WorldWideScience

Sample records for primer pair cp

  1. Higgs pair production in the MSSM with explicit CP violation

    International Nuclear Information System (INIS)

    Demir, D.A.

    1999-07-01

    In the minimal supersymmetric standard model with explicit CP violation, associated production of the lightest Higgs boson with heavier ones is analyzed. Due to explicit CP violation, the Higgs bosons are no longer CP eigenstates so that both of the heavy Higgs bosons contribute to the process. While the radiative corrections in the Higgs sector turn out to be quite important, the vertex radiative corrections remain small as in the CP conserving theory. (author)

  2. Measuring the CP state of tau lepton pairs from Higgs decay at the ILC

    OpenAIRE

    Jeans, D.; Wilson, G. W.

    2018-01-01

    In the Standard Model, the Higgs boson is a CP even state with CP conserving couplings; any deviations from this would be a sign of new physics. These CP properties can be probed by measuring Higgs decays to tau lepton pairs: the transverse correlation between the tau spins depends on CP. This paper develops such an analysis, using full simulation of signal and background events in the International Large Detector concept for the International Linear Collider. We consider Higgs-strahlung even...

  3. Pair formation models for sexually transmitted infections : A primer

    NARCIS (Netherlands)

    Kretzschmar, MEE; Heijne, Janneke C M

    For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward

  4. CP violation in top pair production at an e^+e^- collider

    CERN Document Server

    Chang, Darwin; Phillips, Ivan

    1992-01-01

    We investigate a possible CP violating effect in $e^+e^-$ annihilation into $t\\bar t$ top quark pairs. As an illustrative example, we assume the source of the CP nonconservation is in the Yukawa couplings of a neutral Higgs boson which contain both scalar and pseudoscalar pieces. One of the interesting observable effects is the difference in production rates between the two CP conjugate polarized $t\\bar t$ states.

  5. Pair formation models for sexually transmitted infections: A primer

    Directory of Open Access Journals (Sweden)

    Mirjam Kretzschmar

    2017-08-01

    Full Text Available For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward transmission of the infection as long as they persist. In addition, for curable infections re-infection from an infected partner may occur. Furthermore, interventions based on contact tracing rely on the possibility of identifying and treating partners of infected individuals. To reflect these features in a mathematical model, pair formation models were introduced to mathematical epidemiology in the 1980's. They have since been developed into a widely used tool in modelling sexually transmitted infections and the impact of interventions. Here we give a basic introduction to the concepts of pair formation models for a susceptible-infected-susceptible (SIS epidemic. We review some results and applications of pair formation models mainly in the context of chlamydia infection. Keywords: Pair formation, Mathematical model, Partnership duration, Sexually transmitted infections, Basic reproduction number

  6. Higgs pair production at NLO QCD for CP-violating Higgs sectors

    Science.gov (United States)

    Gröber, R.; Mühlleitner, M.; Spira, M.

    2017-12-01

    Higgs pair production through gluon fusion is an important process at the LHC to test the dynamics underlying electroweak symmetry breaking. Higgs sectors beyond the Standard Model (SM) can substantially modify this cross section through novel couplings not present in the SM or the on-shell production of new heavy Higgs bosons that subsequently decay into Higgs pairs. CP violation in the Higgs sector is important for the explanation of the observed matter-antimatter asymmetry through electroweak baryogenesis. In this work we compute the next-to-leading order (NLO) QCD corrections in the heavy top quark limit, including the effects of CP violation in the Higgs sector. We choose the effective theory (EFT) approach, which provides a rather model-independent way to explore New Physics (NP) effects by adding dimension-6 operators, both CP-conserving and CP-violating ones, to the SM Lagrangian. Furthermore, we perform the computation within a specific UV-complete model and choose as benchmark model the general 2-Higgs-Doublet Model with CP violation, the C2HDM. Depending on the dimension-6 coefficients, the relative NLO QCD corrections are affected by several per cent through the new CP-violating operators. This is also the case for SM-like Higgs pair production in the C2HDM, while the relative QCD corrections in the production of heavier C2HDM Higgs boson pairs deviate more strongly from the SM case. The absolute cross sections both in the EFT and the C2HDM can be modified by more than an order of magnitude. In particular, in the C2HDM the resonant production of Higgs pairs can by far exceed the SM cross section.

  7. Higgs pair production at NLO QCD for CP-violating Higgs sectors

    Directory of Open Access Journals (Sweden)

    R. Gröber

    2017-12-01

    Full Text Available Higgs pair production through gluon fusion is an important process at the LHC to test the dynamics underlying electroweak symmetry breaking. Higgs sectors beyond the Standard Model (SM can substantially modify this cross section through novel couplings not present in the SM or the on-shell production of new heavy Higgs bosons that subsequently decay into Higgs pairs. CP violation in the Higgs sector is important for the explanation of the observed matter-antimatter asymmetry through electroweak baryogenesis. In this work we compute the next-to-leading order (NLO QCD corrections in the heavy top quark limit, including the effects of CP violation in the Higgs sector. We choose the effective theory (EFT approach, which provides a rather model-independent way to explore New Physics (NP effects by adding dimension-6 operators, both CP-conserving and CP-violating ones, to the SM Lagrangian. Furthermore, we perform the computation within a specific UV-complete model and choose as benchmark model the general 2-Higgs-Doublet Model with CP violation, the C2HDM. Depending on the dimension-6 coefficients, the relative NLO QCD corrections are affected by several per cent through the new CP-violating operators. This is also the case for SM-like Higgs pair production in the C2HDM, while the relative QCD corrections in the production of heavier C2HDM Higgs boson pairs deviate more strongly from the SM case. The absolute cross sections both in the EFT and the C2HDM can be modified by more than an order of magnitude. In particular, in the C2HDM the resonant production of Higgs pairs can by far exceed the SM cross section.

  8. Higgs pair production in the CP-violating two-Higgs-doublet model

    Science.gov (United States)

    Bian, Ligong; Chen, Ning; Jiang, Yun

    2017-12-01

    The SM-like Higgs pair production is discussed in the framework of the general CP-violating two-Higgs-doublet model, where we find that the CP-violating mixing angles can be related to the Higgs self-couplings. Therefore, the future experimental searches for Higgs boson pairs can be constrained by the improved precision of the electric dipole moment measurements. Based on a series of constraints of the SM-like Higgs boson signal fits, the perturbative unitarity and stability bounds to the Higgs potential, and the most recent LHC searches for heavy Higgs bosons, we suggest a set of benchmark models for the future high-energy collider searches for Higgs pair production. The e+e- colliders operating at s = (500GeV,1 TeV) are capable of measuring the Higgs cubic self-couplings of the benchmark models directly. We also estimate the cross sections of the resonance contributions to the Higgs pair productions for the benchmark models at the future LHC and SppC/FCC-hh runs.

  9. Effects of Higgs sector CP violation in top-quark pair production at the LHC

    CERN Document Server

    Bernreuther, W; Flesch, M

    1998-01-01

    A striking manifestation of CP violation in the electroweak symmetry breaking sector would be the existence of neutral Higgs boson(s) with undefined CP parity. We analyse signatures of such a boson, with a mass of about 300 GeV or larger, produced in high energy proton-proton collisions at LHC energies in its top-quark antitop-quark decay channel. The large irreducible $t\\bar t$ background is taken into account. We propose, both for the dilepton and the lepton + jets decay channels of $t\\bar t$, several correlations and asymmetries with which (Higgs sector) CP violation can be traced. We show that for judiciously chosen cuts on the $t\\bar t$ invariant mass these CP observables yield, for an LHC integrated luminosity of 100 $\\rm{fb}^{-1}$, statistically significant signals for a range of Higgs boson masses and Yukawa couplings.

  10. CP violation in b-hadron decays using top-pair events in 8 TeV ATLAS data

    CERN Document Server

    D'onofrio, Adelina; The ATLAS collaboration

    2017-01-01

    CP violation in weak interactions is a well-established evidence in Particle Physics. Nevertheless, the most recent combination of all CP violation measurements is found to be insufficient to explain the size of the matter anti-matter asymmetry present in the Universe. The large number of top- antitop pair events produced in pp colllisions at the Large Hadron Collider (LHC) provides a unique source of b-quarks that can be used to probe the CP violation in heavy-flavour mixing and decay. This measurement focu- ses on semileptonic top-antitop events where one of the W-bosons decays hadronically and the other one decays leptonically. The charge of the lep- ton (electron or muon) from the W-boson tags the charge of the b-quark at production. In events where a muon is associated to the semileptonic decay of the b-quark (either directly or after a b → c hadronic transition), two charge asymmetries (CA) and several CP asymmetries, based on the charges of the lepton from the W-boson and this muon, can be measured. ...

  11. Determining the CP nature of spin-0 mediators in associated production of dark matter and tt̄ pairs

    Energy Technology Data Exchange (ETDEWEB)

    Haisch, Ulrich [Rudolf Peierls Centre for Theoretical Physics, University of Oxford,OX1 3NP Oxford (United Kingdom); CERN, Theoretical Physics Department,CH-1211 Geneva 23 (Switzerland); Pani, Priscilla [Department of Physics, Stockholm University,AlbaNova University Center, 106 91 Stockholm (Sweden); CERN, Experimental Physics Department,CH-1211 Geneva 23 (Switzerland); Polesello, Giacomo [INFN, Sezione di Pavia,Via Bassi 6, 27100 Pavia (Italy); CERN, Experimental Physics Department,CH-1211 Geneva 23 (Switzerland)

    2017-02-27

    In the framework of spin-0 s-channel simplified models, we explore the possibility of assessing the structure of dark matter interactions through the associate production of dark matter and tt̄ pairs. To this purpose, final states with two leptons are considered and the kinematic properties of the dilepton system is studied. We develop a realistic analysis strategy and provide a detailed evaluation of the achievable sensitivity for the dark matter signal assuming integrated luminosities of 300 fb{sup −1} and 3 ab{sup −1} at the 14 TeV LHC. Furthermore, upper limits on the mediator masses for which the two different CP hypotheses can be distinguished are derived. The obtained limits on the signal strengths are finally translated into constraints on the parameter space of two spin-0 simplified models including a scenario with an extended Higgs sector.

  12. Applications of the EPR effect in the particle physics correlated decays of kaon and b-meson pairs with CP violation

    International Nuclear Information System (INIS)

    Lipkin, H. J.

    1989-11-01

    The Einstein-Podolsky-Rosen effect arises in particle physics when pairs of neutral K, D or B mesons are created in a definite quantum state, and the decays of the two mesons are correlated. Choosing the decay mode to be detected for one of the two mesons creates a 'polarized beam' on the other side which has interesting and usfull properties. Application to nvestigations of CP violation are discussed. (author)

  13. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  14. The CP-violating 2HDM in light of a strong first order electroweak phase transition and implications for Higgs pair production

    Science.gov (United States)

    Basler, P.; Mühlleitner, M.; Wittbrodt, J.

    2018-03-01

    We investigate the strength of the electroweak phase transition (EWPT) within the CP-violating 2-Higgs-Doublet Model (C2HDM). The 2HDM is a simple and well-studied model, which can feature CP violation at tree level in its extended scalar sector. This makes it, in contrast to the Standard Model (SM), a promising candidate for explaining the baryon asymmetry of the universe through electroweak baryogenesis. We apply a renormalisation scheme which allows efficient scans of the C2HDM parameter space by using the loop-corrected masses and mixing matrix as input parameters. This procedure enables us to investigate the possibility of a strong first order EWPT required for baryogenesis and study its phenomenological implications for the LHC. Like in the CP-conserving (real) 2HDM (R2HDM) we find that a strong EWPT favours mass gaps between the non-SM-like Higgs bosons. These lead to prominent final states comprised of gauge+Higgs bosons or pairs of Higgs bosons. In contrast to the R2HDM, the CP-mixing of the C2HDM also favours approximately mass degenerate spectra with dominant decays into SM particles. The requirement of a strong EWPT further allows us to distinguish the C2HDM from the R2HDM using the signal strengths of the SM-like Higgs boson. We additionally find that a strong EWPT requires an enhancement of the SM-like trilinear Higgs coupling at next-to-leading order (NLO) by up to a factor of 2.4 compared to the NLO SM coupling, establishing another link between cosmology and collider phenomenology. We provide several C2HDM benchmark scenarios compatible with a strong EWPT and all experimental and theoretical constraints. We include the dominant branching ratios of the non-SM-like Higgs bosons as well as the Higgs pair production cross section of the SM-like Higgs boson for every benchmark point. The pair production cross sections can be substantially enhanced compared to the SM and could be observable at the high-luminosity LHC, allowing access to the trilinear

  15. A newly constructed primer pair for the PCR amplification, cloning and sequencing of the flagellin (flaA) gene from isolatesof urease-negative Campylobacter lari.

    Science.gov (United States)

    Sekizuka, Tsuyoshi; Yokoi, Taeko; Murayama, Ohoshi; Millar, B Cherie; Moore, Johne; Matsuda, Motoo

    2005-08-01

    A newly constructed primer pair (lari-Af/lari-Ar) designed to generate a product of the flagellin (flaA) gene for urease-negative Campylobacter lari produced a PCR amplicon of about 1700 bp for 16 isolates from 7 seagulls, 5 humans, 3 food animals and one mussel in Japan and Northern Ireland. Nucleotide sequencing and alignments of the flaA amplicons from these isolates demonstrated that the deduced amino acid sequences of the possible open reading frame were 564-572 amino acid residues in length with calculated molecular weights of 58,804 to 59,463. The deduced amino acid sequence similarity analysis strongly suggested that the ORF of the flaA from the 16 isolates showed 70-75% sequence similarities to those of Campylobacter jejuni isolates. The approximate Mr of the flagellin purified from some of the isolates of urease-negative C. lari was estimated to range from 59.6 to 61.8 kDa. Thus, flagellin from the isolates of urease-negative C. lari was shown for the first time to have a molecular size similar to those of C. jejuni and Campylobacter coli isolates, but to be different from the shorter flaA and smaller flagellin of urease-positive thermophilic Campylobacter (UPTC) isolates. Flagellins from C. lari spp., consisting of the two representative taxa of urease-negative C. lari and UPTC, thus show genotypic and phenotypic diversity.

  16. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  17. CP violation

    CERN Document Server

    1989-01-01

    Contents: CP Phenomenology: Introduction to CP Violation (C Jarlskog); CP-Violation in the K 0 -K 0 -System (K Kleinknecht); The Quark Mixing Matrix, Charm Decays and B Decays (S Stone); The Question of CP Noninvariance - As Seen through the Eyes of Neutral Beauty (I I Bigi et al.); In Search of CP Noninvariance in Heavy Quark Systems (L-L Chau); CP Violation at High Energy e + e - Colliders (J Bernabéu & M B Gavela); CP Violation in the Standard Model with Four Families (A Datta & E A Paschos); CP Effects When Neutrinos are their Own Antiparticles (B Kayser); On Spontaneous CP Violation Trigg

  18. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  19. Measurement of the lifetime of the CP pair component of Bs0 in LHCb. Validation of the phototubes of the pre-shower

    International Nuclear Information System (INIS)

    Borras, D.

    2006-10-01

    This manuscript discusses a twofold research: an instrumental work and a prospective physics study both conducted in the framework of the LHCb experiment (CERN), foreseen to start at the Spring 2008. The LHC machine is a proton-proton collider clocked at 40 MHz and delivering a center-of-mass energy of 14 TeV. At nominal luminosity, about 10 12 pairs of b-particles will be produced in LHCb. After the remarkable achievements of the B factories (BaBar and Belle), it is established that the Standard Model (through the CKM mechanism) is the dominant source of CP violation in the B system. Moreover, no significant deviation to the Standard Model predictions is observed in the whole Flavour Physics data up to now. In this scope, the large statistics which will be available at LHCb should allow to reach rare decays potentially sensitive to New Physics contribution. it will also allow to perform precision measurements and deeply test the global consistency of the CKM predictions, in particular with the B s 0 particles. This document describes a prospective study about the measurement of the lifetime of the short component of the B s 0 meson, reconstructed in the final state B s 0 → D s + D s - , where the D s meson decays in KKπ. It has been shown that LHCb should reach a 2% precision on this observable for a nominal year of data taking, yielding interesting constraints on ΔΓ s /Γ s . On the instrumentation side, the team I belong to has the charge of the entire readout of the Pre-Shower (PS) detector of the LHCb spectrometer (design, construction and qualification). My contribution was devoted to the operation of a dedicated test bench aimed at qualifying the phototubes reading the PS detector. The photodetectors which have been retained are the 64-anodes PMTs produced by the Hamamatsu company. The main physics specifications for these devices were concerning the uniformity of the response of the 64 channels, their linearity, the control of their drift along time

  20. A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.

    Science.gov (United States)

    Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin

    2005-06-01

    Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism

  1. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  2. CP violation

    CERN Multimedia

    CERN. Geneva

    1999-01-01

    In the first two lectures, CP violation in the K system is pedagogically reviewed: its manifestations in the neutral K meson systems, in rare K meson decays and in decays of charged K mesons, and results from classical and current experiments, are discussed. In the third lecture, CP Violation in the B system and the forthcoming experimental tests will be discussed.

  3. CP violation

    Indian Academy of Sciences (India)

    We have just entered a period during which we expect considerable progress toward understanding CP violation. Here we review what we have learnt so far, and what is to be expected in the near future. To do this we cover the foundation of CP violation at a level which can be understood by physicists who are not working ...

  4. CP violation

    International Nuclear Information System (INIS)

    Gronau, M.

    1995-01-01

    We review the present status of the Standard Model of CP violation, which is based on a complex phase in the Cabibbo-Kobayashi-Maskawa (CKM) matrix. So far CP violation has been observed only in K 0 -K 0 mixing, consistent with a sizable phase. The implications of future CP nonconserving measusrements in K and B decays are discussed within the model. Direct CP violation in K→2π may be observed in the near future, however this would not be a powerful test of the model. B decays provide a wide variety of CP asymmetry measurements, which can serve as precise tests of the Standard Model in cases where the asymmetry is cleanly related to phases of CKM matrix elements. Some of the most promising cases are discussed. ((orig.))

  5. Measurement of the lifetime of the CP pair component of B{sub s}{sup 0} in LHCb. Validation of the phototubes of the pre-shower; Mesure du temps de vie de la composante CP paire du B{sub s}{sup 0} dans LHCb. Qualification des phototubes du preshower

    Energy Technology Data Exchange (ETDEWEB)

    Borras, D

    2006-10-15

    This manuscript discusses a twofold research: an instrumental work and a prospective physics study both conducted in the framework of the LHCb experiment (CERN), foreseen to start at the Spring 2008. The LHC machine is a proton-proton collider clocked at 40 MHz and delivering a center-of-mass energy of 14 TeV. At nominal luminosity, about 10{sup 12} pairs of b-particles will be produced in LHCb. After the remarkable achievements of the B factories (BaBar and Belle), it is established that the Standard Model (through the CKM mechanism) is the dominant source of CP violation in the B system. Moreover, no significant deviation to the Standard Model predictions is observed in the whole Flavour Physics data up to now. In this scope, the large statistics which will be available at LHCb should allow to reach rare decays potentially sensitive to New Physics contribution. it will also allow to perform precision measurements and deeply test the global consistency of the CKM predictions, in particular with the B{sub s}{sup 0} particles. This document describes a prospective study about the measurement of the lifetime of the short component of the B{sub s}{sup 0} meson, reconstructed in the final state B{sub s}{sup 0} {yields} D{sub s}{sup +}D{sub s}{sup -}, where the D{sub s} meson decays in KK{pi}. It has been shown that LHCb should reach a 2% precision on this observable for a nominal year of data taking, yielding interesting constraints on {delta}{gamma}{sub s}/{gamma}{sub s}. On the instrumentation side, the team I belong to has the charge of the entire readout of the Pre-Shower (PS) detector of the LHCb spectrometer (design, construction and qualification). My contribution was devoted to the operation of a dedicated test bench aimed at qualifying the phototubes reading the PS detector. The photodetectors which have been retained are the 64-anodes PMTs produced by the Hamamatsu company. The main physics specifications for these devices were concerning the uniformity of

  6. CP violation

    International Nuclear Information System (INIS)

    Gilman, F.J.

    1989-12-01

    Predictions for CP violation in the three generation Standard Model are reviewed based on what is known about the Cabibbo-Kobayashi-Maskawa matrix. Application to the K and B meson systems are emphasized. 43 refs., 13 figs

  7. CP violation

    International Nuclear Information System (INIS)

    Quinn, H.

    1995-12-01

    In this talk the author briefly reviews the cosmological importance of CP violation and the status of calculations of baryogenisis in the context of the Standard Model. The author then turns to a discussion of Standard Model Predictions for CP violation in B decays, stressing the importance of multiple measurements to overconstrain the model parameters and thus search for indications of beyond-Standard-Model physics

  8. CP Violation

    International Nuclear Information System (INIS)

    Aleksan, R.

    1993-06-01

    The violation of the CP symmetry is a phenomenon, the origin of which is not yet well established and deserves a particular attention since it may be a fundamental property of Nature with very important consequences for the evolution of the universe. We propose in these lectures to have an overview of this phenomenon as we understand it so far. To this end, and after introducing the discrete space-time symmetries, we discuss the observation of the violation of the CP symmetry in the neutral kaon decays. We then derive the general formalism for any neutral system made of a particle and its antiparticle and discuss how CP violation is introduced. We show how this phenomenon is generated in the Standard Model of the electroweak interactions and what are the predictions that can be made. In particular we shall concentrate on the expected effects in the decays of mesons involving the b quark. We review the various possibilities for observing these effects, calculate their magnitudes and show how the consistency of the theory can be tested. Finally, we outline the experimental prospects for studying CP non conservation at an asymmetric B Factory to either verify the Standard Model mechanism or provide evidence for new physics. (author)

  9. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  10. CP violation with an unbroken CP transformation

    Energy Technology Data Exchange (ETDEWEB)

    Ratz, Michael [Department of Physics and Astronomy, University of California,Irvine, California 92697-4575 (United States); Trautner, Andreas [Bethe Center for Theoretical Physics und Physikalisches Institut der Universität Bonn,Nussallee 12, 53115 Bonn (Germany)

    2017-02-21

    A CP conserving SU(3) gauge theory is spontaneously broken to T{sub 7} by the vacuum expectation value (VEV) of a 15-plet. Even though the SU(3)-CP transformation is not broken by the VEV, the theory exhibits physical CP violation in the broken phase. This is because the SU(3)-CP transformation corresponds to the unique order-two outer automorphism of T{sub 7}, which is not a physical CP transformation for the T{sub 7} states, and there is no other possible CP transformation. We explicitly demonstrate that CP is violated by calculating a CP odd decay asymmetry in the broken phase. This scenario provides us with a natural protection for topological vacuum terms, ensuring that θ G{sub μν}G̃{sup μν} is absent even though CP is violated for the physical states of the model.

  11. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  12. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  13. ANNIVERSARY: 25 years without CP

    International Nuclear Information System (INIS)

    Riordan, Michael

    1989-01-01

    In 1964 a small group of Princeton University physicists led by Jim Cronin and Val Fitch performed a landmark experiment at Brookhaven. Using a double-arm spectrometer, they showed that long-lived neutral kaons occasionally decayed into a pair of pions - violating the hitherto sacrosanct CP symmetry of combined mirror reflection and particle-antiparticle switching. From May 21-26 scientists gathered at the Chateau de Blois, southwest of Paris, to celebrate the 25th anniversary of this achievement

  14. ANNIVERSARY: 25 years without CP

    Energy Technology Data Exchange (ETDEWEB)

    Riordan, Michael

    1989-07-15

    In 1964 a small group of Princeton University physicists led by Jim Cronin and Val Fitch performed a landmark experiment at Brookhaven. Using a double-arm spectrometer, they showed that long-lived neutral kaons occasionally decayed into a pair of pions - violating the hitherto sacrosanct CP symmetry of combined mirror reflection and particle-antiparticle switching. From May 21-26 scientists gathered at the Chateau de Blois, southwest of Paris, to celebrate the 25th anniversary of this achievement.

  15. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  16. Giant CP stars

    International Nuclear Information System (INIS)

    Loden, L.O.; Sundman, A.

    1989-01-01

    This study is part of an investigation of the possibility of using chemically peculiar (CP) stars to map local galactic structure. Correct luminosities of these stars are therefore crucial. CP stars are generally regarded as main-sequence or near-main-sequence objects. However, some CP stars have been classified as giants. A selection of stars, classified in literature as CP giants, are compared to normal stars in the same effective temperature interval and to ordinary 'non giant' CP stars. There is no clear confirmation of a higher luminosity for 'CP giants', than for CP stars in general. In addition, CP characteristics seem to be individual properties not repeated in a component star or other cluster members. (author). 50 refs., 5 tabs., 3 figs

  17. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  18. CP Violation course

    CERN Multimedia

    CERN. Geneva HR-RFA

    2006-01-01

    The lecture introduces the concepts and phenomena of matter-antimatter symmetry violation, so-called "CP" violation. The lecture is organized in four courses, the first being devoted to a historical overview and an introduction into fundamental discrete symmetries. The second course introduces the most compelling CP-violating phenomena, and presents the first experimental discovery of CP violation in the neutral kaon system. The third course discusses how CP violation is beautifully incorporated into the Standard Model of particle interactions, and how modern B-meson "factories" provide precise tests of this picture. Finally, the fourth and last course introduces CP violation and the genesis of our matter world.

  19. CP violation in B decay

    OpenAIRE

    Yamamoto, Hitoshi

    2001-01-01

    We review the physics of CP violation in B decays. After introducing the CKM matrix and how it causes CP violation, we cover three types of CP violation that can occur in B decays: CP violation in mixing, CP violation by mixing-decay interference, and CP violation in decay.

  20. Cloning and transformation of SCMV CP gene and regeneration of ...

    African Journals Online (AJOL)

    The coated protein gene of sugarcane mosaic virus ( SCMV CP gene) was cloned from maize (Zea mays L.) leaves showing dwarf mosaic symptoms by reverse-transcription polymerase chain reaction (RTPCR) with degraded primers. The results of sequencing and homologous comparison indicated that the cloned gene ...

  1. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  2. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  3. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  4. CP asymmetries in the supersymmetric trilepton signal at the LHC

    International Nuclear Information System (INIS)

    Bornhauser, S.; Drees, M.; Dreiner, H.; Eboli, O.J.P.; Kim, J.S.; Kittel, O.

    2012-01-01

    In the CP-violating Minimal Supersymmetric Standard Model, we study the production of a neutralino-chargino pair at the LHC. For their decays into three leptons, we analyze CP asymmetries which are sensitive to the CP phases of the neutralino and chargino sector. We present analytical formulas for the entire production and decay process, and identify the CP-violating contributions in the spin correlation terms. This allows us to define the optimal CP asymmetries. We present a detailed numerical analysis of the cross sections, branching ratios, and the CP observables. For light neutralinos, charginos, and squarks, the asymmetries can reach several 10%. We estimate the discovery potential for the LHC to observe CP violation in the trilepton channel. (orig.)

  5. Phenomenology of CP violation

    International Nuclear Information System (INIS)

    Ecker, G.

    1987-01-01

    A short survey of the theoretical status of CP violation is presented. The Standart Model is confronted with the present experimental situation. Possible future tests of our notions of CP violation are discussed, concentrating on rare K decays. Other promising reactions such as B decays are briefly reviewed. Among alternative models of CP violation, multi-Higgs extensions of the Standart Model, left-right symmetric gauge theories and minimal SUSY models are discussed. Finally, the relevance of generalized CP invariance is emphasized. 64 refs., 7 figs. (Author)

  6. Leptonic CP violation theory

    DEFF Research Database (Denmark)

    Hagedorn, C.

    2017-01-01

    I summarize the status of theoretical predictions for the yet to be measured leptonic CP phases, the Dirac phase δ and the two Majorana phases α and β. I discuss different approaches based on: (a) a flavor symmetry without and with corrections, (b) different types of sum rules and (c) flavor and CP...... symmetries. I show their predictive power with examples. In addition, I present scenarios in which low and high energy CP phases are connected so that predictions for the CP phases α, β and δ become correlated to the sign of the baryon asymmetry YB of the Universe that is generated via leptogenesis....

  7. Is CP violation maximal

    International Nuclear Information System (INIS)

    Gronau, M.

    1984-01-01

    Two ambiguities are noted in the definition of the concept of maximal CP violation. The phase convention ambiguity is overcome by introducing a CP violating phase in the quark mixing matrix U which is invariant under rephasing transformations. The second ambiguity, related to the parametrization of U, is resolved by finding a single empirically viable definition of maximal CP violation when assuming that U does not single out one generation. Considerable improvement in the calculation of nonleptonic weak amplitudes is required to test the conjecture of maximal CP violation. 21 references

  8. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  9. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  10. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  11. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  12. CP violation and modular symmetries

    OpenAIRE

    Dent, Thomas

    2001-01-01

    We reconsider the origin of CP violation in fundamental theory. Existing string models of spontaneous CP violation make ambiguous predictions, due to the arbitrariness of CP transformation and the apparent non-invariance of the results under duality. We find an unambiguous modular CP invariance condition, applicable to predictive models of spontaneous CP violation, which circumvents these problems; it strongly constrains CP violation by heterotic string moduli. The dilaton is also evaluated a...

  13. CP violation and modular symmetries

    International Nuclear Information System (INIS)

    Dent, Thomas

    2001-01-01

    We reconsider the origin of CP violation in fundamental theory. Existing string models of spontaneous CP violation make ambiguous predictions, due to the arbitrariness of CP transformation and the apparent noninvariance of the results under duality. We find a modular CP invariance condition, applicable to any predictive model of spontaneous CP violation, which circumvents these problems; it strongly constrains CP violation by heterotic string moduli. The dilaton is also evaluated as a source of CP violation, but is likely experimentally excluded. We consider the prospects for explaining CP violation in strongly coupled strings and brane worlds

  14. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  15. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  16. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  17. CP violation in gauge theories

    International Nuclear Information System (INIS)

    Escobar, C.O.

    Some aspects of CP violation in gauge theories are reviewed. The topics covered include a discussion of the Kobayashi-Maskawa six-quarks model, models of soft- CP violation (extended Higgs sector), the strong CP problem and finally some speculations relating CP violation and magnetic charges in non-abelian gauge theories. (Author) [pt

  18. CP violation in atoms

    International Nuclear Information System (INIS)

    Barr, S.M.

    1992-01-01

    Electric dipole moments of large atoms are an excellent tool to search for CP violation beyond the Standard Model. These tell us about the electron EDM but also about CP-violating electron-nucleon dimension-6 operators that arise from Higgs-exchange. Rapid strides are being made in searches for atomic EDMs. Limits on the electron EDM approaching the values which would be expected from Higgs-exchange mediated CP violation have been achieved. It is pointed out that in this same kind of model if tan β is large the effects in atoms of the dimension-6 e - n operators may outweigh the effect of the electron EDM. (author) 21 refs

  19. Highlights of CP 2000

    CERN Document Server

    Ellis, John R.

    2001-01-01

    Various developing topics in CP violation are reviewed. There are many theoretical reasons to hope that the CKM paradigm may be incomplete. It is surely too soon to be claiming new physics in \\epsilon^\\prime/\\epsilon or in D^0-\\bar D^0 mixing, but rare K decays offer interesting places to search for new physics. It is probably also premature to see a clash between global CKM fits and current estimates of sin \\beta and \\gamma, where much more precise data will soon be available. There are interesting possibilities to look for CP violation in neutrino oscillations and in Higgs physics. Rapid progress can be expected now that CP violation is moving to the top of the particle physics agenda.

  20. Topics in CP violation

    International Nuclear Information System (INIS)

    Quinn, H.R.

    1993-02-01

    Given the varied backgrounds of the members of this audience this talk will be a grab bag of topics related to the general theme of CP Violation. I do not have time to dwell in detail on any of them. First, for the astronomers and astrophysicists among you, I want to begin by reviewing the experimental status of evidence for CP violation in particle processes. There is only one system where this has been observed, and that is in the decays of neutral K mesons

  1. Topics in CP violation

    Science.gov (United States)

    Quinn, H. R.

    1993-02-01

    Given the varied backgrounds of the members of this audience this talk will be a grab bag of topics related to the general theme of CP Violation. I do not have time to dwell in detail on any of them. First, for the astronomers and astrophysicists among you, I want to begin by reviewing the experimental status of evidence for CP violation in particle processes. There is only one system where this has been observed, and that is in the decays of neutral K mesons.

  2. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  4. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  5. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  6. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  7. Beautiful CP violation

    International Nuclear Information System (INIS)

    Dunietz, I.

    1997-01-01

    CP violation is observed to date only in K 0 decays and is parameterizable by a single quantity ε. Because it is one of the least understood phenomena in the Standard Model and holds a clue to baryogenesis, it must be investigated further. Highly specialized searches in K 0 decays are possible. Effects in B decays are much larger. In addition to the traditional B d → J/ψK S , π + π - asymmetries, CP violation could be searched for in already existing inclusive B data samples. The rapid B s --anti B s oscillations cancel in untagged B s data samples, which therefore allow feasibility studies for the observation of CP violation and the extraction of CKM elements with present vertex detectors. The favored method for the extraction of the CKM angle γ is shown to be unfeasible and a solution is presented involving striking direct CP violation in charged B decays. Novel methods for determining the B s mixing parameter Δm are described without the traditional requirement of flavor-specific final states

  8. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  9. CP violation in ATLAS

    International Nuclear Information System (INIS)

    Saavedra, A.F.

    1995-01-01

    Full text: In the standard model CP violation is generated by a non trivial complex phase in the CKM matrix. The Standard Model does not predict the elements of the CKM matrix, they need to be experimentally measured. This will show if all the CP violation phenomena can be accounted by the complex phase or there are other contributing mechanisms which lie beyond the scope of Standard Model. It is of interest to overconstraint the so called unitary triangle by measuring each angle (α, β and γ) from the CP asymmetry that occurs in different decay modes. During the initial low luminosity period of the LHC a large effort will be concentrated in studying B physics, especially CP violation in the B 0 - B-bar 0 system, with the ATLAS detector. The features of the detector which are important for CP studies are: sharp trigger from the muon spectrometer (muons will be identify down to p T ≅ 5GeV, be able to distinguish electrons from hadrons (down to p T ≅ 1 GeV) with the Straw Tracker and Transition detector and high resolution of tracks, secondary vertices with the Semiconductor Tracker (resolution of 10-90 μm. For some decays modes ATLAS is expected to obtain larger sample of events than the B-factories that are being proposed. It has been calculated that the systematic error σ sin (2 α) = 0.06 and σ sin ( 2 β) = 0.027 which is comparable with other future experiments

  10. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  11. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  12. CP violation in K decays

    International Nuclear Information System (INIS)

    Gilman, F.J.

    1989-05-01

    Recent theoretical and experimental progress on the manifestation of CP violation in K decays, and toward understanding whether CP violation originates in a phase, or phases, in the weak mixing matrix of quarks is reviewed. 23 refs., 10 figs

  13. CP violation in B decays

    International Nuclear Information System (INIS)

    Kayser, B.

    1990-01-01

    The study of CP-violating effects in B decays will be a good test of whether CP violation is caused by the known weak interaction. If this is its origin, then large, cleanly-predicted CP-violating effects are expected in certain neutral B decays to hadronic CP eigenstates. The phenomenology of CP violation in the B system is reviewed, and the genesis of these large effects is explained. In this it is shown that large, cleanly-predicted effects are also expected in some decays to states which are not CP eigenstates. The combined study of the latter decays and those to CP eigenstates may make it possible to obtain a statistically-significant CP-violating signal with fewer B mesons that would otherwise be required

  14. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  15. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  16. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  17. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  18. Status in CP violation

    International Nuclear Information System (INIS)

    Fayard, L.

    1989-11-01

    Twenty-five years after the discovery of CP violation in the neutral Kaon system, we still dont know exactly the origin and the components of that weak non invariance. The two more precise experiments give slightly different answers concerning the direct way of CP violation NA 31 gives ε prime/ε incompatible with the Superweak Model (for which ε prime=0) and in agreement with Standard Model predictions compatible with both. Again, one needs new and precise results in order to conclude about ε prime. E731 and NA31 are actually working on their new data samples. Longer term ideas are also being discussed, looking for new experiments able to give ε prime/ε with a precision. Concerning CPT invariance the situation seems to be more clear

  19. LHCb CP violation

    CERN Document Server

    Vesterinen, Mika

    2016-01-01

    The study of $CP$ violation in the beauty hadron sector is a promising approach to search for the effects of physics beyond the Standard Model. Several recent measurements in this area from the LHCb experiment are reported in these proceedings. These are based on the Run-I dataset of 3~fb$^{-1}$ of data collected at proton-proton centre of mass energies of 7 and 8~TeV.

  20. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  1. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  2. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  3. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  4. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  6. Mahonian pairs

    OpenAIRE

    Sagan, Bruce E.; Savage, Carla D.

    2012-01-01

    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  7. CP violating scalar Dark Matter

    Science.gov (United States)

    Cordero-Cid, A.; Hernández-Sánchez, J.; Keus, V.; King, S. F.; Moretti, S.; Rojas, D.; Sokołowska, D.

    2016-12-01

    We study an extension of the Standard Model (SM) in which two copies of the SM scalar SU(2) doublet which do not acquire a Vacuum Expectation Value (VEV), and hence are inert, are added to the scalar sector. We allow for CP-violation in the inert sector, where the lightest inert state is protected from decaying to SM particles through the conservation of a Z 2 symmetry. The lightest neutral particle from the inert sector, which has a mixed CP-charge due to CP-violation, is hence a Dark Matter (DM) candidate. We discuss the new regions of DM relic density opened up by CP-violation, and compare our results to the CP-conserving limit and the Inert Doublet Model (IDM). We constrain the parameter space of the CP-violating model using recent results from the Large Hadron Collider (LHC) and DM direct and indirect detection experiments.

  8. Present status of CP violation

    International Nuclear Information System (INIS)

    Ng, J.N.

    1989-06-01

    A review of the status of CP violation in kaons is given. Status of our knowledge of quark mixing angles in the standard six quark model is presented. The role Β d o - Βd o transition plays in this study is examined. A comparison of the estimates of CP violation effects from models beyond the standard one is given. Other experiments that have the capability of testing different CP violation models are also discussed. (Author) 35 refs., 6 figs., tab

  9. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  10. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  11. CP asymmetries in Strange Baryon Decays

    Science.gov (United States)

    Bigi, I. I.; Kang, Xian-Wei; Li, Hai-Bo

    2018-01-01

    While indirect and direct CP violation (CPV) has been established in the decays of strange and beauty mesons, no CPV has yet been found for baryons. There are different paths to finding CP asymmetry in the decays of strange baryons; they are all highly non-trivial. The HyperCP Collaboration has probed CPV in the decays of single Ξ and Λ [1]. We discuss future lessons from {{{e}}}+{{{e}}}- collisions at BESIII/BEPCII: probing decays of pairs of strange baryons, namely Λ, Σ and Ξ. Realistic goals are to learn about non-perturbative QCD. One can hope to find CPV in the decays of strange baryons; one can also dream of finding the impact of New Dynamics. We point out that an important new era will start with the BESIII/BEPCII data accumulated by the end of 2018. This also supports new ideas to trigger {{J}}/{{\\psi }}\\to \\bar{{{Λ }}}{{Λ }} at the LHCb collaboration. Supported by National Science Foundation (PHY-1520966), National Natural Science Foundation of China (11335009, 11125525), Joint Large-Scale Scientific Facility Funds of the NSFC and CAS (U1532257), the National Key Basic Research Program of China (2015CB856700), Key Research Program of Frontier Sciences, CAS, (QYZDJ-SSW-SLH003), XWK’s work is also supported by MOST (Taiwan) (104-2112-M-001-022)

  12. Cosmological CP Violation

    CERN Document Server

    Tomaschitz, R

    1994-01-01

    Spinor fields are studied in infinite, topologically multiply connected Robertson-Walker cosmologies. Unitary spinor representations for the discrete covering groups of the spacelike slices are constructed. The spectral resolution of Dirac's equation is given in terms of horospherical elementary waves, on which the treatment of spin and energy is based in these cosmologies. The meaning of the energy and the particle-antiparticle concept is explained in the context of this varying cosmic background. Discrete symmetries, in particular inversions of the multiply connected spacelike slices, are studied. The violation of the unitarity of the parity operator, due to self-interference of P-reflected wave packets, is discussed. The violation of the CP and CPT invariance - already on the level of the free Dirac equation on this cosmological background - is pointed out.

  13. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  14. Leptogenesis and residual CP symmetry

    International Nuclear Information System (INIS)

    Chen, Peng; Ding, Gui-Jun; King, Stephen F.

    2016-01-01

    We discuss flavour dependent leptogenesis in the framework of lepton flavour models based on discrete flavour and CP symmetries applied to the type-I seesaw model. Working in the flavour basis, we analyse the case of two general residual CP symmetries in the neutrino sector, which corresponds to all possible semi-direct models based on a preserved Z 2 in the neutrino sector, together with a CP symmetry, which constrains the PMNS matrix up to a single free parameter which may be fixed by the reactor angle. We systematically study and classify this case for all possible residual CP symmetries, and show that the R-matrix is tightly constrained up to a single free parameter, with only certain forms being consistent with successful leptogenesis, leading to possible connections between leptogenesis and PMNS parameters. The formalism is completely general in the sense that the two residual CP symmetries could result from any high energy discrete flavour theory which respects any CP symmetry. As a simple example, we apply the formalism to a high energy S 4 flavour symmetry with a generalized CP symmetry, broken to two residual CP symmetries in the neutrino sector, recovering familiar results for PMNS predictions, together with new results for flavour dependent leptogenesis.

  15. Flavour physics and CP violation

    Indian Academy of Sciences (India)

    It is well known that the study of flavour physics and CP violation is very important to critically test the Standard Model and to look for possible signature of new physics beyond it. The observation of CP violation in kaon system in 1964 has ignited a lot of experimental and theoretical efforts to understand its origin and to look ...

  16. Testing New Indirect CP Violation

    International Nuclear Information System (INIS)

    Grossman, Yuval; Nir, Yosef; Perez, Gilad

    2009-01-01

    If new CP violating physics contributes to neutral meson mixing, but its contribution to CP violation in decay amplitudes is negligible, then there is a model independent relation between four (generally independent) observables related to the mixing: the mass splitting (x), the width splitting (y), the CP violation in mixing (1-|q/p|), and the CP violation in the interference of decays with and without mixing (φ). For the four neutral meson systems, this relation can be written in a simple approximate form: ytanφ≅x(1-|q/p|). In the K system, all four observables have been measured and obey the relation to excellent accuracy. For the B s and D systems, new predictions are provided. The success or failure of these relations will probe the physics that is responsible for the CP violation.

  17. CP-violation and instantons

    International Nuclear Information System (INIS)

    Han, C.G.

    1980-01-01

    Effects of Yang-Mills instantons on CP-violating strong interactions are studied. Using simplified models of CP-noninvariant weak interactions, we calculate the induced strong CP-violation. Even in the simple examples studied, the CP-violating phase of a vacuum-to-vacuum transition amplitude differs in general from the phase of the determinant of the quark mass matrix multiplied by the topological charge of the background Yang-Mills field. Then several CP-violating phenomena such as eta → 2π decay and neutron electric dipole moment induced by instantons are studied. The result of our explicit calculation of eta → 2π decay strength verifies the current algebraic method used by Crewther et al. We also present a calculation of the instanton contribution, in the dilute gas approximation for instanton gas, to the electric dipole moment of a free quark without using 't Hooft's effective Lagrangian

  18. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  19. CP-violation and Todd effects at lep-II

    International Nuclear Information System (INIS)

    Bilal, A.; Masso, E.; Rujula, A. de

    1991-01-01

    LEP-II will be a tool study CP-violation in processes involving vector bosons, and will test in particular the CP properties of the coupling of photons and Z's to W-pairs. While it is difficult to observe truly CP-odd effects, it is easy to measure T-odd ones. The latter can originate from CP-violation, or from radiative corrections involving the absorptive part of the scattering amplitude. T-odd effects are interesting in themselves, in that they accurately test the standard model and are sensitive to its unmeasured ingredients, such as the WW→WW scattering amplitude of the masses of the top quark and the elementary scalar. The prediction of the standard T-odd effects is a necessary stepping stone in the search for an honest-to-goodness violation of CP in the pure gauge sector. We thoroughly analyse the T-odd observables in the e + e - →W + W - process within the standard model, as well as the extra effects to be expected if the γW + W - and/or ZW + W - vertices were to violate CP in a non-standard fashion. (orig.)

  20. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  1. CP-Recursion in Danish

    DEFF Research Database (Denmark)

    Nyvad, Anne Mette; Christensen, Ken Ramshøj; Vikner, Sten

    2017-01-01

    Based on data from extraction, embedded V2, and complementizer stacking, this paper proposes a cP/CP-analysis of CP-recursion in Danish. Because extraction can be shown to be possible from relative clauses, wh-islands, and adverbial clauses, and given that long extraction is successive......-cyclic, an extra specifier position has to be available as an escape hatch. Consequently, such extractions require a CP-recursion analysis, as has been argued for embedded V2 and for complementizer stacking. Given that CP-recursion in embedded V2 clauses does not allow extraction, whereas other types of CP......-recursion do, we suggest that embedded V2 is fundamentally different, in that main clause V2 and embedded V2 involve a CP (“big CP”), whereas all other clausal projections above IP are instances of cP (“little cP”). The topmost “little” c° has an occurrence feature that enables extraction but bars spell...

  2. Is CP a gauge symmetry?

    International Nuclear Information System (INIS)

    Choi, K.; Kaplan, D.B.; Nelson, A.E.

    1993-01-01

    Conventional solutions to the strong CP problem all require the existence of global symmetries. However, quantum gravity may destroy global symmetries, making it hard to understand why the electric dipole moment of the neutron (EDMN) is so small. We suggest here that CP is actually a discrete gauge symmetry, and is therefore not violated by quantum gravity. We show that four-dimensional CP can arise as a discrete gauge symmetry in theories with dimensional compactification, if the original number of Minkowski dimensions equals 8k+1, 8k+2 or 8k+3, and if there are certain restrictions on the gauge group; these conditions are met by superstrings. CP may then be broken spontaneously below 10 9 GeV, explaining the observed CP violation in the kaon system without inducing a large EDMN. We discuss the phenomenology of such models, as well as the peculiar properties of cosmic 'SP strings' which could be produced at the compactification scale. Such strings have the curious property that a particle carried around the string is turned into its CP conjugate. A single CP string renders four-dimensional space-time nonorientable. (orig.)

  3. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  4. Frustrated Lewis pairs: Design and reactivity

    Indian Academy of Sciences (India)

    for FLP systems and their unique reactivity are discussed here. Keywords. Lewis .... we will concentrate on the design principles of such. FLPs and the ... Designs of frustrated Lewis pairs ..... 64 and neutral titanium (III) complex [Cp2TiOC6.

  5. Flavour Physics and CP Violation

    CERN Document Server

    Fleischer, Robert

    2006-01-01

    The starting point of these lectures is an introduction to the weak interactions of quarks and the Standard-Model description of CP violation, where the central role is played by the Cabibbo-Kobayashi-Maskawa matrix and the corresponding unitarity triangles. Since the B-meson system will govern the stage of (quark) flavour physics and CP violation in this decade, it will be our main focus. We shall classify B-meson decays, introduce the theoretical tools to deal with them, investigate the requirements for non-vanishing CP-violating asymmetries, and discuss the main strategies to explore CP violation and the preferred avenues for physics beyond the Standard Model to enter. This formalism is then applied to discuss the status of important B-factory benchmark modes, where we focus on puzzling patterns in the data that may indicate new-physics effects, as well as the prospects for B-decay studies at the LHC.

  6. Flavour physics and CP violation

    Indian Academy of Sciences (India)

    status and prospectives of the flavour physics associated with the strange, charm and .... might reveal something completely unexpected. Standard Model weak ..... Thus, in order to have an observable CP violation effect in the SM, the mixing.

  7. Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

    Science.gov (United States)

    Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

    2018-01-01

    Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

  8. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  9. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  10. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  11. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  12. Astrocyte-specific regulation of hMeCP2 expression in Drosophila

    Directory of Open Access Journals (Sweden)

    David L. Hess-Homeier

    2014-10-01

    Full Text Available Alterations in the expression of Methyl-CpG-binding protein 2 (MeCP2 either by mutations or gene duplication leads to a wide spectrum of neurodevelopmental disorders including Rett Syndrome and MeCP2 duplication disorder. Common features of Rett Syndrome (RTT, MeCP2 duplication disorder, and neuropsychiatric disorders indicate that even moderate changes in MeCP2 protein levels result in functional and structural cell abnormalities. In this study, we investigated two areas of MeCP2 pathophysiology using Drosophila as a model system: the effects of MeCP2 glial gain-of-function activity on circuits controlling sleep behavior, and the cell-type specific regulation of MeCP2 expression. In this study, we first examined the effects of elevated MeCP2 levels on microcircuits by expressing human MeCP2 (hMeCP2 in astrocytes and distinct subsets of amine neurons including dopamine and octopamine (OA neurons. Depending on the cell-type, hMeCP2 expression reduced sleep levels, altered daytime/nighttime sleep patterns, and generated sleep maintenance deficits. Second, we identified a 498 base pair region of the MeCP2e2 isoform that is targeted for regulation in distinct subsets of astrocytes. Levels of the full-length hMeCP2e2 and mutant RTT R106W protein decreased in astrocytes in a temporally and spatially regulated manner. In contrast, expression of the deletion Δ166 hMeCP2 protein was not altered in the entire astrocyte population. qPCR experiments revealed a reduction in full-length hMeCP2e2 transcript levels suggesting transgenic hMeCP2 expression is regulated at the transcriptional level. Given the phenotypic complexities that are caused by alterations in MeCP2 levels, our results provide insight into distinct cellular mechanisms that control MeCP2 expression and link microcircuit abnormalities with defined behavioral deficits.

  13. Measuring $CP$ violation with $\\Delta A_{CP}$ at LHCb

    CERN Document Server

    Pearce, Alex

    2014-01-01

    The control of systematic uncertainties is a key component of many analyses performed at the Large Hadron Collider, and will only become more important as more data are taken during Run II. Many of the CP measurements performed using the LHCb detector have statistical precisions below the per cent level, and so particular care must be taken in this area. One technique for dealing with the various production and detection asymmetries which can mask the physics asymmetry of interest, and increase the measurement’s systematic uncertainty, is $\\Delta A_{CP}$ . The application of $\\Delta A_{CP}$ in three separate LHCb analyses of $D^{0}$ and $\\Lambda_{b}^{0}$ decays will be discussed, along with prospects for applying the technique to $\\Lambda_{c}^{+}$ decays.

  14. Prediction for CP violation via electric dipole moment of τ lepton in γγ→τ{sup +}τ{sup −} process at CLIC

    Energy Technology Data Exchange (ETDEWEB)

    Atağ, S. [Department of Physics, Faculty of Sciences, Ankara University,06100 Tandogan, Ankara (Turkey); Gürkanlı, E. [Department of Physics, Sinop University,57000 Sinop (Turkey); Department of Physics, Faculty of Sciences, Ankara University,06100 Tandogan, Ankara (Turkey)

    2016-06-21

    Pair production of tau leptons in two photon collision γγ→τ{sup +}τ{sup −} is studied at CLIC to test CP violating QED couplings of tau leptons. CP violating effects are investigated using tau pair spin correlations which are observed through the hadronic decay of each τ into πν. Competitive bounds with previous works on the electric dipole moment from CP odd terms have been obtained.

  15. CpG + CpNpG Analysis of Protein-Coding Sequences from Tomato

    DEFF Research Database (Denmark)

    Hobolth, Asger; Nielsen, Rasmus; Wang, Ying

    2006-01-01

    We develop codon-based models for simultaneously inferring the mutational effects of CpG and CpNpG methylation in coding regions. In a data set of 369 tomato genes, we show that there is very little effect of CpNpG methylation but a strong effect of CpG methylation affecting almost all genes. We...... further show that the CpNpG and CpG effects are largely uncorrelated. Our results suggest different roles of CpG and CpNpG methylation, with CpNpG methylation possibly playing a specialized role in defense against transposons and RNA viruses....

  16. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  18. Finding CP-violating Higgses

    OpenAIRE

    Kalinowski, Jan

    1999-01-01

    In a general two-Higgs-doublet model with CP violation in the Higgs sector, the three neutral physical Higgs bosons have no definite CP properties. A new sum rule relating Yukawa and Higgs-Z couplings implies that a neutral Higgs boson cannot escape detection at an e^+e^- collider if it is kinematically accessible in Z+Higgs, $b\\bar b+$Higgs and $t\\bar t+$Higgs production, irrespective of the mixing angles and the masses of the other neutral Higgs bosons. The implications of the sum rules for...

  19. On the strong CP problem

    Energy Technology Data Exchange (ETDEWEB)

    Dowrick, N.J. (Dept. of Physics, Oxford (United Kingdom)); McDougall, N.A. (National Lab. for High Energy Physics, Tsukuba, Ibaraki (Japan))

    1992-07-09

    We show that two well-known solutions to the strong CP problem, the axion and a massless quark, may be understood in terms of the mechanism recently proposed by Samuel where long-range interactions between topological charges may be responsible for the removal of CP violation. We explain how the axion and a QCD meson (identified as the {eta}' if all quarks are massless) suppress fluctuations in global topological charge by almost identical dynamical although the masses, couplings and relevant length scales are very different. Furthermore, we elucidate the precise origin of the {eta}' mass. (orig.).

  20. Ultrasonic green synthesis of an Ag/CP nanocomposite for enhanced photodegradation effectiveness.

    Science.gov (United States)

    Chang, Hai Ning; Hou, Suo Xia; Hao, Zeng Chuan; Cui, Guang Hua

    2018-01-01

    A nanoparticle of cobalt(II) coordination polymer (CP), [Co(L)(npht)] n (1) (H 2 npht=4-nitrophthalic acid, L=1,3-bis(5,6-dimethylbenzimidazol-1-ylmethyl)benzene) and its nanocomposite (Ag/CP 1) were obtained by the sonochemical approach and characterized by IR, elemental analysis, thermogravimetric analyses (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), and X-ray powder diffraction (XRPD). CP 1 shows a 1D double chain containing two different helical chains, which is further extended into a two-dimensional supramolecular framework by C-H⋯O hydrogen bonding interactions. The photoluminescence properties and photocatalytic properties of the nanoparticles of CP 1 and Ag/CP 1 on the degradation of methylene blue (MB) were investigated, Ag/CP 1 exhibited excellent photocatalytic activity under UV and visible light, which can be attributed to the strong interactions between Ag nanorods and CP 1, which lead to electron-hole pair separation between Ag nanorods and CP 1. In addition, the photocatalytic mechanism is also carried out by introducing t-butyl alcohol (TBA) as a widely used ·OH scavenger. The influence of ultrasound irradiation time and power on the morphology and size of the nanostructure CP 1 were studied. The results indicated that a decrease in time and an increase in power led to a decrease of particle size. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Indirect CP violation and implications for D0-D0 and Bs-Bs mixing

    International Nuclear Information System (INIS)

    Kagan, Alexander L.; Sokoloff, Michael D.

    2009-01-01

    The two kinds of indirect CP violation in neutral meson systems are related, in the absence of new weak phases in decay. The result is a model-independent expression relating CP violation in mixing, CP violation in the interference of decays with and without mixing, and the meson mass and width differences. It relates the semileptonic and time-dependent CP asymmetries, and pairs of time-dependent CP asymmetries in D 0 decays to non-CP eigenstates. CP violation in the interference of decays with and without mixing is related to the mixing parameters of relevance to model building: the off-diagonal mixing matrix elements |M 12 |, |Γ 12 |, and φ 12 ≡arg(M 12 /Γ 12 ). Incorporating this relation into a fit to the D 0 -D 0 mixing data implies a level of sensitivity to |φ 12 D | of 0.10 (rad) at 1σ. The formalism is extended to include new weak phases in decay, and in Γ 12 . The phases are highly constrained by direct CP violation measurements. Consequently, the bounds on |φ 12 D | are not significantly altered, and the effects of new weak phases in decay could be difficult to observe at a high luminosity flavor factory (D 0 ) or at the LHC (B s ) via violations of the above relations, unlike in direct CP violation.

  2. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  3. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  4. CP violation in B decays

    International Nuclear Information System (INIS)

    Quinn, H.R.

    1994-02-01

    She reviews how one can test the Standard Model predictions for CP violation. This test requires sufficient independent measurements to overconstrain the model parameters and thus be sensitive to possible beyond Standard Model contributions. She addresses the challenges for theory as well as for experiment to achieve such a test

  5. CP Violation and B Physics

    International Nuclear Information System (INIS)

    Quinn, Helen R

    2001-01-01

    These lectures provide a basic overview of topics related to the study of CP Violation in B decays. In the first lecture, I review the basics of discrete symmetries in field theories, the quantum mechanics of neutral but flavor-non-trivial mesons, and the classification of three types of CP violation [1]. The actual second lecture which I gave will be separately published as it is my Dirac award lecture and is focused on the separate topic of strong CP Violation. In Lecture 2 here, I cover the Standard Model predictions for neutral B decays, and in particular discuss some channels of interest for CP Violation studies. Lecture 3 reviews the various tools and techniques used to deal with the hadronic physics effects. In Lecture 4, I briefly review the present and planned experiments that can study B decays. I cannot teach all the details of this subject in this short course, so my approach is instead to try to give students a grasp of the relevant concepts and an overview of the available tools. The level of these lectures is introductory. I will provide some references to more detailed treatments and current literature, but this is not a review article so I do not attempt to give complete references to all related literature. By now there are some excellent textbooks that cover this subject in great detail [1]. I refer students to these for more details and for more complete references to the original literature

  6. B physics and CP violation

    International Nuclear Information System (INIS)

    Quinn, H.

    2002-01-01

    These lectures provide a basic overview of topics related to the study of CP Violation in B decays. In the first lecture, I review the basics of discrete symmetries in field theories, the quantum mechanics of neutral but flavor-non-trivial mesons, and the classification of three types of CP violation. The actual second lecture which I gave will be separately published as it is my Dirac award lecture and is focussed on the separate topic of strong CP Violation. In Lecture 2 here, I cover the Standard Model predictions for neutral B decays, and in particular discuss some channels of interest for CP Violation studies. Lecture 3 reviews the various tools and techniques used to deal with the hadronic physics effects. In Lecture 4, I briefly review the present and planned experiments that can study B decays. I cannot teach all the details of this subject in this short course, so my approach is instead to try to give students a grasp of the relevant concepts and an overview of the available tools. The level of these lectures is introductory. I will provide some references to more detailed treatments and current literature, but this is not a review article so I do not attempt to give complete references to all related literature. By now there are some excellent textbooks that cover this subject in great detail. I refer students to these for more details and for more complete references to the original literature. (author)

  7. Flavour Physics and CP Violation

    CERN Document Server

    Fleischer, Robert

    2005-01-01

    The starting point of these lectures is an introduction to the weak interactions of quarks and the Standard-Model description of CP violation, where the key element is the Cabibbo--Kobayashi--Maskawa matrix and the corresponding unitarity triangles. Since the B-meson system will govern the stage of (quark) flavour physics and CP violation in this decade, it will be -- after a brief look at the kaon system -- our main focus. We shall classify B-meson decays, introduce the theoretical tools to deal with them, explore the requirements for non-vanishing CP-violating asymmetries, and discuss B^0_q--B^0_q_bar mixing (q={d,s}). We will then turn to B-factory benchmark modes, discuss the physics potential of B^0_s mesons, which is particularly promising for B-decay experiments at hadron colliders, and emphasize the importance of studies of rare decays, which are absent at the tree level in the Standard Model, complement nicely the studies of CP violation, and provide interesting probes for new physics.

  8. CP violation in neutral B decays to non-CP-eigenstates

    International Nuclear Information System (INIS)

    Kayser, B.

    1992-01-01

    If CP violation comes from complex phases in the quark mixing matrix, then neutral B decays to CP eigenstates will exhibit large, cleanly-predicted CP-violating effects. The authors show that the same is true of neutral B decays to several types of ''near-CP-eigenstates.'' By experimentally studying the latter decays as well as those to the CP eigenstates, one will be able to obtain more definitive information on CP violation from a given number of B mesons

  9. Measurement of CP Asymmetry in B0 --> K+K-K0S Decays

    International Nuclear Information System (INIS)

    Dujmic, D

    2004-01-01

    The authors present preliminary measurements of the CP asymmetry parameters and CP content in B 0 --> K + K - K s 0 decays, with φK s 0 events excluded. In a sample of 227 M B(bar B) pairs collected by the BABAR detector at the PEP-II B Factory at SLAC, they find the CP parameters to be S = -0.42 ± 0.17 ± 0.04 and C = 0.10 ± 0.14 ± 0.06, where the first error is statistical and the second systematic. Extracting the fraction of CP-even final states from angular moments f even = 0.89 ± 0.08 ± 0.06, and setting C = 0, they determine sin 2β = 0.55 ± 0.22 ± 0.04 ± 0.11, where the last error is due to uncertainty on the CP content

  10. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  11. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  12. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  13. submitter Time-dependent CP violation in charm mesons

    CERN Document Server

    Inguglia, Gianluca

    CP violation is a well established phenomenon for B and K mesons, but for D0 mesons, bound states made up of a quark-antiquark pair containing a charm quark, a conclusive answer to the question whether there is CP vio- lation or not, has yet to be determined. I show here the phenomenology of time-dependent CP asymmetries in charm decays, and discuss the implica- tions of experimental tests aimed at the measurement of CP violation in the interference between mixing and decays of charm mesons, in particular when studying the decay channels D0 ! h+h (h = K; ). The decay channels considered can also be used to constrain quantities that are poorly measured or still to be investigated, such as MIX and c;eff , provided that the e ects of penguin pollution are ignored. I considered correlated production of D0 mesons at the SuperB experiment and its planned asymmetric run at the charm threshold and performed a study of simulated events, nding that a boost factor = 0:28 would not be su cient to produce competitive re- ...

  14. Observation of CP violation in the B(0) meson system.

    Science.gov (United States)

    Aubert, B; Boutigny, D; Gaillard, J M; Hicheur, A; Karyotakis, Y; Lees, J P; Robbe, P; Tisserand, V; Palano, A; Chen, G P; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Reinertsen, P L; Stugu, B; Abbott, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Clark, A R; Gill, M S; Gritsan, A V; Groysman, Y; Jacobsen, R G; Kadel, R W; Kadyk, J; Kerth, L T; Kluth, S; Kolomensky, Y G; Kral, J F; LeClerc, C; Levi, M E; Liu, T; Lynch, G; Meyer, A B; Momayezi, M; Oddone, P J; Perazzo, A; Pripstein, M; Roe, N A; Romosan, A; Ronan, M T; Shelkov, V G; Telnov, A V; Wenzel, W A; Zisman, M S; Bright-Thomas, P G; Harrison, T J; Hawkes, C M; Knowles, D J; O'Neale, S W; Penny, R C; Watson, A T; Watson, N K; Deppermann, T; Goetzen, K; Koch, H; Krug, J; Kunze, M; Lewandowski, B; Peters, K; Schmuecker, H; Steinke, M; Andress, J C; Barlow, N R; Bhimji, W; Chevalier, N; Clark, P J; Cottingham, W N; De Groot, N; Dyce, N; Foster, B; McFall, J D; Wallom, D; Wilson, F F; Abe, K; Hearty, C; Mattison, T S; McKenna, J A; Thiessen, D; Jolly, S; McKemey, A K; Tinslay, J; Blinov, V E; Bukin, A D; Bukin, D A; Buzykaev, A R; Golubev, V B; Ivanchenko, V N; Korol, A A; Kravchenko, E A; Onuchin, A P; Salnikov, A A; Serednyakov, S I; Skovpen, Y I; Telnov, V I; Yushkov, A N; Best, D; Lankford, A J; Mandelkern, M; McMahon, S; Stoker, D P; Ahsan, A; Arisaka, K; Buchanan, C; Chun, S; Branson, J G; MacFarlane, D B; Prell, S; Rahatlou, S; Raven, G; Sharma, V; Campagnari, C; Dahmes, B; Hart, P A; Kuznetsova, N; Levy, S L; Long, O; Lu, A; Richman, J D; Verkerke, W; Witherell, M; Yellin, S; Beringer, J; Dorfan, D E; Eisner, A M; Frey, A; Grillo, A A; Grothe, M; Heusch, C A; Johnson, R P; Kroeger, W; Lockman, W S; Pulliam, T; Sadrozinski, H; Schalk, T; Schmitz, R E; Schumm, B A; Seiden, A; Turri, M; Walkowiak, W; Williams, D C; Wilson, M G; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Hitlin, D G; Metzler, S; Oyang, J; Porter, F C; Ryd, A; Samuel, A; Weaver, M; Yang, S; Zhu, R Y; Devmal, S; Geld, T L; Jayatilleke, S; Mancinelli, G; Meadows, B T; Sokoloff, M D; Barillari, T; Bloom, P; Dima, M O; Fahey, S; Ford, W T; Johnson, D R; Nauenberg, U; Olivas, A; Park, H; Rankin, P; Roy, J; Sen, S; Smith, J G; van Hoek, W C; Wagner, D L; Blouw, J; Harton, J L; Krishnamurthy, M; Soffer, A; Toki, W H; Wilson, R J; Zhang, J; Brandt, T; Brose, J; Colberg, T; Dahlinger, G; Dickopp, M; Dubitzky, R S; Hauke, A; Maly, E; Müller-Pfefferkorn, R; Otto, S; Schubert, K R; Schwierz, R; Spaan, B; Wilden, L; Behr, L; Bernard, D; Bonneaud, G R; Brochard, F; Cohen-Tanugi, J; Ferrag, S; Roussot, E; T'Jampens, S; Thiebaux, C; Vasileiadis, G; Verderi, M; Anjomshoaa, A; Bernet, R; Khan, A; Lavin, D; Muheim, F; Playfer, S; Swain, J E; Falbo, M; Borean, C; Bozzi, C; Dittongo, S; Folegani, M; Piemontese, L; Treadwell, E; Anulli, F; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Falciai, D; Finocchiaro, G; Patteri, P; Peruzzi, I M; Piccolo, M; Xie, Y; Zallo, A; Bagnasco, S; Buzzo, A; Contri, R; Crosetti, G; Fabbricatore, P; Farinon, S; Lo Vetere, M; Macri, M; Monge, M R; Musenich, R; Pallavicini, M; Parodi, R; Passaggio, S; Pastore, F C; Patrignani, C; Pia, M G; Priano, C; Robutti, E; Santroni, A; Morii, M; Bartoldus, R; Dignan, T; Hamilton, R; Mallik, U; Cochran, J; Crawley, H B; Fischer, P A; Lamsa, J; Meyer, W T; Rosenberg, E I; Benkebil, M; Grosdidier, G; Hast, C; Höcker, A; Lacker, H M; Laplace, S; Lepeltier, V; Lutz, A M; Plaszczynski, S; Schune, M H; Trincaz-Duvoid, S; Valassi, A; Wormser, G; Bionta, R M; Brigljević, V; Lange, D J; Mugge, M; Shi, X; van Bibber, K; Wenaus, T J; Wright, D M; Wuest, C R; Carroll, M; Fry, J R; Gabathuler, E; Gamet, R; George, M; Kay, M; Payne, D J; Sloane, R J; Touramanis, C; Aspinwall, M L; Bowerman, D A; Dauncey, P D; Egede, U; Eschrich, I; Gunawardane, N J; Nash, J A; Sanders, P; Smith, D; Azzopardi, D E; Back, J J; Dixon, P; Harrison, P F; Potter, R J; Shorthouse, H W; Strother, P; Vidal, P B; Williams, M I; Cowan, G; George, S; Green, M G; Kurup, A; Marker, C E; McGrath, P; McMahon, T R; Ricciardi, S; Salvatore, F; Scott, I; Vaitsas, G; Brown, D; Davis, C L; Allison, J; Barlow, R J; Boyd, J T; Forti, A C; Fullwood, J; Jackson, F; Lafferty, G D; Savvas, N; Simopoulos, E T; Weatherall, J H; Farbin, A; Jawahery, A; Lillard, V; Olsen, J; Roberts, D A; Schieck, J R; Blaylock, G; Dallapiccola, C; Flood, K T; Hertzbach, S S; Kofler, R; Moore, T B; Staengle, H; Willocq, S; Brau, B; Cowan, R; Sciolla, G; Taylor, F; Yamamoto, R K; Milek, M; Patel, P M; Trischuk, J; Lanni, F; Palombo, F; Bauer, J M; Booke, M; Cremaldi, L; Eschenburg, V; Kroeger, R; Reidy, J; Sanders, D A; Summers, D J; Martin, J P; Nief, J Y; Seitz, R; Taras, P; Zacek, V; Nicholson, H; Sutton, C S; Cartaro, C; Cavallo, N; De Nardo, G; Fabozzi, F; Gatto, C; Lista, L; Paolucci, P; Piccolo, D; Sciacca, C; LoSecco, J M; Alsmiller, J R; Gabriel, T A; Handler, T; Brau, J; Frey, R; Iwasaki, M; Sinev, N B; Strom, D; Colecchia, F; Dal Corso, F; Dorigo, A; Galeazzi, F; Margoni, M; Michelon, G; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Torassa, E; Voci, C; Benayoun, M; Briand, H; Chauveau, J; David, P; de La Vaissière, C; Del Buono, L; Hamon, O; Le Diberder, F; Leruste, P; Lory, J; Roos, L; Stark, J; Versillé, S; Manfredi, P F; Re, V; Speziali, V; Frank, E D; Gladney, L; Guo, Q H; Panetta, J H; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Carpinelli, M; Forti, F; Giorgi, M A; Lusiani, A; Martinez-Vidal, F; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Sandrelli, F; Simi, G; Triggiani, G; Walsh, J; Haire, M; Judd, D; Paick, K; Turnbull, L; Wagoner, D E; Albert, J; Bula, C; Elmer, P; Lu, C; McDonald, K T; Miftakov, V; Schaffner, S F; Smith, A J; Tumanov, A; Varnes, E W; Cavoto, G; del Re, D; Faccini, R; Ferrarotto, F; Ferroni, F; Fratini, K; Lamanna, E; Leonardi, E; Mazzoni, M A; Morganti, S; Piredda, G; Safai Tehrani, F; Serra, M; Voena, C; Christ, S; Waldi, R; Adye, T; Franek, B; Geddes, N I; Gopal, G P; Xella, S M; Aleksan, R; De Domenico, G; Emery, S; Gaidot, A; Ganzhur, S F; Giraud, P F; Hamel De Monchenault, G; Kozanecki, W; Langer, M; London, G W; Mayer, B; Serfass, B; Vasseur, G; Yèche, C; Zito, M; Copty, N; Purohit, M V; Singh, H; Yumiceva, F X; Adam, I; Anthony, P L; Aston, D; Baird, K; Berger, J P; Bloom, E; Boyarski, A M; Bulos, F; Calderini, G; Claus, R; Convery, M R; Coupal, D P; Coward, D H; Dorfan, J; Dorser, M; Dunwoodie, W; Field, R C; Glanzman, T; Godfrey, G L; Gowdy, S J; Grosso, P; Himel, T; Hryn'ova, T; Huffer, M E; Innes, W R; Jessop, C P; Kelsey, M H; Kim, P; Kocian, M L; Langennegger, U; Leith, D W; Luitz, S; Luth, V; Lynch, H L; Marsiske, H; Menke, S; Messner, R; Moffeit, K C; Mount, R; Muller, D R; O'Grady, C P; Perl, M; Petrak, S; Quinn, H; Ratcliff, B N; Robertson, S H; Rochester, L S; Roodman, A; Schietinger, T; Schindler, R H; Schwiening, J; Seeman, J T; Serbo, V V; Snyder, S R; Soha, A; Spanier, S M; Stelzer, J; Su, D; Sullivan, M K; Tanaka, H A; Va'vra, J; Wagner, S R; Weinstein, A J; Wienands, U; Wisniewski, W J; Wright, D H; Young, C C; Burchat, P R; Cheng, C H; Kirkby, D; Meyer, T I; Roat, C; Henderson, R; Bugg, W; Cohn, H; Weidemann, A W; Izen, J M; Kitayama, I; Lou, X C; Turcotte, M; Bianchi, F; Bona, M; DiGirolamo, B; Gamba, D; Smol, A; Zanin, D; Bosisio, L; Della Ricci, G; Lanceri, L; Pompili, A; Poropat, P; Vuagnin, G; Panvini, R S; Brown, C M; De Silva, A; Kowalewski, R; Roney, J M; Band, H R; Charles, E; Dasu, S; Di Lodovico, F; Eichenbaum, A M; Hu, H; Johnson, J R; Liu, R; Nielsen, J; Pan, Y; Prepost, R; Scott, I J; Sekula, S J; von Wimmersperg-Toeller, J H; Wu, S L; Zobernig, H; Kordich, T M; Neal, H

    2001-08-27

    We present an updated measurement of time-dependent CP-violating asymmetries in neutral B decays with the BABAR detector at the PEP-II asymmetric B Factory at SLAC. This result uses an additional sample of Upsilon(4S) decays collected in 2001, bringing the data available to 32 x 10(6) BB macro pairs. We select events in which one neutral B meson is fully reconstructed in a final state containing charmonium and the flavor of the other neutral B meson is determined from its decay products. The amplitude of the CP-violating asymmetry, which in the standard model is proportional to sin2 beta, is derived from the decay time distributions in such events. The result sin2 beta = 0.59+/-0.14(stat)+/-0.05(syst) establishes CP violation in the B(0) meson system. We also determine absolute value of lambda = 0.93+/-0.09(stat)+/-0.03(syst), consistent with no direct CP violation.

  15. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  16. Flavour physics and CP violation

    CERN Document Server

    Nir, Y.

    2015-05-22

    We explain the many reasons for the interest in flavor physics. We describe flavor physics and the related CP violation within the Standard Model, and explain how the B-factories proved that the Kobayashi-Maskawa mechanism dominates the CP violation that is observed in meson decays. We explain the implications of flavor physics for new physics, with emphasis on the “new physics flavor puzzle”, and present the idea of minimal flavor violation as a possible solution. We explain why the values flavor parameters of the Standard Model are puzzling, present the Froggatt-Nielsen mechanism as a possible solution, and describe how measurements of neutrino parameters are interpreted in the context of this puzzle. We show that the recently discovered Higgs-like boson may provide new opportunities for making progress on the various flavor puzzles.

  17. Constraints on the CP-Violating MSSM

    CERN Document Server

    Arbey, A; Godbole, R M; Mahmoudi, F

    2016-01-01

    We discuss the prospects for observing CP violation in the MSSM with six CP-violating phases, using a geometric approach to maximise CP-violating observables subject to the experimental upper bounds on electric dipole moments. We consider constraints from Higgs physics, flavour physics, the dark matter relic density and spin-independent scattering cross section with matter.

  18. CP violation without elementary scalar fields

    International Nuclear Information System (INIS)

    Eichten, E.; Lane, K.; Preskill, J.

    1980-04-01

    Dynamically broken gauge theories of electroweak interactions provide a natural mechanism for generating CP violation. Even if all vacuum angles are unobservable, strong CP violation is not automatically avoided. In the absence of strong CP violation, the neutron electric dipole moment is expected to be of order 10 -24 e cm

  19. CP-violations in B decays

    Indian Academy of Sciences (India)

    Recent results on CP-violation measurements in decays from energy asymmetric -factory experiments are reported. Thanks to large accumulated data samples, CP-violations in decays in mixing-decay interference and direct CP-violation are now firmly established. The measurements of three angles of the unitarity ...

  20. New look at CP violation

    International Nuclear Information System (INIS)

    Iqbal, M.J.; Miller, G.A.

    1990-01-01

    The CP-violating (CPV) kaonic matrix elements ε', ImA 0 , and ImA 2 are used to compute CPV observables in baryonic systems. The numerical results for the electric dipole moment and the difference between Λ and bar Λ decay parameters are similar to other approaches that use quark operators. Relations between the neutron electric dipole moment, CPV pion-nucleon coupling constants, and Λ-decay parameters are derived

  1. Cytosine methylation at CpCpG sites triggers accumulation of non-CpG methylation in gene bodies

    OpenAIRE

    Zabet, NR; Catoni, Marco; Prischi, F; Paszkowski, Jerzy Waclaw

    2017-01-01

    Methylation of cytosine is an epigenetic mark involved in the regulation of transcription, usually associated with transcriptional repression. In mammals, methylated cytosines are found predominantly in CpGs but in plants non-CpG methylation (in the CpHpG or CpHpH contexts, where H is A, C or T) is also present and is associated with the transcriptional silencing of transposable elements. In addition, CpG methylation is found in coding regions of active genes. In the absence of the demethylas...

  2. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  3. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  4. Elevated β-catenin activity contributes to carboplatin resistance in A2780cp ovarian cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Barghout, Samir H. [Department of Obstetrics and Gynecology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB (Canada); Zepeda, Nubia; Xu, Zhihua [Department of Oncology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB (Canada); Steed, Helen [Department of Obstetrics and Gynecology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB (Canada); Lee, Cheng-Han [Department of Laboratory Medicine and Pathology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB (Canada); Fu, YangXin, E-mail: yangxin@ualberta.ca [Department of Oncology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB (Canada); Department of Obstetrics and Gynecology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB (Canada)

    2015-12-04

    Ovarian cancer is the fifth leading cause of cancer-related mortalities in women. Epithelial ovarian cancer (EOC) represents approximately 90% of all ovarian malignancies. Most EOC patients are diagnosed at advanced stages and current chemotherapy regimens are ineffective against advanced EOC due to the development of chemoresistance. It is important to better understand the molecular mechanisms underlying acquired resistance to effectively manage this disease. In this study, we examined the expression of the Wnt/β-catenin signaling components in the paired cisplatin-sensitive (A2780s) and cisplatin-resistant (A2780cp) EOC cell lines. Our results showed that several negative regulators of Wnt signaling are downregulated, whereas a few Wnt ligands and known Wnt/β-catenin target genes are upregulated in A2780cp cells compared to A2780s cells, suggesting that Wnt/β-catenin signaling is more active in A2780cp cells. Further analysis revealed nuclear localization of β-catenin and higher β-catenin transcriptional activity in A2780cp cells compared to A2780s cells. Finally, we demonstrated that chemical inhibition of β-catenin transcriptional activity by its inhibitor CCT036477 sensitized A2780cp cells to carboplatin, supporting a role for β-catenin in carboplatin resistance in A2780cp cells. In conclusion, our data suggest that increased Wnt/β-catenin signaling activity contributes to carboplatin resistance in A2780cp cells. - Highlights: • Wnt ligands and target genes are upregulated in cisplatin resistant A2780cp cells. • Negative regulators of Wnt signaling are down-regulated in A2780cp cells. • β-catenin transcriptional activity is higher in A2780cp cells compared to A2780s cells. • Inhibition of β-catenin activity increases carboplatin cytotoxicity in A2780cp cells.

  5. Elevated β-catenin activity contributes to carboplatin resistance in A2780cp ovarian cancer cells

    International Nuclear Information System (INIS)

    Barghout, Samir H.; Zepeda, Nubia; Xu, Zhihua; Steed, Helen; Lee, Cheng-Han; Fu, YangXin

    2015-01-01

    Ovarian cancer is the fifth leading cause of cancer-related mortalities in women. Epithelial ovarian cancer (EOC) represents approximately 90% of all ovarian malignancies. Most EOC patients are diagnosed at advanced stages and current chemotherapy regimens are ineffective against advanced EOC due to the development of chemoresistance. It is important to better understand the molecular mechanisms underlying acquired resistance to effectively manage this disease. In this study, we examined the expression of the Wnt/β-catenin signaling components in the paired cisplatin-sensitive (A2780s) and cisplatin-resistant (A2780cp) EOC cell lines. Our results showed that several negative regulators of Wnt signaling are downregulated, whereas a few Wnt ligands and known Wnt/β-catenin target genes are upregulated in A2780cp cells compared to A2780s cells, suggesting that Wnt/β-catenin signaling is more active in A2780cp cells. Further analysis revealed nuclear localization of β-catenin and higher β-catenin transcriptional activity in A2780cp cells compared to A2780s cells. Finally, we demonstrated that chemical inhibition of β-catenin transcriptional activity by its inhibitor CCT036477 sensitized A2780cp cells to carboplatin, supporting a role for β-catenin in carboplatin resistance in A2780cp cells. In conclusion, our data suggest that increased Wnt/β-catenin signaling activity contributes to carboplatin resistance in A2780cp cells. - Highlights: • Wnt ligands and target genes are upregulated in cisplatin resistant A2780cp cells. • Negative regulators of Wnt signaling are down-regulated in A2780cp cells. • β-catenin transcriptional activity is higher in A2780cp cells compared to A2780s cells. • Inhibition of β-catenin activity increases carboplatin cytotoxicity in A2780cp cells.

  6. Quark mixing and CP violation

    International Nuclear Information System (INIS)

    Paschos, E.A.

    1992-01-01

    These lectures present a pedagogical introduction to the topics quark mixing and CP violation. They explain how the mixing matrix comes about and reviews the values of constraints for its elements. The second chapter reviews the CP transformation properties of amplitudes and defines the quantities which are measured in the experiments. Then it reviews the theory of CP violation in the standard model. In addition to the phase and the angles introduced through the flavor matrix, numerical predictions also depend (a) on hadronic matrix elements of weak current operators and (b) the short distance expansion of effective Hamiltonians computed by methods of Quantum Chromodynamics (QCD). I also review these topics and present predictions for (ε'/ε) which are shown to be consistent with the experiments. Last but not least, the article is divided into sections which are as self-contained as possible. The article assumes a general knowledge of the electroweak theory. For guidance, the interested reader will find a table of contents at the end of the text. (author). 29 refs, 5 figs, 1 tab

  7. CP violation experiment at Fermilab

    International Nuclear Information System (INIS)

    Hsiung, Yee B.

    1990-07-01

    The E731 experiment at Fermilab has searched for ''direct'' CP violation in K 0 → ππ, which is parametrized by var-epsilon '/var-epsilon. For the first time, in 20% of the data set, all four modes of the K L,S → π + π - (π 0 π 0 ) were collected simultaneously, providing a great check on the systematic uncertainty. The result is Re(var-epsilon '/var-epsilon) = -0.0004 ± 0.0014 (stat) ± 0.0006(syst), which provides no evidence for ''direct'' CP violation. The CPT symmetry has also been tested by measuring the phase difference Δφ = φ 00 - φ ± between the two CP violating parameters η 00 and η ± . We fine Δφ = -0.3 degrees ± 2.4 degree(stat) ± 1.2 degree(syst). Using this together with the world average φ ± , we fine that the phase of the K 0 -bar K 0 mixing parameter var-epsilon is 44.5 degree ± 1.5 degree. Both of these results agree well with the predictions of CPT symmetry. 17 refs., 10 figs

  8. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    Science.gov (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  9. Some ideas for learning CP-theories

    OpenAIRE

    Fierens, Daan

    2008-01-01

    Causal Probabilistic logic (CP-logic) is a language for describing complex probabilistic processes. In this talk we consider the problem of learning CP-theories from data. We briefly discuss three possible approaches. First, we review the existing algorithm by Meert et al. Second, we show how simple CP-theories can be learned by using the learning algorithm for Logical Bayesian Networks and converting the result into a CP-theory. Third, we argue that for learning more complex CP-theories, an ...

  10. B decays and models for CP violation

    International Nuclear Information System (INIS)

    He, X.

    1996-01-01

    The decay modes B to ππ, ψK S , K - D, πK, and ηK are promising channels to study the unitarity triangle of the CP-violating Cabibbo-Kobayashi-Maskawa (CKM) matrix. In this paper I study the consequences of these measurements in the Weinberg model. I show that using the same set of measurements, the following different mechanisms for CP violation can be distinguished: (1) CP is violated in the CKM sector only; (2) CP is violated spontaneously in the Higgs sector only; and (3) CP is violated in both the CKM and Higgs sectors. copyright 1996 The American Physical Society

  11. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  12. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  13. V2 and cP/CP

    DEFF Research Database (Denmark)

    Vikner, Sten; Christensen, Ken Ramshøj; Nyvad, Anne Mette

    2017-01-01

    As in Nyvad et al. (2017), we will explore a particular derivation of (embedded) V2, in terms of a cP/CP-distinction, which may be seen as a version of the CP-recursion analysis (de Haan & Weerman 1986; Vikner 1995 and many others). e idea is that because embedded V2 clauses do not allow extraction......, whereas other types of CP-recursion clauses do (Christensen et al. 2013a; 2013b; Christensen & Nyvad 2014), CP-recursion in embedded V2 is assumed to be fundamentally di erent from other kinds of CP-recursion, in that main clause V2 and embedded V2 involve a CP (“big CP”), whereas other clausal...... projections above IP are instances of cP (“little cP”)....

  14. CP invariance: a point of view

    International Nuclear Information System (INIS)

    Mohan, Gyan

    1983-01-01

    That the longlived component L of K 0 has both CP = +1 and CP = -1 modes of decay is often cited as evidence of violation of CP invariance. The careful ones find the compelling evidence to be the non-dilution of the regeneration interference pattern when the incident K 0 beam is mixed even substantially with anti-K 0 . However the two phenomena comprehensively imply that L has a CP = +1 component Lsub(+) and CP = -1 component Lsub(-) and that the longlived component of both K 0 and anti-K 0 are one and the same L. This does not demand abandoning CP invariance. It does imply that anti-K 0 is not the CP conjugate of K 0 . (author)

  15. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  16. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  17. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  18. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  19. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  20. Flavor Physics & CP Violation 2015

    Science.gov (United States)

    "Flavor Physics & CP violation 2015" (FPCP 2015) was held in Nagoya, Japan, at Nagoya University, from May 25 to May 29 2015. This is the 13th meeting of the series of annual conferences started in Philadelphia, PA, USA in 2002. The aim of the conference is to review developments in flavor physics and CP violation, in both theory and experiment, exploiting the potential to study new physics at the LHC and future facilities. The topics include CP violation, rare decays, CKM elements with heavy quark decays, flavor phenomena in charged leptons and neutrinos, and also interplay between flavor and LHC high Pt physics. The FPCP2015 conference had more than 140 participants, including researchers from abroad and many young researchers (postdocs and students). The conference consisted of plenary talks and poster presentations. The plenary talks include 2 overview talks, 48 review talks, and 2 talks for outlook in theories and experiments, given by world leading researchers. There was also a special lecture by Prof. Makoto Kobayashi, one of the Nobel laureates in 2008. The poster session had 41 contributions. Many young researchers presented their works. These proceedings contain written documents for these plenary and poster presentations. The full scientific program and presentation materials can be found at http://fpcp2015.hepl.phys.nagoya-u.ac.jp/. We would like to thank the International Advisory Committee for their invaluable assistance in coordinating the scientific program and in helping to identifying many speakers. Thanks are also due to the Local Organizing Committee for tireless efforts for smooth running of the conference and very enjoyable social activities. We also thank the financial supports provided by Japanese Scociety for the Promotion of Science (JSPS) unfer the Grant-in-Aid for Scientific Research (S) "Probing New Physics with Tau-Lepton" (No. 26220706), by Nagoya University under the Program for Promoting the Enhancement of Research Universities, and

  1. First CP violation results from BABAR

    International Nuclear Information System (INIS)

    Hitlin, D.G.

    2001-01-01

    We present a preliminary measurement of time-dependent Cp-violating asymmetries in B 0 → J/ψK 0 S and B 0 → ψ(2S)K 0 S decays recorded by the BABAR. detector at the PEP-2 asymmetric B Factory at SLAC. The data sample consists of 9.0 fb -1 collected at the γ(4S) resonance and 0.8 fb -1 off-resonance. One of the neutral B mesons, produced in pairs at the γ(4S), is fully reconstructed. The flavor of the other neutral B meson is tagged at the time of its decay, mainly with the charge of identified leptons and kaons. The time difference between the decays is determined by measuring the distance between the decay vertices. Wrong-tag probabilities and the time resolution function are measured with samples of fully-reconstructed semileptonic and hadronic neutral B final states. The value of the asymmetry amplitude, sin 2β, is determined from a maximum likelihood fit to the time distribution of 120 tagged B 0 → J/ψK 0 S and B 0 → ψ(2S)K 0 S candidates: sin 2β=0.12±O.37(stat)±0.09(syst). (author)

  2. Experience on CP1 turbines

    International Nuclear Information System (INIS)

    Moinaud, C.

    1984-01-01

    Analysis of the experience acquired on the behaviour of the turbine itself, excluding alternators, superheaters... of the nuclear power plants of the French program contract CP1 (Fessenhein prototype): method of anomaly process (assumption, scenarios, calculations and hierarchy of the assumptions), study of the accidents on the shutdown valves and control valves (HP admission devices), on the LP admission devices, on the HP module (leakage at the parting line, bolt and screw accidents), on the LP module (diaphragm, diapragm support erosion, rotor anomaly, blade anomaly with rupture of the wire bracing), behaviour of the shafting and of the pillars (radial and axial floating) and at last global behaviour of the group [fr

  3. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  4. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

    Science.gov (United States)

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

  5. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  6. Search for nonstandard model CP or T violation at the τ-charm factory

    International Nuclear Information System (INIS)

    Huang, T.; Lu, W.; Tao, Z.

    1997-01-01

    We systematically investigate the possibility of finding CP or T violation in the τ sector at the τ-charm factory. CP or T violation may occur in the τ pair production process, expressed as an electric dipole moment, and in τ decay processes. By assuming that an electric dipole moment as large as 10 -19 ecm and CP or T violation effects originating from τ decay as large as 10 -3 are observable at the τ-charm factory, we study all the possible extensions of the SM which are relevant for generating CP or T violation in the τ sector. And we point out, there are a few kinds of models which are hopeful candidates for generating such CP or T violation. For these models we consider all the theoretical and current experimental constraints and find that there exists some parameter space which will result in a measurable CP or T violation. Therefore we conclude that the τ-charm factory is a hopeful place to discover CP or T violation in the τ sector. copyright 1997 The American Physical Society

  7. B decays and models for CP violation

    International Nuclear Information System (INIS)

    He, Xiao Gang

    1995-12-01

    The decay modes B to π π,υK S , K - D, πK and ηK are promising channels to study the unitarity triangle of the CP violating Cabibbo-Kobayashi-Maskawa (CKM) matrix. The consequences of these measurements in the Weinberg model are discussed. It is shown that measurements of CP violation in B decay can be used to distinguish Standard Model from Weinberg model and that the following different mechanisms for CP violation can be distinguished: 1) CP is violated in the CKM sector only; 2) CP is violated spontaneously in the Higgs sector only; and 3) CP is violated in both the CKM and Higgs sectors. 27 refs., 4 figs

  8. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  9. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  10. Exploring CP Violation in the MSSM

    CERN Document Server

    Arbey, A.; Godbole, R.M.; Mahmoudi, F.

    2015-01-01

    We explore the prospects for observing CP violation in the minimal supersymmetric extension of the Standard Model (MSSM) with six CP-violating parameters, three gaugino mass phases and three phases in trilinear soft supersymmetry-breaking parameters, using the CPsuperH code combined with a geometric approach to maximize CP-violating observables subject to the experimental upper bounds on electric dipole moments. We also implement CP-conserving constraints from Higgs physics, flavour physics and the upper limits on the cosmological dark matter density and spin-independent scattering. We study possible values of observables within the constrained MSSM (CMSSM), the non-universal Higgs model (NUHM), the CPX scenario and a variant of the phenomenological MSSM (pMSSM). We find values of the CP-violating asymmetry A_CP in b -> s gamma decay that may be as large as 3%, so future measurements of A_CP may provide independent information about CP violation in the MSSM. We find that CP-violating MSSM contributions to the...

  11. Superweak-like models of CP violation

    International Nuclear Information System (INIS)

    Lavoura, L.

    1992-01-01

    I put forward a two-Higgs-doublet model in which CP violation is mediated only by the neutral Higgs bosons, via the mechanism of scalar-pseudoscalar mixing. In this model there is no CP violation in the exchange of either W bosons or of charged Higgs bosons. The model is therefore an approximate realization of the superweak theory of CP violation. It has only two basic CP-violating quantities. I point out that other models of this kind, but with more than two Higgs doublets, may also be built

  12. Measurement of the ratio B(B-→D0K-)/B(B-→D0π-) and of the CP asymmetry of B-→DCP+0K- decays

    International Nuclear Information System (INIS)

    Aubert, B.; Barate, R.; Boutigny, D.; Couderc, F.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Tisserand, V.; Zghiche, A.; Grauges-Pous, E.; Palano, A.; Pompili, A.; Chen, J.C.; Qi, N.D.; Rong, G.; Wang, P.; Zhu, Y.S.; Eigen, G.; Ofte, I.; Stugu, B.

    2005-01-01

    We study the decays B - →D 0 π - and B - →D 0 K - , where the D 0 decays into D 0 π 0 , with the D 0 reconstructed in the CP-even (CP+) eigenstates K - K + and π - π + and in the (non-CP) channels K - π + , K - π + π + π - , and K - π + π 0 . Using a sample of about 123x10 6 BB pairs, we measure the ratios of decay rates R non-CP ≡ (B(B - →D non-CP 0 K - )/B(B - →D non-CP 0 π - ))=0.0813±0.0040(stat) -0.0031 +0.0042 (syst), and provide the first measurements of R CP+ ≡ (B(B - →D CP+ 0 K - )/B(B - →D CP+ 0 π - ))=0.086±0.021(stat)±0.007(syst), and of the CP asymmetry A CP+ ≡ (B(B - →D CP+ 0 K - )-B(B + →D CP+ 0 K + )/B(B - →D CP+ 0 K - )+B(B + →D CP+ 0 K + ))=-0.10±0.23 (stat) -0.04 +0.03 (syst).

  13. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  14. Measurement of Ratios of Branching Fractions and CP-Violating Asymmetries of B+/- --> D*K +/- decays

    International Nuclear Information System (INIS)

    Aubert, B.; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; Garra Tico, J.; Grauges, E.; Lopez, L.; Palano, A.; Pappagallo, M.; Eigen, G.; Stugu, B.; Sun, L.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, R.N.; Jacobsen, R.G.

    2008-01-01

    The authors report a study of B ± → D*K ± decays with D* decaying to Dπ 0 or Dγ, using 383 x 10 6 B(bar B) pairs collected at the Υ(4S) resonance with the BABAR detector at the SLAC PEP-II B-Factory. The D meson decays under study include a non-CP mode (K ± π # -+#), CP-even modes (K ± K # -+#, π ± π # -+#) and CP-odd modes (K S 0 π 0 , K S 0 φ, K S 0 ω). They measure ratios (R* CP± ) of branching fractions of decays to CP eigenmode states and to flavor-specific states as well as CP asymmetries A* CP± = -0.11 ± 0.09 ± 0.01, R* CP+ = 1.31 ± 0.13 ± 0.04, and A* CP- = 0.06 ± 0.10 ± 0.02, R* CP- = 1.10 ± 0.12 ± 0.04, where the first error is statistical and the second error is systematic. Translating the results into an alternative parameterization, widely used for related measurements, they obtain x* + = 0.11 ± 0.06 ± 0.02 and x* - = 0.00 ± 0.06 ± 0.01. No significant CP-violating charge asymmetry is found in either the flavor-specific mode D → K ± π # -+# or in B ± → D*π ± decays

  15. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  16. LHCb : Measuring $CP$ violation with $\\Delta A_{CP}$ at LHCb

    CERN Multimedia

    Pearce, A

    2014-01-01

    Measurements are presented of direct $CP$ violation in $D^{0}$ meson decays in LHCb, using the $\\Delta A_{CP}$ technique, and a proposal is outlined to make similar measurements in the decays of the charmed baryon $\\Lambda_{c}^{+}$. The motivations for use of the $\\Delta A_{CP}$ method are discussed, along with the current results and future prospects.

  17. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  18. Registration of 'CP 09-2392' Sugarcane

    Science.gov (United States)

    CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...

  19. Spontaneous CP violation on the lattice

    CERN Document Server

    Laine, Mikko

    2000-01-01

    At finite temperatures around the electroweak phase transition, the thermodynamics of the MSSM can be described by a three-dimensional two Higgs doublet effective theory. This effective theory has a phase where CP is spontaneously violated. We study spontaneous CP violation with non-perturbative lattice simulations, and analyse whether one could end up in this phase for any physical MSSM parameter values.

  20. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  1. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  2. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  3. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  4. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  5. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  6. First Observation of CP Violation in B[over ¯]^{0}→D_{CP}^{(*)}h^{0} Decays by a Combined Time-Dependent Analysis of BABAR and Belle Data.

    Science.gov (United States)

    Abdesselam, A; Adachi, I; Adametz, A; Adye, T; Ahmed, H; Aihara, H; Akar, S; Alam, M S; Albert, J; Al Said, S; Andreassen, R; Angelini, C; Anulli, F; Arinstein, K; Arnaud, N; Asner, D M; Aston, D; Aulchenko, V; Aushev, T; Ayad, R; Babu, V; Badhrees, I; Bahinipati, S; Bakich, A M; Band, H R; Banerjee, Sw; Barberio, E; Bard, D J; Barlow, R J; Batignani, G; Beaulieu, A; Bellis, M; Ben-Haim, E; Bernard, D; Bernlochner, F U; Bettarini, S; Bettoni, D; Bevan, A J; Bhardwaj, V; Bhuyan, B; Bianchi, F; Biasini, M; Biswal, J; Blinov, V E; Bloom, P C; Bobrov, A; Bomben, M; Bondar, A; Bonneaud, G R; Bonvicini, G; Bozek, A; Bozzi, C; Bračko, M; Briand, H; Browder, T E; Brown, D N; Brown, D N; Bünger, C; Burchat, P R; Buzykaev, A R; Calabrese, R; Calcaterra, A; Calderini, G; Carpinelli, M; Cartaro, C; Casarosa, G; Cenci, R; Červenkov, D; Chang, P; Chao, D S; Chauveau, J; Cheaib, R; Chekelian, V; Chen, A; Chen, C; Cheng, C H; Cheon, B G; Chilikin, K; Chistov, R; Cho, K; Chobanova, V; Choi, H H F; Choi, S-K; Chrzaszcz, M; Cibinetto, G; Cinabro, D; Cochran, J; Coleman, J P; Contri, R; Convery, M R; Cowan, G; Cowan, R; Cremaldi, L; Dalseno, J; Dasu, S; Davier, M; Davis, C L; De Mori, F; De Nardo, G; Denig, A G; Derkach, D; de Sangro, R; Dey, B; Di Lodovico, F; Dingfelder, J; Dittrich, S; Doležal, Z; Dorfan, J; Drásal, Z; Drutskoy, A; Druzhinin, V P; Dubois-Felsmann, G P; Dunwoodie, W; Dutta, D; Ebert, M; Echenard, B; Eidelman, S; Eigen, G; Eisner, A M; Emery, S; Ernst, J A; Faccini, R; Farhat, H; Fast, J E; Feindt, M; Ferber, T; Ferrarotto, F; Ferroni, F; Field, R C; Filippi, A; Finocchiaro, G; Fioravanti, E; Flood, K T; Ford, W T; Forti, F; Franco Sevilla, M; Fritsch, M; Fry, J R; Fulsom, B G; Gabathuler, E; Gabyshev, N; Gamba, D; Garmash, A; Gary, J W; Garzia, I; Gaspero, M; Gaur, V; Gaz, A; Gershon, T J; Getzkow, D; Gillard, R; Li Gioi, L; Giorgi, M A; Glattauer, R; Godang, R; Goh, Y M; Goldenzweig, P; Golob, B; Golubev, V B; Gorodeisky, R; Gradl, W; Graham, M T; Grauges, E; Griessinger, K; Gritsan, A V; Grosdidier, G; Grünberg, O; Guttman, N; Haba, J; Hafner, A; Hamilton, B; Hara, T; Harrison, P F; Hast, C; Hayasaka, K; Hayashii, H; Hearty, C; He, X H; Hess, M; Hitlin, D G; Hong, T M; Honscheid, K; Hou, W-S; Hsiung, Y B; Huard, Z; Hutchcroft, D E; Iijima, T; Inguglia, G; Innes, W R; Ishikawa, A; Itoh, R; Iwasaki, Y; Izen, J M; Jaegle, I; Jawahery, A; Jessop, C P; Joffe, D; Joo, K K; Julius, T; Kang, K H; Kass, R; Kawasaki, T; Kerth, L T; Khan, A; Kiesling, C; Kim, D Y; Kim, J B; Kim, J H; Kim, K T; Kim, P; Kim, S H; Kim, Y J; King, G J; Kinoshita, K; Ko, B R; Koch, H; Kodyš, P; Kolomensky, Yu G; Korpar, S; Kovalskyi, D; Kowalewski, R; Kravchenko, E A; Križan, P; Krokovny, P; Kuhr, T; Kumar, R; Kuzmin, A; Kwon, Y-J; Lacker, H M; Lafferty, G D; Lanceri, L; Lange, D J; Lankford, A J; Latham, T E; Leddig, T; Le Diberder, F; Lee, D H; Lee, I S; Lee, M J; Lees, J P; Leith, D W G S; Leruste, Ph; Lewczuk, M J; Lewis, P; Libby, J; Lockman, W S; Long, O; Lopes Pegna, D; LoSecco, J M; Lou, X C; Lueck, T; Luitz, S; Lukin, P; Luppi, E; Lusiani, A; Luth, V; Lutz, A M; Lynch, G; MacFarlane, D B; Malaescu, B; Mallik, U; Manoni, E; Marchiori, G; Margoni, M; Martellotti, S; Martinez-Vidal, F; Masuda, M; Mattison, T S; Matvienko, D; McKenna, J A; Meadows, B T; Miyabayashi, K; Miyashita, T S; Miyata, H; Mizuk, R; Mohanty, G B; Moll, A; Monge, M R; Moon, H K; Morandin, M; Muller, D R; Mussa, R; Nakano, E; Nakazawa, H; Nakao, M; Nanut, T; Nayak, M; Neal, H; Neri, N; Nisar, N K; Nishida, S; Nugent, I M; Oberhof, B; Ocariz, J; Ogawa, S; Okuno, S; Olaiya, E O; Olsen, J; Ongmongkolkul, P; Onorato, G; Onuchin, A P; Onuki, Y; Ostrowicz, W; Oyanguren, A; Pakhlova, G; Pakhlov, P; Palano, A; Pal, B; Palombo, F; Pan, Y; Panduro Vazquez, W; Paoloni, E; Park, C W; Park, H; Passaggio, S; Patel, P M; Patrignani, C; Patteri, P; Payne, D J; Pedlar, T K; Peimer, D R; Peruzzi, I M; Pesántez, L; Pestotnik, R; Petrič, M; Piccolo, M; Piemontese, L; Piilonen, L E; Pilloni, A; Piredda, G; Playfer, S; Poireau, V; Porter, F C; Posocco, M; Prasad, V; Prell, S; Prepost, R; Puccio, E M T; Pulliam, T; Purohit, M V; Pushpawela, B G; Rama, M; Randle-Conde, A; Ratcliff, B N; Raven, G; Ribežl, E; Richman, J D; Ritchie, J L; Rizzo, G; Roberts, D A; Robertson, S H; Röhrken, M; Roney, J M; Roodman, A; Rossi, A; Rostomyan, A; Rotondo, M; Roudeau, P; Sacco, R; Sakai, Y; Sandilya, S; Santelj, L; Santoro, V; Sanuki, T; Sato, Y; Savinov, V; Schindler, R H; Schneider, O; Schnell, G; Schroeder, T; Schubert, K R; Schumm, B A; Schwanda, C; Schwartz, A J; Schwitters, R F; Sciacca, C; Seiden, A; Sekula, S J; Senyo, K; Seon, O; Serednyakov, S I; Sevior, M E; Shapkin, M; Shebalin, V; Shen, C P; Shibata, T-A; Shiu, J-G; Simard, M; Simi, G; Simon, F; Simonetto, F; Skovpen, Yu I; Smith, A J S; Smith, J G; Snyder, A; So, R Y; Sobie, R J; Soffer, A; Sohn, Y-S; Sokoloff, M D; Sokolov, A; Solodov, E P; Solovieva, E; Spaan, B; Spanier, S M; Starič, M; Stocchi, A; Stroili, R; Stugu, B; Su, D; Sullivan, M K; Sumihama, M; Sumisawa, K; Sumiyoshi, T; Summers, D J; Sun, L; Tamponi, U; Taras, P; Tasneem, N; Teramoto, Y; Tisserand, V; Todyshev, K Yu; Toki, W H; Touramanis, C; Trabelsi, K; Tsuboyama, T; Uchida, M; Uglov, T; Unno, Y; Uno, S; Usov, Y; Uwer, U; Vahsen, S E; Van Hulse, C; Vanhoefer, P; Varner, G; Vasseur, G; Va'vra, J; Verderi, M; Vinokurova, A; Vitale, L; Vorobyev, V; Voß, C; Wagner, M N; Wagner, S R; Waldi, R; Walsh, J J; Wang, C H; Wang, M-Z; Wang, P; Watanabe, Y; West, C A; Williams, K M; Wilson, F F; Wilson, J R; Wisniewski, W J; Won, E; Wormser, G; Wright, D M; Wu, S L; Wulsin, H W; Yamamoto, H; Yamaoka, J; Yashchenko, S; Yuan, C Z; Yusa, Y; Zallo, A; Zhang, C C; Zhang, Z P; Zhilich, V; Zhulanov, V; Zupanc, A

    2015-09-18

    We report a measurement of the time-dependent CP asymmetry of B[over ¯]^{0}→D_{CP}^{(*)}h^{0} decays, where the light neutral hadron h^{0} is a π^{0}, η, or ω meson, and the neutral D meson is reconstructed in the CP eigenstates K^{+}K^{-}, K_{S}^{0}π^{0}, or K_{S}^{0}ω. The measurement is performed combining the final data samples collected at the ϒ(4S) resonance by the BABAR and Belle experiments at the asymmetric-energy B factories PEP-II at SLAC and KEKB at KEK, respectively. The data samples contain (471±3)×10^{6} BB[over ¯] pairs recorded by the BABAR detector and (772±11)×10^{6} BB[over ¯] pairs recorded by the Belle detector. We measure the CP asymmetry parameters -η_{f}S=+0.66±0.10(stat)±0.06(syst) and C=-0.02±0.07(stat)±0.03(syst). These results correspond to the first observation of CP violation in B[over ¯]^{0}→D_{CP}^{(*)}h^{0} decays. The hypothesis of no mixing-induced CP violation is excluded in these decays at the level of 5.4 standard deviations.

  7. The comparison of antioxidative and hepatoprotective activities of Codonopsis pilosula polysaccharide (CP) and sulfated CP.

    Science.gov (United States)

    Liu, Cui; Chen, Jin; Li, Entao; Fan, Qiang; Wang, Deyun; Li, Peng; Li, Xiuping; Chen, Xingying; Qiu, Shulei; Gao, Zhenzhen; Li, Hongquan; Hu, Yuanliang

    2015-02-01

    Codonopsis pilosula polysaccharide (CP) was extracted, purified and modified by chlorosulfonic acid-pyridine method to obtain a sulfated CP (sCP). Their antioxidative activities in vitro were compared through the free radical-scavenging test. The results demonstrated that the scavenging capabilities of sCP were significantly stronger than those of CP. In vivo test, the mice hepatic injury model was prepared by BCG/LPS method, then administrated respectively with sCP and CP at three dosages, the biochemical indexes in serum, antioxidative indexes in liver homogenate and histopathological change in liver of the mice were compared. The results showed that in high (200mg/kg) and middle (150mg/kg) dosages of sCP groups, the contents of ALT, AST and TNF-α in serum and MDA in liver homogenate were significantly lower than those in the model group and numerically lower than those in the CP groups, the activities of SOD and GSH-Px in liver homogenate were significantly higher than those in the model group and numerically higher than those in the CP groups. In the model group there were obvious pathological changes in the liver, while in the sCP groups were near normal. These results indicate that sCP and CP possess antioxidative activity in vitro and in vivo, the activity of sCP is stronger than that of CP and sulfation modification can enhance the antioxidative and hepatoprotective activities of Codonopsis pilosula polysaccharide. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. CP nonconservation in dynamically broken gauge theories

    International Nuclear Information System (INIS)

    Lane, K.

    1981-01-01

    The recent proposal of Eichten, Lane, and Preskill for CP nonconservation in electroweak gauge theories with dynamical symmetry breaking is reviewed. Through the alignment of the vacuum with the explicit chiral symmetry breaking Hamiltonian, these theories provide a natural way to understand the dynamical origin of CP nonconservation. Special attention is paid to the problem of strong CP violation. Even through all vacuum angles are zero, this problem is not automatically avoided. In the absence of strong CP violation, the neutron electric dipole moment is expected to be 10 -24 -10 -26 e-cm. A new class of models is proposed in which both strong CP violation and large /ΔS/ = 2 effects may be avoided. In these models, /ΔC/ = 2 processes such as D/sup o/ D/sup -o/ mixing may be large enough to observe

  9. CP violation and the top quark

    International Nuclear Information System (INIS)

    Atwood, D.

    1994-02-01

    We consider signals of CP violation in semi-leptonic decay of the top quark. We show that the transverse polarization asymmetries of the τ-lepton in the decay t → brv is extremely sensitive CP violation. As an illustration we consider CP phases arising from the charged Higgs exchange in the Weinberg three Higgs doublet model. Qualitatively, the polarization asymmetries are enhanced over rate or energy asymmetries by a factor of O(m t /m r ) ∼ 100 with a corresponding increase in sensitivity to CP violating parameters. We also examine τ polarization in b decays via b → cvr and find that may also be very effective in constraining CP violating effects such as those that arise from an extended Higgs sector

  10. Theory prospective on leptonic CP violation

    International Nuclear Information System (INIS)

    Petcov, S.T.

    2016-01-01

    The phenomenology of 3-neutrino mixing, the current status of our knowledge about the 3-neutrino mixing parameters, including the absolute neutrino mass scale, and of the Dirac and Majorana CP violation in the lepton sector are reviewed. The problems of CP violation in neutrino oscillations and of determining the nature – Dirac or Majorana – of massive neutrinos are discussed. The seesaw mechanism of neutrino mass generation and the related leptogenesis scenario of generation of the baryon asymmetry of the Universe are considered. The results showing that the CP violation necessary for the generation of the baryon asymmetry of the Universe in leptogenesis can be due exclusively to the Dirac and/or Majorana CP-violating phase(s) in the neutrino mixing matrix U are briefly reviewed. The discrete symmetry approach to understanding the observed pattern of neutrino mixing and the related predictions for the leptonic Dirac CP violation are also reviewed.

  11. Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.

    Science.gov (United States)

    Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A

    2004-09-01

    Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.

  12. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  13. Deviation from bimaximal mixing and leptonic CP phases in S4 family symmetry and generalized CP

    International Nuclear Information System (INIS)

    Li, Cai-Chang; Ding, Gui-Jun

    2015-01-01

    The lepton flavor mixing matrix having one row or one column in common with the bimaximal mixing up to permutations is still compatible with the present neutrino oscillation data. We provide a thorough exploration of generating such a mixing matrix from S 4 family symmetry and generalized CP symmetry H CP . Supposing that S 4 ⋊H CP is broken down to Z 2 ST 2 SU ×H CP ν in the neutrino sector and Z 4 TST 2 U ⋊H CP l in the charged lepton sector, one column of the PMNS matrix would be of the form (1/2,1/√2,1/2) T up to permutations, both Dirac CP phase and Majorana CP phases are trivial to accommodate the observed lepton mixing angles. The phenomenological implications of the remnant symmetry K 4 (TST 2 ,T 2 U) ×H CP ν in the neutrino sector and Z 2 SU ×H CP l in the charged lepton sector are studied. One row of PMNS matrix is determined to be (1/2,1/2,−i/√2), and all the three leptonic CP phases can only be trivial to fit the measured values of the mixing angles. Two models based on S 4 family symmetry and generalized CP are constructed to implement these model independent predictions enforced by remnant symmetry. The correct mass hierarchy among the charged leptons is achieved. The vacuum alignment and higher order corrections are discussed.

  14. CP violations in the Universe

    Science.gov (United States)

    Auriemma, Giulio

    2003-12-01

    The origin of the asymmetry between matter and antimatter that is evident in our part of the Universe is one of the open questions in cosmology, because the CPT symmetry between matter and antimatter seems to be absolutely conserved at microscopic level. We repeat here the classical proofs which exclude the viability of a Universe baryon symmetric on the average, or the observed asymmetry as an initial conditions. The current understanding is that the asymmetry should have been dynamically generated before nucleosynthesis, by B, C, and CP violating processes, acting out of thermodynamical equilibrium, as suggested by Sakharov in the 70's. The physical realizations of these conditions would be possible, in principle, also in the framework of the Standard Model of elementary particles, but the present limits on the mass of the higgs particle exclude this possibility. Finally we present the model of baryogenesis through leptogenesis, which is allowed by a minimal extension of the Standard Model, which has the appeal of being testable in future long-baseline neutrino oscillation experiments.

  15. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  16. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  17. The structure of completely positive matrices according to their CP-rank and CP-plus-rank

    NARCIS (Netherlands)

    Dickinson, Peter James Clair; Bomze, Immanuel M.; Still, Georg J.

    2015-01-01

    We study the topological properties of the cp-rank operator $\\mathrm{cp}(A)$ and the related cp-plus-rank operator $\\mathrm{cp}^+(A)$ (which is introduced in this paper) in the set $\\mathcal{S}^n$ of symmetric $n\\times n$-matrices. For the set of completely positive matrices, $\\mathcal{CP}^n$, we

  18. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  19. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  20. Strong CP, flavor, and twisted split fermions

    International Nuclear Information System (INIS)

    Harnik, Roni; Perez, Gilad; Schwartz, Matthew D.; Shirman, Yuri

    2005-01-01

    We present a natural solution to the strong CP problem in the context of split fermions. By assuming CP is spontaneously broken in the bulk, a weak CKM phase is created in the standard model due to a twisting in flavor space of the bulk fermion wavefunctions. But the strong CP phase remains zero, being essentially protected by parity in the bulk and CP on the branes. As always in models of spontaneous CP breaking, radiative corrections to theta bar from the standard model are tiny, but even higher dimension operators are not that dangerous. The twisting phenomenon was recently shown to be generic, and not to interfere with the way that split fermions naturally weaves small numbers into the standard model. It follows that out approach to strong CP is compatible with flavor, and we sketch a comprehensive model. We also look at deconstructed version of this setup which provides a viable 4D model of spontaneous CP breaking which is not in the Nelson-Barr class. (author)

  1. Exploring CP violation in the MSSM.

    Science.gov (United States)

    Arbey, Alexandre; Ellis, John; Godbole, Rohini M; Mahmoudi, Farvah

    We explore the prospects for observing CP violation in the minimal supersymmetric extension of the Standard Model (MSSM) with six CP-violating parameters, three gaugino mass phases and three phases in trilinear soft supersymmetry-breaking parameters, using the CPsuperH code combined with a geometric approach to maximise CP-violating observables subject to the experimental upper bounds on electric dipole moments. We also implement CP-conserving constraints from Higgs physics, flavour physics and the upper limits on the cosmological dark matter density and spin-independent scattering. We study possible values of observables within the constrained MSSM (CMSSM), the non-universal Higgs model (NUHM), the CPX scenario and a variant of the phenomenological MSSM (pMSSM). We find values of the CP-violating asymmetry [Formula: see text] in [Formula: see text] decay that may be as large as 3 %, so future measurements of [Formula: see text] may provide independent information about CP violation in the MSSM. We find that CP-violating MSSM contributions to the [Formula: see text] meson mass mixing term [Formula: see text] are in general below the present upper limit, which is dominated by theoretical uncertainties. If these could be reduced, [Formula: see text] could also provide an interesting and complementary constraint on the six CP-violating MSSM phases, enabling them all to be determined experimentally, in principle. We also find that CP violation in the [Formula: see text] and [Formula: see text] couplings can be quite large, and so may offer interesting prospects for future [Formula: see text], [Formula: see text], [Formula: see text] and [Formula: see text] colliders.

  2. CP -symmetry of order 4 and its consequences

    International Nuclear Information System (INIS)

    Ivanov, Igor P.

    2017-01-01

    Extended Higgs sectors offer rich opportunities for various forms of CP -violation. Here, we describe a new form of CP-conservation and discuss its consequences. We give a concrete example of a three-Higgs-doublet model dubbed CP4-3HDM with a CP -symmetry of order 4 and no other other accidental symmetries. If the vacuum conserves this symmetry, the model is CP -conserving with pairwise mass-degenerate extra neutral Higgs bosons. These fields cannot be classified as CP -even or CP -odd but they can be combined into complex physical fields which are CP -half-odd, that is, they pick up the i factor upon CP transformation. These CP -half-odd scalars can be Yukawa-coupled to the fermion bilinears in a CP -conserving way. We discuss fundamental and phenomenological features of the model, and stress a peculiar clash between the CP -symmetry and any convention for the particle-antiparticle assignment. (paper)

  3. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    Science.gov (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  4. CP violation in the baryon sector

    CERN Document Server

    Smith, Eluned Anne

    2017-01-01

    The study of CP violation in the baryon sector is still a relatively new field and offers the possibility to make many CP measurements which could complement those performed in the meson sector. This is especially true of late given the large number of baryons currently being produced at the LHC. Such measurements could help further over-constrain the CKM unitary triangle, as well as furthering our understand of baryongenesis. These proceedings will give an overview of the current state of the search for CP violation in the baryon sector.

  5. CP violation in CMS expected performance

    CERN Document Server

    Stefanescu, J

    1999-01-01

    The CMS experiment can contribute significantly to the measurement of the CP violation asymmetries. A recent evaluation of the expected precision on the CP violation parameter sin 2 beta in the channel B /sub d//sup 0/ to J/ psi $9 K/sub s//sup 0/ has been performed using a simulation of the CMS tracker including full pattern recognition. CMS has also studied the possibility to observe CP violation in the decay channel B/sub s//sup 0/ to J/ psi phi . The $9 results of these studies are reviewed. (7 refs).

  6. CP Violation in Single Top Quark Production

    Energy Technology Data Exchange (ETDEWEB)

    Geng, Weigang [Michigan State Univ., East Lansing, MI (United States)

    2012-01-01

    We present a search for CP violation in single top quark production with the DØ experiment at the Tevatron proton-antiproton collider. CP violation in the top electroweak interaction results in different single top quark production cross sections for top and antitop quarks. We perform the search in the single top quark final state using 5.4 fb-1 of data, in the s-channel, t-channel, and for both combined. At this time, we do not see an observable CP asymmetry.

  7. Baryogenesis and standard model CP violation

    International Nuclear Information System (INIS)

    Huet, P.

    1994-08-01

    The standard model possesses a natural source of CP violation contained in the phase of the CKM matrix. Whether the latter participated to the making of the matter-antimatter asymmetry of the observable universe is a fundamental question which has been addressed only recently. The generation of a CP observable occurs through interference of quantum paths along which a sequence of flavor mixings and chirality flips take place. The coherence of this phenomenon in the primeval plasma is limited by the fast quark-gluon interactions. At the electroweak era, this phenomenon of decoherence forbids a successful baryogenesis based on the sole CP violation of the CKM matrix

  8. The seesaw path to leptonic CP violation

    Energy Technology Data Exchange (ETDEWEB)

    Caputo, A.; Hernandez, P. [Universidad de Valencia and CSIC, Edificio Institutos Investigacion, Instituto de Fisica Corpuscular, Paterna (Spain); CERN, Theoretical Physics Department, Geneva (Switzerland); Kekic, M.; Salvado, J. [Universidad de Valencia and CSIC, Edificio Institutos Investigacion, Instituto de Fisica Corpuscular, Paterna (Spain); Lopez-Pavon, J. [CERN, Theoretical Physics Department, Geneva (Switzerland)

    2017-04-15

    Future experiments such as SHiP and high-intensity e{sup +}e{sup -} colliders will have a superb sensitivity to heavy Majorana neutrinos with masses below M{sub Z}. We show that the measurement of the mixing to electrons and muons of one such state could establish the existence of CP violating phases in the neutrino mixing matrix, in the context of low-scale seesaw models. We quantify in the minimal model the CP reach of these future experiments, and demonstrate that CP violating phases in the mixing matrix could be established at 5σ CL in a very significant fraction of parameter space. (orig.)

  9. The seesaw path to leptonic CP violation

    CERN Document Server

    Caputo, A.; Kekic, M.; López-Pavón, J.; Salvado, J.

    2017-04-24

    Future experiments such as SHiP and high-intensity $e^+ e^-$ colliders will have a superb sensitivity to heavy Majorana neutrinos with masses below $M_Z$. We show that the measurement of the mixing to electrons and muons of one such state could imply the discovery of leptonic CP violation in the context of seesaw models. We quantify in the minimal model the CP discovery potential of these future experiments, and demonstrate that a 5$\\sigma$ CL discovery of leptonic CP violation would be possible in a very significant fraction of parameter space.

  10. Flavor physics and CP violation

    Science.gov (United States)

    Chang, Paoti; Chen, Kai-Feng; Hou, Wei-Shu

    2017-11-01

    We currently live in the age of the CKM paradigm. The 3 × 3 matrix that links (d , s , b) quarks to (u , c , t) in the charged current weak interaction, being complex and nominally with 18 parameters, can be accounted for by just 3 rotation angles and one CP violating (CPV) phase, with unitarity and the CKM phases triumphantly tested at the B factories. But the CKM picture is unsatisfactory and has too many parameters. The main aim of Flavor Physics and CP violation (FPCP) studies is the pursuit to uncover New Physics beyond the Standard Model (SM). Two highlights of LHC Run 1 period are the CPV phase ϕs of Bs mixing and Bs →μ+μ- decay, which were found to be again consistent with SM, though the saga is yet unfinished. We also saw the emergence of the P5‧ angular variable anomaly in B0 →K∗0μ+μ- decay and R K (∗) anomaly in B →K (∗)μ+μ- to B →K (∗)e+e- rate ratios, and the BaBar anomaly in B →D (∗) τν decays, which suggest possible New Physics in these flavor processes, pointing to extra Z‧, charged Higgs, or leptoquarks. Charmless hadronic, semileptonic, purely leptonic and radiative B decays continue to offer various further windows on New Physics. Away from B physics, the rare K → πνν decays and ε‧ / ε in the kaon sector, μ → e transitions, muon g - 2 and electric dipole moments of the neutron and electron, τ → μγ , μμμ , eee, and a few charm physics probes, offer broadband frontier windows on New Physics. Lastly, flavor changing neutral transitions involving the top quark t and the 125 GeV Higgs boson h, such as t → ch and h → μτ, offer a new window into FPCP, while a new Z‧ related or inspired by the P5‧ anomaly, could show up in analogous top quark processes, perhaps even link with low energy phenomena such as muon g - 2 or rare kaon processes. In particular, we advocate the potential new SM, the two Higgs doublet model without discrete symmetries to control flavor violation, as SM2. As we are

  11. Jagiellonian University Searches for the Standard Model Higgs boson decay to $\\tau $ lepton pairs at the CMS experiment

    CERN Document Server

    Pyskir, Andrzej

    2017-01-01

    We present results of searches for the Standard Model Higgs boson decaying to tau lepton pairs at the CMS experiment with data collected during the LHC Run 1. We also present some insight into the analysis with Run 2 data. CP sensitive variables are described and an experimental method of probing CP of the Higgs boson is presented.

  12. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylog...

  13. Aspects of soft and spontaneous CP violation

    International Nuclear Information System (INIS)

    Frampton, P.H.; Harada, M.

    1999-01-01

    We study four different models for CP violation: the standard Kobayashi-Maskawa (KM) model, the aspon model of spontaneous breaking, and two models of soft breaking. In all except the standard model, the strong CP problem is addressed and solved. Testable predictions for the area of the unitarity triangle and for (ε ' /ε) K are emphasized. The issue of CP violation may well become the first place where the standard model of particle theory is shown definitively to be deficient. There are two reasons for expecting this to happen: (1) the strong CP problem is still not understood in the unadorned standard model and (2) the KM mechanism, although unquestionably present, may not provide the full explanation of ε K and (ε ' /ε) K . copyright 1999 The American Physical Society

  14. CP violation in B and D decays

    International Nuclear Information System (INIS)

    Bigi, I.I.

    1986-06-01

    Non-leptonic B decays offer the best opportunity to discover the violation of CP invariance outside the neutral K system. Employing the Standard Model one predicts - with reasonable confidence - CP asymmetries of up to 205 (or even more in some cases). The branching ratios for the individual exclusive modes of interest are not expected to exceed the 10 -3 level in most cases; the identification of such decays poses non-trivial problems. It is shown that by summing intelligently over appropriate classes of decays one can greatly enhance statistics without jeopardizing the signal. Data that contain 10 6 produced B mesons would allow meaningful searches for CP violation. It is noted that ''New Physics'' could lead to CP asymmetries in D 0 decays of order 1%. Due to higher branching ratios one can search for such effects in samples of 10 6 produced D mesons. 7 refs

  15. Instantons, CP-violation and axions

    Energy Technology Data Exchange (ETDEWEB)

    Choudhury, S. R.

    1980-07-01

    Some specific aspects of the developments in pseudoparticle solutions of Gauge theories are discussed. The general features of the Lagrangian are described. The concepts of instantons, confinement, O-vacua and CP nonconservation are explained.

  16. CP violation in b-hadrons

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00341004

    2016-01-01

    Latest LHCb measurements of $CP$ violation in b-hadrons are presented based on $pp$ collision data collected in 2011 and 2012 at centre-of-mass energies of $\\sqrt{s}=7$ $\\rm TeV$ and $8\\ \\rm TeV$ respectively. The total integrated luminosity collected is 3.0 fb$^{-1}$. Results include recent measurements of $CP$ violation in $B_d$ and $B_s$ mixing, along with those of quantifying the effects of $b\\to c\\bar{c} s$ loop pollution. Standard Model $CP$ violation tests in loop transitions are discussed with results consistent with expectations. New decays of b-baryons are presented and preliminary studies of $CP$ violation are performed.

  17. A definition of maximal CP-violation

    International Nuclear Information System (INIS)

    Roos, M.

    1985-01-01

    The unitary matrix of quark flavour mixing is parametrized in a general way, permitting a mathematically natural definition of maximal CP violation. Present data turn out to violate this definition by 2-3 standard deviations. (orig.)

  18. First evidence for direct CP violation

    International Nuclear Information System (INIS)

    Schaffer, A.C.

    1988-06-01

    The double ratio R of the relative decay rates of the short-and long-lived neutral kaons into two charged and two neutral pions was measured to be 0.980 ± 0.004 ± 0.005. The deviation of R from unity implies CP violation in the transition of the CP-odd K 2 into two pions with ε , / ε = (3.3 ± 1.1) X 10 -3

  19. Status of the CP-PACS Project

    International Nuclear Information System (INIS)

    Ukawa, A.

    1995-01-01

    The CP-PACS Project, which started in April 1992, is a five-year plan to develop a massively parallel computer for carrying out research in computational physics with primary emphasis on lattice QCD. This article describes the architectural design of the CP-PACS computer, the entire computing system including the front end and mass storage, and results of benchmarks for the expected performance for lattice QCD applications. ((orig.))

  20. Toimintaterapeuttinen nukkekoti CP-vammaisille lapsille

    OpenAIRE

    Ruotsalainen, Ulla; Tokola, Eveliina

    2009-01-01

    Toiminnallisen opinnäytetyön tarkoitus oli suunnitella ja rakentaa toimintaterapeuttinen nukkekoti CP-vammaisille lapsille. Työn toimeksiantajana oli toimintaterapeutti Päivi Raitanen Terapiapajalta. Työn tavoitteena oli toteuttaa mukana kuljetettava ja lapsen pyörätuolin pöytälevylle sopiva nukkekoti, jolla leikkiminen tukee CP-vammaisen lapsen toimintaterapiaa. Yleisimpiä tavoitteita ovat muun muuassa hienomotoristen taitojen, leikkitaitojen, syy-seuraussuhteiden ja visuaalisen hahmott...

  1. Heavy quarks and CP: Moriond 1985

    International Nuclear Information System (INIS)

    Bjorken, J.D.

    1985-03-01

    The presentations at the Fifth Moriond Workshop on Heavy Quarks, Flavor Mixing, and CP Violation (La Plagne, France, January 13-19, 1985) are summarized. The following topics are reviewed. What's New (beyond the top, top quarks, bottom quarks, charm quarks, strange quarks, and others); why is all this being done (strong interactions and hadron structure, and electroweak properties); and what next (facilities and can one see CP violation in the B-anti B system). 64 refs., 10 figs

  2. Penguins and cp violation in β decays

    International Nuclear Information System (INIS)

    He, X.C.

    1996-11-01

    The measurement of the ε-parameter in the K 0 - K-bar 0 meson system is the only direct evidence for CP violation in the laboratory. The Standard Model (SM) of three generations with the source for CP violation arising from the phases in the Cabibbo-Kobayashi-Maskawa (CKM) matrix is consistent with the experiment. An unique feature of this model is that the CKM matrix is a 3 x 3 unitary matrix. (author)

  3. Neutrino mass textures with maximal CP violation

    International Nuclear Information System (INIS)

    Aizawa, Ichiro; Kitabayashi, Teruyuki; Yasue, Masaki

    2005-01-01

    We show three types of neutrino mass textures, which give maximal CP violation as well as maximal atmospheric neutrino mixing. These textures are described by six real mass parameters: one specified by two complex flavor neutrino masses and two constrained ones and the others specified by three complex flavor neutrino masses. In each texture, we calculate mixing angles and masses, which are consistent with observed data, as well as Majorana CP phases

  4. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  5. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  6. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  7. CP and CP-PGN protect mice against MRSA infection by inducing M1 macrophages.

    Science.gov (United States)

    Zhang, Yang; Li, Xiang-Xiang; Ma, Yuan; Xu, Jie; Zhao, Li-Na; Qian, Xue-Feng; Zhang, Xian-Feng; Shi, Jin-Fang; Han, Qing-Zhen

    2017-12-04

    Corynebacterium pyruviciproducens (C. pyruviciproducens, CP), as a newly discovered immunomodulator, has been confirmed to have a stronger immunoregulation than Propionibacterium acnes (P. acnes) of the traditional immune adjuvant, by previous experiments with model antigen ovalbumin and sheep red blood cells. Here, it was designed to assess its ability to resist methicillin-resistant Staphylococcus aureus (MRSA), since MRSA as a vital gram positive pathogen is characterized by high morbidity and mortality. In this report, it was indicated that C. pyruviciproducens and its peptidoglycan (CP-PGN) could help to be against bloodstream infection of MRSA with raised survival rate, decreased bacteria load and alleviated systemic inflammation, and these effects of CP-PGN were more pronounced. However, the whole CP was inclined to prevent localized abdominal infection of MRSA from progressing to a systemic infection. And they showed the potential as a therapeutic drug alone or combined with vancomycin. The diversity of capacity of activating macrophages induced by CP and CP-PGN may result in distinct resistance to MRSA in different infection models. Furthermore, both CP and CP-PGN induced M1 macrophages. In conclusion, CP and its PGN could act as promising immune agents to treat and prevent MRSA infection.

  8. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  9. Measurement of the CP Content and CP Violating Asymmetries in Neutral B Decays to Two D Mesons with the BaBar Detector

    Energy Technology Data Exchange (ETDEWEB)

    Lillard, V.

    2005-04-25

    This dissertation presents a measurement of time-dependent CP-violating asymmetries and a measurement of the CP-odd parity fraction in the decay B{sup 0} {yields} D*{sup +} D*{sup -}. The measurements are derived from a data sample of 88 x 10{sup 6} B{bar B} pairs collected by the BABAR detector at the PEP-II asymmetric-energy B Factory located at the Stanford Linear Accelerator Center. A one-dimensional angular analysis of the decay products measures the CP-odd fraction to be 0.063 {+-} 0.055(stat) {+-} 0.009(syst), indicating that the D*{sup +}D*{sup -} final state is mostly CP-even. The time-dependent CP asymmetry parameters Im({lambda}{sub +}) and |{lambda}{sub +}| are determined from an analysis of the time-dependence of flavor-tagged B decays. One neutral B meson is fully reconstructed in a D*{sup +} D*{sup -} final state, while the other B is inclusively reconstructed in order to determine its flavor. The Standard Model predicts the CP asymmetry parameters Im({lambda}{sub +}) and |{lambda}{sub +}| to be sin2{beta} and 1, respectively, in the absence of penguin diagram contributions. They are determined to be 0.05 {+-} 0.29(stat) {+-} 0.10(syst) and 0.75 {+-} 0.19(stat) {+-} 0.02(syst), respectively, which corresponds to a 2.5 sigma deviation from Standard Model predictions with penguin contributions ignored.

  10. Pairing correlations in nuclei

    International Nuclear Information System (INIS)

    Baba, C.V.K.

    1988-01-01

    There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs

  11. Synthesis and oxidation of CpIrIII compounds: functionalization of a Cp methyl group.

    Science.gov (United States)

    Park-Gehrke, Lisa S; Freudenthal, John; Kaminsky, Werner; Dipasquale, Antonio G; Mayer, James M

    2009-03-21

    [CpIrCl(2)](2) () and new CpIr(III)(L-L)X complexes (L-L = N-O or C-N chelating ligands; X = Cl, I, Me) have been prepared and their reactivity with two-electron chemical oxidants explored. Reaction of with PhI(OAc)(2) in wet solvents yields a new chloro-bridged dimer in which each of the Cp ligands has been singly acetoxylated to form [Cp(OAc)Ir(III)Cl(2)](2) () (Cp(OAc) = eta(5)-C(5)Me(4)CH(2)OAc). Complex and related carboxy- and alkoxy-functionalized Cp(OR) complexes can also be prepared from plus (PhIO)(n) and ROH. [Cp(OAc)Ir(III)Cl(2)](2) () and the methoxy analogue [Cp(OMe)Ir(III)Cl(2)](2) () have been structurally characterized. Treatment of [CpIrCl(2)](2) () with 2-phenylpyridine yields CpIr(III)(ppy)Cl () (ppy = cyclometallated 2-phenylpyridyl) which is readily converted to its iodide and methyl analogues CpIr(III)(ppy)I and CpIr(III)(ppy)Me (). CpIr(III) complexes were also prepared with N-O chelating ligands derived from anthranilic acid (2-aminobenzoic acid) and alpha-aminoisobutyric acid (H(2)NCMe(2)COOH), ligands chosen to be relatively oxidation resistant. These complexes and were reacted with potential two-electron oxidants including PhI(OAc)(2), hexachlorocyclohexadienone (C(6)Cl(6)O), N-fluoro-2,4,6-trimethylpyridinium (Me(3)pyF(+)), [Me(3)O]BF(4) and MeOTf (OTf = triflate, CF(3)SO(3)). Iridium(V) complexes were not observed or implicated in these reactions, despite the similarity of the potential products to known CpIr(V) species. The carbon electrophiles [Me(3)O]BF(4) and MeOTf appear to react preferentially at the N-O ligands, to give methyl esters in some cases. Overall, the results indicate that Cp is not inert under oxidizing conditions and is therefore not a good supporting ligand for oxidizing organometallic complexes.

  12. Recent Results on T and CP Violation at BABAR

    Energy Technology Data Exchange (ETDEWEB)

    Perez Perez, Alejandro [Istituto Nazionale di Fisica Nucleare (INFN), Pisa (Italy).

    2015-02-06

    CP-violation (CPV) and Time-reversal violation (TRV) are intimately related through the CPT theorem: if one of these discrete symmetries is violated the other one has to be violated in such a way to conserve CPT. Although CPV in the B0B0-bar system has been established by the B-factories, implying indirectly TRV, there is still no direct evidence of TRV. We report on the observation of TRV in the B-meson system performed with a dataset of 468 × 106 BB-bar pairs produced in Υ(4S) decays collected by the BABAR detector at the PEP-II asymmetric-energy e+e- collider at the SLAC National Accelerator Laboratory. We also report on other CPV measurements recently performed on the B-meson system

  13. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  14. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.

    2018-01-01

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  15. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.

    2018-05-23

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  16. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  17. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  18. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  19. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  20. CP and other gauge symmetries in string theory

    International Nuclear Information System (INIS)

    Dine, M.; Leigh, R.G.; MacIntire, D.A.

    1992-01-01

    We argue that CP is a gauge symmetry in string theory. As a consequence, CP cannot be explicitly broken either perturbatively or nonperturbatively; there can be no nonperturbative CP-violating parameters. String theory is thus an example of a theory where all θ angles arise due to spontaneous CP violation, and are in principle calculable

  1. CP violation induced by the double resonance for pure annihilation decay process in perturbative QCD

    Energy Technology Data Exchange (ETDEWEB)

    Lue, Gang; Li, Sheng-Tao; Wang, Yu-Ting [Henan University of Technology, College of Science, Zhengzhou (China); Lu, Ye [Guangxi Normal University, Department of Physics, Guilin (China)

    2017-08-15

    In a perturbative QCD approach we study the direct CP violation in the pure annihilation decay process of anti B{sup 0}{sub s} → π{sup +}π{sup -}π{sup +}π{sup -} induced by the ρ and ω double resonance effect. Generally, the CP violation is small in the pure annihilation type decay process. However, we find that the CP violation can be enhanced by double ρ-ω interference when the invariant masses of the π{sup +}π{sup -} pairs are in the vicinity of the ω resonance. For the decay process of anti B{sup 0}{sub s} → π{sup +}π{sup -}π{sup +}π{sup -}, the CP violation can reach A{sub CP}(anti B{sup 0}{sub s} → π{sup +}π{sup -}π{sup +}π{sup -}) = 27.20{sup +0.05+0.28+7.13}{sub -0.15-0.31-6.11}%. (orig.)

  2. Measurements of CP Asymmetries in the Decay B --> {phi}K

    Energy Technology Data Exchange (ETDEWEB)

    Aubert, B

    2004-08-16

    The authors present a preliminary measurement of the time-dependent CP asymmetry for the neutral B-meson decay B{sup 0} --> {phi}K{sup 0}. They use a sample of approximately 227 million B-meson pairs recorded at the {Upsilon}(4S) resonance with the BABAR detector at the PEP-II B-meson Factory at SLAC. They reconstruct the CP eigenstates {phi}K{sub s}{sup 0} and {phi}K{sub L}{sup 0} where {phi} --> K{sup +}K{sup -}, K{sub s}{sup 0} --> {pi}{sup +}{pi}{sup -}, and K{sub L}{sup 0} is observed via its hadronic interactions. The other B meson in the event is tagged as either a B{sup 0} or {bar B}{sup 0} from its decay products. The values of the CP-violation parameters deived from the combined {phi}K{sup 0} dataset are S{sub {phi}K} = +0.50 {+-} 0.25(stat.){sub -0.04}{sup +0.07}(syst.) and C{sub {phi}K} = 0.00 {+-} 0.23(stat.) {+-}0.05(syst.). In addition, the authors measure the CP-violating charge asymmetry A{sub CP}(B{sup +} --> {phi}K{sup +}) = 0.054 {+-} 0.056(stat.) {+-} 0.012(syst.). All results are preliminary.

  3. Determinations of P, and CP, for heavy mesons and tests for their violations without polarization experiments

    International Nuclear Information System (INIS)

    Nelson, C.A.

    1984-10-01

    Powerful results are tabulated which can be used at modern colliders to make fundamental symmetry tests by analysis of sequential decays of X → V 1 V 2 . By generalization of the phi phi parity test which has recently been used to determine the parity of the eta/sub c/, the P ( or CP) quantum number can always be determined for X of any spin J which decays P (or respectively CP) invariantly into VV or V anti V where each vector meson decays into two spin-0 bosons, or is ω. P can also always be determined from a mode like K* + anti K* 0 . A neutral spin-0 technipion and an elementary Higgs particle, for instance, can be distinguished by such CP invariant decay modes and by phi rho 0 , phi J, J UPSILON, or if sufficiently massive by phi Z 0 or JZ 0 where J/psi and Z 0 go into a lepton-antilepton pair. Generalization to the gZ 0 and gg decay channels, g = gluon jet, which would be relevant to new resonance physics, for example, at the CERN collider is discussed. There are also very simple tests for possible violations of P, of the combination of C plus isospin, of both P and CP, and of both C and CP. 9 references

  4. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  5. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  6. Study of CP asymmetry in B^{0}-B[over ¯]^{0} mixing with inclusive dilepton events.

    Science.gov (United States)

    Lees, J P; Poireau, V; Tisserand, V; Grauges, E; Palano, A; Eigen, G; Stugu, B; Brown, D N; Kerth, L T; Kolomensky, Yu G; Lee, M J; Lynch, G; Koch, H; Schroeder, T; Hearty, C; Mattison, T S; McKenna, J A; So, R Y; Khan, A; Blinov, V E; Buzykaev, A R; Druzhinin, V P; Golubev, V B; Kravchenko, E A; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Todyshev, K Yu; Lankford, A J; Mandelkern, M; Dey, B; Gary, J W; Long, O; Campagnari, C; Franco Sevilla, M; Hong, T M; Kovalskyi, D; Richman, J D; West, C A; Eisner, A M; Lockman, W S; Panduro Vazquez, W; Schumm, B A; Seiden, A; Chao, D S; Cheng, C H; Echenard, B; Flood, K T; Hitlin, D G; Miyashita, T S; Ongmongkolkul, P; Porter, F C; Röhrken, M; Andreassen, R; Huard, Z; Meadows, B T; Pushpawela, B G; Sokoloff, M D; Sun, L; Bloom, P C; Ford, W T; Gaz, A; Smith, J G; Wagner, S R; Ayad, R; Toki, W H; Spaan, B; Bernard, D; Verderi, M; Playfer, S; Bettoni, D; Bozzi, C; Calabrese, R; Cibinetto, G; Fioravanti, E; Garzia, I; Luppi, E; Piemontese, L; Santoro, V; Calcaterra, A; de Sangro, R; Finocchiaro, G; Martellotti, S; Patteri, P; Peruzzi, I M; Piccolo, M; Rama, M; Zallo, A; Contri, R; Lo Vetere, M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Bhuyan, B; Prasad, V; Adametz, A; Uwer, U; Lacker, H M; Dauncey, P D; Mallik, U; Chen, C; Cochran, J; Prell, S; Ahmed, H; Gritsan, A V; Arnaud, N; Davier, M; Derkach, D; Grosdidier, G; Le Diberder, F; Lutz, A M; Malaescu, B; Roudeau, P; Stocchi, A; Wormser, G; Lange, D J; Wright, D M; Coleman, J P; Fry, J R; Gabathuler, E; Hutchcroft, D E; Payne, D J; Touramanis, C; Bevan, A J; Di Lodovico, F; Sacco, R; Cowan, G; Bougher, J; Brown, D N; Davis, C L; Denig, A G; Fritsch, M; Gradl, W; Griessinger, K; Hafner, A; Schubert, K R; Barlow, R J; Lafferty, G D; Cenci, R; Hamilton, B; Jawahery, A; Roberts, D A; Cowan, R; Sciolla, G; Cheaib, R; Patel, P M; Robertson, S H; Neri, N; Palombo, F; Cremaldi, L; Godang, R; Sonnek, P; Summers, D J; Simard, M; Taras, P; De Nardo, G; Onorato, G; Sciacca, C; Martinelli, M; Raven, G; Jessop, C P; LoSecco, J M; Honscheid, K; Kass, R; Feltresi, E; Margoni, M; Morandin, M; Posocco, M; Rotondo, M; Simi, G; Simonetto, F; Stroili, R; Akar, S; Ben-Haim, E; Bomben, M; Bonneaud, G R; Briand, H; Calderini, G; Chauveau, J; Leruste, Ph; Marchiori, G; Ocariz, J; Biasini, M; Manoni, E; Pacetti, S; Rossi, A; Angelini, C; Batignani, G; Bettarini, S; Carpinelli, M; Casarosa, G; Cervelli, A; Chrzaszcz, M; Forti, F; Giorgi, M A; Lusiani, A; Oberhof, B; Paoloni, E; Perez, A; Rizzo, G; Walsh, J J; Lopes Pegna, D; Olsen, J; Smith, A J S; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Li Gioi, L; Pilloni, A; Piredda, G; Bünger, C; Dittrich, S; Grünberg, O; Hess, M; Leddig, T; Voß, C; Waldi, R; Adye, T; Olaiya, E O; Wilson, F F; Emery, S; Vasseur, G; Anulli, F; Aston, D; Bard, D J; Cartaro, C; Convery, M R; Dorfan, J; Dubois-Felsmann, G P; Dunwoodie, W; Ebert, M; Field, R C; Fulsom, B G; Graham, M T; Hast, C; Innes, W R; Kim, P; Leith, D W G S; Lewis, P; Lindemann, D; Luitz, S; Luth, V; Lynch, H L; MacFarlane, D B; Muller, D R; Neal, H; Perl, M; Pulliam, T; Ratcliff, B N; Roodman, A; Salnikov, A A; Schindler, R H; Snyder, A; Su, D; Sullivan, M K; Va'vra, J; Wisniewski, W J; Wulsin, H W; Purohit, M V; White, R M; Wilson, J R; Randle-Conde, A; Sekula, S J; Bellis, M; Burchat, P R; Puccio, E M T; Alam, M S; Ernst, J A; Gorodeisky, R; Guttman, N; Peimer, D R; Soffer, A; Spanier, S M; Ritchie, J L; Ruland, A M; Schwitters, R F; Wray, B C; Izen, J M; Lou, X C; Bianchi, F; De Mori, F; Filippi, A; Gamba, D; Lanceri, L; Vitale, L; Martinez-Vidal, F; Oyanguren, A; Villanueva-Perez, P; Albert, J; Banerjee, Sw; Beaulieu, A; Bernlochner, F U; Choi, H H F; King, G J; Kowalewski, R; Lewczuk, M J; Lueck, T; Nugent, I M; Roney, J M; Sobie, R J; Tasneem, N; Gershon, T J; Harrison, P F; Latham, T E; Band, H R; Dasu, S; Pan, Y; Prepost, R; Wu, S L

    2015-02-27

    We present a measurement of the asymmetry A_{CP} between same-sign inclusive dilepton samples ℓ^{+}ℓ^{+} and ℓ^{-}ℓ^{-} (ℓ=e, μ) from semileptonic B decays in ϒ(4S)→BB[over ¯] events, using the complete data set recorded by the BABAR experiment near the ϒ(4S) resonance, corresponding to 471×10^{6} BB[over ¯] pairs. The asymmetry A_{CP} allows comparison between the mixing probabilities P(B[over ¯]^{0}→B^{0}) and P(B^{0}→B[over ¯]^{0}), and therefore probes CP and T violation. The result, A_{CP}=[-3.9±3.5(stat)±1.9(syst)]×10^{-3}, is consistent with the standard model expectation.

  7. Did the CP audits promote the enterprises' CP? A case study in Beijing.

    Science.gov (United States)

    Yu, Gang; Huang, Jun; Chen, Qing

    2002-03-09

    Seven enterprises that have had recent Cleaner Production (CP) audits in Beijing were interviewed to identify whether these enterprises implemented the audit recommendations. If enterprises did implement the recommendations, their reasons and the results were analyzed. Finally, some suggestions on how to promote enterprise-wide CP were given.

  8. Secure pairing with biometrics

    NARCIS (Netherlands)

    Buhan, I.R.; Boom, B.J.; Doumen, J.M.; Hartel, Pieter H.; Veldhuis, Raymond N.J.

    Secure pairing enables two devices that share no prior context with each other to agree upon a security association, which they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping and to a

  9. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.

    2011-01-01

    Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and

  10. Solutions of nuclear pairing

    International Nuclear Information System (INIS)

    Balantekin, A. B.; Pehlivan, Y.

    2007-01-01

    We give the exact solution of orbit dependent nuclear pairing problem between two nondegenerate energy levels using the Bethe ansatz technique. Our solution reduces to previously solved cases in the appropriate limits including Richardson's treatment of reduced pairing in terms of rational Gaudin algebra operators

  11. Pair correlations in nuclei

    International Nuclear Information System (INIS)

    Shimizu, Yoshifumi

    2009-01-01

    Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

  12. Flavor and CP invariant composite Higgs models

    International Nuclear Information System (INIS)

    Redi, Michele; Weiler, Andreas

    2011-09-01

    The flavor protection in composite Higgs models with partial compositeness is known to be insufficient. We explore the possibility to alleviate the tension with CP odd observables by assuming that flavor or CP are symmetries of the composite sector, broken by the coupling to Standard Model fields. One realization is that the composite sector has a flavor symmetry SU(3) or SU(3) U x SU(3) D which allows us to realize Minimal Flavor Violation. We show how to avoid the previously problematic tension between a flavor symmetric composite sector and electro-weak precision tests. Some of the light quarks are substantially or even fully composite with striking signals at the LHC. We discuss the constraints from recent dijet mass measurements and give an outlook on the discovery potential. We also present a different protection mechanism where we separate the generation of flavor hierarchies and the origin of CP violation. This can eliminate or safely reduce unwanted CP violating effects, realizing effectively ''Minimal CP Violation'' and is compatible with a dynamical generation of flavor at low scales. (orig.)

  13. Flavor and CP invariant composite Higgs models

    Energy Technology Data Exchange (ETDEWEB)

    Redi, Michele [CERN - European Organization for Nuclear Research, Geneva (Switzerland). Theory Div.; INFN, Firenze (Italy); Weiler, Andreas [CERN - European Organization for Nuclear Research, Geneva (Switzerland). Theory Div.; Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2011-09-15

    The flavor protection in composite Higgs models with partial compositeness is known to be insufficient. We explore the possibility to alleviate the tension with CP odd observables by assuming that flavor or CP are symmetries of the composite sector, broken by the coupling to Standard Model fields. One realization is that the composite sector has a flavor symmetry SU(3) or SU(3){sub U} x SU(3){sub D} which allows us to realize Minimal Flavor Violation. We show how to avoid the previously problematic tension between a flavor symmetric composite sector and electro-weak precision tests. Some of the light quarks are substantially or even fully composite with striking signals at the LHC. We discuss the constraints from recent dijet mass measurements and give an outlook on the discovery potential. We also present a different protection mechanism where we separate the generation of flavor hierarchies and the origin of CP violation. This can eliminate or safely reduce unwanted CP violating effects, realizing effectively ''Minimal CP Violation'' and is compatible with a dynamical generation of flavor at low scales. (orig.)

  14. Cooper Pairs in Insulators?

    International Nuclear Information System (INIS)

    Valles, James

    2008-01-01

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

  15. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

  16. CP-even and CP-odd transverse polarization of the electron in muon decay

    International Nuclear Information System (INIS)

    Kuznetsov, A.

    1981-01-01

    A model of the weak interaction which contains intermediate vector bosons of the most general form and which admits CP violation in muon decay is used to calculate the CP-even and CP-odd transverse polarization of the μ-decay electrons with inclusion of radiative corrections. It is shown that these corrections are important only at the beginning of the spectrum, and their contribution reduces the observed effects of the transverse polarization. The transverse polarization grows appreciably at electron energies close to the maximum energy and at small emission angles. It is expedient to search for the CP-even and CP-odd transverse polarization of the electrons at energies E/sub e/ = 0.975E/sup max//sub e/ and emission angles theta = 25--35 0

  17. CP-even and CP-odd transverse polarization of the electron in the muon decay

    International Nuclear Information System (INIS)

    Kuznetsov, A.V.

    1981-01-01

    In the most general weak interaction model with intermediate vector bosons, allowing CP breaking in the muon decay, CP- even and CP-odd transverse polarization of the μ-decay electrons is calculated taking into account the radiative corrections. It is shown that such corrections are essential only at the beginning of the spectrum reducing the observed transverse polarization effects. When the electron energy is close to its maximum and the emission angles are small, the transverse polarization considerably grows. Search for CP-even and CP-odd transverse polarization of the electrons should be carried out at energies Esub(e) approximately equal to O.975 Esub(e)sup(max) and emission angles THETA approximately equal to 25+35 deg [ru

  18. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    Science.gov (United States)

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  19. Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

    Directory of Open Access Journals (Sweden)

    Douglas de Almeida Pereira

    2015-09-01

    Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

  20. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  1. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  2. Lectures on Flavor Physics and CP Violation

    CERN Document Server

    Grinstein, Benjamín

    2016-12-20

    These lectures on flavor physics are an introduction to the subject. First lec- ture: We discuss the meaning of flavor and the importance of flavor physics in restricting extensions of the Standard Model (SM) of Electroweak interactions. We explain the origin of the KM matrix and how its elements are determined. We discuss FCNC and the GIM mechanism, followed by how a principle of Minimal Flavor Violation leads to SM extensions that are safe as far as FCNC are concerned even if the new physics comes in at low, TeVish scales. This is illustrated by the example of B radiative decays ( b → sγ ). Second lecture: We then turn our attention to CP-violation. We start by presenting neutral meson mixing. Then we consider various CP-asymmetries, culminating in the theoretically clean interference between mixing and decay into CP eigenstates.

  3. CP asymmetries in semiinclusive B0 decays

    Energy Technology Data Exchange (ETDEWEB)

    Dunietz, Isard

    1999-02-01

    It was recently pointed out that inclusive B^0(t) decays could show CP violation. The totally inclusive asymmetry is expected to be tiny [O(10^{-3})] because of large cancellations among the asymmetries in the charmless, single charm and double charm final states. Enriching particular final state configurations could significantly increase the CP-asymmetry and observability. Such studies can extract fundamental CKM (Cabibbo-Kobayashi-Maskawa) parameters, and (perhaps) even Delta m(B_s). A superb vertex detector could see CP violation with 10^5 (10^6) flavor-tagged B_s (B_d) mesons within the CKM model. Because the effects could be significantly larger due to new physics, they should be searched for in existing or soon available data samples.

  4. On the measurement of leptonic CP violation

    International Nuclear Information System (INIS)

    Burguet Castell, J.; Gavela, M.B.; Gomez Cadenas, J.J.; Hernandez, P.; Mena, O.

    2001-01-01

    We show that the simultaneous determination of the leptonic CP-odd phase δ and the angle θ 13 from the subleading transitions ν e →ν μ and ν-bar e →ν-bar μ results generically, at fixed neutrino energy and baseline, in two degenerate solutions. In light of this, we refine a previous analysis of the sensitivity to leptonic CP violation at a neutrino factory, in the LMA-MSW scenario, by exploring the full range of δ and θ 13 . Furthermore, we take into account the expected uncertainties on the solar and atmospheric oscillation parameters and in the average Earth matter density along the neutrino path. An intermediate baseline of O(3000) km is still the best option to tackle CP violation, although a combination of two baselines turns out to be very important in resolving degeneracies

  5. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  6. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-07-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  7. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    International Nuclear Information System (INIS)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-01-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  8. New primers for amplification of cytochrome c oxidase subunit I barcode region designed for species of Decapoda (Crustacea

    Directory of Open Access Journals (Sweden)

    Fernando L. Mantelatto

    Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.

  9. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    Science.gov (United States)

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  10. The CpG island searcher: a new WWW resource.

    Science.gov (United States)

    Takai, Daiya; Jones, Peter A

    2003-01-01

    Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

  11. A possible explanation of the CP puzzle

    International Nuclear Information System (INIS)

    Takhtamyshev, Georgij

    1996-03-01

    The problem of mirror-reflection symmetry (MRS) and time-reversal symmetry (TRS) in our world is discussed. The opinion is expressed, that well-known experiments on parity violation and CP-violation can be treated as signals of some new, yet unknown, level of matter. An hypothesis, which can be used as a base for some future model or theory is formulated. In the framework of this hypothesis, experiments will demonstrate parity violation or CP-violation do not contradict MRS or TRS conservation. (author). 14 refs

  12. CP violation in rare K decays

    International Nuclear Information System (INIS)

    Ecker, G.

    1990-01-01

    The investigation of rare K decays calls for a unified treatment of short- and long-distance aspects as provided by chiral perturbation theory. For the standard model with three generations, the theoretical predictions for signals of CP violation in those decays are reviewed. With direct CP violation as the main target, special emphasis is given to the charge asymmetries in charged K decays and to the especially rare decays K L → π 0 ll-bar. Time dependent rate asymmetries in K 0 decays and the longitudinal muon polarization in K L → μ + μ - are also discussed. 50 refs., 3 figs., 1 tab. (Author)

  13. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  14. Measurement of CP--violating asymmetries in D0 → π+π- and D0 → K+K- decays at CDF

    International Nuclear Information System (INIS)

    2011-01-01

    We report on a measurement of CP-violating asymmetries (A CP ) in the Cabibbo-suppressed D 0 → π + π - and D 0 → K + K - decays reconstructed in a data sample corresponding to 5.9 fb -1 of integrated luminosity collected by the upgraded Collider Detector at Fermilab. We use the strong decay D* + → D 0 π + to identify the flavor of the charmed meson at production and exploit CP-conserving strong c(bar c) pair-production in p(bar p) collisions. High-statistics samples of Cabibbo-favored D 0 → K - π + decays with and without a D* ± tag are used to correct for instrumental effects and significantly reduce systematic uncertainties. We measure A CP (D 0 → π + π - ) = (+0.22 ± 0.24(stat) ± 0.11 (syst))% and A CP (D 0 → K + K - ) = (-0.24 ± 0.22 (stat) ± 0.09 (syst))%, in agreement with CP conservation. These are the most precise determinations from a single experiment to date. Under the assumption of negligible direct CP violation in D 0 → π + π - and D 0 → K + K - decays, the results provide an upper limit to the CP-violating asymmetry in D 0 mixing, |A CP ind (D 0 )| < 0.13% at the 90% confidence level.

  15. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... anticipate that it will also be useful for phylogeny and bar-coding studies....

  16. Mesoscopic pairing without superconductivity

    Science.gov (United States)

    Hofmann, Johannes

    2017-12-01

    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  17. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.

    2006-01-01

    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  18. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    Science.gov (United States)

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  19. Natural strong CP conservation in flipped physics

    Energy Technology Data Exchange (ETDEWEB)

    Frampton, P.H. (Institute of Field Physics, Department of Physics and Astronomy, University of North Carolina, Chapel Hill, NC (USA)); Kephart, T.W. (Department of Physics and Astronomy, Vanderbilt University, Nashville, TN (USA))

    1990-08-13

    A natural axion-free solution of the strong {ital CP} problem {ital at} {ital tree} {ital level} is noted within an E(6) grand unified theory. Using this as a springboard, it is shown that several flipped SU(5) theories which occur in superstring phenomenology contain within them a mechanism which enforces {bar {theta}}=0 at high accuracy.

  20. CP and B Physics: Progress and prospects

    International Nuclear Information System (INIS)

    Bjorken, J.D.

    1997-06-01

    This summary of the 2nd International Conference on B Physics and CP Violation (Honolulu, 24--27 March, 1997) contains, in addition to what is implied in the title, some extended remarks on the limitations of theory as well as speculations regarding nonperturbative enhancement of decay modes of the class b → s+ charmless hadrons

  1. CP violating phenomena and theoretical results

    International Nuclear Information System (INIS)

    Grimus, W.

    1987-01-01

    An introduction to CP violating phenomena is given and the standard model and its most popular low energy extensions in this context are reviewed. The discussion comprises the minimal supersymmetric extension of the standard model, left-right symmetry, the standard model with more than one Higgs doublet and gauged horizontal symmetries. (Author)

  2. Discrete symmetries, strong CP problem and gravity

    International Nuclear Information System (INIS)

    Senjanovic, G.

    1993-05-01

    Spontaneous breaking of parity or time reversal invariance offers a solution to the strong CP problem, the stability of which under quantum gravitational effects provides an upper limit on the scale of symmetry breaking. Even more important, these Planck scale effects may provide a simple and natural way out of the resulting domain wall problem. (author). 22 refs

  3. Sigma decomposition: the CP-odd Lagrangian

    Energy Technology Data Exchange (ETDEWEB)

    Hierro, I.M. [Dipartimento di Fisica “G. Galilei”, Università di Padova and INFN, Sezione di Padova,Via Marzolo 8, I-35131 Padua (Italy); Merlo, L. [Instituto de Física Teórica, IFT-UAM/CSIC, Universidad Autónoma de Madrid,Cantoblanco, 28049, Madrid (Spain); Rigolin, S. [Dipartimento di Fisica “G. Galilei”, Università di Padova and INFN, Sezione di Padova,Via Marzolo 8, I-35131 Padua (Italy)

    2016-04-04

    In Alonso et al., http://dx.doi.org/10.1007/JHEP12(2014)034, the CP-even sector of the effective chiral Lagrangian for a generic composite Higgs model with a symmetric coset has been constructed, up to four momenta. In this paper, the CP-odd couplings are studied within the same context. If only the Standard Model bosonic sources of custodial symmetry breaking are considered, then at most six independent operators form a basis. One of them is the weak-θ term linked to non-perturbative sources of CP violation, while the others describe CP-odd perturbative couplings between the Standard Model gauge bosons and an Higgs-like scalar belonging to the Goldstone boson sector. The procedure is then applied to three distinct exemplifying frameworks: the original SU(5)/SO(5) Georgi-Kaplan model, the minimal custodial-preserving SO(5)/SO(4) model and the minimal SU(3)/(SU(2)×U(1)) model, which intrinsically breaks custodial symmetry. Moreover, the projection of the high-energy electroweak effective theory to the low-energy chiral effective Lagrangian for a dynamical Higgs is performed, uncovering strong relations between the operator coefficients and pinpointing the differences with the elementary Higgs scenario.

  4. Masses, flavor mix and CP violation

    International Nuclear Information System (INIS)

    Chaussard, L.

    2004-06-01

    The author describes the relationships between masses, mixing of flavors and CP violation. This document is divided into 4 chapters: 1) fermions' masses, 2) mixing of flavors and CP violation, 3) beauty physics and 4) neutrino physics. In chapter 1 an attempt is made to explain what is behind the concepts of lepton mass and quark mass. As for neutrinos, the only neutral fermion, Dirac's and Majorana's views are exposed as well as their consequences. Fermion flavors are mixed in the process of mass generation and this mix is responsible for the breaking of CP and T symmetries. In chapter 2 the author shows how the analysis of particle oscillations from neutral mesons (K 0 , D 0 , B d 0 and B s 0 ) and from neutrinos can shed light on CP violation. Chapter 3 is dedicated to the contribution of beauty physics to the determination of the unitary triangle, through the oscillations of beauty mesons. In chapter 4 the author reviews the experimental results obtained recently concerning neutrino mass and neutrino oscillations and draws some perspectives on future neutrino experiments. (A.C.)

  5. CP violation in exclusive B decays

    International Nuclear Information System (INIS)

    Numata, Ken

    1991-01-01

    We review some decay modes of B 0 or B-bar 0 , with which we measure CP violation or phases of Cabibbo-Kobayashi-Maskawa (CKM) matrix elements. For simplicity, we restrict the topics to the cases of B d 0 -B d -bar 0 system. (author)

  6. CP violation in B decays and supersymmetry

    International Nuclear Information System (INIS)

    Barbieri, R.; Strumia, A.

    1997-01-01

    CP violation in hadronic B decays is studied in a definite and well-motivated framework of flavour physics and supersymmetry. Possible deviations from the standard model both in mixing and in decay amplitudes are discussed. An attempt is made to describe an experimental strategy for looking at these deviations and for measuring the relevant parameters. (orig.)

  7. [Review of experiments measuring CP nonconservation

    International Nuclear Information System (INIS)

    Gollin, G.D.

    1985-08-01

    Recent experiments setting limits on the magnitude of the ratio of two CP nonconservation parameters epsilon'/epsilon are discussed. Gauge theory calculations suggest that epsilon'/epsilon > .005, somewhat at odds with the results epsilon'/epsilon = -.0046 +- .0058 from a Chicago-Saclay measurement and epsilon'/epsilon = .0017 +- .0082 from a Yale-BNL experiment. 9 refs., 5 figs., 2 tabs

  8. A standard form for generalized CP transformations

    International Nuclear Information System (INIS)

    Ecker, G.; Grimus, W.; Neufeld, H.

    1987-01-01

    The investigation of general CP transformations leads to transformations of the form U → W T UW with unitary matrices U, W. It is shown that a basis for weak eigenstates can always be chosen such that W T UW has a certain real standard form. (Author)

  9. CP violation in $b$ hadrons at LHCb

    CERN Document Server

    Hicheur, Adlene

    2017-01-01

    The most recent results on $CP$ violation in b hadrons obtained by the LHCb Collaboration with Run I and years 2015-2016 of Run II are reviewed. The different types of violation are covered by the studies presented in this paper.

  10. A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

    Directory of Open Access Journals (Sweden)

    Andrés Alvarado

    Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

  11. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  12. First observation of CP violation in B¯0 → D(*)CP h0 decays by a combined time-dependent analysis of BaBar And Belle Data

    Energy Technology Data Exchange (ETDEWEB)

    Abdesselam, A. [Univ. of Tabuk, Tabuk (Kingdom of Saudi Arabia). et al.

    2015-09-16

    We report a measurement of the time-dependent CP asymmetry of B¯0 → D(*)CPh0 decays, where the light neutral hadron h0 is a π0, η, or ω meson, and the neutral D meson is reconstructed in the CP eigenstates K+K, K0Sπ0, or K0Sω. The measurement is performed combining the final data samples collected at the Υ(4S) resonance by the BABAR and Belle experiments at the asymmetric-energy B factories PEP-II at SLAC and KEKB at KEK, respectively. The data samples contain (471±3)×106 BB¯ pairs recorded by the BABAR detector and (772±11)×106 BB¯ pairs recorded by the Belle detector. We measure the CP asymmetry parameters –ηfS=+0.66±0.10(stat)±0.06(syst) and C=–0.02±0.07(stat)±0.03(syst). These results correspond to the first observation of CP violation in B¯0 → D(*)CPh0 decays. As a result, the hypothesis of no mixing-induced CP violation is excluded in these decays at the level of 5.4 standard deviations.

  13. Measurement of CP-Violating Asymmetries in B0 Decays to CP Eigenstates

    Energy Technology Data Exchange (ETDEWEB)

    MacFarlane, David B

    2001-02-26

    We present measurements of time-dependent CP-violating asymmetries in neutral B decays to several CP eigenstates. The measurement uses a data sample of 23 million {Upsilon}(4S) {yields} B{bar B} decays collected by the BABAR detector at the PEP-II asymmetric B Factory at SLAC. In this sample, we find events where one neutral B meson is fully reconstructed in a CP eigenstate containing charmonium and the flavor of the other neutral B meson is determined from its decay products. The amplitude of the CP-violating asymmetry, which in the Standard Model is proportional to sin2{beta}, is derived from the decay time distributions in such events. The result is sin2{beta} = 0.34 {+-} 0.20 (stat) {+-} 0.05 (syst).

  14. Measurement of CP-violating asymmetries in B0 decays to CP eigenstates.

    Science.gov (United States)

    Aubert, B; Boutigny, D; De Bonis, I; Gaillard, J M; Jeremie, A; Karyotakis, Y; Lees, J P; Robbe, P; Tisserand, V; Palano, A; Chen, G P; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Reinertsen, P L; Stugu, B; Abbott, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Clark, A R; Dardin, S; Day, C; Dow, S F; Elioff, T; Fan, Q; Gaponenko, I; Gill, M S; Goozen, F R; Gowdy, S J; Gritsan, A; Groysman, Y; Jacobsen, R G; Jared, R C; Kadel, R W; Kadyk, J; Karcher, A; Kerth, L T; Kipnis, I; Kluth, S; Kolomensky, Y G; Kral, J F; Lafever, R; LeClerc, C; Levi, M E; Lewis, S A; Lionberger, C; Liu, T; Long, M; Lynch, G; Marino, M; Marks, K; Meyer, A B; Mokhtarani, A; Momayezi, M; Nyman, M; Oddone, P J; Ohnemus, J; Oshatz, D; Patton, S; Perazzo, A; Peters, C; Pope, W; Pripstein, M; Quarrie, D R; Rasson, J E; Roe, N A; Romosan, A; Ronan, M T; Shelkov, V G; Stone, R; Telnov, A V; von der Lippe, H; Weber, T; Wenzel, W A; Zisman, M S; Bright-Thomas, P G; Harrison, T J; Hawkes, C M; Kirk, A; Knowles, D J; O'Neale, S W; Watson, A T; Watson, N K; Deppermann, T; Koch, H; Krug, J; Kunze, M; Lewandowski, B; Peters, K; Schmuecker, H; Steinke, M; Andress, J C; Barlow, N R; Bhimji, W; Chevalier, N; Clark, P J; Cottingham, W N; De Groot, N; Dyce, N; Foster, B; Mass, A; McFall, J D; Wallom, D; Wilson, F F; Abe, K; Hearty, C; Mattison, T S; McKenna, J A; Thiessen, D; Camanzi, B; Jolly, S; McKemey, A K; Tinslay, J; Blinov, V E; Bukin, A D; Bukin, D A; Buzykaev, A R; Dubrovin, M S; Golubev, V B; Ivanchenko, V N; Kolachev, G M; Korol, A A; Kravchenko, E A; Onuchin, A P; Salnikov, A A; Serednyakov, S I; Skovpen, Y I; Telnov, V I; Yushkov, A N; Lankford, A J; Mandelkern, M; McMahon, S; Stoker, D P; Ahsan, A; Buchanan, C; Chun, S; MacFarlane, D B; Prell, S; Rahatlou, S; Raven, G; Sharma, V; Burke, S; Campagnari, C; Dahmes, B; Hale, D; Hart, P A; Kuznetsova, N; Kyre, S; Levy, S L; Long, O; Lu, A; Richman, J D; Verkerke, W; Witherell, M; Yellin, S; Beringer, J; Dorfan, D E; Eisner, A M; Frey, A; Grillo, A A; Grothe, M; Heusch, C A; Johnson, R P; Kroeger, W; Lockman, W S; Pulliam, T; Sadrozinski, H; Schalk, T; Schmitz, R E; Schumm, B A; Seiden, A; Spencer, E N; Turri, M; Walkowiak, W; Williams, D C; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Hanson, J E; Hitlin, D G; Metzler, S; Oyang, J; Porter, F C; Ryd, A; Samuel, A; Weaver, M; Yang, S; Zhu, R Y; Devmal, S; Geld, T L; Jayatilleke, S; Jayatilleke, S M; Mancinelli, G; Meadows, B T; Sokoloff, M D; Bloom, P; Fahey, S; Ford, W T; Gaede, F; van Hoek, W C; Johnson, D R; Michael, A K; Nauenberg, U; Olivas, A; Park, H; Rankin, P; Roy, J; Sen, S; Smith, J G; Wagner, D L; Blouw, J; Harton, J L; Krishnamurthy, M; Soffer, A; Toki, W H; Warner, D W; Wilson, R J; Zhang, J; Brandt, T; Brose, J; Colberg, T; Dahlinger, G; Dickopp, M; Dubitzky, R S; Eckstein, P; Futterschneider, H; Krause, R; Maly, E; Müller-Pfefferkorn, R; Otto, S; Schubert, K R; Schwierz, R; Spaan, B; Wilden, L; Behr, L; Bernard, D; Bonneaud, G R; Brochard, F; Cohen-Tanugi, J; Ferrag, S; Fouque, G; Gastaldi, F; Matricon, P; Mora de Freitas, P; Renard, C; Roussot, E; T'Jampens, S; Thiebaux, C; Vasileiadis, G; Verderi, M; Anjomshoaa, A; Bernet, R; Di Lodovico, F; Khan, A; Muheim, F; Playfer, S; Swain, J E; Falbo, M; Bozzi, C; Dittongo, S; Folegani, M; Piemontese, L; Treadwell, E; Anulli, F; Baldini-Ferroli, R; Calcaterra, A; de Sangro, R; Falciai, D; Finocchiaro, G; Patteri, P; Peruzzi, I M; Piccolo, M; Xie, Y; Zallo, A; Bagnasco, S; Buzzo, A; Contri, R; Crosetti, G; Lo Vetere, M; Macri, M; Monge, M R; Pallavicini, M; Passaggio, S; Pastore, F C; Patrignani, C; Pia, M G; Robutti, E; Santroni, A; Morii, M; Bartoldus, R; Dignan, T; Hamilton, R; Mallik, U; Cochran, J; Crawley, H B; Fischer, P A; Lamsa, J; McKay, R; Meyer, W T; Rosenberg, E I; Albert, J N; Beigbeder, C; Benkebil, M; Breton, D; Cizeron, R; Du, S; Grosdidier, G; Hast, C; Höcker, A; LePeltier, V; Lutz, A M; Plaszczynski, S; Schune, M H; Trincaz-Duvoid, S; Truong, K; Valassi, A; Wormser, G; Bionta, R M; Brigljević, V; Brooks, A; Fackler, O; Fujino, D; Lange, D J; Mugge, M; O'Connor, T G; Pedrotti, B; Shi, X; van Bibber, K; Wenaus, T J; Wright, D M; Wuest, C R; Yamamoto, B; Carroll, M; Fry, J R; Gabathuler, E; Gamet, R; George, M; Kay, M; Payne, D J; Sloane, R J; Touramanis, C; Aspinwall, M L; Bowerman, D A; Dauncey, P D; Egede, U; Eschrich, I; Gunawardane, N J; Martin, R; Nash, J A; Price, D R; Sanders, P; Smith, D; Azzopardi, D E; Back, J J; Dixon, P; Harrison, P F; Newman-Coburn, D; Potter, R J; Shorthouse, H W; Strother, P; Vidal, P B; Williams, M I; Cowan, G; George, S; Green, M G; Kurup, A; Marker, C E; McGrath, P; McMahon, T R; Salvatore, F; Scott, I; Vaitsas, G; Brown, D; Davis, C L; Ford, K; Li, Y; Pavlovich, J; Allison, J; Barlow, R J; Boyd, J T; Fullwood, J; Jackson, F; Lafferty, G D; Savvas, N; Simopoulos, E T; Thompson, R J; Weatherall, J H; Bard, R; Farbin, A; Jawahery, A; Lillard, V; Olsen, J; Roberts, D A; Schieck, J R; Blaylock, G; Dallapiccola, C; Flood, K T; Hertzbach, S S; Kofler, R; Lin, C S; Staengle, H; Willocq, S; Wittlin, J; Brau, B; Cowan, R; Sciolla, G; Taylor, F; Yamamoto, R K; Britton, D I; Milek, M; Patel, P M; Trischuk, J; Lanni, F; Palombo, F; Bauer, J M; Booke, M; Cremaldi, L; Eschenberg, V; Kroeger, R; Reep, M; Reidy, J; Sanders, D A; Summers, D J; Beaulieu, M; Martin, J P; Nief, J Y; Seitz, R; Taras, P; Zacek, V; Nicholson, H; Sutton, C S; Cavallo, N; Cartaro, C; De Nardo, G; Fabozzi, F; Gatto, C; Lista, L; Paolucci, P; Piccolo, D; Sciacca, C; LoSecco, J M; Alsmiller, J R; Gabriel, T A; Handler, T; Heck, J; Brau, J E; Frey, R; Iwasaki, M; Sinev, N B; Strom, D; Borsato, E; Colecchia, F; Dal Corso, F; Galeazzi, F; Margoni, M; Marzolla, M; Michelon, G; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Torassa, E; Voci, C; Bailly, P; Benayoun, M; Briand, H; Chauveau, J; David, P; De La Vaissière, C; Del Buono, L; Genat, J F; Hamon, O; Le Diberder, F; Lebbolo, H; Leruste, P; Lory, J; Martin, L; Roos, L; Stark, J; Versillé, S; Zhang, B; Manfredi, P F; Ratti, L; Re, V; Speziali, V; Frank, E D; Gladney, L; Guo, Q H; Panetta, J H; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Bosi, F; Carpinelli, M; Forti, F; Giorgi, M A; Lusiani, A; Martinez-Vidal, F; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Sandrelli, F; Simi, G; Triggiani, G; Walsh, J; Hairre, M; Judd, D; Paick, K; Turnbull, L; Wagoner, D E; Albert, J; Bula, C; Fernholz, R; Lu, C; McDonald, K T; Miftakov, V; Sands, B; Schaffner, S F; Smith, A J; Tumanov, A; Varnes, E W; Bronzini, F; Buccheri, A; Bulfon, C; Cavoto, G; del Re, D; Faccini, R; Ferrarotto, F; Ferroni, F; Fratini, K; Lamanna, E; Leonardi, E; Mazzoni, M A; Morganti, S; Piredda, G; Safai Tehrani, F; Serra, M; Voena, C; Waldi, R; Jacques, P F; Kalelkar, M; Plano, R J; Adye, T; Claxton, B; Franek, B; Galagedera, S; Geddes, N I; Gopal, G P; Lidbury, J; Xella, S M; Aleksan, R; Besson, P; Bourgeois, P; De Domenico, G; Emery, S; Gaidot, A; Ganzhur, S F; Gosset, L; Hamel de Monchenault, G; Kozanecki, W; Langer, M; London, G W; Mayer, B; Serfass, B; Vasseur, G; Yeche, C; Zito, M; Copty, N; Purohit, M V; Singh, H; Yumiceva, F X; Adam, I; Anthony, P L; Aston, D; Baird, K; Bartelt, J; Becla, J; Bell, R; Bloom, E; Boeheim, C T; Boyarski, A M; Boyce, R F; Bulos, F; Burgess, W; Byers, B; Calderini, G; Claus, R; Convery, M R; Coombes, R; Cottrell, L; Coupal, D P; Coward, D H; Craddock, W W; DeStaebler, H; Dorfan, J; Doser, M; Dunwoodie, W; Ecklund, S; Fieguth, T H; Field, R C; Freytag, D R; Glanzman, T; Godfrey, G L; Grosso, P; Haller, G; Hanushevsky, A; Harris, J; Hasan, A; Hewett, J L; Himel, T; Huffer, M E; Innes, W R; Jessop, C P; Kawahara, H; Keller, L; Kelsey, M H; Kim, P; Klaisner, L A; Kocian, M L; Krebs, H J; Kunz, P F; Langenegger, U; Langeveld, W; Leith, D W; Louie, S K; Luitz, S; Luth, V; Lynch, H L; MacDonald, J; Manzin, G; Mariske, H; McCulloch, M; McShurley, D; Menke, S; Messner, R; Metcalfe, S; Moffeit, K C; Mount, R; Muller, D R; Nelson, D; Nordby, M; O'Grady, C P; O'Neill, F G; Oxoby, G; Pavel, T; Perl, J; Petrak, S; Putallaz, G; Quinn, H; Raines, P E; Ratcliff, B N; Reif, R; Robertson, S H; Rochester, L S; Roodman, A; Russell, J J; Sapozhnikov, L; Saxton, O H; Schietinger, T; Schindler, R H; Schwiening, J; Seeman, J T; Serbo, V V; Skarpass, K; Snyder, A; Soha, A; Spanier, S M; Stahl, A; Stelzer, J; Su, D; Sullivan, M K; Talby, M; Tanaka, H A; Va'vra, J; Wagner, S R; Weinstein, A J; White, J L; Wienands, U; Wisniewski, W J; Young, C C; Zioulas, G; Burchat, P R; Cheng, C H; Kirkby, D; Meyer, T I; Roat, C; De Silva, A; Henderson, R; Berridge, S; Bugg, W; Cohn, H; Hart, E; Weidemann, A W; Benninger, T; Izen, J M; Kitayama, I; Lou, X C; Turcotte, M; Bianchi, F; Bona, M; Di Girolamo, B; Gamba, D; Smol, A; Zanin, D; Bosisio, L; Della Ricca, G; Lanceri, L; Pompili, A; Poropat, P; Vuagnin, G; Panvini, R S; Brown, C M; Kowalewski, R; Roney, J M; Band, H R; Charles, E; Dasu, S; Elmer, P; Hu, H; Johnson, J R; Nielsen, J; Orejudos, W; Pan, Y; Prepost, R; Scott, I J; von Wimmersperg-Toeller, J H; Wu, S L; Yu, Z; Zobernig, H; Kordich, T M; Moore, T B; Neal, H

    2001-03-19

    We present measurements of time-dependent CP-violating asymmetries in neutral B decays to several CP eigenstates. The measurement uses a data sample of 23x10(6) Upsilon(4S)-->BbarB decays collected by the BABAR detector at the PEP-II asymmetric B Factory at SLAC. In this sample, we find events in which one neutral B meson is fully reconstructed in a CP eigenstate containing charmonium and the flavor of the other neutral B meson is determined from its decay products. The amplitude of the CP-violating asymmetry, which in the standard model is proportional to sin2beta, is derived from the decay time distributions in such events. The result is sin2beta = 0.34+/-0.20 (stat)+/-0.05 (syst).

  15. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  16. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  17. [Paired kidneys in transplant].

    Science.gov (United States)

    Regueiro López, Juan C; Leva Vallejo, Manuel; Prieto Castro, Rafael; Anglada Curado, Francisco; Vela Jiménez, Francisco; Ruiz García, Jesús

    2009-02-01

    Many factors affect the graft and patient survival on the renal transplant outcome. These factors depend so much of the recipient and donor. We accomplished a study trying to circumvent factors that depend on the donor. We checked the paired kidneys originating of a same donor cadaver. We examined the risk factors in the evolution and follow-up in 278 couples of kidney transplant. We describe their differences, significance, the graft and patient survival, their functionality in 3 and 5 years and the risk factors implicated in their function. We study immunogenic and no immunogenic variables, trying to explain the inferior results in the grafts that are established secondly. We regroup the paired kidneys in those that they did not show paired initial function within the same couple. The results yield a discreet deterioration in the graft and patient survival for second group establish, superior creatinina concentration, without obtaining statistical significance. The Cox regression study establishes the early rejection (inferior to three months) and DR incompatibility values like risk factors. This model of paired kidneys would be able to get close to best-suited form for risk factors analysis in kidney transplant from cadaver donors, if more patients examine themselves in the same way. The paired kidneys originating from the same donor do not show the same function in spite of sharing the same conditions of the donor and perioperative management.

  18. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  19. A search for CP violation in hyperon decays by the hyper-CP experiment at Fermilab

    International Nuclear Information System (INIS)

    Holmstrom, T.

    2002-01-01

    The Hyper-CP collaboration is performing a precision search for CP violation in hyperon decays, these decays are sensitive to sources of CP violation to which neutral kaon decays are not. The measured CP observable is proportional to the difference between the product of the Ξ and Λ decay α parameters and that of the CP-conjugate decays. About 2.5 billion fully-reconstructed Ξ - → Λπ - → pπ - π - and Ξ-bar + → Λ-barπ + → p-barπ + π + decays were taken in 2 fixed-target runs at Fermilab, allowing a statistical sensitivity of about 2.10 -4 in the CP asymmetry. These 2 runs gave us the largest sample of Ξ and Ω ever collected. An initial study has been done on a fraction of the data and we have obtained: A ΞΛ equals (-7±12(statistical)±6.2(systematic))*10 -4 . Other preliminary results are also presented in this series of slides

  20. Unraveling the sequence-dependent polymorphic behavior of d(CpG) steps in B-DNA.

    Science.gov (United States)

    Dans, Pablo Daniel; Faustino, Ignacio; Battistini, Federica; Zakrzewska, Krystyna; Lavery, Richard; Orozco, Modesto

    2014-10-01

    We have made a detailed study of one of the most surprising sources of polymorphism in B-DNA: the high twist/low twist (HT/LT) conformational change in the d(CpG) base pair step. Using extensive computations, complemented with database analysis, we were able to characterize the twist polymorphism in the d(CpG) step in all the possible tetranucleotide environment. We found that twist polymorphism is coupled with BI/BII transitions, and, quite surprisingly, with slide polymorphism in the neighboring step. Unexpectedly, the penetration of cations into the minor groove of the d(CpG) step seems to be the key element in promoting twist transitions. The tetranucleotide environment also plays an important role in the sequence-dependent d(CpG) polymorphism. In this connection, we have detected a previously unexplored intramolecular C-H···O hydrogen bond interaction that stabilizes the low twist state when 3'-purines flank the d(CpG) step. This work explains a coupled mechanism involving several apparently uncorrelated conformational transitions that has only been partially inferred by earlier experimental or theoretical studies. Our results provide a complete description of twist polymorphism in d(CpG) steps and a detailed picture of the molecular choreography associated with this conformational change. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Junctionless Cooper pair transistor

    Energy Technology Data Exchange (ETDEWEB)

    Arutyunov, K. Yu., E-mail: konstantin.yu.arutyunov@jyu.fi [National Research University Higher School of Economics , Moscow Institute of Electronics and Mathematics, 101000 Moscow (Russian Federation); P.L. Kapitza Institute for Physical Problems RAS , Moscow 119334 (Russian Federation); Lehtinen, J.S. [VTT Technical Research Centre of Finland Ltd., Centre for Metrology MIKES, P.O. Box 1000, FI-02044 VTT (Finland)

    2017-02-15

    Highlights: • Junctionless Cooper pair box. • Quantum phase slips. • Coulomb blockade and gate modulation of the Coulomb gap. - Abstract: Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current–voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  2. Probing flavor and CP in decays of beauty and charm

    Energy Technology Data Exchange (ETDEWEB)

    Schacht, Stefan

    2013-07-10

    In order to probe for new physics beyond the Standard Model of particle physics, we explore decays of beauty and charm mesons. In the b sector we find ourselves in the realm of precision physics so that we can improve significantly the bounds on supersymmetric flavor violation from new theoretical and experimental progress in anti B → anti K{sup (*)}l{sup +}l{sup -}. From these bounds we derive several phenomenological implications, as bounds on Radiative Flavor Violation models that are partly even sharper than the ones from Kaon physics. In order to improve the bounds on new physics models from anti B → anti K{sup (*)}l{sup +}l{sup -} even more in the future, we extract subsequently anti B → anti K{sup *} form factor ratios from data at high invariant lepton pair masses. These are the current bottleneck for the advancement in precision. In the charm sector unexpectedly large CP violation was measured recently. Currently, the experimental situation is unsettled. We work here on the main problem that one cannot reliably calculate the hadronic part from first principles, i.e., cannot exclude possible enhancements from this source. We perform for the first time a comprehensive SU(3){sub F} analysis of D → P{sub 8}P{sub 8} decays including linear breaking in full generality. We find the SU(3){sub F} expansion to be indeed working. Furthermore, the fit shows a large triplet matrix element enhancement that cannot be excluded for sure without having a dynamical theory at hand. We show as a proof of principle that with significantly improved data we could disentangle the triplet model including the Standard Model from other new physics models. Using reasonable theoretical input from QCD factorization we can eliminate some of the many degrees of freedom of the pure SU(3){sub F} analysis. This can sharpen partially the correlation between D-decay CP asymmetries and branching ratios.

  3. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  4. Direct CP violation in B -> pi sup +pi sup -pi. Determination of alpha without discrete ambiguity

    CERN Document Server

    Leitner, O; Thomas, A W

    2002-01-01

    Direct CP violation in the hadronic decays B-bar sup 0 -> pi sup +pi sup -pi sup 0 is investigated near the peak of the rho sup 0 taking into account the effect of rho - omega mixing. Branching ratio for processes B sup+- sup , sup 0 -> rho sup+- sup , sup 0 pi sup+- sup , sup 0 and B sup - -> omega pi sup - are calculated as well. We find that the CP violation asymmetry is strongly dependent on the CKM matrix elements. For a fixed N sub c sup e sup f sup f , the CP violation asymmetry, a, has a maximum of order - 40% to - 70% for B-bar sup 0 -> rho sup 0 (omega)pi sup 0 when the invariant mass of the pi sup +pi sup - pair is in the vicinity of the omega resonance. The sensitivity of the asymmetry to N sub c sup e sup f sup f is small in that case. Moreover, we find that in the range of N sub c sup e sup f sup f which is allowed by the most recent experimental branching ratios from the BABAR, BELLE and CLEO Collaborations, the sign of sin delta is always positive. Thus, a measurement of direct CP violation in...

  5. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  6. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    Science.gov (United States)

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Structural and Electrochemical Consequences of [Cp*] Ligand Protonation.

    Science.gov (United States)

    Peng, Yun; Ramos-Garcés, Mario V; Lionetti, Davide; Blakemore, James D

    2017-09-05

    There are few examples of the isolation of analogous metal complexes bearing [η 5 -Cp*] and [η 4 -Cp*H] (Cp* = pentamethylcyclopentadienyl) complexes within the same metal/ligand framework, despite the relevance of such structures to catalytic applications. Recently, protonation of Cp*Rh(bpy) (bpy = 2,2'-bipyridyl) has been shown to yield a complex bearing the uncommon [η 4 -Cp*H] ligand, rather than generating a [Rh III -H] complex. We now report the purification and isolation of this protonated species, as well as characterization of analogous complexes of 1,10-phenanthroline (phen). Specifically, reaction of Cp*Rh(bpy) or Cp*Rh(phen) with 1 equiv of Et 3 NH + Br - affords rhodium compounds bearing endo-η 4 -pentamethylcyclopentadiene (η 4 -Cp*H) as a ligand. NMR spectroscopy and single-crystal X-ray diffraction studies confirm protonation of the Cp* ligand, rather than formation of metal hydride complexes. Analysis of new structural data and electronic spectra suggests that phen is significantly reduced in Cp*Rh(phen), similar to the case of Cp*Rh(bpy). Backbonding interactions with olefinic motifs are activated by formation of [η 4 -Cp*H]; protonation of [Cp*] stabilizes the low-valent metal center and results in loss of reduced character on the diimine ligands. In accord with these changes in electronic structure, electrochemical studies reveal a distinct manifold of redox processes that are accessible in the [Cp*H] complexes in comparison with their [Cp*] analogues; these processes suggest new applications in catalysis for the complexes bearing endo-η 4 -Cp*H.

  8. Testing CP in K/sub μ/3 decays

    International Nuclear Information System (INIS)

    Leurer, M.

    1989-01-01

    K factories will open the way for high-precision CP tests in K/sub μ/ 3 decays. The standard model does not predict CP breaking in this process. We consider here the effects of nonstandard interactions mediated by vector and scalar particles and by leptoquarks. We show that, for the only experimentally measurable quantity, vector particles alone never induce CP violation, and give a general expression for the CP breaking induced by scalars and leptoquarks

  9. Soft CP violation in K-meson systems

    International Nuclear Information System (INIS)

    Montero, J.C.; Nishi, C.C.; Pleitez, V.; Ravinez, O.; Rodriguez, M.C.

    2006-01-01

    We consider a model with soft CP violation which accommodates the CP violation in the neutral kaons even if we assume that the Cabibbo-Kobayashi-Maskawa mixing matrix is real and the sources of CP violation are three complex vacuum expectation values and a trilinear coupling in the scalar potential. We show that for some reasonable values of the masses and other parameters the model allows us to explain all the observed CP violation processes in the K 0 -K 0 system

  10. The CP 1 type separators-superheaters

    International Nuclear Information System (INIS)

    Palacio, G.

    1984-01-01

    Analysis of the functionnement of the separators superheaters in the first French 900 MW PWR units (Fessenhein 1-2 and Bugey 2-3-4-5) and in the program CP 1 units: localization of the separators superheaters, design, tests and choice of the materials, description of the separators superheaters (shells, separators, superheater bundles, internal lagging, purging tank and condensate stank, steam line equipments); study of the various operation modes (nominals, transients, malfunctions, conservation during shutdowns) and the in service behaviour of the components; study of the modifications on the CP 1 equipments and their behaviour; description of the measures, tests and on site controls (controls during planned shutdowns and controls during service) [fr

  11. A CP violetion model of cosmological origin

    International Nuclear Information System (INIS)

    Truppel, W.L.

    1987-01-01

    It's presented a model of spontaneous violation of the CP symmetry whose mechanism of symmetry breaking is of cosmological nature. The main feature is the conformal coupling of the field of a λφ 4 theory with a background gravitational field. We show that, for the open Friedmann model of the universe, the reason of the critical temperaTure for the symmetry restoration to the equilibrium temperature of the universe rrmains constant, so that either the symmetry breaking never happened or, if happened, it can't be reverted by means of thermal effects. Upon coupling the boson to a fermion, this symmetry breaking id related to the CP non-conservation in two distinct ways: violating the P and T symmetries, and violating the C and T symmetries. (author) [pt

  12. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  13. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  14. Origin of CP-violation through quark mass matrix

    International Nuclear Information System (INIS)

    Kang, K.

    1990-01-01

    After a brief review of the CP violation models, we trace the origin of CP-phases from the phases of a class of quark mass matrices compatible with the calculability condition. The case of three generations corresponding to the standard milliweak CP model is discussed explicitly for the generic case of Fritzsch-type mass matrices. (orig.)

  15. James Cronin, CP Violation, and the Pierre Auger Observatory

    Science.gov (United States)

    dropdown arrow Site Map A-Z Index Menu Synopsis James Cronin, CP Violation and the Pierre Auger Observatory matter over antimatter."1 "The experiment uncovered the CP [charge-parity] violation, or a with Additional Information Additional information about James Cronin and the charge-parity (CP

  16. Val L. Fitch, the CP Violation, and Antimatter

    Science.gov (United States)

    dropdown arrow Site Map A-Z Index Menu Synopsis Val L. Fitch, the CP Violation, and Antimatter Resources ) 'to verify a fundamental tenet of physics, known as CP [charge-parity] symmetry, by showing that two into two pi mesons. Cronin and Fitch had found an example of CP violation. The discovery's

  17. Neutrinos as a probe of CP-violation and leptogenesis

    Indian Academy of Sciences (India)

    Establishing CP-violation in the lepton sector is one of the most challenging future tasks in neutrino physics. The lepton mixing matrix contains one Dirac phase and, if neutrinos are Majorana particles, two additional CP-violating phases. I will review the main theoretical aspects of CP-violation in the lepton sector. Then, I will ...

  18. Light Higgs boson in THDM with explicit CP violation

    International Nuclear Information System (INIS)

    Akhmetzyanova, Eh.N.; Dolgopolov, M.V.; Smirnov, I.A.; Dubinin, M.N.

    2005-01-01

    The effective Lagrangian of the two-doublet Higgs sector with complex parameters is considered in the case of Minimal Supersymmetric Model with explicit CP violation. Light Higgs boson decay widths are calculated for the scenario with maximal mixing of CP even and CP odd states [ru

  19. A new look at CP violation

    International Nuclear Information System (INIS)

    Iqbal, M.J.; Miller, G.A.

    1989-12-01

    The CP violating (CPV) kaonic matrix elements ε', ImA 0 , and ImA 2 , are used to compute CPV observables in baryonic systems. The numerical results for the electric dipole moment and the difference between Λ and Λ - decay parameters are similar to other approaches that use quark operators. Relations between the neutron electric dipole moment, CPV pion-nucleon coupling constants, and Λ decay parameters are derived

  20. NODAL interpreter for CP/M

    International Nuclear Information System (INIS)

    Oide, Katsunobu.

    1982-11-01

    A NODAL interpreter which works under CP/M operating system is made for microcomputers. This interpreter language named NODAL-80 has a similar structure to the NODAL of SPS, but its commands, variables, and expressions are modified to increase the flexibility of programming. NODAL-80 also uses a simple intermediate code to make the execution speed fast without imposing any restriction on the dynamic feature of NODAL language. (author)

  1. Status of CP violation in hyperon decays

    International Nuclear Information System (INIS)

    He, X.G.; Steger, H.; Valencia, G.

    1991-01-01

    We update the estimate of CP violating observables in hyperon decays. We consider the effect of a heavy top quark, as well as recent bounds on the CKM angles. We present an estimate of the uncertainties associated with the evaluation of the hadronic matrix elements by comparing different models. We find that A(Λ - 0 ) is likely to occur at the 10 -5 level within the standard model, although it could reach 10 -4 . (orig.)

  2. CP violating mixings of toponium states

    International Nuclear Information System (INIS)

    Loew, U.

    1988-01-01

    In the present thesis the possibility of an admixture χ of the 2 1 P 1 toponium state which has the CP quantum number -1 to the 2 3 S 1 toponium state with CP quantum number +1 is discussed. The value of χ was estimated in 3 different models of the electroweak interaction. In the standard model the lowest contribution to χ is of 6th order in the weak coupling g or of 4th order in g and of 2nd order in the strong coupling g S . The Feynman diagrams which contribute to χ contain 2 loops. According to a crude estimate of these diagrams it is expected that they yield a contribution smaller than 10 -10 . In the model with extended Higgs sector - for a top-quark mass of 45 GeV - a value of 7x10 -4 resulted for χ. For a top-quark mass of 100 GeV it is expected that χ is even of the order of magnitude of 10 -2 . The large contributions originate from CP violating coupling neutral Higgs particles. In the right-left symmetric model two contributions to χ were calculated. The first one results from the exchange of the right- and left-handed W bosons. For a mass m R =500 GeV this contribution lies at χ ≅ 10 -14 . The second contribution is again based on the exchange of two neutral CP violating coupling Higgs particles. It lies in the order of magnitude at 10 -8 . Possibilities were indicated to find the estimated admixture χ in an experiment. A correlation in the 3-gluon decay of toponium and the decay of toponium into exclusive decays was discussed. (orig./HSI) [de

  3. CP-violation and electric dipole moments

    Energy Technology Data Exchange (ETDEWEB)

    Le Dall, Matthias; Ritz, Adam, E-mail: aritz@uvic.ca [University of Victoria, Department of Physics and Astronomy (Canada)

    2013-03-15

    Searches for intrinsic electric dipole moments of nucleons, atoms and molecules are precision flavour-diagonal probes of new -odd physics. We review and summarise the effective field theory analysis of the observable EDMs in terms of a general set of CP-odd operators at 1 GeV, and the ensuing model-independent constraints on new physics. We also discuss the implications for supersymmetric models, in light of the mass limits emerging from the LHC.

  4. Frustrated Lewis Pairs

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 11. Frustrated Lewis Pairs : Enabling via inability. Sanjoy Mukherjee ... Author Affiliations. Sanjoy Mukherjee Pakkirisamy Thilagar1. Department of Inorgainic and Physical Chemistry Indian Institute of Science Bangalore 560 012, India.

  5. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  6. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.

    2013-01-01

    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  7. On the Nature of CP Pup

    Science.gov (United States)

    Mason, E.; Orio, M.; Mukai, K.; Bianchini, A.; deMartino, D.; diMille, F.; Williams, R. E.

    2013-01-01

    We present new X-ray and optical spectra of the old nova CP Pup (nova Pup 1942) obtained with Chandra and the CTIO 4m telescope. The X-ray spectrum reveals a multi-temperature optically thin plasma reaching a maximum temperature of 36+19 keV 16 absorbed by local complex neutral material. The time resolved optical spectroscopy confirms the presence of the 1.47 hr period, with cycle-to-cycle amplitude changes, as well as of an additional long term modulation which is suggestive either of a longer pe- riod or of non-Keplerian velocities in the emission line regions. These new observational facts add further support to CP Pup as a magnetic cataclysmic variable (mCV). We compare the mCV and the non-mCV scenarios and while we cannot conclude whether CP Pup is a long period system, all observational evidences point at an intermediate polar (IP) type CV.

  8. CP Violation in Heavy MSSM Higgs Scenarios

    CERN Document Server

    Carena, M; Lee, J S; Pilaftsis, A; Wagner, C E M

    2016-01-01

    We introduce and explore new heavy Higgs scenarios in the Minimal Supersymmetric Standard Model (MSSM) with explicit CP violation, which have important phenomenological implications that may be testable at the LHC. For soft supersymmetry-breaking scales M_S above a few TeV and a charged Higgs boson mass M_H+ above a few hundred GeV, new physics effects including those from explicit CP violation decouple from the light Higgs boson sector. However, such effects can significantly alter the phenomenology of the heavy Higgs bosons while still being consistent with constraints from low-energy observables, for instance electric dipole moments. To consider scenarios with a charged Higgs boson much heavier than the Standard Model (SM) particles but much lighter than the supersymmetric particles, we revisit previous calculations of the MSSM Higgs sector. We compute the Higgs boson masses in the presence of CP violating phases, implementing improved matching and renormalization group (RG) effects, as well as two-loop RG...

  9. Quaternionic potentials and CP-violation

    International Nuclear Information System (INIS)

    Nishi, Celso Chikahiro

    2000-01-01

    Full text follows: In the formulation of Quantum Mechanics by using a non-commutative ring of quaternions, we attempt to solve the Schroedinger equation with quaternionic potentials. Decay processes can easily be modeled by including complex imaginary potentials. Although, it could be explained as a transition between states under action of a perturbation. Purely imaginary quaternionic potentials can be used to describe CP-violation effects. The neutral kaon system, K 0 - K-bar 0 or K L - K S , represents an example of CP-violation phenomenon. The inclusion of quaternionic potentials imply a reformulation of the whole quantum theory. The use of a quaternionic algebra in discussing the Schroedinger equation leads to the lost of time reversal invariance (T), closely connected to CP violation by the well-known CPT theorem. In particular, we study the Schroedinger equation in presence of a quaternionic potential barrier given in terms of V, real potential acting in the region of width a, and jW, purely quaternionic potential acting in the region of width b. Different cases, |W|/V and b/a, are discussed in view of possible deviations of standard Quantum Mechanics. The complex linear Schroedinger equation is solved for stationary states. The explicit solution contains complex and quaternionic transmission/reflection coefficients. A wave packet treatment needs to make a more realistic and physical description. We briefly discuss possible interpretations and remaining questions. (author)

  10. Excited cooper pairs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)

    2001-02-01

    Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

  11. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...

  12. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  13. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....

  14. Multi-pair states in electron–positron pair creation

    Energy Technology Data Exchange (ETDEWEB)

    Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.

    2016-09-10

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  15. Multi-pair states in electron–positron pair creation

    International Nuclear Information System (INIS)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

    2016-01-01

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  16. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  17. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  18. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  19. Measurement of the $C\\!P$ asymmetry in $B^0 \\to K^{*0} \\mu^+ \\mu^-$ decays

    CERN Document Server

    Aaij, R; Adametz, A; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amhis, Y; Anderlini, L; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, Th; Bay, A; Beddow, J; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Corti, G; Couturier, B; Cowan, G A; Craik, D; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Domingo Bonal, F; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Elsby, D; Esperante Pereira, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Hill, D; Hoballah, M; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, M; Keaveney, J; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Kochebina, O; Komarov, I; Komarov, V; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Mac Raighne, A; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Maino, M; Malde, S; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Mazurov, A; McCarthy, J; McGregor, G; McNulty, R; Meissner, M; Merk, M; Merkel, J; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neufeld, N; Nguyen, A D; Nguyen-Mau, C; Nicol, M; Niess, V; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, N A; Smith, E; Smith, M; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Videau, I; Vieira, D; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voss, H; Voß, C; Waldi, R; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zvyagin, A

    2013-01-01

    A measurement of the $C\\!P$ asymmetry in $B^0 \\rightarrow K^{*0} \\mu^+ \\mu^-$ decays is presented, based on 1.0$\\mbox{\\,fb}^{-1}$ of $pp$ collision data recorded by the LHCb experiment during 2011. The measurement is performed in six bins of invariant mass squared of the $\\mu^+\\mu^-$ pair, excluding the $\\mathrm{J}\\mskip -3mu/\\mskip -2mu\\psi\\mskip 2mu$ and $\\psi(2S)$ resonance regions. Production and detection asymmetries are removed using the $B^0 \\rightarrow \\mathrm{J}\\mskip -3mu/\\mskip -2mu\\psi\\mskip 2mu K^{*0}$ decay as a control mode. The integrated $C\\!P$ asymmetry is found to be $-0.072 \\pm 0.040 \\,(\\mbox{stat.}) \\pm 0.005 \\,(\\mbox{syst.})$, consistent with the Standard Model.

  20. Non-unitary neutrino mixing and CP violation in the minimal inverse seesaw model

    International Nuclear Information System (INIS)

    Malinsky, Michal; Ohlsson, Tommy; Xing, Zhi-zhong; Zhang He

    2009-01-01

    We propose a simplified version of the inverse seesaw model, in which only two pairs of the gauge-singlet neutrinos are introduced, to interpret the observed neutrino mass hierarchy and lepton flavor mixing at or below the TeV scale. This 'minimal' inverse seesaw scenario (MISS) is technically natural and experimentally testable. In particular, we show that the effective parameters describing the non-unitary neutrino mixing matrix are strongly correlated in the MISS, and thus, their upper bounds can be constrained by current experimental data in a more restrictive way. The Jarlskog invariants of non-unitary CP violation are calculated, and the discovery potential of such new CP-violating effects in the near detector of a neutrino factory is discussed.

  1. On the determination of CP-even and CP-odd components of a mixed CP Higgs boson at e+e- linear colliders

    International Nuclear Information System (INIS)

    Dova, Maria Teresa; Ferrari, Sergio

    2005-01-01

    We present a method to investigate the CP quantum numbers of the Higgs boson in the process e + e - ->Zφ at a future e + e - linear collider (LC), where φ, a generic Higgs boson, is a mixture of CP-even and CP-odd states. The procedure consists of a comparison of the data with predictions obtained from Monte Carlo simulations corresponding to the productions of scalar and pseudoscalar Higgs and the interference term which constitutes a distinctive signal of CP violation. We present estimates of the sensitivity of the method from Monte Carlo studies using hypothetical data samples with a full LC detector simulation taking into account the background signals

  2. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  3. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  4. CP violation outside the standard model phenomenology for pedestrians

    International Nuclear Information System (INIS)

    Lipkin, H.J.

    1993-01-01

    So far the only experimental evidence for CP violation is the 1964 discovery of K L →2π where the two mass eigenstates produced by neutral meson mixing both decay into the same CP eigenstate. This result is described by two parameters ε and ε'. Today ε ∼ its 1964 value, ε' data are still inconclusive and there is no new evidence for CP violation. One might expect to observe similar phenomena in other systems and also direct CP violation as charge asymmetries between decays of charge conjugate hadrons H ± → f ± . Why is it so hard to find CP violation? How can B Physics help? Does CP lead beyond the standard model? The author presents a pedestrian symmetry approach which exhibits the difficulties and future possibilities of these two types of CP-violation experiments, neutral meson mixing and direct charge asymmetry: what may work, what doesn't work and why

  5. Analysis list: Cp190 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Cp190 Cell line,Embryo,Larvae + dm3 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/...target/Cp190.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/target/Cp190.5.tsv http://dbarchive.bioscience...dbc.jp/kyushu-u/dm3/target/Cp190.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Cp190.Cell_l...ine.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/colo/Cp190.Embryo.tsv,http://dbarchive.bioscience...dbc.jp/kyushu-u/dm3/colo/Cp190.Larvae.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/

  6. Transferability of microsatellite primers developed for stingless bees to four other species of the genus Melipona.

    Science.gov (United States)

    Viana, M V C; Miranda, E A; de Francisco, A K; Carvalho, C A L; Waldschmidt, A M

    2011-11-22

    Microsatellite markers are a useful tool for ecological monitoring of natural and managed populations. A technical limitation is the necessity for investment in the development of primers. Heterologous primers can provide an alternative to searching for new loci. In bees, these markers have been used in populational and intracolonial genetic analyses. The genus Melipona has the largest number of species among bee genera, about 70, occurring throughout the Neotropical region. However, only five species of the genus Melipona have specific microsatellite markers. Given the great diversity of this genus, this number is not representative. We analyzed the transferability of 49 microsatellite loci to four other species of the genus Melipona (M. scutellaris, M. mondury, M. mandacaia, and M. quadrifasciata). Four individuals of each species, from different localities, were used in amplification tests. Primer pairs described for five Melipona species and for Trigona carbonaria were tested. Among the 49 loci, 22 gave amplification products for all four species, while three gave nonspecific bands and five showed no amplification products. The remaining loci varied in the pattern of amplification, according to the species examined. The number of alleles ranged from 1 to 6. The results demonstrate the possibility of using these heterologous markers in other Melipona species, increasing the number of loci that can be analyzed and contributing to further genetic analyses of intra- and intercolonial structure, which is required for conservation measure planning, genetic improvement and resolution of taxonomic problems.

  7. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  8. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  9. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  10. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  11. A CP violating mixing matrix compatible with neutral flavour conservation and spontaneous CP violation

    International Nuclear Information System (INIS)

    Ecker, G.; Grimus, W.; Neufeld, H.

    1987-01-01

    A specific ansatz for the Yukawa couplings of a four-generation SU(2) L x U(I) model with two Higgs doublets is discussed which leads to neutral flavour conservation, spontaneous CP violation and to a genuinely complex mixing matrix. W exchange conserves CP in the limit m t' = m t only. The decay rate for t → b is reduced by a factor two compared to the Standard Model with three generations. The phenomenological implications for K 0 -K-bar 0 and B 0 -B-bar 0 are investigated. (Author)

  12. Radiative violation of CP-symmetry

    International Nuclear Information System (INIS)

    Galvan Herrera, J.B.

    1990-01-01

    The left-right quiral symmetry is not conserved by the Standard model. A subgroup of the standard gauge group (SU(2) L ) breaks this symmetry in a explicit way. Moreover, the standard model, if there are theree or more matter generations, violates the CP discrete symmetry. This prediction has been experimentally demonstrated correct in the Kaon anti Kaon system. In this work some possible explanations to the CP violation parameter magnitude are researched. We have studied the variation of the Kobayashi-Maskawa matrix with the energy scale. To realize this work we have developed a general method to calculate the renormalization group equations of the Kobayashi-Maskawa matrix parameters. From these equations we could also calculate the renormalization group equation of the J parameter that characterizes the CP violation. This calculus has been applied in a concrete example: a typical supersymmetric model from superstring theories. This model can be seen like a natural extension of the supersymmetric standard model. This kind of models have a gauge group bigger that the standard one more particles and new terms of the Lagrangian. We have verified that such model provides us of a correct low energy fenomenology and, moreover other results, some particle spectrums have been developed. In the elaboration of this model some conditions, that the model has to respected to be compatible with the actual fenomenology, have been studied. The most interesting results of this thesis are the develop of a general method to calculate the renormalization group equations of the Kobayashi-Maskawa matrix parameters and the develop of a new mechanism of the radiative violation. This mechanism is related with the new terms of the Lagrangian. (Author)

  13. The HyperCP data acquisition system

    International Nuclear Information System (INIS)

    Kaplan, D.M.

    1997-06-01

    For the HyperCP experiment at Fermilab, we have assembled a data acquisition system that records on up to 45 Exabyte 8505 tape drives in parallel at up to 17 MB/s. During the beam spill, data are acquired from the front-end digitization systems at ∼ 60 MB/s via five parallel data paths. The front-end systems achieve typical readout deadtime of ∼ 1 micros per event, allowing operation at 75-kHz trigger rate with approx-lt 30% deadtime. Event building and tapewriting are handled by 15 Motorola MVME167 processors in 5 VME crates

  14. Gravitational leptogenesis, C, CP and strong equivalence

    International Nuclear Information System (INIS)

    McDonald, Jamie I.; Shore, Graham M.

    2015-01-01

    The origin of matter-antimatter asymmetry is one of the most important outstanding problems at the interface of particle physics and cosmology. Gravitational leptogenesis (baryogenesis) provides a possible mechanism through explicit couplings of spacetime curvature to appropriate lepton (or baryon) currents. In this paper, the idea that these strong equivalence principle violating interactions could be generated automatically through quantum loop effects in curved spacetime is explored, focusing on the realisation of the discrete symmetries C, CP and CPT which must be broken to induce matter-antimatter asymmetry. The related issue of quantum corrections to the dispersion relation for neutrino propagation in curved spacetime is considered within a fully covariant framework.

  15. The CKM matrix and CP violation

    International Nuclear Information System (INIS)

    Nir, Y.

    1991-10-01

    The CKM picture of the quark sector is reviewed. We explain how the phenomena of quark mixing, CP violation and the absence of flavor changing neutral currents arise in the Standard Model. We describe the determination of the CKM elements from direct measurements, from unitarity and from indirect measurements. We discuss the motivation for schemes of quark mass matrices and analyze the Fritzsch scheme as an example. Finally, we list the experimental and theoretical improvements expected in the future in the determination of the CKM matrix. 86 refs., 6 figs

  16. CP violating decays in leptogenesis scenarios

    International Nuclear Information System (INIS)

    Covi, L.; Roulet, E.; Vissani, F.

    1996-05-01

    We compute the CP violation in the decays of heavy electroweak singlet neutrinos, arising from both the one-loop vertex corrections and the wave function mixing. We extend the computation to the supersymmetric version of the model and discuss the implications for the generation of a lepton number asymmetry by the out of equilibrium decay of the heavy (s)neutrinos in the early Universe, to be reprocessed later in the observed baryon excess by anomalous electroweak processes. (author). 14 refs, 2 figs

  17. Gravitational leptogenesis, C, CP and strong equivalence

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, Jamie I.; Shore, Graham M. [Department of Physics, Swansea University,Swansea, SA2 8PP (United Kingdom)

    2015-02-12

    The origin of matter-antimatter asymmetry is one of the most important outstanding problems at the interface of particle physics and cosmology. Gravitational leptogenesis (baryogenesis) provides a possible mechanism through explicit couplings of spacetime curvature to appropriate lepton (or baryon) currents. In this paper, the idea that these strong equivalence principle violating interactions could be generated automatically through quantum loop effects in curved spacetime is explored, focusing on the realisation of the discrete symmetries C, CP and CPT which must be broken to induce matter-antimatter asymmetry. The related issue of quantum corrections to the dispersion relation for neutrino propagation in curved spacetime is considered within a fully covariant framework.

  18. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  19. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  20. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  1. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  2. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  3. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  4. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  5. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  6. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  7. Coulomb pair-creation

    International Nuclear Information System (INIS)

    Hrasko, P.; Foeldy, L.; Toth, A.

    1986-07-01

    Electron-positron pair production in strong Coulomb fields is outlined. It is shown that the singular behaviour of the adiabatic basis can be removed if solutions of the time dependent external field Dirac equation are used as a basis to expand the fermion field operator. This latter 'asymptotic basis' makes it possible to introduce Feynman-propagator. Applying the reduction technique, the computation of all of the basic quantities can be reduced to the solution of an integral equation. The positron spectrum for separable potential model with Lorentzian time dependence and for potential jump is analyzed in the pole approximation. (author)

  8. Pairing correlations around scission

    International Nuclear Information System (INIS)

    Krappe, H.J.; Fadeev, S.

    2001-01-01

    To describe pairing correlations in a fissioning system one commonly projects the BCS wave function separately onto good particle numbers in each fragment in the exit channel, but only onto the total number of particles in the parent system. We propose to interpolate between these limiting situations by the generator-coordinate method with the particle-number difference between the nascent fragments as the generator coordinate. Model calculations are presented for the Hill-Wheeler-box potential with a δ-function diaphragm to mimic scission

  9. Au pairs on Facebook

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... the au pairs resist and embrace such dominant representations, and on how such representations are ascribed different meanings in the transnational social fields of which the migrant are a part. The article is based on ethnographic fieldwork conducted between 2010 and 2014 in Denmark, the Philippines...

  10. Minimal RED Cell Pairs Markedly Improve Electrode Kinetics and Power Production in Microbial Reverse Electrodialysis Cells

    KAUST Repository

    Cusick, Roland D.

    2013-12-17

    Power production from microbial reverse electrodialysis cell (MRC) electrodes is substantially improved compared to microbial fuel cells (MFCs) by using ammonium bicarbonate (AmB) solutions in multiple RED cell pair stacks and the cathode chamber. Reducing the number of RED membranes pairs while maintaining enhanced electrode performance could help to reduce capital costs. We show here that using only a single RED cell pair (CP), created by operating the cathode in concentrated AmB, dramatically increased power production normalized to cathode area from both acetate (Acetate: from 0.9 to 3.1 W/m 2-cat) and wastewater (WW: 0.3 to 1.7 W/m2), by reducing solution and charge transfer resistances at the cathode. A second RED cell pair increased RED stack potential and reduced anode charge transfer resistance, further increasing power production (Acetate: 4.2 W/m2; WW: 1.9 W/m2). By maintaining near optimal electrode power production with fewer membranes, power densities normalized to total membrane area for the 1-CP (Acetate: 3.1 W/m2-mem; WW: 1.7 W/m2) and 2-CP (Acetate: 1.3 W/m2-mem; WW: 0.6 W/m2) reactors were much higher than previous MRCs (0.3-0.5 W/m2-mem with acetate). While operating at peak power, the rate of wastewater COD removal, normalized to reactor volume, was 30-50 times higher in 1-CP and 2-CP MRCs than that in a single chamber MFC. These findings show that even a single cell pair AmB RED stack can significantly enhance electrical power production and wastewater treatment. © 2013 American Chemical Society.

  11. Minimal RED Cell Pairs Markedly Improve Electrode Kinetics and Power Production in Microbial Reverse Electrodialysis Cells

    KAUST Repository

    Cusick, Roland D.; Hatzell, Marta; Zhang, Fang; Logan, Bruce E.

    2013-01-01

    Power production from microbial reverse electrodialysis cell (MRC) electrodes is substantially improved compared to microbial fuel cells (MFCs) by using ammonium bicarbonate (AmB) solutions in multiple RED cell pair stacks and the cathode chamber. Reducing the number of RED membranes pairs while maintaining enhanced electrode performance could help to reduce capital costs. We show here that using only a single RED cell pair (CP), created by operating the cathode in concentrated AmB, dramatically increased power production normalized to cathode area from both acetate (Acetate: from 0.9 to 3.1 W/m 2-cat) and wastewater (WW: 0.3 to 1.7 W/m2), by reducing solution and charge transfer resistances at the cathode. A second RED cell pair increased RED stack potential and reduced anode charge transfer resistance, further increasing power production (Acetate: 4.2 W/m2; WW: 1.9 W/m2). By maintaining near optimal electrode power production with fewer membranes, power densities normalized to total membrane area for the 1-CP (Acetate: 3.1 W/m2-mem; WW: 1.7 W/m2) and 2-CP (Acetate: 1.3 W/m2-mem; WW: 0.6 W/m2) reactors were much higher than previous MRCs (0.3-0.5 W/m2-mem with acetate). While operating at peak power, the rate of wastewater COD removal, normalized to reactor volume, was 30-50 times higher in 1-CP and 2-CP MRCs than that in a single chamber MFC. These findings show that even a single cell pair AmB RED stack can significantly enhance electrical power production and wastewater treatment. © 2013 American Chemical Society.

  12. Measurement of the Time-Dependent CP Asymmetry of Partially Reconstructed B0 to D*+D*- Decays

    Energy Technology Data Exchange (ETDEWEB)

    Lees, J. P.

    2012-08-13

    We present a new measurement of the time-dependent CP asymmetry of B{sup 0} {yields}D*{sup +}D*{sup -} decays using (471 {+-} 5) million B{bar B} pairs collected with the BABAR detector at the PEP-II B Factory at the SLAC National Accelerator Laboratory. Using the technique of partial reconstruction, we measure the time-dependent CP asymmetry parameters S = -0.34 {+-} 0.12 {+-} 0.05 and C = +0:15 {+-} 0.09 {+-} 0.04. Using the value for the CP-odd fraction R{perpendicular} = 0.158 {+-} 0.028 {+-} 0.006, previously measured by BABAR with fully reconstructed B{sup 0} {yields} D{sup *+}D{sup *-} events, we extract the CP-even components S{sub +} = -0.49 {+-} 0.18 {+-} 0.07 {+-} 0.04 and C{sub +} = +0.15 {+-} 0.09 {+-} 0.04. In each case, the first uncertainty is statistical and the second is systematic; the third uncertainty on S{sub +} is the contribution from the uncertainty on R{perpendicular}. The measured value of the CP-even component S{sub +} is consistent with the value of sin 2{beta} measured in b {yields} (c{bar c})s transitions, and with the Standard Model expectation of small penguin contributions.

  13. Measuring the CP property of Higgs coupling to tau leptons in the VBF channel at the LHC

    Energy Technology Data Exchange (ETDEWEB)

    Han, Tao [PITT-PACC, Department of Physics and Astronomy, University of Pittsburgh,Pittsburgh, PA 15260 (United States); Department of Physics, Tsinghua University, Collaborative Innovation Center of Quantum Matter,Beijing 100086 (China); Mukhopadhyay, Satyanarayan [PITT-PACC, Department of Physics and Astronomy, University of Pittsburgh,Pittsburgh, PA 15260 (United States); Mukhopadhyaya, Biswarup [Regional Centre for Accelerator-based Particle Physics, Harish-Chandra Research Institute, HBNI,Chhatnag Road, Jhusi, Allahabad 211019 (India); Wu, Yongcheng [Department of Physics, Tsinghua University, Collaborative Innovation Center of Quantum Matter,Beijing 100086 (China); PITT-PACC, Department of Physics and Astronomy, University of Pittsburgh,Pittsburgh, PA 15260 (United States)

    2017-05-23

    We study the prospects of measuring the CP property of the Higgs (h) coupling to tau leptons using the vector boson fusion (VBF) production mode at the high-luminosity LHC. Utilizing the previously proposed angle between the planes spanned by the momentum vectors of the (π{sup +}π{sup 0}) and (π{sup −}π{sup 0}) pairs originating in τ{sup ±} decays as the CP-odd observable, we perform a detailed Monte Carlo analysis, taking into account the relevant standard model backgrounds, as well as detector resolution effects. We find that excluding a pure CP-odd coupling hypothesis requires O(400 fb{sup −1}) luminosity at the 14 TeV LHC, and values of the CP-mixing angle larger than about 25{sup ∘} can be excluded at 95% confidence level using 3 ab{sup −1} data. It is observed that the uncertainty in the angular resolution of the neutral pion momenta does not constitute a significant hurdle. Achieving a signal to background ratio (S/B) close to one, while keeping a high enough signal yield required to study the angular distributions selects out VBF as a promising mode to probe the CP nature of the hττ coupling, with gluon fusion suffering from a low S/B, and the W{sup ±}h/Zh mode (with leptonically decaying W{sup ±}/Z) having a much smaller signal rate.

  14. Bc meson weak decays and CP violation

    International Nuclear Information System (INIS)

    Liu, J.; Chao, K.

    1997-01-01

    The form factors for B c transitions are calculated with a relativistic constituent quark model based on the Bethe-Salpeter formalism. The rates for some semileptonic and nonleptonic B c weak decays and CP-violating asymmetries for two-body hardonic B c decays are estimated as well. The calculated widths are compared with those predicted in other quark models of mesons. For the most promising signatures for the discovery of B c : B c →ψlν→(l '+ l '- )lν and B c →ψπ→(l '+ l '- )π (with l ' =e or μ), the combined branching ratios are, respectively, estimated to be 1.06x10 -3 and 4.8a 1 2 x10 -5 for τ B c =0.5 ps and as large as 2.56x10 -3 and 1.15a 1 2 x10 -4 for τ B c =1.2 ps. There are large CP-violating effects in some B c decay modes, and the rates for some of these (e.g., B c →ψD * ,η c D, and η c D * , etc.) are large too. copyright 1997 The American Physical Society

  15. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  16. Direct CP violation in τ± → K± ρ0 (ω)ντ → K± π+π-ντ

    International Nuclear Information System (INIS)

    Wang, Chao; Guo, Xin-Heng; Liu, Ying; Li, Rui-Cheng

    2014-01-01

    We study the direct CP violation in the τ ± → K ± ρ 0 (ω)ν τ → K ± π + π - ν τ decay process in the standard model. An interesting mechanism involving the charge symmetry violating mixing between ρ 0 and ω is applied to enlarge the CP asymmetry. We find that the CP-violating asymmetry can be enhanced greatly via this ρ-ω mixing mechanism when the invariant mass of the π + π - pair is in the vicinity of the ω resonance. With this mechanism, the maximum differential and localized integrated CP asymmetries can reach -(5.6 -1.7 +2.9 ) @ x 10 -12 and 6.3 -3.3 +2.4 @ x 10 -11 , respectively, which is still negligible. (orig.)

  17. Is CP violation observable in long baseline neutrino oscillation experiments?

    International Nuclear Information System (INIS)

    Tanimoto, M.

    1997-01-01

    We have studied CP violation originating from the phase of the neutrino-mixing matrix in the long baseline neutrino oscillation experiments. The direct measurement of CP violation is the difference of the transition probabilities between CP-conjugate channels. In those experiments, the CP-violating effect is not suppressed if the highest neutrino mass scale is taken to be 1 endash 5 eV, which is appropriate for the cosmological hot dark matter. Assuming the hierarchy for the neutrino masses, the upper bounds of CP violation have been calculated for three cases, in which mixings are constrained by the recent short baseline ones. The calculated upper bounds are larger than 10 -2 , which will be observable in the long baseline accelerator experiments. The matter effect, which is not CP invariant, has been also estimated in those experiments. copyright 1997 The American Physical Society

  18. SU(4) x U(1) gauge theory. II. CP nonconservation

    International Nuclear Information System (INIS)

    Deshpande, N.G.; Hwa, R.C.; Mannheim, P.D.

    1979-01-01

    We exploit the higher symmetry inherent in an SU(4) x U(1) gauge theory to construct a spontaneously broken theory of CP nonconservation. Higgs multiplets in the adjoint representation of SU(4) contain both even and odd CP fields; thus, requiring the simultaneous nonvanishing of the vacuum expectation values of these fields leads to CP noninvariance of the vacuum. We find that all the CP-nonconserving effects are mediated in our theory by the superheavy gauge bosons of the broken SU(4) x U(1) symmetry. In fact, the very existence of CP violation sets an upper limit on the masses of these bosons. In our model the dominant CP effect lies in the neutral kaon system and is found to arise through a direct (ΔS = 2) K 1 -K 2 transition. The model has all the features of a superweak theory, with a neutron electric dipole moment substantially smaller than 10 -24 e cm

  19. CP violation in the K and B systems

    International Nuclear Information System (INIS)

    Kayser, B.

    1997-01-01

    Although CP violation was discovered more than thirty years ago, its origin is still unknown. In these lectures, we describe the CP-violation effects which have been seen in K decays, and explain how CP violation can be caused by the Standard Model weak interaction. The hypothesis that this interaction is indeed the origin of CP violation will be incisively tested by future experiments on B and K decays. We explain what quantities these experiments will try to determine, and how they will be able to determine them in a theoretically clean way. To clarify the physics of the K system, we give a phase-convention-free description of CP violation in this system. We conclude by briefly exploring whether electric dipole moments actually violate CP even if CPT invariance is not assumed. (author)

  20. Invariant approach to CP in unbroken Δ(27

    Directory of Open Access Journals (Sweden)

    Gustavo C. Branco

    2015-10-01

    Full Text Available The invariant approach is a powerful method for studying CP violation for specific Lagrangians. The method is particularly useful for dealing with discrete family symmetries. We focus on the CP properties of unbroken Δ(27 invariant Lagrangians with Yukawa-like terms, which proves to be a rich framework, with distinct aspects of CP, making it an ideal group to investigate with the invariant approach. We classify Lagrangians depending on the number of fields transforming as irreducible triplet representations of Δ(27. For each case, we construct CP-odd weak basis invariants and use them to discuss the respective CP properties. We find that CP violation is sensitive to the number and type of Δ(27 representations.

  1. CP violation in the K and B systems

    International Nuclear Information System (INIS)

    Kayser, B.

    1996-11-01

    Although CP violation was discovered more than thirty years ago, its origin is still unknown. In these lectures, we describe the CP- violating effects which have been seen in K decays, and explain how CP violation can be caused by the Standard Model weak interaction. The hypothesis that this interaction is indeed the origin of CP violation will be incisively tested by future experiments on B and K decays. We explain what quantities these experiments will try to determine, and how they will be able to determine them in a theoretically clean way. To clarify the physics of the K system, we give a phase-convention-free description of CP violation in this system. We conclude by briefly exploring whether electric dipole moments actually violate CP even if CPT invariance is not assumed

  2. Assessing Intimacy: The Pair Inventory.

    Science.gov (United States)

    Schaefer, Mark T.; Olson, David H.

    1981-01-01

    Personal Assessment of Intimacy in Relationships (PAIR) provides systematic information in five types of intimacy: emotional, social, sexual, intellectual and recreational. PAIR can be used with couples in marital therapy and enrichment groups. (Author)

  3. Epigenomic profiling of DNA methylation in paired prostate cancer versus adjacent benign tissue.

    Science.gov (United States)

    Geybels, Milan S; Zhao, Shanshan; Wong, Chao-Jen; Bibikova, Marina; Klotzle, Brandy; Wu, Michael; Ostrander, Elaine A; Fan, Jian-Bing; Feng, Ziding; Stanford, Janet L

    2015-12-01

    Aberrant DNA methylation may promote prostate carcinogenesis. We investigated epigenome-wide DNA methylation profiles in prostate cancer (PCa) compared to adjacent benign tissue to identify differentially methylated CpG sites. The study included paired PCa and adjacent benign tissue samples from 20 radical prostatectomy patients. Epigenetic profiling was done using the Infinium HumanMethylation450 BeadChip. Linear models that accounted for the paired study design and False Discovery Rate Q-values were used to evaluate differential CpG methylation. mRNA expression levels of the genes with the most differentially methylated CpG sites were analyzed. In total, 2,040 differentially methylated CpG sites were identified in PCa versus adjacent benign tissue (Q-value Cancer Genome Atlas (TCGA) data provided confirmatory evidence for our findings. This study of PCa versus adjacent benign tissue showed many differentially methylated CpGs and regions in and outside gene promoter regions, which may potentially be used for the development of future epigenetic-based diagnostic tests or as therapeutic targets. © 2015 Wiley Periodicals, Inc.

  4. CP violation in the lepton sector and implications for leptogenesis

    DEFF Research Database (Denmark)

    Hagedorn, C.; Mohapatra, R. N.; Molinaro, E.

    2018-01-01

    We review the current status of the data on neutrino masses and lepton mixing and the prospects for measuring the CP-violating phases in the lepton sector. The possible connection between low energy CP violation encoded in the Dirac and Majorana phases of the Pontecorvo-Maki-Nakagawa-Sakata mixing...... matrix and successful leptogenesis is emphasized in the context of seesaw extensions of the Standard Model with a flavor symmetry Gf (and CP symmetry)....

  5. Benchmark test of CP-PACS for lattice QCD

    International Nuclear Information System (INIS)

    Yoshie, Tomoteru

    1996-01-01

    The CP-PACS is a massively parallel computer dedicated for calculations in computational physics and will be in operation in the spring of 1996 at Center for Computational Physics, University of Tsukuba. In this paper, we describe the architecture of the CP-PACS and report the results of the estimate of the performance of the CP-PACS for typical lattice QCD calculations. (author)

  6. Discrete ambiguities in CP-violating asymmetries in B decays

    International Nuclear Information System (INIS)

    London, David

    1998-01-01

    The CP-angles α, β and γ can be extracted from CP-violating asymmetries in the B system, but only up to discrete ambiguities. These discrete ambiguities make it difficult to determine with certainty whether or not new physics is present. I show that, if the condition α+β+γ=π is imposed, there remains a twofold ambiguity in the CP-angle set (α,β,γ), and I discuss ways to cleanly resolve this final discrete ambiguity

  7. A brief introduction to the strong CP problem

    International Nuclear Information System (INIS)

    Wu, Dan-di; Melbourne Univ., Parkville

    1991-09-01

    The present status of the strong CP problem is briefly reviewed in a heuristic way. A crisis in EDMN calculation is explained. The equation of vacuum alignment obtained by the author and collaborators last year put a constraint on strong CP parameters. Thus the strong CP will be forced to vanish in one of the three scenarios characterized by axion, zero quark mass, and vanishing quark condensate. 12 refs

  8. Phenomenology of CP violation from the Kobayashi-Maskawa model

    International Nuclear Information System (INIS)

    Wang, L.L.C.

    1980-01-01

    The CP violation consequences of the K-M model, which Kobayashi, Maskawa introduced in 1977 for the purpose of incorporating CP violation via the complexity in the mixing matrix of the quarks are discussed. Much of the talk is a review of current work on the subject. Some new results on the CP violation effects in exclusive and inclusive decays of bottom, charm and strange particles are also given

  9. Rephasing-invariant CP violating parameters with Majorana neutrinos

    International Nuclear Information System (INIS)

    Nieves, Jose F.; Pal, Palash B.

    2001-06-01

    We analyze the dependence of the squared amplitudes on the rephasing-invariant CP-violating parameters of the lepton sector, involving Majorana neutrinos, for various lepton- conserving and lepton-violating processes. We analyze the conditions under which the CP-violating effects in such processes vanish, in terms of the minimal set of rephasing invariants, giving special attention to the dependence on the extra CP-violating parameters that are due to the Majorana nature of the neutrinos. (author)

  10. MeCP2 regulates ethanol sensitivity and intake.

    Science.gov (United States)

    Repunte-Canonigo, Vez; Chen, Jihuan; Lefebvre, Celine; Kawamura, Tomoya; Kreifeldt, Max; Basson, Oan; Roberts, Amanda J; Sanna, Pietro Paolo

    2014-09-01

    We have investigated the expression of chromatin-regulating genes in the prefrontal cortex and in the shell subdivision of the nucleus accumbens during protracted withdrawal in mice with increased ethanol drinking after chronic intermittent ethanol (CIE) vapor exposure and in mice with a history of non-dependent drinking. We observed that the methyl-CpG binding protein 2 (MeCP2) was one of the few chromatin-regulating genes to be differentially regulated by a history of dependence. As MeCP2 has the potential of acting as a broad gene regulator, we investigated sensitivity to ethanol and ethanol drinking in MeCP2(308/) (Y) mice, which harbor a truncated MeCP2 allele but have a milder phenotype than MeCP2 null mice. We observed that MeCP2(308/) (Y) mice were more sensitive to ethanol's stimulatory and sedative effects than wild-type (WT) mice, drank less ethanol in a limited access 2 bottle choice paradigm and did not show increased drinking after induction of dependence with exposure to CIE vapors. Alcohol metabolism did not differ in MeCP2(308/) (Y) and WT mice. Additionally, MeCP2(308/) (Y) mice did not differ from WT mice in ethanol preference in a 24-hour paradigm nor in their intake of graded solutions of saccharin or quinine, suggesting that the MeCP2(308/) (Y) mutation did not alter taste function. Lastly, using the Gene Set Enrichment Analysis algorithm, we found a significant overlap in the genes regulated by alcohol and by MeCP2. Together, these results suggest that MeCP2 contributes to the regulation of ethanol sensitivity and drinking. © 2013 The Authors, Addiction Biology © 2013 Society for the Study of Addiction.

  11. Higgs boson results on couplings to fermions, CP parameters and perspectives for high-lumi LHC (ATLAS AND CMS)

    CERN Document Server

    Brandstetter, Johannes

    2018-01-01

    This talk summarizes latest ATLAS and CMS results on Higgs boson couplings to fermions. Presented topics include decays into final states of pairs of tau leptons and pairs of bottom quarks as well as results on the ttH production mode. Results are complemented by tests of the CP invariance and searches for lepton flavor violating decays. Finally, prospects of future Higgs boson analyses within the scope of the High Luminosity LHC program are discussed. The presented results mostly use LHC 2016 data collected at a center-of-mass energy of $\\sqrt{\\mathrm{s}}=13~$TeV corresponding to an integrated luminosity of about 36~$\\mathrm{fb^{-1}}$.

  12. Measurement of Branching Fractions and Search for CP-violating Charge Asymmetries in Charmless Two-body B Decays into Pions and Kaons

    Energy Technology Data Exchange (ETDEWEB)

    Dallapiccola, Carlo

    2001-07-25

    We present measurements of the branching fractions and a search for CP-violating charge asymmetries in charmless hadronic decays of B mesons into two-body final states of kaons and pions. The results are based on a data sample of approximately 23 million BB(bar) pairs collected by the BABAR detector at the PEP-II asymmetric B Factory at SLAC.

  13. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  14. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  15. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  16. Measurements of direct CP violation in charm decays at LHCb

    CERN Document Server

    INSPIRE-00257861

    2013-01-01

    Two searches for direct CP violation in D 0 ! h h + (where h = K or ) are presented using data corresponding to an integrated luminosity of 1.0 fb 1 collected in 2011 by LHCb in pp collisions at a centre-of-mass energy of 7 TeV. One analysis uses D 0 mesons produced via a D resonance and the other analysis uses D 0 mesons originating from semileptonic b - decays. In the rst case the avour is tagged by the charge of the accompanying pion and in the latter by the muon charge. The dierence of the CP -violating asymmetries ( A CP = A CP ( K K + ) A CP ( + )) in the two decay channels is measured to be A CP (muon tagged) = (0 : 49 0 : 30 (stat) 0 : 14 (syst))% ; A CP (pion tagged) = ( 0 : 35 0 : 15 (stat) 0 : 10 (syst))% ; A CP (LHCb) = ( 0 : 15 0 : 16)% : These results do not conrm evidence for CP violation in the charm sector

  17. Evidence for non-CpG methylation in mammals

    DEFF Research Database (Denmark)

    Yan, Jie; Zierath, Juleen R; Barres, Romain

    2011-01-01

    In mammals, the existence of cytosine methylation on non-CpG sequences is controversial. Here, we adapted a LuminoMetric-based Assay (LUMA) to determine global non-CpG methylation levels in rodent and human tissues. We observed that......In mammals, the existence of cytosine methylation on non-CpG sequences is controversial. Here, we adapted a LuminoMetric-based Assay (LUMA) to determine global non-CpG methylation levels in rodent and human tissues. We observed that...

  18. CP violation conditions in N-Higgs-doublet potentials

    International Nuclear Information System (INIS)

    Nishi, C. C.

    2006-01-01

    Conditions for CP violation in the scalar potential sector of general N-Higgs-doublet models are analyzed from a group theoretical perspective. For the simplest two-Higgs-doublet model potential, a minimum set of conditions for explicit and spontaneous CP violation is presented. The conditions can be given a clear geometrical interpretation in terms of quantities in the adjoint representation of the basis transformation group for the two doublets. Such conditions depend on CP-odd pseudoscalar invariants. When the potential is CP invariant, the explicit procedure to reach the real CP-basis and the explicit CP transformation can also be obtained. The procedure to find the real basis and the conditions for CP violation are then extended to general N-Higgs-doublet model potentials. The analysis becomes more involved and only a formal procedure to reach the real basis is found. Necessary conditions for CP invariance can still be formulated in terms of group invariants: the CP-odd generalized pseudoscalars. The problem can be completely solved for three Higgs-doublets

  19. CP violation in KL → π0e+e-

    International Nuclear Information System (INIS)

    Littenberg, L.S.

    1989-01-01

    It's been appreciated for many years that the decays K L → π 0 ell bar ell are CP violating to lowest order in the Standard Model, and that the component of direct CP violation in these decays is likely to be comparable to that of the CP violation due to state mixing (ε). This is to be contrasted with the case of K 0 → ππ wherein the latter contribution is predicted to be hundreds of times larger than the former. This paper investigates this CP violation further. 19 refs., 2 figs

  20. Frequency Constrained ShiftCP Modeling of Neuroimaging Data

    DEFF Research Database (Denmark)

    Mørup, Morten; Hansen, Lars Kai; Madsen, Kristoffer H.

    2011-01-01

    The shift invariant multi-linear model based on the CandeComp/PARAFAC (CP) model denoted ShiftCP has proven useful for the modeling of latency changes in trial based neuroimaging data[17]. In order to facilitate component interpretation we presently extend the shiftCP model such that the extracted...... components can be constrained to pertain to predefined frequency ranges such as alpha, beta and gamma activity. To infer the number of components in the model we propose to apply automatic relevance determination by imposing priors that define the range of variation of each component of the shiftCP model...

  1. Investigation of Inclusive CP Asymmetries in B$^{0}$ Decays

    CERN Document Server

    Barate, R; Ghez, P; Goy, C; Lees, J P; Merle, E; Minard, M N; Pietrzyk, B; Bravo, S; Casado, M P; Chmeissani, M; Crespo, J M; Fernández, E; Fernández-Bosman, M; Garrido, L; Graugès-Pous, E; Martínez, M; Merino, G; Miquel, R; Mir, L M; Pacheco, A; Ruiz, H; Colaleo, A; Creanza, D; De Palma, M; Iaselli, Giuseppe; Maggi, G; Maggi, M; Nuzzo, S; Ranieri, A; Raso, G; Ruggieri, F; Selvaggi, G; Silvestris, L; Tempesta, P; Tricomi, A; Zito, G; Huang, X; Lin, J; Ouyang, Q; Wang, T; Xie, Y; Xu, R; Xue, S; Zhang, J; Zhang, L; Zhao, W; Abbaneo, D; Boix, G; Buchmüller, O L; Cattaneo, M; Cerutti, F; Dissertori, G; Drevermann, H; Forty, Roger W; Frank, M; Greening, T C; Hansen, J B; Harvey, J; Janot, P; Jost, B; Lehraus, Ivan; Mato, P; Minten, Adolf G; Moutoussi, A; Ranjard, F; Rolandi, Luigi; Schlatter, W D; Schmitt, M; Schneider, O; Spagnolo, P; Tejessy, W; Teubert, F; Tournefier, E; Wright, A E; Ajaltouni, Ziad J; Badaud, F; Chazelle, G; Deschamps, O; Falvard, A; Gay, P; Guicheney, C; Henrard, P; Jousset, J; Michel, B; Monteil, S; Montret, J C; Pallin, D; Perret, P; Podlyski, F; Hansen, J D; Hansen, J R; Hansen, P H; Nilsson, B S; Petersen, B; Wäänänen, A; Daskalakis, G; Kyriakis, A; Markou, C; Simopoulou, Errietta; Vayaki, Anna; Blondel, A; Bonneaud, G R; Brient, J C; Rougé, A; Rumpf, M; Swynghedauw, M; Verderi, M; Videau, H L; Focardi, E; Parrini, G; Zachariadou, K; Antonelli, A; Antonelli, M; Bencivenni, G; Bologna, G; Bossi, F; Campana, P; Capon, G; Chiarella, V; Laurelli, P; Mannocchi, G; Murtas, F; Murtas, G P; Passalacqua, L; Pepé-Altarelli, M; Halley, A W; Lynch, J G; Negus, P; O'Shea, V; Raine, C; Teixeira-Dias, P; Thompson, A S; Cavanaugh, R J; Dhamotharan, S; Geweniger, C; Hanke, P; Hansper, G; Hepp, V; Kluge, E E; Putzer, A; Sommer, J; Tittel, K; Werner, S; Wunsch, M; Beuselinck, R; Binnie, David M; Cameron, W; Dornan, Peter J; Girone, M; Marinelli, N; Sedgbeer, J K; Thompson, J C; Thomson, E; Ghete, V M; Girtler, P; Kneringer, E; Kuhn, D; Rudolph, G; Bowdery, C K; Buck, P G; Finch, A J; Foster, F; Hughes, G; Jones, R W L; Robertson, N A; Giehl, I; Jakobs, K; Kleinknecht, K; Quast, G; Renk, B; Rohne, E; Sander, H G; Wachsmuth, H W; Zeitnitz, C; Bonissent, A; Carr, J; Coyle, P; Leroy, O; Payre, P; Rousseau, D; Talby, M; Aleppo, M; Ragusa, F; Dietl, H; Ganis, G; Heister, A; Hüttmann, K; Lütjens, G; Mannert, C; Männer, W; Moser, H G; Schael, S; Settles, Ronald; Stenzel, H; Wiedenmann, W; Wolf, G; Azzurri, P; Boucrot, J; Callot, O; Chen, S; Cordier, A; Davier, M; Duflot, L; Grivaz, J F; Heusse, P; Jacholkowska, A; Le Diberder, F R; Lefrançois, J; Lutz, A M; Schune, M H; Veillet, J J; Videau, I; Yuan, C; Zerwas, D; Bagliesi, G; Boccali, T; Calderini, G; Ciulli, V; Foà, L; Giassi, A; Ligabue, F; Messineo, A; Palla, Fabrizio; Rizzo, G; Sanguinetti, G; Sciabà, A; Sguazzoni, G; Tenchini, Roberto; Venturi, A; Verdini, P G; Blair, G A; Cowan, G D; Green, M G; Medcalf, T; Strong, J A; Von Wimmersperg-Töller, J H; Clifft, R W; Edgecock, T R; Norton, P R; Tomalin, I R; Bloch-Devaux, B; Colas, P; Emery, S; Kozanecki, Witold; Lançon, E; Lemaire, M C; Locci, E; Pérez, P; Rander, J; Renardy, J F; Roussarie, A; Schuller, J P; Schwindling, J; Trabelsi, A; Vallage, B; Black, S N; Dann, J H; Johnson, R P; Kim, H Y; Konstantinidis, N P; Litke, A M; McNeil, M A; Taylor, G; Booth, C N; Cartwright, S L; Combley, F; Lehto, M H; Thompson, L F; Affholderbach, K; Böhrer, A; Brandt, S; Grupen, Claus; Misiejuk, A; Prange, G; Sieler, U; Giannini, G; Gobbo, B; Rothberg, J E; Wasserbaech, S R; Armstrong, S R; Cranmer, K; Elmer, P; Ferguson, D P S; Gao, Y; González, S; Hayes, O J; Hu, H; Jin, S; Kile, J; McNamara, P A; Nielsen, J; Orejudos, W; Pan, Y B; Saadi, Y; Scott, I J; Walsh, J; Wu Sau Lan; Wu, X; Zobernig, G

    2001-01-01

    A search for CP violating effects in the mixing of neutral B mesons is performed using a sample of 4.1 million hadronic Z decays collected with the ALEPH detector from 1991 to 1995. By studying time-dependent asymmetries in flavour-tagged samples of semileptonic and fully inclusive b-hadron decays, two measurements of the semileptonic asymmetry a_cp are extracted. No evidence for CP violation is observed, and the combined value a_cp = -0.013 +- 0.026 is obtained.

  2. CpG island mapping by epigenome prediction.

    Directory of Open Access Journals (Sweden)

    Christoph Bock

    2007-06-01

    Full Text Available CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1 reliance on arbitrary threshold parameters that bear little biological justification, (2 failure to account for widespread heterogeneity among CpG islands, and (3 apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to

  3. CpG island mapping by epigenome prediction.

    Science.gov (United States)

    Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

    2007-06-01

    CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic

  4. Search for CP violation in baryon decays at LHCb

    CERN Multimedia

    CERN. Geneva

    2016-01-01

    The phenomenon of CP violation has been observed in the K- and B-meson systems, but not yet with any baryonic particle. We report on searches for CP violation in baryon decays at LHCb using Run I data. We find evidence for CP violation in Lambda0b -> p pi- pi+ pi- decays with a statistical significance corresponding to 3.3 standard deviations, including systematic uncertainties. This represents the first evidence of CP violation in the baryon sector. An overview of other recent results of baryon decays will be presented, along with some highlights of the charmless B-decay programme.

  5. CP violation in τ → ντ + 3π

    International Nuclear Information System (INIS)

    Tsai, Y.S.

    1998-01-01

    In the Standard Model no CP violation can occur in decay processes involving leptons either as a parent or a daughter because these processes involve one W exchange and thus, even if the CP violating complex coupling exists in these decays, its effect will not show up when the amplitude is squared. The author needs two diagrams to interfere with each other to see the CP violating effects. Here, he discusses ways to find CP violation in the decay of τ ± → ν τ + 3π from unpolarized as well as polarized τ ±

  6. A model for the origin and mechanisms of CP violation

    International Nuclear Information System (INIS)

    Wu, Y.

    1995-01-01

    In this talk I will show that the two-Higgs doublet model with vacuum CP violation and approximate global U(1) family symmetries may provide one of the simplest and attractive models for understanding the origin and mechanisms of CP violation. It is shown that the mechanism of spontaneous symmetry breaking provides not only a mechanism for generating masses of the bosons and fermions, but also a mechanism for creating CP-phases of the bosons and fermions, so that CP violation occurs, after spontaneous symmetry breaking, in all possible ways from a single CP phase of the vacuum and is generally classified into four types of CP-violating mechanism. A new type of CP-violating mechanism in the charged Higgs boson interactions of the fermions is emphasized and can provide a consistent description for both established and reported CP-, P-, and T-violating phenomena. Of particular importance is the new source of CP violation for charged Higgs boson interactions that lead to the value of ε'/ε as large as 10 -3 independent of the CKM phase. copyright 1995 American Institute of Physics

  7. QSO Pairs across Active Galaxies

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... Several QSO pairs have been reported and their redshifts determined, where the two objects in each pair are located across an active galaxy. The usually accepted explanation of such occurrences is that the pair is ejected from the parent galaxy. Currently interpreted redshifted spectra for both the QSOs ...

  8. Pairing in hadron structure

    International Nuclear Information System (INIS)

    Chela-Flores, J.

    1981-08-01

    A many-body approach to hadron structure is presented, in which we consider two parton species: spin-0 (b-partons), and spin-1/2 (f-partons). We extend a boson and a fermion pairing scheme for the b-, and f-partons respectively, into a Yang-Mills gauge theory. The main feature of this theory is that the gauge field is not identified with the usual gluon field variable in QCD. We study the confinement problem of the hadron constituents, and obtain, for low temperatures, partons that are confined by energy gaps. As the critical temperatures for the corresponding phase transitions are approached, the energy gap gradually disappears, and confinement is lost. The theory goes beyond the non-relativistic harmonic oscillator quark model, in the sense of giving physical reasons why a non-relativistic approximation is adequate in describing the internal dynamics of hadron structure. (author)

  9. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  10. Paired Hall states

    International Nuclear Information System (INIS)

    Greiter, M.

    1992-01-01

    This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8

  11. Impact of CP-violating interference effects on MSSM Higgs searches

    International Nuclear Information System (INIS)

    Fuchs, Elina

    2017-05-01

    Interference and mixing effects between neutral Higgs bosons in the MSSM with complex parameters are shown to have a significant impact on the interpretation of LHC searches for additional Higgs bosons. Complex MSSM parameters introduce mixing between the CP-even and CP-odd Higgs states and generate CP-violating interference terms. Both effects are enhanced in the case of almost degenerate states. Employing as an example an extension of a frequently used benchmark scenario by a non-zero phase φ A t , the interference contributions are obtained for the production of neutral Higgs bosons in gluon-fusion and in association with b-quarks followed by the decay into a pair of τ-leptons. While the resonant mixing increases the individual cross sections for the two heavy Higgs bosons h 2 and h 3 , strongly destructive interference effects between the contributions involving h 2 and h 3 leave a considerable parameter region unexcluded that would appear to be ruled out if the interference effects were neglected.

  12. Impact of CP-violating interference effects on MSSM Higgs searches

    Energy Technology Data Exchange (ETDEWEB)

    Fuchs, Elina [Weizmann Institute of Science, Department of Particle Physics and Astrophysics, Rehovot (Israel); Weiglein, Georg [DESY, Hamburg (Germany)

    2018-02-15

    Interference and mixing effects between neutral Higgs bosons in the MSSM with complex parameters are shown to have a significant impact on the interpretation of LHC searches for additional Higgs bosons. Complex MSSM parameters introduce mixing between the CP-even and CP-odd Higgs states h, H, A into the mass eigenstates h{sub 1}, h{sub 2}, h{sub 3} and generate CP-violating interference terms. Both effects are enhanced in the case of almost degenerate states. Employing as an example an extension of a frequently used benchmark scenario by a non-zero phase φ{sub A{sub t}}, the interference contributions are obtained for the production of neutral Higgs bosons in gluon-fusion and in association with b-quarks followed by the decay into a pair of τ-leptons. While the resonant mixing increases the individual cross sections for the two heavy Higgs bosons h{sub 2} and h{sub 3}, strongly destructive interference effects between the contributions involving h{sub 2} and h{sub 3} leave a considerable parameter region unexcluded that would appear to be ruled out if the interference effects were neglected. (orig.)

  13. CP-violating top quark couplings at future linear $e^+e^-$ colliders

    CERN Document Server

    Bernreuther, Werner; Garcia Garcia, Ignacio; Perello Rosello, Martin; Poeschl, Roman; Richard, Francois; Ros, Eduardo; Vos, Marcel

    2017-01-01

    We study the potential of future lepton colliders to probe violation of the CP symmetry in the top quark sector. In certain extensions of the Standard Model, such as the two-Higgs-doublet model (2HDM), sizeable anomalous top quark dipole moments can arise, that may be revealed by a precise measurement of top quark pair production. We present results from detailed Monte Carlo studies for the ILC at 500 GeV and CLIC at 380 GeV and use parton level simulations to explore the potential of high-energy operation. We find that precise measurements in $e^+e^- \\rightarrow t \\bar{t}$ production with subsequent decay to lepton plus jets final states can provide sufficient sensitivity to detect Higgs-boson-induced CP violation in a viable two-Higgs-doublet model. The potential of a linear $e^+e^-$ collider to detect CP-violating electric and weak dipole form factors of the top quark exceeds the prospects of the HL-LHC by over an order of magnitude.

  14. Impact of CP-violating interference effects on MSSM Higgs searches

    Energy Technology Data Exchange (ETDEWEB)

    Fuchs, Elina [Weizmann Institute of Science, Rehovoth (Israel). Dept. of Particle Physics and Astrophysics; Weiglein, Georg [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2017-05-15

    Interference and mixing effects between neutral Higgs bosons in the MSSM with complex parameters are shown to have a significant impact on the interpretation of LHC searches for additional Higgs bosons. Complex MSSM parameters introduce mixing between the CP-even and CP-odd Higgs states and generate CP-violating interference terms. Both effects are enhanced in the case of almost degenerate states. Employing as an example an extension of a frequently used benchmark scenario by a non-zero phase φ{sub A{sub t}}, the interference contributions are obtained for the production of neutral Higgs bosons in gluon-fusion and in association with b-quarks followed by the decay into a pair of τ-leptons. While the resonant mixing increases the individual cross sections for the two heavy Higgs bosons h{sub 2} and h{sub 3}, strongly destructive interference effects between the contributions involving h{sub 2} and h{sub 3} leave a considerable parameter region unexcluded that would appear to be ruled out if the interference effects were neglected.

  15. CP-violating top quark couplings at future linear e{sup +}e{sup -} colliders

    Energy Technology Data Exchange (ETDEWEB)

    Bernreuther, W. [RWTH Aachen University, Institut fuer Theoretische Teilchenphysik und Kosmologie, Aachen (Germany); Chen, L. [RWTH Aachen University, Institut fuer Theoretische Teilchenphysik und Kosmologie, Aachen (Germany); Max-Planck-Institut fuer Physik, Muenchen (Germany); Garcia, I. [Instituto de Fisica Corpuscular (IFIC, UVEG/CSIC), Valencia (Spain); CERN, Geneva (Switzerland); Perello, M.; Ros, E.; Vos, M. [Instituto de Fisica Corpuscular (IFIC, UVEG/CSIC), Valencia (Spain); Poeschl, R.; Richard, F. [Centre Scientifique d' Orsay, Laboratoire de l' Accelerateur Lineaire (LAL), Orsay (France)

    2018-02-15

    We study the potential of future lepton colliders to probe violation of the CP symmetry in the top quark sector. In certain extensions of the Standard Model, such as the two-Higgs-doublet model (2HDM), sizeable anomalous top quark dipole moments can arise, which may be revealed by a precise measurement of top quark pair production. We present results from detailed Monte Carlo studies for the ILC at 500 GeV and CLIC at 380 GeV and use parton-level simulations to explore the potential of high-energy operation. We find that precise measurements in e{sup +}e{sup -} → t anti t production with subsequent decay to lepton plus jets final states can provide sufficient sensitivity to detect Higgs-boson-induced CP violation in a viable two-Higgs-doublet model. The potential of a linear e{sup +}e{sup -} collider to detect CP-violating electric and weak dipole form factors of the top quark exceeds the prospects of the HL-LHC by over an order of magnitude. (orig.)

  16. CP-violating top quark couplings at future linear e^+e^- colliders

    Science.gov (United States)

    Bernreuther, W.; Chen, L.; García, I.; Perelló, M.; Poeschl, R.; Richard, F.; Ros, E.; Vos, M.

    2018-02-01

    We study the potential of future lepton colliders to probe violation of the CP symmetry in the top quark sector. In certain extensions of the Standard Model, such as the two-Higgs-doublet model (2HDM), sizeable anomalous top quark dipole moments can arise, which may be revealed by a precise measurement of top quark pair production. We present results from detailed Monte Carlo studies for the ILC at 500 GeV and CLIC at 380 GeV and use parton-level simulations to explore the potential of high-energy operation. We find that precise measurements in e^+e^- → t\\bar{t} production with subsequent decay to lepton plus jets final states can provide sufficient sensitivity to detect Higgs-boson-induced CP violation in a viable two-Higgs-doublet model. The potential of a linear e^+e^- collider to detect CP-violating electric and weak dipole form factors of the top quark exceeds the prospects of the HL-LHC by over an order of magnitude.

  17. Impact of CP-violating interference effects on MSSM Higgs searches

    Science.gov (United States)

    Fuchs, Elina; Weiglein, Georg

    2018-02-01

    Interference and mixing effects between neutral Higgs bosons in the MSSM with complex parameters are shown to have a significant impact on the interpretation of LHC searches for additional Higgs bosons. Complex MSSM parameters introduce mixing between the CP-even and CP-odd Higgs states h, H, A into the mass eigenstates h_1, h_2, h_3 and generate CP-violating interference terms. Both effects are enhanced in the case of almost degenerate states. Employing as an example an extension of a frequently used benchmark scenario by a non-zero phase φ _{A_t}, the interference contributions are obtained for the production of neutral Higgs bosons in gluon-fusion and in association with b-quarks followed by the decay into a pair of τ -leptons. While the resonant mixing increases the individual cross sections for the two heavy Higgs bosons h_2 and h_3, strongly destructive interference effects between the contributions involving h_2 and h_3 leave a considerable parameter region unexcluded that would appear to be ruled out if the interference effects were neglected.

  18. Single isospin decay amplitude and CP violation

    Energy Technology Data Exchange (ETDEWEB)

    Deshpande, N.G. [Oregon Univ., Eugene, OR (United States). Inst. of Theoretical Science; He, Xiaogang [Melbourne Univ., Parkville, VIC (Australia). School of Physics; Pakvasa, S. [Hawaii Univ., Honolulu, HI (United States). Dept. of Physics and Astronomy

    1996-06-01

    While for K meson or hyperon decays, the partial rate asymmetries are always zero if the final states are single isospin states, in B decays the situation is dramatically different and partial rate asymmetries can be non-zero if the final states are single isospin states. Partial rate asymmetries were calculated for several B decays with single isospin amplitude in the finale states using factorization approximation. It was found that more intermediate on-shell states with different Cabbibbo-Kobayashi-Maskawa factors are allowed in B decay and CP violating partial rate asymmetries need not to be zero even if the final state contains only a single isospin state. 17 refs., 4 figs.

  19. 60 years controlled nuclear fission: CP-1

    International Nuclear Information System (INIS)

    Anon.

    2002-01-01

    On December 2, 1942, the Chicago Pile 1 (CP-1) went critical for the first time. In this way, the scientists and engineers involved in the project under the leadership of Enrico Fermi succeeded in demonstrating that a self-sustaining nuclear reaction with nuclear fission processes was technically feasible. Only four years after the discovery and proof of nuclear fission by Otto Hahn, Fritz Strassmann, and Lise Meitner, the experiment consisting of graphite blocks as the moderator and uranium dioxide pellets as the fuel, as well as instrumentation and control devices, had been set up in the former squash court of the field and track stadium of the University of Chicago. Precisely at 3.36 a.m. Chicago time, after control rods had been withdrawn, the instruments showed the chain reaction by the neutron flux they indicated. An important cornerstone in the use of nuclear power had thus been laid. (orig.)

  20. Experimental hint for gravitational CP violation

    Energy Technology Data Exchange (ETDEWEB)

    Gharibyan, Vahagn [Deutsches Elektronen-Synchrotron, Hamburg (Germany). MDI Group

    2016-01-15

    An equality of particle and antiparticle gravitational interactions holds in general relativity and is supported by indirect observations. Gravity dependence on rotation or spin direction is experimentally constrained only at low energies. Here a method based on high energy Compton scattering is developed to measure the gravitational interaction of accelerated charged particles. Within that formalism the Compton spectra measured at HERA rule out the positron's anti-gravity and hint for a gravitational CP violation around 13 GeV energies, at a maximal level of 1.3±0.2% for the charge and 0.68±0.09% for the space parity. A stronger gravitational coupling to left helicity electrons relative to right helicity positrons is detected.

  1. Experimental hint for gravitational CP violation

    International Nuclear Information System (INIS)

    Gharibyan, Vahagn

    2016-01-01

    An equality of particle and antiparticle gravitational interactions holds in general relativity and is supported by indirect observations. Gravity dependence on rotation or spin direction is experimentally constrained only at low energies. Here a method based on high energy Compton scattering is developed to measure the gravitational interaction of accelerated charged particles. Within that formalism the Compton spectra measured at HERA rule out the positron's anti-gravity and hint for a gravitational CP violation around 13 GeV energies, at a maximal level of 1.3±0.2% for the charge and 0.68±0.09% for the space parity. A stronger gravitational coupling to left helicity electrons relative to right helicity positrons is detected.

  2. QCD corrections to decay distributions of neutral Higgs bosons with (in)definite CP parity

    International Nuclear Information System (INIS)

    Bernreuther, W.; Brandenburg, A.; Flesch, M.

    1997-01-01

    We compute the order α s QCD corrections to the density matrix for the decay of a neutral Higgs boson var-phi with (in)definite CP parity into a quark-antiquark pair and the QED corrections for the decay into a pair of charged leptons. We classify and calculate single spin asymmetries and spin-spin correlations which are generated by the scalar and pseudoscalar Yukawa couplings. These spin effects can be traced in var-phi →τ - τ + and, for heavy Higgs bosons, in var-phi →t bar t. We also calculate resulting correlations among the final states and estimate, for the respective decay modes, the number of events needed to measure the Yukawa couplings with these correlations at the 3σ level. copyright 1997 The American Physical Society

  3. Probing CP violation in h→γγ with converted photons

    Energy Technology Data Exchange (ETDEWEB)

    Bishara, Fady [Department of Physics, University of Cincinnati,345 Clifton Ct., Cincinnati, OH 45221 (United States); Theoretical Physics Department, Fermilab,P.O. Box 500, Batavia, IL 60510 (United States); Grossman, Yuval [Department of Physics, LEPP, Cornell University,109 Clark Hall, Ithaca, NY 14853 (United States); Harnik, Roni [Theoretical Physics Department, Fermilab,P.O. Box 500, Batavia, IL 60510 (United States); Robinson, Dean J. [State Key Laboratory of Theoretical Physics andKavli Institute for Theoretical Physics China (KITPC),Institute of Theoretical Physics, Chinese Academy of Sciences,Beijing 100190 (China); Department of Physics, University of California,366 Le Conte Hall #7300, Berkeley, CA 94720 (United States); Shu, Jing [Ernest Orlando Lawrence Berkeley National Laboratory, University of California,1 Cyclotron Road, Berkeley, CA 94720 (United States); Zupan, Jure [Department of Physics, University of Cincinnati,345 Clifton Ct., Cincinnati, OH 45221 (United States)

    2014-04-11

    We study Higgs diphoton decays, in which both photons undergo nuclear conversion to electron-positron pairs. The kinematic distribution of the two electron-positron pairs may be used to probe the CP violating (CPV) coupling of the Higgs to photons, that may be produced by new physics. Detecting CPV in this manner requires interference between the spin-polarized helicity amplitudes for both conversions. We derive leading order, analytic forms for these amplitudes. In turn, we obtain compact, leading-order expressions for the full process rate. While performing experiments involving photon conversions may be challenging, we use the results of our analysis to construct experimental cuts on certain observables that may enhance sensitivity to CPV. We show that there exist regions of phase space on which sensitivity to CPV is of order unity. The statistical sensitivity of these cuts are verified numerically, using dedicated Monte-Carlo simulations.

  4. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  5. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  6. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  7. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    Science.gov (United States)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  8. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  9. Multi-pair states in electron–positron pair creation

    Directory of Open Access Journals (Sweden)

    Anton Wöllert

    2016-09-01

    Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  10. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  11. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  12. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  13. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  14. Measurement of branching ratios and CP asymmetries for the decays B0→π+π-, B0→K+π-, B0→K+K-

    International Nuclear Information System (INIS)

    Prothmann, Kolja Andreas

    2013-01-01

    We present measurements of the branching fractions and CP violation parameters for the decay channels B 0 →π + π - , B 0 →K + π - and B 0 →K + K - . The final Belle dataset of 772 million B anti B pairs produced at the Υ(4S) resonance at the KEKB asymmetric-energy e + e - collider is used. For the branching fractions, we obtain B(B 0 →π + π - )=(5.63± 0.16(stat)± 0.16(syst)) x 10 -6 , B(B 0 →K ± π -+ )=(18.71±0.25(stat)± 0.37(syst)) x 10 -6 , B(B 0 →K + K - ) -8 at 90% CL. For the CP-asymmetries, we obtain following values: A CP (B 0 →π + π - )=0.33±0.06(stat)±0.03 (syst), S CP (B 0 →π + π - )=-0.64±0.08(stat)±0.03(syst), A CP (B 0 →K ± K -+ )=-0.061±0.014(stat)±0.008 (syst), where A CP and S CP represent direct and mixing-induced CP violation, respectively. For the CP-violating weak phase φ 2 we exclude the region 23.8 2 <66.8 at the 1σ level. A model independent test of new physics using a sum rule in the Kπ system yields a mild deviation from the standard model of -0.289±0.139(stat)±0.064(syst) with a 1.9σ significance.

  15. Pair potentials in liquid metals

    International Nuclear Information System (INIS)

    Faber, T.E.

    1980-01-01

    The argument which justifies the use of a pair potential to describe the structure-dependent term in the energy of liquid metals is briefly reviewed. Because there is an additional term in the energy which depends upon volume rather than structure, and because the pair potential itself is volume-dependent, the relationship between pair potential and observable properties such as pressure, bulk modulus and pair distribution function is more complicated for liquid metals than it is for molecular liquids. Perhaps for this reason, the agreement between pair potentials inferred from observable properties and pair potentials calculated by means of pseudo-potential theory is still far from complete. The pair potential concept is applicable only to simple liquid metals, in which the electron-ion interaction is weak. No attempt is made to discuss liquid transition and rare-earth metals, which are not simple in this sense. (author)

  16. Experimental many-pairs nonlocality

    Science.gov (United States)

    Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian

    2017-08-01

    Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.

  17. CP violation for electroweak baryogenesis from mixing of standard model and heavy vector quarks

    International Nuclear Information System (INIS)

    McDonald, J.

    1996-01-01

    It is known that the CP violation in the minimal standard model is insufficient to explain the observed baryon asymmetry of the Universe in the context electroweak baryogenesis. In this paper we consider the possibility that the additional CP violation required could originate in the mixing of the standard model quarks and heavy vector quark pairs. We consider the baryon asymmetry in the context of the spontaneous baryogenesis scenario. It is shown that, in general, the CP-violating phase entering the mass matrix of the standard model and heavy vector quarks must be space dependent in order to produce a baryon asymmetry, suggesting that the additional CP violation must be spontaneous in nature. This is true for the case of the simplest models which mix the standard model and heavy vector quarks. We derive a charge potential term for the model by diagonalizing the quark mass matrix in the presence of the electroweak bubble wall, which turns out to be quite different from the fermionic hypercharge potentials usually considered in spontaneous baryogenesis models, and obtain the rate of baryon number generation within the wall. We find, for the particular example where the standard model quarks mix with weak-isodoublet heavy vector quarks via the expectation value of a gauge singlet scalar, that we can account for the observed baryon asymmetry with conservative estimates for the uncertain parameters of electroweak baryogenesis, provided that the heavy vector quarks are not heavier than a few hundred GeV and that the coupling of the standard model quarks to the heavy vector quarks and gauge singlet scalars is not much smaller than order of 1, corresponding to a mixing angle of the heavy vector quarks and standard model quarks not much smaller than order of 10 -1 . copyright 1996 The American Physical Society

  18. Search for neutral Higgs bosons in CP-conserving and CP-violating MSSM scenarios

    CERN Document Server

    Abbiendi, G.; Akesson, P.F.; Alexander, G.; Allison, John; Amaral, P.; Anagnostou, G.; Anderson, K.J.; Asai, S.; Axen, D.; Azuelos, G.; Bailey, I.; Barberio, E.; Barillari, T.; Barlow, R.J.; Batley, R.J.; Bechtle, P.; Behnke, T.; Bell, Kenneth Watson; Bell, P.J.; Bella, G.; Bellerive, A.; Benelli, G.; Bethke, S.; Biebel, O.; Boeriu, O.; Bock, P.; Boutemeur, M.; Braibant, S.; Brigliadori, L.; Brown, Robert M.; Buesser, K.; Burckhart, H.J.; Campana, S.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, D.G.; Ciocca, C.; Csilling, A.; Cuffiani, M.; Dado, S.; De Roeck, A.; De Wolf, E.A.; Desch, K.; Dienes, B.; Donkers, M.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Etzion, E.; Fabbri, F.; Feld, L.; Ferrari, P.; Fiedler, F.; Fleck, I.; Ford, M.; Frey, A.; Gagnon, P.; Gary, John William; Gaycken, G.; Geich-Gimbel, C.; Giacomelli, G.; Giacomelli, P.; Giunta, Marina; Goldberg, J.; Gross, E.; Grunhaus, J.; Gruwe, M.; Gunther, P.O.; Gupta, A.; Hajdu, C.; Hamann, M.; Hanson, G.G.; Harel, A.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herten, G.; Heuer, R.D.; Hill, J.C.; Hoffman, Kara Dion; Horvath, D.; Igo-Kemenes, P.; Ishii, K.; Jeremie, H.; Jovanovic, P.; Junk, T.R.; Kanaya, N.; Kanzaki, J.; Karlen, D.; Kawagoe, K.; Kawamoto, T.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Kluth, S.; Kobayashi, T.; Kobel, M.; Komamiya, S.; Kramer, T.; Krieger, P.; von Krogh, J.; Kruger, K.; Kuhl, T.; Kupper, M.; Lafferty, G.D.; Landsman, H.; Lanske, D.; Layter, J.G.; Lellouch, D.; Lettso, J.; Levinson, L.; Lillich, J.; Lloyd, S.L.; Loebinger, F.K.; Lu, J.; Ludwig, A.; Ludwig, J.; Mader, W.; Marcellini, S.; Martin, A.J.; Masetti, G.; Mashimo, T.; Mattig, Peter; McKenna, J.; McPherson, R.A.; Meijers, F.; Menges, W.; Merritt, F.S.; Mes, H.; Meyer, Niels T.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Moed, S.; Mohr, W.; Mori, T.; Mutter, A.; Nagai, K.; Nakamura, I.; Nanjo, H.; Neal, H.A.; Nisius, R.; O'Neale, S.W.; Oh, A.; Oreglia, M.J.; Orito, S.; Pahl, C.; Pasztor, G.; Pater, J.R.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poli, B.; Pooth, O.; Przybycien, M.; Quadt, A.; Rabbertz, K.; Rembser, C.; Renkel, P.; Roney, J.M.; Rozen, Y.; Runge, K.; Sachs, K.; Saeki, T.; Sarkisyan, E.K.G.; Schaile, A.D.; Schaile, O.; Scharff-Hansen, P.; Schieck, J.; Schorner-Sadenius, T.; Schroder, Matthias; Schumacher, M.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Sherwood, P.; Skuja, A.; Smith, A.M.; Sobie, R.; Soldner-Rembold, S.; Spano, F.; Stahl, A.; Strom, David M.; Strohmer, R.; Tarem, S.; Tasevsky, M.; Teuscher, R.; Thomson, M.A.; Torrence, E.; Toya, D.; Tran, P.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turner-Watson, M.F.; Ueda, I.; Ujvari, B.; Vollmer, C.F.; Vannerem, P.; Vertesi, R.; Verzocchi, M.; Voss, H.; Vossebeld, J.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wengler, T.; Wermes, N.; Wilson, G.W.; Wilson, J.A.; Wolf, G.; Wyatt, T.R.; Yamashita, S.; Zer-Zion, D.; Zivkovic, Lidija

    2004-01-01

    This report summarizes the final results from the OPAL collaboration on searches for neutral Higgs bosons predicted by the Minimal Supersymmetric Standard Model (MSSM). CP-conserving and for the first time at LEP CP-violating scenarios are studied. New scenarios are also included, which aim to set the stage for Higgs searches at future colliders. The results are based on the data collected with the OPAL detector at e+e- centre-of-mass energies up to 209 GeV. The data are consistent with the prediction of the Standard Model with no Higgs boson produced. Model-independent limits are derived for the cross-section of a number of events topologies motivated by prediction of the MSSM. Limits on Higgs boson masses and other MSSM parameters are obtained for a number of representative MSSM benchmark scenarios. For example, in the CP-conserving scenario mh-max where the MSSM parameters are adjusted to predict the largest range of values for mh at each tan beta, and for a top quark mass of 174.3 GeV, the domain 0.784.5 ...

  19. Synthesis and reactivity of dimolybdathiaborane cluster [(Cp Mo ...

    Indian Academy of Sciences (India)

    Cluster 2 has a bicapped octahedral geometry with the {Fe(CO)3} fragment occupying one of the ... thesis and characterization of [(Cp. ∗ ... Infrared spectra were obtained on a Nicolet 6700 FT-. IR spectrometer. Microanalyses for C, H, and N were performed on .... tains signals attributable to the one type of Cp. ∗ ligand.

  20. Solution of the strong CP problem by color exchange

    International Nuclear Information System (INIS)

    Barr, S.M.; Zee, A.

    1985-08-01

    We present a new way to solve the strong CP problem in models with a spontaneously broken CP invariance. It is simpler than existing non-Peccei-Quinn approaches. It predicts the existence of light (i.e. weak scale) colored Higgs bosons which could be seen in colliders. 25 refs., 3 figs

  1. Proceedings of the Workshop on CP Violation at KAON Factory

    International Nuclear Information System (INIS)

    Ng, J.N.

    1989-07-01

    These proceedings contain the written version of eight talks delivered at the Workshop on CP Violation at KAON Factory. The articles contain reviews on the exploration of CP violation effects associated with the s-quark. Discussion on the use of intense kaon fluxes, which will be available at the proposed KAON Factory, are included

  2. Isospin analysis of CP asymmetries in B decays

    International Nuclear Information System (INIS)

    Gronau, M.; London, D.

    1990-09-01

    There is some theoretical uncertainty in the predictions for CP violating hadronic asymmetries in neutral B decays to CP eigenstates due to the existence of penguin diagrams. Using isospin relatins, we show that it is possible to remove this uncertainty for the decays B d 0 → ππ, up to a 4-fold ambiguity. (orig.)

  3. A mini review on CP-violating minimal supersymmetric Standard

    Indian Academy of Sciences (India)

    We discuss the present status of the Higgs sector of the CP-violating minimal supersymmetric Standard Model (CPVMSSM). In the Standard Model (SM) of particle physics, the only source of CP violation is the complex phase in the Cabibbo–Kobayashi–Maskawa (CKM) matrix. By now we all know that this singlephase is ...

  4. Difficulty for Weinberg model of CP nonconservation through Higgs exchange

    International Nuclear Information System (INIS)

    Deshpande, N.G.

    1981-01-01

    We evaluate the CP violation parameter element of'/element of in the Weinberg model of CP nonconservation. When gluon exchange effects are included, we find element of'/element of approx. -.045, which is in conflict with the experimental measurement element of'/element of = -.003 +- .015

  5. On the determination of the CP of the Higgs boson

    Energy Technology Data Exchange (ETDEWEB)

    Skjold, A.

    1995-12-31

    While the Higgs particle of the Standard Models is a Cp-even scalar particle, extended models may contain Higgs particles that are odd under CP, and also models invoking Higgs-like particles which are not eigenstates of CP may be considered. In the context of Higgs production via the Bjorken process and Higgs decay to tour fermions distributions that are sensitive to the CP parity are discussed. The author also discuss observables which may demonstrate presence of CP violation and identify a phase shift {delta} which is a measure of the strength of CP violation in the Higgs-vector-vector coupling, and which can be measured directly in the relevant distribution. In the case of Higgs production via the Bjorken process at a future e{sup +}e{sup -}collider, Monte Carlo data on the expected efficiency is presented, and it is concluded that it is relatively easy to determine whether the produced particle is even or odd under CP. However, observation of any CP violation would require a very large amount of data. It is argued that the analogous prospects at LEP2 or at a future hadron collider like the LHC seem to be less promising. 63 refs.

  6. On the determination of the CP of the Higgs boson

    International Nuclear Information System (INIS)

    Skjold, A.

    1995-01-01

    While the Higgs particle of the Standard Models is a Cp-even scalar particle, extended models may contain Higgs particles that are odd under CP, and also models invoking Higgs-like particles which are not eigenstates of CP may be considered. In the context of Higgs production via the Bjorken process and Higgs decay to tour fermions distributions that are sensitive to the CP parity are discussed. The author also discuss observables which may demonstrate presence of CP violation and identify a phase shift δ which is a measure of the strength of CP violation in the Higgs-vector-vector coupling, and which can be measured directly in the relevant distribution. In the case of Higgs production via the Bjorken process at a future e + e - collider, Monte Carlo data on the expected efficiency is presented, and it is concluded that it is relatively easy to determine whether the produced particle is even or odd under CP. However, observation of any CP violation would require a very large amount of data. It is argued that the analogous prospects at LEP2 or at a future hadron collider like the LHC seem to be less promising. 63 refs

  7. Why does CP violation matter to the universe?

    CERN Document Server

    Ellis, Jonathan Richard

    1999-01-01

    The seemingly obscure phenomenon of CP violation is increasingly being viewed as the key to a deeper understanding of both the behaviour of elementary particles and the big bang origin of the universe. Here, John Ellis of CERN explains how far and how deep the implications of CP violation extend. (0 refs).

  8. On the determination of the CP of the Higgs boson

    Energy Technology Data Exchange (ETDEWEB)

    Skjold, A

    1996-12-31

    While the Higgs particle of the Standard Models is a Cp-even scalar particle, extended models may contain Higgs particles that are odd under CP, and also models invoking Higgs-like particles which are not eigenstates of CP may be considered. In the context of Higgs production via the Bjorken process and Higgs decay to tour fermions distributions that are sensitive to the CP parity are discussed. The author also discuss observables which may demonstrate presence of CP violation and identify a phase shift {delta} which is a measure of the strength of CP violation in the Higgs-vector-vector coupling, and which can be measured directly in the relevant distribution. In the case of Higgs production via the Bjorken process at a future e{sup +}e{sup -}collider, Monte Carlo data on the expected efficiency is presented, and it is concluded that it is relatively easy to determine whether the produced particle is even or odd under CP. However, observation of any CP violation would require a very large amount of data. It is argued that the analogous prospects at LEP2 or at a future hadron collider like the LHC seem to be less promising. 63 refs.

  9. CP violation searches in the charm sector at LHCb

    CERN Multimedia

    CERN. Geneva

    2016-01-01

    LHCb has collected the world's largest sample of charmed hadrons, thus enabling measurements of direct and indirect CP violation parameters of D^0 mesons to be made with unprecedented precision. The difference in CP asymmetries between the singly Cabibbo-suppressed (SCS) D^0 -> K+K- and D^0 -> pi+pi- decays (Delta A_CP) has emerged as a powerful observable to search for direct CPV in the charm sector. By taking the difference between the two modes, most of the asymmetries induced by the detector or coming from the production mechanism are cancelled. The measurement of Delta A_CP done at LHCb is the most precise measurement of a time-integrated CP asymmetry in the charm sector from a single experiment, with a precision reaching the sub-permille level. Two independent measurements of Delta A_CP based on complementary data sets will be presented. Related 2-body searches and searches for direct CP violation in multi-body decays of the D^0 mesons will be discussed. Indirect CP violation in charm is measured throug...

  10. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  11. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  12. $CP$ violation in the B system at LHCb

    CERN Document Server

    AUTHOR|(CDS)2067431

    2014-01-01

    A selection of recent LHCb results on $CP$ violation in the $B$ system is presented. These include direct $CP$ violation measurements in $B^0 \\to \\phi K^*(892)^0$, $B_{(s)}^0 \\to K^\\pm\\pi^\\pm$, $B^\\pm \\to K^\\pm \\pi^+\\pi^-$, $B^\\pm \\to K^\\pm K^+K^-$ and $B^\\pm \\to \\phi K^\\pm$ decays; time-dependent $CP$ violation measurements in $B_s^0 \\to K^+K^-$ and $B^0 \\to \\pi^+\\pi^-$ decays; determination of the flavour-specific $CP$-violating asymmetry $a_{sl}^s$ in $B_s^0$ decays; and study of the mixing-induced $CP$ violation in $B_s^0 \\to J/\\psi K^+K^-$ and $B_s^0 \\to J/\\psi \\pi^+\\pi^-$ decays.

  13. The possibility of leptonic CP-violation measurement with JUNO

    Science.gov (United States)

    Smirnov, M. V.; Hu, Zh. J.; Li, S. J.; Ling, J. J.

    2018-06-01

    The existence of CP-violation in the leptonic sector is one of the most important issues for modern science. Neutrino physics is a key to the solution of this problem. JUNO (under construction) is the near future of neutrino physics. However CP-violation is not a priority for the current scientific program. We estimate the capability of δCP measurement, assuming a combination of the JUNO detector and a superconductive cyclotron as the antineutrino source. This method of measuring CP-violation is an alternative to conventional beam experiments. A significance level of 3σ can be reached for 22% of the δCP range. The accuracy of measurement lies between 8o and 22o. It is shown that the dominant influence on the result is the uncertainty in the mixing angle Θ23.

  14. Neutrino mixing and lepton CP-phase in neutrino oscillations

    International Nuclear Information System (INIS)

    Ryzhikh, D.A.; Ter-Martirosyan, K.A.

    2001-01-01

    One studied oscillations of the Dirac neutrinos belonging to three generations in vacuum with regard to the effect of the lepton CP-breaking phase on them in the matrix of lepton mixing (analogue of the quark CP-phase). In the general form one obtained formulae for probabilities of transition of neutrino of one kind to another at oscillations depending on three angles of mixing and on CP-phase. It was pointed that when measuring oscillation average probabilities of transition of neutrino of one kind to another one might in principle, restore the value of lepton CP-phase. Manifestation of CP-phase in the form of deviation of the values of probabilities of direct neutrino transition from reverse one is the effect practically escaping observation [ru

  15. Testing non-standard CP violation in neutrino propagation

    International Nuclear Information System (INIS)

    Winter, Walter

    2009-01-01

    Non-standard physics which can be described by effective four fermion interactions may be an additional source of CP violation in the neutrino propagation. We discuss the detectability of such a CP violation at a neutrino factory. We assume the current baseline setup of the international design study of a neutrino factory (IDS-NF) for the simulation. We find that the CP violation from certain non-standard interactions is, in principle, detectable significantly below their current bounds - even if there is no CP violation in the standard oscillation framework. Therefore, a new physics effect might be mis-interpreted as the canonical Dirac CP violation, and a possibly even more exciting effect might be missed

  16. Implications of maximal Jarlskog invariant and maximal CP violation

    International Nuclear Information System (INIS)

    Rodriguez-Jauregui, E.; Universidad Nacional Autonoma de Mexico

    2001-04-01

    We argue here why CP violating phase Φ in the quark mixing matrix is maximal, that is, Φ=90 . In the Standard Model CP violation is related to the Jarlskog invariant J, which can be obtained from non commuting Hermitian mass matrices. In this article we derive the conditions to have Hermitian mass matrices which give maximal Jarlskog invariant J and maximal CP violating phase Φ. We find that all squared moduli of the quark mixing elements have a singular point when the CP violation phase Φ takes the value Φ=90 . This special feature of the Jarlskog invariant J and the quark mixing matrix is a clear and precise indication that CP violating Phase Φ is maximal in order to let nature treat democratically all of the quark mixing matrix moduli. (orig.)

  17. Four-dimensional CP2 model on a lattice

    International Nuclear Information System (INIS)

    Bitar, K.M.; Raja, R.

    1983-01-01

    We investigate the phenomenon of dynamical generation of gauge interactions from CP/sup N/-1 models in four dimensions. We do this for the CP 2 model on a lattice. The phase diagram of a model that interpolates between CP 2 and U(1) gauge theory on a lattice is first mapped out. The potential between static charges in various regions of this diagram is also measured. Contrary to hopes based on the large-N behavior of similar models in two dimensions and on our phase diagram, we find that the potentials generated by CP 2 do not bear any resemblance to those of U(1). They are rather similar to the Higgs phase of an Abelian gauge theory in both phases displayed by CP 2

  18. On the energy crisis in noncommutative CP(1) model

    International Nuclear Information System (INIS)

    Sourrouille, Lucas

    2010-01-01

    We study the CP(1) system in (2+1)-dimensional noncommutative space with and without Chern-Simons term. Using the Seiberg-Witten map we convert the noncommutative CP(1) system to an action written in terms of the commutative fields. We find that this system presents the same infinite size instanton solution as the commutative Chern-Simons-CP(1) model without a potential term. Based on this result we argue that the BPS equations are compatible with the full variational equations of motion, rejecting the hypothesis of an 'energy crisis'. In addition we examine the noncommutative CP(1) system with a Chern-Simons interaction. In this case we find that when the theory is transformed by the Seiberg-Witten map it also presents the same instanton solution as the commutative Chern-Simons-CP(1) model.

  19. Addressing the strong CP problem with quark mass ratios

    Energy Technology Data Exchange (ETDEWEB)

    Diaz-Cruz, J.L.; Saldana-Salazar, U.J. [Benemerita Univ. Autonoma de Puebla (Mexico). Facultad de Ciencias Fisico-Matematicas; Hollik, W.G. [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)

    2016-05-15

    The strong CP problem is one of many puzzles in the theoretical description of elementary particles physics that still lacks an explanation. Solutions to that problem usually comprise new symmetries or fields or both. The main problem seems to be how to achieve small CP in the strong interactions despite large CP violation in weak interactions. Observation of CP violation is exclusively through the Higgs-Yukawa interactions. In this letter, we show that with minimal assumptions on the structure of mass (Yukawa) matrices the strong CP problem does not exist in the Standard Model and no extension to solve this is needed. However, to solve the flavor puzzle, models based on minimal SU(3) flavor groups leading to the proposed flavor matrices are favored.

  20. Addressing the strong CP problem with quark mass ratios

    International Nuclear Information System (INIS)

    Diaz-Cruz, J.L.; Saldana-Salazar, U.J.

    2016-05-01

    The strong CP problem is one of many puzzles in the theoretical description of elementary particles physics that still lacks an explanation. Solutions to that problem usually comprise new symmetries or fields or both. The main problem seems to be how to achieve small CP in the strong interactions despite large CP violation in weak interactions. Observation of CP violation is exclusively through the Higgs-Yukawa interactions. In this letter, we show that with minimal assumptions on the structure of mass (Yukawa) matrices the strong CP problem does not exist in the Standard Model and no extension to solve this is needed. However, to solve the flavor puzzle, models based on minimal SU(3) flavor groups leading to the proposed flavor matrices are favored.

  1. CP violation in the lepton sector with Majorana neutrinos

    International Nuclear Information System (INIS)

    Aguila, F. del

    1995-01-01

    We study CP violation in the lepton sector in extended models with right-handed neutrinos, without and with left-right symmetry, and with arbitrary mass terms. We find the conditions which must be satisfied by the neutrino and charged lepton mass matrices for CP conservation. These constraints, which are independent of the choice of weak basis, are proven to be also sufficient in simple cases. This invariant formulation makes apparent the necessary requirements for CP violation, as well as the size of CP violating effects. As an example, we show that CP violation can be much larger in left-right symmetric models than in models with only additional right-handed neutrinos, i.e., without right-handed currents. (orig.)

  2. Strong-Weak CP Hierarchy from Non-Renormalization Theorems

    Energy Technology Data Exchange (ETDEWEB)

    Hiller, Gudrun

    2002-01-28

    We point out that the hierarchy between the measured values of the CKM phase and the strong CP phase has a natural origin in supersymmetry with spontaneous CP violation and low energy supersymmetry breaking. The underlying reason is simple and elegant: in supersymmetry the strong CP phase is protected by an exact non-renormalization theorem while the CKM phase is not. We present explicit examples of models which exploit this fact and discuss corrections to the non-renormalization theorem in the presence of supersymmetry breaking. This framework for solving the strong CP problem has generic predictions for the superpartner spectrum, for CP and flavor violation, and predicts a preferred range of values for electric dipole moments.

  3. Segregation of Calcium Isotopes in the Atmospheres of CP Stars as a Consequence of Light-Induced Drift

    Science.gov (United States)

    Parkhomenko, A. I.; Shalagin, A. M.

    2018-06-01

    A mechanism for the segregation of calcium isotopes in the atmospheres of chemically peculiar (CP) stars due to light-induced drift (LID) of singly charged 48Ca+ ions is discussed. One peculiarity of Ca+ is that an adequate description of the effect of LID requires taking into account several energy levels of Ca+, and thus several pairs of relative differences ( ν i - ν k )/ ν i for the transport frequencies for collisions of levels i and k with neutral atoms (hydrogen, helium). The known real (calculated ab initio) interaction potentials are used to numerically calculate the factors ( ν i - ν k )/ ν i for several states of Ca+ for collisions with H and He atoms. These computations show that, at the temperatures characteristic of the atmospheres of CP stars, T = 6600-12 000 K, fairly high values are obtained for Ca+ ions, ( ν i - ν k )/ ν i ≈ 0.4-0.6. Simple, transparent computations demonstrate that the LID rates of Ca+ ions in the atmospheres of cool CP stars ( T eff = 6600 K) exceed the drift rate due to light pressure by two orders of magnitude. The LID is directed upward in the stellar atmosphere, and the heavy isotope 48Ca is pushed into upper layers of the atmosphere. This can explain the observed predominance of the heavy isotope 48Ca in the upper atmospheric layers of CP stars; according to the radiative-diffusion theory, the action of light pressure alone (in the absence of LID) would lead to sinking of the isotope 48Ca deeper into stellar atmosphere, following the lighter main isotope 40Ca. The 48Ca+ LIDrate decreases and its drift rate due to light pressure increases with growth of the effective temperatures in the atmospheres of CP stars. The manifestations of LID and light pressure are roughly comparable in the atmospheres of CP stars with effective temperatures near T eff = 9500 K.

  4. Leptogenesis and low energy CP-violation in neutrino physics

    International Nuclear Information System (INIS)

    Pascoli, S.; Petcov, S.T.; Riotto, A.

    2007-01-01

    Taking into account the recent progress in the understanding of the lepton flavor effects in leptogenesis, we investigate in detail the possibility that the CP-violation necessary for the generation of the baryon asymmetry of the Universe is due exclusively to the Dirac and/or Majorana CP-violating phases in the PMNS neutrino mixing matrix U, and thus is directly related to the low energy CP-violation in the lepton sector (e.g., in neutrino oscillations, etc.). We first derive the conditions of CP-invariance of the neutrino Yukawa couplings λ in the see-saw Lagrangian, and of the complex orthogonal matrix R in the 'orthogonal' parametrization of λ. We show, e.g. that under certain conditions (i) real R and specific CP-conserving values of the Majorana and Dirac phases can imply CP-violation, and (ii) purely imaginary R does not necessarily imply breaking of CP-symmetry. We study in detail the case of hierarchical heavy Majorana neutrino mass spectrum, presenting results for three possible types of light neutrino mass spectrum: (i) normal hierarchical, (ii) inverted hierarchical, and (iii) quasi-degenerate. Results in the alternative case of quasi-degenerate in mass heavy Majorana neutrinos, are also derived. The minimal supersymmetric extension of the standard theory with right-handed Majorana neutrinos and see-saw mechanism of neutrino mass generation is discussed as well. We illustrate the possible correlations between the baryon asymmetry of the Universe and (i) the rephasing invariant J CP controlling the magnitude of CP-violation in neutrino oscillations, or (ii) the effective Majorana mass in neutrinoless double beta decay, in the cases when the only source of CP-violation is respectively the Dirac or the Majorana phases in the neutrino mixing matrix

  5. Measurements of the B0 bar B0 CP asymmetry

    International Nuclear Information System (INIS)

    Lueth, V.

    1993-01-01

    A figure of merit for a measurement of CP violation is the error on the intrinsic asymmetry A CP . The observed asymmetry A obs will always be smaller than A CP due to a number of effects that dilute the measurement. If one defines A obs =DA CP , where D represents the product of all dilution factors, then the error on A CP , δA CP is related to the number of produced B 0 or bar B 0 , N prod , needed to obtain a given error on δA CP by N prod =1/((δA CP ) 2 D 2 εBr). To determine the figure of merit for a particular decay mode one must determine the number of reconstructed events N obs and calculate the corresponding dilution factor D. N obs depends on the luminosity and production cross section, on the branching ratio of the B 0 or bar B 0 into the specific final state under study, Br, and on ε, the reconstruction efficiency for both the combination of the signal CP state and any tagging signal. The production rate N prod , the dilution factor D, and the efficiency ε, differ substantially in magnitude as a function of energy and detector layout. The detection efficiency and dilution factor can both be written as a product of several factors that can be estimated for a particular experiment. These factors depend critically on the decay mode under study, the tagging method, the detector configuration, and more generally on the production process, backgrounds, and detector performance. Furthermore, the present knowledge of these quantities varies largely, as well as ones ability to ultimately measure the dilution factor which relates the experimentally observed asymmetry to the true CP asymmetry

  6. Arsenic-Rich Polyarsenides Stabilized by Cp*Fe Fragments.

    Science.gov (United States)

    Schmidt, Monika; Konieczny, David; Peresypkina, Eugenia V; Virovets, Alexander V; Balázs, Gabor; Bodensteiner, Michael; Riedlberger, Felix; Krauss, Hannes; Scheer, Manfred

    2017-06-12

    The redox chemistry of [Cp*Fe(η 5 -As 5 )] (1, Cp*=η 5 -C 5 Me 5 ) has been investigated by cyclic voltammetry, revealing a redox behavior similar to that of its lighter congener [Cp*Fe(η 5 -P 5 )]. However, the subsequent chemical reduction of 1 by KH led to the formation of a mixture of novel As n scaffolds with n up to 18 that are stabilized only by [Cp*Fe] fragments. These include the arsenic-poor triple-decker complex [K(dme) 2 ][{Cp*Fe(μ,η 2:2 -As 2 )} 2 ] (2) and the arsenic-rich complexes [K(dme) 3 ] 2 [(Cp*Fe) 2 (μ,η 4:4 -As 10 )] (3), [K(dme) 2 ] 2 [(Cp*Fe) 2 (μ,η 2:2:2:2 -As 14 )] (4), and [K(dme) 3 ] 2 [(Cp*Fe) 4 (μ 4 ,η 4:3:3:2:2:1:1 -As 18 )] (5). Compound 4 and the polyarsenide complex 5 are the largest anionic As n ligand complexes reported thus far. Complexes 2-5 were characterized by single-crystal X-ray diffraction, 1 H NMR spectroscopy, EPR spectroscopy (2), and mass spectrometry. Furthermore, DFT calculations showed that the intermediate [Cp*Fe(η 5 -As 5 )] - , which is presumably formed first, undergoes fast dimerization to the dianion [(Cp*Fe) 2 (μ,η 4:4 -As 10 )] 2- . © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  8. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  9. Integration of CpG-free DNA induces de novo methylation of CpG islands in pluripotent stem cells

    KAUST Repository

    Takahashi, Yuta; Wu, Jun; Suzuki, Keiichiro; Martinez-Redondo, Paloma; Li, Mo; Liao, Hsin-Kai; Wu, Min-Zu; Herná ndez-Bení tez, Reyna; Hishida, Tomoaki; Shokhirev, Maxim Nikolaievich; Esteban, Concepcion Rodriguez; Sancho-Martinez, Ignacio; Belmonte, Juan Carlos Izpisua

    2017-01-01

    that insertion of CpG-free DNA into targeted CGIs induces de novo methylation of the entire CGI in human pluripotent stem cells (PSCs). The methylation status is stably maintained even after CpG-free DNA removal, extensive passaging, and differentiation

  10. Test of CP invariance in vector-boson fusion production of the Higgs boson using the Optimal Observable method in the ditau decay channel with the ATLAS detector.

    Science.gov (United States)

    Aad, G; Abbott, B; Abdinov, O; Abdallah, J; Abeloos, B; Aben, R; Abolins, M; Aben, R; Abolins, M; AbouZeid, O S; Abraham, N L; Abramowicz, H; Abreu, H; Abreu, R; Abulaiti, Y; Acharya, B S; Adamczyk, L; Adams, D L; Adelman, J; Adomeit, S; Adye, T; Affolder, A A; Agatonovic-Jovin, T; Agricola, J; Aguilar-Saavedra, J A; Ahlen, S P; Ahmadov, F; Aielli, G; Akerstedt, H; Åkesson, T P A; Akimov, A V; Alberghi, G L; Albert, J; Albrand, S; Verzini, M J Alconada; Aleksa, M; Aleksandrov, I N; Alexa, C; Alexander, G; Alexopoulos, T; Alhroob, M; Alimonti, G; Alison, J; Alkire, S P; Allbrooke, B M M; Allen, B W; Allport, P P; Aloisio, A; Alonso, A; Alonso, F; Alpigiani, C; Gonzalez, B Alvarez; Piqueras, D Álvarez; Alviggi, M G; Amadio, B T; Amako, K; Coutinho, Y Amaral; Amelung, C; Amidei, D; Santos, S P Amor Dos; Amorim, A; Amoroso, S; Amram, N; Amundsen, G; Anastopoulos, C; Ancu, L S; Andari, N; Andeen, T; Anders, C F; Anders, G; Anders, J K; Anderson, K J; Andreazza, A; Andrei, V; Angelidakis, S; Angelozzi, I; Anger, P; Angerami, A; Anghinolfi, F; Anisenkov, A V; Anjos, N; Annovi, A; Antonelli, M; Antonov, A; Antos, J; Anulli, F; Aoki, M; Bella, L Aperio; Arabidze, G; Arai, Y; Araque, J P; Arce, A T H; Arduh, F A; Arguin, J-F; Argyropoulos, S; Arik, M; Armbruster, A J; Armitage, L J; Arnaez, O; Arnold, H; Arratia, M; Arslan, O; Artamonov, A; Artoni, G; Artz, S; Asai, S; Asbah, N; Ashkenazi, A; Åsman, B; Asquith, L; Assamagan, K; Astalos, R; Atkinson, M; Atlay, N B; Augsten, K; Avolio, G; Axen, B; Ayoub, M K; Azuelos, G; Baak, M A; Baas, A E; Baca, M J; Bachacou, H; Bachas, K; Backes, M; Backhaus, M; Bagiacchi, P; Bagnaia, P; Bai, Y; Baines, J T; Baker, O K; Baldin, E M; Balek, P; Balestri, T; Balli, F; Balunas, W K; Banas, E; Banerjee, Sw; Bannoura, A A E; Barak, L; Barberio, E L; Barberis, D; Barbero, M; Barillari, T; Barisonzi, M; Barklow, T; Barlow, N; Barnes, S L; Barnett, B M; Barnett, R M; Barnovska, Z; Baroncelli, A; Barone, G; Barr, A J; Navarro, L Barranco; Barreiro, F; da Costa, J Barreiro Guimarães; Bartoldus, R; Barton, A E; Bartos, P; Basalaev, A; Bassalat, A; Basye, A; Bates, R L; Batista, S J; Batley, J R; Battaglia, M; Bauce, M; Bauer, F; Bawa, H S; Beacham, J B; Beattie, M D; Beau, T; Beauchemin, P H; Bechtle, P; Beck, H P; Becker, K; Becker, M; Beckingham, M; Becot, C; Beddall, A J; Beddall, A; Bednyakov, V A; Bedognetti, M; Bee, C P; Beemster, L J; Beermann, T A; Begel, M; Behr, J K; Belanger-Champagne, C; Bell, A S; Bell, W H; Bella, G; Bellagamba, L; Bellerive, A; Bellomo, M; Belotskiy, K; Beltramello, O; Belyaev, N L; Benary, O; Benchekroun, D; Bender, M; Bendtz, K; Benekos, N; Benhammou, Y; Noccioli, E Benhar; Benitez, J; Garcia, J A Benitez; Benjamin, D P; Bensinger, J R; Bentvelsen, S; Beresford, L; Beretta, M; Berge, D; Kuutmann, E Bergeaas; Berger, N; Berghaus, F; Beringer, J; Berlendis, S; Bernard, N R; Bernius, C; Bernlochner, F U; Berry, T; Berta, P; Bertella, C; Bertoli, G; Bertolucci, F; Bertram, I A; Bertsche, C; Bertsche, D; Besjes, G J; Bylund, O Bessidskaia; Bessner, M; Besson, N; Betancourt, C; Bethke, S; Bevan, A J; Bhimji, W; Bianchi, R M; Bianchini, L; Bianco, M; Biebel, O; Biedermann, D; Bielski, R; Biesuz, N V; Biglietti, M; De Mendizabal, J Bilbao; Bilokon, H; Bindi, M; Binet, S; Bingul, A; Bini, C; Biondi, S; Bjergaard, D M; Black, C W; Black, J E; Black, K M; Blackburn, D; Blair, R E; Blanchard, J-B; Blanco, J E; Blazek, T; Bloch, I; Blocker, C; Blum, W; Blumenschein, U; Blunier, S; Bobbink, G J; Bobrovnikov, V S; Bocchetta, S S; Bocci, A; Bock, C; Boehler, M; Boerner, D; Bogaerts, J A; Bogavac, D; Bogdanchikov, A G; Bohm, C; Boisvert, V; Bold, T; Boldea, V; Boldyrev, A S; Bomben, M; Bona, M; Boonekamp, M; Borisov, A; Borissov, G; Bortfeldt, J; Bortoletto, D; Bortolotto, V; Bos, K; Boscherini, D; Bosman, M; Sola, J D Bossio; Boudreau, J; Bouffard, J; Bouhova-Thacker, E V; Boumediene, D; Bourdarios, C; Boutle, S K; Boveia, A; Boyd, J; Boyko, I R; Bracinik, J; Brandt, A; Brandt, G; Brandt, O; Bratzler, U; Brau, B; Brau, J E; Braun, H M; Madden, W D Breaden; Brendlinger, K; Brennan, A J; Brenner, L; Brenner, R; Bressler, S; Bristow, T M; Britton, D; Britzger, D; Brochu, F M; Brock, I; Brock, R; Brooijmans, G; Brooks, T; Brooks, W K; Brosamer, J; Brost, E; Broughton, J H; de Renstrom, P A Bruckman; Bruncko, D; Bruneliere, R; Bruni, A; Bruni, G; Brunt, B H; Bruschi, M; Bruscino, N; Bryant, P; Bryngemark, L; Buanes, T; Buat, Q; Buchholz, P; Buckley, A G; Budagov, I A; Buehrer, F; Bugge, M K; Bulekov, O; Bullock, D; Burckhart, H; Burdin, S; Burgard, C D; Burghgrave, B; Burka, K; Burke, S; Burmeister, I; Busato, E; Büscher, D; Büscher, V; Bussey, P; Butler, J M; Butt, A I; Buttar, C M; Butterworth, J M; Butti, P; Buttinger, W; Buzatu, A; Buzykaev, A R; Urbán, S Cabrera; Caforio, D; Cairo, V M; Cakir, O; Calace, N; Calafiura, P; Calandri, A; Calderini, G; Calfayan, P; Caloba, L P; Calvet, D; Calvet, S; Calvet, T P; Toro, R Camacho; Camarda, S; Camarri, P; Cameron, D; Armadans, R Caminal; Camincher, C; Campana, S; Campanelli, M; Campoverde, A; Canale, V; Canepa, A; Bret, M Cano; Cantero, J; Cantrill, R; Cao, T; Garrido, M D M Capeans; Caprini, I; Caprini, M; Capua, M; Caputo, R; Carbone, R M; Cardarelli, R; Cardillo, F; Carli, T; Carlino, G; Carminati, L; Caron, S; Carquin, E; Carrillo-Montoya, G D; Carter, J R; Carvalho, J; Casadei, D; Casado, M P; Casolino, M; Casper, D W; Castaneda-Miranda, E; Castelli, A; Gimenez, V Castillo; Castro, N F; Catinaccio, A; Catmore, J R; Cattai, A; Caudron, J; Cavaliere, V; Cavallaro, E; Cavalli, D; Cavalli-Sforza, M; Cavasinni, V; Ceradini, F; Alberich, L Cerda; Cerio, B C; Cerqueira, A S; Cerri, A; Cerrito, L; Cerutti, F; Cerv, M; Cervelli, A; Cetin, S A; Chafaq, A; Chakraborty, D; Chalupkova, I; Chan, S K; Chan, Y L; Chang, P; Chapman, J D; Charlton, D G; Chatterjee, A; Chau, C C; Barajas, C A Chavez; Che, S; Cheatham, S; Chegwidden, A; Chekanov, S; Chekulaev, S V; Chelkov, G A; Chelstowska, M A; Chen, C; Chen, H; Chen, K; Chen, S; Chen, S; Chen, X; Chen, Y; Cheng, H C; Cheng, H J; Cheng, Y; Cheplakov, A; Cheremushkina, E; Moursli, R Cherkaoui El; Chernyatin, V; Cheu, E; Chevalier, L; Chiarella, V; Chiarelli, G; Chiodini, G; Chisholm, A S; Chitan, A; Chizhov, M V; Choi, K; Chomont, A R; Chouridou, S; Chow, B K B; Christodoulou, V; Chromek-Burckhart, D; Chudoba, J; Chuinard, A J; Chwastowski, J J; Chytka, L; Ciapetti, G; Ciftci, A K; Cinca, D; Cindro, V; Cioara, I A; Ciocio, A; Cirotto, F; Citron, Z H; Ciubancan, M; Clark, A; Clark, B L; Clark, P J; Clarke, R N; Clement, C; Coadou, Y; Cobal, M; Coccaro, A; Cochran, J; Coffey, L; Colasurdo, L; Cole, B; Cole, S; Colijn, A P; Collot, J; Colombo, T; Compostella, G; Muiño, P Conde; Coniavitis, E; Connell, S H; Connelly, I A; Consorti, V; Constantinescu, S; Conta, C; Conti, G; Conventi, F; Cooke, M; Cooper, B D; Cooper-Sarkar, A M; Cornelissen, T; Corradi, M; Corriveau, F; Corso-Radu, A; Cortes-Gonzalez, A; Cortiana, G; Costa, G; Costa, M J; Costanzo, D; Cottin, G; Cowan, G; Cox, B E; Cranmer, K; Crawley, S J; Cree, G; Crépé-Renaudin, S; Crescioli, F; Cribbs, W A; Ortuzar, M Crispin; Cristinziani, M; Croft, V; Crosetti, G; Donszelmann, T Cuhadar; Cummings, J; Curatolo, M; Cúth, J; Cuthbert, C; Czirr, H; Czodrowski, P; D'Auria, S; D'Onofrio, M; De Sousa, M J Da Cunha Sargedas; Via, C Da; Dabrowski, W; Dai, T; Dale, O; Dallaire, F; Dallapiccola, C; Dam, M; Dandoy, J R; Dang, N P; Daniells, A C; Dann, N S; Danninger, M; Hoffmann, M Dano; Dao, V; Darbo, G; Darmora, S; Dassoulas, J; Dattagupta, A; Davey, W; David, C; Davidek, T; Davies, M; Davison, P; Davygora, Y; Dawe, E; Dawson, I; Daya-Ishmukhametova, R K; De, K; de Asmundis, R; De Benedetti, A; De Castro, S; De Cecco, S; De Groot, N; de Jong, P; De la Torre, H; De Lorenzi, F; De Pedis, D; De Salvo, A; De Sanctis, U; De Santo, A; De Regie, J B De Vivie; Dearnaley, W J; Debbe, R; Debenedetti, C; Dedovich, D V; Deigaard, I; Del Peso, J; Del Prete, T; Delgove, D; Deliot, F; Delitzsch, C M; Deliyergiyev, M; Dell'Acqua, A; Dell'Asta, L; Dell'Orso, M; Della Pietra, M; Della Volpe, D; Delmastro, M; Delsart, P A; Deluca, C; DeMarco, D A; Demers, S; Demichev, M; Demilly, A; Denisov, S P; Denysiuk, D; Derendarz, D; Derkaoui, J E; Derue, F; Dervan, P; Desch, K; Deterre, C; Dette, K; Deviveiros, P O; Dewhurst, A; Dhaliwal, S; Di Ciaccio, A; Di Ciaccio, L; Di Clemente, W K; Di Domenico, A; Di Donato, C; Di Girolamo, A; Di Girolamo, B; Di Mattia, A; Di Micco, B; Di Nardo, R; Di Simone, A; Di Sipio, R; Di Valentino, D; Diaconu, C; Diamond, M; Dias, F A; Diaz, M A; Diehl, E B; Dietrich, J; Diglio, S; Dimitrievska, A; Dingfelder, J; Dita, P; Dita, S; Dittus, F; Djama, F; Djobava, T; Djuvsland, J I; do Vale, M A B; Dobos, D; Dobre, M; Doglioni, C; Dohmae, T; Dolejsi, J; Dolezal, Z; Dolgoshein, B A; Donadelli, M; Donati, S; Dondero, P; Donini, J; Dopke, J; Doria, A; Dova, M T; Doyle, A T; Drechsler, E; Dris, M; Du, Y; Duarte-Campderros, J; Duchovni, E; Duckeck, G; Ducu, O A; Duda, D; Dudarev, A; Duflot, L; Duguid, L; Dührssen, M; Dunford, M; Yildiz, H Duran; Düren, M; Durglishvili, A; Duschinger, D; Dutta, B; Dyndal, M; Eckardt, C; Ecker, K M; Edgar, R C; Edson, W; Edwards, N C; Eifert, T; Eigen, G; Einsweiler, K; Ekelof, T; Kacimi, M El; Ellajosyula, V; Ellert, M; Elles, S; Ellinghaus, F; Elliot, A A; Ellis, N; Elmsheuser, J; Elsing, M; Emeliyanov, D; Enari, Y; Endner, O C; Endo, M; Ennis, J S; Erdmann, J; Ereditato, A; Ernis, G; Ernst, J; Ernst, M; Errede, S; Ertel, E; Escalier, M; Esch, H; Escobar, C; Esposito, B; Etienvre, A I; Etzion, E; Evans, H; Ezhilov, A; Fabbri, F; Fabbri, L; Facini, G; Fakhrutdinov, R M; Falciano, S; Falla, R J; Faltova, J; Fang, Y; Fanti, M; Farbin, A; Farilla, A; Farina, C; Farooque, T; Farrell, S; Farrington, S M; Farthouat, P; Fassi, F; Fassnacht, P; Fassouliotis, D; Giannelli, M Faucci; Favareto, A; Fawcett, W J; Fayard, L; Fedin, O L; Fedorko, W; Feigl, S; Feligioni, L; Feng, C; Feng, E J; Feng, H; Fenyuk, A B; Feremenga, L; Martinez, P Fernandez; Perez, S Fernandez; Ferrando, J; Ferrari, A; Ferrari, P; Ferrari, R; de Lima, D E Ferreira; Ferrer, A; Ferrere, D; Ferretti, C; Parodi, A Ferretto; Fiedler, F; Filipčič, A; Filipuzzi, M; Filthaut, F; Fincke-Keeler, M; Finelli, K D; Fiolhais, M C N; Fiorini, L; Firan, A; Fischer, A; Fischer, C; Fischer, J; Fisher, W C; Flaschel, N; Fleck, I; Fleischmann, P; Fletcher, G T; Fletcher, G; Fletcher, R R M; Flick, T; Floderus, A; Castillo, L R Flores; Flowerdew, M J; Forcolin, G T; Formica, A; Forti, A; Foster, A G; Fournier, D; Fox, H; Fracchia, S; Francavilla, P; Franchini, M; Francis, D; Franconi, L; Franklin, M; Frate, M; Fraternali, M; Freeborn, D; Fressard-Batraneanu, S M; Friedrich, F; Froidevaux, D; Frost, J A; Fukunaga, C; Torregrosa, E Fullana; Fusayasu, T; Fuster, J; Gabaldon, C; Gabizon, O; Gabrielli, A; Gabrielli, A; Gach, G P; Gadatsch, S; Gadomski, S; Gagliardi, G; Gagnon, L G; Gagnon, P; Galea, C; Galhardo, B; Gallas, E J; Gallop, B J; Gallus, P; Galster, G; Gan, K K; Gao, J; Gao, Y; Gao, Y S; Walls, F M Garay; García, C; Navarro, J E García; Garcia-Sciveres, M; Gardner, R W; Garelli, N; Garonne, V; Bravo, A Gascon; Gatti, C; Gaudiello, A; Gaudio, G; Gaur, B; Gauthier, L; Gavrilenko, I L; Gay, C; Gaycken, G; Gazis, E N; Gecse, Z; Gee, C N P; Geich-Gimbel, Ch; Geisler, M P; Gemme, C; Genest, M H; Geng, C; Gentile, S; George, S; Gerbaudo, D; Gershon, A; Ghasemi, S; Ghazlane, H; Ghneimat, M; Giacobbe, B; Giagu, S; Giannetti, P; Gibbard, B; Gibson, S M; Gignac, M; Gilchriese, M; Gillam, T P S; Gillberg, D; Gilles, G; Gingrich, D M; Giokaris, N; Giordani, M P; Giorgi, F M; Giorgi, F M; Giraud, P F; Giromini, P; Giugni, D; Giuli, F; Giuliani, C; Giulini, M; Gjelsten, B K; Gkaitatzis, S; Gkialas, I; Gkougkousis, E L; Gladilin, L K; Glasman, C; Glatzer, J; Glaysher, P C F; Glazov, A; Goblirsch-Kolb, M; Godlewski, J; Goldfarb, S; Golling, T; Golubkov, D; Gomes, A; Gonçalo, R; Costa, J Goncalves Pinto Firmino Da; Gonella, L; Gongadze, A; de la Hoz, S González; Parra, G Gonzalez; Gonzalez-Sevilla, S; Goossens, L; Gorbounov, P A; Gordon, H A; Gorelov, I; Gorini, B; Gorini, E; Gorišek, A; Gornicki, E; Goshaw, A T; Gössling, C; Gostkin, M I; Goudet, C R; Goujdami, D; Goussiou, A G; Govender, N; Gozani, E; Graber, L; Grabowska-Bold, I; Gradin, P O J; Grafström, P; Gramling, J; Gramstad, E; Grancagnolo, S; Gratchev, V; Gray, H M; Graziani, E; Greenwood, Z D; Grefe, C; Gregersen, K; Gregor, I M; Grenier, P; Grevtsov, K; Griffiths, J; Grillo, A A; Grimm, K; Grinstein, S; Gris, Ph; Grivaz, J-F; Groh, S; Grohs, J P; Gross, E; Grosse-Knetter, J; Grossi, G C; Grout, Z J; Guan, L; Guan, W; Guenther, J; Guescini, F; Guest, D; Gueta, O; Guido, E; Guillemin, T; Guindon, S; Gul, U; Gumpert, C; Guo, J; Guo, Y; Gupta, S; Gustavino, G; Gutierrez, P; Ortiz, N G Gutierrez; Gutschow, C; Guyot, C; Gwenlan, C; Gwilliam, C B; Haas, A; Haber, C; Hadavand, H K; Haddad, N; Hadef, A; Haefner, P; Hageböck, S; Hajduk, Z; Hakobyan, H; Haleem, M; Haley, J; Hall, D; Halladjian, G; Hallewell, G D; Hamacher, K; Hamal, P; Hamano, K; Hamilton, A; Hamity, G N; Hamnett, P G; Han, L; Hanagaki, K; Hanawa, K; Hance, M; Haney, B; Hanke, P; Hanna, R; Hansen, J B; Hansen, J D; Hansen, M C; Hansen, P H; Hara, K; Hard, A S; Harenberg, T; Hariri, F; Harkusha, S; Harrington, R D; Harrison, P F; Hartjes, F; Hasegawa, M; Hasegawa, Y; Hasib, A; Hassani, S; Haug, S; Hauser, R; Hauswald, L; Havranek, M; Hawkes, C M; Hawkings, R J; Hawkins, A D; Hayden, D; Hays, C P; Hays, J M; Hayward, H S; Haywood, S J; Head, S J; Heck, T; Hedberg, V; Heelan, L; Heim, S; Heim, T; Heinemann, B; Heinrich, J J; Heinrich, L; Heinz, C; Hejbal, J; Helary, L; Hellman, S; Helsens, C; Henderson, J; Henderson, R C W; Heng, Y; Henkelmann, S; Correia, A M Henriques; Henrot-Versille, S; Herbert, G H; Jiménez, Y Hernández; Herten, G; Hertenberger, R; Hervas, L; Hesketh, G G; Hessey, N P; Hetherly, J W; Hickling, R; Higón-Rodriguez, E; Hill, E; Hill, J C; Hiller, K H; Hillier, S J; Hinchliffe, I; Hines, E; Hinman, R R; Hirose, M; Hirschbuehl, D; Hobbs, J; Hod, N; Hodgkinson, M C; Hodgson, P; Hoecker, A; Hoeferkamp, M R; Hoenig, F; Hohlfeld, M; Hohn, D; Holmes, T R; Homann, M; Hong, T M; Hooberman, B H; Hopkins, W H; Horii, Y; Horton, A J; Hostachy, J-Y; Hou, S; Hoummada, A; Howard, J; Howarth, J; Hrabovsky, M; Hristova, I; Hrivnac, J; Hryn'ova, T; Hrynevich, A; Hsu, C; Hsu, P J; Hsu, S-C; Hu, D; Hu, Q; Huang, Y; Hubacek, Z; Hubaut, F; Huegging, F; Huffman, T B; Hughes, E W; Hughes, G; Huhtinen, M; Hülsing, T A; Huseynov, N; Huston, J; Huth, J; Iacobucci, G; Iakovidis, G; Ibragimov, I; Iconomidou-Fayard, L; Ideal, E; Idrissi, Z; Iengo, P; Igonkina, O; Iizawa, T; Ikegami, Y; Ikeno, M; Ilchenko, Y; Iliadis, D; Ilic, N; Ince, T; Introzzi, G; Ioannou, P; Iodice, M; Iordanidou, K; Ippolito, V; Quiles, A Irles; Isaksson, C; Ishino, M; Ishitsuka, M; Ishmukhametov, R; Issever, C; Istin, S; Ito, F; Ponce, J M Iturbe; Iuppa, R; Ivarsson, J; Iwanski, W; Iwasaki, H; Izen, J M; Izzo, V; Jabbar, S; Jackson, B; Jackson, M; Jackson, P; Jain, V; Jakobi, K B; Jakobs, K; Jakobsen, S; Jakoubek, T; Jamin, D O; Jana, D K; Jansen, E; Jansky, R; Janssen, J; Janus, M; Jarlskog, G; Javadov, N; Javůrek, T; Jeanneau, F; Jeanty, L; Jejelava, J; Jeng, G-Y; Jennens, D; Jenni, P; Jentzsch, J; Jeske, C; Jézéquel, S; Ji, H; Jia, J; Jiang, H; Jiang, Y; Jiggins, S; Pena, J Jimenez; Jin, S; Jinaru, A; Jinnouchi, O; Johansson, P; Johns, K A; Johnson, W J; Jon-And, K; Jones, G; Jones, R W L; Jones, S; Jones, T J; Jongmanns, J; Jorge, P M; Jovicevic, J; Ju, X; Rozas, A Juste; Köhler, M K; Kaczmarska, A; Kado, M; Kagan, H; Kagan, M; Kahn, S J; Kajomovitz, E; Kalderon, C W; Kaluza, A; Kama, S; Kamenshchikov, A; Kanaya, N; Kaneti, S; Kantserov, V A; Kanzaki, J; Kaplan, B; Kaplan, L S; Kapliy, A; Kar, D; Karakostas, K; Karamaoun, A; Karastathis, N; Kareem, M J; Karentzos, E; Karnevskiy, M; Karpov, S N; Karpova, Z M; Karthik, K; Kartvelishvili, V; Karyukhin, A N; Kasahara, K; Kashif, L; Kass, R D; Kastanas, A; Kataoka, Y; Kato, C; Katre, A; Katzy, J; Kawade, K; Kawagoe, K; Kawamoto, T; Kawamura, G; Kazama, S; Kazanin, V F; Keeler, R; Kehoe, R; Keller, J S; Kempster, J J; Keoshkerian, H; Kepka, O; Kerševan, B P; Kersten, S; Keyes, R A; Khalil-Zada, F; Khandanyan, H; Khanov, A; Kharlamov, A G; Khoo, T J; Khovanskiy, V; Khramov, E; Khubua, J; Kido, S; Kim, H Y; Kim, S H; Kim, Y K; Kimura, N; Kind, O M; King, B T; King, M; King, S B; Kirk, J; Kiryunin, A E; Kishimoto, T; Kisielewska, D; Kiss, F; Kiuchi, K; Kivernyk, O; Kladiva, E; Klein, M H; Klein, M; Klein, U; Kleinknecht, K; Klimek, P; Klimentov, A; Klingenberg, R; Klinger, J A; Klioutchnikova, T; Kluge, E-E; Kluit, P; Kluth, S; Knapik, J; Kneringer, E; Knoops, E B F G; Knue, A; Kobayashi, A; Kobayashi, D; Kobayashi, T; Kobel, M; Kocian, M; Kodys, P; Koffas, T; Koffeman, E; Kogan, L A; Kohriki, T; Koi, T; Kolanoski, H; Kolb, M; Koletsou, I; Komar, A A; Komori, Y; Kondo, T; Kondrashova, N; Köneke, K; König, A C; Kono, T; Konoplich, R; Konstantinidis, N; Kopeliansky, R; Koperny, S; Köpke, L; Kopp, A K; Korcyl, K; Kordas, K; Korn, A; Korol, A A; Korolkov, I; Korolkova, E V; Kortner, O; Kortner, S; Kosek, T; Kostyukhin, V V; Kotov, V M; Kotwal, A; Kourkoumeli-Charalampidi, A; Kourkoumelis, C; Kouskoura, V; Koutsman, A; Kowalewska, A B; Kowalewski, R; Kowalski, T Z; Kozanecki, W; Kozhin, A S; Kramarenko, V A; Kramberger, G; Krasnopevtsev, D; Krasny, M W; Krasznahorkay, A; Kraus, J K; Kravchenko, A; Kretz, M; Kretzschmar, J; Kreutzfeldt, K; Krieger, P; Krizka, K; Kroeninger, K; Kroha, H; Kroll, J; Kroseberg, J; Krstic, J; Kruchonak, U; Krüger, H; Krumnack, N; Kruse, A; Kruse, M C; Kruskal, M; Kubota, T; Kucuk, H; Kuday, S; Kuechler, J T; Kuehn, S; Kugel, A; Kuger, F; Kuhl, A; Kuhl, T; Kukhtin, V; Kukla, R; Kulchitsky, Y; Kuleshov, S; Kuna, M; Kunigo, T; Kupco, A; Kurashige, H; Kurochkin, Y A; Kus, V; Kuwertz, E S; Kuze, M; Kvita, J; Kwan, T; Kyriazopoulos, D; Rosa, A La; Navarro, J L La Rosa; Rotonda, L La; Lacasta, C; Lacava, F; Lacey, J; Lacker, H; Lacour, D; Lacuesta, V R; Ladygin, E; Lafaye, R; Laforge, B; Lagouri, T; Lai, S; Lammers, S; Lampl, W; Lançon, E; Landgraf, U; Landon, M P J; Lang, V S; Lange, J C; Lankford, A J; Lanni, F; Lantzsch, K; Lanza, A; Laplace, S; Lapoire, C; Laporte, J F; Lari, T; Manghi, F Lasagni; Lassnig, M; Laurelli, P; Lavrijsen, W; Law, A T; Laycock, P; Lazovich, T; Lazzaroni, M; Dortz, O Le; Guirriec, E Le; Menedeu, E Le; Quilleuc, E P Le; LeBlanc, M; LeCompte, T; Ledroit-Guillon, F; Lee, C A; Lee, S C; Lee, L; Lefebvre, G; Lefebvre, M; Legger, F; Leggett, C; Lehan, A; Miotto, G Lehmann; Lei, X; Leight, W A; Leisos, A; Leister, A G; Leite, M A L; Leitner, R; Lellouch, D; Lemmer, B; Leney, K J C; Lenz, T; Lenzi, B; Leone, R; Leone, S; Leonidopoulos, C; Leontsinis, S; Lerner, G; Leroy, C; Lesage, A A J; Lester, C G; Levchenko, M; Levêque, J; Levin, D; Levinson, L J; Levy, M; Leyko, A M; Leyton, M; Li, B; Li, H; Li, H L; Li, L; Li, L; Li, Q; Li, S; Li, X; Li, Y; Liang, Z; Liao, H; Liberti, B; Liblong, A; Lichard, P; Lie, K; Liebal, J; Liebig, W; Limbach, C; Limosani, A; Lin, S C; Lin, T H; Lindquist, B E; Lipeles, E; Lipniacka, A; Lisovyi, M; Liss, T M; Lissauer, D; Lister, A; Litke, A M; Liu, B; Liu, D; Liu, H; Liu, H; Liu, J; Liu, J B; Liu, K; Liu, L; Liu, M; Liu, M; Liu, Y L; Liu, Y; Livan, M; Lleres, A; Merino, J Llorente; Lloyd, S L; Sterzo, F Lo; Lobodzinska, E; Loch, P; Lockman, W S; Loebinger, F K; Loevschall-Jensen, A E; Loew, K M; Loginov, A; Lohse, T; Lohwasser, K; Lokajicek, M; Long, B A; Long, J D; Long, R E; Longo, L; Looper, K A; Lopes, L; Mateos, D Lopez; Paredes, B Lopez; Paz, I Lopez; Solis, A Lopez; Lorenz, J; Martinez, N Lorenzo; Losada, M; Lösel, P J; Lou, X; Lounis, A; Love, J; Love, P A; Lu, H; Lu, N; Lubatti, H J; Luci, C; Lucotte, A; Luedtke, C; Luehring, F; Lukas, W; Luminari, L; Lundberg, O; Lund-Jensen, B; Lynn, D; Lysak, R; Lytken, E; Lyubushkin, V; Ma, H; Ma, L L; Ma, Y; Maccarrone, G; Macchiolo, A; Macdonald, C M; Maček, B; Miguens, J Machado; Madaffari, D; Madar, R; Maddocks, H J; Mader, W F; Madsen, A; Maeda, J; Maeland, S; Maeno, T; Maevskiy, A; Magradze, E; Mahlstedt, J; Maiani, C; Maidantchik, C; Maier, A A; Maier, T; Maio, A; Majewski, S; Makida, Y; Makovec, N; Malaescu, B; Malecki, Pa; Maleev, V P; Malek, F; Mallik, U; Malon, D; Malone, C; Maltezos, S; Malyshev, V M; Malyukov, S; Mamuzic, J; Mancini, G; Mandelli, B; Mandelli, L; Mandić, I; Maneira, J; Andrade Filho, L Manhaes de; Ramos, J Manjarres; Mann, A; Mansoulie, B; Mantifel, R; Mantoani, M; Manzoni, S; Mapelli, L; Marceca, G; March, L; Marchiori, G; Marcisovsky, M; Marjanovic, M; Marley, D E; Marroquim, F; Marsden, S P; Marshall, Z; Marti, L F; Marti-Garcia, S; Martin, B; Martin, T A; Martin, V J; Latour, B Martin Dit; Martinez, M; Martin-Haugh, S; Martoiu, V S; Martyniuk, A C; Marx, M; Marzano, F; Marzin, A; Masetti, L; Mashimo, T; Mashinistov, R; Masik, J; Maslennikov, A L; Massa, I; Massa, L; Mastrandrea, P; Mastroberardino, A; Masubuchi, T; Mättig, P; Mattmann, J; Maurer, J; Maxfield, S J; Maximov, D A; Mazini, R; Mazza, S M; Fadden, N C Mc; Goldrick, G Mc; Kee, S P Mc; McCarn, A; McCarthy, R L; McCarthy, T G; McClymont, L I; McFarlane, K W; Mcfayden, J A; Mchedlidze, G; McMahon, S J; McPherson, R A; Medinnis, M; Meehan, S; Mehlhase, S; Mehta, A; Meier, K; Meineck, C; Meirose, B; Garcia, B R Mellado; Meloni, F; Mengarelli, A; Menke, S; Meoni, E; Mercurio, K M; Mergelmeyer, S; Mermod, P; Merola, L; Meroni, C; Merritt, F S; Messina, A; Metcalfe, J; Mete, A S; Meyer, C; Meyer, C; Meyer, J-P; Meyer, J; Theenhausen, H Meyer Zu; Middleton, R P; Miglioranzi, S; Mijović, L; Mikenberg, G; Mikestikova, M; Mikuž, M; Milesi, M; Milic, A; Miller, D W; Mills, C; Milov, A; Milstead, D A; Minaenko, A A; Minami, Y; Minashvili, I A; Mincer, A I; Mindur, B; Mineev, M; Ming, Y; Mir, L M; Mistry, K P; Mitani, T; Mitrevski, J; Mitsou, V A; Miucci, A; Miyagawa, P S; Mjörnmark, J U; Moa, T; Mochizuki, K; Mohapatra, S; Mohr, W; Molander, S; Moles-Valls, R; Monden, R; Mondragon, M C; Mönig, K; Monk, J; Monnier, E; Montalbano, A; Berlingen, J Montejo; Monticelli, F; Monzani, S; Moore, R W; Morange, N; Moreno, D; Llácer, M Moreno; Morettini, P; Mori, D; Mori, T; Morii, M; Morinaga, M; Morisbak, V; Moritz, S; Morley, A K; Mornacchi, G; Morris, J D; Mortensen, S S; Morvaj, L; Mosidze, M; Moss, J; Motohashi, K; Mount, R; Mountricha, E; Mouraviev, S V; Moyse, E J W; Muanza, S; Mudd, R D; Mueller, F; Mueller, J; Mueller, R S P; Mueller, T; Muenstermann, D; Mullen, P; Mullier, G A; Sanchez, F J Munoz; Quijada, J A Murillo; Murray, W J; Murrone, A; Musheghyan, H; Muskinja, M; Myagkov, A G; Myska, M; Nachman, B P; Nackenhorst, O; Nadal, J; Nagai, K; Nagai, R; Nagano, K; Nagasaka, Y; Nagata, K; Nagel, M; Nagy, E; Nairz, A M; Nakahama, Y; Nakamura, K; Nakamura, T; Nakano, I; Namasivayam, H; Garcia, R F Naranjo; Narayan, R; Villar, D I Narrias; Naryshkin, I; Naumann, T; Navarro, G; Nayyar, R; Neal, H A; Nechaeva, P Yu; Neep, T J; Nef, P D; Negri, A; Negrini, M; Nektarijevic, S; Nellist, C; Nelson, A; Nemecek, S; Nemethy, P; Nepomuceno, A A; Nessi, M; Neubauer, M S; Neumann, M; Neves, R M; Nevski, P; Newman, P R; Nguyen, D H; Nickerson, R B; Nicolaidou, R; Nicquevert, B; Nielsen, J; Nikiforov, A; Nikolaenko, V; Nikolic-Audit, I; Nikolopoulos, K; Nilsen, J K; Nilsson, P; Ninomiya, Y; Nisati, A; Nisius, R; Nobe, T; Nodulman, L; Nomachi, M; Nomidis, I; Nooney, T; Norberg, S; Nordberg, M; Norjoharuddeen, N; Novgorodova, O; Nowak, S; Nozaki, M; Nozka, L; Ntekas, K; Nurse, E; Nuti, F; O'grady, F; O'Neil, D C; O'Rourke, A A; O'Shea, V; Oakham, F G; Oberlack, H; Obermann, T; Ocariz, J; Ochi, A; Ochoa, I; Ochoa-Ricoux, J P; Oda, S; Odaka, S; Ogren, H; Oh, A; Oh, S H; Ohm, C C; Ohman, H; Oide, H; Okawa, H; Okumura, Y; Okuyama, T; Olariu, A; Seabra, L F Oleiro; Pino, S A Olivares; Damazio, D Oliveira; Olszewski, A; Olszowska, J; Onofre, A; Onogi, K; Onyisi, P U E; Oram, C J; Oreglia, M J; Oren, Y; Orestano, D; Orlando, N; Orr, R S; Osculati, B; Ospanov, R; Garzon, G Otero Y; Otono, H; Ouchrif, M; Ould-Saada, F; Ouraou, A; Oussoren, K P; Ouyang, Q; Ovcharova, A; Owen, M; Owen, R E; Ozcan, V E; Ozturk, N; Pachal, K; Pages, A Pacheco; Aranda, C Padilla; Pagáčová, M; Griso, S Pagan; Paige, F; Pais, P; Pajchel, K; Palacino, G; Palestini, S; Palka, M; Pallin, D; Palma, A; Panagiotopoulou, E St; Pandini, C E; Vazquez, J G Panduro; Pani, P; Panitkin, S; Pantea, D; Paolozzi, L; Papadopoulou, Th D; Papageorgiou, K; Paramonov, A; Hernandez, D Paredes; Parker, A J; Parker, M A; Parker, K A; Parodi, F; Parsons, J A; Parzefall, U; Pascuzzi, V; Pasqualucci, E; Passaggio, S; Pastore, F; Pastore, Fr; Pásztor, G; Pataraia, S; Patel, N D; Pater, J R; Pauly, T; Pearce, J; Pearson, B; Pedersen, L E; Pedersen, M; Lopez, S Pedraza; Pedro, R; Peleganchuk, S V; Pelikan, D; Penc, O; Peng, C; Peng, H; Penwell, J; Peralva, B S; Perego, M M; Perepelitsa, D V; Codina, E Perez; Perini, L; Pernegger, H; Perrella, S; Peschke, R; Peshekhonov, V D; Peters, K; Peters, R F Y; Petersen, B A; Petersen, T C; Petit, E; Petridis, A; Petridou, C; Petroff, P; Petrolo, E; Petrov, M; Petrucci, F; Pettersson, N E; Peyaud, A; Pezoa, R; Phillips, P W; Piacquadio, G; Pianori, E; Picazio, A; Piccaro, E; Piccinini, M; Pickering, M A; Piegaia, R; Pilcher, J E; Pilkington, A D; Pin, A W J; Pina, J; Pinamonti, M; Pinfold, J L; Pingel, A; Pires, S; Pirumov, H; Pitt, M; Plazak, L; Pleier, M-A; Pleskot, V; Plotnikova, E; Plucinski, P; Pluth, D; Poettgen, R; Poggioli, L; Pohl, D; Polesello, G; Poley, A; Policicchio, A; Polifka, R; Polini, A; Pollard, C S; Polychronakos, V; Pommès, K; Pontecorvo, L; Pope, B G; Popeneciu, G A; Popovic, D S; Poppleton, A; Pospisil, S; Potamianos, K; Potrap, I N; Potter, C J; Potter, C T; Poulard, G; Poveda, J; Pozdnyakov, V; Astigarraga, M E Pozo; Pralavorio, P; Pranko, A; Prell, S; Price, D; Price, L E; Primavera, M; Prince, S; Proissl, M; Prokofiev, K; Prokoshin, F; Protopopescu, S; Proudfoot, J; Przybycien, M; Puddu, D; Puldon, D; Purohit, M; Puzo, P; Qian, J; Qin, G; Qin, Y; Quadt, A; Quayle, W B; Queitsch-Maitland, M; Quilty, D; Raddum, S; Radeka, V; Radescu, V; Radhakrishnan, S K; Radloff, P; Rados, P; Ragusa, F; Rahal, G; Raine, J A; Rajagopalan, S; Rammensee, M; Rangel-Smith, C; Ratti, M G; Rauscher, F; Rave, S; Ravenscroft, T; Raymond, M; Read, A L; Readioff, N P; Rebuzzi, D M; Redelbach, A; Redlinger, G; Reece, R; Reeves, K; Rehnisch, L; Reichert, J; Reisin, H; Rembser, C; Ren, H; Rescigno, M; Resconi, S; Rezanova, O L; Reznicek, P; Rezvani, R; Richter, R; Richter, S; Richter-Was, E; Ricken, O; Ridel, M; Rieck, P; Riegel, C J; Rieger, J; Rifki, O; Rijssenbeek, M; Rimoldi, A; Rinaldi, L; Ristić, B; Ritsch, E; Riu, I; Rizatdinova, F; Rizvi, E; Rizzi, C; Robertson, S H; Robichaud-Veronneau, A; Robinson, D; Robinson, J E M; Robson, A; Roda, C; Rodina, Y; Perez, A Rodriguez; Rodriguez, D Rodriguez; Roe, S; Rogan, C S; Røhne, O; Romaniouk, A; Romano, M; Saez, S M Romano; Adam, E Romero; Rompotis, N; Ronzani, M; Roos, L; Ros, E; Rosati, S; Rosbach, K; Rose, P; Rosenthal, O; Rossetti, V; Rossi, E; Rossi, L P; Rosten, J H N; Rosten, R; Rotaru, M; Roth, I; Rothberg, J; Rousseau, D; Royon, C R; Rozanov, A; Rozen, Y; Ruan, X; Rubbo, F; Rubinskiy, I; Rud, V I; Rudolph, M S; Rühr, F; Ruiz-Martinez, A; Rurikova, Z; Rusakovich, N A; Ruschke, A; Russell, H L; Rutherfoord, J P; Ruthmann, N; Ryabov, Y F; Rybar, M; Rybkin, G; Ryu, S; Ryzhov, A; Saavedra, A F; Sabato, G; Sacerdoti, S; Sadrozinski, H F-W; Sadykov, R; Tehrani, F Safai; Saha, P; Sahinsoy, M; Saimpert, M; Saito, T; Sakamoto, H; Sakurai, Y; Salamanna, G; Salamon, A; Loyola, J E Salazar; Salek, D; De Bruin, P H Sales; Salihagic, D; Salnikov, A; Salt, J; Salvatore, D; Salvatore, F; Salvucci, A; Salzburger, A; Sammel, D; Sampsonidis, D; Sanchez, A; Sánchez, J; Martinez, V Sanchez; Sandaker, H; Sandbach, R L; Sander, H G; Sanders, M P; Sandhoff, M; Sandoval, C; Sandstroem, R; Sankey, D P C; Sannino, M; Sansoni, A; Santoni, C; Santonico, R; Santos, H; Castillo, I Santoyo; Sapp, K; Sapronov, A; Saraiva, J G; Sarrazin, B; Sasaki, O; Sasaki, Y; Sato, K; Sauvage, G; Sauvan, E; Savage, G; Savard, P; Sawyer, C; Sawyer, L; Saxon, J; Sbarra, C; Sbrizzi, A; Scanlon, T; Scannicchio, D A; Scarcella, M; Scarfone, V; Schaarschmidt, J; Schacht, P; Schaefer, D; Schaefer, R; Schaeffer, J; Schaepe, S; Schaetzel, S; Schäfer, U; Schaffer, A C; Schaile, D; Schamberger, R D; Scharf, V; Schegelsky, V A; Scheirich, D; Schernau, M; Schiavi, C; Schillo, C; Schioppa, M; Schlenker, S; Schmieden, K; Schmitt, C; Schmitt, S; Schmitz, S; Schneider, B; Schnellbach, Y J; Schnoor, U; Schoeffel, L; Schoening, A; Schoenrock, B D; Schopf, E; Schorlemmer, A L S; Schott, M; Schovancova, J; Schramm, S; Schreyer, M; Schuh, N; Schultens, M J; Schultz-Coulon, H-C; Schulz, H; Schumacher, M; Schumm, B A; Schune, Ph; Schwanenberger, C; Schwartzman, A; Schwarz, T A; Schwegler, Ph; Schweiger, H; Schwemling, Ph; Schwienhorst, R; Schwindling, J; Schwindt, T; Sciolla, G; Scuri, F; Scutti, F; Searcy, J; Seema, P; Seidel, S C; Seiden, A; Seifert, F; Seixas, J M; Sekhniaidze, G; Sekhon, K; Sekula, S J; Seliverstov, D M; Semprini-Cesari, N; Serfon, C; Serin, L; Serkin, L; Sessa, M; Seuster, R; Severini, H; Sfiligoj, T; Sforza, F; Sfyrla, A; Shabalina, E; Shaikh, N W; Shan, L Y; Shang, R; Shank, J T; Shapiro, M; Shatalov, P B; Shaw, K; Shaw, S M; Shcherbakova, A; Shehu, C Y; Sherwood, P; Shi, L; Shimizu, S; Shimmin, C O; Shimojima, M; Shiyakova, M; Shmeleva, A; Saadi, D Shoaleh; Shochet, M J; Shojaii, S; Shrestha, S; Shulga, E; Shupe, M A; Sicho, P; Sidebo, P E; Sidiropoulou, O; Sidorov, D; Sidoti, A; Siegert, F; Sijacki, Dj; Silva, J; Silverstein, S B; Simak, V; Simard, O; Simic, Lj; Simion, S; Simioni, E; Simmons, B; Simon, D; Simon, M; Sinervo, P; Sinev, N B; Sioli, M; Siragusa, G; Sivoklokov, S Yu; Sjölin, J; Sjursen, T B; Skinner, M B; Skottowe, H P; Skubic, P; Slater, M; Slavicek, T; Slawinska, M; Sliwa, K; Slovak, R; Smakhtin, V; Smart, B H; Smestad, L; Smirnov, S Yu; Smirnov, Y; Smirnova, L N; Smirnova, O; Smith, M N K; Smith, R W; Smizanska, M; Smolek, K; Snesarev, A A; Snidero, G; Snyder, S; Sobie, R; Socher, F; Soffer, A; Soh, D A; Sokhrannyi, G; Sanchez, C A Solans; Solar, M; Soldatov, E Yu; Soldevila, U; Solodkov, A A; Soloshenko, A; Solovyanov, O V; Solovyev, V; Sommer, P; Son, H; Song, H Y; Sood, A; Sopczak, A; Sopko, V; Sorin, V; Sosa, D; Sotiropoulou, C L; Soualah, R; Soukharev, A M; South, D; Sowden, B C; Spagnolo, S; Spalla, M; Spangenberg, M; Spanò, F; Sperlich, D; Spettel, F; Spighi, R; Spigo, G; Spiller, L A; Spousta, M; Denis, R D St; Stabile, A; Staerz, S; Stahlman, J; Stamen, R; Stamm, S; Stanecka, E; Stanek, R W; Stanescu, C; Stanescu-Bellu, M; Stanitzki, M M; Stapnes, S; Starchenko, E A; Stark, G H; Stark, J; Staroba, P; Starovoitov, P; Staszewski, R; Steinberg, P; Stelzer, B; Stelzer, H J; Stelzer-Chilton, O; Stenzel, H; Stewart, G A; Stillings, J A; Stockton, M C; Stoebe, M; Stoicea, G; Stolte, P; Stonjek, S; Stradling, A R; Straessner, A; Stramaglia, M E; Strandberg, J; Strandberg, S; Strandlie, A; Strauss, M; Strizenec, P; Ströhmer, R; Strom, D M; Stroynowski, R; Strubig, A; Stucci, S A; Stugu, B; Styles, N A; Su, D; Su, J; Subramaniam, R; Suchek, S; Sugaya, Y; Suk, M; Sulin, V V; Sultansoy, S; Sumida, T; Sun, S; Sun, X; Sundermann, J E; Suruliz, K; Susinno, G; Sutton, M R; Suzuki, S; Svatos, M; Swiatlowski, M; Sykora, I; Sykora, T; Ta, D; Taccini, C; Tackmann, K; Taenzer, J; Taffard, A; Tafirout, R; Taiblum, N; Takai, H; Takashima, R; Takeda, H; Takeshita, T; Takubo, Y; Talby, M; Talyshev, A A; Tam, J Y C; Tan, K G; Tanaka, J; Tanaka, R; Tanaka, S; Tannenwald, B B; Araya, S Tapia; Tapprogge, S; Tarem, S; Tartarelli, G F; Tas, P; Tasevsky, M; Tashiro, T; Tassi, E; Delgado, A Tavares; Tayalati, Y; Taylor, A C; Taylor, G N; Taylor, P T E; Taylor, W; Teischinger, F A; Teixeira-Dias, P; Temming, K K; Temple, D; Kate, H Ten; Teng, P K; Teoh, J J; Tepel, F; Terada, S; Terashi, K; Terron, J; Terzo, S; Testa, M; Teuscher, R J; Theveneaux-Pelzer, T; Thomas, J P; Thomas-Wilsker, J; Thompson, E N; Thompson, P D; Thompson, R J; Thompson, A S; Thomsen, L A; Thomson, E; Thomson, M; Tibbetts, M J; Torres, R E Ticse; Tikhomirov, V O; Tikhonov, Yu A; Timoshenko, S; Tipton, P; Tisserant, S; Todome, K; Todorov, T; Todorova-Nova, S; Tojo, J; Tokár, S; Tokushuku, K; Tolley, E; Tomlinson, L; Tomoto, M; Tompkins, L; Toms, K; Tong, B; Torrence, E; Torres, H; Pastor, E Torró; Toth, J; Touchard, F; Tovey, D R; Trefzger, T; Tremblet, L; Tricoli, A; Trigger, I M; Trincaz-Duvoid, S; Tripiana, M F; Trischuk, W; Trocmé, B; Trofymov, A; Troncon, C; Trottier-McDonald, M; Trovatelli, M; Truong, L; Trzebinski, M; Trzupek, A; Tseng, J C-L; Tsiareshka, P V; Tsipolitis, G; Tsirintanis, N; Tsiskaridze, S; Tsiskaridze, V; Tskhadadze, E G; Tsui, K M; Tsukerman, I I; Tsulaia, V; Tsuno, S; Tsybychev, D; Tudorache, A; Tudorache, V; Tuna, A N; Tupputi, S A; Turchikhin, S; Turecek, D; Turgeman, D; Turra, R; Turvey, A J; Tuts, P M; Tyndel, M; Ucchielli, G; Ueda, I; Ueno, R; Ughetto, M; Ukegawa, F; Unal, G; Undrus, A; Unel, G; Ungaro, F C; Unno, Y; Unverdorben, C; Urban, J; Urquijo, P; Urrejola, P; Usai, G; Usanova, A; Vacavant, L; Vacek, V; Vachon, B; Valderanis, C; Santurio, E Valdes; Valencic, N; Valentinetti, S; Valero, A; Valery, L; Valkar, S; Vallecorsa, S; Ferrer, J A Valls; Van Den Wollenberg, W; Van Der Deijl, P C; van der Geer, R; van der Graaf, H; van Eldik, N; van Gemmeren, P; Van Nieuwkoop, J; van Vulpen, I; van Woerden, M C; Vanadia, M; Vandelli, W; Vanguri, R; Vaniachine, A; Vankov, P; Vardanyan, G; Vari, R; Varnes, E W; Varol, T; Varouchas, D; Vartapetian, A; Varvell, K E; Vasquez, J G; Vazeille, F; Schroeder, T Vazquez; Veatch, J; Veloce, L M; Veloso, F; Veneziano, S; Ventura, A; Venturi, M; Venturi, N; Venturini, A; Vercesi, V; Verducci, M; Verkerke, W; Vermeulen, J C; Vest, A; Vetterli, M C; Viazlo, O; Vichou, I; Vickey, T; Boeriu, O E Vickey; Viehhauser, G H A; Viel, S; Vigani, L; Vigne, R; Villa, M; Perez, M Villaplana; Vilucchi, E; Vincter, M G; Vinogradov, V B; Vittori, C; Vivarelli, I; Vlachos, S; Vlasak, M; Vogel, M; Vokac, P; Volpi, G; Volpi, M; von der Schmitt, H; von Toerne, E; Vorobel, V; Vorobev, K; Vos, M; Voss, R; Vossebeld, J H; Vranjes, N; Milosavljevic, M Vranjes; Vrba, V; Vreeswijk, M; Vuillermet, R; Vukotic, I; Vykydal, Z; Wagner, P; Wagner, W; Wahlberg, H; Wahrmund, S; Wakabayashi, J; Walder, J; Walker, R; Walkowiak, W; Wallangen, V; Wang, C; Wang, C; Wang, F; Wang, H; Wang, H; Wang, J; Wang, J; Wang, K; Wang, R; Wang, S M; Wang, T; Wang, T; Wang, X; Wanotayaroj, C; Warburton, A; Ward, C P; Wardrope, D R; Washbrook, A; Watkins, P M; Watson, A T; Watson, I J; Watson, M F; Watts, G; Watts, S; Waugh, B M; Webb, S; Weber, M S; Weber, S W; Webster, J S; Weidberg, A R; Weinert, B; Weingarten, J; Weiser, C; Weits, H; Wells, P S; Wenaus, T; Wengler, T; Wenig, S; Wermes, N; Werner, M; Werner, P; Wessels, M; Wetter, J; Whalen, K; Whallon, N L; Wharton, A M; White, A; White, M J; White, R; White, S; Whiteson, D; Wickens, F J; Wiedenmann, W; Wielers, M; Wienemann, P; Wiglesworth, C; Wiik-Fuchs, L A M; Wildauer, A; Wilk, F; Wilkens, H G; Williams, H H; Williams, S; Willis, C; Willocq, S; Wilson, J A; Wingerter-Seez, I; Winklmeier, F; Winston, O J; Winter, B T; Wittgen, M; Wittkowski, J; Wollstadt, S J; Wolter, M W; Wolters, H; Wosiek, B K; Wotschack, J; Woudstra, M J; Wozniak, K W; Wu, M; Wu, M; Wu, S L; Wu, X; Wu, Y; Wyatt, T R; Wynne, B M; Xella, S; Xu, D; Xu, L; Yabsley, B; Yacoob, S; Yakabe, R; Yamaguchi, D; Yamaguchi, Y; Yamamoto, A; Yamamoto, S; Yamanaka, T; Yamauchi, K; Yamazaki, Y; Yan, Z; Yang, H; Yang, H; Yang, Y; Yang, Z; Yao, W-M; Yap, Y C; Yasu, Y; Yatsenko, E; Wong, K H Yau; Ye, J; Ye, S; Yeletskikh, I; Yen, A L; Yildirim, E; Yorita, K; Yoshida, R; Yoshihara, K; Young, C; Young, C J S; Youssef, S; Yu, D R; Yu, J; Yu, J M; Yu, J; Yuan, L; Yuen, S P Y; Yusuff, I; Zabinski, B; Zaidan, R; Zaitsev, A M; Zakharchuk, N; Zalieckas, J; Zaman, A; Zambito, S; Zanello, L; Zanzi, D; Zeitnitz, C; Zeman, M; Zemla, A; Zeng, J C; Zeng, Q; Zengel, K; Zenin, O; Ženiš, T; Zerwas, D; Zhang, D; Zhang, F; Zhang, G; Zhang, H; Zhang, J; Zhang, L; Zhang, R; Zhang, R; Zhang, X; Zhang, Z; Zhao, X; Zhao, Y; Zhao, Z; Zhemchugov, A; Zhong, J; Zhou, B; Zhou, C; Zhou, L; Zhou, L; Zhou, M; Zhou, N; Zhu, C G; Zhu, H; Zhu, J; Zhu, Y; Zhuang, X; Zhukov, K; Zibell, A; Zieminska, D; Zimine, N I; Zimmermann, C; Zimmermann, S; Zinonos, Z; Zinser, M; Ziolkowski, M; Živković, L; Zobernig, G; Zoccoli, A; Nedden, M Zur; Zurzolo, G; Zwalinski, L

    2016-01-01

    A test of CP invariance in Higgs boson production via vector-boson fusion using the method of the Optimal Observable is presented. The analysis exploits the decay mode of the Higgs boson into a pair of [Formula: see text] leptons and is based on 20.3 [Formula: see text] of proton-proton collision data at [Formula: see text] = 8 [Formula: see text] collected by the ATLAS experiment at the LHC. Contributions from CP-violating interactions between the Higgs boson and electroweak gauge bosons are described in an effective field theory framework, in which the strength of CP violation is governed by a single parameter [Formula: see text]. The mean values and distributions of CP-odd observables agree with the expectation in the Standard Model and show no sign of CP violation. The CP-mixing parameter [Formula: see text] is constrained to the interval [Formula: see text] at 68% confidence level, consistent with the Standard Model expectation of [Formula: see text].

  11. Test of CP invariance in vector-boson fusion production of the Higgs boson using the Optimal Observable method in the ditau decay channel with the ATLAS detector

    Energy Technology Data Exchange (ETDEWEB)

    Aad, G. [CPPM, Aix-Marseille Univ. et CNRS/IN2P3, Marseille (France); Abbott, B. [Oklahoma Univ., Norman, OK (United States). Homer L. Dodge Dept. of Physics and Astronomy; Abdinov, O. [Azerbaijan Academy of Sciences, Baku (Azerbaijan). Inst. of Physics; Collaboration: ATLAS Collaboration; and others

    2016-12-15

    A test of CP invariance in Higgs boson production via vector-boson fusion using the method of the Optimal Observable is presented. The analysis exploits the decay mode of the Higgs boson into a pair of τ leptons and is based on 20.3 fb{sup -1} of proton-proton collision data at √(s) = 8 TeV collected by the ATLAS experiment at the LHC. Contributions from CP-violating interactions between the Higgs boson and electroweak gauge bosons are described in an effective field theory framework, in which the strength of CP violation is governed by a single parameter d. The mean values and distributions of CP-odd observables agree with the expectation in the Standard Model and show no sign of CP violation. The CP-mixing parameter d is constrained to the interval (-0.11, 0.05) at 68% confidence level, consistent with the Standard Model expectation of d = 0. (orig.)

  12. Test of CP Invariance in vector-boson fusion production of the Higgs boson using the Optimal Observable method in the ditau decay channel with the ATLAS detector

    CERN Document Server

    Aad, Georges; Abdallah, Jalal; Abdinov, Ovsat; Abeloos, Baptiste; Aben, Rosemarie; Abolins, Maris; AbouZeid, Ossama; Abraham, Nicola; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Affolder, Tony; Agatonovic-Jovin, Tatjana; Agricola, Johannes; Aguilar-Saavedra, Juan Antonio; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alison, John; Alkire, Steven Patrick; Allbrooke, Benedict; Allen, Benjamin William; Allport, Phillip; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Alvarez Gonzalez, Barbara; Άlvarez Piqueras, Damián; Alviggi, Mariagrazia; Amadio, Brian Thomas; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anders, John Kenneth; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Arabidze, Giorgi; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arduh, Francisco Anuar; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Armitage, Lewis James; Arnaez, Olivier; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Artz, Sebastian; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Augsten, Kamil; Avolio, Giuseppe; Axen, Bradley; Ayoub, Mohamad Kassem; Azuelos, Georges; Baak, Max; Baas, Alessandra; Baca, Matthew John; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Baines, John; Baker, Oliver Keith; Baldin, Evgenii; Balek, Petr; Balestri, Thomas; Balli, Fabrice; Balunas, William Keaton; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Barak, Liron; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnes, Sarah Louise; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barranco Navarro, Laura; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Basalaev, Artem; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batista, Santiago Juan; Batley, Richard; Battaglia, Marco; Bauce, Matteo; Bauer, Florian; Bawa, Harinder Singh; Beacham, James Baker; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Bechtle, Philip; Beck, Hans~Peter; Becker, Kathrin; Becker, Maurice; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bednyakov, Vadim; Bedognetti, Matteo; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Janna Katharina; Belanger-Champagne, Camille; Bell, Andrew Stuart; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Belyaev, Nikita; Benary, Odette; Benchekroun, Driss; Bender, Michael; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez, Jose; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Bentvelsen, Stan; Beresford, Lydia; Beretta, Matteo; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Beringer, Jürg; Berlendis, Simon; Bernard, Nathan Rogers; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertram, Iain Alexander; Bertsche, Carolyn; Bertsche, David; Besjes, Geert-Jan; Bessidskaia Bylund, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bevan, Adrian John; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Biedermann, Dustin; Bielski, Rafal; Biesuz, Nicolo Vladi; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Biondi, Silvia; Bjergaard, David Martin; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blanco, Jacobo Ezequiel; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Blunier, Sylvain; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Bock, Christopher; Boehler, Michael; Boerner, Daniela; Bogaerts, Joannes Andreas; Bogavac, Danijela; Bogdanchikov, Alexander; Bohm, Christian; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Bortfeldt, Jonathan; Bortoletto, Daniela; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Bossio Sola, Jonathan David; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Boutle, Sarah Kate; Boveia, Antonio; Boyd, James; Boyko, Igor; Bracinik, Juraj; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Breaden Madden, William Dmitri; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Lydia; Brenner, Richard; Bressler, Shikma; Bristow, Timothy Michael; Britton, Dave; Britzger, Daniel; Brochu, Frederic; Brock, Ian; Brock, Raymond; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Broughton, James; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Bruni, Alessia; Bruni, Graziano; Brunt, Benjamin; Bruschi, Marco; Bruscino, Nello; Bryant, Patrick; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Buchholz, Peter; Buckley, Andrew; Budagov, Ioulian; Buehrer, Felix; Bugge, Magnar Kopangen; Bulekov, Oleg; Bullock, Daniel; Burckhart, Helfried; Burdin, Sergey; Burgard, Carsten Daniel; Burghgrave, Blake; Burka, Klaudia; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Buzykaev, Aleksey; Cabrera Urbán, Susana; Caforio, Davide; Cairo, Valentina; Cakir, Orhan; Calace, Noemi; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Caloba, Luiz; Calvet, David; Calvet, Samuel; Calvet, Thomas Philippe; Camacho Toro, Reina; Camarda, Stefano; Camarri, Paolo; Cameron, David; Caminal Armadans, Roger; Camincher, Clement; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Carbone, Ryne Michael; Cardarelli, Roberto; Cardillo, Fabio; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Casolino, Mirkoantonio; Casper, David William; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Caudron, Julien; Cavaliere, Viviana; Cavallaro, Emanuele; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerda Alberich, Leonor; Cerio, Benjamin; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chan, Stephen Kam-wah; Chan, Yat Long; Chang, Philip; Chapman, John Derek; Charlton, Dave; Chatterjee, Avishek; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Che, Siinn; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Shenjian; Chen, Shion; Chen, Xin; Chen, Ye; Cheng, Hok Chuen; Cheng, Huajie; Cheng, Yangyang; Cheplakov, Alexander; Cheremushkina, Evgenia; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiarelli, Giorgio; Chiodini, Gabriele; Chisholm, Andrew; Chitan, Adrian; Chizhov, Mihail; Choi, Kyungeon; Chomont, Arthur Rene; Chouridou, Sofia; Chow, Bonnie Kar Bo; Christodoulou, Valentinos; Chromek-Burckhart, Doris; Chudoba, Jiri; Chuinard, Annabelle Julia; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Cinca, Diane; Cindro, Vladimir; Cioara, Irina Antonela; Ciocio, Alessandra; Cirotto, Francesco; Citron, Zvi Hirsh; Ciubancan, Mihai; Clark, Allan G; Clark, Brian Lee; Clark, Philip James; Clarke, Robert; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Colasurdo, Luca; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collot, Johann; Colombo, Tommaso; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Connell, Simon Henry; Connelly, Ian; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Crawley, Samuel Joseph; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cribbs, Wayne Allen; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cúth, Jakub; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Dandoy, Jeffrey Rogers; Dang, Nguyen Phuong; Daniells, Andrew Christopher; Dann, Nicholas Stuart; Danninger, Matthias; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Merlin; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Benedetti, Abraham; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dedovich, Dmitri; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Delgove, David; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; DeMarco, David; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Denysiuk, Denys; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Dette, Karola; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Clemente, William Kennedy; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Diaconu, Cristinel; Diamond, Miriam; Dias, Flavia; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Djuvsland, Julia Isabell; Barros do Vale, Maria Aline; Dobos, Daniel; Dobre, Monica; Doglioni, Caterina; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Drechsler, Eric; Dris, Manolis; Du, Yanyan; Duarte-Campderros, Jorge; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Duschinger, Dirk; Dutta, Baishali; Dyndal, Mateusz; Eckardt, Christoph; Ecker, Katharina Maria; Edgar, Ryan Christopher; Edson, William; Edwards, Nicholas Charles; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellajosyula, Venugopal; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Elliot, Alison; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Ennis, Joseph Stanford; Erdmann, Johannes; Ereditato, Antonio; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Fabbri, Federica; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farina, Christian; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Faucci Giannelli, Michele; Favareto, Andrea; Fawcett, William James; Fayard, Louis; Fedin, Oleg; Fedorko, Wojciech; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Feremenga, Last; Fernandez Martinez, Patricia; Fernandez Perez, Sonia; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Adam; Fischer, Cora; Fischer, Julia; Fisher, Wade Cameron; Flaschel, Nils; Fleck, Ivor; Fleischmann, Philipp; Fletcher, Gareth Thomas; Fletcher, Gregory; Fletcher, Rob Roy MacGregor; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Flowerdew, Michael; Forcolin, Giulio Tiziano; Formica, Andrea; Forti, Alessandra; Foster, Andrew Geoffrey; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Francis, David; Franconi, Laura; Franklin, Melissa; Frate, Meghan; Fraternali, Marco; Freeborn, David; Fressard-Batraneanu, Silvia; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fusayasu, Takahiro; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gach, Grzegorz; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Louis Guillaume; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gao, Jun; Gao, Yanyan; Gao, Yongsheng; Garay Walls, Francisca; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gascon Bravo, Alberto; Gatti, Claudio; Gaudiello, Andrea; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Gecse, Zoltan; Gee, Norman; Geich-Gimbel, Christoph; Geisler, Manuel Patrice; Gemme, Claudia; Genest, Marie-Hélène; Geng, Cong; Gentile, Simonetta; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghasemi, Sara; Ghazlane, Hamid; Ghneimat, Mazuza; Giacobbe, Benedetto; Giagu, Stefano; Giannetti, Paola; Gibbard, Bruce; Gibson, Stephen; Gignac, Matthew; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giorgi, Filippo Maria; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giromini, Paolo; Giugni, Danilo; Giuli, Francesco; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gkougkousis, Evangelos Leonidas; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Goblirsch-Kolb, Maximilian; Godlewski, Jan; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; Gongadze, Alexi; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Goudet, Christophe Raymond; Goujdami, Driss; Goussiou, Anna; Govender, Nicolin; Gozani, Eitan; Graber, Lars; Grabowska-Bold, Iwona; Gradin, Per Olov Joakim; Grafström, Per; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Greenwood, Zeno Dixon; Grefe, Christian; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Grevtsov, Kirill; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grivaz, Jean-Francois; Groh, Sabrina; Grohs, Johannes Philipp; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Grout, Zara Jane; Guan, Liang; Guan, Wen; Guenther, Jaroslav; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Guo, Jun; Guo, Yicheng; Gupta, Shaun; Gustavino, Giuliano; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Hadef, Asma; Haefner, Petra; Hageböck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Haley, Joseph; Hall, David; Halladjian, Garabed; Hallewell, Gregory David; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamilton, Andrew; Hamity, Guillermo Nicolas; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Haney, Bijan; Hanke, Paul; Hanna, Remie; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Maike Christina; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Hariri, Faten; Harkusha, Siarhei; Harrington, Robert; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Makoto; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauser, Reiner; Hauswald, Lorenz; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayden, Daniel; Hays, Chris; Hays, Jonathan Michael; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Jochen Jens; Heinrich, Lukas; Heinz, Christian; Hejbal, Jiri; Helary, Louis; Hellman, Sten; Helsens, Clement; Henderson, James; Henderson, Robert; Heng, Yang; Henkelmann, Steffen; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hetherly, Jeffrey Wayne; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hinman, Rachel Reisner; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hohlfeld, Marc; Hohn, David; Holmes, Tova Ray; Homann, Michael; Hong, Tae Min; Hooberman, Benjamin Henry; Hopkins, Walter; Horii, Yasuyuki; Horton, Arthur James; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hrynevich, Aliaksei; Hsu, Catherine; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Qipeng; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Ideal, Emma; Idrissi, Zineb; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikeno, Masahiro; Ilchenko, Iurii; Iliadis, Dimitrios; Ilic, Nikolina; Ince, Tayfun; Introzzi, Gianluca; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Ito, Fumiaki; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Ivarsson, Jenny; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jabbar, Samina; Jackson, Brett; Jackson, Matthew; Jackson, Paul; Jain, Vivek; Jakobi, Katharina Bianca; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansky, Roland; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanneau, Fabien; Jeanty, Laura; Jejelava, Juansher; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Hai; Jiang, Yi; Jiggins, Stephen; Jimenez Pena, Javier; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Johansson, Per; Johns, Kenneth; Johnson, William Joseph; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Sarah; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Jovicevic, Jelena; Ju, Xiangyang; Juste Rozas, Aurelio; Köhler, Markus Konrad; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kahn, Sebastien Jonathan; Kajomovitz, Enrique; Kalderon, Charles William; Kaluza, Adam; Kama, Sami; Kamenshchikov, Andrey; Kanaya, Naoko; Kaneti, Steven; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kaplan, Laser Seymour; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karamaoun, Andrew; Karastathis, Nikolaos; Kareem, Mohammad Jawad; Karentzos, Efstathios; Karnevskiy, Mikhail; Karpov, Sergey; Karpova, Zoya; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kasahara, Kota; Kashif, Lashkar; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Kato, Chikuma; Katre, Akshay; Katzy, Judith; Kawade, Kentaro; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Keeler, Richard; Kehoe, Robert; Keller, John; Kempster, Jacob Julian; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Keyes, Robert; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharlamov, Alexey; Khoo, Teng Jian; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kido, Shogo; Kim, Hee Yeun; Kim, Shinhong; Kim, Young-Kee; Kimura, Naoki; Kind, Oliver Maria; King, Barry; King, Matthew; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kiuchi, Kenji; Kivernyk, Oleh; Kladiva, Eduard; Klein, Matthew Henry; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Knapik, Joanna; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Aine; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Kolb, Mathis; Koletsou, Iro; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Kortner, Oliver; Kortner, Sandra; Kosek, Tomas; Kostyukhin, Vadim; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumeli-Charalampidi, Athina; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewska, Anna Bozena; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Krizka, Karol; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Krumnack, Nils; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kucuk, Hilal; Kuday, Sinan; Kuechler, Jan Thomas; Kuehn, Susanne; Kugel, Andreas; Kuger, Fabian; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kukla, Romain; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunigo, Takuto; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwan, Tony; Kyriazopoulos, Dimitrios; La Rosa, Alessandro; La Rosa Navarro, Jose Luis; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Lammers, Sabine; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lange, J örn Christian; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Lanza, Agostino; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lasagni Manghi, Federico; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Lazovich, Tomo; Lazzaroni, Massimo; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; Le Quilleuc, Eloi; LeBlanc, Matthew Edgar; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leisos, Antonios; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonidopoulos, Christos; Leontsinis, Stefanos; Lerner, Giuseppe; Leroy, Claude; Lesage, Arthur; Lester, Christopher; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Qi; Li, Shu; Li, Xingguo; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Liblong, Aaron; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Lin, Tai-Hua; Lindquist, Brian Edward; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Hao; Liu, Hongbin; Liu, Jian; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanlin; Liu, Yanwen; Livan, Michele; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loew, Kevin Michael; Loginov, Andrey; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Long, Brian Alexander; Long, Jonathan David; Long, Robin Eamonn; Longo, Luigi; Looper, Kristina Anne; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lopez Solis, Alvaro; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Lösel, Philipp Jonathan; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lu, Haonan; Lu, Nan; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luedtke, Christian; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lynn, David; Lysak, Roman; Lytken, Else; Lyubushkin, Vladimir; Ma, Hong; Ma, Lian Liang; Ma, Yanhui; Maccarrone, Giovanni; Macchiolo, Anna; Macdonald, Calum Michael; Maček, Boštjan; Machado Miguens, Joana; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeda, Junpei; Maeland, Steffen; Maeno, Tadashi; Maevskiy, Artem; Magradze, Erekle; Mahlstedt, Joern; Maiani, Camilla; Maidantchik, Carmen; Maier, Andreas Alexander; Maier, Thomas; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mancini, Giada; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Maneira, José; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany; Mann, Alexander; Mansoulie, Bruno; Mantifel, Rodger; Mantoani, Matteo; Manzoni, Stefano; Mapelli, Livio; Marceca, Gino; March, Luis; Marchiori, Giovanni; Marcisovsky, Michal; Marjanovic, Marija; Marley, Daniel; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian Thomas; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Mario; Martin-Haugh, Stewart; Martoiu, Victor Sorin; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massa, Lorenzo; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mättig, Peter; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazza, Simone Michele; Mc Fadden, Neil Christopher; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McClymont, Laurie; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Meyer Zu Theenhausen, Hanno; Middleton, Robin; Miglioranzi, Silvia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Milesi, Marco; Milic, Adriana; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Minaenko, Andrey; Minami, Yuto; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mistry, Khilesh; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Monden, Ryutaro; Mondragon, Matthew Craig; Mönig, Klaus; Monk, James; Monnier, Emmanuel; Montalbano, Alyssa; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Morange, Nicolas; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Mori, Daniel; Mori, Tatsuya; Morii, Masahiro; Morinaga, Masahiro; Morisbak, Vanja; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Mortensen, Simon Stark; Morvaj, Ljiljana; Mosidze, Maia; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Ralph Soeren Peter; Mueller, Thibaut; Muenstermann, Daniel; Mullen, Paul; Mullier, Geoffrey; Munoz Sanchez, Francisca Javiela; Murillo Quijada, Javier Alberto; Murray, Bill; Murrone, Alessia; Musheghyan, Haykuhi; Muskinja, Miha; Myagkov, Alexey; Myska, Miroslav; Nachman, Benjamin Philip; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagano, Kunihiro; Nagasaka, Yasushi; Nagata, Kazuki; Nagel, Martin; Nagy, Elemer; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Naranjo Garcia, Roger Felipe; Narayan, Rohin; Narrias Villar, Daniel Isaac; Naryshkin, Iouri; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Nef, Pascal Daniel; Negri, Andrea; Negrini, Matteo; Nektarijevic, Snezana; Nellist, Clara; Nelson, Andrew; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolopoulos, Konstantinos; Nilsen, Jon Kerr; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Nooney, Tamsin; Norberg, Scarlet; Nordberg, Markus; Norjoharuddeen, Nurfikri; Novgorodova, Olga; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nurse, Emily; Nuti, Francesco; O'grady, Fionnbarr; O'Neil, Dugan; O'Rourke, Abigail Alexandra; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Ochoa-Ricoux, Juan Pedro; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Oide, Hideyuki; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Oleiro Seabra, Luis Filipe; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onogi, Kouta; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Owen, Rhys Edward; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Palma, Alberto; Panagiotopoulou, Evgenia; Pandini, Carlo Enrico; Panduro Vazquez, William; Pani, Priscilla; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Adam Jackson; Parker, Michael Andrew; Parker, Kerry Ann; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pascuzzi, Vincent; Pasqualucci, Enrico; Passaggio, Stefano; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Pauly, Thilo; Pearce, James; Pearson, Benjamin; Pedersen, Lars Egholm; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Penc, Ondrej; Peng, Cong; Peng, Haiping; Penwell, John; Peralva, Bernardo; Perego, Marta Maria; Perepelitsa, Dennis; Perez Codina, Estel; Perini, Laura; Pernegger, Heinz; Perrella, Sabrina; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petroff, Pierre; Petrolo, Emilio; Petrov, Mariyan; Petrucci, Fabrizio; Pettersson, Nora Emilia; Peyaud, Alan; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Pickering, Mark Andrew; Piegaia, Ricardo; Pilcher, James; Pilkington, Andrew; Pin, Arnaud Willy J; Pina, João Antonio; Pinamonti, Michele; Pinfold, James; Pingel, Almut; Pires, Sylvestre; Pirumov, Hayk; Pitt, Michael; Plazak, Lukas; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Pluth, Daniel; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Polesello, Giacomo; Poley, Anne-luise; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pozo Astigarraga, Mikel Eukeni; Pralavorio, Pascal; Pranko, Aliaksandr; Prell, Soeren; Price, Darren; Price, Lawrence; Primavera, Margherita; Prince, Sebastien; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Puddu, Daniele; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Raddum, Silje; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Raine, John Andrew; Rajagopalan, Srinivasan; Rammensee, Michael; Rangel-Smith, Camila; Ratti, Maria Giulia; Rauscher, Felix; Rave, Stefan; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reichert, Joseph; Reisin, Hernan; Rembser, Christoph; Ren, Huan; Rescigno, Marco; Resconi, Silvia; Rezanova, Olga; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Richter, Stefan; Richter-Was, Elzbieta; Ricken, Oliver; Ridel, Melissa; Rieck, Patrick; Riegel, Christian Johann; Rieger, Julia; Rifki, Othmane; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ristić, Branislav; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Rizzi, Chiara; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Rodina, Yulia; Rodriguez Perez, Andrea; Rodriguez Rodriguez, Daniel; Roe, Shaun; Rogan, Christopher Sean; Røhne, Ole; Romaniouk, Anatoli; Romano, Marino; Romano Saez, Silvestre Marino; Romero Adam, Elena; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Peyton; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Jonatan; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Russell, Heather; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryu, Soo; Ryzhov, Andrey; Saavedra, Aldo; Sabato, Gabriele; Sacerdoti, Sabrina; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Saha, Puja; Sahinsoy, Merve; Saimpert, Matthias; Saito, Tomoyuki; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Salazar Loyola, Javier Esteban; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sammel, Dirk; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sannino, Mario; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarrazin, Bjorn; Sasaki, Osamu; Sasaki, Yuichi; Sato, Koji; Sauvage, Gilles; Sauvan, Emmanuel; Savage, Graham; Savard, Pierre; Sawyer, Craig; Sawyer, Lee; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Scarfone, Valerio; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaeffer, Jan; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Schiavi, Carlo; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmieden, Kristof; Schmitt, Christian; Schmitt, Stefan; Schmitz, Simon; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schopf, Elisabeth; Schorlemmer, Andre Lukas; Schott, Matthias; Schovancova, Jaroslava; Schramm, Steven; Schreyer, Manuel; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwarz, Thomas Andrew; Schwegler, Philipp; Schweiger, Hansdieter; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Sciolla, Gabriella; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Seema, Pienpen; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekhon, Karishma; Sekula, Stephen; Seliverstov, Dmitry; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Sessa, Marco; Seuster, Rolf; Severini, Horst; Sfiligoj, Tina; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shaikh, Nabila Wahab; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Shaw, Savanna Marie; Shcherbakova, Anna; Shehu, Ciwake Yusufu; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shiyakova, Mariya; Shmeleva, Alevtina; Shoaleh Saadi, Diane; Shochet, Mel; Shojaii, Seyedruhollah; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Sicho, Petr; Sidebo, Per Edvin; Sidiropoulou, Ourania; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simon, Dorian; Simon, Manuel; Sinervo, Pekka; Sinev, Nikolai; Sioli, Maximiliano; Siragusa, Giovanni; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skinner, Malcolm Bruce; Skottowe, Hugh Philip; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Slawinska, Magdalena; Sliwa, Krzysztof; Slovak, Radim; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Matthew; Smith, Russell; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snyder, Scott; Sobie, Randall; Socher, Felix; Soffer, Abner; Soh, Dart-yin; Sokhrannyi, Grygorii; Solans Sanchez, Carlos; Solar, Michael; Soldatov, Evgeny; Soldevila, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Son, Hyungsuk; Song, Hong Ye; Sood, Alexander; Sopczak, Andre; Sopko, Vit; Sorin, Veronica; Sosa, David; Sotiropoulou, Calliope Louisa; Soualah, Rachik; Soukharev, Andrey; South, David; Sowden, Benjamin; Spagnolo, Stefania; Spalla, Margherita; Spangenberg, Martin; Spanò, Francesco; Sperlich, Dennis; Spettel, Fabian; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spousta, Martin; St Denis, Richard Dante; Stabile, Alberto; Staerz, Steffen; Stahlman, Jonathan; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Giordon; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Strubig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramaniam, Rajivalochan; Suchek, Stanislav; Sugaya, Yorihito; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Shota; Svatos, Michal; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Taccini, Cecilia; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Shuji; Tannenwald, Benjamin Bordy; Tapia Araya, Sebastian; Tapprogge, Stefan; Tarem, Shlomit; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Aaron; Taylor, Geoffrey; Taylor, Pierre Thor Elliot; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira-Dias, Pedro; Temming, Kim Katrin; Temple, Darren; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Tepel, Fabian-Phillipp; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Theveneaux-Pelzer, Timothée; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Ray; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Tibbetts, Mark James; Ticse Torres, Royer Edson; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tipton, Paul; Tisserant, Sylvain; Todome, Kazuki; Todorov, Theodore; Todorova-Nova, Sharka; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tolley, Emma; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Tong, Baojia(Tony); Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Trofymov, Artur; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; Truong, Loan; Trzebinski, Maciej; Trzupek, Adam; Tseng, Jeffrey; Tsiareshka, Pavel; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsui, Ka Ming; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turgeman, Daniel; Turra, Ruggero; Turvey, Andrew John; Tuts, Michael; Tyndel, Mike; Ucchielli, Giulia; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Unverdorben, Christopher; Urban, Jozef; Urquijo, Phillip; Urrejola, Pedro; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valderanis, Chrysostomos; Valdes Santurio, Eduardo; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Den Wollenberg, Wouter; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vankov, Peter; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vasquez, Jared Gregory; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloce, Laurelle Maria; Veloso, Filipe; Veneziano, Stefano; Ventura, Andrea; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigani, Luigi; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Vittori, Camilla; Vivarelli, Iacopo; Vlachos, Sotirios; Vlasak, Michal; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Peter; Wagner, Wolfgang; Wahlberg, Hernan; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wallangen, Veronica; Wang, Chao; Wang, Chao; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Tingting; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Washbrook, Andrew; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; Whallon, Nikola Lazar; Wharton, Andrew Mark; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wildauer, Andreas; Wilk, Fabian; Wilkens, Henric George; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, John; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winston, Oliver James; Winter, Benedict Tobias; Wittgen, Matthias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wu, Mengqing; Wu, Miles; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yakabe, Ryota; Yamaguchi, Daiki; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Shimpei; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Yi; Yang, Zongchang; Yao, Weiming; Yap, Yee Chinn; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yen, Andy L; Yildirim, Eda; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yuen, Stephanie P; Yusuff, Imran; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zakharchuk, Nataliia; Zalieckas, Justas; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zeng, Jian Cong; Zeng, Qi; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Guangyi; Zhang, Huijun; Zhang, Jinlong; Zhang, Lei; Zhang, Rui; Zhang, Ruiqi; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Xiandong; Zhao, Yongke; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Chen; Zhou, Lei; Zhou, Li; Zhou, Mingliang; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Stephanie; Zinonos, Zinonas; Zinser, Markus; Ziolkowski, Michael; Živković, Lidija; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zwalinski, Lukasz

    2016-11-29

    A test of CP invariance in Higgs boson production via vector-boson fusion using the method of the Optimal Observable is presented. The analysis exploits the decay mode of the Higgs boson into a pair of $\\tau$ leptons and is based on 20.3 fb$^{-1}$ of proton—proton collision data at $\\sqrt{s}$ = 8 TeV collected by the ATLAS experiment at the LHC. Contributions from CP-violating interactions between the Higgs boson and electroweak gauge bosons are described in an effective field theory framework, in which the strength of CP violation is governed by a single parameter $\\tilde{d}$. The mean values and distributions of CP-odd observables agree with the expectation in the Standard Model and show no sign of CP violation. The CP-mixing parameter $\\tilde{d}$ is constrained to the interval [-0.11,0.05] at 68% confidence level, consistent with the Standard Model expectation of $\\tilde{d}=0$.

  13. Deletions of a differentially methylated CpG island at SNRPN define a putative imprinting control region

    Energy Technology Data Exchange (ETDEWEB)

    Sutcliffe, J.S.,; Nakao, M.; Beaudet, A.L. [Baylor College of Medicine, Houston, TX (United States)] [and others

    1994-09-01

    Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are associated with paternal and maternal deficiencies, respectively, of gene expression within human chromosome 15q11-q13, and are caused by deletion, uniparental disomy, or other mutations. Four transcripts designated PAR-5, PAR-7, PAR-1 and PAR-4 were isolated and localized to a region within 300 kb telomeric to the gene encoding small nuclear ribonucleoprotein-associated polypeptide N (SNRPN). Analysis of the transcripts in cultured fibroblasts and lymphoblasts from deletion patients demonstrated that SNRPN, PAR-5 and PAR-1 are expressed exclusively from the paternal chromosome, defining an imprinted domain that spans at least 200 kb. All three imprinted transcripts were absent in cells from three PWS patients (one pair of sibs and one sporadic case) with small deletions that involve a differentially methylated CpG island containing a previously undescribed 5{prime} untranslated exon ({alpha}) of SNRPN. Methylation of the CpG island is specific for the maternal chromosome consistent with paternal expression of the imprinted domain. One deletion, which is benign when maternally transmitted, extends upstream <30 kb from the CpG island, and is associated with altered methylation centromeric to SNRPN, and loss of transcription telomeric to SNRPN, implying the presence of an imprinting control region around the CpG island containing exon {alpha}.

  14. MeCP2-Related Diseases and Animal Models

    Directory of Open Access Journals (Sweden)

    Chinelo D. Ezeonwuka

    2014-01-01

    Full Text Available The role of epigenetics in human disease has become an area of increased research interest. Collaborative efforts from scientists and clinicians have led to a better understanding of the molecular mechanisms by which epigenetic regulation is involved in the pathogenesis of many human diseases. Several neurological and non-neurological disorders are associated with mutations in genes that encode for epigenetic factors. One of the most studied proteins that impacts human disease and is associated with deregulation of epigenetic processes is Methyl CpG binding protein 2 (MeCP2. MeCP2 is an epigenetic regulator that modulates gene expression by translating epigenetic DNA methylation marks into appropriate cellular responses. In order to highlight the importance of epigenetics to development and disease, we will discuss how MeCP2 emerges as a key epigenetic player in human neurodevelopmental, neurological, and non-neurological disorders. We will review our current knowledge on MeCP2-related diseases, including Rett Syndrome, Angelman Syndrome, Fetal Alcohol Spectrum Disorder, Hirschsprung disease, and Cancer. Additionally, we will briefly discuss about the existing MeCP2 animal models that have been generated for a better understanding of how MeCP2 impacts certain human diseases.

  15. Kramers Pairs in configuration interaction

    DEFF Research Database (Denmark)

    Avery, John Scales; Avery, James Emil

    2003-01-01

    The theory of symmetry-preserving Kramers pair creation operators is reviewed and formulas for applying these operators to configuration interaction calculations are derived. A new and more general type of symmetry-preserving pair creation operator is proposed and shown to commute with the total ...

  16. CP violation as a probe of flavor origin in supersymmetry

    International Nuclear Information System (INIS)

    Demir, D.A.; Masiero, A.; Vives, O.

    1999-11-01

    We address the question of the relation between supersymmetry breaking and the origin of flavor in the context of CP violating phenomena. We prove that, in the absence of the Cabibbo-Kobayashi-Maskawa phase, a general Minimal Supersymmetric Standard Model with all possible phases in the soft-breaking terms, but no new flavor structure beyond the usual Yukawa matrices, can never give a sizeable contribution to ε K , ε'/ε or hadronic B 0 CP asymmetries. Observation of supersymmetric contributions to CP asymmetries in B decays would hint at a non-flavor blind mechanism of supersymmetry breaking. (author)

  17. CP nonconservation in decays of W and Z bosons

    International Nuclear Information System (INIS)

    Hou, W.; Deshpande, N.G.; Eilam, G.; Soni, A.

    1986-01-01

    The possibility of CP asymmetries in decays of W and Z bosons is examined. The asymmetries studied are the differences in the branching ratios of charge-conjugate modes such as W + →tb-bar vs W - →t-barb or Z→b-bars vs Z→bs-bar. In the standard model, with three generations, such effects are found to be vanishingly small. With four generations, flavor-changing transitions such as Z→bs-bar or b'b-bar may be observable, but the prospects for observing CP asymmetries appear discouraging. We also discuss the situation in some other models of CP nonconservation

  18. Constructing co-Higgs bundles on CP^2

    OpenAIRE

    Rayan, Steven

    2013-01-01

    On a complex manifold, a co-Higgs bundle is a holomorphic vector bundle with an endomorphism twisted by the tangent bundle. The notion of generalized holomorphic bundle in Hitchin's generalized geometry coincides with that of co-Higgs bundle when the generalized complex manifold is ordinary complex. Schwarzenberger's rank-2 vector bundle on the projective plane, constructed from a line bundle on the double cover CP^1 \\times CP^1 \\to CP^2, is naturally a co-Higgs bundle, with the twisted endom...

  19. Towards a dynamical solution of the strong CP problem

    International Nuclear Information System (INIS)

    Schierholz, G.

    1994-01-01

    One may argue that QCD solves the strong CP problem by itself. To test this idea, a lattice simulation suggests itself. In view of the difficulty of such a calculation we have, as a first step, investigated the problem in the CP 3 model. The CP 3 model is in many respects similar to QCD. In this talk I present some first results of our calculation. Among other things it is shown that the model has a first order deconfining phase transition in θ and that the critical value of θ decreases towards zero as β is taken to infinity. This suggests that θ is tuned to zero in the continuum limit. ((orig.))

  20. arXiv Flavour Physics and CP Violation

    CERN Document Server

    Kamenik, J.F.

    2016-01-01

    These notes represent a summary of three lectures on flavour and CP violation, given at the CERNs European School of High Energy Physics in 2014. They cover flavour physics within the standard model, phenomenology of CP violation in meson mixing and decays, as well as constraints of flavour observableson physics beyond the standard model. In preparing the lectures (and consequently this summary) I drew heavily from several existing excellent and exhaustive sets of lecture notes and reviews on flavour physics and CP violation [1]. The reader is encouraged to consult those as well as the original literature for a more detailed study.

  1. CP violation in K- and B-meson decays

    CERN Multimedia

    2000-01-01

    These lectures will describe CP violation in K- and B-meson decays and will include the following topics:i) Grand view of the field including CKM matrix and the unitarily triangle ii) General aspects of the theoretical framework iii) Fundamentals of particle-antiparticle mixing iv) Fundamentals of CP violation v) Standard analysis of the unitarily triangle vi) The ratio e'/e including most recent developments vii) CP Violation in rare K- decays viii) Violation in B-Decays (asymmetries and other strategies) ix) A brief look beyond the Standard Model

  2. Methods for detection of methyl-CpG dinucleotides

    Science.gov (United States)

    Dunn, John J.

    2012-09-11

    The invention provides methods for enriching methyl-CpG sequences from a DNA sample. The method makes use of conversion of cytosine residues to uracil under conditions in which methyl-cytosine residues are preserved. Additional methods of the invention enable to preservation of the context of me-CpG dinucleotides. The invention also provides a recombinant, full length and substantially pure McrA protein (rMcrA) for binding and isolation of DNA fragments containing the sequence 5'-C.sup.MeCpGG-3'. Methods for making and using the rMcrA protein, and derivatives thereof are provided.

  3. First Search for {ital CP} Violation in Tau Lepton Decay

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, S.; Kubota, Y.; Lee, S.J.; ONeill, J.J.; Poling, R.; Riehle, T.; Smith, A. [University of Minnesota, Minneapolis, Minnesota 55455 (United States); Alam, M.S.; Athar, S.B.; Ling, Z.; Mahmood, A.H.; Timm, S.; Wappler, F. [State University of New York at Albany, Albany, New York 12222 (United States); Anastassov, A.; Duboscq, J.E.; Fujino, D.; Gan, K.K.; Hart, T.; Honscheid, K.; Kagan, H.; Kass, R.; Lee, J.; Schwarthoff, H.; Spencer, M.B.; Sung, M.; Undrus, A.; Wolf, A.; Zoeller, M.M. [The Ohio State University, Columbus, Ohio 43210 (United States); Richichi, S.J.; Severini, H.; Skubic, P. [University of Oklahoma, Norman, Oklahoma 73019 (United States); Bishai, M.; Fast, J.; Hinson, J.W.; Menson, N.; Miller, D.H.; Shibata, E.I.; Shipsey, I.P.; Yurko, M. [Purdue University, West Lafayette, Indiana 47907 (United States); Glenn, S.; Kwon, Y.; Lyon, A.L.; Roberts, S.; Thorndike, E.H. [University of Rochester, Rochester, New York 14627 (United States); Jessop, C.P.; Lingel, K.; Marsiske, H.; Perl, M.L.; Savinov, V.; Ugolini, D.; Zhou, X. [Stanford Linear Accelerator Center, Stanford University, Stanford, California 94309 (United States); Coan, T.E.; Fadeyev, V.; Korolkov, I.; Maravin, Y.; Narsky, I.; Shelkov, V.; Staeck, J.; Stroynowski, R.; Volobouev, I.; Ye, J. [Southern Methodist University, Dallas, Texas 75275 (United States); Artuso, M.; Azfar, F.; Efimov, A.; Goldberg, M.; He, D.; Kopp, S.; Moneti, G.C.; Mountain, R.; Schuh, S.; Skwarnicki, T.; Stone, S.; Viehhauser, G.; Wang, J.C.; Xing, X. [Syracuse University, Syracuse, New York 13244 (United States); Bartelt, J.; Csorna, S.E.; Jain, V.; McLean, K.W.; Marka, S. [Vanderbilt University, Nashville, Tennessee 37235 (United States); Godang, R.; Kinoshita, K.; Lai, I.C.; Pomianowski, P.; Schrenk, S. [Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061 (United States); Bonvicini, G.; Cinabro, D.; Greene, R.; Perera, L.P.; Zhou, G.J. [Wayne State Univ., (United States)

    1998-11-01

    We have performed the first search for CP violation in tau lepton decay. CP violation in lepton decay does not occur in the minimal standard model but can occur in extensions such as the multi-Higgs doublet model. It appears as a characteristic difference between the {tau}{sup {minus}} and {tau}{sup +} decay angular distributions for the semileptonic decay modes such as {tau}{sup {minus}}{r_arrow}K{sup 0}{pi}{sup {minus}}{nu} . We define an observable asymmetry to exploit this and find no evidence for any CP violation. {copyright} {ital 1998} {ital The American Physical Society }

  4. Microbial C:P stoichiometry is shaped by redox conditions along an elevation gradient in humid tropical rainforests

    Science.gov (United States)

    Lin, Y.; Gross, A.; Silver, W. L.

    2017-12-01

    Elemental stoichiometry of microorganisms is intimately related to ecosystem carbon and nutrient fluxes and is ultimately controlled by the chemical (plant tissue, soil, redox) and physical (temperature, moisture, aeration) environment. Previous meta-analyses have shown that the C:P ratio of soil microbial biomass exhibits significant variations among and within biomes. Little is known about the underlying causes of this variability. We examined soil microbial C:P ratios along an elevation gradient in the Luquillo Experimental Forest in Puerto Rico. We analyzed soils from mixed forest paired with monodominant palm forest every 100 m from 300 m to 1000 m a.s.l.. Mean annual precipitation increased with increasing elevation, resulting in stronger reducing conditions and accumulation of soil Fe(II) at higher elevations. The mean value and variability of soil microbial C:P ratios generally increased with increasing elevation except at 1000 m. At high elevations (600-900 m), the average value of microbial C:P ratio (108±10:1) was significantly higher than the global average ( 55:1). We also found that soil organic P increased with increasing elevation, suggesting that an inhibition of organic P mineralization, not decreased soil P availability, may cause the high microbial C:P ratio. The soil microbial C:P ratio was positively correlated with soil HCl-extractable Fe(II), suggesting that reducing conditions may be responsible for the elevational changes observed. In a follow-up experiment, soils from mixed forests at four elevation levels (300, 500, 700, and 1000 m) were incubated under aerobic and anaerobic conditions for two weeks. We found that anaerobic incubation consistently increased the soil microbial C:P ratio relative to the aerobic incubation. Overall, our results indicate that redox conditions can shift the elemental composition of microbial biomass. The high microbial C:P ratios induced under anoxic conditions may reflect inhibition of microbial P

  5. Robotic dismantlement systems at the CP-5 reactor D and D project

    International Nuclear Information System (INIS)

    Seifert, L. S.

    1998-01-01

    The Chicago Pile 5 (CP-5) Research Reactor Facility is currently undergoing decontamination and decommissioning (D and D) at the Argonne National Laboratory (ANL) Illinois site. CP-5 was the principle nuclear reactor used to produce neutrons for scientific research at Argonne from 1954 to 1979. The CP-5 reactor was a heavy-water cooled and moderated, enriched uranium-fueled reactor with a graphite reflector. The CP-5 D and D project includes the disassembly, segmentation and removal of all the radioactive components, equipment and structures associated with the CP-5 facility. The Department of Energy's Robotics Technology Development Program and the Federal Energy Technology Center, Morgantown Office provided teleoperated, remote systems for use in the dismantlement of the CP-5 reactor assembly for tasks requiring remote dismantlement as part of the EM-50 Large-Scale Demonstration Program (LSDP). The teleoperated systems provided were the Dual Arm Work Platform (DAWP), the Rosie Mobile Teleoperated Robot Work System (ROSIE), and a remotely-operated crane control system with installed swing-reduction control system. Another remotely operated apparatus, a Brokk BM250, was loaned to ANL by the Princeton Plasma Physics Laboratory (PPPL). This machine is not teleoperated and was not part of the LSDP, but deserves some mention in this discussion. The DAWP is a robotic dismantlement system that includes a pair of Schilling Robotic Systems Titan III hydraulic manipulator arms mounted to a specially designed support platform: a hydraulic power unit (HPU) and a remote operator console. The DAWP is designed to be crane-suspended for remote positioning. ROSIE, developed by RedZone Robotics, Inc. is a mobile, electro-hydraulic, omnidirectional platform with a heavy-duty telescoping boom mounted to the platform's deck. The work system includes the mobile platform (locomotor), a power distribution unit (PDU) and a remote operator console. ROSIE moves about the reactor building

  6. Property (RD) for Hecke Pairs

    International Nuclear Information System (INIS)

    Shirbisheh, Vahid

    2012-01-01

    As the first step towards developing noncommutative geometry over Hecke C ∗ -algebras, we study property (RD) (Rapid Decay) for Hecke pairs. When the subgroup H in a Hecke pair (G, H) is finite, we show that the Hecke pair (G, H) has (RD) if and only if G has (RD). This provides us with a family of examples of Hecke pairs with property (RD). We also adapt Paul Jolissant’s works in Jolissaint (J K-Theory 2:723–735, 1989; Trans Amer Math Soc 317(1):167–196, 1990) to the setting of Hecke C ∗ -algebras and show that when a Hecke pair (G, H) has property (RD), the algebra of rapidly decreasing functions on the set of double cosets is closed under holomorphic functional calculus of the associated (reduced) Hecke C ∗ -algebra. Hence they have the same K 0 -groups.

  7. Instability of vortex pair leapfrogging

    DEFF Research Database (Denmark)

    Tophøj, Laust; Aref, Hassan

    2013-01-01

    Leapfrogging is a periodic solution of the four-vortex problem with two positive and two negative point vortices all of the same absolute circulation arranged as co-axial vortex pairs. The set of co-axial motions can be parameterized by the ratio 0 vortex pair sizes at the time when one...... pair passes through the other. Leapfrogging occurs for α > σ2, where is the silver ratio. The motion is known in full analytical detail since the 1877 thesis of Gröbli and a well known 1894 paper by Love. Acheson ["Instability of vortex leapfrogging," Eur. J. Phys.21, 269-273 (2000...... pairs fly off to infinity, and a "walkabout" mode, where the vortices depart from leapfrogging but still remain within a finite distance of one another. We show numerically that this transition is more gradual, a result that we relate to earlier investigations of chaotic scattering of vortex pairs [L...

  8. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  9. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  10. Development of primers for sequencing the NSP1, NSP3, and VP6 genes of the group A porcine rotavirus

    Directory of Open Access Journals (Sweden)

    Fernanda Dornelas Florentino Silva

    2014-02-01

    Full Text Available Rotavirus is the causative pathogen of diarrhea in humans and in several animal species. Eight pairs of primers were developed and used for Sanger sequencing of the coding region of the NSP1, NSP3, and VP6 genes based on the conserved regions of the genome of the group A porcine rotavirus. Three samples previously screened as positive for group A rotaviruses were subjected to gene amplification and sequencing to characterize the pathogen. The information generated from this study is crucial for the understanding of the epidemiology of the disease.

  11. EFEKTIVITAS PEMBERIAN TERAPI MUSIK (MOZART DAN BACK EXERCISE TERHADAP PENURUNAN NYERI DYSMENORRHEA PRIMER

    Directory of Open Access Journals (Sweden)

    reni heryani

    2017-12-01

    Full Text Available Dysmenorrhea / nyeri haid adalah nyeri menjelang atau selama haid, yang kadang menyebabkan gangguan aktivitas dan memerlukan istirahat. Nyeri menstruasi atau dysmenorrhea adalah kekakuan atau kejang di bagian bawah perut akibat menstruasi dan produksi zat prostaglandin yang terjadi pada waktu menjelang atau selama menstruasi Dismenorea primer didefinisikan sebagai nyeri haid yang tidak berhubungan dengan kondisi patologis pelvis. Nyeri yang biasanya dirasakan adalah kram yang timbul-hilang atau nyeri yang terus menerus biasanya pada perut bagian bawah yang menjalar sampai ke punggung bagian bawah. Salah satu exercise yang dapat diberikan untuk nyeri dysmenorrhea  ini adalah dengan pemberian terapi musik dan back exercise.Tujuan penelitian ini adalah untuk mengetahui efektivitas pemberian terapi musik dan back exercise terhadap penurunan nyeri dysmenorrhea. Penelitian ini merupakan penelitian Quasi experimental pre and post test with control group design. Populasi pada penelitian ini adalah remaja putri yang sedang mengalami  menstruasi dengan  nyeri dysmenorrhea dengan jumlah responden sebanyak 50 orang yang dibagi menjadi 2 kelompok. Kelompok 1 sebagai kelompok eksperimen, diberikan perlakukan terapi musik (mozart dan back exercise  dan kelompok 2 sebagai kelompok kontrol yang tidak diberikan terapi musik (mozart dan back exercise. Pada penelitian ini menggunakan uji hipotesis Paired Sample T- test untuk mengetahui pengaruh pemberian terapi musik dan back exercice terhadap dysmenorrhea primer. Kemudian untuk uji beda pengaruh antara kelompok kontrol dan kelompok perlakuan digunakan uji Independent Sample T-test.Tingkat nyeri dismenorhoea sebelum diberikan perlakuan adalah nyeri tingkat sedang (rata-rata : 2,08 dan setelah diberikan perlakuan adalah adalah nyeri tingkat ringan (rata rata = 0,88. Uji efektifitas menggunakan Paired Sample T-Test pada kelompok eksperimen menunjukkan hasil p= 0,00 dan pada kelompok kontrol p= 0,00. Dengan

  12. GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

    Science.gov (United States)

    Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

    2017-05-24

    As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

  13. Dynamical symmetry breaking: Exotic quarks and the strong CP problem

    International Nuclear Information System (INIS)

    Furlong, R.C.

    1988-10-01

    Decuplet quarks (quens) transforming as 10's under SU(3)/sub C/ are shown to be superior to sextet quarks (quixes) in their ability to resolve the Strong CP problem, resulting in composite invisible axions (CIAs). 8 refs

  14. Measurement of CP violation at a Neutrino Factory

    CERN Document Server

    Gómez-Cadenas, J J

    2001-01-01

    The prospects of measuring CP violation in the leptonic sector using the intense neutrino beams arising from muon decay in the straight sections of a muon accumulator ring (the so-called neutrino factory) are discussed.

  15. LHC experimental sensitivity to CP violating gtt couplings

    CERN Document Server

    Sjölin, J

    2003-01-01

    The level of CP violation in pp to tt+X induced by the standard model is known to be below the experimental sensitivity by many orders of magnitude. However, in some effective theories, it is plausible that new CP violating physics could reveal itself as additional non- renormalizable terms in the Lagrangian. Since these should respect the symmetries of the low-energy gauge interaction, violate CP and generate the correct event topology, the set of allowed terms is highly restricted. This analysis gives an estimate of the expected experimental sensitivity to the lowest order effective CP violating gtt interaction term beyond the standard model using simulated data from the ATLAS detector at the LHC. (36 refs).

  16. Introduction to heavy meson decays and CP asymmetries

    International Nuclear Information System (INIS)

    Ligeti, Zoltan

    2003-01-01

    These lectures are intended to provide an introduction to heavy meson decays and CP violation. The first lecture contains a brief review of the standard model and how the CKM matrix and CP violation arise, mixing and CP violation in neutral meson systems, and explanation of the cleanliness of the sin 2β measurement. The second lecture deals with the heavy quark limit, some applications of heavy quark symmetry and the operator product expansion for exclusive and inclusive semileptonic B decays. The third lecture concerns with theoretically clean CP violation measurements that may become possible in the future, and some developments toward a better understanding of nonleptonic B decays. The conclusions include a subjective best buy list for the near future

  17. CP-violating profile of the electroweak bubble wall

    Energy Technology Data Exchange (ETDEWEB)

    Funakubo, Koichi [Saga Univ. (Japan). Dept. of Physics; Kakuto, Akira; Otsuki, Shoichiro; Takenaga, Kazunori; Toyoda, Fumihiko

    1995-11-01

    In any scenario of the electroweak baryogenesis, the profile of the CP violating bubble wall, created at the first-order phase transition, plays an essential role. We attempt to determine it by solving the equations of motion for the scalars in the two-Higgs-doublet model at the transition temperature. According to the parameters in the potential, we found three solutions. Two of them smoothly connect the CP-violating broken phase and the symmetric phase, while the other connects CP-conserving vacua but violates CP in the intermediate region. We also estimate the chiral charge flux, which will be turned into the baryon density in the symmetric phase by the sphaleron process. (author).

  18. 50 years of CP violation — What have we learned?

    Energy Technology Data Exchange (ETDEWEB)

    McKellar, Bruce H. J. [Centre of Excellence for Particle Physics at the Terrascale School of Physics, University of Melbourne, Australia 3010 (Australia)

    2015-04-24

    Early after the discovery of CP violation, the explanation of how the Standard Model of particle physics could allow CP violation was quickly given, but it took many years for the original observation to be unequivocally explained on that basis. It was also proposed that this observation opened up the possibility that we could now explain the fact that the universe is made of matter. Remarkably, 50 years later we have no evidence in particle physics that there is any CP violation except that of the Kobayashi Maskawa mechanism of the standard model. Yet we fail completely to explain the baryon asymmetry of the Universe through that mechanism. After reviewing the main points in the history I describe the present experimental attempts to find CP violation beyond the standard model, and explain the theoretical attempts to explain the matter in the Universe.

  19. CP violation in multibody decays of beauty baryons

    Energy Technology Data Exchange (ETDEWEB)

    Durieux, Gauthier

    2016-08-15

    Beauty baryons are being observed in large numbers in the LHCb detector. The rich kinematic distributions of their multibody decays are therefore becoming accessible and provide us with new opportunities to search for CP violation. We analyse the angular distributions of some three- and four-body decays of spin-1/2 baryons using the Jacob-Wick helicity formalism. The asymmetries that provide access to small differences of CP-odd phases between decay amplitudes of identical CP-even phases are notably discussed. The understanding gained on processes featuring specific resonant intermediate states allows us to establish which asymmetries are relevant for what purpose. It is for instance shown that some CP-odd angular asymmetries measured by the LHCb collaboration in the Λ{sub b}→Λφ→pπ K{sup +}K{sup -} decay are expected to vanish identically.

  20. Flavour Physics and CP Violation : Expecting the LHC

    CERN Document Server

    Fleischer, Robert

    2008-01-01

    The starting point of these lectures is an introduction to the weak interactions of quarks and the Standard-Model description of CP violation, where the central role is played by the Cabibbo-Kobayashi-Maskawa matrix and the corresponding unitarity triangles. Since the B-meson system governs the stage of (quark) flavour physics and CP violation, it is our main focus: we shall classify B-meson decays, introduce the theoretical tools to deal with them, investigate the requirements for non-vanishing CP-violating asymmetries, and discuss the main strategies to explore CP violation and the preferred avenues for physics beyond the Standard Model to enter. This formalism allows us then to discuss important benchmark modes, where we will also address the question of how much space for new-physics effects in the B studies at the LHC is left by the recent experimental results from the B factories and the Tevatron.