the charm sector at LHCb
International Nuclear Information System (INIS)
Coombes, M.P.
2014-01-01
Results of searches for CP-violation in charm hadrons and measurements of CP-violating and D 0 mixing parameters are presented for LHCb data accumulated during 2010 and 2011. A time-integrated CP-violating asymmetry in two-body D 0 decays constitutes the first evidence of CP violation in the decay of charm hadrons. No CP violation has been found in D + → K - K + π + decays. Concerning mixing and time-dependent CP asymmetries in D 0 decays, results are compatible with the absence of CP-violation
Quinn, H. R.
1993-02-01
Given the varied backgrounds of the members of this audience this talk will be a grab bag of topics related to the general theme of CP Violation. I do not have time to dwell in detail on any of them. First, for the astronomers and astrophysicists among you, I want to begin by reviewing the experimental status of evidence for CP violation in particle processes. There is only one system where this has been observed, and that is in the decays of neutral K mesons.
International Nuclear Information System (INIS)
Quinn, H.R.
1993-02-01
Given the varied backgrounds of the members of this audience this talk will be a grab bag of topics related to the general theme of CP Violation. I do not have time to dwell in detail on any of them. First, for the astronomers and astrophysicists among you, I want to begin by reviewing the experimental status of evidence for CP violation in particle processes. There is only one system where this has been observed, and that is in the decays of neutral K mesons
Flavour physics and CP violation
Indian Academy of Sciences (India)
It is well known that the study of flavour physics and CP violation is very important to critically test the Standard Model and to look for possible signature of new physics beyond it. The observation of CP violation in kaon system in 1964 has ignited a lot of experimental and theoretical efforts to understand its origin and to look ...
Medium Caliber Lead-Free Electric Primer. Version 2
2012-09-01
2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in
Directory of Open Access Journals (Sweden)
Jesse B. Therien
2017-07-01
Full Text Available The first generation of biochemical studies of complex, iron-sulfur-cluster-containing [FeFe]-hydrogenases and Mo-nitrogenase were carried out on enzymes purified from Clostridium pasteurianum (strain W5. Previous studies suggested that two distinct [FeFe]-hydrogenases are expressed differentially under nitrogen-fixing and non-nitrogen-fixing conditions. As a result, the first characterized [FeFe]-hydrogenase (CpI is presumed to have a primary role in central metabolism, recycling reduced electron carriers that accumulate during fermentation via proton reduction. A role for capturing reducing equivalents released as hydrogen during nitrogen fixation has been proposed for the second hydrogenase, CpII. Biochemical characterization of CpI and CpII indicated CpI has extremely high hydrogen production activity in comparison to CpII, while CpII has elevated hydrogen oxidation activity in comparison to CpI when assayed under the same conditions. This suggests that these enzymes have evolved a catalytic bias to support their respective physiological functions. Using the published genome of C. pasteurianum (strain W5 hydrogenase sequences were identified, including the already known [NiFe]-hydrogenase, CpI, and CpII sequences, and a third hydrogenase, CpIII was identified in the genome as well. Quantitative real-time PCR experiments were performed in order to analyze transcript abundance of the hydrogenases under diazotrophic and non-diazotrophic growth conditions. There is a markedly reduced level of CpI gene expression together with concomitant increases in CpII gene expression under nitrogen-fixing conditions. Structure-based analyses of the CpI and CpII sequences reveal variations in their catalytic sites that may contribute to their alternative physiological roles. This work demonstrates that the physiological roles of CpI and CpII are to evolve and to consume hydrogen, respectively, in concurrence with their catalytic activities in vitro, with Cp
Therien, Jesse B.; Artz, Jacob H.; Poudel, Saroj; Hamilton, Trinity L.; Liu, Zhenfeng; Noone, Seth M.; Adams, Michael W. W.; King, Paul W.; Bryant, Donald A.; Boyd, Eric S.; Peters, John W.
2017-01-01
The first generation of biochemical studies of complex, iron-sulfur-cluster-containing [FeFe]-hydrogenases and Mo-nitrogenase were carried out on enzymes purified from Clostridium pasteurianum (strain W5). Previous studies suggested that two distinct [FeFe]-hydrogenases are expressed differentially under nitrogen-fixing and non-nitrogen-fixing conditions. As a result, the first characterized [FeFe]-hydrogenase (CpI) is presumed to have a primary role in central metabolism, recycling reduced electron carriers that accumulate during fermentation via proton reduction. A role for capturing reducing equivalents released as hydrogen during nitrogen fixation has been proposed for the second hydrogenase, CpII. Biochemical characterization of CpI and CpII indicated CpI has extremely high hydrogen production activity in comparison to CpII, while CpII has elevated hydrogen oxidation activity in comparison to CpI when assayed under the same conditions. This suggests that these enzymes have evolved a catalytic bias to support their respective physiological functions. Using the published genome of C. pasteurianum (strain W5) hydrogenase sequences were identified, including the already known [NiFe]-hydrogenase, CpI, and CpII sequences, and a third hydrogenase, CpIII was identified in the genome as well. Quantitative real-time PCR experiments were performed in order to analyze transcript abundance of the hydrogenases under diazotrophic and non-diazotrophic growth conditions. There is a markedly reduced level of CpI gene expression together with concomitant increases in CpII gene expression under nitrogen-fixing conditions. Structure-based analyses of the CpI and CpII sequences reveal variations in their catalytic sites that may contribute to their alternative physiological roles. This work demonstrates that the physiological roles of CpI and CpII are to evolve and to consume hydrogen, respectively, in concurrence with their catalytic activities in vitro, with CpII capturing excess
Measurement of the direct $CP$-violating parameter $A_{CP}$ in the decay $D^+ \\to K^-\\pi^+\\pi^+$
Abazov, Victor Mukhamedovich; Acharya, Bannanje Sripath; Adams, Mark Raymond; Adams, Todd; Agnew, James P; Alexeev, Guennadi D; Alkhazov, Georgiy D; Alton, Andrew K; Askew, Andrew Warren; Atkins, Scott; Augsten, Kamil; Avila, Carlos A; Badaud, Frederique; Bagby, Linda F; Baldin, Boris; Bandurin, Dmitry V; Banerjee, Sunanda; Barberis, Emanuela; Baringer, Philip S; Bartlett, JFrederick; Bassler, Ursula Rita; Bazterra, Victor; Bean, Alice L; Begalli, Marcia; Bellantoni, Leo; Beri, Suman B; Bernardi, Gregorio; Bernhard, Ralf Patrick; Bertram, Iain A; Besancon, Marc; Beuselinck, Raymond; Bhat, Pushpalatha C; Bhatia, Sudeep; Bhatnagar, Vipin; Blazey, Gerald Charles; Blessing, Susan K; Bloom, Kenneth A; Boehnlein, Amber S; Boline, Daniel Dooley; Boos, Edward E; Borissov, Guennadi; Borysova, Maryna; Brandt, Andrew; Brandt, Oleg; Brock, Raymond L; Bross, Alan D; Brown, Duncan Paul; Bu, Xue-Bing; Buehler, Marc; Buescher, Volker; Bunichev, Viacheslav Yevgenyevich; Burdin, Sergey; Buszello, Claus Peter; Camacho-Perez, Enrique; Casey, Brendan Cameron Kieran; Castilla-Valdez, Heriberto; Caughron, Seth Aaron; Chakrabarti, Subhendu; Chan, Kwok Ming Leo; Chandra, Avdhesh; Chapon, Emilien; Chen, Guo; Cho, Sung-Woong; Choi, Suyong; Choudhary, Brajesh C; Cihangir, Selcuk; Claes, Daniel R; Clutter, Justace Randall; Cooke, Michael P; Cooper, William Edward; Corcoran, Marjorie D; Couderc, Fabrice; Cousinou, Marie-Claude; Cutts, David; Das, Amitabha; Davies, Gavin John; de Jong, Sijbrand Jan; De La Cruz-Burelo, Eduard; Deliot, Frederic; Demina, Regina; Denisov, Dmitri S; Denisov, Sergei P; Desai, Satish Vijay; Deterre, Cecile; DeVaughan, Kayle Otis; Diehl, HThomas; Diesburg, Michael; Ding, Pengfei; Dominguez, DAaron M; Dubey, Abhinav Kumar; Dudko, Lev V; Duperrin, Arnaud; Dutt, Suneel; Eads, Michael T; Edmunds, Daniel L; Ellison, John A; Elvira, VDaniel; Enari, Yuji; Evans, Harold G; Evdokimov, Valeri N; Faure, Alexandre; Feng, Lei; Ferbel, Thomas; Fiedler, Frank; Filthaut, Frank; Fisher, Wade Cameron; Fisk, HEugene; Fortner, Michael R; Fox, Harald; Fuess, Stuart C; Garbincius, Peter H; Garcia-Bellido, Aran; Garcia-Gonzalez, Jose Andres; Gavrilov, Vladimir B; Geng, Weigang; Gerber, Cecilia Elena; Gershtein, Yuri S; Ginther, George E; Gogota, Olga; Golovanov, Georgy Anatolievich; Grannis, Paul D; Greder, Sebastien; Greenlee, Herbert B; Grenier, Gerald Jean; Gris, Phillipe Luc; Grivaz, Jean-Francois; Grohsjean, Alexander; Gruenendahl, Stefan; Gruenewald, Martin Werner; Guillemin, Thibault; Gutierrez, Gaston R; Gutierrez, Phillip; Haley, Joseph Glenn Biddle; Han, Liang; Harder, Kristian; Harel, Amnon; Hauptman, John Michael; Hays, Jonathan M; Head, Tim; Hebbeker, Thomas; Hedin, David R; Hegab, Hatim; Heinson, Ann; Heintz, Ulrich; Hensel, Carsten; Heredia-De La Cruz, Ivan; Herner, Kenneth Richard; Hesketh, Gavin G; Hildreth, Michael D; Hirosky, Robert James; Hoang, Trang; Hobbs, John D; Hoeneisen, Bruce; Hogan, Julie; Hohlfeld, Mark; Holzbauer, Jenny Lyn; Howley, Ian James; Hubacek, Zdenek; Hynek, Vlastislav; Iashvili, Ia; Ilchenko, Yuriy; Illingworth, Robert A; Ito, Albert S; Jabeen, Shabnam; Jaffre, Michel J; Jayasinghe, Ayesh; Jeong, Min-Soo; Jesik, Richard L; Jiang, Peng; Johns, Kenneth Arthur; Johnson, Emily; Johnson, Marvin E; Jonckheere, Alan M; Jonsson, Per Martin; Joshi, Jyoti; Jung, Andreas Werner; Juste, Aurelio; Kajfasz, Eric; Karmanov, Dmitriy Y; Katsanos, Ioannis; Kaur, Manbir; Kehoe, Robert Leo Patrick; Kermiche, Smain; Khalatyan, Norayr; Khanov, Alexander; Kharchilava, Avto; Kharzheev, Yuri N; Kiselevich, Ivan Lvovich; Kohli, Jatinder M; Kozelov, Alexander V; Kraus, James Alexander; Kumar, Ashish; Kupco, Alexander; Kurca, Tibor; Kuzmin, Valentin Alexandrovich; Lammers, Sabine Wedam; Lebrun, Patrice; Lee, Hyeon-Seung; Lee, Seh-Wook; Lee, William M; Lei, Xiaowen; Lellouch, Jeremie; Li, Dikai; Li, Hengne; Li, Liang; Li, Qi-Zhong; Lim, Jeong Ku; Lincoln, Donald W; Linnemann, James Thomas; Lipaev, Vladimir V; Lipton, Ronald J; Liu, Huanzhao; Liu, Yanwen; Lobodenko, Alexandre; Lokajicek, Milos; Lopes de Sa, Rafael; Luna-Garcia, Rene; Lyon, Adam Leonard; Maciel, Arthur KA; Madar, Romain; Magana-Villalba, Ricardo; Malik, Sudhir; Malyshev, Vladimir L; Mansour, Jason; Martinez-Ortega, Jorge; McCarthy, Robert L; Mcgivern, Carrie Lynne; Meijer, Melvin M; Melnitchouk, Alexander S; Menezes, Diego D; Mercadante, Pedro Galli; Merkin, Mikhail M; Meyer, Arnd; Meyer, Jorg Manfred; Miconi, Florian; Mondal, Naba K; Mulhearn, Michael James; Nagy, Elemer; Narain, Meenakshi; Nayyar, Ruchika; Neal, Homer A; Negret, Juan Pablo; Neustroev, Petr V; Nguyen, Huong Thi; Nunnemann, Thomas P; Hernandez Orduna, Jose de Jesus; Osman, Nicolas Ahmed; Osta, Jyotsna; Pal, Arnab; Parashar, Neeti; Parihar, Vivek; Park, Sung Keun; Partridge, Richard A; Parua, Nirmalya; Patwa, Abid; Penning, Bjoern; Perfilov, Maxim Anatolyevich; Peters, Reinhild Yvonne Fatima; Petridis, Konstantinos; Petrillo, Gianluca; Petroff, Pierre; Pleier, Marc-Andre; Podstavkov, Vladimir M; Popov, Alexey V; Prewitt, Michelle; Price, Darren; Prokopenko, Nikolay N; Qian, Jianming; Quadt, Arnulf; Quinn, Breese; Ratoff, Peter N; Razumov, Ivan A; Ripp-Baudot, Isabelle; Rizatdinova, Flera; Rominsky, Mandy Kathleen; Ross, Anthony; Royon, Christophe; Rubinov, Paul Michael; Ruchti, Randal C; Sajot, Gerard; Sanchez-Hernandez, Alberto; Sanders, Michiel P; Santos, Angelo Souza; Savage, David G; Savitskyi, Mykola; Sawyer, HLee; Scanlon, Timothy P; Schamberger, RDean; Scheglov, Yury A; Schellman, Heidi M; Schwanenberger, Christian; Schwienhorst, Reinhard H; Sekaric, Jadranka; Severini, Horst; Shabalina, Elizaveta K; Shary, Viacheslav V; Shaw, Savanna; Shchukin, Andrey A; Simak, Vladislav J; Skubic, Patrick Louis; Slattery, Paul F; Smirnov, Dmitri V; Snow, Gregory R; Snow, Joel Mark; Snyder, Scott Stuart; Soldner-Rembold, Stefan; Sonnenschein, Lars; Soustruznik, Karel; Stark, Jan; Stoyanova, Dina A; Strauss, Michael G; Suter, Louise; Svoisky, Peter V; Titov, Maxim; Tokmenin, Valeriy V; Tsai, Yun-Tse; Tsybychev, Dmitri; Tuchming, Boris; Tully, Christopher George T; Uvarov, Lev; Uvarov, Sergey L; Uzunyan, Sergey A; Van Kooten, Richard J; van Leeuwen, Willem M; Varelas, Nikos; Varnes, Erich W; Vasilyev, Igor A; Verkheev, Alexander Yurievich; Vertogradov, Leonid S; Verzocchi, Marco; Vesterinen, Mika; Vilanova, Didier; Vokac, Petr; Wahl, Horst D; Wang, Michael HLS; Warchol, Jadwiga; Watts, Gordon Thomas; Wayne, Mitchell R; Weichert, Jonas; Welty-Rieger, Leah Christine; Williams, Mark Richard James; Wilson, Graham Wallace; Wobisch, Markus; Wood, Darien Robert; Wyatt, Terence R; Xie, Yunhe; Yamada, Ryuji; Yang, Siqi; Yasuda, Takahiro; Yatsunenko, Yuriy A; Ye, Wanyu; Ye, Zhenyu; Yin, Hang; Yip, Kin; Youn, Sungwoo; Yu, Jiaming; Zennamo, Joseph; Zhao, Tianqi Gilbert; Zhou, Bing; Zhu, Junjie; Zielinski, Marek; Zieminska, Daria; Zivkovic, Lidija
2014-12-11
We measure the direct CP-violating parameter A_CP for the decay of the charged charm meson, D+ -> K-pi+pi+ (and charge conjugate), using the full 10.4 fb-1 sample of ppbar collisions at sqrt(s) = 1.96 TeV collected by the D0 detector at the Fermilab Tevatron collider. We extract the raw reconstructed charge asymmetry by fitting the invariant mass distributions for the sum and difference of charge-specific samples. This quantity is then corrected for detector-related asymmetries using data-driven methods and for possible physics asymmetries (from B -> D processes) using input from Monte Carlo simulation. We measure A_CP = [-0.16 +- 0.15 (stat.) +- 0.09 (syst.)]%, which is consistent with zero, as expected from the standard model prediction of CP conservation, and is the most precise measurement of this quantity to date
Search for CP violation in tt̄ production and decay in proton-proton collisions at √s=8 TeV
Energy Technology Data Exchange (ETDEWEB)
Khachatryan, V.; Sirunyan, A.M.; Tumasyan, A. [Yerevan Physics Institute, Yerevan (Armenia); Adam, W. [Institut für Hochenergiephysik, Wien (Austria); Collaboration: The CMS collaboration; and others
2017-03-20
The results of a first search for CP violation in the production and decay of top quark-antiquark (tt̄) pairs are presented. The search is based on asymmetries in T-odd, triple-product correlation observables, where T is the time-reversal operator. The analysis uses a sample of proton-proton collisions at √s=8 TeV collected by the CMS experiment, corresponding to an integrated luminosity of 19.7 fb{sup −1}. Events are selected having one electron or muon and at least four jets. The T-odd observables are measured using four-momentum vectors associated with tt̄ production and decay. The measured asymmetries exhibit no evidence for CP-violating effects, consistent with the expectation from the standard model.
Evidence for non-CpG methylation in mammals
DEFF Research Database (Denmark)
Yan, Jie; Zierath, Juleen R; Barres, Romain
2011-01-01
In mammals, the existence of cytosine methylation on non-CpG sequences is controversial. Here, we adapted a LuminoMetric-based Assay (LUMA) to determine global non-CpG methylation levels in rodent and human tissues. We observed that......In mammals, the existence of cytosine methylation on non-CpG sequences is controversial. Here, we adapted a LuminoMetric-based Assay (LUMA) to determine global non-CpG methylation levels in rodent and human tissues. We observed that...
Strong-Weak CP Hierarchy from Non-Renormalization Theorems
Energy Technology Data Exchange (ETDEWEB)
Hiller, Gudrun
2002-01-28
We point out that the hierarchy between the measured values of the CKM phase and the strong CP phase has a natural origin in supersymmetry with spontaneous CP violation and low energy supersymmetry breaking. The underlying reason is simple and elegant: in supersymmetry the strong CP phase is protected by an exact non-renormalization theorem while the CKM phase is not. We present explicit examples of models which exploit this fact and discuss corrections to the non-renormalization theorem in the presence of supersymmetry breaking. This framework for solving the strong CP problem has generic predictions for the superpartner spectrum, for CP and flavor violation, and predicts a preferred range of values for electric dipole moments.
Testing non-standard CP violation in neutrino propagation
International Nuclear Information System (INIS)
Winter, Walter
2009-01-01
Non-standard physics which can be described by effective four fermion interactions may be an additional source of CP violation in the neutrino propagation. We discuss the detectability of such a CP violation at a neutrino factory. We assume the current baseline setup of the international design study of a neutrino factory (IDS-NF) for the simulation. We find that the CP violation from certain non-standard interactions is, in principle, detectable significantly below their current bounds - even if there is no CP violation in the standard oscillation framework. Therefore, a new physics effect might be mis-interpreted as the canonical Dirac CP violation, and a possibly even more exciting effect might be missed
Energy Technology Data Exchange (ETDEWEB)
Dallapiccola, Carlo
2001-07-25
We present measurements of the branching fractions and a search for CP-violating charge asymmetries in charmless hadronic decays of B mesons into two-body final states of kaons and pions. The results are based on a data sample of approximately 23 million BB(bar) pairs collected by the BABAR detector at the PEP-II asymmetric B Factory at SLAC.
Kalinowski, Jan
1999-01-01
In a general two-Higgs-doublet model with CP violation in the Higgs sector, the three neutral physical Higgs bosons have no definite CP properties. A new sum rule relating Yukawa and Higgs-Z couplings implies that a neutral Higgs boson cannot escape detection at an e^+e^- collider if it is kinematically accessible in Z+Higgs, $b\\bar b+$Higgs and $t\\bar t+$Higgs production, irrespective of the mixing angles and the masses of the other neutral Higgs bosons. The implications of the sum rules for...
Recent Results on T and CP Violation at BABAR
Energy Technology Data Exchange (ETDEWEB)
Perez Perez, Alejandro [Istituto Nazionale di Fisica Nucleare (INFN), Pisa (Italy).
2015-02-06
CP-violation (CPV) and Time-reversal violation (TRV) are intimately related through the CPT theorem: if one of these discrete symmetries is violated the other one has to be violated in such a way to conserve CPT. Although CPV in the B0B0-bar system has been established by the B-factories, implying indirectly TRV, there is still no direct evidence of TRV. We report on the observation of TRV in the B-meson system performed with a dataset of 468 × 106 BB-bar pairs produced in Υ(4S) decays collected by the BABAR detector at the PEP-II asymmetric-energy e+e- collider at the SLAC National Accelerator Laboratory. We also report on other CPV measurements recently performed on the B-meson system
Directory of Open Access Journals (Sweden)
reni heryani
2017-12-01
Full Text Available Dysmenorrhea / nyeri haid adalah nyeri menjelang atau selama haid, yang kadang menyebabkan gangguan aktivitas dan memerlukan istirahat. Nyeri menstruasi atau dysmenorrhea adalah kekakuan atau kejang di bagian bawah perut akibat menstruasi dan produksi zat prostaglandin yang terjadi pada waktu menjelang atau selama menstruasi Dismenorea primer didefinisikan sebagai nyeri haid yang tidak berhubungan dengan kondisi patologis pelvis. Nyeri yang biasanya dirasakan adalah kram yang timbul-hilang atau nyeri yang terus menerus biasanya pada perut bagian bawah yang menjalar sampai ke punggung bagian bawah. Salah satu exercise yang dapat diberikan untuk nyeri dysmenorrhea ini adalah dengan pemberian terapi musik dan back exercise.Tujuan penelitian ini adalah untuk mengetahui efektivitas pemberian terapi musik dan back exercise terhadap penurunan nyeri dysmenorrhea. Penelitian ini merupakan penelitian Quasi experimental pre and post test with control group design. Populasi pada penelitian ini adalah remaja putri yang sedang mengalami menstruasi dengan nyeri dysmenorrhea dengan jumlah responden sebanyak 50 orang yang dibagi menjadi 2 kelompok. Kelompok 1 sebagai kelompok eksperimen, diberikan perlakukan terapi musik (mozart dan back exercise dan kelompok 2 sebagai kelompok kontrol yang tidak diberikan terapi musik (mozart dan back exercise. Pada penelitian ini menggunakan uji hipotesis Paired Sample T- test untuk mengetahui pengaruh pemberian terapi musik dan back exercice terhadap dysmenorrhea primer. Kemudian untuk uji beda pengaruh antara kelompok kontrol dan kelompok perlakuan digunakan uji Independent Sample T-test.Tingkat nyeri dismenorhoea sebelum diberikan perlakuan adalah nyeri tingkat sedang (rata-rata : 2,08 dan setelah diberikan perlakuan adalah adalah nyeri tingkat ringan (rata rata = 0,88. Uji efektifitas menggunakan Paired Sample T-Test pada kelompok eksperimen menunjukkan hasil p= 0,00 dan pada kelompok kontrol p= 0,00. Dengan
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Value for money assessment for public-private partnerships : a primer.
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.
Khandaker, Gulam; Smithers-Sheedy, Hayley; Islam, Johurul; Alam, Monzurul; Jung, Jenny; Novak, Iona; Booy, Robert; Jones, Cheryl; Badawi, Nadia; Muhit, Mohammad
2015-09-25
The causes and pathogenesis of cerebral palsy (CP) are all poorly understood, particularly in low- and middle-income countries (LMIC). There are gaps in knowledge about CP in Bangladesh, especially in the spheres of epidemiological research, intervention and service utilization. In high-income countries CP registers have made substantial contributions to our understanding of CP. In this paper, we describe a pilot study protocol to develop, implement, and evaluate a CP population register in Bangladesh (i.e., Bangladesh Cerebral Palsy Register - BCPR) to facilitate studies on prevalence, severity, aetiology, associated impairments and risk factors for CP. The BCPR will utilise a modified version of the Australian Cerebral Palsy Register (ACPR) on a secured web-based platform hosted by the Cerebral Palsy Alliance Research Institute, Australia. A standard BCPR record form (i.e., data collection form) has been developed in consultation with local and international experts. Using this form, the BPCR will capture information about maternal health, birth history and the nature of disability in all children with CP aged CP will be identified by using the community based Key Informants Method (KIM). Data from the completed BPCR record together with details of assessment by a research physician will be entered into an online data repository. Once implemented, BCPR will be, to the best of our knowledge, the first formalised CP register from a LMIC. Establishment of the BCPR will enable estimates of prevalence; facilitate clinical surveillance and promote research to improve the care of individuals with CP in Bangladesh.
CP violation searches in the charm sector at LHCb
CERN. Geneva
2016-01-01
LHCb has collected the world's largest sample of charmed hadrons, thus enabling measurements of direct and indirect CP violation parameters of D^0 mesons to be made with unprecedented precision. The difference in CP asymmetries between the singly Cabibbo-suppressed (SCS) D^0 -> K+K- and D^0 -> pi+pi- decays (Delta A_CP) has emerged as a powerful observable to search for direct CPV in the charm sector. By taking the difference between the two modes, most of the asymmetries induced by the detector or coming from the production mechanism are cancelled. The measurement of Delta A_CP done at LHCb is the most precise measurement of a time-integrated CP asymmetry in the charm sector from a single experiment, with a precision reaching the sub-permille level. Two independent measurements of Delta A_CP based on complementary data sets will be presented. Related 2-body searches and searches for direct CP violation in multi-body decays of the D^0 mesons will be discussed. Indirect CP violation in charm is measured throug...
Directory of Open Access Journals (Sweden)
Austin M. Wofford
2014-04-01
Full Text Available Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences ofycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group.
Wofford, Austin M.; Finch, Kristen; Bigott, Adam; Willyard, Ann
2014-01-01
• Premise of the study: Recently released Pinus plastome sequences support characterization of 15 plastid simple sequence repeat (cpSSR) loci originally published for P. contorta and P. thunbergii. This allows selection of loci for single-tube PCR multiplexed genotyping in any subsection of the genus. • Methods: Unique placement of primers and primer conservation across the genus were investigated, and a set of six loci were selected for single-tube multiplexing. We compared interspecific variation between cpSSRs and nucleotide sequences of ycf1 and tested intraspecific variation for cpSSRs using 911 samples in the P. ponderosa species complex. • Results: The cpSSR loci contain mononucleotide and complex repeats with additional length variation in flanking regions. They are not located in hypervariable regions, and most primers are conserved across the genus. A single PCR per sample multiplexed for six loci yielded 45 alleles in 911 samples. • Discussion: The protocol allows efficient genotyping of many samples. The cpSSR loci are too variable for Pinus phylogenies but are useful for the study of genetic structure within and among populations. The multiplex method could easily be extended to other plant groups by choosing primers for cpSSR loci in a plastome alignment for the target group. PMID:25202625
$CP$ violation in the B system at LHCb
AUTHOR|(CDS)2067431
2014-01-01
A selection of recent LHCb results on $CP$ violation in the $B$ system is presented. These include direct $CP$ violation measurements in $B^0 \\to \\phi K^*(892)^0$, $B_{(s)}^0 \\to K^\\pm\\pi^\\pm$, $B^\\pm \\to K^\\pm \\pi^+\\pi^-$, $B^\\pm \\to K^\\pm K^+K^-$ and $B^\\pm \\to \\phi K^\\pm$ decays; time-dependent $CP$ violation measurements in $B_s^0 \\to K^+K^-$ and $B^0 \\to \\pi^+\\pi^-$ decays; determination of the flavour-specific $CP$-violating asymmetry $a_{sl}^s$ in $B_s^0$ decays; and study of the mixing-induced $CP$ violation in $B_s^0 \\to J/\\psi K^+K^-$ and $B_s^0 \\to J/\\psi \\pi^+\\pi^-$ decays.
Four-dimensional CP2 model on a lattice
International Nuclear Information System (INIS)
Bitar, K.M.; Raja, R.
1983-01-01
We investigate the phenomenon of dynamical generation of gauge interactions from CP/sup N/-1 models in four dimensions. We do this for the CP 2 model on a lattice. The phase diagram of a model that interpolates between CP 2 and U(1) gauge theory on a lattice is first mapped out. The potential between static charges in various regions of this diagram is also measured. Contrary to hopes based on the large-N behavior of similar models in two dimensions and on our phase diagram, we find that the potentials generated by CP 2 do not bear any resemblance to those of U(1). They are rather similar to the Higgs phase of an Abelian gauge theory in both phases displayed by CP 2
Stelzer, Adrian C; Hrobárik, Peter; Braun, Thomas; Kaupp, Martin; Braun-Cula, Beatrice
2016-05-16
The subvalent aluminum compound [Cp*Al]4 (1) reacts with dioxygen, N2O, or sulfur to yield the heterocubane complexes [Cp*AlX]4 [X = O (2) and S (3)]. Treatment of [Cp*AlO]4 (2) with (tBuO)3SiOH gave [(tBuO)3SiOAlO]4 (6) and Cp*H. The structures and spectroscopic data of the Al clusters are supported by density functional theory (DFT) calculations, which also demonstrate the importance of noncovalent interactions (NCI) in oligomeric Al(I) complexes as well as in [Cp*AlS]4 and the heavier homologues of Se and Te. The computed (27)Al NMR shifts indicate a deshielding at the Al centers with increasing electronegativity of the chalcogen atom as well as significant spin-orbit shielding effects within the heavier heterocubane [Al4E4] cores. Further hydrolysis of 6 with an additional amount of silanol in the presence of water resulted in the formation of [Al4(OH)6(OH2)2(OSiOtBu3)6] (7), which shows a structural motif found in boehmite and diaspore.
Ginsberg, Naomi S.; Davis, Jeffrey A.; Ballottari, Matteo; Cheng, Yuan-Chung; Bassi, Roberto; Fleming, Graham R.
2011-01-01
The CP29 light harvesting complex from green plants is a pigment-protein complex believed to collect, conduct, and quench electronic excitation energy in photosynthesis. We have spectroscopically determined the relative angle between electronic transition dipole moments of its chlorophyll excitation energy transfer pairs in their local protein environments without relying on simulations or an X-ray crystal structure. To do so, we measure a basis set of polarized 2D electronic spectra and isolate their absorptive components on account of the tensor relation between the light polarization sequences used to obtain them. This broadly applicable advance further enhances the acuity of polarized 2D electronic spectroscopy and provides a general means to initiate or feed back on the structural modeling of electronically-coupled chromophores in condensed phase systems, tightening the inferred relations between the spatial and electronic landscapes of ultrafast energy flow. We also discuss the pigment composition of CP29 in the context of light harvesting, energy channeling, and photoprotection within photosystem II. PMID:21321222
Toimintaterapeuttinen nukkekoti CP-vammaisille lapsille
Ruotsalainen, Ulla; Tokola, Eveliina
2009-01-01
Toiminnallisen opinnäytetyön tarkoitus oli suunnitella ja rakentaa toimintaterapeuttinen nukkekoti CP-vammaisille lapsille. Työn toimeksiantajana oli toimintaterapeutti Päivi Raitanen Terapiapajalta. Työn tavoitteena oli toteuttaa mukana kuljetettava ja lapsen pyörätuolin pöytälevylle sopiva nukkekoti, jolla leikkiminen tukee CP-vammaisen lapsen toimintaterapiaa. Yleisimpiä tavoitteita ovat muun muuassa hienomotoristen taitojen, leikkitaitojen, syy-seuraussuhteiden ja visuaalisen hahmott...
International Nuclear Information System (INIS)
Xiang, Shengyan; Liu, Zhaojun; Zhang, Baozhen; Zhou, Jing; Zhu, Bu-Dong; Ji, Jiafu; Deng, Dajun
2010-01-01
Alu methylation is correlated with the overall level of DNA methylation and recombination activity of the genome. However, the maintenance and methylation status of each CpG site within Alu elements (Alu) and its methylation status have not well characterized. This information is useful for understanding natural status of Alu in the genome and helpful for developing an optimal assay to quantify Alu hypomethylation. Bisulfite clone sequencing was carried out in 14 human gastric samples initially. A Cac8I COBRA-DHPLC assay was developed to detect methylated-Alu proportion in cell lines and 48 paired gastric carcinomas and 55 gastritis samples. DHPLC data were statistically interpreted using SPSS version 16.0. From the results of 427 Alu bisulfite clone sequences, we found that only 27.2% of CpG sites within Alu elements were preserved (4.6 of 17 analyzed CpGs, A ~ Q) and that 86.6% of remaining-CpGs were methylated. Deamination was the main reason for low preservation of methylation targets. A high correlation coefficient of methylation was observed between Alu clones and CpG site J (0.963), A (0.950), H (0.946), D (0.945). Comethylation of the sites H and J were used as an indicator of the proportion of methylated-Alu in a Cac8I COBRA-DHPLC assay. Validation studies showed that hypermethylation or hypomethylation of Alu elements in human cell lines could be detected sensitively by the assay after treatment with 5-aza-dC and M.SssI, respectively. The proportion of methylated-Alu copies in gastric carcinomas (3.01%) was significantly lower than that in the corresponding normal samples (3.19%) and gastritis biopsies (3.23%). Most Alu CpG sites are deaminated in the genome. 27% of Alu CpG sites represented in our amplification products. 87% of the remaining CpG sites are methylated. Alu hypomethylation in primary gastric carcinomas could be detected with the Cac8I COBRA-DHPLC assay quantitatively
Measurements of direct CP violation in charm decays at LHCb
INSPIRE-00257861
2013-01-01
Two searches for direct CP violation in D 0 ! h h + (where h = K or ) are presented using data corresponding to an integrated luminosity of 1.0 fb 1 collected in 2011 by LHCb in pp collisions at a centre-of-mass energy of 7 TeV. One analysis uses D 0 mesons produced via a D resonance and the other analysis uses D 0 mesons originating from semileptonic b - decays. In the rst case the avour is tagged by the charge of the accompanying pion and in the latter by the muon charge. The dierence of the CP -violating asymmetries ( A CP = A CP ( K K + ) A CP ( + )) in the two decay channels is measured to be A CP (muon tagged) = (0 : 49 0 : 30 (stat) 0 : 14 (syst))% ; A CP (pion tagged) = ( 0 : 35 0 : 15 (stat) 0 : 10 (syst))% ; A CP (LHCb) = ( 0 : 15 0 : 16)% : These results do not conrm evidence for CP violation in the charm sector
Val L. Fitch, the CP Violation, and Antimatter
dropdown arrow Site Map A-Z Index Menu Synopsis Val L. Fitch, the CP Violation, and Antimatter Resources ) 'to verify a fundamental tenet of physics, known as CP [charge-parity] symmetry, by showing that two into two pi mesons. Cronin and Fitch had found an example of CP violation. The discovery's
Meglécz, Emese; Costedoat, Caroline; Dubut, Vincent; Gilles, André; Malausa, Thibaut; Pech, Nicolas; Martin, Jean-François
2010-02-01
QDD is an open access program providing a user-friendly tool for microsatellite detection and primer design from large sets of DNA sequences. The program is designed to deal with all steps of treatment of raw sequences obtained from pyrosequencing of enriched DNA libraries, but it is also applicable to data obtained through other sequencing methods, using FASTA files as input. The following tasks are completed by QDD: tag sorting, adapter/vector removal, elimination of redundant sequences, detection of possible genomic multicopies (duplicated loci or transposable elements), stringent selection of target microsatellites and customizable primer design. It can treat up to one million sequences of a few hundred base pairs in the tag-sorting step, and up to 50,000 sequences in a single input file for the steps involving estimation of sequence similarity. QDD is freely available under the GPL licence for Windows and Linux from the following web site: http://www.univ-provence.fr/gsite/Local/egee/dir/meglecz/QDD.html. Supplementary data are available at Bioinformatics online.
CP violation through particle mixing and the H-A lineshape
International Nuclear Information System (INIS)
Bernabeu, Jose; Binosi, Daniele; Papavassiliou, Joannis
2006-01-01
We consider the possibility of looking for CP-mixing effects in two-Higgs doublet models (and particularly in the MSSM) by studying the lineshape of the CP-even (H) and CP-odd (A) neutral scalars. In most cases H and A come quite degenerate in mass, and their s-channel production would lead to nearly overlapping resonances. CP-violating effects may connect these two Higgs bosons, giving origin to one-loop particle mixing, which, due to their mass proximity, can be resonantly enhanced. The corresponding transition amplitude contains then CP-even and CP-odd components; besides the signal of intereference between both amplitudes, leading to a CP-odd asymmetry, we propose to look for the mixing probability itself, a quantity which, although CP-even, can originate only from a CP-odd amplitude. We show that, in general, the effect of such a mixing probability cannot be mimicked by (or be re-absorbed into) a simple redefinition of the H and A masses in the context of a CP-conserving model. Specifically, the effects of the CP-mixing are such that, either the mass-splitting of the H and A bosons cannot be accounted for in the absence of CP-mixing, and/or the detailed energy dependence of the produced lineshape is clearly different from the one obtained by redefining the masses, but not allowing any mixing. This analysis suggests that the detailed study of the lineshape of this Higgs system may provide valuable information on the CP nature of the underlying theory
Directory of Open Access Journals (Sweden)
Tea Huotari
Full Text Available Non-indigenous species (NIS are species living outside their historic or native range. Invasive NIS often cause severe environmental impacts, and may have large economical and social consequences. Elodea (Hydrocharitaceae is a New World genus with at least five submerged aquatic angiosperm species living in fresh water environments. Our aim was to survey the geographical distribution of cpDNA haplotypes within the native and introduced ranges of invasive aquatic weeds Elodea canadensis and E. nuttallii and to reconstruct the spreading histories of these invasive species. In order to reveal informative chloroplast (cp genome regions for phylogeographic analyses, we compared the plastid sequences of native and introduced individuals of E. canadensis. In total, we found 235 variable sites (186 SNPs, 47 indels and two inversions between the two plastid sequences consisting of 112,193 bp and developed primers flanking the most variable genomic areas. These 29 primer pairs were used to compare the level and pattern of intraspecific variation within E. canadensis to interspecific variation between E. canadensis and E. nuttallii. Nine potentially informative primer pairs were used to analyze the phylogeographic structure of both Elodea species, based on 70 E. canadensis and 25 E. nuttallii individuals covering native and introduced distributions. On the whole, the level of variation between the two Elodea species was 53% higher than that within E. canadensis. In our phylogeographic analysis, only a single haplotype was found in the introduced range in both species. These haplotypes H1 (E. canadensis and A (E. nuttallii were also widespread in the native range, covering the majority of native populations analyzed. Therefore, we were not able to identify either the geographic origin of the introduced populations or test the hypothesis of single versus multiple introductions. The divergence between E. canadensis haplotypes was surprisingly high, and future
Huotari, Tea; Korpelainen, Helena
2013-01-01
Non-indigenous species (NIS) are species living outside their historic or native range. Invasive NIS often cause severe environmental impacts, and may have large economical and social consequences. Elodea (Hydrocharitaceae) is a New World genus with at least five submerged aquatic angiosperm species living in fresh water environments. Our aim was to survey the geographical distribution of cpDNA haplotypes within the native and introduced ranges of invasive aquatic weeds Elodea canadensis and E. nuttallii and to reconstruct the spreading histories of these invasive species. In order to reveal informative chloroplast (cp) genome regions for phylogeographic analyses, we compared the plastid sequences of native and introduced individuals of E. canadensis. In total, we found 235 variable sites (186 SNPs, 47 indels and two inversions) between the two plastid sequences consisting of 112,193 bp and developed primers flanking the most variable genomic areas. These 29 primer pairs were used to compare the level and pattern of intraspecific variation within E. canadensis to interspecific variation between E. canadensis and E. nuttallii. Nine potentially informative primer pairs were used to analyze the phylogeographic structure of both Elodea species, based on 70 E. canadensis and 25 E. nuttallii individuals covering native and introduced distributions. On the whole, the level of variation between the two Elodea species was 53% higher than that within E. canadensis. In our phylogeographic analysis, only a single haplotype was found in the introduced range in both species. These haplotypes H1 (E. canadensis) and A (E. nuttallii) were also widespread in the native range, covering the majority of native populations analyzed. Therefore, we were not able to identify either the geographic origin of the introduced populations or test the hypothesis of single versus multiple introductions. The divergence between E. canadensis haplotypes was surprisingly high, and future research may
CP violation for electroweak baryogenesis from mixing of standard model and heavy vector quarks
International Nuclear Information System (INIS)
McDonald, J.
1996-01-01
It is known that the CP violation in the minimal standard model is insufficient to explain the observed baryon asymmetry of the Universe in the context electroweak baryogenesis. In this paper we consider the possibility that the additional CP violation required could originate in the mixing of the standard model quarks and heavy vector quark pairs. We consider the baryon asymmetry in the context of the spontaneous baryogenesis scenario. It is shown that, in general, the CP-violating phase entering the mass matrix of the standard model and heavy vector quarks must be space dependent in order to produce a baryon asymmetry, suggesting that the additional CP violation must be spontaneous in nature. This is true for the case of the simplest models which mix the standard model and heavy vector quarks. We derive a charge potential term for the model by diagonalizing the quark mass matrix in the presence of the electroweak bubble wall, which turns out to be quite different from the fermionic hypercharge potentials usually considered in spontaneous baryogenesis models, and obtain the rate of baryon number generation within the wall. We find, for the particular example where the standard model quarks mix with weak-isodoublet heavy vector quarks via the expectation value of a gauge singlet scalar, that we can account for the observed baryon asymmetry with conservative estimates for the uncertain parameters of electroweak baryogenesis, provided that the heavy vector quarks are not heavier than a few hundred GeV and that the coupling of the standard model quarks to the heavy vector quarks and gauge singlet scalars is not much smaller than order of 1, corresponding to a mixing angle of the heavy vector quarks and standard model quarks not much smaller than order of 10 -1 . copyright 1996 The American Physical Society
MeCP2-Related Diseases and Animal Models
Directory of Open Access Journals (Sweden)
Chinelo D. Ezeonwuka
2014-01-01
Full Text Available The role of epigenetics in human disease has become an area of increased research interest. Collaborative efforts from scientists and clinicians have led to a better understanding of the molecular mechanisms by which epigenetic regulation is involved in the pathogenesis of many human diseases. Several neurological and non-neurological disorders are associated with mutations in genes that encode for epigenetic factors. One of the most studied proteins that impacts human disease and is associated with deregulation of epigenetic processes is Methyl CpG binding protein 2 (MeCP2. MeCP2 is an epigenetic regulator that modulates gene expression by translating epigenetic DNA methylation marks into appropriate cellular responses. In order to highlight the importance of epigenetics to development and disease, we will discuss how MeCP2 emerges as a key epigenetic player in human neurodevelopmental, neurological, and non-neurological disorders. We will review our current knowledge on MeCP2-related diseases, including Rett Syndrome, Angelman Syndrome, Fetal Alcohol Spectrum Disorder, Hirschsprung disease, and Cancer. Additionally, we will briefly discuss about the existing MeCP2 animal models that have been generated for a better understanding of how MeCP2 impacts certain human diseases.
CP violation outside the standard model phenomenology for pedestrians
International Nuclear Information System (INIS)
Lipkin, H.J.
1993-01-01
So far the only experimental evidence for CP violation is the 1964 discovery of K L →2π where the two mass eigenstates produced by neutral meson mixing both decay into the same CP eigenstate. This result is described by two parameters ε and ε'. Today ε ∼ its 1964 value, ε' data are still inconclusive and there is no new evidence for CP violation. One might expect to observe similar phenomena in other systems and also direct CP violation as charge asymmetries between decays of charge conjugate hadrons H ± → f ± . Why is it so hard to find CP violation? How can B Physics help? Does CP lead beyond the standard model? The author presents a pedestrian symmetry approach which exhibits the difficulties and future possibilities of these two types of CP-violation experiments, neutral meson mixing and direct charge asymmetry: what may work, what doesn't work and why
Search for neutral Higgs bosons in CP-conserving and CP-violating MSSM scenarios
Abbiendi, G.; Akesson, P.F.; Alexander, G.; Allison, John; Amaral, P.; Anagnostou, G.; Anderson, K.J.; Asai, S.; Axen, D.; Azuelos, G.; Bailey, I.; Barberio, E.; Barillari, T.; Barlow, R.J.; Batley, R.J.; Bechtle, P.; Behnke, T.; Bell, Kenneth Watson; Bell, P.J.; Bella, G.; Bellerive, A.; Benelli, G.; Bethke, S.; Biebel, O.; Boeriu, O.; Bock, P.; Boutemeur, M.; Braibant, S.; Brigliadori, L.; Brown, Robert M.; Buesser, K.; Burckhart, H.J.; Campana, S.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, D.G.; Ciocca, C.; Csilling, A.; Cuffiani, M.; Dado, S.; De Roeck, A.; De Wolf, E.A.; Desch, K.; Dienes, B.; Donkers, M.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Etzion, E.; Fabbri, F.; Feld, L.; Ferrari, P.; Fiedler, F.; Fleck, I.; Ford, M.; Frey, A.; Gagnon, P.; Gary, John William; Gaycken, G.; Geich-Gimbel, C.; Giacomelli, G.; Giacomelli, P.; Giunta, Marina; Goldberg, J.; Gross, E.; Grunhaus, J.; Gruwe, M.; Gunther, P.O.; Gupta, A.; Hajdu, C.; Hamann, M.; Hanson, G.G.; Harel, A.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herten, G.; Heuer, R.D.; Hill, J.C.; Hoffman, Kara Dion; Horvath, D.; Igo-Kemenes, P.; Ishii, K.; Jeremie, H.; Jovanovic, P.; Junk, T.R.; Kanaya, N.; Kanzaki, J.; Karlen, D.; Kawagoe, K.; Kawamoto, T.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Kluth, S.; Kobayashi, T.; Kobel, M.; Komamiya, S.; Kramer, T.; Krieger, P.; von Krogh, J.; Kruger, K.; Kuhl, T.; Kupper, M.; Lafferty, G.D.; Landsman, H.; Lanske, D.; Layter, J.G.; Lellouch, D.; Lettso, J.; Levinson, L.; Lillich, J.; Lloyd, S.L.; Loebinger, F.K.; Lu, J.; Ludwig, A.; Ludwig, J.; Mader, W.; Marcellini, S.; Martin, A.J.; Masetti, G.; Mashimo, T.; Mattig, Peter; McKenna, J.; McPherson, R.A.; Meijers, F.; Menges, W.; Merritt, F.S.; Mes, H.; Meyer, Niels T.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Moed, S.; Mohr, W.; Mori, T.; Mutter, A.; Nagai, K.; Nakamura, I.; Nanjo, H.; Neal, H.A.; Nisius, R.; O'Neale, S.W.; Oh, A.; Oreglia, M.J.; Orito, S.; Pahl, C.; Pasztor, G.; Pater, J.R.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poli, B.; Pooth, O.; Przybycien, M.; Quadt, A.; Rabbertz, K.; Rembser, C.; Renkel, P.; Roney, J.M.; Rozen, Y.; Runge, K.; Sachs, K.; Saeki, T.; Sarkisyan, E.K.G.; Schaile, A.D.; Schaile, O.; Scharff-Hansen, P.; Schieck, J.; Schorner-Sadenius, T.; Schroder, Matthias; Schumacher, M.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Sherwood, P.; Skuja, A.; Smith, A.M.; Sobie, R.; Soldner-Rembold, S.; Spano, F.; Stahl, A.; Strom, David M.; Strohmer, R.; Tarem, S.; Tasevsky, M.; Teuscher, R.; Thomson, M.A.; Torrence, E.; Toya, D.; Tran, P.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turner-Watson, M.F.; Ueda, I.; Ujvari, B.; Vollmer, C.F.; Vannerem, P.; Vertesi, R.; Verzocchi, M.; Voss, H.; Vossebeld, J.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wengler, T.; Wermes, N.; Wilson, G.W.; Wilson, J.A.; Wolf, G.; Wyatt, T.R.; Yamashita, S.; Zer-Zion, D.; Zivkovic, Lidija
2004-01-01
This report summarizes the final results from the OPAL collaboration on searches for neutral Higgs bosons predicted by the Minimal Supersymmetric Standard Model (MSSM). CP-conserving and for the first time at LEP CP-violating scenarios are studied. New scenarios are also included, which aim to set the stage for Higgs searches at future colliders. The results are based on the data collected with the OPAL detector at e+e- centre-of-mass energies up to 209 GeV. The data are consistent with the prediction of the Standard Model with no Higgs boson produced. Model-independent limits are derived for the cross-section of a number of events topologies motivated by prediction of the MSSM. Limits on Higgs boson masses and other MSSM parameters are obtained for a number of representative MSSM benchmark scenarios. For example, in the CP-conserving scenario mh-max where the MSSM parameters are adjusted to predict the largest range of values for mh at each tan beta, and for a top quark mass of 174.3 GeV, the domain 0.784.5 ...
Malberg, J.; Lupton, E.; Schnöckelborg, E.M.; de Bruin, B.; de Sutter, J.; Meyer, K.; Hartl, F.; Wolf, R.
2013-01-01
The dissymmetrical naphthalene-bridged complexes [Cp'Fe(mu-C10H8)FeCp*] (3; Cp* = eta(5)-C5Me5, Cp' = eta(5)-C5H2-1,2,4-tBu(3)) and [Cp'Fe(mu-C10H8)RuCp*] (4) were synthesized via a one-pot procedure from FeCl2(thf)(1.5), Cp'K, KC10H8, and [Cp*FeCl(tmeda)] (tmeda =
Baryogenesis and standard model CP violation
International Nuclear Information System (INIS)
Huet, P.
1994-08-01
The standard model possesses a natural source of CP violation contained in the phase of the CKM matrix. Whether the latter participated to the making of the matter-antimatter asymmetry of the observable universe is a fundamental question which has been addressed only recently. The generation of a CP observable occurs through interference of quantum paths along which a sequence of flavor mixings and chirality flips take place. The coherence of this phenomenon in the primeval plasma is limited by the fast quark-gluon interactions. At the electroweak era, this phenomenon of decoherence forbids a successful baryogenesis based on the sole CP violation of the CKM matrix
Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P
1988-01-01
Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118
Economics : pricing, demand, and economic efficiency : a primer.
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
Flavor and CP invariant composite Higgs models
International Nuclear Information System (INIS)
Redi, Michele; Weiler, Andreas
2011-09-01
The flavor protection in composite Higgs models with partial compositeness is known to be insufficient. We explore the possibility to alleviate the tension with CP odd observables by assuming that flavor or CP are symmetries of the composite sector, broken by the coupling to Standard Model fields. One realization is that the composite sector has a flavor symmetry SU(3) or SU(3) U x SU(3) D which allows us to realize Minimal Flavor Violation. We show how to avoid the previously problematic tension between a flavor symmetric composite sector and electro-weak precision tests. Some of the light quarks are substantially or even fully composite with striking signals at the LHC. We discuss the constraints from recent dijet mass measurements and give an outlook on the discovery potential. We also present a different protection mechanism where we separate the generation of flavor hierarchies and the origin of CP violation. This can eliminate or safely reduce unwanted CP violating effects, realizing effectively ''Minimal CP Violation'' and is compatible with a dynamical generation of flavor at low scales. (orig.)
Antoniou, Grigoris; Harmelen, Frank van
2004-01-01
The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a
Limits from LEP Data on CP-Violating Nonminimal Higgs Sectors
International Nuclear Information System (INIS)
Gunion, J.F.; Grzadkowski, B.; Kalinowski, J.; Haber, H.E.; Kalinowski, J.
1997-01-01
We derive a sum rule which shows how to extend limits from LEP data on the masses of the lightest CP-even and CP-odd Higgs bosons of a CP-conserving two-Higgs doublet model to any two Higgs bosons of a general CP-violating two-Higgs-doublet model. We generalize the analysis to a Higgs sector consisting of an arbitrary number of Higgs doublets and singlets, giving explicit limits for the CP-conserving and CP-violating two-doublet plus one-singlet Higgs sectors. copyright 1997 The American Physical Society
Directory of Open Access Journals (Sweden)
Huamin Liu
2017-08-01
Full Text Available Wintersweet (Chimonanthus praecox is a popular garden plant because of its flowering time, sweet fragrance, and ornamental value. However, research into the molecular mechanism that regulates flower development in wintersweet is still limited. In this study, we sought to investigate the molecular characteristics, expression patterns, and potential functions of two C3H-type zinc finger (CZF protein genes, CpCZF1 and CpCZF2, which were isolated from the wintersweet flowers based on the flower developmental transcriptome database. CpCZF1 and CpCZF2 were more highly expressed in flower organs than in vegetative tissues, and during the flower development, their expression profiles were associated with flower primordial differentiation, especially that of petal and stamen primordial differentiation. Overexpression of either CpCZF1 or CpCZF2 caused alterations on stamens in transgenic Arabidopsis. The expression levels of the stamen identity-related genes, such as AGAMOUS (AG, PISTILLATA (PI, SEPALLATA1 (SEP1, SEPALLATA2 (SEP2, SEPALLATA3 (SEP3, APETALA1 (AP1, APETALA2 (AP2, and boundary gene RABBIT EAR (RBE were significantly up-regulated in CpCZF1 overexpression lines. Additionally, the transcripts of AG, PI, APETALA3 SEP1-3, AP1, and RBE were markedly increased in CpCZF2 overexpressed plant inflorescences. Moreover, CpCZF1 and CpCZF2 could interact with each other by using yeast two-hybrid and bimolecular fluorescence complementation assays. Our results suggest that CpCZF1 and CpCZF2 may be involved in the regulation of stamen development and cause the formation of abnormal flowers in transgenic Arabidopsis plants.
Parkhomenko, A. I.; Shalagin, A. M.
2018-06-01
A mechanism for the segregation of calcium isotopes in the atmospheres of chemically peculiar (CP) stars due to light-induced drift (LID) of singly charged 48Ca+ ions is discussed. One peculiarity of Ca+ is that an adequate description of the effect of LID requires taking into account several energy levels of Ca+, and thus several pairs of relative differences ( ν i - ν k )/ ν i for the transport frequencies for collisions of levels i and k with neutral atoms (hydrogen, helium). The known real (calculated ab initio) interaction potentials are used to numerically calculate the factors ( ν i - ν k )/ ν i for several states of Ca+ for collisions with H and He atoms. These computations show that, at the temperatures characteristic of the atmospheres of CP stars, T = 6600-12 000 K, fairly high values are obtained for Ca+ ions, ( ν i - ν k )/ ν i ≈ 0.4-0.6. Simple, transparent computations demonstrate that the LID rates of Ca+ ions in the atmospheres of cool CP stars ( T eff = 6600 K) exceed the drift rate due to light pressure by two orders of magnitude. The LID is directed upward in the stellar atmosphere, and the heavy isotope 48Ca is pushed into upper layers of the atmosphere. This can explain the observed predominance of the heavy isotope 48Ca in the upper atmospheric layers of CP stars; according to the radiative-diffusion theory, the action of light pressure alone (in the absence of LID) would lead to sinking of the isotope 48Ca deeper into stellar atmosphere, following the lighter main isotope 40Ca. The 48Ca+ LIDrate decreases and its drift rate due to light pressure increases with growth of the effective temperatures in the atmospheres of CP stars. The manifestations of LID and light pressure are roughly comparable in the atmospheres of CP stars with effective temperatures near T eff = 9500 K.
Direct CP Violation in Charmless Hadronic B-Meson Decays at the PEP-II Asymmetric B-Meson Factory
Energy Technology Data Exchange (ETDEWEB)
Telnov, Alexandre Valerievich; /UC, Berkeley
2005-05-06
The study of the quark transition b {yields} s{bar s}s, which is a pure loop-level (''penguin'') process leading to several B-meson-decay final states, most notably {phi}K, is arguably the hottest topic in B-meson physics today. The reason is the sensitivity of the amplitudes and the CP-violating asymmetries in such processes to physics beyond the Standard Model. By performing these measurements, we improve our understanding of the phenomenon of combined-parity (CP) violation, which is believed to be responsible for the dominance of matter over antimatter in our Universe. Here, we present measurements of branching fractions and charge asymmetries in the decays B{sup +} {yields} {phi}K{sup +} and B{sup 0} {yields} {phi}K{sup 0} in a sample of approximately 89 million B{bar B} pairs collected by the BABAR detector at the PEP-II asymmetric-energy B-meson Factory at SLAC. We determine {Beta}(B{sup +} {yields} {phi}K{sup +}) = (10.0{sub -0.8}{sup +0.9} {+-} 0.5) x 10{sup -6} and {Beta}(B{sup 0} {yields} {phi}K{sup 0}) = (8.4{sub -1.3}{sup +1.5} {+-} 0.5) x 10{sup -6}, where the first error is statistical and the second is systematic. Additionally, we measure the CP-violating charge asymmetry {Alpha}{sub CP}(B{sup {+-}} {yields} {phi}K{sup {+-}}) = 0.04 {+-} 0.09 {+-} 0.01, with a 90% confidence-level interval of [-0.10, 0.18], and set an upper limit on the CKM- and color-suppressed decay B{sup +} {yields} {phi}{pi}{sup +}, {Beta}(B{sup +} {yields} {phi}{pi}{sup +}) < 0.41 x 10{sup -6} (at the 90% confidence level). Our results are consistent with the Standard Model, which predicts {Alpha}{sub CP}(B{sup {+-}} {yields} {phi}K{sup {+-}}) {approx}< 1% and {Beta}(B {yields} {phi}{tau}) << 10{sup -7}. Since many models of physics beyond the Standard Model introduce additional loop diagrams with new heavy particles and new CP-violating phases that would contribute to these decays, potentially making {Alpha}{sub CP} (B{sup {+-}} {yields} {phi
A model for the origin and mechanisms of CP violation
International Nuclear Information System (INIS)
Wu, Y.
1995-01-01
In this talk I will show that the two-Higgs doublet model with vacuum CP violation and approximate global U(1) family symmetries may provide one of the simplest and attractive models for understanding the origin and mechanisms of CP violation. It is shown that the mechanism of spontaneous symmetry breaking provides not only a mechanism for generating masses of the bosons and fermions, but also a mechanism for creating CP-phases of the bosons and fermions, so that CP violation occurs, after spontaneous symmetry breaking, in all possible ways from a single CP phase of the vacuum and is generally classified into four types of CP-violating mechanism. A new type of CP-violating mechanism in the charged Higgs boson interactions of the fermions is emphasized and can provide a consistent description for both established and reported CP-, P-, and T-violating phenomena. Of particular importance is the new source of CP violation for charged Higgs boson interactions that lead to the value of ε'/ε as large as 10 -3 independent of the CKM phase. copyright 1995 American Institute of Physics
Integration of CpG-free DNA induces de novo methylation of CpG islands in pluripotent stem cells
Takahashi, Yuta; Wu, Jun; Suzuki, Keiichiro; Martinez-Redondo, Paloma; Li, Mo; Liao, Hsin-Kai; Wu, Min-Zu; Herná ndez-Bení tez, Reyna; Hishida, Tomoaki; Shokhirev, Maxim Nikolaievich; Esteban, Concepcion Rodriguez; Sancho-Martinez, Ignacio; Belmonte, Juan Carlos Izpisua
2017-01-01
that insertion of CpG-free DNA into targeted CGIs induces de novo methylation of the entire CGI in human pluripotent stem cells (PSCs). The methylation status is stably maintained even after CpG-free DNA removal, extensive passaging, and differentiation
Origin of CP-violation through quark mass matrix
International Nuclear Information System (INIS)
Kang, K.
1990-01-01
After a brief review of the CP violation models, we trace the origin of CP-phases from the phases of a class of quark mass matrices compatible with the calculability condition. The case of three generations corresponding to the standard milliweak CP model is discussed explicitly for the generic case of Fritzsch-type mass matrices. (orig.)
Constructing co-Higgs bundles on CP^2
Rayan, Steven
2013-01-01
On a complex manifold, a co-Higgs bundle is a holomorphic vector bundle with an endomorphism twisted by the tangent bundle. The notion of generalized holomorphic bundle in Hitchin's generalized geometry coincides with that of co-Higgs bundle when the generalized complex manifold is ordinary complex. Schwarzenberger's rank-2 vector bundle on the projective plane, constructed from a line bundle on the double cover CP^1 \\times CP^1 \\to CP^2, is naturally a co-Higgs bundle, with the twisted endom...
Registration of 'CP 09-2392' Sugarcane
CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...
Energy Technology Data Exchange (ETDEWEB)
Dan Arthur; Bruce Langhus; Jon Seekins
2005-05-25
During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of
CP properties of symmetry-constrained two-Higgs-doublet models
Ferreira, P M; Nachtmann, O; Silva, Joao P
2010-01-01
The two-Higgs-doublet model can be constrained by imposing Higgs-family symmetries and/or generalized CP symmetries. It is known that there are only six independent classes of such symmetry-constrained models. We study the CP properties of all cases in the bilinear formalism. An exact symmetry implies CP conservation. We show that soft breaking of the symmetry can lead to spontaneous CP violation (CPV) in three of the classes.
Frequency Constrained ShiftCP Modeling of Neuroimaging Data
DEFF Research Database (Denmark)
Mørup, Morten; Hansen, Lars Kai; Madsen, Kristoffer H.
2011-01-01
The shift invariant multi-linear model based on the CandeComp/PARAFAC (CP) model denoted ShiftCP has proven useful for the modeling of latency changes in trial based neuroimaging data[17]. In order to facilitate component interpretation we presently extend the shiftCP model such that the extracted...... components can be constrained to pertain to predefined frequency ranges such as alpha, beta and gamma activity. To infer the number of components in the model we propose to apply automatic relevance determination by imposing priors that define the range of variation of each component of the shiftCP model...
Aspects of soft and spontaneous CP violation
International Nuclear Information System (INIS)
Frampton, P.H.; Harada, M.
1999-01-01
We study four different models for CP violation: the standard Kobayashi-Maskawa (KM) model, the aspon model of spontaneous breaking, and two models of soft breaking. In all except the standard model, the strong CP problem is addressed and solved. Testable predictions for the area of the unitarity triangle and for (ε ' /ε) K are emphasized. The issue of CP violation may well become the first place where the standard model of particle theory is shown definitively to be deficient. There are two reasons for expecting this to happen: (1) the strong CP problem is still not understood in the unadorned standard model and (2) the KM mechanism, although unquestionably present, may not provide the full explanation of ε K and (ε ' /ε) K . copyright 1999 The American Physical Society
Viana, M V C; Miranda, E A; de Francisco, A K; Carvalho, C A L; Waldschmidt, A M
2011-11-22
Microsatellite markers are a useful tool for ecological monitoring of natural and managed populations. A technical limitation is the necessity for investment in the development of primers. Heterologous primers can provide an alternative to searching for new loci. In bees, these markers have been used in populational and intracolonial genetic analyses. The genus Melipona has the largest number of species among bee genera, about 70, occurring throughout the Neotropical region. However, only five species of the genus Melipona have specific microsatellite markers. Given the great diversity of this genus, this number is not representative. We analyzed the transferability of 49 microsatellite loci to four other species of the genus Melipona (M. scutellaris, M. mondury, M. mandacaia, and M. quadrifasciata). Four individuals of each species, from different localities, were used in amplification tests. Primer pairs described for five Melipona species and for Trigona carbonaria were tested. Among the 49 loci, 22 gave amplification products for all four species, while three gave nonspecific bands and five showed no amplification products. The remaining loci varied in the pattern of amplification, according to the species examined. The number of alleles ranged from 1 to 6. The results demonstrate the possibility of using these heterologous markers in other Melipona species, increasing the number of loci that can be analyzed and contributing to further genetic analyses of intra- and intercolonial structure, which is required for conservation measure planning, genetic improvement and resolution of taxonomic problems.
Quasifree knockout of proton pairs from carbon with 640 MeV protons
International Nuclear Information System (INIS)
Komarov, V.I.; Kosarev, G.I.; Netzband, D.; Mueller, H.; Stiehler, T.; Tesch, S.
1980-10-01
The direct nuclear reaction C(p,3p) at 640 MeV has been investigated in an exclusive type of experiment using scintillation counter technique. The measuring conditions have been selected according to the kinematics of quasi-free two-nucleon knockout at large momentum transfer. A phenomenological model is discussed, which is capable of describing qualitatively the dependence of the differential cross section on the opening angle of the forward emitted proton pair as well as on the energy of backward going protons. (author)
Electron-positron pair creation from vacuum induced by variable electric field
International Nuclear Information System (INIS)
Marinov, M.S.; Popov, V.S.
1977-01-01
Problem is considered of spontaneous creation of electron-positron pairs from the vacuum induced by external electric field, that is homogeneous and depends on time in an arbitrary way. The Heisenberg equations of motion are obtained for the creation-annihilation operators. The solution is a linear canonical transformation. The problem is reduced to a set of differential equations for the second-order matrices determining this transformation. A consequence of the CP symmetry of the Dirac equation with an external electric field is that the e + e - pair is created from the vacuum in a state with total spin 1. The case when the variating electric field conserves its direction, is considered in more detail. In this case the equations are much simplified and may be reduced to the Riccati equation or to problem of oscillator with variable frequency, so the problem is equivalent to the one-dimensional quantal problem of a barrier penetration. Two approximate methods to calculate the pair creation probabilities are discussed: the quasiclassical approach and the antidiabatical method, applicable for sharp variations of the external field. Numerical estimates are obtained for the number of e + e - pairs produced by the field E(t) = E cos ωt. Group-theoretical aspects of the problem are also considered. (author)
Masses, flavor mix and CP violation
International Nuclear Information System (INIS)
Chaussard, L.
2004-06-01
The author describes the relationships between masses, mixing of flavors and CP violation. This document is divided into 4 chapters: 1) fermions' masses, 2) mixing of flavors and CP violation, 3) beauty physics and 4) neutrino physics. In chapter 1 an attempt is made to explain what is behind the concepts of lepton mass and quark mass. As for neutrinos, the only neutral fermion, Dirac's and Majorana's views are exposed as well as their consequences. Fermion flavors are mixed in the process of mass generation and this mix is responsible for the breaking of CP and T symmetries. In chapter 2 the author shows how the analysis of particle oscillations from neutral mesons (K 0 , D 0 , B d 0 and B s 0 ) and from neutrinos can shed light on CP violation. Chapter 3 is dedicated to the contribution of beauty physics to the determination of the unitary triangle, through the oscillations of beauty mesons. In chapter 4 the author reviews the experimental results obtained recently concerning neutrino mass and neutrino oscillations and draws some perspectives on future neutrino experiments. (A.C.)
Integration of CpG-free DNA induces de novo methylation of CpG islands in pluripotent stem cells
Takahashi, Yuta
2017-05-05
CpG islands (CGIs) are primarily promoter-associated genomic regions and are mostly unmethylated within highly methylated mammalian genomes. The mechanisms by which CGIs are protected from de novo methylation remain elusive. Here we show that insertion of CpG-free DNA into targeted CGIs induces de novo methylation of the entire CGI in human pluripotent stem cells (PSCs). The methylation status is stably maintained even after CpG-free DNA removal, extensive passaging, and differentiation. By targeting the DNA mismatch repair gene MLH1 CGI, we could generate a PSC model of a cancer-related epimutation. Furthermore, we successfully corrected aberrant imprinting in induced PSCs derived from an Angelman syndrome patient. Our results provide insights into how CpG-free DNA induces de novo CGI methylation and broaden the application of targeted epigenome editing for a better understanding of human development and disease.
Rett Syndrome Mutant Neural Cells Lacks MeCP2 Immunoreactive Bands.
Directory of Open Access Journals (Sweden)
Carlos Bueno
Full Text Available Dysfunctions of MeCP2 protein lead to various neurological disorders such as Rett syndrome and Autism. The exact functions of MeCP2 protein is still far from clear. At a molecular level, there exist contradictory data. MeCP2 protein is considered a single immunoreactive band around 75 kDa by western-blot analysis but several reports have revealed the existence of multiple MeCP2 immunoreactive bands above and below the level where MeCP2 is expected. MeCP2 immunoreactive bands have been interpreted in different ways. Some researchers suggest that multiple MeCP2 immunoreactive bands are unidentified proteins that cross-react with the MeCP2 antibody or degradation product of MeCP2, while others suggest that MeCP2 post-transcriptional processing generates multiple molecular forms linked to cell signaling, but so far they have not been properly analyzed in relation to Rett syndrome experimental models. The purpose of this study is to advance understanding of multiple MeCP2 immunoreactive bands in control neural cells and p.T158M MeCP2e1 mutant cells. We have generated stable wild-type and p.T158M MeCP2e1-RFP mutant expressing cells. Application of N- and C- terminal MeCP2 antibodies, and also, RFP antibody minimized concerns about nonspecific cross-reactivity, since they react with the same antigen at different epitopes. We report the existence of multiple MeCP2 immunoreactive bands in control cells, stable wild-type and p.T158M MeCP2e1-RFP mutant expressing cells. Also, MeCP2 immunoreactive bands differences were found between wild-type and p.T158M MeCP2e1-RFP mutant expressing cells. Slower migration phosphorylated band around 70kDa disappeared in p.T158M MeCP2e1-RFP mutant expressing cells. These data suggest that threonine 158 could represent an important phosphorylation site potentially involved in protein function. Our results clearly indicate that MeCP2 antibodies have no cross-reactivity with similar epitopes on others proteins, supporting the
Braren, Früd; Schleper, Peter
In some extensions of the Standard Model, extended Higgs sectors are postulated, from which, in addition to the Standard Model-like Higgs boson, a new CP-odd scalar arises. If this scalar’s mass is small, final states consisting of two photon pairs would be generated by the decay of the Higgs boson into two of the above mentioned scalars and the subsequent decays of the scalars into photon pairs. In the ATLAS detector, such a pair of photons would be reconstructed as a single photon. In order to analyse the data generated by the ATLAS detector at the LHC, one needs to know the efficiency of the photon pairs to be identified as a single photon. Using Monte-Carlo simulations, this identification efficiency is calculated and analysed for several photon selections and for three different masses of the scalar in the mass range of 100 to 400 MeV. This leads to the creation of an optimized cut menu for this final state. The aim of this is to make the analysis of the ATLAS-generated data with regard to this special...
CP Violation in Single Top Quark Production
Energy Technology Data Exchange (ETDEWEB)
Geng, Weigang [Michigan State Univ., East Lansing, MI (United States)
2012-01-01
We present a search for CP violation in single top quark production with the DØ experiment at the Tevatron proton-antiproton collider. CP violation in the top electroweak interaction results in different single top quark production cross sections for top and antitop quarks. We perform the search in the single top quark final state using 5.4 fb-1 of data, in the s-channel, t-channel, and for both combined. At this time, we do not see an observable CP asymmetry.
Quick spacecraft charging primer
International Nuclear Information System (INIS)
Larsen, Brian Arthur
2014-01-01
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
Benchmark test of CP-PACS for lattice QCD
International Nuclear Information System (INIS)
Yoshie, Tomoteru
1996-01-01
The CP-PACS is a massively parallel computer dedicated for calculations in computational physics and will be in operation in the spring of 1996 at Center for Computational Physics, University of Tsukuba. In this paper, we describe the architecture of the CP-PACS and report the results of the estimate of the performance of the CP-PACS for typical lattice QCD calculations. (author)
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
Worm Algorithm for CP(N-1) Model
Rindlisbacher, Tobias
2017-01-01
The CP(N-1) model in 2D is an interesting toy model for 4D QCD as it possesses confinement, asymptotic freedom and a non-trivial vacuum structure. Due to the lower dimensionality and the absence of fermions, the computational cost for simulating 2D CP(N-1) on the lattice is much lower than that for simulating 4D QCD. However, to our knowledge, no efficient algorithm for simulating the lattice CP(N-1) model has been tested so far, which also works at finite density. To this end we propose a new type of worm algorithm which is appropriate to simulate the lattice CP(N-1) model in a dual, flux-variables based representation, in which the introduction of a chemical potential does not give rise to any complications. In addition to the usual worm moves where a defect is just moved from one lattice site to the next, our algorithm additionally allows for worm-type moves in the internal variable space of single links, which accelerates the Monte Carlo evolution. We use our algorithm to compare the two popular CP(N-1) l...
Flavor and CP invariant composite Higgs models
Energy Technology Data Exchange (ETDEWEB)
Redi, Michele [CERN - European Organization for Nuclear Research, Geneva (Switzerland). Theory Div.; INFN, Firenze (Italy); Weiler, Andreas [CERN - European Organization for Nuclear Research, Geneva (Switzerland). Theory Div.; Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)
2011-09-15
The flavor protection in composite Higgs models with partial compositeness is known to be insufficient. We explore the possibility to alleviate the tension with CP odd observables by assuming that flavor or CP are symmetries of the composite sector, broken by the coupling to Standard Model fields. One realization is that the composite sector has a flavor symmetry SU(3) or SU(3){sub U} x SU(3){sub D} which allows us to realize Minimal Flavor Violation. We show how to avoid the previously problematic tension between a flavor symmetric composite sector and electro-weak precision tests. Some of the light quarks are substantially or even fully composite with striking signals at the LHC. We discuss the constraints from recent dijet mass measurements and give an outlook on the discovery potential. We also present a different protection mechanism where we separate the generation of flavor hierarchies and the origin of CP violation. This can eliminate or safely reduce unwanted CP violating effects, realizing effectively ''Minimal CP Violation'' and is compatible with a dynamical generation of flavor at low scales. (orig.)
Khachatryan, Vardan; Tumasyan, Armen; Adam, Wolfgang; Aşılar, Ece; Bergauer, Thomas; Brandstetter, Johannes; Brondolin, Erica; Dragicevic, Marko; Erö, Janos; Flechl, Martin; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hartl, Christian; Hörmann, Natascha; Hrubec, Josef; Jeitler, Manfred; König, Axel; Krätschmer, Ilse; Liko, Dietrich; Matsushita, Takashi; Mikulec, Ivan; Rabady, Dinyar; Rad, Navid; Rahbaran, Babak; Rohringer, Herbert; Schieck, Jochen; Strauss, Josef; Waltenberger, Wolfgang; Wulz, Claudia-Elisabeth; Dvornikov, Oleg; Makarenko, Vladimir; Zykunov, Vladimir; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Alderweireldt, Sara; De Wolf, Eddi A; Janssen, Xavier; Lauwers, Jasper; Van De Klundert, Merijn; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Van Spilbeeck, Alex; Abu Zeid, Shimaa; Blekman, Freya; D'Hondt, Jorgen; Daci, Nadir; De Bruyn, Isabelle; Deroover, Kevin; Lowette, Steven; Moortgat, Seth; Moreels, Lieselotte; Olbrechts, Annik; Python, Quentin; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Parijs, Isis; Brun, Hugues; Clerbaux, Barbara; De Lentdecker, Gilles; Delannoy, Hugo; Fasanella, Giuseppe; Favart, Laurent; Goldouzian, Reza; Grebenyuk, Anastasia; Karapostoli, Georgia; Lenzi, Thomas; Léonard, Alexandre; Luetic, Jelena; Maerschalk, Thierry; Marinov, Andrey; Randle-conde, Aidan; Seva, Tomislav; Vander Velde, Catherine; Vanlaer, Pascal; Vannerom, David; Yonamine, Ryo; Zenoni, Florian; Zhang, Fengwangdong; Cimmino, Anna; Cornelis, Tom; Dobur, Didar; Fagot, Alexis; Garcia, Guillaume; Gul, Muhammad; Khvastunov, Illia; Poyraz, Deniz; Salva Diblen, Sinem; Schöfbeck, Robert; Sharma, Archana; Tytgat, Michael; Van Driessche, Ward; Yazgan, Efe; Zaganidis, Nicolas; Bakhshiansohi, Hamed; Beluffi, Camille; Bondu, Olivier; Brochet, Sébastien; Bruno, Giacomo; Caudron, Adrien; De Visscher, Simon; Delaere, Christophe; Delcourt, Martin; Francois, Brieuc; Giammanco, Andrea; Jafari, Abideh; Jez, Pavel; Komm, Matthias; Krintiras, Georgios; Lemaitre, Vincent; Magitteri, Alessio; Mertens, Alexandre; Musich, Marco; Nuttens, Claude; Piotrzkowski, Krzysztof; Quertenmont, Loic; Selvaggi, Michele; Vidal Marono, Miguel; Wertz, Sébastien; Beliy, Nikita; Aldá Júnior, Walter Luiz; Alves, Fábio Lúcio; Alves, Gilvan; Brito, Lucas; Hensel, Carsten; Moraes, Arthur; Pol, Maria Elena; Rebello Teles, Patricia; Belchior Batista Das Chagas, Ewerton; Carvalho, Wagner; Chinellato, Jose; Custódio, Analu; Melo Da Costa, Eliza; Da Silveira, Gustavo Gil; De Jesus Damiao, Dilson; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Huertas Guativa, Lina Milena; Malbouisson, Helena; Matos Figueiredo, Diego; Mora Herrera, Clemencia; Mundim, Luiz; Nogima, Helio; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Sznajder, Andre; Tonelli Manganote, Edmilson José; Vilela Pereira, Antonio; Ahuja, Sudha; Bernardes, Cesar Augusto; Dogra, Sunil; Tomei, Thiago; De Moraes Gregores, Eduardo; Mercadante, Pedro G; Moon, Chang-Seong; Novaes, Sergio F; Padula, Sandra; Romero Abad, David; Ruiz Vargas, José Cupertino; Aleksandrov, Aleksandar; Hadjiiska, Roumyana; Iaydjiev, Plamen; Rodozov, Mircho; Stoykova, Stefka; Sultanov, Georgi; Vutova, Mariana; Dimitrov, Anton; Glushkov, Ivan; Litov, Leander; Pavlov, Borislav; Petkov, Peicho; Fang, Wenxing; Ahmad, Muhammad; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Chen, Mingshui; Chen, Ye; Cheng, Tongguang; Jiang, Chun-Hua; Leggat, Duncan; Liu, Zhenan; Romeo, Francesco; Shaheen, Sarmad Masood; Spiezia, Aniello; Tao, Junquan; Wang, Chunjie; Wang, Zheng; Zhang, Huaqiao; Zhao, Jingzhou; Ban, Yong; Chen, Geng; Li, Qiang; Liu, Shuai; Mao, Yajun; Qian, Si-Jin; Wang, Dayong; Xu, Zijun; Avila, Carlos; Cabrera, Andrés; Chaparro Sierra, Luisa Fernanda; Florez, Carlos; Gomez, Juan Pablo; González Hernández, Carlos Felipe; Ruiz Alvarez, José David; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Puljak, Ivica; Ribeiro Cipriano, Pedro M; Sculac, Toni; Antunovic, Zeljko; Kovac, Marko; Brigljevic, Vuko; Ferencek, Dinko; Kadija, Kreso; Mesic, Benjamin; Micanovic, Sasa; Sudic, Lucija; Susa, Tatjana; Attikis, Alexandros; Mavromanolakis, Georgios; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A; Rykaczewski, Hans; Tsiakkouri, Demetra; Finger, Miroslav; Finger Jr, Michael; Carrera Jarrin, Edgar; Assran, Yasser; Elkafrawy, Tamer; Mahrous, Ayman; Kadastik, Mario; Perrini, Lucia; Raidal, Martti; Tiko, Andres; Veelken, Christian; Eerola, Paula; Pekkanen, Juska; Voutilainen, Mikko; Härkönen, Jaakko; Jarvinen, Terhi; Karimäki, Veikko; Kinnunen, Ritva; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Tuominiemi, Jorma; Tuovinen, Esa; Wendland, Lauri; Talvitie, Joonas; Tuuva, Tuure; Besancon, Marc; Couderc, Fabrice; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Favaro, Carlotta; Ferri, Federico; Ganjour, Serguei; Ghosh, Saranya; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Kucher, Inna; Locci, Elizabeth; Machet, Martina; Malcles, Julie; Rander, John; Rosowsky, André; Titov, Maksym; Zghiche, Amina; Abdulsalam, Abdulla; Antropov, Iurii; Baffioni, Stephanie; Beaudette, Florian; Busson, Philippe; Cadamuro, Luca; Chapon, Emilien; Charlot, Claude; Davignon, Olivier; Granier de Cassagnac, Raphael; Jo, Mihee; Lisniak, Stanislav; Miné, Philippe; Nguyen, Matthew; Ochando, Christophe; Ortona, Giacomo; Paganini, Pascal; Pigard, Philipp; Regnard, Simon; Salerno, Roberto; Sirois, Yves; Strebler, Thomas; Yilmaz, Yetkin; Zabi, Alexandre; Agram, Jean-Laurent; Andrea, Jeremy; Aubin, Alexandre; Bloch, Daniel; Brom, Jean-Marie; Buttignol, Michael; Chabert, Eric Christian; Chanon, Nicolas; Collard, Caroline; Conte, Eric; Coubez, Xavier; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Le Bihan, Anne-Catherine; Skovpen, Kirill; Van Hove, Pierre; Gadrat, Sébastien; Beauceron, Stephanie; Bernet, Colin; Boudoul, Gaelle; Bouvier, Elvire; Carrillo Montoya, Camilo Andres; Chierici, Roberto; Contardo, Didier; Courbon, Benoit; Depasse, Pierre; El Mamouni, Houmani; Fan, Jiawei; Fay, Jean; Gascon, Susan; Gouzevitch, Maxime; Grenier, Gérald; Ille, Bernard; Lagarde, Francois; Laktineh, Imad Baptiste; Lethuillier, Morgan; Mirabito, Laurent; Pequegnot, Anne-Laure; Perries, Stephane; Popov, Andrey; Sabes, David; Sordini, Viola; Vander Donckt, Muriel; Verdier, Patrice; Viret, Sébastien; Toriashvili, Tengizi; Tsamalaidze, Zviad; Autermann, Christian; Beranek, Sarah; Feld, Lutz; Heister, Arno; Kiesel, Maximilian Knut; Klein, Katja; Lipinski, Martin; Ostapchuk, Andrey; Preuten, Marius; Raupach, Frank; Schael, Stefan; Schomakers, Christian; Schulz, Johannes; Verlage, Tobias; Weber, Hendrik; Zhukov, Valery; Albert, Andreas; Brodski, Michael; Dietz-Laursonn, Erik; Duchardt, Deborah; Endres, Matthias; Erdmann, Martin; Erdweg, Sören; Esch, Thomas; Fischer, Robert; Güth, Andreas; Hamer, Matthias; Hebbeker, Thomas; Heidemann, Carsten; Hoepfner, Kerstin; Knutzen, Simon; Merschmeyer, Markus; Meyer, Arnd; Millet, Philipp; Mukherjee, Swagata; Olschewski, Mark; Padeken, Klaas; Pook, Tobias; Radziej, Markus; Reithler, Hans; Rieger, Marcel; Scheuch, Florian; Sonnenschein, Lars; Teyssier, Daniel; Thüer, Sebastian; Cherepanov, Vladimir; Flügge, Günter; Kargoll, Bastian; Kress, Thomas; Künsken, Andreas; Lingemann, Joschka; Müller, Thomas; Nehrkorn, Alexander; Nowack, Andreas; Pistone, Claudia; Pooth, Oliver; Stahl, Achim; Aldaya Martin, Maria; Arndt, Till; Asawatangtrakuldee, Chayanit; Beernaert, Kelly; Behnke, Olaf; Behrens, Ulf; Bin Anuar, Afiq Aizuddin; Borras, Kerstin; Campbell, Alan; Connor, Patrick; Contreras-Campana, Christian; Costanza, Francesco; Diez Pardos, Carmen; Dolinska, Ganna; Eckerlin, Guenter; Eckstein, Doris; Eichhorn, Thomas; Eren, Engin; Gallo, Elisabetta; Garay Garcia, Jasone; Geiser, Achim; Gizhko, Andrii; Grados Luyando, Juan Manuel; Gunnellini, Paolo; Harb, Ali; Hauk, Johannes; Hempel, Maria; Jung, Hannes; Kalogeropoulos, Alexis; Karacheban, Olena; Kasemann, Matthias; Keaveney, James; Kleinwort, Claus; Korol, Ievgen; Krücker, Dirk; Lange, Wolfgang; Lelek, Aleksandra; Leonard, Jessica; Lipka, Katerina; Lobanov, Artur; Lohmann, Wolfgang; Mankel, Rainer; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mittag, Gregor; Mnich, Joachim; Mussgiller, Andreas; Ntomari, Eleni; Pitzl, Daniel; Placakyte, Ringaile; Raspereza, Alexei; Roland, Benoit; Sahin, Mehmet Özgür; Saxena, Pooja; Schoerner-Sadenius, Thomas; Seitz, Claudia; Spannagel, Simon; Stefaniuk, Nazar; Van Onsem, Gerrit Patrick; Walsh, Roberval; Wissing, Christoph; Blobel, Volker; Centis Vignali, Matteo; Draeger, Arne-Rasmus; Dreyer, Torben; Garutti, Erika; Gonzalez, Daniel; Haller, Johannes; Hoffmann, Malte; Junkes, Alexandra; Klanner, Robert; Kogler, Roman; Kovalchuk, Nataliia; Lapsien, Tobias; Lenz, Teresa; Marchesini, Ivan; Marconi, Daniele; Meyer, Mareike; Niedziela, Marek; Nowatschin, Dominik; Pantaleo, Felice; Peiffer, Thomas; Perieanu, Adrian; Poehlsen, Jennifer; Sander, Christian; Scharf, Christian; Schleper, Peter; Schmidt, Alexander; Schumann, Svenja; Schwandt, Joern; Stadie, Hartmut; Steinbrück, Georg; Stober, Fred-Markus Helmut; Stöver, Marc; Tholen, Heiner; Troendle, Daniel; Usai, Emanuele; Vanelderen, Lukas; Vanhoefer, Annika; Vormwald, Benedikt; Akbiyik, Melike; Barth, Christian; Baur, Sebastian; Baus, Colin; Berger, Joram; Butz, Erik; Caspart, René; Chwalek, Thorsten; Colombo, Fabio; De Boer, Wim; Dierlamm, Alexander; Fink, Simon; Freund, Benedikt; Friese, Raphael; Giffels, Manuel; Gilbert, Andrew; Goldenzweig, Pablo; Haitz, Dominik; Hartmann, Frank; Heindl, Stefan Michael; Husemann, Ulrich; Katkov, Igor; Kudella, Simon; Mildner, Hannes; Mozer, Matthias Ulrich; Müller, Thomas; Plagge, Michael; Quast, Gunter; Rabbertz, Klaus; Röcker, Steffen; Roscher, Frank; Schröder, Matthias; Shvetsov, Ivan; Sieber, Georg; Simonis, Hans-Jürgen; Ulrich, Ralf; Wayand, Stefan; Weber, Marc; Weiler, Thomas; Williamson, Shawn; Wöhrmann, Clemens; Wolf, Roger; Anagnostou, Georgios; Daskalakis, Georgios; Geralis, Theodoros; Giakoumopoulou, Viktoria Athina; Kyriakis, Aristotelis; Loukas, Demetrios; Topsis-Giotis, Iasonas; Kesisoglou, Stilianos; Panagiotou, Apostolos; Saoulidou, Niki; Tziaferi, Eirini; Evangelou, Ioannis; Flouris, Giannis; Foudas, Costas; Kokkas, Panagiotis; Loukas, Nikitas; Manthos, Nikolaos; Papadopoulos, Ioannis; Paradas, Evangelos; Filipovic, Nicolas; Bencze, Gyorgy; Hajdu, Csaba; Horvath, Dezso; Sikler, Ferenc; Veszpremi, Viktor; Vesztergombi, Gyorgy; Zsigmond, Anna Julia; Beni, Noemi; Czellar, Sandor; Karancsi, János; Makovec, Alajos; Molnar, Jozsef; Szillasi, Zoltan; Bartók, Márton; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Bahinipati, Seema; Choudhury, Somnath; Mal, Prolay; Mandal, Koushik; Nayak, Aruna; Sahoo, Deepak Kumar; Sahoo, Niladribihari; Swain, Sanjay Kumar; Bansal, Sunil; Beri, Suman Bala; Bhatnagar, Vipin; Chawla, Ridhi; Bhawandeep, Bhawandeep; Kalsi, Amandeep Kaur; Kaur, Anterpreet; Kaur, Manjit; Kumar, Ramandeep; Kumari, Priyanka; Mehta, Ankita; Mittal, Monika; Singh, Jasbir; Walia, Genius; Kumar, Ashok; Bhardwaj, Ashutosh; Choudhary, Brajesh C; Garg, Rocky Bala; Keshri, Sumit; Malhotra, Shivali; Naimuddin, Md; Nishu, Nishu; Ranjan, Kirti; Sharma, Ramkrishna; Sharma, Varun; Bhattacharya, Rajarshi; Bhattacharya, Satyaki; Chatterjee, Kalyanmoy; Dey, Sourav; Dutt, Suneel; Dutta, Suchandra; Ghosh, Shamik; Majumdar, Nayana; Modak, Atanu; Mondal, Kuntal; Mukhopadhyay, Supratik; Nandan, Saswati; Purohit, Arnab; Roy, Ashim; Roy, Debarati; Roy Chowdhury, Suvankar; Sarkar, Subir; Sharan, Manoj; Thakur, Shalini; Behera, Prafulla Kumar; Chudasama, Ruchi; Dutta, Dipanwita; Jha, Vishwajeet; Kumar, Vineet; Mohanty, Ajit Kumar; Netrakanti, Pawan Kumar; Pant, Lalit Mohan; Shukla, Prashant; Topkar, Anita; Aziz, Tariq; Dugad, Shashikant; Kole, Gouranga; Mahakud, Bibhuprasad; Mitra, Soureek; Mohanty, Gagan Bihari; Parida, Bibhuti; Sur, Nairit; Sutar, Bajrang; Banerjee, Sudeshna; Bhowmik, Sandeep; Dewanjee, Ram Krishna; Ganguly, Sanmay; Guchait, Monoranjan; Jain, Sandhya; Kumar, Sanjeev; Maity, Manas; Majumder, Gobinda; Mazumdar, Kajari; Sarkar, Tanmay; Wickramage, Nadeesha; Chauhan, Shubhanshu; Dube, Sourabh; Hegde, Vinay; Kapoor, Anshul; Kothekar, Kunal; Pandey, Shubham; Rane, Aditee; Sharma, Seema; Chenarani, Shirin; Eskandari Tadavani, Esmaeel; Etesami, Seyed Mohsen; Fahim, Ali; Khakzad, Mohsen; Mohammadi Najafabadi, Mojtaba; Naseri, Mohsen; Paktinat Mehdiabadi, Saeid; Rezaei Hosseinabadi, Ferdos; Safarzadeh, Batool; Zeinali, Maryam; Felcini, Marta; Grunewald, Martin; Abbrescia, Marcello; Calabria, Cesare; Caputo, Claudio; Colaleo, Anna; Creanza, Donato; Cristella, Leonardo; De Filippis, Nicola; De Palma, Mauro; Fiore, Luigi; Iaselli, Giuseppe; Maggi, Giorgio; Maggi, Marcello; Miniello, Giorgia; My, Salvatore; Nuzzo, Salvatore; Pompili, Alexis; Pugliese, Gabriella; Radogna, Raffaella; Ranieri, Antonio; Selvaggi, Giovanna; Silvestris, Lucia; Venditti, Rosamaria; Verwilligen, Piet; Abbiendi, Giovanni; Battilana, Carlo; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Brigliadori, Luca; Campanini, Renato; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Chhibra, Simranjit Singh; Codispoti, Giuseppe; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Grandi, Claudio; Guiducci, Luigi; Marcellini, Stefano; Masetti, Gianni; Montanari, Alessandro; Navarria, Francesco; Perrotta, Andrea; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gian Piero; Tosi, Nicolò; Albergo, Sebastiano; Costa, Salvatore; Di Mattia, Alessandro; Giordano, Ferdinando; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Viliani, Lorenzo; Benussi, Luigi; Bianco, Stefano; Fabbri, Franco; Piccolo, Davide; Primavera, Federica; Calvelli, Valerio; Ferro, Fabrizio; Lo Vetere, Maurizio; Monge, Maria Roberta; Robutti, Enrico; Tosi, Silvano; Brianza, Luca; Brivio, Francesco; Dinardo, Mauro Emanuele; Fiorendi, Sara; Gennai, Simone; Ghezzi, Alessio; Govoni, Pietro; Malberti, Martina; Malvezzi, Sandra; Manzoni, Riccardo Andrea; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Pigazzini, Simone; Ragazzi, Stefano; Tabarelli de Fatis, Tommaso; Buontempo, Salvatore; Cavallo, Nicola; De Nardo, Guglielmo; Di Guida, Salvatore; Esposito, Marco; Fabozzi, Francesco; Fienga, Francesco; Iorio, Alberto Orso Maria; Lanza, Giuseppe; Lista, Luca; Meola, Sabino; Paolucci, Pierluigi; Sciacca, Crisostomo; Thyssen, Filip; Azzi, Patrizia; Bacchetta, Nicola; Benato, Lisa; Bisello, Dario; Boletti, Alessio; Carlin, Roberto; Carvalho Antunes De Oliveira, Alexandra; Checchia, Paolo; Dall'Osso, Martino; De Castro Manzano, Pablo; Dorigo, Tommaso; Dosselli, Umberto; Gasparini, Fabrizio; Gasparini, Ugo; Gozzelino, Andrea; Lacaprara, Stefano; Margoni, Martino; Meneguzzo, Anna Teresa; Pazzini, Jacopo; Pozzobon, Nicola; Ronchese, Paolo; Simonetto, Franco; Torassa, Ezio; Zanetti, Marco; Zotto, Pierluigi; Zumerle, Gianni; Braghieri, Alessandro; Magnani, Alice; Montagna, Paolo; Ratti, Sergio P; Re, Valerio; Riccardi, Cristina; Salvini, Paola; Vai, Ilaria; Vitulo, Paolo; Alunni Solestizi, Luisa; Bilei, Gian Mario; Ciangottini, Diego; Fanò, Livio; Lariccia, Paolo; Leonardi, Roberto; Mantovani, Giancarlo; Menichelli, Mauro; Saha, Anirban; Santocchia, Attilio; Androsov, Konstantin; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Castaldi, Rino; Ciocci, Maria Agnese; Dell'Orso, Roberto; Donato, Silvio; Fedi, Giacomo; Giassi, Alessandro; Grippo, Maria Teresa; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Palla, Fabrizio; Rizzi, Andrea; Savoy-Navarro, Aurore; Spagnolo, Paolo; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; Cipriani, Marco; Del Re, Daniele; Diemoz, Marcella; Gelli, Simone; Longo, Egidio; Margaroli, Fabrizio; Marzocchi, Badder; Meridiani, Paolo; Organtini, Giovanni; Paramatti, Riccardo; Preiato, Federico; Rahatlou, Shahram; Rovelli, Chiara; Santanastasio, Francesco; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Bartosik, Nazar; Bellan, Riccardo; Biino, Cristina; Cartiglia, Nicolo; Cenna, Francesca; Costa, Marco; Covarelli, Roberto; Degano, Alessandro; Demaria, Natale; Finco, Linda; Kiani, Bilal; Mariotti, Chiara; Maselli, Silvia; Migliore, Ernesto; Monaco, Vincenzo; Monteil, Ennio; Monteno, Marco; Obertino, Maria Margherita; Pacher, Luca; Pastrone, Nadia; Pelliccioni, Mario; Pinna Angioni, Gian Luca; Ravera, Fabio; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Shchelina, Ksenia; Sola, Valentina; Solano, Ada; Staiano, Amedeo; Traczyk, Piotr; Belforte, Stefano; Casarsa, Massimo; Cossutti, Fabio; Della Ricca, Giuseppe; Zanetti, Anna; Kim, Dong Hee; Kim, Gui Nyun; Kim, Min Suk; Lee, Sangeun; Lee, Seh Wook; Oh, Young Do; Sekmen, Sezen; Son, Dong-Chul; Yang, Yu Chul; Lee, Ari; Kim, Hyunchul; Brochero Cifuentes, Javier Andres; Kim, Tae Jeong; Cho, Sungwoong; Choi, Suyong; Go, Yeonju; Gyun, Dooyeon; Ha, Seungkyu; Hong, Byung-Sik; Jo, Youngkwon; Kim, Yongsun; Lee, Byounghoon; Lee, Kisoo; Lee, Kyong Sei; Lee, Songkyo; Lim, Jaehoon; Park, Sung Keun; Roh, Youn; Almond, John; Kim, Junho; Lee, Haneol; Oh, Sung Bin; Radburn-Smith, Benjamin Charles; Seo, Seon-hee; Yang, Unki; Yoo, Hwi Dong; Yu, Geum Bong; Choi, Minkyoo; Kim, Hyunyong; Kim, Ji Hyun; Lee, Jason Sang Hun; Park, Inkyu; Ryu, Geonmo; Ryu, Min Sang; Choi, Young-Il; Goh, Junghwan; Hwang, Chanwook; Lee, Jongseok; Yu, Intae; Dudenas, Vytautas; Juodagalvis, Andrius; Vaitkus, Juozas; Ahmed, Ijaz; Ibrahim, Zainol Abidin; Komaragiri, Jyothsna Rani; Md Ali, Mohd Adli Bin; Mohamad Idris, Faridah; Wan Abdullah, Wan Ahmad Tajuddin; Yusli, Mohd Nizam; Zolkapli, Zukhaimira; Castilla-Valdez, Heriberto; De La Cruz-Burelo, Eduard; Heredia-De La Cruz, Ivan; Hernandez-Almada, Alberto; Lopez-Fernandez, Ricardo; Magaña Villalba, Ricardo; Mejia Guisao, Jhovanny; Sánchez Hernández, Alberto; Carrillo Moreno, Salvador; Oropeza Barrera, Cristina; Vazquez Valencia, Fabiola; Carpinteyro, Severiano; Pedraza, Isabel; Salazar Ibarguen, Humberto Antonio; Uribe Estrada, Cecilia; Morelos Pineda, Antonio; Krofcheck, David; Butler, Philip H; Ahmad, Ashfaq; Ahmad, Muhammad; Hassan, Qamar; Hoorani, Hafeez R; Khan, Wajid Ali; Saddique, Asif; Shah, Mehar Ali; Shoaib, Muhammad; Waqas, Muhammad; Bialkowska, Helena; Bluj, Michal; Boimska, Bożena; Frueboes, Tomasz; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Zalewski, Piotr; Bunkowski, Karol; Byszuk, Adrian; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Misiura, Maciej; Olszewski, Michal; Walczak, Marek; Bargassa, Pedrame; Beirão Da Cruz E Silva, Cristóvão; Calpas, Betty; Di Francesco, Agostino; Faccioli, Pietro; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Hollar, Jonathan; Leonardo, Nuno; Lloret Iglesias, Lara; Nemallapudi, Mythra Varun; Rodrigues Antunes, Joao; Seixas, Joao; Toldaiev, Oleksii; Vadruccio, Daniele; Varela, Joao; Vischia, Pietro; Afanasiev, Serguei; Bunin, Pavel; Gavrilenko, Mikhail; Golutvin, Igor; Gorbunov, Ilya; Kamenev, Alexey; Karjavin, Vladimir; Lanev, Alexander; Malakhov, Alexander; Matveev, Viktor; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Shulha, Siarhei; Skatchkov, Nikolai; Smirnov, Vitaly; Voytishin, Nikolay; Zarubin, Anatoli; Chtchipounov, Leonid; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Kuznetsova, Ekaterina; Murzin, Victor; Oreshkin, Vadim; Sulimov, Valentin; Vorobyev, Alexey; Andreev, Yuri; Dermenev, Alexander; Gninenko, Sergei; Golubev, Nikolai; Karneyeu, Anton; Kirsanov, Mikhail; Krasnikov, Nikolai; Pashenkov, Anatoli; Tlisov, Danila; Toropin, Alexander; Epshteyn, Vladimir; Gavrilov, Vladimir; Lychkovskaya, Natalia; Popov, Vladimir; Pozdnyakov, Ivan; Safronov, Grigory; Spiridonov, Alexander; Toms, Maria; Vlasov, Evgueni; Zhokin, Alexander; Bylinkin, Alexander; Chadeeva, Marina; Rusinov, Vladimir; Zhemchugov, Evgenii; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Leonidov, Andrey; Terkulov, Adel; Baskakov, Alexey; Belyaev, Andrey; Boos, Edouard; Bunichev, Viacheslav; Dubinin, Mikhail; Dudko, Lev; Gribushin, Andrey; Klyukhin, Vyacheslav; Korneeva, Natalia; Lokhtin, Igor; Miagkov, Igor; Obraztsov, Stepan; Perfilov, Maxim; Petrushanko, Sergey; Savrin, Viktor; Blinov, Vladimir; Skovpen, Yuri; Shtol, Dmitry; Azhgirey, Igor; Bayshev, Igor; Bitioukov, Sergei; Elumakhov, Dmitry; Kachanov, Vassili; Kalinin, Alexey; Konstantinov, Dmitri; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Sobol, Andrei; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Cirkovic, Predrag; Devetak, Damir; Dordevic, Milos; Milosevic, Jovan; Rekovic, Vladimir; Alcaraz Maestre, Juan; Barrio Luna, Mar; Calvo, Enrique; Cerrada, Marcos; Chamizo Llatas, Maria; Colino, Nicanor; De La Cruz, Begona; Delgado Peris, Antonio; Escalante Del Valle, Alberto; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M; Josa, Maria Isabel; Navarro De Martino, Eduardo; Pérez-Calero Yzquierdo, Antonio María; Puerta Pelayo, Jesus; Quintario Olmeda, Adrián; Redondo, Ignacio; Romero, Luciano; Senghi Soares, Mara; de Trocóniz, Jorge F; Missiroli, Marino; Moran, Dermot; Cuevas, Javier; Fernandez Menendez, Javier; Gonzalez Caballero, Isidro; González Fernández, Juan Rodrigo; Palencia Cortezon, Enrique; Sanchez Cruz, Sergio; Suárez Andrés, Ignacio; Vizan Garcia, Jesus Manuel; Cabrillo, Iban Jose; Calderon, Alicia; Castiñeiras De Saa, Juan Ramon; Curras, Esteban; Fernandez, Marcos; Garcia-Ferrero, Juan; Gomez, Gervasio; Lopez Virto, Amparo; Marco, Jesus; Martinez Rivero, Celso; Matorras, Francisco; Piedra Gomez, Jonatan; Rodrigo, Teresa; Ruiz-Jimeno, Alberto; Scodellaro, Luca; Trevisani, Nicolò; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Bachtis, Michail; Baillon, Paul; Ball, Austin; Barney, David; Bloch, Philippe; Bocci, Andrea; Bonato, Alessio; Botta, Cristina; Camporesi, Tiziano; Castello, Roberto; Cepeda, Maria; Cerminara, Gianluca; D'Alfonso, Mariarosaria; D'Enterria, David; Dabrowski, Anne; Daponte, Vincenzo; David Tinoco Mendes, Andre; De Gruttola, Michele; De Roeck, Albert; Di Marco, Emanuele; Dobson, Marc; Dorney, Brian; Du Pree, Tristan; Duggan, Daniel; Dünser, Marc; Dupont, Niels; Elliott-Peisert, Anna; Fartoukh, Stephane; Franzoni, Giovanni; Fulcher, Jonathan; Funk, Wolfgang; Gigi, Dominique; Gill, Karl; Girone, Maria; Glege, Frank; Gulhan, Doga; Gundacker, Stefan; Guthoff, Moritz; Hammer, Josef; Harris, Philip; Hegeman, Jeroen; Innocente, Vincenzo; Janot, Patrick; Kieseler, Jan; Kirschenmann, Henning; Knünz, Valentin; Kornmayer, Andreas; Kortelainen, Matti J; Kousouris, Konstantinos; Krammer, Manfred; Lange, Clemens; Lecoq, Paul; Lourenco, Carlos; Lucchini, Marco Toliman; Malgeri, Luca; Mannelli, Marcello; Martelli, Arabella; Meijers, Frans; Merlin, Jeremie Alexandre; Mersi, Stefano; Meschi, Emilio; Milenovic, Predrag; Moortgat, Filip; Morovic, Srecko; Mulders, Martijn; Neugebauer, Hannes; Orfanelli, Styliani; Orsini, Luciano; Pape, Luc; Perez, Emmanuel; Peruzzi, Marco; Petrilli, Achille; Petrucciani, Giovanni; Pfeiffer, Andreas; Pierini, Maurizio; Racz, Attila; Reis, Thomas; Rolandi, Gigi; Rovere, Marco; Ruan, Manqi; Sakulin, Hannes; Sauvan, Jean-Baptiste; Schäfer, Christoph; Schwick, Christoph; Seidel, Markus; Sharma, Archana; Silva, Pedro; Sphicas, Paraskevas; Steggemann, Jan; Stoye, Markus; Takahashi, Yuta; Tosi, Mia; Treille, Daniel; Triossi, Andrea; Tsirou, Andromachi; Veckalns, Viesturs; Veres, Gabor Istvan; Verweij, Marta; Wardle, Nicholas; Wöhri, Hermine Katharina; Zagoździńska, Agnieszka; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; Kotlinski, Danek; Langenegger, Urs; Rohe, Tilman; Bachmair, Felix; Bäni, Lukas; Bianchini, Lorenzo; Casal, Bruno; Dissertori, Günther; Dittmar, Michael; Donegà, Mauro; Grab, Christoph; Heidegger, Constantin; Hits, Dmitry; Hoss, Jan; Kasieczka, Gregor; Lecomte, Pierre; Lustermann, Werner; Mangano, Boris; Marionneau, Matthieu; Martinez Ruiz del Arbol, Pablo; Masciovecchio, Mario; Meinhard, Maren Tabea; Meister, Daniel; Micheli, Francesco; Musella, Pasquale; Nessi-Tedaldi, Francesca; Pandolfi, Francesco; Pata, Joosep; Pauss, Felicitas; Perrin, Gaël; Perrozzi, Luca; Quittnat, Milena; Rossini, Marco; Schönenberger, Myriam; Starodumov, Andrei; Tavolaro, Vittorio Raoul; Theofilatos, Konstantinos; Wallny, Rainer; Aarrestad, Thea Klaeboe; Amsler, Claude; Caminada, Lea; Canelli, Maria Florencia; De Cosa, Annapaola; Galloni, Camilla; Hinzmann, Andreas; Hreus, Tomas; Kilminster, Benjamin; Ngadiuba, Jennifer; Pinna, Deborah; Rauco, Giorgia; Robmann, Peter; Salerno, Daniel; Yang, Yong; Zucchetta, Alberto; Candelise, Vieri; Doan, Thi Hien; Jain, Shilpi; Khurana, Raman; Konyushikhin, Maxim; Kuo, Chia-Ming; Lin, Willis; Lu, Yun-Ju; Pozdnyakov, Andrey; Yu, Shin-Shan; Kumar, Arun; Chang, Paoti; Chang, You-Hao; Chang, Yu-Wei; Chao, Yuan; Chen, Kai-Feng; Chen, Po-Hsun; Dietz, Charles; Fiori, Francesco; Hou, George Wei-Shu; Hsiung, Yee; Liu, Yueh-Feng; Lu, Rong-Shyang; Miñano Moya, Mercedes; Paganis, Efstathios; Psallidas, Andreas; Tsai, Jui-fa; Tzeng, Yeng-Ming; Asavapibhop, Burin; Singh, Gurpreet; Srimanobhas, Norraphat; Suwonjandee, Narumon; Adiguzel, Aytul; Cerci, Salim; Damarseckin, Serdal; Demiroglu, Zuhal Seyma; Dozen, Candan; Dumanoglu, Isa; Girgis, Semiray; Gokbulut, Gul; Guler, Yalcin; Hos, Ilknur; Kangal, Evrim Ersin; Kara, Ozgun; Kiminsu, Ugur; Oglakci, Mehmet; Onengut, Gulsen; Ozdemir, Kadri; Sunar Cerci, Deniz; Tali, Bayram; Topakli, Huseyin; Turkcapar, Semra; Zorbakir, Ibrahim Soner; Zorbilmez, Caglar; Bilin, Bugra; Bilmis, Selcuk; Isildak, Bora; Karapinar, Guler; Yalvac, Metin; Zeyrek, Mehmet; Gülmez, Erhan; Kaya, Mithat; Kaya, Ozlem; Yetkin, Elif Asli; Yetkin, Taylan; Cakir, Altan; Cankocak, Kerem; Sen, Sercan; Grynyov, Boris; Levchuk, Leonid; Sorokin, Pavel; Aggleton, Robin; Ball, Fionn; Beck, Lana; Brooke, James John; Burns, Douglas; Clement, Emyr; Cussans, David; Flacher, Henning; Goldstein, Joel; Grimes, Mark; Heath, Greg P; Heath, Helen F; Jacob, Jeson; Kreczko, Lukasz; Lucas, Chris; Newbold, Dave M; Paramesvaran, Sudarshan; Poll, Anthony; Sakuma, Tai; Seif El Nasr-storey, Sarah; Smith, Dominic; Smith, Vincent J; Bell, Ken W; Belyaev, Alexander; Brew, Christopher; Brown, Robert M; Calligaris, Luigi; Cieri, Davide; Cockerill, David JA; Coughlan, John A; Harder, Kristian; Harper, Sam; Olaiya, Emmanuel; Petyt, David; Shepherd-Themistocleous, Claire; Thea, Alessandro; Tomalin, Ian R; Williams, Thomas; Baber, Mark; Bainbridge, Robert; Buchmuller, Oliver; Bundock, Aaron; Burton, Darren; Casasso, Stefano; Citron, Matthew; Colling, David; Corpe, Louie; Dauncey, Paul; Davies, Gavin; De Wit, Adinda; Della Negra, Michel; Di Maria, Riccardo; Dunne, Patrick; Elwood, Adam; Futyan, David; Haddad, Yacine; Hall, Geoffrey; Iles, Gregory; James, Thomas; Lane, Rebecca; Laner, Christian; Lucas, Robyn; Lyons, Louis; Magnan, Anne-Marie; Malik, Sarah; Mastrolorenzo, Luca; Nash, Jordan; Nikitenko, Alexander; Pela, Joao; Penning, Bjoern; Pesaresi, Mark; Raymond, David Mark; Richards, Alexander; Rose, Andrew; Seez, Christopher; Summers, Sioni; Tapper, Alexander; Uchida, Kirika; Vazquez Acosta, Monica; Virdee, Tejinder; Wright, Jack; Zenz, Seth Conrad; Cole, Joanne; Hobson, Peter R; Khan, Akram; Kyberd, Paul; Leslie, Dawn; Reid, Ivan; Symonds, Philip; Teodorescu, Liliana; Turner, Mark; Borzou, Ahmad; Call, Kenneth; Dittmann, Jay; Hatakeyama, Kenichi; Liu, Hongxuan; Pastika, Nathaniel; Cooper, Seth; Henderson, Conor; Rumerio, Paolo; West, Christopher; Arcaro, Daniel; Avetisyan, Aram; Bose, Tulika; Gastler, Daniel; Rankin, Dylan; Richardson, Clint; Rohlf, James; Sulak, Lawrence; Zou, David; Benelli, Gabriele; Berry, Edmund; Cutts, David; Garabedian, Alex; Hakala, John; Heintz, Ulrich; Hogan, Julie Managan; Jesus, Orduna; Kwok, Ka Hei Martin; Laird, Edward; Landsberg, Greg; Mao, Zaixing; Narain, Meenakshi; Piperov, Stefan; Sagir, Sinan; Spencer, Eric; Syarif, Rizki; Breedon, Richard; Breto, Guillermo; Burns, Dustin; Calderon De La Barca Sanchez, Manuel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Conway, Rylan; Cox, Peter Timothy; Erbacher, Robin; Flores, Chad; Funk, Garrett; Gardner, Michael; Ko, Winston; Lander, Richard; Mclean, Christine; Mulhearn, Michael; Pellett, Dave; Pilot, Justin; Shalhout, Shalhout; Smith, John; Squires, Michael; Stolp, Dustin; Tripathi, Mani; Bravo, Cameron; Cousins, Robert; Dasgupta, Abhigyan; Everaerts, Pieter; Florent, Alice; Hauser, Jay; Ignatenko, Mikhail; Mccoll, Nickolas; Saltzberg, David; Schnaible, Christian; Takasugi, Eric; Valuev, Vyacheslav; Weber, Matthias; Burt, Kira; Clare, Robert; Ellison, John Anthony; Gary, J William; Ghiasi Shirazi, Seyyed Mohammad Amin; Hanson, Gail; Heilman, Jesse; Jandir, Pawandeep; Kennedy, Elizabeth; Lacroix, Florent; Long, Owen Rosser; Olmedo Negrete, Manuel; Paneva, Mirena Ivova; Shrinivas, Amithabh; Si, Weinan; Wei, Hua; Wimpenny, Stephen; Yates, Brent; Branson, James G; Cerati, Giuseppe Benedetto; Cittolin, Sergio; Derdzinski, Mark; Gerosa, Raffaele; Holzner, André; Klein, Daniel; Krutelyov, Vyacheslav; Letts, James; Macneill, Ian; Olivito, Dominick; Padhi, Sanjay; Pieri, Marco; Sani, Matteo; Sharma, Vivek; Simon, Sean; Tadel, Matevz; Vartak, Adish; Wasserbaech, Steven; Welke, Charles; Wood, John; Würthwein, Frank; Yagil, Avraham; Zevi Della Porta, Giovanni; Amin, Nick; Bhandari, Rohan; Bradmiller-Feld, John; Campagnari, Claudio; Dishaw, Adam; Dutta, Valentina; Franco Sevilla, Manuel; George, Christopher; Golf, Frank; Gouskos, Loukas; Gran, Jason; Heller, Ryan; Incandela, Joe; Mullin, Sam Daniel; Ovcharova, Ana; Qu, Huilin; Richman, Jeffrey; Stuart, David; Suarez, Indara; Yoo, Jaehyeok; Anderson, Dustin; Apresyan, Artur; Bendavid, Joshua; Bornheim, Adolf; Bunn, Julian; Chen, Yi; Duarte, Javier; Lawhorn, Jay Mathew; Mott, Alexander; Newman, Harvey B; Pena, Cristian; Spiropulu, Maria; Vlimant, Jean-Roch; Xie, Si; Zhu, Ren-Yuan; Andrews, Michael Benjamin; Azzolini, Virginia; Ferguson, Thomas; Paulini, Manfred; Russ, James; Sun, Menglei; Vogel, Helmut; Vorobiev, Igor; Weinberg, Marc; Cumalat, John Perry; Ford, William T; Jensen, Frank; Johnson, Andrew; Krohn, Michael; Mulholland, Troy; Stenson, Kevin; Wagner, Stephen Robert; Alexander, James; Chaves, Jorge; Chu, Jennifer; Dittmer, Susan; Mcdermott, Kevin; Mirman, Nathan; Nicolas Kaufman, Gala; Patterson, Juliet Ritchie; Rinkevicius, Aurelijus; Ryd, Anders; Skinnari, Louise; Soffi, Livia; Tan, Shao Min; Tao, Zhengcheng; Thom, Julia; Tucker, Jordan; Wittich, Peter; Zientek, Margaret; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Apollinari, Giorgio; Banerjee, Sunanda; Bauerdick, Lothar AT; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C; Bolla, Gino; Burkett, Kevin; Butler, Joel Nathan; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Cremonesi, Matteo; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gottschalk, Erik; Gray, Lindsey; Green, Dan; Grünendahl, Stefan; Gutsche, Oliver; Hare, Daryl; Harris, Robert M; Hasegawa, Satoshi; Hirschauer, James; Hu, Zhen; Jayatilaka, Bodhitha; Jindariani, Sergo; Johnson, Marvin; Joshi, Umesh; Klima, Boaz; Kreis, Benjamin; Lammel, Stephan; Linacre, Jacob; Lincoln, Don; Lipton, Ron; Liu, Miaoyuan; Liu, Tiehui; Lopes De Sá, Rafael; Lykken, Joseph; Maeshima, Kaori; Magini, Nicolo; Marraffino, John Michael; Maruyama, Sho; Mason, David; McBride, Patricia; Merkel, Petra; Mrenna, Stephen; Nahn, Steve; O'Dell, Vivian; Pedro, Kevin; Prokofyev, Oleg; Rakness, Gregory; Ristori, Luciano; Sexton-Kennedy, Elizabeth; Soha, Aron; Spalding, William J; Spiegel, Leonard; Stoynev, Stoyan; Strait, James; Strobbe, Nadja; Taylor, Lucas; Tkaczyk, Slawek; Tran, Nhan Viet; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vernieri, Caterina; Verzocchi, Marco; Vidal, Richard; Wang, Michael; Weber, Hannsjoerg Artur; Whitbeck, Andrew; Wu, Yujun; Acosta, Darin; Avery, Paul; Bortignon, Pierluigi; Bourilkov, Dimitri; Brinkerhoff, Andrew; Carnes, Andrew; Carver, Matthew; Curry, David; Das, Souvik; Field, Richard D; Furic, Ivan-Kresimir; Konigsberg, Jacobo; Korytov, Andrey; Low, Jia Fu; Ma, Peisen; Matchev, Konstantin; Mei, Hualin; Mitselmakher, Guenakh; Rank, Douglas; Shchutska, Lesya; Sperka, David; Thomas, Laurent; Wang, Jian; Wang, Sean-Jiun; Yelton, John; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Ackert, Andrew; Adams, Jordon Rowe; Adams, Todd; Askew, Andrew; Bein, Samuel; Diamond, Brendan; Hagopian, Sharon; Hagopian, Vasken; Johnson, Kurtis F; Prosper, Harrison; Santra, Arka; Yohay, Rachel; Baarmand, Marc M; Bhopatkar, Vallary; Colafranceschi, Stefano; Hohlmann, Marcus; Noonan, Daniel; Roy, Titas; Yumiceva, Francisco; Adams, Mark Raymond; Apanasevich, Leonard; Berry, Douglas; Betts, Russell Richard; Bucinskaite, Inga; Cavanaugh, Richard; Evdokimov, Olga; Gauthier, Lucie; Gerber, Cecilia Elena; Hofman, David Jonathan; Jung, Kurt; Kurt, Pelin; O'Brien, Christine; Sandoval Gonzalez, Irving Daniel; Turner, Paul; Varelas, Nikos; Wang, Hui; Wu, Zhenbin; Zakaria, Mohammed; Zhang, Jingyu; Bilki, Burak; Clarida, Warren; Dilsiz, Kamuran; Durgut, Süleyman; Gandrajula, Reddy Pratap; Haytmyradov, Maksat; Khristenko, Viktor; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Ogul, Hasan; Onel, Yasar; Ozok, Ferhat; Penzo, Aldo; Snyder, Christina; Tiras, Emrah; Wetzel, James; Yi, Kai; Anderson, Ian; Blumenfeld, Barry; Cocoros, Alice; Eminizer, Nicholas; Fehling, David; Feng, Lei; Gritsan, Andrei; Maksimovic, Petar; Martin, Christopher; Osherson, Marc; Roskes, Jeffrey; Sarica, Ulascan; Swartz, Morris; Xiao, Meng; Xin, Yongjie; You, Can; Al-bataineh, Ayman; Baringer, Philip; Bean, Alice; Boren, Samuel; Bowen, James; Bruner, Christopher; Castle, James; Forthomme, Laurent; Kenny III, Raymond Patrick; Khalil, Sadia; Kropivnitskaya, Anna; Majumder, Devdatta; Mcbrayer, William; Murray, Michael; Sanders, Stephen; Stringer, Robert; Tapia Takaki, Daniel; Wang, Quan; Ivanov, Andrew; Kaadze, Ketino; Maravin, Yurii; Mohammadi, Abdollah; Saini, Lovedeep Kaur; Skhirtladze, Nikoloz; Toda, Sachiko; Rebassoo, Finn; Wright, Douglas; Anelli, Christopher; Baden, Drew; Baron, Owen; Belloni, Alberto; Calvert, Brian; Eno, Sarah Catherine; Ferraioli, Charles; Gomez, Jaime; Hadley, Nicholas John; Jabeen, Shabnam; Kellogg, Richard G; Kolberg, Ted; Kunkle, Joshua; Lu, Ying; Mignerey, Alice; Ricci-Tam, Francesca; Shin, Young Ho; Skuja, Andris; Tonjes, Marguerite; Tonwar, Suresh C; Abercrombie, Daniel; Allen, Brandon; Apyan, Aram; Barbieri, Richard; Baty, Austin; Bi, Ran; Bierwagen, Katharina; Brandt, Stephanie; Busza, Wit; Cali, Ivan Amos; Demiragli, Zeynep; Di Matteo, Leonardo; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Hsu, Dylan; Iiyama, Yutaro; Innocenti, Gian Michele; Klute, Markus; Kovalskyi, Dmytro; Krajczar, Krisztian; Lai, Yue Shi; Lee, Yen-Jie; Levin, Andrew; Luckey, Paul David; Maier, Benedikt; Marini, Andrea Carlo; Mcginn, Christopher; Mironov, Camelia; Narayanan, Siddharth; Niu, Xinmei; Paus, Christoph; Roland, Christof; Roland, Gunther; Salfeld-Nebgen, Jakob; Stephans, George; Sumorok, Konstanty; Tatar, Kaya; Varma, Mukund; Velicanu, Dragos; Veverka, Jan; Wang, Jing; Wang, Ta-Wei; Wyslouch, Bolek; Yang, Mingming; Zhukova, Victoria; Benvenuti, Alberto; Chatterjee, Rajdeep Mohan; Evans, Andrew; Finkel, Alexey; Gude, Alexander; Hansen, Peter; Kalafut, Sean; Kao, Shih-Chuan; Kubota, Yuichi; Lesko, Zachary; Mans, Jeremy; Nourbakhsh, Shervin; Ruckstuhl, Nicole; Rusack, Roger; Tambe, Norbert; Turkewitz, Jared; Acosta, John Gabriel; Oliveros, Sandra; Avdeeva, Ekaterina; Bartek, Rachel; Bloom, Kenneth; Claes, Daniel R; Dominguez, Aaron; Fangmeier, Caleb; Gonzalez Suarez, Rebeca; Kamalieddin, Rami; Kravchenko, Ilya; Malta Rodrigues, Alan; Meier, Frank; Monroy, Jose; Siado, Joaquin Emilo; Snow, Gregory R; Stieger, Benjamin; Alyari, Maral; Dolen, James; George, Jimin; Godshalk, Andrew; Harrington, Charles; Iashvili, Ia; Kaisen, Josh; Kharchilava, Avto; Kumar, Ashish; Parker, Ashley; Rappoccio, Salvatore; Roozbahani, Bahareh; Alverson, George; Barberis, Emanuela; Hortiangtham, Apichart; Massironi, Andrea; Morse, David Michael; Nash, David; Orimoto, Toyoko; Teixeira De Lima, Rafael; Trocino, Daniele; Wang, Ren-Jie; Wood, Darien; Bhattacharya, Saptaparna; Charaf, Otman; Hahn, Kristan Allan; Kubik, Andrew; Kumar, Ajay; Mucia, Nicholas; Odell, Nathaniel; Pollack, Brian; Schmitt, Michael Henry; Sung, Kevin; Trovato, Marco; Velasco, Mayda; Dev, Nabarun; Hildreth, Michael; Hurtado Anampa, Kenyi; Jessop, Colin; Karmgard, Daniel John; Kellams, Nathan; Lannon, Kevin; Marinelli, Nancy; Meng, Fanbo; Mueller, Charles; Musienko, Yuri; Planer, Michael; Reinsvold, Allison; Ruchti, Randy; Smith, Geoffrey; Taroni, Silvia; Wayne, Mitchell; Wolf, Matthias; Woodard, Anna; Alimena, Juliette; Antonelli, Louis; Bylsma, Ben; Durkin, Lloyd Stanley; Flowers, Sean; Francis, Brian; Hart, Andrew; Hill, Christopher; Hughes, Richard; Ji, Weifeng; Liu, Bingxuan; Luo, Wuming; Puigh, Darren; Winer, Brian L; Wulsin, Howard Wells; Cooperstein, Stephane; Driga, Olga; Elmer, Peter; Hardenbrook, Joshua; Hebda, Philip; Lange, David; Luo, Jingyu; Marlow, Daniel; Mc Donald, Jeffrey; Medvedeva, Tatiana; Mei, Kelvin; Mooney, Michael; Olsen, James; Palmer, Christopher; Piroué, Pierre; Stickland, David; Svyatkovskiy, Alexey; Tully, Christopher; Zuranski, Andrzej; Malik, Sudhir; Barker, Anthony; Barnes, Virgil E; Folgueras, Santiago; Gutay, Laszlo; Jha, Manoj; Jones, Matthew; Jung, Andreas Werner; Khatiwada, Ajeeta; Miller, David Harry; Neumeister, Norbert; Schulte, Jan-Frederik; Shi, Xin; Sun, Jian; Wang, Fuqiang; Xie, Wei; Parashar, Neeti; Stupak, John; Adair, Antony; Akgun, Bora; Chen, Zhenyu; Ecklund, Karl Matthew; Geurts, Frank JM; Guilbaud, Maxime; Li, Wei; Michlin, Benjamin; Northup, Michael; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Rorie, Jamal; Tu, Zhoudunming; Zabel, James; Betchart, Burton; Bodek, Arie; de Barbaro, Pawel; Demina, Regina; Duh, Yi-ting; Ferbel, Thomas; Galanti, Mario; Garcia-Bellido, Aran; Han, Jiyeon; Hindrichs, Otto; Khukhunaishvili, Aleko; Lo, Kin Ho; Tan, Ping; Verzetti, Mauro; Agapitos, Antonis; Chou, John Paul; Contreras-Campana, Emmanuel; Gershtein, Yuri; Gómez Espinosa, Tirso Alejandro; Halkiadakis, Eva; Heindl, Maximilian; Hidas, Dean; Hughes, Elliot; Kaplan, Steven; Kunnawalkam Elayavalli, Raghav; Kyriacou, Savvas; Lath, Amitabh; Nash, Kevin; Saka, Halil; Salur, Sevil; Schnetzer, Steve; Sheffield, David; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Thomassen, Peter; Walker, Matthew; Delannoy, Andrés G; Foerster, Mark; Heideman, Joseph; Riley, Grant; Rose, Keith; Spanier, Stefan; Thapa, Krishna; Bouhali, Othmane; Celik, Ali; Dalchenko, Mykhailo; De Mattia, Marco; Delgado, Andrea; Dildick, Sven; Eusebi, Ricardo; Gilmore, Jason; Huang, Tao; Juska, Evaldas; Kamon, Teruki; Mueller, Ryan; Pakhotin, Yuriy; Patel, Rishi; Perloff, Alexx; Perniè, Luca; Rathjens, Denis; Rose, Anthony; Safonov, Alexei; Tatarinov, Aysen; Ulmer, Keith; Akchurin, Nural; Cowden, Christopher; Damgov, Jordan; De Guio, Federico; Dragoiu, Cosmin; Dudero, Phillip Russell; Faulkner, James; Gurpinar, Emine; Kunori, Shuichi; Lamichhane, Kamal; Lee, Sung Won; Libeiro, Terence; Peltola, Timo; Undleeb, Sonaina; Volobouev, Igor; Wang, Zhixing; Greene, Senta; Gurrola, Alfredo; Janjam, Ravi; Johns, Willard; Maguire, Charles; Melo, Andrew; Ni, Hong; Sheldon, Paul; Tuo, Shengquan; Velkovska, Julia; Xu, Qiao; Arenton, Michael Wayne; Barria, Patrizia; Cox, Bradley; Goodell, Joseph; Hirosky, Robert; Ledovskoy, Alexander; Li, Hengne; Neu, Christopher; Sinthuprasith, Tutanon; Sun, Xin; Wang, Yanchu; Wolfe, Evan; Xia, Fan; Clarke, Christopher; Harr, Robert; Karchin, Paul Edmund; Sturdy, Jared; Belknap, Donald; Buchanan, James; Caillol, Cécile; Dasu, Sridhara; Dodd, Laura; Duric, Senka; Gomber, Bhawna; Grothe, Monika; Herndon, Matthew; Hervé, Alain; Klabbers, Pamela; Lanaro, Armando; Levine, Aaron; Long, Kenneth; Loveless, Richard; Ojalvo, Isabel; Perry, Thomas; Pierro, Giuseppe Antonio; Polese, Giovanni; Ruggles, Tyler; Savin, Alexander; Smith, Nicholas; Smith, Wesley H; Taylor, Devin; Woods, Nathaniel
2017-03-20
The results of a first search for CP violation in the production and decay of top quark-antiquark ($\\mathrm{ t \\bar{t} }$) pairs are presented. The search is based on asymmetries in T-odd, triple-product correlation observables, where T is the time-reversal operator. The analysis uses a sample of proton-proton collisions at $ \\sqrt{s} = $ 8 TeV collected by the CMS experiment, corresponding to an integrated luminosity of 19.7 fb$^{-1}$. Events are selected having one electron or muon and at least four jets. The T-odd observables are measured using four-momentum vectors associated with $ \\mathrm{ t \\bar{t} } $ production and decay. The measured asymmetries exhibit no evidence for CP-violating effects, consistent with the expectation from the standard model.
International Nuclear Information System (INIS)
Ecker, G.; Grimus, W.; Neufeld, H.
1987-01-01
A specific ansatz for the Yukawa couplings of a four-generation SU(2) L x U(I) model with two Higgs doublets is discussed which leads to neutral flavour conservation, spontaneous CP violation and to a genuinely complex mixing matrix. W exchange conserves CP in the limit m t' = m t only. The decay rate for t → b is reduced by a factor two compared to the Standard Model with three generations. The phenomenological implications for K 0 -K-bar 0 and B 0 -B-bar 0 are investigated. (Author)
Marketing Information Products and Services : A Primer for ...
International Development Research Centre (IDRC) Digital Library (Canada)
Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...
The seesaw path to leptonic CP violation
Caputo, A.; Kekic, M.; López-Pavón, J.; Salvado, J.
2017-04-24
Future experiments such as SHiP and high-intensity $e^+ e^-$ colliders will have a superb sensitivity to heavy Majorana neutrinos with masses below $M_Z$. We show that the measurement of the mixing to electrons and muons of one such state could imply the discovery of leptonic CP violation in the context of seesaw models. We quantify in the minimal model the CP discovery potential of these future experiments, and demonstrate that a 5$\\sigma$ CL discovery of leptonic CP violation would be possible in a very significant fraction of parameter space.
Leptogenesis and low energy CP-violation in neutrino physics
International Nuclear Information System (INIS)
Pascoli, S.; Petcov, S.T.; Riotto, A.
2007-01-01
Taking into account the recent progress in the understanding of the lepton flavor effects in leptogenesis, we investigate in detail the possibility that the CP-violation necessary for the generation of the baryon asymmetry of the Universe is due exclusively to the Dirac and/or Majorana CP-violating phases in the PMNS neutrino mixing matrix U, and thus is directly related to the low energy CP-violation in the lepton sector (e.g., in neutrino oscillations, etc.). We first derive the conditions of CP-invariance of the neutrino Yukawa couplings λ in the see-saw Lagrangian, and of the complex orthogonal matrix R in the 'orthogonal' parametrization of λ. We show, e.g. that under certain conditions (i) real R and specific CP-conserving values of the Majorana and Dirac phases can imply CP-violation, and (ii) purely imaginary R does not necessarily imply breaking of CP-symmetry. We study in detail the case of hierarchical heavy Majorana neutrino mass spectrum, presenting results for three possible types of light neutrino mass spectrum: (i) normal hierarchical, (ii) inverted hierarchical, and (iii) quasi-degenerate. Results in the alternative case of quasi-degenerate in mass heavy Majorana neutrinos, are also derived. The minimal supersymmetric extension of the standard theory with right-handed Majorana neutrinos and see-saw mechanism of neutrino mass generation is discussed as well. We illustrate the possible correlations between the baryon asymmetry of the Universe and (i) the rephasing invariant J CP controlling the magnitude of CP-violation in neutrino oscillations, or (ii) the effective Majorana mass in neutrinoless double beta decay, in the cases when the only source of CP-violation is respectively the Dirac or the Majorana phases in the neutrino mixing matrix
CP violation in the lepton sector with Majorana neutrinos
International Nuclear Information System (INIS)
Aguila, F. del
1995-01-01
We study CP violation in the lepton sector in extended models with right-handed neutrinos, without and with left-right symmetry, and with arbitrary mass terms. We find the conditions which must be satisfied by the neutrino and charged lepton mass matrices for CP conservation. These constraints, which are independent of the choice of weak basis, are proven to be also sufficient in simple cases. This invariant formulation makes apparent the necessary requirements for CP violation, as well as the size of CP violating effects. As an example, we show that CP violation can be much larger in left-right symmetric models than in models with only additional right-handed neutrinos, i.e., without right-handed currents. (orig.)
James Cronin, CP Violation, and the Pierre Auger Observatory
dropdown arrow Site Map A-Z Index Menu Synopsis James Cronin, CP Violation and the Pierre Auger Observatory matter over antimatter."1 "The experiment uncovered the CP [charge-parity] violation, or a with Additional Information Additional information about James Cronin and the charge-parity (CP
CPLEAR et BABAR, all aspects of CP violation; CPLEAR et BABAR la violation de CP dans tous ses etats
Energy Technology Data Exchange (ETDEWEB)
Yeche, Ch
2003-06-01
This report of French 'Habilitation a diriger les recherches' summarizes my scientific activity from 1993 to 2003. During this decade, my research work was related to two particle physics experiments: CPLEAR and BABAR. The first one, CPLEAR, has recorded data from 1988 to 1995 on the low energy anti-proton ring (LEAR) at CERN. This experiment was devoted to the study of T, CPT et CP discrete symmetries. The second experiment, BABAR, has been running since 1999, on the PEP-II B factory at SLAC. This experiment searches for CP violation and tests the Standard Model through the measurements of the angles and the sides of the Unitarity Triangle. My research work is divided in five main topics: Study of CP and CPT violation in K{sup 0} {yields} {pi}{sup +} {pi}{sup -} decays; Performance optimization of the particle identification detector (DIRC) of the BABAR experiment; B meson tagging in BABAR experiment; {delta}m{sub d} measurement and Search for CP and T violation in mixing with dilepton events; Search for CP violation in B{sup 0} {yields} {rho}{sup {+-}} {pi}{sup {+-}} and B{sup 0} {yields} {pi}{sup {+-}} K{sup {+-}} decays. (author)
CP110 exhibits novel regulatory activities during centriole assembly in Drosophila
Franz, Anna; Roque, Hélio; Saurya, Saroj; Dobbelaere, Jeroen
2013-01-01
CP110 is a conserved centriole protein implicated in the regulation of cell division, centriole duplication, and centriole length and in the suppression of ciliogenesis. Surprisingly, we report that mutant flies lacking CP110 (CP110Δ) were viable and fertile and had no obvious defects in cell division, centriole duplication, or cilia formation. We show that CP110 has at least three functions in flies. First, it subtly influences centriole length by counteracting the centriole-elongating activity of several centriole duplication proteins. Specifically, we report that centrioles are ∼10% longer than normal in CP110Δ mutants and ∼20% shorter when CP110 is overexpressed. Second, CP110 ensures that the centriolar microtubules do not extend beyond the distal end of the centriole, as some centriolar microtubules can be more than 50 times longer than the centriole in the absence of CP110. Finally, and unexpectedly, CP110 suppresses centriole overduplication induced by the overexpression of centriole duplication proteins. These studies identify novel and surprising functions for CP110 in vivo in flies. PMID:24297749
An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET
Energy Technology Data Exchange (ETDEWEB)
Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)
2011-01-15
Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.
Spontaneous CP violation on the lattice
Laine, Mikko
2000-01-01
At finite temperatures around the electroweak phase transition, the thermodynamics of the MSSM can be described by a three-dimensional two Higgs doublet effective theory. This effective theory has a phase where CP is spontaneously violated. We study spontaneous CP violation with non-perturbative lattice simulations, and analyse whether one could end up in this phase for any physical MSSM parameter values.
Microsatellite primers for fungus-growing ants
DEFF Research Database (Denmark)
Villesen, Palle; Gertsch, P J; Boomsma, JJ
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Microsatellite Primers for Fungus-Growing Ants
DEFF Research Database (Denmark)
Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Investigation of Inclusive CP Asymmetries in B$^{0}$ Decays
Barate, R; Ghez, P; Goy, C; Lees, J P; Merle, E; Minard, M N; Pietrzyk, B; Bravo, S; Casado, M P; Chmeissani, M; Crespo, J M; Fernández, E; Fernández-Bosman, M; Garrido, L; Graugès-Pous, E; Martínez, M; Merino, G; Miquel, R; Mir, L M; Pacheco, A; Ruiz, H; Colaleo, A; Creanza, D; De Palma, M; Iaselli, Giuseppe; Maggi, G; Maggi, M; Nuzzo, S; Ranieri, A; Raso, G; Ruggieri, F; Selvaggi, G; Silvestris, L; Tempesta, P; Tricomi, A; Zito, G; Huang, X; Lin, J; Ouyang, Q; Wang, T; Xie, Y; Xu, R; Xue, S; Zhang, J; Zhang, L; Zhao, W; Abbaneo, D; Boix, G; Buchmüller, O L; Cattaneo, M; Cerutti, F; Dissertori, G; Drevermann, H; Forty, Roger W; Frank, M; Greening, T C; Hansen, J B; Harvey, J; Janot, P; Jost, B; Lehraus, Ivan; Mato, P; Minten, Adolf G; Moutoussi, A; Ranjard, F; Rolandi, Luigi; Schlatter, W D; Schmitt, M; Schneider, O; Spagnolo, P; Tejessy, W; Teubert, F; Tournefier, E; Wright, A E; Ajaltouni, Ziad J; Badaud, F; Chazelle, G; Deschamps, O; Falvard, A; Gay, P; Guicheney, C; Henrard, P; Jousset, J; Michel, B; Monteil, S; Montret, J C; Pallin, D; Perret, P; Podlyski, F; Hansen, J D; Hansen, J R; Hansen, P H; Nilsson, B S; Petersen, B; Wäänänen, A; Daskalakis, G; Kyriakis, A; Markou, C; Simopoulou, Errietta; Vayaki, Anna; Blondel, A; Bonneaud, G R; Brient, J C; Rougé, A; Rumpf, M; Swynghedauw, M; Verderi, M; Videau, H L; Focardi, E; Parrini, G; Zachariadou, K; Antonelli, A; Antonelli, M; Bencivenni, G; Bologna, G; Bossi, F; Campana, P; Capon, G; Chiarella, V; Laurelli, P; Mannocchi, G; Murtas, F; Murtas, G P; Passalacqua, L; Pepé-Altarelli, M; Halley, A W; Lynch, J G; Negus, P; O'Shea, V; Raine, C; Teixeira-Dias, P; Thompson, A S; Cavanaugh, R J; Dhamotharan, S; Geweniger, C; Hanke, P; Hansper, G; Hepp, V; Kluge, E E; Putzer, A; Sommer, J; Tittel, K; Werner, S; Wunsch, M; Beuselinck, R; Binnie, David M; Cameron, W; Dornan, Peter J; Girone, M; Marinelli, N; Sedgbeer, J K; Thompson, J C; Thomson, E; Ghete, V M; Girtler, P; Kneringer, E; Kuhn, D; Rudolph, G; Bowdery, C K; Buck, P G; Finch, A J; Foster, F; Hughes, G; Jones, R W L; Robertson, N A; Giehl, I; Jakobs, K; Kleinknecht, K; Quast, G; Renk, B; Rohne, E; Sander, H G; Wachsmuth, H W; Zeitnitz, C; Bonissent, A; Carr, J; Coyle, P; Leroy, O; Payre, P; Rousseau, D; Talby, M; Aleppo, M; Ragusa, F; Dietl, H; Ganis, G; Heister, A; Hüttmann, K; Lütjens, G; Mannert, C; Männer, W; Moser, H G; Schael, S; Settles, Ronald; Stenzel, H; Wiedenmann, W; Wolf, G; Azzurri, P; Boucrot, J; Callot, O; Chen, S; Cordier, A; Davier, M; Duflot, L; Grivaz, J F; Heusse, P; Jacholkowska, A; Le Diberder, F R; Lefrançois, J; Lutz, A M; Schune, M H; Veillet, J J; Videau, I; Yuan, C; Zerwas, D; Bagliesi, G; Boccali, T; Calderini, G; Ciulli, V; Foà, L; Giassi, A; Ligabue, F; Messineo, A; Palla, Fabrizio; Rizzo, G; Sanguinetti, G; Sciabà, A; Sguazzoni, G; Tenchini, Roberto; Venturi, A; Verdini, P G; Blair, G A; Cowan, G D; Green, M G; Medcalf, T; Strong, J A; Von Wimmersperg-Töller, J H; Clifft, R W; Edgecock, T R; Norton, P R; Tomalin, I R; Bloch-Devaux, B; Colas, P; Emery, S; Kozanecki, Witold; Lançon, E; Lemaire, M C; Locci, E; Pérez, P; Rander, J; Renardy, J F; Roussarie, A; Schuller, J P; Schwindling, J; Trabelsi, A; Vallage, B; Black, S N; Dann, J H; Johnson, R P; Kim, H Y; Konstantinidis, N P; Litke, A M; McNeil, M A; Taylor, G; Booth, C N; Cartwright, S L; Combley, F; Lehto, M H; Thompson, L F; Affholderbach, K; Böhrer, A; Brandt, S; Grupen, Claus; Misiejuk, A; Prange, G; Sieler, U; Giannini, G; Gobbo, B; Rothberg, J E; Wasserbaech, S R; Armstrong, S R; Cranmer, K; Elmer, P; Ferguson, D P S; Gao, Y; González, S; Hayes, O J; Hu, H; Jin, S; Kile, J; McNamara, P A; Nielsen, J; Orejudos, W; Pan, Y B; Saadi, Y; Scott, I J; Walsh, J; Wu Sau Lan; Wu, X; Zobernig, G
2001-01-01
A search for CP violating effects in the mixing of neutral B mesons is performed using a sample of 4.1 million hadronic Z decays collected with the ALEPH detector from 1991 to 1995. By studying time-dependent asymmetries in flavour-tagged samples of semileptonic and fully inclusive b-hadron decays, two measurements of the semileptonic asymmetry a_cp are extracted. No evidence for CP violation is observed, and the combined value a_cp = -0.013 +- 0.026 is obtained.
CP-odd Phase Correlations and Electric Dipole Moments
Olive, Keith A; Ritz, A; Santoso, Y; Olive, Keith A.; Pospelov, Maxim; Ritz, Adam; Santoso, Yudi
2005-01-01
We revisit the constraints imposed by electric dipole moments (EDMs) of nucleons and heavy atoms on new CP-violating sources within supersymmetric theories. We point out that certain two-loop renormalization group corrections induce significant mixing between the basis-invariant CP-odd phases. In the framework of the constrained minimal supersymmetric standard model (CMSSM), the CP-odd invariant related to the soft trilinear A-phase at the GUT scale, theta_A, induces non-trivial and distinct CP-odd phases for the three gaugino masses at the weak scale. The latter give one-loop contributions to EDMs enhanced by tan beta, and can provide the dominant contribution to the electron EDM induced by theta_A. We perform a detailed analysis of the EDM constraints within the CMSSM, exhibiting the reach, in terms of sparticle spectra, which may be obtained assuming generic phases, as well as the limits on the CP-odd phases for some specific parameter points where detailed phenomenological studies are available. We also i...
Light Higgs boson in THDM with explicit CP violation
International Nuclear Information System (INIS)
Akhmetzyanova, Eh.N.; Dolgopolov, M.V.; Smirnov, I.A.; Dubinin, M.N.
2005-01-01
The effective Lagrangian of the two-doublet Higgs sector with complex parameters is considered in the case of Minimal Supersymmetric Model with explicit CP violation. Light Higgs boson decay widths are calculated for the scenario with maximal mixing of CP even and CP odd states [ru
A brief introduction to the strong CP problem
International Nuclear Information System (INIS)
Wu, Dan-di; Melbourne Univ., Parkville
1991-09-01
The present status of the strong CP problem is briefly reviewed in a heuristic way. A crisis in EDMN calculation is explained. The equation of vacuum alignment obtained by the author and collaborators last year put a constraint on strong CP parameters. Thus the strong CP will be forced to vanish in one of the three scenarios characterized by axion, zero quark mass, and vanishing quark condensate. 12 refs
A Cp-theory problem book compactness in function spaces
Tkachuk, Vladimir V
2015-01-01
This third volume in Vladimir Tkachuk's series on Cp-theory problems applies all modern methods of Cp-theory to study compactness-like properties in function spaces and introduces the reader to the theory of compact spaces widely used in Functional Analysis. The text is designed to bring a dedicated reader from basic topological principles to the frontiers of modern research covering a wide variety of topics in Cp-theory and general topology at the professional level. The first volume, Topological and Function Spaces © 2011, provided an introduction from scratch to Cp-theory and general topology, preparing the reader for a professional understanding of Cp-theory in the last section of its main text. The second volume, Special Features of Function Spaces © 2014, continued from the first, giving reasonably complete coverage of Cp-theory, systematically introducing each of the major topics and providing 500 carefully selected problems and exercises with complete solutions. This third volume is self-contained...
Upadhyay, Mohita; Sharma, Neha; Vivekanandan, Perumal
2014-01-01
Differences in the relative abundance of dinucleotides, if any may provide important clues on host-driven evolution of viruses. We studied dinucleotide frequencies of large DNA viruses infecting vertebrates (n = 105; viruses infecting mammals = 99; viruses infecting aves = 6; viruses infecting reptiles = 1) and invertebrates (n = 88; viruses infecting insects = 84; viruses infecting crustaceans = 4). We have identified systematic depletion of CpT(ApG) dinucleotides and over-representation of CpG dinucleotides as the unique genomic signature of large DNA viruses infecting invertebrates. Detailed investigation of this unique genomic signature suggests the existence of invertebrate host-induced pressures specifically targeting CpT(ApG) and CpG dinucleotides. The depletion of CpT dinucleotides among large DNA viruses infecting invertebrates is at least in part, explained by non-canonical DNA methylation by the infected host. Our findings highlight the role of invertebrate host-related factors in shaping virus evolution and they also provide the necessary framework for future studies on evolution, epigenetics and molecular biology of viruses infecting this group of hosts. PMID:25369195
CP violation in B and D decays
International Nuclear Information System (INIS)
Bigi, I.I.
1986-06-01
Non-leptonic B decays offer the best opportunity to discover the violation of CP invariance outside the neutral K system. Employing the Standard Model one predicts - with reasonable confidence - CP asymmetries of up to 205 (or even more in some cases). The branching ratios for the individual exclusive modes of interest are not expected to exceed the 10 -3 level in most cases; the identification of such decays poses non-trivial problems. It is shown that by summing intelligently over appropriate classes of decays one can greatly enhance statistics without jeopardizing the signal. Data that contain 10 6 produced B mesons would allow meaningful searches for CP violation. It is noted that ''New Physics'' could lead to CP asymmetries in D 0 decays of order 1%. Due to higher branching ratios one can search for such effects in samples of 10 6 produced D mesons. 7 refs
Directory of Open Access Journals (Sweden)
Steven Y C Tong
Full Text Available We aimed to design a real-time reverse-transcriptase-PCR (rRT-PCR, high-resolution melting (HRM assay to detect the H275Y mutation that confers oseltamivir resistance in influenza A/H1N1 2009 viruses.A novel strategy of amplifying a single base pair, the relevant SNP at position 823 of the neuraminidase gene, was chosen to maintain specificity of the assay. Wildtype and mutant virus were differentiated when using known reference samples of cell-cultured virus. However, when dilutions of these reference samples were assayed, amplification of non-specific primer-dimer was evident and affected the overall melting temperature (T(m of the amplified products. Due to primer-dimer appearance at >30 cycles we found that if the cycle threshold (C(T for a dilution was >30, the HRM assay did not consistently discriminate mutant from wildtype. Where the C(T was 32.98 would have an H275Y assay C(T>30. Analysis of the TaqMan C(T values for 609 consecutive clinical samples predicted that 207 (34% of the samples would result in an HRM assay C(T>30 and therefore not be amenable to the HRM assay.The use of single base pair PCR and HRM can be useful for specifically interrogating SNPs. When applied to H1N1 09, the constraints this placed on primer design resulted in amplification of primer-dimer products. The impact primer-dimer had on HRM curves was adjusted for by plotting T(m against C(T. Although less sensitive than TaqMan assays, the HRM assay can rapidly, and at low cost, screen samples with moderate viral concentrations.
CP-violating profile of the electroweak bubble wall
Energy Technology Data Exchange (ETDEWEB)
Funakubo, Koichi [Saga Univ. (Japan). Dept. of Physics; Kakuto, Akira; Otsuki, Shoichiro; Takenaga, Kazunori; Toyoda, Fumihiko
1995-11-01
In any scenario of the electroweak baryogenesis, the profile of the CP violating bubble wall, created at the first-order phase transition, plays an essential role. We attempt to determine it by solving the equations of motion for the scalars in the two-Higgs-doublet model at the transition temperature. According to the parameters in the potential, we found three solutions. Two of them smoothly connect the CP-violating broken phase and the symmetric phase, while the other connects CP-conserving vacua but violates CP in the intermediate region. We also estimate the chiral charge flux, which will be turned into the baryon density in the symmetric phase by the sphaleron process. (author).
LHC experimental sensitivity to CP violating gtt couplings
Sjölin, J
2003-01-01
The level of CP violation in pp to tt+X induced by the standard model is known to be below the experimental sensitivity by many orders of magnitude. However, in some effective theories, it is plausible that new CP violating physics could reveal itself as additional non- renormalizable terms in the Lagrangian. Since these should respect the symmetries of the low-energy gauge interaction, violate CP and generate the correct event topology, the set of allowed terms is highly restricted. This analysis gives an estimate of the expected experimental sensitivity to the lowest order effective CP violating gtt interaction term beyond the standard model using simulated data from the ATLAS detector at the LHC. (36 refs).
CP violating observables in e$^{-}$e$^{+}$ --> W$^{-}$W$^{+}$
Chang, D; Phillips, I
1993-01-01
We consider various integrated lepton charge-energy asymmetries and azimuthal asymmetries as tests of CP violation in the process $e^-e^+ \\to W^-W^+$. These asymmetries are sensitive to different linear combinations of the CP violating form factors in the three gauge boson $W^-W^+$ production vertex, and can distinguish dispersive and absorptive parts of the form factors. It makes use of purely hadronic and purely leptonic modes of $W$'s decays as well as the mixed modes. The techniques of using the kinematics of jets or missing momentum to construct CP--odd observables are also employed. These CP violating observables are illustrated in the generalized Left-Right Model and the Charged Higgs Model.
Sigma decomposition: the CP-odd Lagrangian
Energy Technology Data Exchange (ETDEWEB)
Hierro, I.M. [Dipartimento di Fisica “G. Galilei”, Università di Padova and INFN, Sezione di Padova,Via Marzolo 8, I-35131 Padua (Italy); Merlo, L. [Instituto de Física Teórica, IFT-UAM/CSIC, Universidad Autónoma de Madrid,Cantoblanco, 28049, Madrid (Spain); Rigolin, S. [Dipartimento di Fisica “G. Galilei”, Università di Padova and INFN, Sezione di Padova,Via Marzolo 8, I-35131 Padua (Italy)
2016-04-04
In Alonso et al., http://dx.doi.org/10.1007/JHEP12(2014)034, the CP-even sector of the effective chiral Lagrangian for a generic composite Higgs model with a symmetric coset has been constructed, up to four momenta. In this paper, the CP-odd couplings are studied within the same context. If only the Standard Model bosonic sources of custodial symmetry breaking are considered, then at most six independent operators form a basis. One of them is the weak-θ term linked to non-perturbative sources of CP violation, while the others describe CP-odd perturbative couplings between the Standard Model gauge bosons and an Higgs-like scalar belonging to the Goldstone boson sector. The procedure is then applied to three distinct exemplifying frameworks: the original SU(5)/SO(5) Georgi-Kaplan model, the minimal custodial-preserving SO(5)/SO(4) model and the minimal SU(3)/(SU(2)×U(1)) model, which intrinsically breaks custodial symmetry. Moreover, the projection of the high-energy electroweak effective theory to the low-energy chiral effective Lagrangian for a dynamical Higgs is performed, uncovering strong relations between the operator coefficients and pinpointing the differences with the elementary Higgs scenario.
CpGislandEVO: A Database and Genome Browser for Comparative Evolutionary Genomics of CpG Islands
Directory of Open Access Journals (Sweden)
Guillermo Barturen
2013-01-01
Full Text Available Hypomethylated, CpG-rich DNA segments (CpG islands, CGIs are epigenome markers involved in key biological processes. Aberrant methylation is implicated in the appearance of several disorders as cancer, immunodeficiency, or centromere instability. Furthermore, methylation differences at promoter regions between human and chimpanzee strongly associate with genes involved in neurological/psychological disorders and cancers. Therefore, the evolutionary comparative analyses of CGIs can provide insights on the functional role of these epigenome markers in both health and disease. Given the lack of specific tools, we developed CpGislandEVO. Briefly, we first compile a database of statistically significant CGIs for the best assembled mammalian genome sequences available to date. Second, by means of a coupled browser front-end, we focus on the CGIs overlapping orthologous genes extracted from OrthoDB, thus ensuring the comparison between CGIs located on truly homologous genome segments. This allows comparing the main compositional features between homologous CGIs. Finally, to facilitate nucleotide comparisons, we lifted genome coordinates between assemblies from different species, which enables the analysis of sequence divergence by direct count of nucleotide substitutions and indels occurring between homologous CGIs. The resulting CpGislandEVO database, linking together CGIs and single-cytosine DNA methylation data from several mammalian species, is freely available at our website.
Addressing the strong CP problem with quark mass ratios
Energy Technology Data Exchange (ETDEWEB)
Diaz-Cruz, J.L.; Saldana-Salazar, U.J. [Benemerita Univ. Autonoma de Puebla (Mexico). Facultad de Ciencias Fisico-Matematicas; Hollik, W.G. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)
2016-05-15
The strong CP problem is one of many puzzles in the theoretical description of elementary particles physics that still lacks an explanation. Solutions to that problem usually comprise new symmetries or fields or both. The main problem seems to be how to achieve small CP in the strong interactions despite large CP violation in weak interactions. Observation of CP violation is exclusively through the Higgs-Yukawa interactions. In this letter, we show that with minimal assumptions on the structure of mass (Yukawa) matrices the strong CP problem does not exist in the Standard Model and no extension to solve this is needed. However, to solve the flavor puzzle, models based on minimal SU(3) flavor groups leading to the proposed flavor matrices are favored.
Addressing the strong CP problem with quark mass ratios
International Nuclear Information System (INIS)
Diaz-Cruz, J.L.; Saldana-Salazar, U.J.
2016-05-01
The strong CP problem is one of many puzzles in the theoretical description of elementary particles physics that still lacks an explanation. Solutions to that problem usually comprise new symmetries or fields or both. The main problem seems to be how to achieve small CP in the strong interactions despite large CP violation in weak interactions. Observation of CP violation is exclusively through the Higgs-Yukawa interactions. In this letter, we show that with minimal assumptions on the structure of mass (Yukawa) matrices the strong CP problem does not exist in the Standard Model and no extension to solve this is needed. However, to solve the flavor puzzle, models based on minimal SU(3) flavor groups leading to the proposed flavor matrices are favored.
Neutrino mixing and lepton CP-phase in neutrino oscillations
International Nuclear Information System (INIS)
Ryzhikh, D.A.; Ter-Martirosyan, K.A.
2001-01-01
One studied oscillations of the Dirac neutrinos belonging to three generations in vacuum with regard to the effect of the lepton CP-breaking phase on them in the matrix of lepton mixing (analogue of the quark CP-phase). In the general form one obtained formulae for probabilities of transition of neutrino of one kind to another at oscillations depending on three angles of mixing and on CP-phase. It was pointed that when measuring oscillation average probabilities of transition of neutrino of one kind to another one might in principle, restore the value of lepton CP-phase. Manifestation of CP-phase in the form of deviation of the values of probabilities of direct neutrino transition from reverse one is the effect practically escaping observation [ru
CP violation and supersymmetry-breaking in superstring models
International Nuclear Information System (INIS)
Dent, T.E.
2000-09-01
In this thesis I discuss aspects of the phenomenology of heterotic string, theory, using low-energy effective supergravity models. I investigate the origin of CP violation, the implications for low-energy physics of the modular invariance of the theory, supersymmetry-breaking via gaugino condensation in a hidden sector, and the interplay between these topics. I review the theory of CP violation and the problem of CP violation in supersymmetry phenomenology. In a scenario where the origin of CP violation lies in the compactification of the extra dimensions of string theory, I present simple models which include a duality symmetry acting on the compactification modulus and on observable fields. I show how the structure of the theory affects CP-violating observables, and discuss the effect of such a symmetry on low-energy physics in general. I present a detailed investigation of supersymmetry-breaking by gaugino condensation in supergravity, in particular as applied to the stabilisation of string moduli. For hidden sectors with or without matter I calculate corrections to the usual formulae for the scalar potential and soft supersymmetry-breaking terms. I discuss the phenomenological implications of these corrections and show that they may affect the value of the compactification modulus. and consequently the prospects for predictions of CP violation in string models. (author)
arXiv Flavour Physics and CP Violation
Kamenik, J.F.
2016-01-01
These notes represent a summary of three lectures on flavour and CP violation, given at the CERNs European School of High Energy Physics in 2014. They cover flavour physics within the standard model, phenomenology of CP violation in meson mixing and decays, as well as constraints of flavour observableson physics beyond the standard model. In preparing the lectures (and consequently this summary) I drew heavily from several existing excellent and exhaustive sets of lecture notes and reviews on flavour physics and CP violation [1]. The reader is encouraged to consult those as well as the original literature for a more detailed study.
A physicists guide to The Los Alamos Primer
International Nuclear Information System (INIS)
Reed, B Cameron
2016-01-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)
International Nuclear Information System (INIS)
Quinn, Helen R
2001-01-01
These lectures provide a basic overview of topics related to the study of CP Violation in B decays. In the first lecture, I review the basics of discrete symmetries in field theories, the quantum mechanics of neutral but flavor-non-trivial mesons, and the classification of three types of CP violation [1]. The actual second lecture which I gave will be separately published as it is my Dirac award lecture and is focused on the separate topic of strong CP Violation. In Lecture 2 here, I cover the Standard Model predictions for neutral B decays, and in particular discuss some channels of interest for CP Violation studies. Lecture 3 reviews the various tools and techniques used to deal with the hadronic physics effects. In Lecture 4, I briefly review the present and planned experiments that can study B decays. I cannot teach all the details of this subject in this short course, so my approach is instead to try to give students a grasp of the relevant concepts and an overview of the available tools. The level of these lectures is introductory. I will provide some references to more detailed treatments and current literature, but this is not a review article so I do not attempt to give complete references to all related literature. By now there are some excellent textbooks that cover this subject in great detail [1]. I refer students to these for more details and for more complete references to the original literature
International Nuclear Information System (INIS)
Quinn, H.
2002-01-01
These lectures provide a basic overview of topics related to the study of CP Violation in B decays. In the first lecture, I review the basics of discrete symmetries in field theories, the quantum mechanics of neutral but flavor-non-trivial mesons, and the classification of three types of CP violation. The actual second lecture which I gave will be separately published as it is my Dirac award lecture and is focussed on the separate topic of strong CP Violation. In Lecture 2 here, I cover the Standard Model predictions for neutral B decays, and in particular discuss some channels of interest for CP Violation studies. Lecture 3 reviews the various tools and techniques used to deal with the hadronic physics effects. In Lecture 4, I briefly review the present and planned experiments that can study B decays. I cannot teach all the details of this subject in this short course, so my approach is instead to try to give students a grasp of the relevant concepts and an overview of the available tools. The level of these lectures is introductory. I will provide some references to more detailed treatments and current literature, but this is not a review article so I do not attempt to give complete references to all related literature. By now there are some excellent textbooks that cover this subject in great detail. I refer students to these for more details and for more complete references to the original literature. (author)
Energy Technology Data Exchange (ETDEWEB)
Aubert, B
2004-08-17
The authors have reconstructed B{sup -} --> D{sup 0}K{sup -} decays with D{sup 0} mesons decaying to non-CP (K{sup -}{pi}{sup +}), CD-even (K{sup -}K{sup +}, {pi}{sup -}{pi}{sup +}) and CP-odd (K{sup 0}{sub s}{pi}{sup 0}) eigenstates. They have measured the CP asymmetries A{sub CP{sup +}} = 0.40 {+-} 0.15(stat) {+-} 0.08(syst), A{sup CP{sup -}} = 0.21 {+-} 0.17(stat) {+-} 0.07(syst), and the double ratio of branching fractions R{sub +} = 0.87 {+-} 0.14(stat) {+-} 0.06(syst), R{sub -} = 0.80 {+-} 0.14(stat) {+-} 0.08(syst). These results improve the previous existing measurements from BABAR. All results presented in this document are preliminary.
International Nuclear Information System (INIS)
Littenberg, L.S.
1989-01-01
It's been appreciated for many years that the decays K L → π 0 ell bar ell are CP violating to lowest order in the Standard Model, and that the component of direct CP violation in these decays is likely to be comparable to that of the CP violation due to state mixing (ε). This is to be contrasted with the case of K 0 → ππ wherein the latter contribution is predicted to be hundreds of times larger than the former. This paper investigates this CP violation further. 19 refs., 2 figs
International Nuclear Information System (INIS)
Tsai, Y.S.
1998-01-01
In the Standard Model no CP violation can occur in decay processes involving leptons either as a parent or a daughter because these processes involve one W exchange and thus, even if the CP violating complex coupling exists in these decays, its effect will not show up when the amplitude is squared. The author needs two diagrams to interfere with each other to see the CP violating effects. Here, he discusses ways to find CP violation in the decay of τ ± → ν τ + 3π from unpolarized as well as polarized τ ±
On the determination of the CP of the Higgs boson
Energy Technology Data Exchange (ETDEWEB)
Skjold, A.
1995-12-31
While the Higgs particle of the Standard Models is a Cp-even scalar particle, extended models may contain Higgs particles that are odd under CP, and also models invoking Higgs-like particles which are not eigenstates of CP may be considered. In the context of Higgs production via the Bjorken process and Higgs decay to tour fermions distributions that are sensitive to the CP parity are discussed. The author also discuss observables which may demonstrate presence of CP violation and identify a phase shift {delta} which is a measure of the strength of CP violation in the Higgs-vector-vector coupling, and which can be measured directly in the relevant distribution. In the case of Higgs production via the Bjorken process at a future e{sup +}e{sup -}collider, Monte Carlo data on the expected efficiency is presented, and it is concluded that it is relatively easy to determine whether the produced particle is even or odd under CP. However, observation of any CP violation would require a very large amount of data. It is argued that the analogous prospects at LEP2 or at a future hadron collider like the LHC seem to be less promising. 63 refs.
On the determination of the CP of the Higgs boson
Energy Technology Data Exchange (ETDEWEB)
Skjold, A
1996-12-31
While the Higgs particle of the Standard Models is a Cp-even scalar particle, extended models may contain Higgs particles that are odd under CP, and also models invoking Higgs-like particles which are not eigenstates of CP may be considered. In the context of Higgs production via the Bjorken process and Higgs decay to tour fermions distributions that are sensitive to the CP parity are discussed. The author also discuss observables which may demonstrate presence of CP violation and identify a phase shift {delta} which is a measure of the strength of CP violation in the Higgs-vector-vector coupling, and which can be measured directly in the relevant distribution. In the case of Higgs production via the Bjorken process at a future e{sup +}e{sup -}collider, Monte Carlo data on the expected efficiency is presented, and it is concluded that it is relatively easy to determine whether the produced particle is even or odd under CP. However, observation of any CP violation would require a very large amount of data. It is argued that the analogous prospects at LEP2 or at a future hadron collider like the LHC seem to be less promising. 63 refs.
On the determination of the CP of the Higgs boson
International Nuclear Information System (INIS)
Skjold, A.
1995-01-01
While the Higgs particle of the Standard Models is a Cp-even scalar particle, extended models may contain Higgs particles that are odd under CP, and also models invoking Higgs-like particles which are not eigenstates of CP may be considered. In the context of Higgs production via the Bjorken process and Higgs decay to tour fermions distributions that are sensitive to the CP parity are discussed. The author also discuss observables which may demonstrate presence of CP violation and identify a phase shift δ which is a measure of the strength of CP violation in the Higgs-vector-vector coupling, and which can be measured directly in the relevant distribution. In the case of Higgs production via the Bjorken process at a future e + e - collider, Monte Carlo data on the expected efficiency is presented, and it is concluded that it is relatively easy to determine whether the produced particle is even or odd under CP. However, observation of any CP violation would require a very large amount of data. It is argued that the analogous prospects at LEP2 or at a future hadron collider like the LHC seem to be less promising. 63 refs
CpG traffic lights are markers of regulatory regions in humans
Khamis, Abdullah M.; Lioznova, Anna V.; Artemov, Artem V.; Ramensky, Vasily; Bajic, Vladimir B.; Medvedeva, Yulia A.
2016-01-01
DNA methylation is involved in regulation of gene expression. Although modern methods profile DNA methylation at single CpG sites, methylation levels are usually averaged over genomic regions in the downstream analyses. In this study we demonstrate that single CpG methylation can serve as a more accurate predictor of gene expression compared to average promoter / gene body methylation. CpG positions with significant correlation between methylation and expression of a gene nearby (named CpG traffic lights) are evolutionary conserved and enriched for exact TSS positions and active enhancers. Among all promoter types, CpG traffic lights are especially enriched in poised promoters. Genes that harbor CpG traffic lights are associated with development and signal transduction. Methylation levels of individual CpG traffic lights vary between cell types dramatically with the increased frequency of intermediate methylation levels, indicating cell population heterogeneity in CpG methylation levels. Being in line with the concept of the inherited stochastic epigenetic variation, methylation of such CpG positions might contribute to transcriptional regulation. Alternatively, one can hypothesize that traffic lights are markers of absent gene expression resulting from inactivation of their regulatory elements. The CpG traffic lights provide a promising insight into mechanisms of enhancer activity and gene regulation linking methylation of single CpG to expression.
CpG traffic lights are markers of regulatory regions in humans
Khamis, Abdullah M.
2016-12-29
DNA methylation is involved in regulation of gene expression. Although modern methods profile DNA methylation at single CpG sites, methylation levels are usually averaged over genomic regions in the downstream analyses. In this study we demonstrate that single CpG methylation can serve as a more accurate predictor of gene expression compared to average promoter / gene body methylation. CpG positions with significant correlation between methylation and expression of a gene nearby (named CpG traffic lights) are evolutionary conserved and enriched for exact TSS positions and active enhancers. Among all promoter types, CpG traffic lights are especially enriched in poised promoters. Genes that harbor CpG traffic lights are associated with development and signal transduction. Methylation levels of individual CpG traffic lights vary between cell types dramatically with the increased frequency of intermediate methylation levels, indicating cell population heterogeneity in CpG methylation levels. Being in line with the concept of the inherited stochastic epigenetic variation, methylation of such CpG positions might contribute to transcriptional regulation. Alternatively, one can hypothesize that traffic lights are markers of absent gene expression resulting from inactivation of their regulatory elements. The CpG traffic lights provide a promising insight into mechanisms of enhancer activity and gene regulation linking methylation of single CpG to expression.
On the energy crisis in noncommutative CP(1) model
International Nuclear Information System (INIS)
Sourrouille, Lucas
2010-01-01
We study the CP(1) system in (2+1)-dimensional noncommutative space with and without Chern-Simons term. Using the Seiberg-Witten map we convert the noncommutative CP(1) system to an action written in terms of the commutative fields. We find that this system presents the same infinite size instanton solution as the commutative Chern-Simons-CP(1) model without a potential term. Based on this result we argue that the BPS equations are compatible with the full variational equations of motion, rejecting the hypothesis of an 'energy crisis'. In addition we examine the noncommutative CP(1) system with a Chern-Simons interaction. In this case we find that when the theory is transformed by the Seiberg-Witten map it also presents the same instanton solution as the commutative Chern-Simons-CP(1) model.
The possibility of leptonic CP-violation measurement with JUNO
Smirnov, M. V.; Hu, Zh. J.; Li, S. J.; Ling, J. J.
2018-06-01
The existence of CP-violation in the leptonic sector is one of the most important issues for modern science. Neutrino physics is a key to the solution of this problem. JUNO (under construction) is the near future of neutrino physics. However CP-violation is not a priority for the current scientific program. We estimate the capability of δCP measurement, assuming a combination of the JUNO detector and a superconductive cyclotron as the antineutrino source. This method of measuring CP-violation is an alternative to conventional beam experiments. A significance level of 3σ can be reached for 22% of the δCP range. The accuracy of measurement lies between 8o and 22o. It is shown that the dominant influence on the result is the uncertainty in the mixing angle Θ23.
Implications of maximal Jarlskog invariant and maximal CP violation
International Nuclear Information System (INIS)
Rodriguez-Jauregui, E.; Universidad Nacional Autonoma de Mexico
2001-04-01
We argue here why CP violating phase Φ in the quark mixing matrix is maximal, that is, Φ=90 . In the Standard Model CP violation is related to the Jarlskog invariant J, which can be obtained from non commuting Hermitian mass matrices. In this article we derive the conditions to have Hermitian mass matrices which give maximal Jarlskog invariant J and maximal CP violating phase Φ. We find that all squared moduli of the quark mixing elements have a singular point when the CP violation phase Φ takes the value Φ=90 . This special feature of the Jarlskog invariant J and the quark mixing matrix is a clear and precise indication that CP violating Phase Φ is maximal in order to let nature treat democratically all of the quark mixing matrix moduli. (orig.)
Introduction to heavy meson decays and CP asymmetries
International Nuclear Information System (INIS)
Ligeti, Zoltan
2003-01-01
These lectures are intended to provide an introduction to heavy meson decays and CP violation. The first lecture contains a brief review of the standard model and how the CKM matrix and CP violation arise, mixing and CP violation in neutral meson systems, and explanation of the cleanliness of the sin 2β measurement. The second lecture deals with the heavy quark limit, some applications of heavy quark symmetry and the operator product expansion for exclusive and inclusive semileptonic B decays. The third lecture concerns with theoretically clean CP violation measurements that may become possible in the future, and some developments toward a better understanding of nonleptonic B decays. The conclusions include a subjective best buy list for the near future
Top quark pair property measurements and $t\\bar{t}+X$, using the ATLAS detector at the LHC
AUTHOR|(INSPIRE)INSPIRE-00451917; The ATLAS collaboration
2018-01-01
Measuring the properties of the top quark has been proven to be a reliable test of the Standard Model of particle physics (SM). At the Large Hadron Collider, top quark physics has entered the era of precision measurements which allows to measure new top quark properties and to repeat other top quark properties measurements with improved precision. This article presents the measurements of top quark spin observables, charge and CP asymmetries, $W$ boson polarisation from $t\\bar{t}$ events and the cross section of $t\\bar{t}$ pairs produced in association with a $W$ or $Z$ boson. All these measurements are using data from proton-proton collisions taken with the ATLAS detector at the Large Hadron Collider. The spin correlation $C(n,n)$ is measured for the first time and direct CP violation is measured directly for the first time in the context of $b$-hadron decays. The measured value of the CP mixing asymmetry $A^{b}_{mix}$ presented here cannot disprove the deviation in the dimuon asymmetry seen by the DØ exper...
Rephasing-invariant CP violating parameters with Majorana neutrinos
International Nuclear Information System (INIS)
Nieves, Jose F.; Pal, Palash B.
2001-06-01
We analyze the dependence of the squared amplitudes on the rephasing-invariant CP-violating parameters of the lepton sector, involving Majorana neutrinos, for various lepton- conserving and lepton-violating processes. We analyze the conditions under which the CP-violating effects in such processes vanish, in terms of the minimal set of rephasing invariants, giving special attention to the dependence on the extra CP-violating parameters that are due to the Majorana nature of the neutrinos. (author)
Neutrinos as a probe of CP-violation and leptogenesis
Indian Academy of Sciences (India)
Establishing CP-violation in the lepton sector is one of the most challenging future tasks in neutrino physics. The lepton mixing matrix contains one Dirac phase and, if neutrinos are Majorana particles, two additional CP-violating phases. I will review the main theoretical aspects of CP-violation in the lepton sector. Then, I will ...
A bottom-up approach to the strong CP problem
Diaz-Cruz, J. L.; Hollik, W. G.; Saldana-Salazar, U. J.
2018-05-01
The strong CP problem is one of many puzzles in the theoretical description of elementary particle physics that still lacks an explanation. While top-down solutions to that problem usually comprise new symmetries or fields or both, we want to present a rather bottom-up perspective. The main problem seems to be how to achieve small CP violation in the strong interactions despite the large CP violation in weak interactions. In this paper, we show that with minimal assumptions on the structure of mass (Yukawa) matrices, they do not contribute to the strong CP problem and thus we can provide a pathway to a solution of the strong CP problem within the structures of the Standard Model and no extension at the electroweak scale is needed. However, to address the flavor puzzle, models based on minimal SU(3) flavor groups leading to the proposed flavor matrices are favored. Though we refrain from an explicit UV completion of the Standard Model, we provide a simple requirement for such models not to show a strong CP problem by construction.
International Nuclear Information System (INIS)
Ukawa, A.
1995-01-01
The CP-PACS Project, which started in April 1992, is a five-year plan to develop a massively parallel computer for carrying out research in computational physics with primary emphasis on lattice QCD. This article describes the architectural design of the CP-PACS computer, the entire computing system including the front end and mass storage, and results of benchmarks for the expected performance for lattice QCD applications. ((orig.))
First evidence for direct CP violation
International Nuclear Information System (INIS)
Schaffer, A.C.
1988-06-01
The double ratio R of the relative decay rates of the short-and long-lived neutral kaons into two charged and two neutral pions was measured to be 0.980 ± 0.004 ± 0.005. The deviation of R from unity implies CP violation in the transition of the CP-odd K 2 into two pions with ε , / ε = (3.3 ± 1.1) X 10 -3
CP symmetry violation. The search for its origin
International Nuclear Information System (INIS)
Cronin, J.W.
1981-01-01
The present experimental situation on detection of CP symmetry violation is presented. Interference between decays of long-lived (Ksub(L)sup(0)) and short-lived (Ksub(S)sup(0)) mesons into two charged pions serves a direct demonstration of the fact that the effect is caused by CP symmetry breaking. The time distribution of decays into π + π - when the 4-10 GeV Ksub(L) meson beam passes through a carbon regenerator is given as an example of the measurement accuracy. The measurements of the charge asymmetry in half-lepton channels of Ksub(L)→π +- l +- ν decay where l is an electron or a muon are discussed. It is noted that the presence of the charge asymmetry serves an indication of CP invariance violation and permits to carry out experimental differentiation between the matter and antimatter. Different theoretical assumptions on the nature of CP invariance violation are discussed. A list of experiments on search for CP, T and C invariance violation carried out in different laboratories of the world is given [ru
Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia
2001-01-01
Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...
A violation of CP symmetry in B meson decays
International Nuclear Information System (INIS)
Karyotakis, Y.; Monchenault, G.H. de
2002-01-01
This article reviews the issue of CP-violation and reports the most recent results about the observation of large CP asymmetries in the decay of neutral B-mesons. Some of the CP asymmetries in the neutral B-meson decay are expected to be large. CP-violation always involves quantum mechanical interference. This occurs for instance when there are 2 paths for a particle to decay into a given final state. The interference between the mixing-induced amplitude (B 0 → B-bar 0 → f) and the decay amplitude (B 0 → f) to a CP eigenstate f leads to a time dependent CP asymmetry that can be interpreted in terms of the angles of the unitary triangle (sin(2β)). The experimental challenge comes from the fact that B decays to some CP eigenstates have very small branching ratios and low efficiencies for complete reconstruction of the final state. It is therefore necessary to produce a very large number of B-mesons to perform a CP-measurement. To make the measurement possible, a new type of e + e - collider, called asymmetric B-factory has been designed. 2 asymmetric B-factories are operating in the world: PEP2 (Stanford, Usa) fitted with the Babar detector and KEK-B (Japan) which hosts Belle detector. The measurements given by Babar and Belle are in good agreement and can be combined. The average value is sin(2β) = 0.78 ± 0.08 and this value is in excellent agreement with the standard model predictions based on available experimental data. (A.C.)
Deelman, B.J; Wierda, F.; Meetsma, A.; Teuben, J.H
1995-01-01
The activation of esters and amides by (Cp(2)*LnH)(2) [Ln = Y (1a), Ln = La (1b), Cp*=C(5)Me] and Cp(2)*Y(2-C(6)H(4)CH(2)NMe(2)) (2) is described. Compounds 1a and 1b react with ethyl acetate to form Cp(2)*YOEt (3a) and Cp(2)*LaOEt (30). With 1a and ethyl benzoate a 1:1 mixture of 3a and
The seesaw path to leptonic CP violation
Energy Technology Data Exchange (ETDEWEB)
Caputo, A.; Hernandez, P. [Universidad de Valencia and CSIC, Edificio Institutos Investigacion, Instituto de Fisica Corpuscular, Paterna (Spain); CERN, Theoretical Physics Department, Geneva (Switzerland); Kekic, M.; Salvado, J. [Universidad de Valencia and CSIC, Edificio Institutos Investigacion, Instituto de Fisica Corpuscular, Paterna (Spain); Lopez-Pavon, J. [CERN, Theoretical Physics Department, Geneva (Switzerland)
2017-04-15
Future experiments such as SHiP and high-intensity e{sup +}e{sup -} colliders will have a superb sensitivity to heavy Majorana neutrinos with masses below M{sub Z}. We show that the measurement of the mixing to electrons and muons of one such state could establish the existence of CP violating phases in the neutrino mixing matrix, in the context of low-scale seesaw models. We quantify in the minimal model the CP reach of these future experiments, and demonstrate that CP violating phases in the mixing matrix could be established at 5σ CL in a very significant fraction of parameter space. (orig.)
International Nuclear Information System (INIS)
Paschos, E.A.
1992-01-01
These lectures present a pedagogical introduction to the topics quark mixing and CP violation. They explain how the mixing matrix comes about and reviews the values of constraints for its elements. The second chapter reviews the CP transformation properties of amplitudes and defines the quantities which are measured in the experiments. Then it reviews the theory of CP violation in the standard model. In addition to the phase and the angles introduced through the flavor matrix, numerical predictions also depend (a) on hadronic matrix elements of weak current operators and (b) the short distance expansion of effective Hamiltonians computed by methods of Quantum Chromodynamics (QCD). I also review these topics and present predictions for (ε'/ε) which are shown to be consistent with the experiments. Last but not least, the article is divided into sections which are as self-contained as possible. The article assumes a general knowledge of the electroweak theory. For guidance, the interested reader will find a table of contents at the end of the text. (author). 29 refs, 5 figs, 1 tab
CP violation experiment at Fermilab
International Nuclear Information System (INIS)
Hsiung, Yee B.
1990-07-01
The E731 experiment at Fermilab has searched for ''direct'' CP violation in K 0 → ππ, which is parametrized by var-epsilon '/var-epsilon. For the first time, in 20% of the data set, all four modes of the K L,S → π + π - (π 0 π 0 ) were collected simultaneously, providing a great check on the systematic uncertainty. The result is Re(var-epsilon '/var-epsilon) = -0.0004 ± 0.0014 (stat) ± 0.0006(syst), which provides no evidence for ''direct'' CP violation. The CPT symmetry has also been tested by measuring the phase difference Δφ = φ 00 - φ ± between the two CP violating parameters η 00 and η ± . We fine Δφ = -0.3 degrees ± 2.4 degree(stat) ± 1.2 degree(syst). Using this together with the world average φ ± , we fine that the phase of the K 0 -bar K 0 mixing parameter var-epsilon is 44.5 degree ± 1.5 degree. Both of these results agree well with the predictions of CPT symmetry. 17 refs., 10 figs
Directory of Open Access Journals (Sweden)
Nao Nishida
Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.
77 FR 37098 - Proposed Collection; Comment Request for Form 8038-CP
2012-06-20
... 8038-CP AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice and request for comments... Form 8038-CP, Return for Credit Payments to Issuers of Qualified Bonds. DATES: Written comments should... Issuers of Qualified Bonds. OMB Number: 1545-2142. Form Number: Form 8038-CP. Abstract: Form 8038-CP...
First CP violation results from BABAR
International Nuclear Information System (INIS)
Hitlin, D.G.
2001-01-01
We present a preliminary measurement of time-dependent Cp-violating asymmetries in B 0 → J/ψK 0 S and B 0 → ψ(2S)K 0 S decays recorded by the BABAR. detector at the PEP-2 asymmetric B Factory at SLAC. The data sample consists of 9.0 fb -1 collected at the γ(4S) resonance and 0.8 fb -1 off-resonance. One of the neutral B mesons, produced in pairs at the γ(4S), is fully reconstructed. The flavor of the other neutral B meson is tagged at the time of its decay, mainly with the charge of identified leptons and kaons. The time difference between the decays is determined by measuring the distance between the decay vertices. Wrong-tag probabilities and the time resolution function are measured with samples of fully-reconstructed semileptonic and hadronic neutral B final states. The value of the asymmetry amplitude, sin 2β, is determined from a maximum likelihood fit to the time distribution of 120 tagged B 0 → J/ψK 0 S and B 0 → ψ(2S)K 0 S candidates: sin 2β=0.12±O.37(stat)±0.09(syst). (author)
Search for CP violation in baryon decays at LHCb
CERN. Geneva
2016-01-01
The phenomenon of CP violation has been observed in the K- and B-meson systems, but not yet with any baryonic particle. We report on searches for CP violation in baryon decays at LHCb using Run I data. We find evidence for CP violation in Lambda0b -> p pi- pi+ pi- decays with a statistical significance corresponding to 3.3 standard deviations, including systematic uncertainties. This represents the first evidence of CP violation in the baryon sector. An overview of other recent results of baryon decays will be presented, along with some highlights of the charmless B-decay programme.
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown
Directory of Open Access Journals (Sweden)
I Dewa Nyoman Nyana
2016-11-01
Full Text Available Yellowing vein banding disease has been reported infecting cucurbit plants in Bali since 2014. Similar vein banding symptom on chilli pepper was observed previously, and early diagnosis indicated infection of Polerovirus. The objective of this research was to confirm the presence of Polerovirus infection on cucumber plant showing yellow vein banding symptom in Bali. Reverse transcription polymerase chain reaction – based detection method was conducted using specific primer pairs PeVYV-CP-F-BamH1/ PeVYV-CP-R-Pst1followed by sequencing and nucleotide sequence analysis. Specific DNA fragments of ± 650 bp was successfully amplified from field samples. Nucleotide sequence analysis showed that the sequence has the highest similarity > 95% with Pepper vein yellow virus (PeVYV infecting chili pepper from Indonesia (Bali, and Rembang, Japan, and Greece.
The impact of intragenic CpG content on gene expression.
Bauer, Asli Petra; Leikam, Doris; Krinner, Simone; Notka, Frank; Ludwig, Christine; Längst, Gernot; Wagner, Ralf
2010-07-01
The development of vaccine components or recombinant therapeutics critically depends on sustained expression of the corresponding transgene. This study aimed to determine the contribution of intragenic CpG content to expression efficiency in transiently and stably transfected mammalian cells. Based upon a humanized version of green fluorescent protein (GFP) containing 60 CpGs within its coding sequence, a CpG-depleted variant of the GFP reporter was established by carefully modulating the codon usage. Interestingly, GFP reporter activity and detectable protein amounts in stably transfected CHO and 293 cells were significantly decreased upon CpG depletion and independent from promoter usage (CMV, EF1 alpha). The reduction in protein expression associated with CpG depletion was likewise observed for other unrelated reporter genes and was clearly reflected by a decline in mRNA copy numbers rather than translational efficiency. Moreover, decreased mRNA levels were neither due to nuclear export restrictions nor alternative splicing or mRNA instability. Rather, the intragenic CpG content influenced de novo transcriptional activity thus implying a common transcription-based mechanism of gene regulation via CpGs. Increased high CpG transcription correlated with changed nucleosomal positions in vitro albeit histone density at the two genes did not change in vivo as monitored by ChIP.
Primer on consumer marketing research : procedures, methods, and tools
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
A Cp-theory problem book special features of function spaces
Tkachuk, Vladimir V
2014-01-01
The books in Vladimir Tkachuk’s A Cp-Theory Problem Book series will be the ‘go to’ texts for basic reference to Cp-theory. This second volume, Special Features of Function Spaces, gives a reasonably complete coverage of Cp-theory, systematically introducing each of the major topics and providing 500 carefully selected problems and exercises with complete solutions. Bonus results and open problems are also given. The text is designed to bring a dedicated reader from basic topological principles to the frontiers of modern research covering a wide variety of topics in Cp-theory and general topology at the professional level. The first volume, Topological and Function Spaces © 2011, provided an introduction from scratch to Cp-theory and general topology, preparing the reader for a professional understanding of Cp-theory in the last section of its main text. This second volume continues from the first, and can be used as a textbook for courses in both Cp-theory and general topology as well as a referenc...
CpG Oligodeoxynucleotides as a Future Vaccine for Allergic Diseases
Directory of Open Access Journals (Sweden)
Kunio Sano
2005-01-01
Full Text Available An astounding feature of the DNA sequences termed CpG motifs is the induction of immune and inflammatory responses in a senseless manner. CpG motifs exist abundantly in microbes and evoke innate immunity that constitutes the first line of defense against microbial infections in vertebrates. CpG motifs that essentially work in an antigen-nonspecific fashion, however, turn into novel immunomodulators that can manipulate acquired immunity in an antigen-specific manner if oligodeoxynucleotides containing CpG motifs (CpG ODNs are directly conjugated to the antigen. CpG ODNs with potent polyclonal Th1-inducing ability show promise for application in immunotherapy whereby neutralization of dominant allergy-prone Th2 cells is achieved by inducing allergen-specific Th1 cells. The underlying mechanisms include an unexpected enhancement of dendritic cell function as a linker between innate and acquired immunity. In the foreseeable future the mainstream therapeutic role of corticosteroids in anti-inflammatory therapy for allergic diseases could possibly be replaced by immunotherapy using CpG ODN-conjugated antigens.
Is CP violation observable in long baseline neutrino oscillation experiments?
International Nuclear Information System (INIS)
Tanimoto, M.
1997-01-01
We have studied CP violation originating from the phase of the neutrino-mixing matrix in the long baseline neutrino oscillation experiments. The direct measurement of CP violation is the difference of the transition probabilities between CP-conjugate channels. In those experiments, the CP-violating effect is not suppressed if the highest neutrino mass scale is taken to be 1 endash 5 eV, which is appropriate for the cosmological hot dark matter. Assuming the hierarchy for the neutrino masses, the upper bounds of CP violation have been calculated for three cases, in which mixings are constrained by the recent short baseline ones. The calculated upper bounds are larger than 10 -2 , which will be observable in the long baseline accelerator experiments. The matter effect, which is not CP invariant, has been also estimated in those experiments. copyright 1997 The American Physical Society
International Nuclear Information System (INIS)
Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.
1988-01-01
The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Energy Technology Data Exchange (ETDEWEB)
Dowrick, N.J. (Dept. of Physics, Oxford (United Kingdom)); McDougall, N.A. (National Lab. for High Energy Physics, Tsukuba, Ibaraki (Japan))
1992-07-09
We show that two well-known solutions to the strong CP problem, the axion and a massless quark, may be understood in terms of the mechanism recently proposed by Samuel where long-range interactions between topological charges may be responsible for the removal of CP violation. We explain how the axion and a QCD meson (identified as the {eta}' if all quarks are massless) suppress fluctuations in global topological charge by almost identical dynamical although the masses, couplings and relevant length scales are very different. Furthermore, we elucidate the precise origin of the {eta}' mass. (orig.).
Criticality calculations with MCNP trademark: A primer
International Nuclear Information System (INIS)
Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.
1994-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand
Energy Technology Data Exchange (ETDEWEB)
Ziethe, J.
2007-05-22
In this work we calculated observables which can be used to determine the CP parity of the Higgs boson. We considered the neutral Higgs bosons of the MSSM as well as CP-indefinite Higgs bosons. The calculation have been made for an application at LHC. For Higgs production we considered gluon fusion (in NLO) and b-quark annihilation (in LO) and for the Higgs decay studied the decay in tau lepton or top quark. We find that the angle between the charged particles of the tau (or top) decay are a good observable to determine CP properties of the intermediate Higgs bosons. For CP indefinite Higgs bosons we considered triplet-correlation-observables. (orig.)
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
Measurements of the B0 bar B0 CP asymmetry
International Nuclear Information System (INIS)
Lueth, V.
1993-01-01
A figure of merit for a measurement of CP violation is the error on the intrinsic asymmetry A CP . The observed asymmetry A obs will always be smaller than A CP due to a number of effects that dilute the measurement. If one defines A obs =DA CP , where D represents the product of all dilution factors, then the error on A CP , δA CP is related to the number of produced B 0 or bar B 0 , N prod , needed to obtain a given error on δA CP by N prod =1/((δA CP ) 2 D 2 εBr). To determine the figure of merit for a particular decay mode one must determine the number of reconstructed events N obs and calculate the corresponding dilution factor D. N obs depends on the luminosity and production cross section, on the branching ratio of the B 0 or bar B 0 into the specific final state under study, Br, and on ε, the reconstruction efficiency for both the combination of the signal CP state and any tagging signal. The production rate N prod , the dilution factor D, and the efficiency ε, differ substantially in magnitude as a function of energy and detector layout. The detection efficiency and dilution factor can both be written as a product of several factors that can be estimated for a particular experiment. These factors depend critically on the decay mode under study, the tagging method, the detector configuration, and more generally on the production process, backgrounds, and detector performance. Furthermore, the present knowledge of these quantities varies largely, as well as ones ability to ultimately measure the dilution factor which relates the experimentally observed asymmetry to the true CP asymmetry
Standard Model CP-violation and baryon asymmetry
Gavela, M.B.; Orloff, J.; Pene, O.
1994-01-01
Simply based on CP arguments, we argue against a Standard Model explanation of the baryon asymmetry of the universe in the presence of a first order phase transition. A CP-asymmetry is found in the reflection coefficients of quarks hitting the phase boundary created during the electroweak transition. The problem is analyzed both in an academic zero temperature case and in the realistic finite temperature one. The building blocks are similar in both cases: Kobayashi-Maskawa CP-violation, CP-even phases in the reflection coefficients of quarks, and physical transitions due to fermion self-energies. In both cases an effect is present at order $\\alpha_W^2$ in rate. A standard GIM behaviour is found as intuitively expected. In the finite temperature case, a crucial role is played by the damping rate of quasi-particles in a hot plasma, which is a relevant scale together with $M_W$ and the temperature. The effect is many orders of magnitude below what observation requires, and indicates that non standard physics is ...
CPLEAR et BABAR, all aspects of CP violation
International Nuclear Information System (INIS)
Yeche, Ch.
2003-06-01
This report of French 'Habilitation a diriger les recherches' summarizes my scientific activity from 1993 to 2003. During this decade, my research work was related to two particle physics experiments: CPLEAR and BABAR. The first one, CPLEAR, has recorded data from 1988 to 1995 on the low energy anti-proton ring (LEAR) at CERN. This experiment was devoted to the study of T, CPT et CP discrete symmetries. The second experiment, BABAR, has been running since 1999, on the PEP-II B factory at SLAC. This experiment searches for CP violation and tests the Standard Model through the measurements of the angles and the sides of the Unitarity Triangle. My research work is divided in five main topics: Study of CP and CPT violation in K 0 → π + π - decays; Performance optimization of the particle identification detector (DIRC) of the BABAR experiment; B meson tagging in BABAR experiment; Δm d measurement and Search for CP and T violation in mixing with dilepton events; Search for CP violation in B 0 → ρ ± π ± and B 0 → π ± K ± decays. (author)
CP-odd phase correlations and electric dipole moments
International Nuclear Information System (INIS)
Olive, Keith A.; Pospelov, Maxim; Ritz, Adam; Santoso, Yudi
2005-01-01
We revisit the constraints imposed by electric dipole moments (EDMs) of nucleons and heavy atoms on new CP-violating sources within supersymmetric theories. We point out that certain two-loop renormalization group corrections induce significant mixing between the basis-invariant CP-odd phases. In the framework of the constrained minimal supersymmetric standard model, the CP-odd invariant related to the soft trilinear A-phase at the grand unified theory (GUT) scale, θ A , induces nontrivial and distinct CP-odd phases for the three gaugino masses at the weak scale. The latter give one-loop contributions to EDMs enhanced by tanβ, and can provide the dominant contribution to the electron EDM induced by θ A . We perform a detailed analysis of the EDM constraints within the constrained minimal supersymmetric standard model, exhibiting the reach, in terms of sparticle spectra, which may be obtained assuming generic phases, as well as the limits on the CP-odd phases for some specific parameter points where detailed phenomenological studies are available. We also illustrate how this reach will expand with results from the next generation of experiments which are currently in development
CP violation in multibody decays of beauty baryons
Energy Technology Data Exchange (ETDEWEB)
Durieux, Gauthier
2016-08-15
Beauty baryons are being observed in large numbers in the LHCb detector. The rich kinematic distributions of their multibody decays are therefore becoming accessible and provide us with new opportunities to search for CP violation. We analyse the angular distributions of some three- and four-body decays of spin-1/2 baryons using the Jacob-Wick helicity formalism. The asymmetries that provide access to small differences of CP-odd phases between decay amplitudes of identical CP-even phases are notably discussed. The understanding gained on processes featuring specific resonant intermediate states allows us to establish which asymmetries are relevant for what purpose. It is for instance shown that some CP-odd angular asymmetries measured by the LHCb collaboration in the Λ{sub b}→Λφ→pπ K{sup +}K{sup -} decay are expected to vanish identically.
Heavy quarks and CP: Moriond 1985
International Nuclear Information System (INIS)
Bjorken, J.D.
1985-03-01
The presentations at the Fifth Moriond Workshop on Heavy Quarks, Flavor Mixing, and CP Violation (La Plagne, France, January 13-19, 1985) are summarized. The following topics are reviewed. What's New (beyond the top, top quarks, bottom quarks, charm quarks, strange quarks, and others); why is all this being done (strong interactions and hadron structure, and electroweak properties); and what next (facilities and can one see CP violation in the B-anti B system). 64 refs., 10 figs
Development of primers for sequencing the NSP1, NSP3, and VP6 genes of the group A porcine rotavirus
Directory of Open Access Journals (Sweden)
Fernanda Dornelas Florentino Silva
2014-02-01
Full Text Available Rotavirus is the causative pathogen of diarrhea in humans and in several animal species. Eight pairs of primers were developed and used for Sanger sequencing of the coding region of the NSP1, NSP3, and VP6 genes based on the conserved regions of the genome of the group A porcine rotavirus. Three samples previously screened as positive for group A rotaviruses were subjected to gene amplification and sequencing to characterize the pathogen. The information generated from this study is crucial for the understanding of the epidemiology of the disease.
International Nuclear Information System (INIS)
Fayard, L.
1989-11-01
Twenty-five years after the discovery of CP violation in the neutral Kaon system, we still dont know exactly the origin and the components of that weak non invariance. The two more precise experiments give slightly different answers concerning the direct way of CP violation NA 31 gives ε prime/ε incompatible with the Superweak Model (for which ε prime=0) and in agreement with Standard Model predictions compatible with both. Again, one needs new and precise results in order to conclude about ε prime. E731 and NA31 are actually working on their new data samples. Longer term ideas are also being discussed, looking for new experiments able to give ε prime/ε with a precision. Concerning CPT invariance the situation seems to be more clear
CP violation in K- and B-meson decays
2000-01-01
These lectures will describe CP violation in K- and B-meson decays and will include the following topics:i) Grand view of the field including CKM matrix and the unitarily triangle ii) General aspects of the theoretical framework iii) Fundamentals of particle-antiparticle mixing iv) Fundamentals of CP violation v) Standard analysis of the unitarily triangle vi) The ratio e'/e including most recent developments vii) CP Violation in rare K- decays viii) Violation in B-Decays (asymmetries and other strategies) ix) A brief look beyond the Standard Model
Directory of Open Access Journals (Sweden)
Hajiyusef Tara
2017-06-01
Full Text Available Chickpea (Cicer arietinum L. is an important legume crop and widely cultivated in northwestern provinces of Iran. During a survey in the 2015 growing season a total of 170 selected chickpea plants with general yellowing symptoms including stunting and leaf bronzing were collected. Serological Elisa and tissue blot immunoassay (TIBA tests revealed the presence of Bean leaf roll virus (BLRV and Chickpea chlorotic stunt virus (CpCSV as the predominant viruses in the region. Some serologically positive samples of BLRV and CpCSV were selected and rechecked by RT-PCR. The results of amplified PCR products using a specific pair of primers towards the Cp gene region of the viruses were approximately 413 bp for CpCSV and 391 bp for BLRV. Results obtained from sequence comparison of BLRV (IR-F-Lor-5 isolate form two subgroups with eight other BLRV isolates from GeneBank indicating a high homology of 96% with isolates from Argentina, Germany, Tunisia, USA, Spain, and Colombia. An isolate from Norabad (Iran (IR-Nor had 98% homology with HQ840727 Libyan isolate. CpCSV sequence comparison with six other GeneBank isolates indicated 98% homology with isolates from Tunisia and Azerbaijan. The overall results of this research revealed the CpCSV and BLRV (luteoviruses associated with the yellowing disease syndrome of chickpea crops in the surveyed region.
SU(4) x U(1) gauge theory. II. CP nonconservation
International Nuclear Information System (INIS)
Deshpande, N.G.; Hwa, R.C.; Mannheim, P.D.
1979-01-01
We exploit the higher symmetry inherent in an SU(4) x U(1) gauge theory to construct a spontaneously broken theory of CP nonconservation. Higgs multiplets in the adjoint representation of SU(4) contain both even and odd CP fields; thus, requiring the simultaneous nonvanishing of the vacuum expectation values of these fields leads to CP noninvariance of the vacuum. We find that all the CP-nonconserving effects are mediated in our theory by the superheavy gauge bosons of the broken SU(4) x U(1) symmetry. In fact, the very existence of CP violation sets an upper limit on the masses of these bosons. In our model the dominant CP effect lies in the neutral kaon system and is found to arise through a direct (ΔS = 2) K 1 -K 2 transition. The model has all the features of a superweak theory, with a neutron electric dipole moment substantially smaller than 10 -24 e cm
Expression and purification of coat protein of citrus tristeza virus ...
African Journals Online (AJOL)
CTV coat protein gene (CTV-cp) cloned in pQE30 vector and transformed to DH5α containing 666bp long from Thailand MK-50 isolate was amplified with a forward primer CTV-CP1 (5' CAC CGA CGA AAC AAA GAA ATT GAA GAA CA 3') and a reverse primer CTVCP2 (5' TCA ACG TGT GTT AAA TTT CCC AAG C 3') and ...
Phenomenology of CP violation from the Kobayashi-Maskawa model
International Nuclear Information System (INIS)
Wang, L.L.C.
1980-01-01
The CP violation consequences of the K-M model, which Kobayashi, Maskawa introduced in 1977 for the purpose of incorporating CP violation via the complexity in the mixing matrix of the quarks are discussed. Much of the talk is a review of current work on the subject. Some new results on the CP violation effects in exclusive and inclusive decays of bottom, charm and strange particles are also given
Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings
DEFF Research Database (Denmark)
Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere
2014-01-01
, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...
Circadian cycle-dependent MeCP2 and brain chromatin changes.
Directory of Open Access Journals (Sweden)
Alexia Martínez de Paz
Full Text Available Methyl CpG binding protein 2 (MeCP2 is a chromosomal protein of the brain, very abundant especially in neurons, where it plays an important role in the regulation of gene expression. Hence it has the potential to be affected by the mammalian circadian cycle. We performed expression analyses of mice brain frontal cortices obtained at different time points and we found that the levels of MeCP2 are altered circadianly, affecting overall organization of brain chromatin and resulting in a circadian-dependent regulation of well-stablished MeCP2 target genes. Furthermore, this data suggests that alterations of MeCP2 can be responsible for the sleeping disorders arising from pathological stages, such as in autism and Rett syndrome.
A database of PCR primers for the chloroplast genomes of higher plants
Heinze, Berthold
2007-01-01
Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828
A database of PCR primers for the chloroplast genomes of higher plants
Directory of Open Access Journals (Sweden)
Heinze Berthold
2007-02-01
Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.
Neutral D→KK^{*} Decays as Discovery Channels for Charm CP Violation.
Nierste, Ulrich; Schacht, Stefan
2017-12-22
We point out that the CP asymmetries in the decays D^{0}→K_{S}K^{*0} and D^{0}→K_{S}K[over ¯]^{*0} are potential discovery channels for charm CP violation in the standard model. We stress that no flavor tagging is necessary, the untagged CP asymmetry a_{CP}^{dir}(D[over (-)]→K_{S}K^{*0}) is essentially equal to the tagged one, so that the untagged measurement comes with a significant statistical gain. Depending on the relevant strong phase, |a_{CP}^{dir,untag}| can be as large as 0.003. The CP asymmetry is dominantly generated by exchange diagrams and does not require nonvanishing penguin amplitudes. While the CP asymmetry is smaller than in the case of D^{0}→K_{S}K_{S}, the experimental analysis is more efficient due to the prompt decay K^{*0}→K^{+}π^{-}. One may further search for favorable strong phases in the Dalitz plot in the vicinity of the K^{*0} peak.
Flavour Physics and CP Violation : Expecting the LHC
Fleischer, Robert
2008-01-01
The starting point of these lectures is an introduction to the weak interactions of quarks and the Standard-Model description of CP violation, where the central role is played by the Cabibbo-Kobayashi-Maskawa matrix and the corresponding unitarity triangles. Since the B-meson system governs the stage of (quark) flavour physics and CP violation, it is our main focus: we shall classify B-meson decays, introduce the theoretical tools to deal with them, investigate the requirements for non-vanishing CP-violating asymmetries, and discuss the main strategies to explore CP violation and the preferred avenues for physics beyond the Standard Model to enter. This formalism allows us then to discuss important benchmark modes, where we will also address the question of how much space for new-physics effects in the B studies at the LHC is left by the recent experimental results from the B factories and the Tevatron.
CP asymmetries in semiinclusive B0 decays
Energy Technology Data Exchange (ETDEWEB)
Dunietz, Isard
1999-02-01
It was recently pointed out that inclusive B^0(t) decays could show CP violation. The totally inclusive asymmetry is expected to be tiny [O(10^{-3})] because of large cancellations among the asymmetries in the charmless, single charm and double charm final states. Enriching particular final state configurations could significantly increase the CP-asymmetry and observability. Such studies can extract fundamental CKM (Cabibbo-Kobayashi-Maskawa) parameters, and (perhaps) even Delta m(B_s). A superb vertex detector could see CP violation with 10^5 (10^6) flavor-tagged B_s (B_d) mesons within the CKM model. Because the effects could be significantly larger due to new physics, they should be searched for in existing or soon available data samples.
A time-dependent measurement of charm CP violation at LHCb
Smith, M
2014-01-01
A time dependent analysis of CP violation in charm mesons is presented through the measurement of the observable $A_{\\Gamma}$. This observable involves precise measurements of the D0 lifetime as it decays to a CP eigenstate. The results presented are the most precise to date. No CP violation is observed.
New physics effects on CP violation in B decays
International Nuclear Information System (INIS)
Nir, Y.
1993-01-01
The author reviews new physics effects on CP violation in B decays. In chapter 2 he introduces the formalism, and discusses the Standard Model picture of CP violation in B decays, with special emphasis on the cleanliness of the predictions. Chapter 3 gives a general discussion of new physics effects: he points out the ingredients in the analysis that are sensitive to new physics and deduces the type of new physics that is most likely to modify the Standard Model predictions. Explicit examples are given in chapter 4: a model with Z-mediated flavor changing neutral currents demonstrates in which ways the new physics will manifest itself in CP asymmetries in B decays; a supersymmetric model with open-quotes quark-squark alignmentclose quotes mechanism shows that supersymmetry may affect CP asymmetries in B decays, even though the minimal supersymmetric Standard Model does not; multi-scalar models may affect the asymmetries even in the absence of new CP violating phases; schemes for quark mass matrices will be crucially tested by the CP asymmetries. In chapter 5 he explains how, if deviations from the Standard Model predictions are measured, one will be able to learn detailed features of the New Physics that is responsible for that
Mason, E.; Orio, M.; Mukai, K.; Bianchini, A.; deMartino, D.; diMille, F.; Williams, R. E.
2013-01-01
We present new X-ray and optical spectra of the old nova CP Pup (nova Pup 1942) obtained with Chandra and the CTIO 4m telescope. The X-ray spectrum reveals a multi-temperature optically thin plasma reaching a maximum temperature of 36+19 keV 16 absorbed by local complex neutral material. The time resolved optical spectroscopy confirms the presence of the 1.47 hr period, with cycle-to-cycle amplitude changes, as well as of an additional long term modulation which is suggestive either of a longer pe- riod or of non-Keplerian velocities in the emission line regions. These new observational facts add further support to CP Pup as a magnetic cataclysmic variable (mCV). We compare the mCV and the non-mCV scenarios and while we cannot conclude whether CP Pup is a long period system, all observational evidences point at an intermediate polar (IP) type CV.
Energy Technology Data Exchange (ETDEWEB)
Roehrken, Markus
2012-07-13
The Belle and BaBar Collaborations experimentally established the existence of CP violating phenomena in the B meson system. In this PhD thesis, the measurements of the branching fraction and the time-dependent CP violation in B{sup 0}→D{sup +}D{sup -} decays based on the final data set of the Belle experiment are presented. Furthermore, the thesis comprises the corresponding measurements in B{sup 0}→D{sup *±}D{sup -+} decays to provide a direct comparison to a related decay. The final Belle data set contains 772 x 10{sup 6} B anti B pairs recorded on the Υ(4S)-resonance at the asymmetric-energy KEKB e{sup +}e{sup -}-collider. The measurement of the time evolution allows the experimental determination of time-dependent CP violating asymmetries. The results of the measurements of branching fractions are B(B{sup 0}→D{sup +}D{sup -})=(2.12±0.16(stat.)±0.18(syst.)) x 10{sup -4}; B(B{sup 0}→D{sup *±}D{sup -+})=(6.14±0.29(stat.)±0.50(syst.)) x 10{sup -4}. The results of the measurement of time-dependent CP violation in B{sup 0}→D{sup +}D{sup -} decays are S{sub D{sup +}D{sup -}}=-1.06{sup +0.21}{sub -0.14}(stat.)±0.08(syst.); C{sub D{sup +}D{sup -}}=-0.43±0.16(stat.)±0.05(syst.). This measurement excludes the conservation of CP symmetry in B{sup 0}→D{sup +}D{sup -} decays, equivalent to S{sub D{sup +}D{sup -}}=C{sub D{sup +}D{sup -}}=0, at a confidence level of 1-2.7 x 10{sup -5} corresponding to a significance of 4.2σ. The results of the measurement of time-dependent CP violation in B{sup 0}→D{sup *±}D{sup -+} decays are A{sub D{sup *}D}=+0.06±0.05(stat.)±0.02(syst.); S{sub D{sup *}D}=-0.78±0.15(stat.)±0.05(syst.); C{sub D{sup *}D}=-0.01±0.11(stat.)±0.04(syst.); ΔS{sub D{sup *}D}=-0.13±0.15(stat.)±0.04(syst.); ΔC{sub D{sup *}D}=+0.12±0.11(stat.)±0.03(syst.). This measurement excludes the conservation of CP symmetry in B{sup 0}→D{sup *±}D{sup -+} decays, equivalent to A{sub D{sup *}D}=S{sub D{sup *}D}=C{sub D{sup *}D}=0, at a
Study of inclusive CP-asymmetries in B0 decays
International Nuclear Information System (INIS)
Huettmann, K.
2000-01-01
The object of the present thesis is the search for CP-violating effects in the mixing of neutral B mesons. For this the time-dependent CP asymmetry in the decay of completely inclusively reconstructed B 0 mesons was studied. The basis of the analysis were about 4.1 millions hadronic Z decays, which were token up in the years 1991-1995 with the ALEPH detector at the e + e - storage ring LEP at CERN. From the data b hadron decays were inclusively reconstructed by means of a search for secondary decay vertices. By a fit to the decay-time spectra od identified B 0 and anti B 0 decays the following value of the semileptonic asymmetry in the B d 0 - anti B d 0 system could be determined: a CP =0.016±0.034(stat.)±0.009(syst.). This value can be alternatively interpreted as a measurement of the CP-violating parameter Re ε B : Re εB/(1+ vertical stroke ε B vertical stroke 2 )=0.004±0.009(stat.)±0.002(syst.). Furthermore a combination of the results of this analysis with a further ALEPH measurement was performed. The value of a CP determined from this, which was obtained under regardment of the statistical correlation of both measurements as well as correlated systematic uncertainties, is: a CP =-0.013±0.026. The present result is compatible with the standard model prediction and yields no significant hint to CP violation in the B d 0 - anti B 0 d mixing. (orig.) [de
Methods for detection of methyl-CpG dinucleotides
Dunn, John J.
2012-09-11
The invention provides methods for enriching methyl-CpG sequences from a DNA sample. The method makes use of conversion of cytosine residues to uracil under conditions in which methyl-cytosine residues are preserved. Additional methods of the invention enable to preservation of the context of me-CpG dinucleotides. The invention also provides a recombinant, full length and substantially pure McrA protein (rMcrA) for binding and isolation of DNA fragments containing the sequence 5'-C.sup.MeCpGG-3'. Methods for making and using the rMcrA protein, and derivatives thereof are provided.
Giarola, Valentino; Krey, Stephanie; von den Driesch, Barbara; Bartels, Dorothea
2016-04-01
Craterostigma plantagineum tolerates extreme desiccation. Leaves of this plant shrink and extensively fold during dehydration and expand again during rehydration, preserving their structural integrity. Genes were analysed that may participate in the reversible folding mechanism. Analysis of transcripts abundantly expressed in desiccated leaves identified a gene putatively coding for an apoplastic glycine-rich protein (CpGRP1). We studied the expression, regulation and subcellular localization of CpGRP1 and its ability to interact with a cell wall-associated protein kinase (CpWAK1) to understand the role of CpGRP1 in the cell wall during dehydration. The CpGRP1 protein accumulates in the apoplast of desiccated leaves. Analysis of the promoter revealed that the gene expression is mainly regulated at the transcriptional level, is independent of abscisic acid (ABA) and involves a drought-responsive cis-element (DRE). CpGRP1 interacts with CpWAK1 which is down-regulated in response to dehydration. Our data suggest a role of the CpGRP1-CpWAK1 complex in dehydration-induced morphological changes in the cell wall during dehydration in C. plantagineum. Cell wall pectins and dehydration-induced pectin modifications are predicted to be involved in the activity of the CpGRP1-CpWAK1 complex. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Liu, Nan-Nan; Xue, Ying-Ying; Ding, Yi-Hong
2017-02-09
[5]Radialene, the missing link for synthesis of radialene family, has been finally obtained via the preparation and decomplexation of the [5]radialene-bis-Fe(CO) 3 complex. The stability of [5]radialene complex benefits from the coordination with Fe(CO) 3 by losing free 1,3-butadiene structures to avoid polymerization. In light of the similar coordination ability of half-sandwiches CpM(Cp = η 5 -C 5 H 5 ; M = Fe, Co, Ni), there is a great possibility that the sandwiched complexes of [5]radialene with CpM are available. Herein, we present the first theoretical prediction on the geometry, spin states and bonding of (CpM)(C 10 H 10 ) and (CpM) 2 (C 10 H 10 ). For M = Fe, Co, Ni, the ground states of (CpM)(C 10 H 10 ) and (CpM) 2 (C 10 H 10 ) are doublet and triplet, singlet and singlet, and doublet and triplet states, where each Fe, Co, and Ni adopts 17, 18, and 19 electron-configuration, respectively. In particular, (CpFe) 2 (C 10 H 10 ) and (CpNi) 2 (C 10 H 10 ) have considerable open-shell singlet features. Generally the trans isomers of (CpM) 2 (C 10 H 10 ) with two CpM fragments on the opposite sides of the [5]radialene plane are apparently more stable than the cis ones with CpM fragments on the same side. However, for the singlet and triplet isomers of (CpNi) 2 (C 10 H 10 ) (both cis and trans isomers), the energy differences are relatively small, indicating that these isomers all have the opportunity to exist. Besides, the easy Diels-Alder (DA) dimerization between the [3]dendralene-like fragments of (CpM)(C 10 H 10 ) suggests the great difficulty in isolating the (CpM)(C 10 H 10 ) monomer.
CP violation with self-tagging Bd modes
International Nuclear Information System (INIS)
Dunietz, I.
1991-01-01
Gronau and Wyler (GW) extract the weak phase γ and remove the dependence on final state phases by measuring six charged B mesons rates, which are grouped into two trinangles. This note applies the GW method to self-tagging B d modes. Self-tagging eliminates the need for time-dependent measurements. Of interest are the six rates, Γ(B d →D 0 K *0 )=Γ(anti B d →anti D 0 anti K *0 ), Γ(B d →anti D 0 K *0 )=Γ(anti B d →D 0 anti K *0 ), Γ(B d →D 0 CP K *0 ) and Γ(anti B d →D 0 CP anti K *0 ), where D 0 CP denotes a CP eigenmode of a D 0 or anti D 0 . Here the K *0 must be seen in its K + π - mode, which tags the beauty flavour. An additional handle exists to resolve an ambiguity in vertical strokesin γvertical stroke, which accomplished by isospin symmetry from B u and B d data. Preliminary results of a feasibility study are given. (orig.)
Directory of Open Access Journals (Sweden)
Puntipar Sonthiphand
Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library
CP violation and ΔI=1/2 enhancement in K decays
International Nuclear Information System (INIS)
Choudhury, S.R.; Scadron, M.D.
1996-01-01
We study CP-conserving and CP-violating K 0 →ππ and K 0 →ππγ decays, using the same techniques which explain the ΔI=1/2 enhancement of the former to also explore CP violation of the latter transitions. If CP violation is driven by the WWγ vertex, we show that direct CP violation in K L →ππγ is scaled to the s→dγ E1 quark transition and the latter is suppressed by the GIM mechanism (compatible with recent experiments). In the same spirit, the dominant ΔI=1/2 enhancement of CP-conserving kaon weak decays can be scaled to an s→d quark transition which is enhanced by the GIM mechanism. copyright 1996 The American Physical Society
Bruce, Michael I; Costuas, Karine; Davin, Thomas; Halet, Jean-François; Kramarczuk, Kathy A; Low, Paul J; Nicholson, Brian K; Perkins, Gary J; Roberts, Rachel L; Skelton, Brian W; Smith, Mark E; White, Allan H
2007-12-14
The sequential conversion of [OsBr(cod)Cp*] (9) to [OsBr(dppe)Cp*] (10), [Os([=C=CH2)(dppe)Cp*]PF6 ([11]PF6), [Os(C triple bond CH)(dppe)Cp*] (12), [{Os(dppe)Cp*}2{mu-(=C=CH-CH=C=)}][PF6]2 ([13](PF6)2) and finally [{Os(dppe)Cp*}(2)(mu-C triple bond CC triple bond C)] (14) has been used to make the third member of the triad [{M(dppe)Cp*}2(mu-C triple bond CC triple bond C)] (M = Fe, Ru, Os). The molecular structures of []PF6, 12 and 14, together with those of the related osmium complexes [Os(NCMe)(dppe)Cp*]PF6 ([15]PF6) and [Os(C triple bond CPh)(dppe)Cp*] (16), have been determined by single-crystal X-ray diffraction studies. Comparison of the redox properties of 14 with those of its iron and ruthenium congeners shows that the first oxidation potential E1 varies as: Fe approximately Os < Ru. Whereas the Fe complex has been shown to undergo three sequential 1-electron oxidation processes within conventional electrochemical solvent windows, the Ru and Os compounds undergo no fewer than four sequential oxidation events giving rise to a five-membered series of redox related complexes [{M(dppe)Cp*}2(mu-C4)]n+ (n = 0, 1, 2, 3 and 4), the osmium derivatives being obtained at considerably lower potentials than the ruthenium analogues. These results are complimented by DFT and DT DFT calculations.
The ability of T2/B4 primers to detect Leishmania infantum among ...
African Journals Online (AJOL)
SERVER
2008-04-03
Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...
An experiment to study CP violation in the B system using an internal target at the HERA proton ring
International Nuclear Information System (INIS)
Hofmann, W.
1993-03-01
A group of physicists centered around the ARGUS collaboration got interested in hadron accelerators as a prolific source of B hadrons. The group is presently studying the option of a major-B-physics experiment to be performed at the HERA proton storage ring in fixed target mode using an internal target. Basic goal of the experiment is the detection of CP violation in the 'gold plated' B 0 → J/Ψ K s decay mode, using a dedicated detector triggered on lepton pairs from J/Ψ decay. (orig./HSI)
Oana, Melania; Nakatsuka, Yumiko; Albert, Daniel R; Davis, H Floyd
2012-05-31
The photodissociation dynamics of CpCo(CO)(2) was studied in a molecular beam using photofragment translational energy spectroscopy with 157 nm photoionization detection of the metallic products. At 532 and 355 nm excitation, the dominant one-photon channel involved loss of a single CO ligand producing CpCoCO. The product angular distributions were isotropic, and a large fraction of excess energy appeared as product vibrational excitation. Production of CpCO + 2CO resulted from two-photon absorption processes. The two-photon dissociation of mixtures containing CpCo(CO)(2) and H(2) at the orifice of a pulsed nozzle was used to produce a novel 16-electron unsaturated species, CpCoH(2). Transition metal ligand exchange reactions, CpCoH(2) + L → CpCoL + H(2) (L = propyne, propene, or ammonia), were studied under single-collision conditions for the first time. In all cases, ligand exchange occurred via 18-electron association complexes with lifetimes comparable to their rotational periods. Although ligand exchange reactions were not detected from CpCoH(2) collisions with methane or propane (L = CH(4) or C(3)H(8)), a molecular beam containing CpCoCH(4) was produced by photolysis of mixtures containing CpCo(CO)(2) and CH(4).
Discrete ambiguities in CP-violating asymmetries in B decays
International Nuclear Information System (INIS)
London, David
1998-01-01
The CP-angles α, β and γ can be extracted from CP-violating asymmetries in the B system, but only up to discrete ambiguities. These discrete ambiguities make it difficult to determine with certainty whether or not new physics is present. I show that, if the condition α+β+γ=π is imposed, there remains a twofold ambiguity in the CP-angle set (α,β,γ), and I discuss ways to cleanly resolve this final discrete ambiguity
Recent results on CP and CPT tests at KLOE/KLOE-2
Energy Technology Data Exchange (ETDEWEB)
Di Domenico, A., E-mail: antonio.didomenico@roma1.infn.it [Department of Physics, Sapienza University of Rome, and INFN Sezione di Roma, Rome (Italy); Silarski, M., E-mail: Michal.Silarski@lnf.infn.it [Institute of Physics, Jagiellonian University, Cracow (Poland)
2012-12-15
Neutral kaon pairs produced in ϕ decays offer a unique possibility to perform fundamental tests of discrete symmetries. Among the most recent results obtained by the KLOE experiment at DAΦNE, the Frascati ϕ-factory, there is the new best limit on the branching ratio of the CP-violating decay K{sub S}→3π{sup 0}, BR<2.6×10{sup −8} at 90% C.L.. The search for possible violations of the CPT symmetry and Lorentz invariance in the context of the Standard-Model Extension (SME) is also described; the new analysis approach fully exploits quantum interferometry in ϕ→K{sub S}K{sub L}→π{sup +}π{sup −}, π{sup +}π{sup −} decays. Finally the status and perspectives of the new data taking campaign with the KLOE-2 experiment at the upgraded DAΦNE machine are briefly reviewed.
Rajwade, Ashwini V; Arora, Ritu S; Kadoo, Narendra Y; Harsulkar, Abhay M; Ghorpade, Prakash B; Gupta, Vidya S
2010-06-01
The objective of this study was to analyze the genetic relationships, using PCR-based ISSR markers, among 70 Indian flax (Linum usitatissimum L.) genotypes actively utilized in flax breeding programs. Twelve ISSR primers were used for the analysis yielding 136 loci, of which 87 were polymorphic. The average number of amplified loci and the average number of polymorphic loci per primer were 11.3 and 7.25, respectively, while the percent loci polymorphism ranged from 11.1 to 81.8 with an average of 63.9 across all the genotypes. The range of polymorphism information content scores was 0.03-0.49, with an average of 0.18. A dendrogram was generated based on the similarity matrix by the Unweighted Pair Group Method with Arithmetic Mean (UPGMA), wherein the flax genotypes were grouped in five clusters. The Jaccard's similarity coefficient among the genotypes ranged from 0.60 to 0.97. When the omega-3 alpha linolenic acid (ALA) contents of the individual genotypes were correlated with the clusters in the dendrogram, the high ALA containing genotypes were grouped in two clusters. This study identified SLS 50, Ayogi, and Sheetal to be the most diverse genotypes and suggested their use in breeding programs and for developing mapping populations.
Measurement of Indirect CP Violation in Charm at LHCb
AUTHOR|(INSPIRE)INSPIRE-00342046
This thesis describes two pieces of work. The first is a study of the resolution of the LHCb vertex locator throughout Run 1. The second comprises analyses to measure the charm mixing and $CP$ violation observables $A_{\\Gamma}$ and $y_{CP}$. An estimate of the resolution of the LHCb vertex locator is required for use in the track fits. A method to measure the resolution with collision data has been developed and tested. The performance of the sub-detector throughout Run 1 of the LHC has been assessed. A significant degrading of the resolution has been seen. The effects of this on the track reconstruction has been examined with little change in the measured quantities being observed. The measurement of indirect $CP$ violation in neutral $D$ meson transitions has been measured through the observables $A_{\\Gamma}$ and $y_{CP}$, using $fb^{-1}$ of $pp$ collisions with a centre of mass energy $7 TeV$, collected by the LHCb detector in 2011. $A_{\\Gamma}$ describes the $CP$ asymmetry of the lifetime of the $D^0$ dec...
Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.
Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G
2013-09-01
New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
FRET analysis of CP12 structural interplay by GAPDH and PRK.
Moparthi, Satish Babu; Thieulin-Pardo, Gabriel; de Torres, Juan; Ghenuche, Petru; Gontero, Brigitte; Wenger, Jérôme
2015-03-13
CP12 is an intrinsically disordered protein playing a key role in the regulation of the Benson-Calvin cycle. Due to the high intrinsic flexibility of CP12, it is essential to consider its structural modulation induced upon binding to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) enzymes. Here, we report for the first time detailed structural modulation about the wild-type CP12 and its site-specific N-terminal and C-terminal disulfide bridge mutants upon interaction with GAPDH and PRK by Förster resonance energy transfer (FRET). Our results indicate an increase in CP12 compactness when the complex is formed with GAPDH or PRK. In addition, the distributions in FRET histograms show the elasticity and conformational flexibility of CP12 in all supra molecular complexes. Contrarily to previous beliefs, our FRET results importantly reveal that both N-terminal and C-terminal site-specific CP12 mutants are able to form the monomeric (GAPDH-CP12-PRK) complex. Copyright © 2015 Elsevier Inc. All rights reserved.
Evolving role of MeCP2 in Rett syndrome and autism.
LaSalle, Janine M; Yasui, Dag H
2009-10-01
Rett syndrome is an X-linked autism-spectrum disorder caused by mutations in MECP2, encoding methyl CpG-binding protein 2. Since the discovery of MECP2 mutations as the genetic cause of Rett syndrome, the understanding of MeCP2 function has evolved. Although MeCP2 was predicted to be a global transcriptional repressor of methylated promoters, large-scale combined epigenomic approaches of MeCP2 binding, methylation and gene expression have demonstrated that MeCP2 binds preferentially to intergenic and intronic regions, and sparsely methylated promoters of active genes. This review compares the evolution of thought within two ‘classic’ epigenetic mechanisms of parental imprinting and X chromosome inactivation to that of the MeCP2 field, and considers the future relevance of integrated epigenomic databases to understanding autism and Rett syndrome.
Energy Technology Data Exchange (ETDEWEB)
Palepu, Narasinga Rao; Kollipara, Mohan Rao [Centre for Advanced Studies in Chemistry, North-Eastern Hill University, Shillong (India); Kaminsky Werner [Dept. of Chemistry, University of Washington, Seattle (United States)
2017-01-15
A series of Cp{sup *}Rh and Cp{sup *}Ir complexes of picolinic hydrazine ligand are synthesized and characterized. Picolinic hydrazine has yielded only dinuclear complexes in the case of rhodium metal whereas both mono and dinuclear complexes with iridium metal. Iridium complexes are formed as quaternary salts by the migration of the N–H proton onto the adjacent amine group of the hydrazine after binding to the metal. Picolinic hydrazine acts as nitrogen and oxygen donor ligand in the form of bi and tetradentate bonding modes.
Synthesis of Carboxylate Cp*Zr(IV) Species: Toward the Formation of Novel Metallocavitands.
Daigle, Maxime; Bi, Wenhua; Légaré, Marc-André; Morin, Jean-François; Fontaine, Frédéric-Georges
2015-06-01
With the intent of generating metallocavitands isostructural to species [(CpZr)3(μ(3)-O)(μ(2)-OH)3(κO,O,μ(2)-O2C(R))3](+), the reaction of Cp*2ZrCl2 and Cp*ZrCl3 with phenylcarboxylic acids was carried out. Depending on the reaction conditions, five new complexes were obtained, which consisted of Cp*2ZrCl(κ(2)-OOCPh) (1), (Cp*ZrCl(κ(2)-OOCPh))2(μ-κ(2)-OOCPh)2 (2), [(Cp*Zr(κ(2)-OOCPh))2(μ-κ(2)-OOCPh)2(μ(2)-OH)2]·Et2O (3·Et2O), [[Cp*ZrCl2](μ-Cl)(μ-OH)(μ-O2CC6H5)[Cp*Zr
Search for anomalous couplings in the decay of polarized Z bosons to tau lepton pairs
International Nuclear Information System (INIS)
Torrence, E.C.
1997-06-01
Using a sample of 4,500 polarized Z decays to τ lepton pairs accumulated with the SLD detector at the SLAC Linear Collider (SLC) in 1993-95, a search has been made for anomalous couplings in the neutral current reaction e + e - →τ + τ - . A measurement of the CP violating Weak Electric Dipole Moment (WEDM) and the CP conserving Weak Magnetic Dipole Moment (WMDM) of the τ lepton has been performed by considering the transverse spin polarization of τ leptons produced at the Z pole. Using a maximum likelihood technique, the observed τ decay spectra in the e, μ, π, and ρ decay channels are used to infer the net transverse polarization of the underlying tau leptons, and a fit for the anomalous dipole moments is performed. No evidence for these dipole movements is observed, and limits are placed on both the real and imaginary parts of the WEDM and WMDM
Measurements of time-dependent CP violation in B0→ωKS0, f0(980)KS0, KS0π0 and K+K-KS0 decays
Chao, Y.; Chen, K.-F.; Miyake, H.; Tajima, O.; Trabelsi, K.; Abe, K.; Abe, K.; Adachi, I.; Aihara, H.; Anipko, D.; Bakich, A. M.; Barberio, E.; Bitenc, U.; Bizjak, I.; Blyth, S.; Bondar, A.; Bračko, M.; Browder, T. E.; Chang, M.-C.; Chang, P.; Chen, A.; Chen, W. T.; Cheon, B. G.; Chistov, R.; Choi, Y.; Choi, Y. K.; Cole, S.; Dalseno, J.; Danilov, M.; Dash, M.; Dragic, J.; Drutskoy, A.; Eidelman, S.; Fratina, S.; Gabyshev, N.; Golob, B.; Ha, H.; Haba, J.; Hara, K.; Hara, T.; Hastings, N. C.; Hayashii, H.; Hazumi, M.; Heffernan, D.; Higuchi, T.; Hokuue, T.; Hoshi, Y.; Hou, W.-S.; Hsiung, Y. B.; Iijima, T.; Ikado, K.; Inami, K.; Ishikawa, A.; Ishino, H.; Itoh, R.; Iwasaki, M.; Iwasaki, Y.; Kaji, H.; Kang, J. H.; Kapusta, P.; Kawai, H.; Kawasaki, T.; Kim, H. J.; Kim, H. O.; Kim, Y. J.; Kinoshita, K.; Korpar, S.; Križan, P.; Krokovny, P.; Kulasiri, R.; Kumar, R.; Kuo, C. C.; Kuzmin, A.; Kwon, Y.-J.; Lee, M. J.; Lesiak, T.; Limosani, A.; Lin, S.-W.; Liventsev, D.; Matsumoto, T.; McOnie, S.; Miyabayashi, K.; Miyata, H.; Miyazaki, Y.; Mizuk, R.; Mohapatra, D.; Moloney, G. R.; Nakahama, Y.; Nakano, E.; Nakao, M.; Natkaniec, Z.; Nishida, S.; Nitoh, O.; Ogawa, S.; Okuno, S.; Olsen, S. L.; Onuki, Y.; Ozaki, H.; Pakhlov, P.; Pakhlova, G.; Park, C. W.; Pestotnik, R.; Piilonen, L. E.; Sakai, Y.; Satoyama, N.; Schietinger, T.; Schneider, O.; Schwartz, A. J.; Seidl, R.; Senyo, K.; Sevior, M. E.; Shapkin, M.; Shibuya, H.; Singh, J. B.; Somov, A.; Soni, N.; Stanič, S.; Starič, M.; Stoeck, H.; Sumisawa, K.; Sumiyoshi, T.; Suzuki, S.; Takasaki, F.; Tamai, K.; Tanaka, M.; Taylor, G. N.; Teramoto, Y.; Tian, X. C.; Tikhomirov, I.; Tsukamoto, T.; Uehara, S.; Ueno, K.; Unno, Y.; Uno, S.; Ushiroda, Y.; Usov, Y.; Varner, G.; Varvell, K. E.; Villa, S.; Vinokurova, A.; Wang, C. H.; Watanabe, Y.; Won, E.; Yabsley, B. D.; Yamaguchi, A.; Yamashita, Y.; Yamauchi, M.; Yusa, Y.; Zhilich, V.; Zhulanov, V.; Zupanc, A.
2007-11-01
We present measurements of time-dependent CP asymmetries in B0→ωKS0, f0(980)KS0, KS0π0 and K+K-KS0 decays based on a sample of 535×106 BB¯ pairs collected at the Υ(4S) resonance with the Belle detector at the KEKB energy-asymmetric e+e- collider. One neutral B meson is fully reconstructed in one of the specified decay channels, and the flavor of the accompanying B meson is identified from its decay products. CP-violation parameters for each of the decay modes are obtained from the asymmetries in the distributions of the proper-time intervals between the two B decays.
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
A Chiang-type lagrangian in CP^2
Cannas da Silva, Ana
2018-03-01
We analyse a monotone lagrangian in CP^2 that is hamiltonian isotopic to the standard lagrangian RP^2, yet exhibits a distinguishing behaviour under reduction by one of the toric circle actions, namely it intersects transversally the reduction level set and it projects one-to-one onto a great circle in CP^1. This lagrangian thus provides an example of embedded composition fitting work of Wehrheim-Woodward and Weinstein.
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
Directory of Open Access Journals (Sweden)
Weiguo Hou
2018-05-01
Full Text Available Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length encoding the cyanophage gp23 major capsid protein (MCP. Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92% belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.
Constraints on Mixing and CP-Violation in the Neutral Charmed Meson System at LHCb
Alexander, Michael Thomas; Soler, P
This thesis presents measurements of the charm sector mixing and CP-violation parameters yCP and AGamma, made using data collected in 2010 by the LHCb experiment at the LHC at a centre of mass energy of 7 TeV. yCP is defined as the difference from unity of the ratio of the effective lifetime of the D0 meson decaying to a CP-undefined final state to its lifetime when decaying to a CP-eigenstate. AGamma is the CP-asymmetry of the effective lifetimes of the D0 and D0bar when decaying to a CP-eigenstate. In the absence of CPV yCP will be consistent with the mixing parameter y, and AGamma will be consistent with zero. CP-violation in the charm sector is predicted to be very small in the SM, though first evidence for direct CP-violation in D0 decays has recently been observed by LHCb. Observation of significantly more CP-violation than is allowed in the SM would be a strong indication of new physics. The current world best measurements of yCP and AGamma show no evidence of CP-violation. The methods used to measure ...
Lebedev, Yury; Das, Ujjal; Schnakenburg, Gregor; Filippou, Alexander C.
2017-01-01
The synthesis and full characterization of the NHC-stabilized tungstenochlorostannylene [Cp*(CO)3W–SnCl(Idipp)] (1Sn), the NHC-stabilized chlorogermylidyne complex [Cp*(CO)2W═GeCl(Idipp)] (2), the tungsten germylidyne complex salt [Cp*(CO)2W
SM with two Higgs doublets: an example of CP-violation without Fermions
International Nuclear Information System (INIS)
Cvetic, G.
1993-01-01
Some CP-violation effects without fermions in the Standard Model are investigated with two Higgs doublets. First, the mass eigenstates of the physical neutral Higgses are calculated for small but nonzero CP-violation parameter ξ * , and then a ''forward-backward'' asymmetry A fb for the decay H → W + W - Z that would be a signal of CP-violation. The effects are in general small. However, A fb turns out to be a rather clean signal of CP-violation: neither the CP-conserving final state interactions nor the direct production background events contribute to Γ fb . The KM-type CP-violation effects that could in principle also contribute to A fb are negligible. 6 refs
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.
CP-violating MSSM Higgs bosons in the light of LEP 2
International Nuclear Information System (INIS)
Carena, M.; Ellis, J.; Pilaftsis, A.; Wagner, C.E.M.
2000-01-01
In the MSSM, the CP parities of the neutral Higgs bosons may be mixed by radiative effects induced by explicit CP violation in the third generation of squarks. To allow for this possibility, we argue that the charged Higgs-boson mass and tanβ should be used to parametrize the MSSM Higgs sector. We introduce a new benchmark scenario of maximal CP violation appropriate for direct searches of CP-violating MSSM Higgs bosons. We show that the bounds established by LEP 2 on the MSSM Higgs sector may be substantially relaxed at low and intermediate values of tanβ in the presence of CP violation, and comment on possible Higgs boson signatures at LEP 2 within this framework.
Why does CP violation matter to the universe?
Ellis, Jonathan Richard
1999-01-01
The seemingly obscure phenomenon of CP violation is increasingly being viewed as the key to a deeper understanding of both the behaviour of elementary particles and the big bang origin of the universe. Here, John Ellis of CERN explains how far and how deep the implications of CP violation extend. (0 refs).
Directory of Open Access Journals (Sweden)
Vasco Elbrecht
Full Text Available Metabarcoding is an emerging genetic tool to rapidly assess biodiversity in ecosystems. It involves high-throughput sequencing of a standard gene from an environmental sample and comparison to a reference database. However, no consensus has emerged regarding laboratory pipelines to screen species diversity and infer species abundances from environmental samples. In particular, the effect of primer bias and the detection limit for specimens with a low biomass has not been systematically examined, when processing samples in bulk. We developed and tested a DNA metabarcoding protocol that utilises the standard cytochrome c oxidase subunit I (COI barcoding fragment to detect freshwater macroinvertebrate taxa. DNA was extracted in bulk, amplified in a single PCR step, and purified, and the libraries were directly sequenced in two independent MiSeq runs (300-bp paired-end reads. Specifically, we assessed the influence of specimen biomass on sequence read abundance by sequencing 31 specimens of a stonefly species with known haplotypes spanning three orders of magnitude in biomass (experiment I. Then, we tested the recovery of 52 different freshwater invertebrate taxa of similar biomass using the same standard barcoding primers (experiment II. Each experiment was replicated ten times to maximise statistical power. The results of both experiments were consistent across replicates. We found a distinct positive correlation between species biomass and resulting numbers of MiSeq reads. Furthermore, we reliably recovered 83% of the 52 taxa used to test primer bias. However, sequence abundance varied by four orders of magnitudes between taxa despite the use of similar amounts of biomass. Our metabarcoding approach yielded reliable results for high-throughput assessments. However, the results indicated that primer efficiency is highly species-specific, which would prevent straightforward assessments of species abundance and biomass in a sample. Thus, PCR
MeCP2 Rett mutations affect large scale chromatin organization
DEFF Research Database (Denmark)
Gupta, Noopur Agarwal; Becker, Annette; Jost, K Laurence
2011-01-01
Rett syndrome is a neurological, X chromosomal-linked disorder associated with mutations in the MECP2 gene. MeCP2 protein has been proposed to play a role in transcriptional regulation as well as in chromatin architecture. Since MeCP2 mutant cells exhibit surprisingly mild changes in gene...... expression, we have now explored the possibility that Rett mutations may affect the ability of MeCP2 to bind and organize chromatin. We found that all but one of the 21 missense MeCP2 mutants analyzed accumulated at heterochromatin and about half of them were significantly affected. Furthermore, two......-thirds of all mutants showed a significantly decreased ability to cluster heterochromatin. Three mutants containing different proline substitutions (P101H, P101R and P152R) were severely affected only in heterochromatin clustering and located far away from the DNA interface in the MeCP2 methyl-binding domain...
Lectures on Flavor Physics and CP Violation
Grinstein, Benjamín
2016-12-20
These lectures on flavor physics are an introduction to the subject. First lec- ture: We discuss the meaning of flavor and the importance of flavor physics in restricting extensions of the Standard Model (SM) of Electroweak interactions. We explain the origin of the KM matrix and how its elements are determined. We discuss FCNC and the GIM mechanism, followed by how a principle of Minimal Flavor Violation leads to SM extensions that are safe as far as FCNC are concerned even if the new physics comes in at low, TeVish scales. This is illustrated by the example of B radiative decays ( b → sγ ). Second lecture: We then turn our attention to CP-violation. We start by presenting neutral meson mixing. Then we consider various CP-asymmetries, culminating in the theoretically clean interference between mixing and decay into CP eigenstates.
On the measurement of leptonic CP violation
International Nuclear Information System (INIS)
Burguet Castell, J.; Gavela, M.B.; Gomez Cadenas, J.J.; Hernandez, P.; Mena, O.
2001-01-01
We show that the simultaneous determination of the leptonic CP-odd phase δ and the angle θ 13 from the subleading transitions ν e →ν μ and ν-bar e →ν-bar μ results generically, at fixed neutrino energy and baseline, in two degenerate solutions. In light of this, we refine a previous analysis of the sensitivity to leptonic CP violation at a neutrino factory, in the LMA-MSW scenario, by exploring the full range of δ and θ 13 . Furthermore, we take into account the expected uncertainties on the solar and atmospheric oscillation parameters and in the average Earth matter density along the neutrino path. An intermediate baseline of O(3000) km is still the best option to tackle CP violation, although a combination of two baselines turns out to be very important in resolving degeneracies
International Nuclear Information System (INIS)
Loginov, D.A.; Muratov, D.V.; Starikova, Z.A.; Petrovskij, P.V.; Kudinov, A.R.
2006-01-01
The reaction of the (borole)rhodium iodide complex [(η-C 4 H 4 BPh)RhI] 4 with Cp*Li afforded the sandwich compound Cp*Rh(η-C 4 H 4 BPh) (1). The reactions of compound 1 with the solvated complexes [Cp*M(MeNO 2 ) 3 ] 2+ (BF 4 - ) 2 gave triple-decker cationic complexes with the central borole ligand [Cp*Rh(μ-η 5 :η 5 -C 4 H 4 BPh)MCp*] 2+ (BF 4 - ) 2 (M = Rh or Ir). The structure of complex 1 was established by X-ray diffraction [ru
Measurement of $CP$ asymmetry in $D^0\\rightarrow K^-K^+$ decays
Aaij, Roel; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Babuschkin, Igor; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baker, Sophie; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Baszczyk, Mateusz; Batozskaya, Varvara; Batsukh, Baasansuren; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Bird, Thomas; Birnkraut, Alex; Bitadze, Alexander; Bizzeti, Andrea; Blake, Thomas; Blanc, Frederic; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borgheresi, Alessio; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chobanova, Veronika; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Dall'Occo, Elena; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Demmer, Moritz; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dungs, Kevin; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Déléage, Nicolas; Easo, Sajan; Ebert, Marcus; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fay, Robert; Fazzini, Davide; Ferguson, Dianne; Fernandez Albor, Victor; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fohl, Klaus; Fontana, Marianna; Fontanelli, Flavio; Forshaw, Dean Charles; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Furfaro, Emiliano; Färber, Christian; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Garsed, Philip John; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, V.V.; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Griffith, Peter; Grillo, Lucia; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; Hatch, Mark; He, Jibo; Head, Timothy; Heister, Arno; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hombach, Christoph; Hopchev, P H; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hussain, Nazim; Hutchcroft, David; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kecke, Matthieu; Kelsey, Matthew; Kenyon, Ian; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Koliiev, Serhii; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Kozachuk, Anastasiia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krokovny, Pavel; Kruse, Florian; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kurek, Krzysztof; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Lemos Cid, Edgar; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Likhomanenko, Tatiana; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Liu, Xuesong; Loh, David; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Maev, Oleg; Maguire, Kevin; Malde, Sneha; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Manning, Peter Michael; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massacrier, Laure Marie; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; Meadows, Brian; Meier, Frank; Meissner, Marco; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Minard, Marie-Noelle; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Monroy, Ignacio Alberto; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Mussini, Manuel; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pikies, Malgorzata; Pinci, Davide; Pistone, Alessandro; Piucci, Alessio; Playfer, Stephen; Plo Casasus, Maximo; Poikela, Tuomas; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Quagliani, Renato; Rachwal, Bartolomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Raniuk, Iurii; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vicente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rodriguez Perez, Pablo; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Ronayne, John William; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sadykhov, Elnur; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schubert, Konstantin; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Eluned; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavorima; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Syropoulos, Vasileios; Szczekowski, Marek; Szumlak, Tomasz; T'Jampens, Stephane; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Toriello, Francis; Tournefier, Edwige; Tourneur, Stephane; Trabelsi, Karim; Traill, Murdo; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tully, Alison; Tuning, Niels; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Vernet, Maxime; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wang, Jianchun; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Matthew; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wraight, Kenneth; Wright, Simon; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhang, Yu; Zhelezov, Alexey; Zheng, Yangheng; Zhokhov, Anatoly; Zhu, Xianglei; Zhukov, Valery; Zucchelli, Stefano
2017-04-10
A measurement of the time-integrated $CP$ asymmetry in the Cabibbo-suppressed decay $D^0\\rightarrow K^-K^+$ is performed using pp collision data, corresponding to an integrated luminosity of 3fb$^-1$, collected with the LHCb detector at centre-of-mass energies of 7 and 8 TeV. The flavour of the charm meson at production is determined from the charge of the pion in $D^{*+}\\rightarrow D^0 \\pi^+$ and $D^{*-}\\rightarrow \\bar{D^0} \\pi^-$ decays. The time-integrated $CP$ asymmetry $A_{CP}(K^-K^+)$ is obtained assuming negligible $CP$ violation in charm mixing and in Cabibbo-favoured $D^0\\rightarrow K^-\\pi^+$, $D^+\\rightarrow K^-\\pi^+\\pi^+$ and $D^+\\rightarrow \\bar{K^0}\\pi^+$ decays used as calibration channels. It is found to be $A_{CP}(K^-K^+)=(0.14\\pm0.15(stat)\\pm0.10(syst))\\%$. A combination of this result with previous LHCb measurements yields $A_{CP}(K^-K^+)=(0.04\\pm0.12(stat)\\pm0.10(syst))\\%$, $A_{CP}(\\pi^-\\pi^+)=(0.07\\pm0.14(stat)\\pm0.11(syst))\\%$. These are the most precise measurements from a single experi...
Synthesis, properties, and crystal structure of complex Cp2Yb(DAD)
International Nuclear Information System (INIS)
Trifonov, A.A.; Kirillov, E.N.; Bochkarev, M.N.; Shumani, G.; Myule, S.
1999-01-01
Diazadiene complex of trivalent ytterbium Cp 2 Yb(DAD) (1) (DAD = Bu 1 -N CH-CH = N-Bu 1 ) was obtained by three routes: the oxidation of Cp 2 Yb(THF) 2 by diazadiene in tetrahydrofuran (THF), the reaction of Cp 2 YbCl with DAD 2- Na 2 + (2:1), and the reaction of Cp 2 YbCl(THF) with DAD - K + in the 1:1 ratio. Complex 1 was characterized by microanalysis, IR spectroscopy, magnetochemistry, and X-ray structural analysis [ru
Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples
Directory of Open Access Journals (Sweden)
Alexandre R. Zuntini
2013-08-01
Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications.
Wani, Gowher A; Shah, Manzoor A; Reshi, Zafar A; Atangana, Alain R; Khasa, Damase P
2014-07-01
A lack of genetic markers impedes our understanding of the population biology of Lemna minor. Thus, the development of appropriate genetic markers for L. minor promises to be highly useful for population genetic studies and for addressing other life history questions regarding the species. • For the first time, we characterized nine polymorphic and 24 monomorphic chloroplast microsatellite markers in L. minor using DNA samples of 26 individuals sampled from five populations in Kashmir and of 17 individuals from three populations in Quebec. Initially, we designed 33 primer pairs, which were tested on genomic DNA from natural populations. Nine loci provided markers with two alleles. Based on genotyping of the chloroplast DNA fragments from 43 sampled individuals, we identified one haplotype in Quebec and 11 haplotypes in Kashmir, of which one occurs in 56% of the genotypes, one in 8%, and nine in 4%, respectively. There was a maximum of two alleles per locus. • These new chloroplast microsatellite markers for L. minor and haplotype distribution patterns indicate a complex phylogeographic history that merits further investigation.
Abraham, A D; Menzel, W; Varrelmann, M; Vetten, H Josef
2009-01-01
Chickpea chlorotic stunt virus (CpCSV), a proposed new member of the genus Polerovirus (family Luteoviridae), has been reported only from Ethiopia. In attempts to determine the geographical distribution and variability of CpCSV, a pair of degenerate primers derived from conserved domains of the luteovirus coat protein (CP) gene was used for RT-PCR analysis of various legume samples originating from five countries and containing unidentified luteoviruses. Sequencing of the amplicons provided evidence for the occurrence of CpCSV also in Egypt, Morocco, Sudan, and Syria. Phylogenetic analysis of the CP nucleotide sequences of 18 samples from the five countries revealed the existence of two geographic groups of CpCSV isolates differing in CP sequences by 8-10%. Group I included isolates from Ethiopia and Sudan, while group II comprised those from Egypt, Morocco and Syria. For distinguishing these two groups, a simple RFLP test using HindIII and/or PvuII for cleavage of CP-gene-derived PCR products was developed. In ELISA and immunoelectron microscopy, however, isolates from these two groups could not be distinguished with rabbit antisera raised against a group-I isolate from Ethiopia (CpCSV-Eth) and a group-II isolate from Syria (CpCSV-Sy). Since none of the ten monoclonal antibodies (MAbs) that had been produced earlier against CpCSV-Eth reacted with group-II isolates, further MAbs were produced. Of the seven MAbs raised against CpCSV-Sy, two reacted only with CpCSV-Sy and two others with both CpCSV-Sy and -Eth. This indicated that there are group I- and II-specific and common (species-specific) epitopes on the CpCSV CP and that the corresponding MAbs are suitable for specific detection and discrimination of CpCSV isolates. Moreover, CpCSV-Sy (group II) caused more severe stunting and yellowing in faba bean than CpCSV-Eth (group I). In conclusion, our data indicate the existence of a geographically associated variation in the molecular, serological and presumably
Neutrino mass textures with maximal CP violation
International Nuclear Information System (INIS)
Aizawa, Ichiro; Kitabayashi, Teruyuki; Yasue, Masaki
2005-01-01
We show three types of neutrino mass textures, which give maximal CP violation as well as maximal atmospheric neutrino mixing. These textures are described by six real mass parameters: one specified by two complex flavor neutrino masses and two constrained ones and the others specified by three complex flavor neutrino masses. In each texture, we calculate mixing angles and masses, which are consistent with observed data, as well as Majorana CP phases
Penguins and cp violation in β decays
International Nuclear Information System (INIS)
He, X.C.
1996-11-01
The measurement of the ε-parameter in the K 0 - K-bar 0 meson system is the only direct evidence for CP violation in the laboratory. The Standard Model (SM) of three generations with the source for CP violation arising from the phases in the Cabibbo-Kobayashi-Maskawa (CKM) matrix is consistent with the experiment. An unique feature of this model is that the CKM matrix is a 3 x 3 unitary matrix. (author)
Synthesis and reactivity of dimolybdathiaborane cluster [(Cp Mo ...
Indian Academy of Sciences (India)
Cluster 2 has a bicapped octahedral geometry with the {Fe(CO)3} fragment occupying one of the ... thesis and characterization of [(Cp. ∗ ... Infrared spectra were obtained on a Nicolet 6700 FT-. IR spectrometer. Microanalyses for C, H, and N were performed on .... tains signals attributable to the one type of Cp. ∗ ligand.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
DNA Extraction and Primer Selection
DEFF Research Database (Denmark)
Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads
Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...
International Nuclear Information System (INIS)
Moriyasu, K.
1981-01-01
A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)
Searches for CP violation in two-body charm decays
INSPIRE-00160626
2015-10-16
The LHCb experiment recorded data corresponding to an integrated luminosity of 3.0 $fb^{-1}$ during its first run of data taking. These data yield the largest samples of charmed hadrons in the world and are used to search for CP violation in the $D^0$ system. Among the many measurements performed at LHCb, a measurement of the direct CP asymmetry in $D^0 \\rightarrow K_S^0 K_S^0$ decays is presented and is found to be $A_{CP}(D^0 \\rightarrow K_S^0 K_S^0) = (-2.9 \\pm 5.2 \\pm 2.2)\\, \\%, $ where the first uncertainty is statistical and the second systematic. This represents a significant improvement in precision over the previous measurement of this parameter. Measurements of the parameter $A^\\Gamma$, defined as the CP asymmetry of the $D^0$ effective lifetime when decaying to a CP eigenstate, are also presented. Using semi-leptonic b-hadron decays to tag the flavour of the $D^0$ meson at production with the $K^+K^-$ and $\\pi^+\\pi^-$ final states yields $A^\\Gamma(K^+K^-) = (-0.134 \\pm 0.077^{+0.026}_{-0.034})\\, \\%...
Tools for Ultraspecific Probe/Primer Design
National Research Council Canada - National Science Library
Fofanov, Yurly
2006-01-01
.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...
Diversity of internal structures in inhibited epoxy primers
Directory of Open Access Journals (Sweden)
Anthony E. Hughes
2015-10-01
Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.