WorldWideScience

Sample records for primer electronic resource

  1. Internet and electronic resources for inflammatory bowel disease: a primer for providers and patients.

    Science.gov (United States)

    Fortinsky, Kyle J; Fournier, Marc R; Benchimol, Eric I

    2012-06-01

    Patients with inflammatory bowel disease (IBD) are increasingly turning to the Internet to research their condition and engage in discourse on their experiences. This has resulted in new dynamics in the relationship between providers and their patients, with misinformation and advertising potentially presenting barriers to the cooperative patient-provider partnership. This article addresses important issues of online IBD-related health information and social media activity, such as quality, reliability, objectivity, and privacy. We reviewed the medical literature on the quality of online information provided to IBD patients, and summarized the most commonly accessed Websites related to IBD. We also assessed the activity on popular social media sites (such as Facebook, Twitter, and YouTube), and evaluated currently available applications for use by IBD patients and providers on mobile phones and tablets. Through our review of the literature and currently available resources, we developed a list of recommended online resources to strengthen patient participation in their care by providing reliable, comprehensive educational material. Copyright © 2011 Crohn's & Colitis Foundation of America, Inc.

  2. Primer on gas integrated resource planning

    Energy Technology Data Exchange (ETDEWEB)

    Goldman, C.; Comnes, G.A.; Busch, J.; Wiel, S. [Lawrence Berkeley Lab., CA (United States)

    1993-12-01

    This report discusses the following topics: gas resource planning: need for IRP; gas integrated resource planning: methods and models; supply and capacity planning for gas utilities; methods for estimating gas avoided costs; economic analysis of gas utility DSM programs: benefit-cost tests; gas DSM technologies and programs; end-use fuel substitution; and financial aspects of gas demand-side management programs.

  3. A Primer on Endoscopic Electronic Medical Records

    OpenAIRE

    Atreja, Ashish; Rizk, Maged; Gurland, Brooke

    2010-01-01

    Endoscopic electronic medical record systems (EEMRs) are now increasingly utilized in many endoscopy centers. Modern EEMRs not only support endoscopy report generation, but often include features such as practice management tools, image and video clip management, inventory management, e-faxes to referring physicians, and database support to measure quality and patient outcomes. There are many existing software vendors offering EEMRs, and choosing a software vendor can be time consuming and co...

  4. Electronic medical devices: a primer for pathologists.

    Science.gov (United States)

    Weitzman, James B

    2003-07-01

    Electronic medical devices (EMDs) with downloadable memories, such as implantable cardiac pacemakers, defibrillators, drug pumps, insulin pumps, and glucose monitors, are now an integral part of routine medical practice in the United States, and functional organ replacements, such as the artificial heart, pancreas, and retina, will most likely become commonplace in the near future. Often, EMDs end up in the hands of the pathologist as a surgical specimen or at autopsy. No established guidelines for systematic examination and reporting or comprehensive reviews of EMDs currently exist for the pathologist. To provide pathologists with a general overview of EMDs, including a brief history; epidemiology; essential technical aspects, indications, contraindications, and complications of selected devices; potential applications in pathology; relevant government regulations; and suggested examination and reporting guidelines. Articles indexed on PubMed of the National Library of Medicine, various medical and history of medicine textbooks, US Food and Drug Administration publications and product information, and specifications provided by device manufacturers. Studies were selected on the basis of relevance to the study objectives. Descriptive data were selected by the author. Suggested examination and reporting guidelines for EMDs received as surgical specimens and retrieved at autopsy. Electronic medical devices received as surgical specimens and retrieved at autopsy are increasing in number and level of sophistication. They should be systematically examined and reported, should have electronic memories downloaded when indicated, will help pathologists answer more questions with greater certainty, and should become an integral part of the formal knowledge base, research focus, training, and practice of pathology.

  5. A primer on endoscopic electronic medical records.

    Science.gov (United States)

    Atreja, Ashish; Rizk, Maged; Gurland, Brooke

    2010-02-01

    Endoscopic electronic medical record systems (EEMRs) are now increasingly utilized in many endoscopy centers. Modern EEMRs not only support endoscopy report generation, but often include features such as practice management tools, image and video clip management, inventory management, e-faxes to referring physicians, and database support to measure quality and patient outcomes. There are many existing software vendors offering EEMRs, and choosing a software vendor can be time consuming and confusing. The goal of this article is inform the readers about current functionalities available in modern EEMR and provide them with a framework necessary to find an EEMR that is best fit for their practice.

  6. Electronic Resource Management Systems

    Directory of Open Access Journals (Sweden)

    Mark Ellingsen

    2004-10-01

    Full Text Available Computer applications which deal with electronic resource management (ERM are quite a recent development. They have grown out of the need to manage the burgeoning number of electronic resources particularly electronic journals. Typically, in the early years of e-journal acquisition, library staff provided an easy means of accessing these journals by providing an alphabetical list on a web page. Some went as far as categorising the e-journals by subject and then grouping the journals either on a single web page or by using multiple pages. It didn't take long before it was recognised that it would be more efficient to dynamically generate the pages from a database rather than to continually edit the pages manually. Of course, once the descriptive metadata for an electronic journal was held within a database the next logical step was to provide administrative forms whereby that metadata could be manipulated. This in turn led to demands for incorporating more information and more functionality into the developing application.

  7. Electronic Resource Management and Design

    Science.gov (United States)

    Abrams, Kimberly R.

    2015-01-01

    We have now reached a tipping point at which electronic resources comprise more than half of academic library budgets. Because of the increasing work associated with the ever-increasing number of e-resources, there is a trend to distribute work throughout the library even in the presence of an electronic resources department. In 2013, the author…

  8. Natural resource validation: A primer on concepts and techniques

    Energy Technology Data Exchange (ETDEWEB)

    Ulibarri, C.A.; Wellman, K.F.

    1997-07-01

    Natural resource valuation has always had a fundamental role in the practice of cost-benefit analysis of health, safety, and environmental issues. The authors provide an objective overview of resource valuation techniques and describe their potential role in environmental restoration/waste management (ER/WM) activities at federal facilities. This handbook considers five general classes of valuation techniques: (1) market-based techniques, which rely on historical information on market prices and transactions to determine resource values; (2) nonmarket techniques that rely on indirect estimates of resource values; (3) nonmarket techniques that are based on direct estimates of resource values; (4) cross-cutting valuation techniques, which combine elements of one or more of these methods; and (5) ecological valuation techniques used in the emerging field of ecological economics. The various valuation techniques under consideration are described by highlighting their applicability in environmental management and regulation. The handbook also addresses key unresolved issues in the application of valuation techniques generally, including discounting future values, incorporating environmental equity concerns, and concerns over the uncertainties in the measurement of natural resource values and environmental risk.

  9. Natural resource valuation: A primer on concepts and techniques

    International Nuclear Information System (INIS)

    Ulibarri, C.A.; Wellman, K.F.

    1997-07-01

    Natural resource valuation has always had a fundamental role in the practice of cost-benefit analysis of health, safety, and environmental issues. The authors provide an objective overview of resource valuation techniques and describe their potential role in environmental restoration/waste management (ER/WM) activities at federal facilities. This handbook considers five general classes of valuation techniques: (1) market-based techniques, which rely on historical information on market prices and transactions to determine resource values; (2) nonmarket techniques that rely on indirect estimates of resource values; (3) nonmarket techniques that are based on direct estimates of resource values; (4) cross-cutting valuation techniques, which combine elements of one or more of these methods; and (5) ecological valuation techniques used in the emerging field of ecological economics. The various valuation techniques under consideration are described by highlighting their applicability in environmental management and regulation. The handbook also addresses key unresolved issues in the application of valuation techniques generally, including discounting future values, incorporating environmental equity concerns, and concerns over the uncertainties in the measurement of natural resource values and environmental risk

  10. Natural resource valuation: A primer on concepts and techniques

    Energy Technology Data Exchange (ETDEWEB)

    Ulibarri, C.A.; Wellman, K.F.

    1997-07-01

    Natural resource valuation has always had a fundamental role in the practice of cost-benefit analysis of health, safety, and environmental issues. Today, this role is becoming all the more apparent in the conduct of natural resource damage assessments (NRDA) and cost-benefit analyses of environmental restoration (ER) and waste management (WM) activities. As such, environmental professionals are more interested in how natural resource values are affected by ER and WM activities. This professional interest extends to the use of NRDA values as measures of liability and legal causes of action under such environmental status as the Clean Water Act (CWA); the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA, as amended); and the Oil Pollution Act (OPA) of 1990. Also, environmental professionals are paying closer attention to NRDA values in cost-benefit analyses of risk and pollution-abatement standards, and in meeting environmental and safety standards - for achievable (ALARA). This handbook reviews natural resource valuation techniques that may be applied to resources at DOE sites within the foregoing contexts.

  11. Natural resource valuation: A primer on concepts and techniques

    International Nuclear Information System (INIS)

    Ulibarri, C.A.; Wellman, K.F.

    1997-07-01

    Natural resource valuation has always had a fundamental role in the practice of cost-benefit analysis of health, safety, and environmental issues. Today, this role is becoming all the more apparent in the conduct of natural resource damage assessments (NRDA) and cost-benefit analyses of environmental restoration (ER) and waste management (WM) activities. As such, environmental professionals are more interested in how natural resource values are affected by ER and WM activities. This professional interest extends to the use of NRDA values as measures of liability and legal causes of action under such environmental status as the Clean Water Act (CWA); the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA, as amended); and the Oil Pollution Act (OPA) of 1990. Also, environmental professionals are paying closer attention to NRDA values in cost-benefit analyses of risk and pollution-abatement standards, and in meeting environmental and safety standards - for achievable (ALARA). This handbook reviews natural resource valuation techniques that may be applied to resources at DOE sites within the foregoing contexts

  12. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  13. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  14. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  15. State Bioenergy Primer: Information and Resources for States on Issues, Opportunities, and Options for Advancing Bioenergy

    Energy Technology Data Exchange (ETDEWEB)

    Byrnett, D. S.; Mulholland, D.; Zinsmeister, E.; Doris, E.; Milbrandt, A.; Robichaud. R.; Stanley, R.; Vimmerstedt, L.

    2009-09-01

    One renewable energy option that states frequently consider to meet their clean energy goals is the use of biomass resources to develop bioenergy. Bioenergy includes bioheat, biopower, biofuels, and bioproducts. This document provides an overview of biomass feedstocks, basic information about biomass conversion technologies, and a discussion of benefits and challenges of bioenergy options. The Primer includes a step-wise framework, resources, and tools for determining the availability of feedstocks, assessing potential markets for biomass, and identifying opportunities for action at the state level. Each chapter contains a list of selected resources and tools that states can use to explore topics in further detail.

  16. PS1-29: Resources to Facilitate Multi-site Collaboration: the PRIMER Research Toolkit

    Science.gov (United States)

    Greene, Sarah; Thompson, Ella; Baldwin, Laura-Mae; Neale, Anne Victoria; Dolor, Rowena

    2010-01-01

    Background and Aims: The national research enterprise has typically functioned in a decentralized fashion, resulting in duplicative or undocumented processes, impeding not only the pace of research, but diffusion of established best practices. To remedy this, many long-standing networks have begun capturing and documenting proven strategies to streamline and standardize various aspects of the research process. The project, “Partnership-driven Resources to IMprove and Enhance Research” (PRIMER), was funded through the Clinical and Translational Science Awards (CTSA) initiative to leverage the collective expertise from two networks: the HMO Research Network and Practice Based Research Networks (PBRNs). Each network has a shared goal of propagating research resources and best practices. Methods: We created and distributed an online survey to 92 CTSA and PBRN representatives in March, 2009 to define critical needs and existing resources that could inform a resource repository. The survey identified barriers and benefits to forming research partnerships, and assessed the perceived utility of various tools that could accelerate the research process. The study team identified, reviewed and organized tools based on the typical research trajectory from design to dissemination. Results: Fifty-five of 92 invitees (59%) completed the survey. Respondents rated the ability to conduct community-relevant research through true academic-community partnerships as the top-rated benefit of multi-site research, followed by the opportunity to accelerate translation of research into practice. The top two perceived barriers to multi-site research were ‘funding opportunities are not adequate (e.g., too few, not enough to support true collaborations), and ‘lack of research infrastructure to support [all] partners (e.g., no IT support, IRB, dedicated research staff). Respondents’ ratings of the utility of various tools and templates was used to guide development of an online

  17. Managing electronic resources a LITA guide

    CERN Document Server

    Weir, Ryan O

    2012-01-01

    Informative, useful, current, Managing Electronic Resources: A LITA Guide shows how to successfully manage time, resources, and relationships with vendors and staff to ensure personal, professional, and institutional success.

  18. Electronic Resources Management Project Presentation 2012

    KAUST Repository

    Ramli, Rindra M.

    2012-11-05

    This presentation describes the electronic resources management project undertaken by the KAUST library. The objectives of this project is to migrate information from MS Sharepoint to Millennium ERM module. One of the advantages of this migration is to consolidate all electronic resources into a single and centralized location. This would allow for better information sharing among library staff.

  19. Implementing CORAL: An Electronic Resource Management System

    Science.gov (United States)

    Whitfield, Sharon

    2011-01-01

    A 2010 electronic resource management survey conducted by Maria Collins of North Carolina State University and Jill E. Grogg of University of Alabama Libraries found that the top six electronic resources management priorities included workflow management, communications management, license management, statistics management, administrative…

  20. Electronic Resources Management System: Recommendation Report 2017

    KAUST Repository

    Ramli, Rindra M.

    2017-01-01

    This recommendation report provides an overview of the selection process for the new Electronic Resources Management System. The library has decided to move away from Innovative Interfaces Millennium ERM module. The library reviewed 3 system

  1. Electronic Resources Management Project Presentation 2012

    KAUST Repository

    Ramli, Rindra M.

    2012-01-01

    This presentation describes the electronic resources management project undertaken by the KAUST library. The objectives of this project is to migrate information from MS Sharepoint to Millennium ERM module. One of the advantages of this migration

  2. PRINCIPLES OF CONTENT FORMATION EDUCATIONAL ELECTRONIC RESOURCE

    Directory of Open Access Journals (Sweden)

    О Ю Заславская

    2017-12-01

    Full Text Available The article considers modern possibilities of information and communication technologies for the design of electronic educational resources. The conceptual basis of the open educational multimedia system is based on the modular architecture of the electronic educational resource. The content of the electronic training module can be implemented in several versions of the modules: obtaining information, practical exercises, control. The regularities in the teaching process in modern pedagogical theory are considered: general and specific, and the principles for the formation of the content of instruction at different levels are defined, based on the formulated regularities. On the basis of the analysis, the principles of the formation of the electronic educational resource are determined, taking into account the general and didactic patterns of teaching.As principles of the formation of educational material for obtaining information for the electronic educational resource, the article considers: the principle of methodological orientation, the principle of general scientific orientation, the principle of systemic nature, the principle of fundamentalization, the principle of accounting intersubject communications, the principle of minimization. The principles of the formation of the electronic training module of practical studies in the article include: the principle of systematic and dose based consistency, the principle of rational use of study time, the principle of accessibility. The principles of the formation of the module for monitoring the electronic educational resource can be: the principle of the operationalization of goals, the principle of unified identification diagnosis.

  3. Electronic Resources Management System: Recommendation Report 2017

    KAUST Repository

    Ramli, Rindra M.

    2017-05-01

    This recommendation report provides an overview of the selection process for the new Electronic Resources Management System. The library has decided to move away from Innovative Interfaces Millennium ERM module. The library reviewed 3 system as potential replacements namely: Proquest 360 Resource Manager, Ex Libris Alma and Open Source CORAL ERMS. After comparing and trialling the systems, it was decided to go for Proquest 360 Resource Manager.

  4. CHALLENGES OF ELECTRONIC INFORMATION RESOURCES IN ...

    African Journals Online (AJOL)

    This paper discusses the role of policy for proper and efficient library services in the electronic era. It points out some of the possible dangers of embarking in electronic resources without a proper focus at hand. Thus, it calls for today's librarians and policy makers to brainstorm and come up with working policies suitable to ...

  5. Library training to promote electronic resource usage

    DEFF Research Database (Denmark)

    Frandsen, Tove Faber; Tibyampansha, Dativa; Ibrahim, Glory

    2017-01-01

    Purpose: Increasing the usage of electronic resources is an issue of concern for many libraries all over the world. Several studies stress the importance of information literacy and instruction in order to increase the usage. Design/methodology/approach: The present article presents the results...

  6. Electronic resource management systems a workflow approach

    CERN Document Server

    Anderson, Elsa K

    2014-01-01

    To get to the bottom of a successful approach to Electronic Resource Management (ERM), Anderson interviewed staff at 11 institutions about their ERM implementations. Among her conclusions, presented in this issue of Library Technology Reports, is that grasping the intricacies of your workflow-analyzing each step to reveal the gaps and problems-at the beginning is crucial to selecting and implementing an ERM. Whether the system will be used to fill a gap, aggregate critical data, or replace a tedious manual process, the best solution for your library depends on factors such as your current soft

  7. use of electronic resources by graduate students of the department

    African Journals Online (AJOL)

    respondent's access electronic resources from the internet via Cybercafé .There is a high ... KEY WORDS: Use, Electronic Resources, Graduate Students, Cybercafé. INTRODUCTION ... Faculty of Education, University of Uyo, Uyo. Olu Olat ...

  8. Use of Electronic Resources in a Private University in Nigeria ...

    African Journals Online (AJOL)

    The study examined awareness and constraints in the use of electronic resources by lecturers and students of Ajayi Crowther University, Oyo, Nigeria. It aimed at justifying the resources expended in the provision of electronic resources in terms of awareness, patronage and factors that may be affecting awareness and use ...

  9. Gender Analysis Of Electronic Information Resource Use: The Case ...

    African Journals Online (AJOL)

    Based on the findings the study concluded that access and use of electronic information resources creates a “social digital divide” along gender lines. The study ... Finally, the library needs to change its marketing strategies on the availability of electronic information resources to increase awareness of these resources.

  10. Electronic Resource Management System. Vernetzung von Lizenzinformationen

    Directory of Open Access Journals (Sweden)

    Michaela Selbach

    2014-12-01

    Full Text Available In den letzten zehn Jahren spielen elektronische Ressourcen im Bereich der Erwerbung eine zunehmend wichtige Rolle: Eindeutig lässt sich hier ein Wandel in den Bibliotheken (fort vom reinen Printbestand zu immer größeren E-Only-Beständen feststellen. Die stetig wachsende Menge an E-Ressourcen und deren Heterogenität stellt Bibliotheken vor die Herausforderung, die E-Ressourcen effizient zu verwalten. Nicht nur Bibliotheken, sondern auch verhandlungsführende Institutionen von Konsortial- und Allianzlizenzen benötigen ein geeignetes Instrument zur Verwaltung von Lizenzinformationen, welches den komplexen Anforderungen moderner E-Ressourcen gerecht wird. Die Deutsche Forschungsgemeinschaft (DFG unterstützt ein Projekt des Hochschulbibliothekszentrums des Landes Nordrhein-Westfalen (hbz, der Universitätsbibliothek Freiburg, der Verbundzentrale des Gemeinsamen Bibliotheksverbundes (GBV und der Universitätsbibliothek Frankfurt, in dem ein bundesweit verfügbares Electronic Ressource Managementsystem (ERMS aufgebaut werden soll. Ein solches ERMS soll auf Basis einer zentralen Knowledge Base eine einheitliche Nutzung von Daten zur Lizenzverwaltung elektronischer Ressourcen auf lokaler, regionaler und nationaler Ebene ermöglichen. Statistische Auswertungen, Rechteverwaltung für alle angeschlossenen Bibliotheken, kooperative Datenpflege sowie ein über standardisierte Schnittstellen geführter Datenaustausch stehen bei der Erarbeitung der Anforderungen ebenso im Fokus wie die Entwicklung eines Daten- und Funktionsmodells. In the last few years the importance of electronic resources in library acquisitions has increased significantly. There has been a shift from mere print holdings to both e- and print combinations and even e-only subscriptions. This shift poses a double challenge for libraries: On the one hand they have to provide their e-resource collections to library users in an appealing way, on the other hand they have to manage these

  11. Electronic human resource management: Enhancing or entrancing?

    Directory of Open Access Journals (Sweden)

    Paul Poisat

    2017-07-01

    Full Text Available Orientation: This article provides an investigation into the current level of development of the body of knowledge related to electronic human resource management (e-HRM by means of a qualitative content analysis. Several aspects of e-HRM, namely definitions of e-HRM, the theoretical perspectives around e-HRM, the role of e-HRM, the various types of e-HRM and the requirements for successful e-HRM, are examined. Research purpose: The purpose of the article was to determine the status of e-HRM and examine the studies that report on the link between e-HRM and organisational productivity. Motivation for the study: e-HRM has the capacity to improve organisational efficiency and leverage the role of human resources (HR as a strategic business partner. Main findings: The notion that the implementation of e-HRM will lead to improved organisational productivity is commonly assumed; however, empirical evidence in this regard was found to be limited. Practical/managerial implications: From the results of this investigation it is evident that more research is required to gain a greater understanding of the influence of e-HRM on organisational productivity, as well as to develop measures for assessing this influence. Contribution: This article proposes additional areas to research and measure when investigating the effectiveness of e-HRM. It provides a different lens from which to view e-HRM assessment whilst keeping it within recognised HR measurement parameters (the HR value chain. In addition, it not only provides areas for measuring e-HRM’s influence but also provides important clues as to how the measurements may be approached.

  12. Utilization of electronic information resources by academic staff at ...

    African Journals Online (AJOL)

    The study investigated the utilization of Electronic Information resources by the academic staff of Makerere University in Uganda. It examined the academic staff awareness of the resources available, the types of resources provided by the Makerere University Library, the factors affecting resource utilization. The study was ...

  13. Users satisfaction with electronic information resources and services ...

    African Journals Online (AJOL)

    This study investigated users satisfaction on the use of electronic information resources and services in MTN Net libraries in ABU & UNIBEN. Two objectives and one null hypotheses were formulated and tested with respect to the users' satisfaction on electronic information resources and services in MTN Net libraries in ...

  14. The Role of the Acquisitions Librarian in Electronic Resources Management

    Science.gov (United States)

    Pomerantz, Sarah B.

    2010-01-01

    With the ongoing shift to electronic formats for library resources, acquisitions librarians, like the rest of the profession, must adapt to the rapidly changing landscape of electronic resources by keeping up with trends and mastering new skills related to digital publishing, technology, and licensing. The author sought to know what roles…

  15. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  16. Selection and Evaluation of Electronic Resources

    Directory of Open Access Journals (Sweden)

    Doğan Atılgan

    2013-11-01

    Full Text Available Publication boom and issues related to controlling and accession of printed sources have created some problems after World War II. Consequently, publishing industry has encountered the problem of finding possible solution for emerged situation. Industry of electronic publishing has started to improve with the rapid increase of the price of printed sources as well as the problem of publication boom. The first effects of electronic publishing were appeared on the academic and scholarly publications then electronic publishing became a crucial part of all types of publications. As a result of these developments, collection developments and service policies of information centers were also significantly changed. In this article, after a general introduction about selection and evaluation processes of electronic publications, the subscribed databases by a state and a privately owned university in Turkey and their usage were examined.

  17. Improving Electronic Resources through Holistic Budgeting

    Science.gov (United States)

    Kusik, James P.; Vargas, Mark A.

    2009-01-01

    To establish a more direct link between its collections and the educational goals of Saint Xavier University, the Byrne Memorial Library has adopted a "holistic" approach to collection development. This article examines how traditional budget practices influenced the library's selection of resources and describes how holistic collection…

  18. Partnership‐Driven Resources to Improve and Enhance Research (PRIMER): A Survey of Community‐Engaged Researchers and Creation of an Online Toolkit

    Science.gov (United States)

    Dolor, Rowena J.; Greene, Sarah M.; Thompson, Ella; Baldwin, Laura‐Mae; Neale, Anne Victoria

    2011-01-01

    Abstract Objective: This project aimed to develop an open‐access website providing adaptable resources to facilitate best practices for multisite research from initiation to closeout. Methods: A web‐based assessment was sent to the leadership of the Clinical and Translational Science Award (CTSA) Community Engagement Key Functions Committee (n= 38) and the CTSA‐affiliated Primary Care Practice‐based Research Networks (PBRN, n= 55). Respondents rated the benefits and barriers of multisite research, the utility of available resources, and indicated their level of interest in unavailable resources. Then, existing research resources were evaluated for relevance to multisite research, adaptability to other projects, and source credibility. Results: Fifty‐five (59%) of invited participants completed the survey. Top perceived benefits of multisite research were the ability to conduct community‐relevant research through academic–community partnerships (34%) and accelerating translation of research into practice (31%). Top perceived barriers were lack of research infrastructure to support PBRNs and community partners (31%) and inadequate funding to support multisite collaborations (26%). Over 200 resources were evaluated, of which 120 unique resources were included in the website. Conclusion: The PRIMER Research Toolkit (http://www.researchtoolkit.org) provides an array of peer‐reviewed resources to facilitate translational research for the conduct of multisite studies within PBRNs and community‐based organizations. Clin Trans Sci 2011; Volume 4: 259–265 PMID:21884512

  19. Page 170 Use of Electronic Resources by Undergraduates in Two ...

    African Journals Online (AJOL)

    undergraduate students use electronic resources such as NUC virtual library, HINARI, ... web pages articles from magazines, encyclopedias, pamphlets and other .... of Nigerian university libraries have Internet connectivity, some of the system.

  20. Utilisation of Electronic Information Resources By Lecturers in ...

    African Journals Online (AJOL)

    This study assesses the use of information resources, specifically, electronic databases by lecturers/teachers in Universities and Colleges of Education in South Western Nigeria. Information resources are central to teachers' education. It provides lecturers/teachers access to information that enhances research and ...

  1. Preservation and conservation of electronic information resources of ...

    African Journals Online (AJOL)

    The major holdings of the broadcast libraries of the Nigerian Television Authority (NTA) are electronic information resources; therefore, providing safe places for general management of these resources have aroused interest in the industry in Nigeria for sometimes. The need to study the preservation and conservation of ...

  2. Using XML Technologies to Organize Electronic Reference Resources

    OpenAIRE

    Huser, Vojtech; Del Fiol, Guilherme; Rocha, Roberto A.

    2005-01-01

    Provision of access to reference electronic resources to clinicians is becoming increasingly important. We have created a framework for librarians to manage access to these resources at an enterprise level, rather than at the individual hospital libraries. We describe initial project requirements, implementation details, and some preliminary results.

  3. Euler European Libraries and Electronic Resources in Mathematical Sciences

    CERN Document Server

    The Euler Project. Karlsruhe

    The European Libraries and Electronic Resources (EULER) Project in Mathematical Sciences provides the EulerService site for searching out "mathematical resources such as books, pre-prints, web-pages, abstracts, proceedings, serials, technical reports preprints) and NetLab (for Internet resources), this outstanding engine is capable of simple, full, and refined searches. It also offers a browse option, which responds to entries in the author, keyword, and title fields. Further information about the Project is provided at the EULER homepage.

  4. Building an electronic resource collection a practical guide

    CERN Document Server

    Lee, Stuart D

    2004-01-01

    This practical book guides information professionals step-by-step through building and managing an electronic resource collection. It outlines the range of electronic products currently available in abstracting and indexing, bibliographic, and other services and then describes how to effectively select, evaluate and purchase them.

  5. Organizational matters of competition in electronic educational resources

    Directory of Open Access Journals (Sweden)

    Ирина Карловна Войтович

    2015-12-01

    Full Text Available The article examines the experience of the Udmurt State University in conducting competitions of educational publications and electronic resources. The purpose of such competitions is to provide methodological support to educational process. The main focus is on competition of electronic educational resources. The technology of such contests is discussed through detailed analysis of the main stages of the contest. It is noted that the main task of the preparatory stage of the competition is related to the development of regulations on competition and the definition of criteria for selection of the submitted works. The paper also proposes a system of evaluation criteria of electronic educational resources developed by members of the contest organizing committee and jury members. The article emphasizes the importance of not only the preparatory stages of the competition, but also measures for its completion, aimed at training teachers create quality e-learning resources.

  6. Why and How to Measure the Use of Electronic Resources

    Directory of Open Access Journals (Sweden)

    Jean Bernon

    2008-11-01

    Full Text Available A complete overview of library activity implies a complete and reliable measurement of the use of both electronic resources and printed materials. This measurement is based on three sets of definitions: document types, use types and user types. There is a common model of definitions for printed materials, but a lot of questions and technical issues remain for electronic resources. In 2006 a French national working group studied these questions. It relied on the COUNTER standard, but found it insufficient and pointed out the need for local tools such as web markers and deep analysis of proxy logs. Within the French national consortium COUPERIN, a new working group is testing ERMS, SUSHI standards, Shibboleth authentication, along with COUNTER standards, to improve the counting of the electronic resources use. At this stage this counting is insufficient and its improvement will be a European challenge for the future.

  7. Access to electronic resources by visually impaired people

    Directory of Open Access Journals (Sweden)

    Jenny Craven

    2003-01-01

    Full Text Available Research into access to electronic resources by visually impaired people undertaken by the Centre for Research in Library and Information Management has not only explored the accessibility of websites and levels of awareness in providing websites that adhere to design for all principles, but has sought to enhance understanding of information seeking behaviour of blind and visually impaired people when using digital resources.

  8. Practical guide to electronic resources in the humanities

    CERN Document Server

    Dubnjakovic, Ana

    2010-01-01

    From full-text article databases to digitized collections of primary source materials, newly emerging electronic resources have radically impacted how research in the humanities is conducted and discovered. This book, covering high-quality, up-to-date electronic resources for the humanities, is an easy-to-use annotated guide for the librarian, student, and scholar alike. It covers online databases, indexes, archives, and many other critical tools in key humanities disciplines including philosophy, religion, languages and literature, and performing and visual arts. Succinct overviews of key eme

  9. Discipline, availability of electronic resources and the use of Finnish National Electronic Library - FinELib

    Directory of Open Access Journals (Sweden)

    Sanna Torma

    2004-01-01

    Full Text Available This study elaborated relations between digital library use by university faculty, users' discipline and the availability of key resources in the Finnish National Electronic Library (FinELib, Finnish national digital library, by using nationwide representative survey data. The results show that the perceived availability of key electronic resources by researchers in FinELib was a stronger predictor of the frequency and purpose of use of its services than users' discipline. Regardless of discipline a good perceived provision of central resources led to a more frequent use of FinELib. The satisfaction with the services did not vary with the discipline, but with the perceived availability of resources.

  10. Access to electronic information resources by students of federal ...

    African Journals Online (AJOL)

    The paper discusses access to electronic information resources by students of Federal Colleges of Education in Eha-Amufu and Umunze. Descriptive survey design was used to investigate sample of 526 students. Sampling technique used was a Multi sampling technique. Data for the study were generated using ...

  11. Electronic Commerce Resource Centers. An Industry--University Partnership.

    Science.gov (United States)

    Gulledge, Thomas R.; Sommer, Rainer; Tarimcilar, M. Murat

    1999-01-01

    Electronic Commerce Resource Centers focus on transferring emerging technologies to small businesses through university/industry partnerships. Successful implementation hinges on a strategic operating plan, creation of measurable value for customers, investment in customer-targeted training, and measurement of performance outputs. (SK)

  12. ANALYTICAL REVIEW OF ELECTRONIC RESOURCES FOR THE STUDY OF LATIN

    Directory of Open Access Journals (Sweden)

    Olena Yu. Balalaieva

    2014-04-01

    Full Text Available The article investigates the current state of development of e-learning content in the Latin language. It is noted that the introduction of ICT in the educational space has expanded the possibility of studying Latin, opened access to digital libraries resources, made it possible to use scientific and educational potential and teaching Latin best practices of world's leading universities. A review of foreign and Ukrainian information resources and electronic editions for the study of Latin is given. Much attention was paid to the didactic potential of local and online multimedia courses of Latin, electronic textbooks, workbooks of interactive tests and exercises, various dictionaries and software translators, databases and digital libraries. Based on analysis of the world market of educational services and products the main trends in the development of information resources and electronic books are examined. It was found that multimedia courses with interactive exercises or workbooks with interactive tests, online dictionaries and translators are the most widely represented and demanded. The noticeable lagging of Ukrainian education and computer linguistics in quantitative and qualitative measures in this industry is established. The obvious drawback of existing Ukrainian resources and electronic editions for the study of Latin is their noninteractive nature. The prospects of e-learning content in Latin in Ukraine are outlined.

  13. Adoption and use of electronic information resources by medical ...

    African Journals Online (AJOL)

    This study investigated the adoption and use of electronic information resources by medical science students of the University of Benin. The descriptive survey research design was adopted for the study and 390 students provided the data. Data collected were analysed with descriptive Statistics(Simple percentage and ...

  14. Modern ICT Tools: Online Electronic Resources Sharing Using Web ...

    African Journals Online (AJOL)

    Modern ICT Tools: Online Electronic Resources Sharing Using Web 2.0 and Its Implications For Library And Information Practice In Nigeria. ... The PDF file you selected should load here if your Web browser has a PDF reader plug-in installed (for example, a recent version of Adobe Acrobat Reader). If you would like more ...

  15. Technical Communicator: A New Model for the Electronic Resources Librarian?

    Science.gov (United States)

    Hulseberg, Anna

    2016-01-01

    This article explores whether technical communicator is a useful model for electronic resources (ER) librarians. The fields of ER librarianship and technical communication (TC) originated and continue to develop in relation to evolving technologies. A review of the literature reveals four common themes for ER librarianship and TC. While the…

  16. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  17. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  18. MODEL OF AN ELECTRONIC EDUCATIONAL RESOURCE OF NEW GENERATION

    Directory of Open Access Journals (Sweden)

    Anatoliy V. Loban

    2016-01-01

    Full Text Available The mathematical structure of the modular architecture of an electronic educational resource (EER of new generation, which allows to decompose the process of studying the subjects of the course at a hierarchically ordered set of data (knowledge and procedures for manipulating them, to determine the roles of participants of process of training of and technology the development and use of EOR in the study procrate.

  19. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  20. End-of-life resource recovery from emerging electronic products

    DEFF Research Database (Denmark)

    Parajuly, Keshav; Habib, Komal; Cimpan, Ciprian

    2016-01-01

    Integrating product design with appropriate end-of-life (EoL) processing is widely recognized to have huge potentials in improving resource recovery from electronic products. In this study, we investigate both the product characteristics and EoL processing of robotic vacuum cleaner (RVC), as a case...... of emerging electronic product, in order to understand the recovery fate of different materials and its linkage to product design. Ten different brands of RVC were dismantled and their material composition and design profiles were studied. Another 125 RVCs (349 kg) were used for an experimental trial...... at a conventional ‘shred-and-separate’ type preprocessing plant in Denmark. A detailed material flow analysis was performed throughout the recycling chain. The results show a mismatch between product design and EoL processing, and the lack of practical implementation of ‘Design for EoL’ thinking. In the best...

  1. Analysis of Human Resources Management Strategy in China Electronic Commerce Enterprises

    Science.gov (United States)

    Shao, Fang

    The paper discussed electronic-commerce's influence on enterprise human resources management, proposed and proved the human resources management strategy which electronic commerce enterprise should adopt from recruitment strategy to training strategy, keeping talent strategy and other ways.

  2. Effects of Electronic Information Resources Skills Training for Lecturers on Pedagogical Practices and Research Productivity

    Science.gov (United States)

    Bhukuvhani, Crispen; Chiparausha, Blessing; Zuvalinyenga, Dorcas

    2012-01-01

    Lecturers use various electronic resources at different frequencies. The university library's information literacy skills workshops and seminars are the main sources of knowledge of accessing electronic resources. The use of electronic resources can be said to have positively affected lecturers' pedagogical practices and their work in general. The…

  3. Electronic Resources and Mission Creep: Reorganizing the Library for the Twenty-First Century

    Science.gov (United States)

    Stachokas, George

    2009-01-01

    The position of electronic resources librarian was created to serve as a specialist in the negotiation of license agreements for electronic resources, but mission creep has added more functions to the routine work of electronic resources such as cataloging, gathering information for collection development, and technical support. As electronic…

  4. Electronic Document Management: A Human Resource Management Case Study

    Directory of Open Access Journals (Sweden)

    Thomas Groenewald

    2004-11-01

    Full Text Available This case study serve as exemplar regarding what can go wrong with the implementation of an electronic document management system. Knowledge agility and knowledge as capital, is outlined against the backdrop of the information society and knowledge economy. The importance of electronic document management and control is sketched thereafter. The literature review is concluded with the impact of human resource management on knowledge agility, which includes references to the learning organisation and complexity theory. The intervention methodology, comprising three phases, follows next. The results of the three phases are presented thereafter. Partial success has been achieved with improving the human efficacy of electronic document management, however the client opted to discontinue the system in use. Opsomming Die gevalle studie dien as voorbeeld van wat kan verkeerd loop met die implementering van ’n elektroniese dokumentbestuur sisteem. Teen die agtergrond van die inligtingsgemeenskap en kennishuishouding word kennissoepelheid en kennis as kapitaal bespreek. Die literatuurstudie word afgesluit met die inpak van menslikehulpbronbestuur op kennissoepelheid, wat ook die verwysings na die leerorganisasie en kompleksietydsteorie insluit. Die metodologie van die intervensie, wat uit drie fases bestaan, volg daarna. Die resultate van die drie fases word vervolgens aangebied. Slegs gedeelte welslae is behaal met die verbetering van die menslike doeltreffendheid ten opsigte van elektroniese dokumentbestuur. Die klient besluit egter om nie voort te gaan om die huidige sisteem te gebruik nie.

  5. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  6. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  7. Electronic Safety Resource Tools -- Supporting Hydrogen and Fuel Cell Commercialization

    Energy Technology Data Exchange (ETDEWEB)

    Barilo, Nick F.

    2014-09-29

    The Pacific Northwest National Laboratory (PNNL) Hydrogen Safety Program conducted a planning session in Los Angeles, CA on April 1, 2014 to consider what electronic safety tools would benefit the next phase of hydrogen and fuel cell commercialization. A diverse, 20-person team led by an experienced facilitator considered the question as it applied to the eight most relevant user groups. The results and subsequent evaluation activities revealed several possible resource tools that could greatly benefit users. The tool identified as having the greatest potential for impact is a hydrogen safety portal, which can be the central location for integrating and disseminating safety information (including most of the tools identified in this report). Such a tool can provide credible and reliable information from a trustworthy source. Other impactful tools identified include a codes and standards wizard to guide users through a series of questions relating to application and specific features of the requirements; a scenario-based virtual reality training for first responders; peer networking tools to bring users from focused groups together to discuss and collaborate on hydrogen safety issues; and a focused tool for training inspectors. Table ES.1 provides results of the planning session, including proposed new tools and changes to existing tools.

  8. Controlling user access to electronic resources without password

    Science.gov (United States)

    Smith, Fred Hewitt

    2015-06-16

    Described herein are devices and techniques for remotely controlling user access to a restricted computer resource. The process includes pre-determining an association of the restricted computer resource and computer-resource-proximal environmental information. Indicia of user-proximal environmental information are received from a user requesting access to the restricted computer resource. Received indicia of user-proximal environmental information are compared to associated computer-resource-proximal environmental information. User access to the restricted computer resource is selectively granted responsive to a favorable comparison in which the user-proximal environmental information is sufficiently similar to the computer-resource proximal environmental information. In at least some embodiments, the process further includes comparing user-supplied biometric measure and comparing it with a predetermined association of at least one biometric measure of an authorized user. Access to the restricted computer resource is granted in response to a favorable comparison.

  9. The Internet School of Medicine: use of electronic resources by medical trainees and the reliability of those resources.

    Science.gov (United States)

    Egle, Jonathan P; Smeenge, David M; Kassem, Kamal M; Mittal, Vijay K

    2015-01-01

    Electronic sources of medical information are plentiful, and numerous studies have demonstrated the use of the Internet by patients and the variable reliability of these sources. Studies have investigated neither the use of web-based resources by residents, nor the reliability of the information available on these websites. A web-based survey was distributed to surgical residents in Michigan and third- and fourth-year medical students at an American allopathic and osteopathic medical school and a Caribbean allopathic school regarding their preferred sources of medical information in various situations. A set of 254 queries simulating those faced by medical trainees on rounds, on a written examination, or during patient care was developed. The top 5 electronic resources cited by the trainees were evaluated for their ability to answer these questions accurately, using standard textbooks as the point of reference. The respondents reported a wide variety of overall preferred resources. Most of the 73 responding medical trainees favored textbooks or board review books for prolonged studying, but electronic resources are frequently used for quick studying, clinical decision-making questions, and medication queries. The most commonly used electronic resources were UpToDate, Google, Medscape, Wikipedia, and Epocrates. UpToDate and Epocrates had the highest percentage of correct answers (47%) and Wikipedia had the lowest (26%). Epocrates also had the highest percentage of wrong answers (30%), whereas Google had the lowest percentage (18%). All resources had a significant number of questions that they were unable to answer. Though hardcopy books have not been completely replaced by electronic resources, more than half of medical students and nearly half of residents prefer web-based sources of information. For quick questions and studying, both groups prefer Internet sources. However, the most commonly used electronic resources fail to answer clinical queries more than half

  10. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  11. Developing Humanities Collections in the Digital Age: Exploring Humanities Faculty Engagement with Electronic and Print Resources

    Science.gov (United States)

    Kachaluba, Sarah Buck; Brady, Jessica Evans; Critten, Jessica

    2014-01-01

    This article is based on quantitative and qualitative research examining humanities scholars' understandings of the advantages and disadvantages of print versus electronic information resources. It explores how humanities' faculty members at Florida State University (FSU) use print and electronic resources, as well as how they perceive these…

  12. Electronic resource management practical perspectives in a new technical services model

    CERN Document Server

    Elguindi, Anne

    2012-01-01

    A significant shift is taking place in libraries, with the purchase of e-resources accounting for the bulk of materials spending. Electronic Resource Management makes the case that technical services workflows need to make a corresponding shift toward e-centric models and highlights the increasing variety of e-formats that are forcing new developments in the field.Six chapters cover key topics, including: technical services models, both past and emerging; staffing and workflow in electronic resource management; implementation and transformation of electronic resource management systems; the ro

  13. Electronic resources access and usage among the postgraduates of ...

    African Journals Online (AJOL)

    ... and usage among the postgraduates of a Nigerian University of Technology. ... faced by postgraduates in using e-resources include takes too much time to find, ... Resources, Access, Use, Postgraduat, Students, University, Technology, Nigeria ... By Country · List All Titles · Free To Read Titles This Journal is Open Access.

  14. Strategic Planning for Electronic Resources Management: A Case Study at Gustavus Adolphus College

    Science.gov (United States)

    Hulseberg, Anna; Monson, Sarah

    2009-01-01

    Electronic resources, the tools we use to manage them, and the needs and expectations of our users are constantly evolving; at the same time, the roles, responsibilities, and workflow of the library staff who manage e-resources are also in flux. Recognizing a need to be more intentional and proactive about how we manage e-resources, the…

  15. A LAN Primer.

    Science.gov (United States)

    Hazari, Sunil I.

    1991-01-01

    Local area networks (LANs) are systems of computers and peripherals connected together for the purposes of electronic mail and the convenience of sharing information and expensive resources. In planning the design of such a system, the components to consider are hardware, software, transmission media, topology, operating systems, and protocols.…

  16. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  17. impact of the use of electronic resources on research output

    African Journals Online (AJOL)

    manda

    ... Julita Nawe. University of Dar Es Salaam Library, P.O. Box 35092, Dar Es Salaam, Tanzania .... significantly, while 28.3% observed that quality of service to the community had improved .... resources and evaluate them is an important area.

  18. Preservation of and Permanent Access to Electronic Information Resources

    National Research Council Canada - National Science Library

    Hodge, Gail

    2004-01-01

    The rapid growth in the creation and dissemination of electronic information has emphasized the digital environment's speed and ease of dissemination with little regard for its long-term preservation and access...

  19. Electronic conferencing for continuing medical education: a resource survey.

    Science.gov (United States)

    Sternberg, R J

    1986-10-01

    The use of electronic technologies to link participants for education conferences is an option for providers of Continuing Medical Education. In order to profile the kinds of electronic networks currently offering audio- or videoteleconferences for physician audiences, a survey was done during late 1985. The information collected included range of services, fees, and geographic areas served. The results show a broad diversity of providers providing both interactive and didactic programming to both physicians and other health care professionals.

  20. Controlling user access to electronic resources without password

    Science.gov (United States)

    Smith, Fred Hewitt

    2017-08-22

    Described herein are devices and techniques for remotely controlling user access to a restricted computer resource. The process includes obtaining an image from a communication device of a user. An individual and a landmark are identified within the image. Determinations are made that the individual is the user and that the landmark is a predetermined landmark. Access to a restricted computing resource is granted based on the determining that the individual is the user and that the landmark is the predetermined landmark. Other embodiments are disclosed.

  1. Electron beam pasteurised oil palm waste: a potential feed resource

    International Nuclear Information System (INIS)

    Mat Rasol Awang; Hassan Hamdani Mutaat; Tamikazu Kume; Tachibana, H.

    2002-01-01

    Pasteurization of oil palm empty fruit bunch (EFB) was performed using electron beam single sided irradiation. The dose profiles of oil palm EFB samples for different thickness in both directions X and Y were established. The results showed the usual characteristics dose uniformity as sample thickness decreased. The mean average absorbed dose on both sides at the surface and bottom of the samples for different thickness samples lead to establishing depth dose curve. Based on depth dose curve and operation conditions of electron beam machine, the process throughput for pasteurized oil palm EFB were estimated. (Author)

  2. Availability of Electronic Resources for Service Provision in ...

    African Journals Online (AJOL)

    The study also revealed that majority of the University libraries have adequate basic infrastructure for effective electronic information services. ... acquired by the library are put into maximal use by the library clientele, thereby ensuring the achievement of the library's objective which is satisfying the users, information needs.

  3. Utilization of bio-resources by low energy electron beam

    International Nuclear Information System (INIS)

    Kume, Tamikazu

    2003-01-01

    Utilization of bio-resources by radiation has been investigated for recycling the natural resources and reducing the environmental pollution. Polysaccharides such as chitosan and sodium alginate were easily degraded by irradiation and induced various kinds of biological activities, i.g. anti-microbial activity, promotion of plant growth, suppression of heavy metal stress, phytoalexins induction. Radiation degraded chitosan was effective to enhance the growth of plants in tissue culture. It was demonstrated that the liquid sample irradiation system using low energy EB was effective for the preparation of degraded polysaccharides. Methylcellulose (MC) can be crosslinked under certain radiation condition as same as carboxymethylcellulose (CMC) and produced the biodegradable hydrogel for medical and agricultural use. Treatment of soybean seeds by low energy EB enhanced the growth and the number of rhizobia on the root. (author)

  4. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  5. Analysis of Pedagogic Potential of Electronic Educational Resources with Elements of Autodidactics

    Directory of Open Access Journals (Sweden)

    Igor A.

    2018-03-01

    Full Text Available Introduction: in recent years didactic properties of electronic educational resources undergo considerable changes, nevertheless, the question of studying of such complete phenomenon as “an electronic educational resource with autodidactics elements” remains open, despite sufficient scientific base of researches of the terms making this concept. Article purpose – determination of essence of electronic educational resources with autodidactics elements. Materials and Methods: the main method of research was the theoretical analysis of the pedagogical and psychological literature on the problem under study. We used the theoretical (analysis, synthesis, comparison and generalization methods, the method of interpretation, pedagogical modeling, and empirical methods (observation, testing, conversation, interview, analysis of students’ performance, pedagogical experiment, peer review. Results: we detected the advantages of electronic educational resources in comparison with traditional ones. The concept of autodidactics as applied to the subject of research is considered. Properties of electronic educational resources with a linear and nonlinear principle of construction are studied.The influence of the principle of construction on the development of the learners’ qualities is shown. We formulated an integral definition of electronic educational resources with elements of autodidactics, namely, the variability, adaptivity and cyclicity of training. A model of the teaching-learning process with electronic educational resources is developed. Discussion and Conclusions: further development of a problem will allow to define whether electronic educational resources with autodidactics elements pedagogical potential for realization of educational and self-educational activity of teachers have, to modify technological procedures taking into account age features of students, their specialties and features of the organization of process of training of

  6. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  7. A Study on Developing Evaluation Criteria for Electronic Resources in Evaluation Indicators of Libraries

    Science.gov (United States)

    Noh, Younghee

    2010-01-01

    This study aimed to improve the current state of electronic resource evaluation in libraries. While the use of Web DB, e-book, e-journal, and other e-resources such as CD-ROM, DVD, and micro materials is increasing in libraries, their use is not comprehensively factored into the general evaluation of libraries and may diminish the reliability of…

  8. Managing Selection for Electronic Resources: Kent State University Develops a New System to Automate Selection

    Science.gov (United States)

    Downey, Kay

    2012-01-01

    Kent State University has developed a centralized system that manages the communication and work related to the review and selection of commercially available electronic resources. It is an automated system that tracks the review process, provides selectors with price and trial information, and compiles reviewers' feedback about the resource. It…

  9. Where Do Electronic Books Fit in the College Research Arsenal of Resources?

    Science.gov (United States)

    Barbier, Patricia

    2007-01-01

    Student use of electronic books has become an accepted supplement to traditional resources. Student use and satisfaction was monitored through an online course discussion board. Increased use of electronic books indicate this service is an accepted supplement to the print book collection.

  10. The National Site Licensing of Electronic Resources: An Institutional Perspective

    Directory of Open Access Journals (Sweden)

    Xiaohua Zhu

    2011-06-01

    Full Text Available While academic libraries in most countries are struggling to negotiate with publishers and vendors individually or collaboratively via consortia, a few countries have experimented with a different model, national site licensing (NSL. Because NSL often involves government and large-scale collaboration, it has the potential to solve many problems in the complex licensing world. However, not many nations have adopted it. This study uses historical research approach and the comparative case study research method to explore the seemingly low level of adoption. The cases include the Canadian National Site Licensing Project (CNSLP, the United Kingdom’s National Electronic Site Licensing Initiative (NESLI, and the United States, which has not adopted NSL. The theoretical framework guiding the research design and data collection is W. Richard Scott’s institutional theory, which utilizes three supporting pillars—regulative, normative, and cultural-cognitive—to analyze institutional processes. In this study, the regulative pillar and the normative pillar of NSL adoption— an institutional construction and change—are examined. Data were collected from monographs, research articles, government documents, and relevant websites. Based on the analysis of these cases, a preliminary model is proposed for the adoption of NSL. The factors that support a country’s adoption of NSL include the need for new institutions, a centralized educational policy-making system and funding system, supportive political trends, and the tradition of cooperation. The factors that may prevent a country from adopting NSL include decentralized educational policy and funding, diversity and the large number of institutions, the concern for the “Big Deal,” and the concern for monopoly.

  11. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  12. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  13. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  14. A survey of the use of electronic scientific information resources among medical and dental students

    Directory of Open Access Journals (Sweden)

    Aarnio Matti

    2006-05-01

    Full Text Available Abstract Background To evaluate medical and dental students' utilization of electronic information resources. Methods A web survey sent to 837 students (49.9% responded. Results Twenty-four per cent of medical students and ninteen per cent of dental students searched MEDLINE 2+ times/month for study purposes, and thiry-two per cent and twenty-four per cent respectively for research. Full-text articles were used 2+ times/month by thirty-three per cent of medical and ten per cent of dental students. Twelve per cent of respondents never utilized either MEDLINE or full-text articles. In multivariate models, the information-searching skills among students were significantly associated with use of MEDLINE and full-text articles. Conclusion Use of electronic resources differs among students. Forty percent were non-users of full-text articles. Information-searching skills are correlated with the use of electronic resources, but the level of basic PC skills plays not a major role in using these resources. The student data shows that adequate training in information-searching skills will increase the use of electronic information resources.

  15. Analytical Study of Usage of Electronic Information Resources at Pharmacopoeial Libraries in India

    Directory of Open Access Journals (Sweden)

    Sunil Tyagi

    2014-02-01

    Full Text Available The objective of this study is to know the rate and purpose of the use of e-resource by the scientists at pharmacopoeial libraries in India. Among other things, this study examined the preferences of the scientists toward printed books and journals, electronic information resources, and pattern of using e-resources. Non-probability sampling specially accidental and purposive technique was applied in the collection of primary data through administration of user questionnaire. The sample respondents chosen for the study consists of principle scientific officer, senior scientific officer, scientific officer, and scientific assistant of different division of the laboratories, namely, research and development, pharmaceutical chemistry, pharmacovigilance, pharmacology, pharmacogonosy, and microbiology. The findings of the study reveal the personal experiences and perceptions they have had on practice and research activity using e-resource. The major findings indicate that of the total anticipated participants, 78% indicated that they perceived the ability to use computer for electronic information resources. The data analysis shows that all the scientists belonging to the pharmacopoeial libraries used electronic information resources to address issues relating to drug indexes and compendia, monographs, drugs obtained through online databases, e-journals, and the Internet sources—especially polices by regulatory agencies, contacts, drug promotional literature, and standards.

  16. Considering Point-of-Care Electronic Medical Resources in Lieu of Traditional Textbooks for Medical Education.

    Science.gov (United States)

    Hale, LaDonna S; Wallace, Michelle M; Adams, Courtney R; Kaufman, Michelle L; Snyder, Courtney L

    2015-09-01

    Selecting resources to support didactic courses is a critical decision, and the advantages and disadvantages must be carefully considered. During clinical rotations, students not only need to possess strong background knowledge but also are expected to be proficient with the same evidence-based POC resources used by clinicians. Students place high value on “real world” learning and therefore may place more value on POC resources that they know practicing clinicians use as compared with medical textbooks. The condensed nature of PA education requires students to develop background knowledge and information literacy skills over a short period. One way to build that knowledge and those skills simultaneously is to use POC resources in lieu of traditional medical textbooks during didactic training. Electronic POC resources offer several advantages over traditional textbooks and should be considered as viable options in PA education.

  17. Elektronik Bilgi Kaynaklarının Seçimi / Selection of Electronic Information Resources

    Directory of Open Access Journals (Sweden)

    Pınar Al

    2003-04-01

    Full Text Available For many years, library users have used only from the printed media in order to get the information that they have needed. Today with the widespread use of the Web and the addition of electronic information resources to library collections, the use of information in the electronic environment as well as in printed media is started to be used. In time, such types of information resources as, electronic journals, electronic books, electronic encyclopedias, electronic dictionaries and electronic theses have been added to library collections. In this study, selection criteria that can be used for electronic information resources are discussed and suggestions are provided for libraries that try to select electronic information resources for their collections.

  18. Use of electronic sales data to tailor nutrition education resources for an ethnically diverse population.

    Science.gov (United States)

    Eyles, H; Rodgers, A; Ni Mhurchu, C

    2010-02-01

    Nutrition education may be most effective when personally tailored. Individualised electronic supermarket sales data offer opportunities to tailor nutrition education using shopper's usual food purchases. The present study aimed to use individualised electronic supermarket sales data to tailor nutrition resources for an ethnically diverse population in a large supermarket intervention trial in New Zealand. Culturally appropriate nutrition education resources (i.e. messages and shopping lists) were developed with the target population (through two sets of focus groups) and ethnic researchers. A nutrient database of supermarket products was developed using retrospective sales data and linked to participant sales to allow tailoring by usual food purchases. Modified Heart Foundation Tick criteria were used to identify 'healthier' products in the database suitable for promotion in the resources. Rules were developed to create a monthly report listing the tailored and culturally targeted messages to be sent to each participant, and to produce automated, tailored shopping lists. Culturally targeted nutrition messages (n = 864) and shopping lists (n = 3 formats) were developed. The food and nutrient database (n = 3000 top-selling products) was created using 12 months of retrospective sales data, and comprised 60%'healthier' products. Three months of baseline sales data were used to determine usual food purchases. Tailored resources were successfully mailed to 123 Māori, 52 Pacific and 346 non-Māori non-Pacific participants over the 6-month trial intervention period. Electronic supermarket sales data can be used to tailor nutrition education resources for a large number of ethnically diverse supermarket shoppers.

  19. REVIEW OF MOODLE PLUGINS FOR DESIGNING MULTIMEDIA ELECTRONIC EDUCATIONAL RESOURCES FROM LANGUAGE DISCIPLINES

    Directory of Open Access Journals (Sweden)

    Anton M. Avramchuk

    2015-09-01

    Full Text Available Today the problem of designing multimedia electronic educational resources from language disciplines in Moodle is very important. This system has a lot of different, powerful resources, plugins to facilitate the learning of students with language disciplines. This article presents an overview and comparative analysis of the five Moodle plugins for designing multimedia electronic educational resources from language disciplines. There have been considered their key features and functionality in order to choose the best for studying language disciplines in the Moodle. Plugins are compared by a group of experts according to the criteria: efficiency, functionality and easy use. For a comparative analysis of the plugins it is used the analytic hierarchy process.

  20. Effects of the Use of Electronic Human Resource Management (EHRM Within Human Resource Management (HRM Functions at Universities

    Directory of Open Access Journals (Sweden)

    Chux Gervase Iwu

    2016-09-01

    Full Text Available This study set out to examine the effect of e-hrm systems in assisting human resource practitioners to execute their duties and responsibilities. In comparison to developed economies of the world, information technology adoption in sub-Saharan Africa has not been without certain glitches. Some of the factors that are responsible for these include poor need identification, sustainable funding, and insufficient skills. Besides these factors, there is also the issue of change management and users sticking to what they already know. Although, the above factors seem negative, there is strong evidence that information systems such as electronic human resource management present benefits to an organization. To achieve this, a dual research approach was utilized. Literature assisted immensely in both the development of the conceptual framework upon which the study hinged as well as in the development of the questionnaire items. The study also made use of an interview checklist to guide the participants. The findings reveal a mix of responses that indicate that while there are gains in adopting e-hrm systems, it is wiser to consider supporting resources as well as articulate the needs of the university better before any investment is made.

  1. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  2. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  3. The Electron Microscopy Outreach Program: A Web-based resource for research and education.

    Science.gov (United States)

    Sosinsky, G E; Baker, T S; Hand, G; Ellisman, M H

    1999-01-01

    We have developed a centralized World Wide Web (WWW)-based environment that serves as a resource of software tools and expertise for biological electron microscopy. A major focus is molecular electron microscopy, but the site also includes information and links on structural biology at all levels of resolution. This site serves to help integrate or link structural biology techniques in accordance with user needs. The WWW site, called the Electron Microscopy (EM) Outreach Program (URL: http://emoutreach.sdsc.edu), provides scientists with computational and educational tools for their research and edification. In particular, we have set up a centralized resource containing course notes, references, and links to image analysis and three-dimensional reconstruction software for investigators wanting to learn about EM techniques either within or outside of their fields of expertise. Copyright 1999 Academic Press.

  4. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  5. Identifying and evaluating electronic learning resources for use in adult-gerontology nurse practitioner education.

    Science.gov (United States)

    Thompson, Hilaire J; Belza, Basia; Baker, Margaret; Christianson, Phyllis; Doorenbos, Ardith; Nguyen, Huong

    2014-01-01

    Enhancing existing curricula to meet newly published adult-gerontology advanced practice registered nurse (APRN) competencies in an efficient manner presents a challenge to nurse educators. Incorporating shared, published electronic learning resources (ELRs) in existing or new courses may be appropriate in order to assist students in achieving competencies. The purposes of this project were to (a) identify relevant available ELR for use in enhancing geriatric APRN education and (b) to evaluate the educational utility of identified ELRs based on established criteria. A multilevel search strategy was used. Two independent team members reviewed identified ELR against established criteria to ensure utility. Only resources meeting all criteria were retained. Resources were found for each of the competency areas and included formats such as podcasts, Web casts, case studies, and teaching videos. In many cases, resources were identified using supplemental strategies and not through traditional search or search of existing geriatric repositories. Resources identified have been useful to advanced practice educators in improving lecture and seminar content in a particular topic area and providing students and preceptors with additional self-learning resources. Addressing sustainability within geriatric APRN education is critical for sharing of best practices among educators and for sustainability of teaching and related resources. © 2014.

  6. USE OF ELECTRONIC EDUCATIONAL RESOURCES WHEN TRAINING IN WORK WITH SPREADSHEETS

    Directory of Open Access Journals (Sweden)

    Х А Гербеков

    2017-12-01

    Full Text Available Today the tools for maintaining training courses based on opportunities of information and communication technologies are developed. Practically in all directions of preparation and on all subject matters electronic textbook and self-instruction manuals are created. Nevertheless the industry of computer educational and methodical materials actively develops and gets more and more areas of development and introduction. In this regard more and more urgent is a problem of development of the electronic educational resources adequate to modern educational requirements. Creation and the organization of training courses with use of electronic educational resources in particular on the basis of Internet technologies remains a difficult methodical task.In article the questions connected with development of electronic educational resources for use when studying the substantial line “Information technologies” of a school course of informatics in particular for studying of spreadsheets are considered. Also the analysis of maintenance of a school course and the unified state examination from the point of view of representation of task in him corresponding to the substantial line of studying “Information technologies” on mastering technology of information processing in spreadsheets and the methods of visualization given by means of charts and schedules is carried out.

  7. From Millennium ERM to Proquest 360 Resource Manager: Implementing a new Electronic Resources Management System ERMS in an International Graduate Research University in Saudi Arabia

    KAUST Repository

    Ramli, Rindra M.

    2017-01-01

    An overview of the Recommendation Study and the subsequent Implementation of a new Electronic Resources Management system ERMS in an international graduate research university in the Kingdom of Saudi Arabia. It covers the timeline, deliverables

  8. Availability, Level of Use and Constraints to Use of Electronic Resources by Law Lecturers in Public Universities in Nigeria

    Science.gov (United States)

    Amusa, Oyintola Isiaka; Atinmo, Morayo

    2016-01-01

    (Purpose) This study surveyed the level of availability, use and constraints to use of electronic resources among law lecturers in Nigeria. (Methodology) Five hundred and fifty-two law lecturers were surveyed and four hundred and forty-two responded. (Results) Data analysis revealed that the level of availability of electronic resources for the…

  9. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  10. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  11. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  12. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  13. GUIDELINES FOR EVALUATION OF PSYCHOLOGICAL AND PEDAGOGICAL QUALITY CHARACTERISTICS OF ELECTRONIC EDUCATIONAL RESOURCES

    Directory of Open Access Journals (Sweden)

    Galina P. Lavrentieva

    2014-05-01

    Full Text Available The article highlights the causes of insufficient effective use of electronic learning resources and sets out the guidelines on ways to solve the aforementioned problems. The set of didactic, methodical, psychological, pedagogical, design and ergonomic quality requirements is considered for evaluation, selection and application of information and communication technologies in the educational process. The most appropriate mechanisms for the ICT introduction into the learning process are disclosed as it should meet the specific learning needs of the student and the objectives of the educational process. The guidance for psycho-educational assessment of quality of electronic educational resources is provided. It is argued that the effectiveness of the ICT use is to be improved by means of quality evaluation mechanisms involved into the educational process.

  14. Model of e-learning with electronic educational resources of new generation

    OpenAIRE

    A. V. Loban; D. A. Lovtsov

    2017-01-01

    Purpose of the article: improving of scientific and methodical base of the theory of the е-learning of variability. Methods used: conceptual and logical modeling of the е-learning of variability process with electronic educational resource of new generation and system analysis of the interconnection of the studied subject area, methods, didactics approaches and information and communication technologies means. Results: the formalization complex model of the е-learning of variability with elec...

  15. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  16. A systematic review of portable electronic technology for health education in resource-limited settings.

    Science.gov (United States)

    McHenry, Megan S; Fischer, Lydia J; Chun, Yeona; Vreeman, Rachel C

    2017-08-01

    The objective of this study is to conduct a systematic review of the literature of how portable electronic technologies with offline functionality are perceived and used to provide health education in resource-limited settings. Three reviewers evaluated articles and performed a bibliography search to identify studies describing health education delivered by portable electronic device with offline functionality in low- or middle-income countries. Data extracted included: study population; study design and type of analysis; type of technology used; method of use; setting of technology use; impact on caregivers, patients, or overall health outcomes; and reported limitations. Searches yielded 5514 unique titles. Out of 75 critically reviewed full-text articles, 10 met inclusion criteria. Study locations included Botswana, Peru, Kenya, Thailand, Nigeria, India, Ghana, and Tanzania. Topics addressed included: development of healthcare worker training modules, clinical decision support tools, patient education tools, perceptions and usability of portable electronic technology, and comparisons of technologies and/or mobile applications. Studies primarily looked at the assessment of developed educational modules on trainee health knowledge, perceptions and usability of technology, and comparisons of technologies. Overall, studies reported positive results for portable electronic device-based health education, frequently reporting increased provider/patient knowledge, improved patient outcomes in both quality of care and management, increased provider comfort level with technology, and an environment characterized by increased levels of technology-based, informal learning situations. Negative assessments included high investment costs, lack of technical support, and fear of device theft. While the research is limited, portable electronic educational resources present promising avenues to increase access to effective health education in resource-limited settings, contingent

  17. Model of e-learning with electronic educational resources of new generation

    Directory of Open Access Journals (Sweden)

    A. V. Loban

    2017-01-01

    Full Text Available Purpose of the article: improving of scientific and methodical base of the theory of the е-learning of variability. Methods used: conceptual and logical modeling of the е-learning of variability process with electronic educational resource of new generation and system analysis of the interconnection of the studied subject area, methods, didactics approaches and information and communication technologies means. Results: the formalization complex model of the е-learning of variability with electronic educational resource of new generation is developed, conditionally decomposed into three basic components: the formalization model of the course in the form of the thesaurusclassifier (“Author of e-resource”, the model of learning as management (“Coordination. Consultation. Control”, the learning model with the thesaurus-classifier (“Student”. Model “Author of e-resource” allows the student to achieve completeness, high degree of didactic elaboration and structuring of the studied material in triples of variants: modules of education information, practical task and control tasks; the result of the student’s (author’s of e-resource activity is the thesaurus-classifier. Model of learning as management is based on the principle of personal orientation of learning in computer environment and determines the logic of interaction between the lecturer and the student when determining the triple of variants individually for each student; organization of a dialogue between the lecturer and the student for consulting purposes; personal control of the student’s success (report generation and iterative search for the concept of the class assignment in the thesaurus-classifier before acquiring the required level of training. Model “Student” makes it possible to concretize the learning tasks in relation to the personality of the student and to the training level achieved; the assumption of the lecturer about the level of training of a

  18. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  19. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  20. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  2. Review of material recovery from used electric and electronic equipment-alternative options for resource conservation.

    Science.gov (United States)

    Friege, Henning

    2012-09-01

    For waste from electric and electronic equipment, the WEEE Directive stipulates the separate collection of electric and electronic waste. As to new electric and electronic devices, the Restriction of Hazardous Substances (RoHS) Directive bans the use of certain chemicals dangerous for man and environment. From the implementation of the WEEE directive, many unsolved problems have been documented: poor collection success, emission of dangerous substances during collection and recycling, irretrievable loss of valuable metals among others. As to RoHS, data from the literature show a satisfying success. The problems identified in the process can be reduced to some basic dilemmas at the borders between waste management, product policy and chemical safety. The objectives of the WEEE Directive and the specific targets for use and recycling of appliances are not consistent. There is no focus on scarce resources. Extended producer responsibility is not sufficient to guarantee sustainable waste management. Waste management reaches its limits due to problems of implementation but also due to physical laws. A holistic approach is necessary looking at all branch points and sinks in the stream of used products and waste from electric and electronic equipment. This may be done with respect to the general rules for sustainable management of material streams covering the three dimensions of sustainable policy. The relationships between the players in the field of electric and electronic devices have to be taken into account. Most of the problems identified in the implementation process will not be solved by the current amendment of the WEEE Directive.

  3. [Use of internet and electronic resources among Spanish intensivist physicians. First national survey].

    Science.gov (United States)

    Gómez-Tello, V; Latour-Pérez, J; Añón Elizalde, J M; Palencia-Herrejón, E; Díaz-Alersi, R; De Lucas-García, N

    2006-01-01

    Estimate knowledge and use habits of different electronic resources in a sample of Spanish intensivists: Internet, E-mail, distribution lists, and use of portable electronic devices. Self-applied questionnaire. A 50-question questionnaire was distributed among Spanish intensivists through the hospital marketing delegates of a pharmaceutical company and of electronic forums. A total of 682 questionnaires were analyzed (participation: 74%). Ninety six percent of those surveyed used Internet individually: 67% admitted training gap. Internet was the second source of clinical consultations most used (61%), slightly behind consultation to colleagues (65%). The pages consulted most were bibliographic databases (65%) and electronic professional journals (63%), with limited use of Evidence Based Medicine pages (19%). Ninety percent of those surveyed used e-mail regularly in the practice of their profession, although 25% admitted that were not aware of its possibilities. The use of E-mail decreased significantly with increase in age. A total of 62% of the intensivists used distribution lists. Of the rest, 42% were not aware of its existence and 32% admitted they had insufficient training to handle them. Twenty percent of those surveyed had portable electronic devices and 64% considered it useful, basically due to its rapid consultation at bedside. Female gender was a negative predictive factor of its use (OR 0.35; 95% CI 0.2-0.63; p=0.0002). A large majority of the Spanish intensivists use Internet and E-mail. E-mail lists and use of portable devices are still underused resources. There are important gaps in training and infrequent use of essential pages. There are specific groups that require directed educational policies.

  4. The Synthesis of the Hierarchical Structure of Information Resources for Management of Electronic Commerce Entities

    Directory of Open Access Journals (Sweden)

    Krutova Anzhelika S.

    2017-06-01

    Full Text Available The aim of the article is to develop the theoretical bases for the classification and coding of economic information and the scientific justification of the content of information resources of an electronic commerce enterprise. The essence of information resources for management of electronic business entities is investigated. It is proved that the organization of accounting in e-commerce systems is advisable to be built on the basis of two circuits: accounting for financial flows and accounting associated with transformation of business factors in products and services as a result of production activities. There presented a sequence of accounting organization that allows to combine the both circuits in a single information system, which provides a possibility for the integrated replenishment and distributed simultaneous use of the e-commerce system by all groups of users. It is proved that the guarantee of efficient activity of the information management system of electronic commerce entities is a proper systematization of the aggregate of information resources on economic facts and operations of an enterprise in accordance with the management tasks by building the hierarchy of accounting nomenclatures. It is suggested to understand nomenclature as an objective, primary information aggregate concerning a certain fact of the economic activity of an enterprise, which is characterized by minimum requisites, is entered into the database of the information system and is to be reflected in the accounting system. It is proposed to build a database of e-commerce systems as a part of directories (constants, personnel, goods / products, suppliers, buyers and the hierarchy of accounting nomenclatures. The package of documents regulating the organization of accounting at an enterprise should include: the provision on the accounting services, the order on the accounting policy, the job descriptions, the schedules of information exchange, the report card and

  5. ELECTRONIC EDUCATIONAL RESOURCES FOR ONLINE SUPPORT OF MODERN CHEMISTRY CLASSES IN SPECIALIZED SCHOOL

    Directory of Open Access Journals (Sweden)

    Maria D. Tukalo

    2013-09-01

    Full Text Available This article contains material of some modern electronic educational resources that can be used via the Internet to support the modern chemistry classes in specialized school. It was drawn attention to the educational chemical experiments as means of knowledge; simulated key motivational characteristics to enhance students interest for learning subjects, their cognitive and practical activity in the formation of self-reliance and self-creative; commented forecasts for creating of conditions to enhance the creative potential of students in a modern learning environment.

  6. THE MODEL OF LINGUISTIC TEACHERS’ COMPETENCY DEVELOPMENT ON DESIGNING MULTIMEDIA ELECTRONIC EDUCATIONAL RESOURCES IN THE MOODLE SYSTEM

    Directory of Open Access Journals (Sweden)

    Anton M. Avramchuk

    2017-10-01

    Full Text Available The article is devoted to the problem of developing the competency of teachers of language disciplines on designing multimedia electronic educational resources in the Moodle system. The concept of "the competence of teachers of language disciplines on designing multimedia electronic educational resources in the Moodle system" is justified and defined. Identified and characterized the components by which the levels of the competency development of teachers of language disciplines on designing multimedia electronic educational resources in the Moodle system should be assessed. Developed a model for the development of the competency of teachers of language disciplines on designing multimedia electronic educational resources in the Moodle system, which is based on the main scientific approaches, used in adult education, and consists of five blocks: target, informative, technological, diagnostic and effective.

  7. A preliminary categorization of end-of-life electrical and electronic equipment as secondary metal resources

    International Nuclear Information System (INIS)

    Oguchi, Masahiro; Murakami, Shinsuke; Sakanakura, Hirofumi; Kida, Akiko; Kameya, Takashi

    2011-01-01

    Highlights: → End-of-life electrical and electronic equipment (EEE) as secondary metal resources. → The content and the total amount of metals in specific equipment are both important. → We categorized 21 EEE types from contents and total amounts of various metals. → Important equipment types as secondary resources were listed for each metal kind. → Collectability and possible collection systems of various EEE types were discussed. - Abstract: End-of-life electrical and electronic equipment (EEE) has recently received attention as a secondary source of metals. This study examined characteristics of end-of-life EEE as secondary metal resources to consider efficient collection and metal recovery systems according to the specific metals and types of EEE. We constructed an analogy between natural resource development and metal recovery from end-of-life EEE and found that metal content and total annual amount of metal contained in each type of end-of-life EEE should be considered in secondary resource development, as well as the collectability of the end-of-life products. We then categorized 21 EEE types into five groups and discussed their potential as secondary metal resources. Refrigerators, washing machines, air conditioners, and CRT TVs were evaluated as the most important sources of common metals, and personal computers, mobile phones, and video games were evaluated as the most important sources of precious metals. Several types of small digital equipment were also identified as important sources of precious metals; however, mid-size information and communication technology (ICT) equipment (e.g., printers and fax machines) and audio/video equipment were shown to be more important as a source of a variety of less common metals. The physical collectability of each type of EEE was roughly characterized by unit size and number of end-of-life products generated annually. Current collection systems in Japan were examined and potentially appropriate collection

  8. Open-Source Electronic Health Record Systems for Low-Resource Settings: Systematic Review.

    Science.gov (United States)

    Syzdykova, Assel; Malta, André; Zolfo, Maria; Diro, Ermias; Oliveira, José Luis

    2017-11-13

    Despite the great impact of information and communication technologies on clinical practice and on the quality of health services, this trend has been almost exclusive to developed countries, whereas countries with poor resources suffer from many economic and social issues that have hindered the real benefits of electronic health (eHealth) tools. As a component of eHealth systems, electronic health records (EHRs) play a fundamental role in patient management and effective medical care services. Thus, the adoption of EHRs in regions with a lack of infrastructure, untrained staff, and ill-equipped health care providers is an important task. However, the main barrier to adopting EHR software in low- and middle-income countries is the cost of its purchase and maintenance, which highlights the open-source approach as a good solution for these underserved areas. The aim of this study was to conduct a systematic review of open-source EHR systems based on the requirements and limitations of low-resource settings. First, we reviewed existing literature on the comparison of available open-source solutions. In close collaboration with the University of Gondar Hospital, Ethiopia, we identified common limitations in poor resource environments and also the main requirements that EHRs should support. Then, we extensively evaluated the current open-source EHR solutions, discussing their strengths and weaknesses, and their appropriateness to fulfill a predefined set of features relevant for low-resource settings. The evaluation methodology allowed assessment of several key aspects of available solutions that are as follows: (1) integrated applications, (2) configurable reports, (3) custom reports, (4) custom forms, (5) interoperability, (6) coding systems, (7) authentication methods, (8) patient portal, (9) access control model, (10) cryptographic features, (11) flexible data model, (12) offline support, (13) native client, (14) Web client,(15) other clients, (16) code

  9. THE MODEL OF LINGUISTIC TEACHERS’ COMPETENCY DEVELOPMENT ON DESIGNING MULTIMEDIA ELECTRONIC EDUCATIONAL RESOURCES IN THE MOODLE SYSTEM

    OpenAIRE

    Anton M. Avramchuk

    2017-01-01

    The article is devoted to the problem of developing the competency of teachers of language disciplines on designing multimedia electronic educational resources in the Moodle system. The concept of "the competence of teachers of language disciplines on designing multimedia electronic educational resources in the Moodle system" is justified and defined. Identified and characterized the components by which the levels of the competency development of teachers of language disciplines on designing ...

  10. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  11. Determining the level of awareness of the physicians in using the variety of electronic information resources and the effecting factors.

    Science.gov (United States)

    Papi, Ahmad; Ghazavi, Roghayeh; Moradi, Salimeh

    2015-01-01

    Understanding of the medical society's from the types of information resources for quick and easy access to information is an imperative task in medical researches and management of the treatment. The present study was aimed to determine the level of awareness of the physicians in using various electronic information resources and the factors affecting it. This study was a descriptive survey. The data collection tool was a researcher-made questionnaire. The study population included all the physicians and specialty physicians of the teaching hospitals affiliated to Isfahan University of Medical Sciences and numbered 350. The sample size based on Morgan's formula was set at 180. The content validity of the tool was confirmed by the library and information professionals and the reliability was 95%. Descriptive statistics were used including the SPSS software version 19. On reviewing the need of the physicians to obtain the information on several occasions, the need for information in conducting the researches was reported by the maximum number of physicians (91.9%) and the usage of information resources, especially the electronic resources, formed 65.4% as the highest rate with regard to meeting the information needs of the physicians. Among the electronic information databases, the maximum awareness was related to Medline with 86.5%. Among the various electronic information resources, the highest awareness (43.3%) was related to the E-journals. The highest usage (36%) was also from the same source. The studied physicians considered the most effective deterrent in the use of electronic information resources as being too busy and lack of time. Despite the importance of electronic information resources for the physician's community, there was no comprehensive knowledge of these resources. This can lead to less usage of these resources. Therefore, careful planning is necessary in the hospital libraries in order to introduce the facilities and full capabilities of the

  12. Success criteria for electronic medical record implementations in low-resource settings: a systematic review.

    Science.gov (United States)

    Fritz, Fleur; Tilahun, Binyam; Dugas, Martin

    2015-03-01

    Electronic medical record (EMR) systems have the potential of supporting clinical work by providing the right information at the right time to the right people and thus make efficient use of resources. This is especially important in low-resource settings where reliable data are also needed to support public health and local supporting organizations. In this systematic literature review, our objectives are to identify and collect literature about success criteria of EMR implementations in low-resource settings and to summarize them into recommendations. Our search strategy relied on PubMed queries and manual bibliography reviews. Studies were included if EMR implementations in low-resource settings were described. The extracted success criteria and measurements were summarized into 7 categories: ethical, financial, functionality, organizational, political, technical, and training. We collected 381 success criteria with 229 measurements from 47 articles out of 223 articles. Most papers were evaluations or lessons learned from African countries, published from 1999 to 2013. Almost half of the EMR systems served a specific disease area like human immunodeficiency virus (HIV). The majority of criteria that were reported dealt with the functionality, followed by organizational issues, and technical infrastructures. Sufficient training and skilled personnel were mentioned in roughly 10%. Political, ethical, and financial considerations did not play a predominant role. More evaluations based on reliable frameworks are needed. Highly reliable data handling methods, human resources and effective project management, as well as technical architecture and infrastructure are all key factors for successful EMR implementation. © The Author 2015. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Impact of Knowledge Resources Linked to an Electronic Health Record on Frequency of Unnecessary Tests and Treatments

    Science.gov (United States)

    Goodman, Kenneth; Grad, Roland; Pluye, Pierre; Nowacki, Amy; Hickner, John

    2012-01-01

    Introduction: Electronic knowledge resources have the potential to rapidly provide answers to clinicians' questions. We sought to determine clinicians' reasons for searching these resources, the rate of finding relevant information, and the perceived clinical impact of the information they retrieved. Methods: We asked general internists, family…

  14. Resource conservation approached with an appropriate collection and upgrade-remanufacturing for used electronic products.

    Science.gov (United States)

    Zlamparet, Gabriel I; Tan, Quanyin; Stevels, A B; Li, Jinhui

    2018-03-01

    This comparative research represents an example for a better conservation of resources by reducing the amount of waste (kg) and providing it more value under the umbrella of remanufacturing. The three discussed cases will expose three issues already addressed separately in the literature. The generation of waste electrical and electronic equipment (WEEE) interacts with the environmental depletion. In this article, we gave the examples of addressed issues under the concept of remanufacturing. Online collection opportunity eliminating classical collection, a business to business (B2B) implementation for remanufactured servers and medical devices. The material reuse (recycling), component sustainability, reuse (part harvesting), product reuse (after repair/remanufacturing) indicates the recovery potential using remanufacturing tool for a better conservation of resources adding more value to the products. Our findings can provide an overview of new system organization for the general collection, market potential and the technological advantages using remanufacturing instead of recycling of WEEE or used electrical and electronic equipment. Copyright © 2017. Published by Elsevier Ltd.

  15. Electronic theses and dissertations: a review of this valuable resource for nurse scholars worldwide.

    Science.gov (United States)

    Goodfellow, L M

    2009-06-01

    A worldwide repository of electronic theses and dissertations (ETDs) could provide worldwide access to the most up-to-date research generated by masters and doctoral students. Until that international repository is established, it is possible to access some of these valuable knowledge resources. ETDs provide a technologically advanced medium with endless multimedia capabilities that far exceed the print and bound copies of theses and dissertations housed traditionally in individual university libraries. CURRENT USE: A growing trend exists for universities worldwide to require graduate students to submit theses or dissertations as electronic documents. However, nurse scholars underutilize ETDs, as evidenced by perusing bibliographic citation lists in many of the research journals. ETDs can be searched for and retrieved through several digital resources such as the Networked Digital Library of Theses and Dissertations (http://www.ndltd.org), ProQuest Dissertations and Theses (http://www.umi.com), the Australasian Digital Theses Program (http://adt.caul.edu.au/) and through individual university web sites and online catalogues. An international repository of ETDs benefits the community of nurse scholars in many ways. The ability to access recent graduate students' research electronically from anywhere in the world is advantageous. For scholars residing in developing countries, access to these ETDs may prove to be even more valuable. In some cases, ETDs are not available for worldwide access and can only be accessed through the university library from which the student graduated. Public access to university library ETD collections is not always permitted. Nurse scholars from both developing and developed countries could benefit from ETDs.

  16. An EPR Primer

    Indian Academy of Sciences (India)

    IAS Admin

    nique is applicable to the studies of systems of interest in physics, ... Physics,. Indian Institute of Science, ... experiment, the electron causes a shift (chemical shift) of the .... of supercooled water in liquid polymorphism, Book Series: Advances in.

  17. From Millennium ERM to Proquest 360 Resource Manager: Implementing a new Electronic Resources Management System ERMS in an International Graduate Research University in Saudi Arabia

    KAUST Repository

    Ramli, Rindra M.

    2017-05-17

    An overview of the Recommendation Study and the subsequent Implementation of a new Electronic Resources Management system ERMS in an international graduate research university in the Kingdom of Saudi Arabia. It covers the timeline, deliverables and challenges as well as lessons learnt by the Project Team.

  18. Electronic tracking of human resource skills and knowledge, just in time training, manageable due diligence

    Energy Technology Data Exchange (ETDEWEB)

    Kolodziej, M.A. [Quick Test International Inc., (Canada). Canadian Technology Human Resource Board; Baker, O. [KeySpan Energy Canada, Calgary, AB (Canada)

    2001-06-01

    KeySpan Energy Canada is in the process of obtaining recognition of various occupational profiles including pipeline operators, inspectors, and field and plant operators from various certifying organizations. The process of allowing individuals to obtain certification is recognized by Canadian Technology Human Resources Board as a step towards national standards for technologists and technicians. Proven competency is a must for workers in todays oil industry in response to increasingly stringent government safety regulations, environmental concerns and high public scrutiny. Quick Test international Inc. has developed a management tool in collaboration with end users at KeySpan Energy Canada. It is an electronic, Internet based competency tool for tracking personal competencies and maintaining continued competency. Response to the tool has been favourable. 2 refs., 4 figs.

  19. Blockchain: A Graph Primer

    OpenAIRE

    Akcora, Cuneyt Gurcan; Gel, Yulia R.; Kantarcioglu, Murat

    2017-01-01

    Bitcoin and its underlying technology Blockchain have become popular in recent years. Designed to facilitate a secure distributed platform without central authorities, Blockchain is heralded as a paradigm that will be as powerful as Big Data, Cloud Computing and Machine learning. Blockchain incorporates novel ideas from various fields such as public key encryption and distributed systems. As such, a reader often comes across resources that explain the Blockchain technology from a certain pers...

  20. Availability, Use and Constraints to Use of Electronic Information Resources by Postgraduates Students at the University of Ibadan

    Directory of Open Access Journals (Sweden)

    Dare Samuel Adeleke

    2017-12-01

    Full Text Available Availability, awareness and use of electronic resources provide access to authoritative, reliable, accurate and timely access to information. The use of electronic information resources (EIRs can enable innovation in teaching and increase timeliness in research of postgraduate students which will eventual result into encouragement of the expected research-led enquiry in this digital age. The study adopted a descriptive survey design. Samples of 300 of postgraduate students within seven out 13 Faculties were randomly selected. Data were collected using questionnaire designed to elicit response from respondents and data were analyzed using descriptive statistics methods percentages, mean, and standard deviation. Results indicated that internet was ranked most available and used in the university. Low level of usage of electronic resources, in particular, full texts data bases is linked to a number of constraints: Interrupted power supply was ranked highest among other factors as speed and capacity of computers, retrieval of records with high recall and low precision, retrieving records relevant to information need, lack of knowledge of search techniques to retrieve information effectively, non possession of requisite IT skills and problems accessing the internet. The study recommended that usage of electronic resources be made compulsory, intensifying awareness campaigns concerning the availability, training on use of electronic resources and the problem of power outage be addressed.

  1. Using mobile electronic devices to deliver educational resources in developing countries.

    Science.gov (United States)

    Mazal, Jonathan Robert; Ludwig, Rebecca

    2015-01-01

    Developing countries have far fewer trained radiography professionals than developed countries, which exacerbates the limited access to imaging services. The lack of trained radiographers reflects, in part, limited availability of radiographer-specific educational resources. Historically, organizations that provided such resources in the developing world faced challenges related to the limited stock of current materials as well as expenses associated with shipping and delivery. Four mobile electronic devices (MEDs) were loaded with educational content (e-books, PDFs, and digital applications) spanning major radiography topics. The MEDs were distributed to 4 imaging departments in Ghana, India, Nepal, and Nigeria based on evidence of need for radiography-specific resources, as revealed by survey responses. A cost comparison of postal delivery vs digital delivery of educational content was performed. The effectiveness of delivering additional content via Wi-Fi transmission also was evaluated. Feedback was solicited on users' experience with the MEDs as a delivery tool for educational content. An initial average per e-book expense of $30.05, which included the cost of the device, was calculated for the MED delivery method compared with $15.56 for postal delivery of printed materials. The cost of the MED delivery method was reduced to an average of $10.05 for subsequent e-book deliveries. Additional content was successfully delivered via Wi-Fi transmission to all recipients during the 3-month follow-up period. Overall user feedback on the experience was positive, and ideas for enhancing the MED-based method were identified. Using MEDs to deliver radiography-specific educational content appears to be more cost effective than postal delivery of printed materials on a long-term basis. MEDs are more efficient for providing updates to educational materials. Customization of content to department needs, and using projector devices could enhance the usefulness of MEDs for

  2. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  3. The electronic encapsulation of knowledge in hydraulics, hydrology and water resources

    Science.gov (United States)

    Abbott, Michael B.

    The rapidly developing practice of encapsulating knowledge in electronic media is shown to lead necessarily to the restructuring of the knowledge itself. The consequences of this for hydraulics, hydrology and more general water-resources management are investigated in particular relation to current process-simulation, real-time control and advice-serving systems. The generic properties of the electronic knowledge encapsulator are described, and attention is drawn to the manner in which knowledge 'goes into hiding' through encapsulation. This property is traced in the simple situations of pure mathesis and in the more complex situations of taxinomia using one example each from hydraulics and hydrology. The consequences for systems architectures are explained, pointing to the need for multi-agent architectures for ecological modelling and for more general hydroinformatics systems also. The relevance of these developments is indicated by reference to ongoing projects in which they are currently being realised. In conclusion, some more general epistemological aspects are considered within the same context. As this contribution is so much concerned with the processes of signification and communication, it has been partly shaped by the theory of semiotics, as popularised by Eco ( A Theory of Semiotics, Indiana University, Bloomington, 1977).

  4. Plastics disassembly versus bulk recycling: engineering design for end-of-life electronics resource recovery.

    Science.gov (United States)

    Rios, Pedro; Stuart, Julie Ann; Grant, Ed

    2003-12-01

    Annual plastic flows through the business and consumer electronics manufacturing supply chain include nearly 3 billion lb of high-value engineering plastics derived from petroleum. The recovery of resource value from this stream presents critical challenges in areas of materials identification and recycling process design that demand new green engineering technologies applied together with life cycle assessment and ecological supply chain analysis to create viable plastics-to-plastics supply cycles. The sustainable recovery of potentially high-value engineering plastics streams requires that recyclers either avoid mixing plastic parts or purify later by separating smaller plastic pieces created in volume reduction (shredding) steps. Identification and separation constitute significant barriers in the plastics-to-plastics recycling value proposition. In the present work, we develop a model that accepts randomly arriving electronic products to study scenarios by which a recycler might identify and separate high-value engineering plastics as well as metals. Using discrete eventsimulation,we compare current mixed plastics recovery with spectrochemical plastic resin identification and subsequent sorting. Our results show that limited disassembly with whole-part identification can produce substantial yields in separated streams of recovered engineering thermoplastics. We find that disassembly with identification does not constitute a bottleneck, but rather, with relatively few workers, can be configured to pull the process and thus decrease maximum staging space requirements.

  5. Information Operations Primer

    Science.gov (United States)

    2008-11-01

    Nomination/Assignment/Allotment. • Electronic Warfare (EW) deconfliction via Joint Restricted Frequency List (JRFL) creation and analysis. • JRFL...restricted frequency list . The objectives of defensive IO include the following: 111 ■ Sustain the MAGTF commander‘s freedom of action...estimates and are also applied during the analysis and selection of friendly courses of action. (JP 1-02) Joint restricted frequency list (JRFL) A

  6. SAGES: a suite of freely-available software tools for electronic disease surveillance in resource-limited settings.

    Directory of Open Access Journals (Sweden)

    Sheri L Lewis

    Full Text Available Public health surveillance is undergoing a revolution driven by advances in the field of information technology. Many countries have experienced vast improvements in the collection, ingestion, analysis, visualization, and dissemination of public health data. Resource-limited countries have lagged behind due to challenges in information technology infrastructure, public health resources, and the costs of proprietary software. The Suite for Automated Global Electronic bioSurveillance (SAGES is a collection of modular, flexible, freely-available software tools for electronic disease surveillance in resource-limited settings. One or more SAGES tools may be used in concert with existing surveillance applications or the SAGES tools may be used en masse for an end-to-end biosurveillance capability. This flexibility allows for the development of an inexpensive, customized, and sustainable disease surveillance system. The ability to rapidly assess anomalous disease activity may lead to more efficient use of limited resources and better compliance with World Health Organization International Health Regulations.

  7. Primer printed circuit boards

    CERN Document Server

    Argyle, Andrew

    2009-01-01

    Step-by-step instructions for making your own PCBs at home. Making your own printed circuit board (PCB) might seem a daunting task, but once you master the steps, it's easy to attain professional-looking results. Printed circuit boards, which connect chips and other components, are what make almost all modern electronic devices possible. PCBs are made from sheets of fiberglass clad with copper, usually in multiplelayers. Cut a computer motherboard in two, for instance, and you'll often see five or more differently patterned layers. Making boards at home is relatively easy

  8. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  9. Electronic Human Resources Management (e-HRM Adoption Studies: Past and Future Research

    Directory of Open Access Journals (Sweden)

    Winarto Winarto

    2018-05-01

    Full Text Available Electronic human resource management (e-HRM systems become more widely used by profit and non-profit organization. However, the field currently lacks sound theoretical frameworks that can be useful in addressing a key issue concerning the implementation of e-HRM systems, in particular to obtain a better understanding of the factors influencing the adoption of e-HRM systems. The objective of this paper is to provide a foundation towards the development of a theoretical framework for the implementation of e-HRM systems and develop a conceptual model that would reflect the nature of e-HRM systems’ adoption through systematic literature review. Adopting Crossan and Apaydin’s procedure of systematic review, this paper investigated 21 empirical papers of electronics human resources management, then categorized them into 4 characteristics which influence the adoption; System and technology characteristics; Organizational characteristics; User/individual characteristics, and Environmental and contextual characteristics. Finally, the e-HRM adoption research framework is drawn and based on the framework; avenues for future research are discussed.   Bahasa Indonesia Abstrak: Manajemen sumber daya manusia elektronik (selanjutnya disebut dengan e-HRM semakin banyak digunakan oleh organisasi profit dan nonprofit. Namun, bidang dan topik ini belum memiliki kerangka teori yang mapan, yang dapat digunakan untuk menganalisis isu-isu terkait penerapan e-HRM, terutama mengenai faktor-faktor yang mempengaruhi adopsi sistem e-HRM. Tujuan penelitian ini adalah untuk memberikan landasan bagi pengembangan kerangka teoritis untuk implementasi sistem e-HRM dan mengembangkan model konseptual yang akan menggambarkan adopsi sistem e-HRM melalui tinjauan literatur sistematis. Mengadopsi prosedur dan metode Crossan dan Apaydin untuk melakukan telaah literatur secara sistematis, paper ini menyelidiki 21 publikasi empiris manajemen sumber daya manusia elektronik dari 2

  10. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  11. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  12. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  13. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  14. Impact of Electronic Resources and Usage in Academic Libraries in Ghana: Evidence from Koforidua Polytechnic & All Nations University College, Ghana

    Science.gov (United States)

    Akussah, Maxwell; Asante, Edward; Adu-Sarkodee, Rosemary

    2015-01-01

    The study investigates the relationship between impact of electronic resources and its usage in academic libraries in Ghana: evidence from Koforidua Polytechnic & All Nations University College, Ghana. The study was a quantitative approach using questionnaire to gather data and information. A valid response rate of 58.5% was assumed. SPSS…

  15. Utilization of Electronic Information Resources by Undergraduate Students of University of Ibadan: A Case Study of Social Sciences and Education

    Science.gov (United States)

    Owolabi, Sola; Idowu, Oluwafemi A.; Okocha, Foluke; Ogundare, Atinuke Omotayo

    2016-01-01

    The study evaluated utilization of electronic information resources by undergraduates in the Faculties of Education and the Social Sciences in University of Ibadan. The study adopted a descriptive survey design with a study population of 1872 undergraduates in the Faculties of Education and the Social Sciences in University of Ibadan, from which a…

  16. Systematic review of electronic surveillance of infectious diseases with emphasis on antimicrobial resistance surveillance in resource-limited settings.

    Science.gov (United States)

    Rattanaumpawan, Pinyo; Boonyasiri, Adhiratha; Vong, Sirenda; Thamlikitkul, Visanu

    2018-02-01

    Electronic surveillance of infectious diseases involves rapidly collecting, collating, and analyzing vast amounts of data from interrelated multiple databases. Although many developed countries have invested in electronic surveillance for infectious diseases, the system still presents a challenge for resource-limited health care settings. We conducted a systematic review by performing a comprehensive literature search on MEDLINE (January 2000-December 2015) to identify studies relevant to electronic surveillance of infectious diseases. Study characteristics and results were extracted and systematically reviewed by 3 infectious disease physicians. A total of 110 studies were included. Most surveillance systems were developed and implemented in high-income countries; less than one-quarter were conducted in low-or middle-income countries. Information technologies can be used to facilitate the process of obtaining laboratory, clinical, and pharmacologic data for the surveillance of infectious diseases, including antimicrobial resistance (AMR) infections. These novel systems require greater resources; however, we found that using electronic surveillance systems could result in shorter times to detect targeted infectious diseases and improvement of data collection. This study highlights a lack of resources in areas where an effective, rapid surveillance system is most needed. The availability of information technology for the electronic surveillance of infectious diseases, including AMR infections, will facilitate the prevention and containment of such emerging infectious diseases. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  17. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  18. The Use of Electronic Resources by Academic Staff at the University of Ilorin, Nigeria

    Science.gov (United States)

    Tella, Adeyinka; Orim, Faith; Ibrahim, Dauda Morenikeji; Memudu, Suleiman Ajala

    2018-01-01

    The use of e-resources is now commonplace among academics in tertiary educational institutions the world over. Many academics including those in the universities are exploring the opportunities of e-resources to facilitate teaching and research. As the use of e-resources is increasing particularly among academics at the University of Ilorin,…

  19. Modeling antecedents of electronic medical record system implementation success in low-resource setting hospitals.

    Science.gov (United States)

    Tilahun, Binyam; Fritz, Fleur

    2015-08-01

    With the increasing implementation of Electronic Medical Record Systems (EMR) in developing countries, there is a growing need to identify antecedents of EMR success to measure and predict the level of adoption before costly implementation. However, less evidence is available about EMR success in the context of low-resource setting implementations. Therefore, this study aims to fill this gap by examining the constructs and relationships of the widely used DeLone and MacLean (D&M) information system success model to determine whether it can be applied to measure EMR success in those settings. A quantitative cross sectional study design using self-administered questionnaires was used to collect data from 384 health professionals working in five governmental hospitals in Ethiopia. The hospitals use a comprehensive EMR system since three years. Descriptive and structural equation modeling methods were applied to describe and validate the extent of relationship of constructs and mediating effects. The findings of the structural equation modeling shows that system quality has significant influence on EMR use (β = 0.32, P quality has significant influence on EMR use (β = 0.44, P service quality has strong significant influence on EMR use (β = 0.36, P effect of EMR use on user satisfaction was not significant. Both EMR use and user satisfaction have significant influence on perceived net-benefit (β = 0.31, P mediating factor in the relationship between service quality and EMR use (P effect on perceived net-benefit of health professionals. EMR implementers and managers in developing countries are in urgent need of implementation models to design proper implementation strategies. In this study, the constructs and relationships depicted in the updated D&M model were found to be applicable to assess the success of EMR in low resource settings. Additionally, computer literacy was found to be a mediating factor in EMR use and user satisfaction of

  20. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  1. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  2. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  3. Use and Cost of Electronic Resources in Central Library of Ferdowsi University Based on E-metrics

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Davarpanah

    2012-07-01

    Full Text Available The purpose of this study was to investigate the usage of electronic journals in Ferdowsi University, Iran based on e-metrics. The paper also aimed to emphasize the analysis of cost-benefit and the correlation between the journal impact factors and the usage data. In this study experiences of Ferdowsi University library on licensing and usage of electronic resources was evaluated by providing a cost-benefit analysis based on the cost and usage statistics of electronic resources. Vendor-provided data were also compared with local usage data. The usage data were collected by tracking web-based access locally, and by collecting vender-provided usage data. The data sources were one-year of vendor-supplied e-resource usage data such as Ebsco, Elsevier, Proquest, Emerald, Oxford and Springer and local usage data collected from the Ferdowsi university web server. The study found that actual usage values differ for vendor-provided data and local usage data. Elsevier has got the highest usage degree in searches, sessions and downloads. Statistics also showed that a small number of journals satisfy significant amount of use while the majority of journals were used less frequent and some were never used at all. The users preferred the PDF rather than HTML format. The data in subject profile suggested that the provided e-resources were best suited to certain subjects. There was no correlation between IF and electronic journal use. Monitoring the usage of e-resources gained increasing importance for acquisition policy and budget decisions. The article provided information about local metrics for the six surveyed vendors/publishers, e.g. usage trends, requests per package, cost per use as related to the scientific specialty of the university.

  4. Use and User Perception of Electronic Information Resources: A Case Study of Siva Institute of Frontier Technology, India

    Directory of Open Access Journals (Sweden)

    Velmurugan Chandran

    2013-12-01

    Full Text Available The present study aims to explore the use and user perception of electronic resources in Siva Institute of Frontier Technology, India. A total number of 123 users were taken into account for the study through a questionnaire-based survey method. A well-structured questionnaire was designed and distributed to the selected 200 students and staff members. 123 copies of the questionnaires were returned dully filled in and the overall response rate was 61.50 percent. The questionnaire contained both open- and close-ended questions. The collected data were classified, analyzed, and tabulated by using simple statistical methods. This study covers the impact of electronic resources on students and faculty in their academic pursuit.

  5. Challenges in the implementation of an electronic surveillance system in a resource-limited setting: Alerta, in Peru

    Directory of Open Access Journals (Sweden)

    Soto Giselle

    2008-11-01

    Full Text Available Abstract Background Infectious disease surveillance is a primary public health function in resource-limited settings. In 2003, an electronic disease surveillance system (Alerta was established in the Peruvian Navy with support from the U.S. Naval Medical Research Center Detachment (NMRCD. Many challenges arose during the implementation process, and a variety of solutions were applied. The purpose of this paper is to identify and discuss these issues. Methods This is a retrospective description of the Alerta implementation. After a thoughtful evaluation according to the Centers for Disease Control and Prevention (CDC guidelines, the main challenges to implementation were identified and solutions were devised in the context of a resource-limited setting, Peru. Results After four years of operation, we have identified a number of challenges in implementing and operating this electronic disease surveillance system. These can be divided into the following categories: (1 issues with personnel and stakeholders; (2 issues with resources in a developing setting; (3 issues with processes involved in the collection of data and operation of the system; and (4 issues with organization at the central hub. Some of the challenges are unique to resource-limited settings, but many are applicable for any surveillance system. For each of these challenges, we developed feasible solutions that are discussed. Conclusion There are many challenges to overcome when implementing an electronic disease surveillance system, not only related to technology issues. A comprehensive approach is required for success, including: technical support, personnel management, effective training, and cultural sensitivity in order to assure the effective deployment of an electronic disease surveillance system.

  6. RESEARCH OF INFLUENCE OF QUALITY OF ELECTRONIC EDUCATIONAL RESOURCES ON QUALITY OF TRAINING WITH USE OF DISTANCE TECHNOLOGIES

    Directory of Open Access Journals (Sweden)

    H. M. Kravtsov

    2013-03-01

    Full Text Available Communication improving of educational processes requires today new approaches to the management arrangements and forming of educational policy in the field of distance learning, which is based on the use of modern information and communication technologies. An important step in this process is the continuous monitoring of the development and implementation of information technology and, in particular, the distance learning systems in higher educational establishments. The main objective of the monitoring is the impact assessment on the development of distance learning following the state educational standards, curricula, methodical and technical equipment and other factors; factors revelation that influence the implementation and outcomes of distance learning; results comparison of educational institution functioning and distance education systems in order to determine the most efficient ways of its development. The paper presents the analysis results of the dependence of the quality of educational services on the electronic educational resources. Trends in educational services development was studied by comparing the quality influence of electronic educational resources on the quality of educational services of higher pedagogical educational institutions of Ukraine as of 2009-2010 and 2012-2013. Generally, the analysis of the survey results allows evaluating quality of the modern education services as satisfactory and it can be said that almost 70% of the success of their future development depends on the quality of the used electronic educational resources and distance learning systems in particular.

  7. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  8. Tracking the Flow of Resources in Electronic Waste - The Case of End-of-Life Computer Hard Disk Drives.

    Science.gov (United States)

    Habib, Komal; Parajuly, Keshav; Wenzel, Henrik

    2015-10-20

    Recovery of resources, in particular, metals, from waste flows is widely seen as a prioritized option to reduce their potential supply constraints in the future. The current waste electrical and electronic equipment (WEEE) treatment system is more focused on bulk metals, where the recycling rate of specialty metals, such as rare earths, is negligible compared to their increasing use in modern products, such as electronics. This study investigates the challenges in recovering these resources in the existing WEEE treatment system. It is illustrated by following the material flows of resources in a conventional WEEE treatment plant in Denmark. Computer hard disk drives (HDDs) containing neodymium-iron-boron (NdFeB) magnets were selected as the case product for this experiment. The resulting output fractions were tracked until their final treatment in order to estimate the recovery potential of rare earth elements (REEs) and other resources contained in HDDs. The results further show that out of the 244 kg of HDDs treated, 212 kg comprising mainly of aluminum and steel can be finally recovered from the metallurgic process. The results further demonstrate the complete loss of REEs in the existing shredding-based WEEE treatment processes. Dismantling and separate processing of NdFeB magnets from their end-use products can be a more preferred option over shredding. However, it remains a technological and logistic challenge for the existing system.

  9. HELP (INFORMATION ELECTRONIC RESOURCE "CHRONICLE OF ONU: DATES, FACTS, EVENTS": HISTORY OF UNIVERSITY IN INFORMATION SPACE

    Directory of Open Access Journals (Sweden)

    А. М. Гавриленко

    2016-03-01

    Object of research is the help information resource "The chronicle of the Odessa national university of I. I. Mechnikov: dates, facts, events". The main objective of our article – to state the main methodological bases of creation of information resource. One of advantages of information resource is possibility of continuous updating and replenishment by new information. Main objective of creation of this information resource is systematization of material on stories of the Odessa national university of I. I. Mechnikov from the date of his basis to the present, ensuring interactive access to information on the main dates, the most significant events in life of university. The base of research are sources on the history of university, chronology of historical development, formation of infrastructure, cadres and scientific researches. In information resource the main stages of development, functioning and transformation of the Odessa University are analyzed, information on its divisions is collected. For creation of this information resource in Scientific library the method of work was developed, the main selection criteria of data are allocated. This information resource have practical value for all who is interested in history of university, historians, scientists-researchers of history of science and the city of Odessa.

  10. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  11. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  12. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  13. Print and Electronic Resources: Usage Statistics at Guru Gobind Singh Indraprastha University Library

    Science.gov (United States)

    Kapoor, Kanta

    2010-01-01

    Purpose: The purpose of this paper is to quantify the use of electronic journals in comparison with the print collections in the Guru Gobind Singh Indraprastha University Library. Design/methodology/approach: A detailed analysis was made of the use of lending services, the Xerox facility and usage of electronic journals such as Science Direct,…

  14. Understanding intention to use electronic information resources: A theoretical extension of the technology acceptance model (TAM).

    Science.gov (United States)

    Tao, Donghua

    2008-11-06

    This study extended the Technology Acceptance Model (TAM) by examining the roles of two aspects of e-resource characteristics, namely, information quality and system quality, in predicting public health students' intention to use e-resources for completing research paper assignments. Both focus groups and a questionnaire were used to collect data. Descriptive analysis, data screening, and Structural Equation Modeling (SEM) techniques were used for data analysis. The study found that perceived usefulness played a major role in determining students' intention to use e-resources. Perceived usefulness and perceived ease of use fully mediated the impact that information quality and system quality had on behavior intention. The research model enriches the existing technology acceptance literature by extending TAM. Representing two aspects of e-resource characteristics provides greater explanatory information for diagnosing problems of system design, development, and implementation.

  15. Building and Managing Electronic Resources in Digital Era in India with Special Reference to IUCAA and NIV, Pune: A Comparative Case Study

    Science.gov (United States)

    Sahu, H. K.; Singh, S. N.

    2015-04-01

    This paper discusses and presents a comparative case study of two libraries in Pune, India, Inter-University Centre for Astronomy and Astrophysics and Information Centre and Library of National Institute of Virology (Indian Council of Medical Research). It compares how both libraries have managed their e-resource collections, including acquisitions, subscriptions, and consortia arrangements, while also developing a collection of their own resources, including pre-prints and publications, video lectures, and other materials in an institutional repository. This study illustrates how difficult it is to manage electronic resources in a developing country like India, even though electronic resources are used more than print resources. Electronic resource management can be daunting, but with a systematic approach, various problems can be solved, and use of the materials will be enhanced.

  16. The level of the usage of the human resource information system and electronic recruitment in Croatian companies

    Directory of Open Access Journals (Sweden)

    Snježana Pivac

    2014-12-01

    Full Text Available Performing business according to contemporary requirements influences companies for continuous usage of modern managerial tools, such as a human resource information system (HRIS and electronic recruitment (ER. Human resources have been recognised as curtail resources and the main source of a competitive advantage in creation of successful business performance. In order to attract and select the top employees, companies use quality information software for attracting internal ones, and electronic recruitment for attracting the best possible external candidates. The main aim of this paper is to research the level of the usage of HRIS and ER within medium-size and large Croatian companies. Moreover, the additional aim of this paper is to evaluate the relationship among the usage of these modern managerial tools and the overall success of human resource management within these companies. For the purpose of this paper, primary and secondary research has been conducted in order to reveal the level of the usage of HRIS and ER as well as the overall success of human resource management in Croatian companies. The companies’ classification (HRIS and ER is done by using the non-hierarchical k-means cluster method as well as the nonparametric Kruskal Wallis test. Further, the companies are ranked by the multicriteria PROMETHEE method. Relevant nonparametric tests are used for testing the overall companies’ HRM. Finally, binary logistic regression is estimated, relating binary variable HRM and HRIS development. After detailed research, it can be concluded that large Croatian companies apply HRIS in majority (with a positive relation to HRM performance, but still require certain degrees of its development.

  17. MendelWeb: An Electronic Science/Math/History Resource for the WWW.

    Science.gov (United States)

    Blumberg, Roger B.

    This paper describes a hypermedia resource, called MendelWeb that integrates elementary biology, discrete mathematics, and the history of science. MendelWeb is constructed from Gregor Menders 1865 paper, "Experiments in Plant Hybridization". An English translation of Mendel's paper, which is considered to mark the birth of classical and…

  18. Helping Patrons Find Locally Held Electronic Resources: An Interlibrary Loan Perspective

    Science.gov (United States)

    Johnston, Pamela

    2016-01-01

    The University of North Texas Libraries provide extensive online access to academic journals through major vendor databases. As illustrated by interlibrary loan borrowing requests for items held in our databases, patrons often have difficulty navigating the available resources. In this study, the Interlibrary Loan staff used data gathered from the…

  19. QR Codes as Finding Aides: Linking Electronic and Print Library Resources

    Science.gov (United States)

    Kane, Danielle; Schneidewind, Jeff

    2011-01-01

    As part of a focused, methodical, and evaluative approach to emerging technologies, QR codes are one of many new technologies being used by the UC Irvine Libraries. QR codes provide simple connections between print and virtual resources. In summer 2010, a small task force began to investigate how QR codes could be used to provide information and…

  20. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  1. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  2. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  3. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  4. Eavesdropping on Electronic Guidebooks: Observing Learning Resources in Shared Listening Environments.

    Science.gov (United States)

    Woodruff, Allison; Aoki, Paul M.; Grinter, Rebecca E.; Hurst, Amy; Szymanski, Margaret H.; Thornton, James D.

    This paper describes an electronic guidebook, "Sotto Voce," that enables visitors to share audio information by eavesdropping on each others guidebook activity. The first section discusses the design and implementation of the guidebook device, key aspects of its user interface, the design goals for the audio environment, the eavesdropping…

  5. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  6. Development and evolution of The Knowledge Hub for Pathology and related electronic resources.

    Science.gov (United States)

    Hardwick, David F; Sinard, John; Silva, Fred

    2011-06-01

    The Knowledge Hub for Pathology was created to provide authenticated and validated knowledge for United States and Canadian Academy of Pathology members and pathologists worldwide with access to the Web. Using the material presented at the annual meeting of the United States and Canadian Academy of Pathology with existing selection and review procedures ensured that these criteria were met without added costly procedures. Further submissions for courses and research papers are provided in electronic format and funded by universities and hospitals for their creation; thus, the principal costs borne by the United States and Canadian Academy of Pathology are Web site-posting costs. Use has escalated rapidly from 2 million hits in 2002 to 51 million in 2009 with use by 35,000 pathologists from now a total of 180 countries. This true "freemium" model is a successful process as are more traditional continuing professional development course structures such as Anatomic Pathology Electronic Case Series, a "premium" model for learning electronically also sponsored by the United States and Canadian Academy of Pathology. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. An Exploratory study on the use of LibAnswers to Resolve, Track and Monitor Electronic Resources Issues: The KAUST Library experience

    KAUST Repository

    Ramli, Rindra M.

    2017-01-01

    An Exploratory study on KAUST library use of LibAnswers in resolving electronic resources questions received in LibAnswers. It describes the findings of the questions received in LibAnswers. The author made suggestions based on the findings to improve the reference services in responding to e-resources questions.

  8. An Exploratory study on the use of LibAnswers to Resolve, Track and Monitor Electronic Resources Issues: The KAUST Library experience

    KAUST Repository

    Ramli, Rindra M.

    2017-05-03

    An Exploratory study on KAUST library use of LibAnswers in resolving electronic resources questions received in LibAnswers. It describes the findings of the questions received in LibAnswers. The author made suggestions based on the findings to improve the reference services in responding to e-resources questions.

  9. Designing a model of electronic human resource management’s implementation at the Ministry of Communications and Information Technology

    Directory of Open Access Journals (Sweden)

    Mirali Seyednaghavi

    2017-06-01

    Full Text Available : In the first phase of this study a model for electronic human resource management in government agencies based on new public services was explored by using software MAXQDA, then in the second phase, relationship between the elements of the theory were tested using software Smart PLS2. So the aim of this study is to design a model of electronic human resource management’s implementation at the Ministry of Communications and Information Technology. In this regard, according to Strauss and Corbin’s structured plan, five hypotheses were tested. Quantitative data analysis indicates that the pressures of the policies and global perspectives cause to move toward e-HRM. Among the contextual conditions macro structural mechanisms, considerations of actors, governance considerations have a significant impact on the strategy of new public services and therefore lead to the consequences of its implementation in public organizations. The findings suggest that e-HRM does not have a positive and meaningful impact on new public services, and in our country, although the recent political developments have somehow removed the gap between public policy makers, administrators, and the public, but there is still a long way to go.

  10. Preference and Use of Electronic Information and Resources by Blind/Visually Impaired in NCR Libraries in India

    Directory of Open Access Journals (Sweden)

    Shailendra Kumar

    2013-06-01

    Full Text Available This paper aims to determine the preference and use of electronic information and resources by blind/visually impaired users in the leading National Capital Region (NCR libraries of India. Survey methodology has been used as the basic research tool for data collection with the help of questionnaires. The 125 in total users surveyed in all the five libraries were selected randomly on the basis of willingness of the users with experience of working in digital environments to participate in the survey. The survey results were tabulated and analyzed with descriptive statistics methods using Excel software and 'Stata version 11'. The findings reveal that ICT have a positive impact in the lives of people with disabilities as it helps them to work independently and increases the level of confidence among them. The Internet is the most preferred medium of access to information among the majority of blind/visually impaired users. The 'Complexity of content available on the net' is found as the major challenge faced during Internet use by blind users of NCR libraries. 'Audio books on CDs/DVDs and DAISY books' are the most preferred electronic resources among the majority of blind/visually impaired users. This study will help the library professionals and organizations/institutions serving people with disabilities to develop effective library services for blind/visually impaired users in the digital environment on the basis of findings on information usage behavior in the study.

  11. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  12. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  13. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  14. Electronic medical records in diabetes consultations: participants' gaze as an interactional resource.

    Science.gov (United States)

    Rhodes, Penny; Small, Neil; Rowley, Emma; Langdon, Mark; Ariss, Steven; Wright, John

    2008-09-01

    Two routine consultations in primary care diabetes clinics are compared using extracts from video recordings of interactions between nurses and patients. The consultations were chosen to present different styles of interaction, in which the nurse's gaze was either primarily toward the computer screen or directed more toward the patient. Using conversation analysis, the ways in which nurses shift both gaze and body orientation between the computer screen and patient to influence the style, pace, content, and structure of the consultation were investigated. By examining the effects of different levels of engagement between the electronic medical record and the embodied patient in the consultation room, we argue for the need to consider the contingent nature of the interface of technology and the person in the consultation. Policy initiatives designed to deliver what is considered best-evidenced practice are modified in the micro context of the interactions of the consultation.

  15. Granulometric composition study of mineral resources using opto-electronic devices and Elsieve software system

    Directory of Open Access Journals (Sweden)

    Kaminski Stanislaw

    2016-01-01

    Full Text Available The use of mechanical sieves has a great impact on measurement results because occurrence of anisometric particles causes undercounting the average size. Such errors can be avoided by using opto-electronic measuring devices that enable measurement of particles from 10 μm up to a few dozen millimetres in size. The results of measurement of each particle size fraction are summed up proportionally to its weight with the use of Elsieve software system and for every type of material particle-size distribution can be obtained. The software allows further statistical interpretation of the results. Beam of infrared radiation identifies size of particles and counts them precisely. Every particle is represented by an electronic impulse proportional to its size. Measurement of particles in aqueous suspension that replaces the hydrometer method can be carried out by using the IPS L analyser (range from 0.2 to 600 μm. The IPS UA analyser (range from 0.5 to 2000 μm is designed for measurement in the air. An ultrasonic adapter enables performing measurements of moist and aggregated particles from 0.5 to 1000 μm. The construction and software system allow to determine second dimension of the particle, its shape coefficient and specific surface area. The AWK 3D analyser (range from 0.2 to 31.5 mm is devoted to measurement of various powdery materials with subsequent determination of particle shape. The AWK B analyser (range from 1 to 130 mm measures materials of thick granulation and shape of the grains. The presented method of measurement repeatedly accelerates and facilitates study of granulometric composition.

  16. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  17. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  18. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  19. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  20. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  1. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  2. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  3. Green Supply Chain Collaboration for Fashionable Consumer Electronics Products under Third-Party Power Intervention—A Resource Dependence Perspective

    Directory of Open Access Journals (Sweden)

    Jiuh-Biing Sheu

    2014-05-01

    Full Text Available Under third-party power intervention (TPPI, which increases uncertainty in task environments, complex channel power interplays and restructuring are indispensable among green supply chain members as they move toward sustainable collaborative relationships for increased viability and competitive advantage. From the resource dependence perspective, this work presents a novel conceptual model to investigate the influence of political and social power on channel power restructuring and induced green supply chain collaboration in brander-retailer bidirectional green supply chains of fashionable consumer electronics products (FCEPs. An FCEP refers to the consumer electronics product (e.g., personal computers, mobile phones, computer notebooks, and game consoles with the features of a well-known brand associated, a short product lifecycle, timely and fashionable design fit for market trends, and quick responsiveness to the variations of market demands. The proposed model is tested empirically using questionnaire data obtained from retailers in the FCEP brander-retailer distribution channels. Analytical results reveal that as an extension of political and social power, TPPI positively affects the reciprocal interdependence of dyadic members and reduces power asymmetry, thereby enhancing the collaborative relationship of dyadic members and leading to improved green supply chain performance. Therein, reciprocal interdependence underlying collaborative relationship is the key to reducing the external environmental uncertainties in the TPPI context.

  4. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  5. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  6. The management of online resources and long-term saving of electronic documents by transfer into the digital space

    Directory of Open Access Journals (Sweden)

    Marius Daniel MAREŞ

    2011-12-01

    The electronic archive refers to the electronic storage system, along with the totality of electronic-type stored documents, while using as storage support any environment that can support storing and from which an electronic document can be presented.

  7. Development of an Electronic Medical Record Based Alert for Risk of HIV Treatment Failure in a Low-Resource Setting

    Science.gov (United States)

    Puttkammer, Nancy; Zeliadt, Steven; Balan, Jean Gabriel; Baseman, Janet; Destiné, Rodney; Domerçant, Jean Wysler; France, Garilus; Hyppolite, Nathaelf; Pelletier, Valérie; Raphael, Nernst Atwood; Sherr, Kenneth; Yuhas, Krista; Barnhart, Scott

    2014-01-01

    Background The adoption of electronic medical record systems in resource-limited settings can help clinicians monitor patients' adherence to HIV antiretroviral therapy (ART) and identify patients at risk of future ART failure, allowing resources to be targeted to those most at risk. Methods Among adult patients enrolled on ART from 2005–2013 at two large, public-sector hospitals in Haiti, ART failure was assessed after 6–12 months on treatment, based on the World Health Organization's immunologic and clinical criteria. We identified models for predicting ART failure based on ART adherence measures and other patient characteristics. We assessed performance of candidate models using area under the receiver operating curve, and validated results using a randomly-split data sample. The selected prediction model was used to generate a risk score, and its ability to differentiate ART failure risk over a 42-month follow-up period was tested using stratified Kaplan Meier survival curves. Results Among 923 patients with CD4 results available during the period 6–12 months after ART initiation, 196 (21.2%) met ART failure criteria. The pharmacy-based proportion of days covered (PDC) measure performed best among five possible ART adherence measures at predicting ART failure. Average PDC during the first 6 months on ART was 79.0% among cases of ART failure and 88.6% among cases of non-failure (pART initiation were added to PDC, the risk score differentiated between those who did and did not meet failure criteria over 42 months following ART initiation. Conclusions Pharmacy data are most useful for new ART adherence alerts within iSanté. Such alerts offer potential to help clinicians identify patients at high risk of ART failure so that they can be targeted with adherence support interventions, before ART failure occurs. PMID:25390044

  8. Development of an electronic medical record based alert for risk of HIV treatment failure in a low-resource setting.

    Directory of Open Access Journals (Sweden)

    Nancy Puttkammer

    Full Text Available The adoption of electronic medical record systems in resource-limited settings can help clinicians monitor patients' adherence to HIV antiretroviral therapy (ART and identify patients at risk of future ART failure, allowing resources to be targeted to those most at risk.Among adult patients enrolled on ART from 2005-2013 at two large, public-sector hospitals in Haiti, ART failure was assessed after 6-12 months on treatment, based on the World Health Organization's immunologic and clinical criteria. We identified models for predicting ART failure based on ART adherence measures and other patient characteristics. We assessed performance of candidate models using area under the receiver operating curve, and validated results using a randomly-split data sample. The selected prediction model was used to generate a risk score, and its ability to differentiate ART failure risk over a 42-month follow-up period was tested using stratified Kaplan Meier survival curves.Among 923 patients with CD4 results available during the period 6-12 months after ART initiation, 196 (21.2% met ART failure criteria. The pharmacy-based proportion of days covered (PDC measure performed best among five possible ART adherence measures at predicting ART failure. Average PDC during the first 6 months on ART was 79.0% among cases of ART failure and 88.6% among cases of non-failure (p<0.01. When additional information including sex, baseline CD4, and duration of enrollment in HIV care prior to ART initiation were added to PDC, the risk score differentiated between those who did and did not meet failure criteria over 42 months following ART initiation.Pharmacy data are most useful for new ART adherence alerts within iSanté. Such alerts offer potential to help clinicians identify patients at high risk of ART failure so that they can be targeted with adherence support interventions, before ART failure occurs.

  9. Innovative direct energy conversion systems using electronic adiabatic processes of electron fluid in solid conductors: new plants of electrical power and hydrogen gas resources without environmental pollutions

    International Nuclear Information System (INIS)

    Kondoh, Y.; Kondo, M.; Shimoda, K.; Takahashi, T.

    2001-07-01

    It is shown that using a novel recycling process of the environmental thermal energy, innovative permanent auto-working direct energy converter systems (PA-DEC systems) from the environmental thermal to electrical and/or chemical potential (TE/CP) energies, abbreviated as PA-TE/CP-DEC systems, can be used for new auto-working electrical power plants and the plants of the compressible and conveyable hydrogen gas resources at various regions in the whole world, with contributions to the world peace and the economical development in the south part of the world. It is shown that the same physical mechanism by free electrons and electrical potential determined by temperature in conductors, which include semiconductors, leads to the Peltier effect and the Seebeck one. It is experimentally clarified that the long distance separation between two π type elements of the heat absorption (HAS) and the production one (HPS) of the Peltier effect circuit system or between the higher temperature side (HTS) and the lower one (LTS) of the Seebeck effect circuit one does not change in the whole for the both effects. By using present systems, we do not need to use petrified fuels such as coals, oils, and natural gases in order to decrease the greenhouse effect by the CO 2 surrounding the earth. Furthermore, we do not need plats of nuclear fissions that left radiating wastes, i.e., with no environmental pollutions. The PA-TE/CP-DEC systems can be applicable for several km scale systems to the micro ones, such as the plants of the electrical power, the compact transportable hydrogen gas resources, a large heat energy container, which can be settled at far place from thermal energy absorbing area, the refrigerators, the air conditioners, home electrical apparatuses, and further the computer elements. It is shown that the simplest PA-TE/CP-DEC system can be established by using only the Seebeck effect components and the resolving water ones. It is clarified that the externally applied

  10. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  11. Consumer reports [electronic resource

    National Research Council Canada - National Science Library

    1942-01-01

    ... only. A limited number of selected reports, advice on product selection and safety alerts are freely available, as are a five year listing of product recalls, a listing of major consumer product...

  12. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  13. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  14. The electronic Rothamsted Archive (e-RA), an online resource for data from the Rothamsted long-term experiments.

    Science.gov (United States)

    Perryman, Sarah A M; Castells-Brooke, Nathalie I D; Glendining, Margaret J; Goulding, Keith W T; Hawkesford, Malcolm J; Macdonald, Andy J; Ostler, Richard J; Poulton, Paul R; Rawlings, Christopher J; Scott, Tony; Verrier, Paul J

    2018-05-15

    The electronic Rothamsted Archive, e-RA (www.era.rothamsted.ac.uk) provides a permanent managed database to both securely store and disseminate data from Rothamsted Research's long-term field experiments (since 1843) and meteorological stations (since 1853). Both historical and contemporary data are made available via this online database which provides the scientific community with access to a unique continuous record of agricultural experiments and weather measured since the mid-19 th century. Qualitative information, such as treatment and management practices, plans and soil information, accompanies the data and are made available on the e-RA website. e-RA was released externally to the wider scientific community in 2013 and this paper describes its development, content, curation and the access process for data users. Case studies illustrate the diverse applications of the data, including its original intended purposes and recent unforeseen applications. Usage monitoring demonstrates the data are of increasing interest. Future developments, including adopting FAIR data principles, are proposed as the resource is increasingly recognised as a unique archive of data relevant to sustainable agriculture, agroecology and the environment.

  15. Principles of formation of the content of an educational electronic resource on the basis of general and didactic patterns of learning

    Directory of Open Access Journals (Sweden)

    Ольга Юрьевна Заславская

    2018-12-01

    Full Text Available The article considers the influence of the development of technical means of teaching on the effectiveness of educational and methodical resources. Modern opportunities of information and communication technologies allow creating electronic educational resources that represent educational information that automates the learning process, provide information assistance, if necessary, collect and process statistical information on the degree of development of the content of the school material by schoolchildren, set an individual trajectory of learning, and so on. The main principle of data organization is the division of the training course into separate sections on the thematic elements and components of the learning process. General regularities include laws that encompass the entire didactic system, and in specific (particular cases, those whose actions extend to a separate component (aspect of the system. From the standpoint of the existence of three types of electronic training modules in the aggregate content of the electronic learning resource - information, control and module of practical classes - the principles of the formation of the electronic learning resource, in our opinion, should regulate all these components. Each of the certain principles is considered in the groups: scientific orientation, methodological orientation, systemic nature, accounting of interdisciplinary connections, fundamentalization, systematic and dosage sequence, rational use of study time, accessibility, minimization, operationalization of goals, unified identification diagnosis.

  16. The module of methodical support in system of electronic educational resources as the innovative element of the modern maintenance of formation

    Directory of Open Access Journals (Sweden)

    Ольга Николаевна Крылова

    2009-06-01

    Full Text Available The article introduces some results of research, which were devoted to evaluation of tearches' mobility to introduce innovations in the contents of education. The author considers innovative potential of modules of the methodical support for system of electronic educational resources.

  17. Charting a Course through CORAL: Texas A&M University Libraries' Experience Implementing an Open-Source Electronic Resources Management System

    Science.gov (United States)

    Hartnett, Eric; Beh, Eugenia; Resnick, Taryn; Ugaz, Ana; Tabacaru, Simona

    2013-01-01

    In 2010, after two previous unsuccessful attempts at electronic resources management system (ERMS) implementation, Texas A&M University (TAMU) Libraries set out once again to find an ERMS that would fit its needs. After surveying the field, TAMU Libraries selected the University of Notre Dame Hesburgh Libraries-developed, open-source ERMS,…

  18. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  19. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  20. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  1. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  2. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  3. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  4. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  5. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  6. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  7. Electronics

    Science.gov (United States)

    2001-01-01

    International Acer Incorporated, Hsin Chu, Taiwan Aerospace Industrial Development Corporation, Taichung, Taiwan American Institute of Taiwan, Taipei, Taiwan...Singapore and Malaysia .5 - 4 - The largest market for semiconductor products is the high technology consumer electronics industry that consumes up...Singapore, and Malaysia . A new semiconductor facility costs around $3 billion to build and takes about two years to become operational

  8. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  9. Evaluation of three electronic report processing systems for preparing hydrologic reports of the U.S Geological Survey, Water Resources Division

    Science.gov (United States)

    Stiltner, G.J.

    1990-01-01

    In 1987, the Water Resources Division of the U.S. Geological Survey undertook three pilot projects to evaluate electronic report processing systems as a means to improve the quality and timeliness of reports pertaining to water resources investigations. The three projects selected for study included the use of the following configuration of software and hardware: Ventura Publisher software on an IBM model AT personal computer, PageMaker software on a Macintosh computer, and FrameMaker software on a Sun Microsystems workstation. The following assessment criteria were to be addressed in the pilot studies: The combined use of text, tables, and graphics; analysis of time; ease of learning; compatibility with the existing minicomputer system; and technical limitations. It was considered essential that the camera-ready copy produced be in a format suitable for publication. Visual improvement alone was not a consideration. This report consolidates and summarizes the findings of the electronic report processing pilot projects. Text and table files originating on the existing minicomputer system were successfully transformed to the electronic report processing systems in American Standard Code for Information Interchange (ASCII) format. Graphics prepared using a proprietary graphics software package were transferred to all the electronic report processing software through the use of Computer Graphic Metafiles. Graphics from other sources were entered into the systems by scanning paper images. Comparative analysis of time needed to process text and tables by the electronic report processing systems and by conventional methods indicated that, although more time is invested in creating the original page composition for an electronically processed report , substantial time is saved in producing subsequent reports because the format can be stored and re-used by electronic means as a template. Because of the more compact page layouts, costs of printing the reports were 15% to 25

  10. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  11. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  12. Electronic resources of the rare books and valuable editions department of the Central Scientific Library of the V.N. Karazin Kharkiv National University: open access for research

    Directory of Open Access Journals (Sweden)

    І. К. Журавльова

    2014-12-01

    Full Text Available The article describes tasks that electronic collections of rare books fulfill: broad access for readers to rare and valuable editions providing, preservation of ensuring of the original. On the example of the electronic collection of the Central Scientific Library of the V.N. Karazin Kharkiv National University – «eScriptorium: electronic archive of rare books and manuscripts for research and education» the possibility of the full-text resources of the valuable editions using is shown. The principles of creation, structure, chronological frameworks, directions of adding the documents to the archive are represented. The perspectives of the project development are outlined as well as examples of the digital libraries of the European countries and Ukraine are provided, the actual task of preserving the originals of the rare books of the country is raised, the innovative approaches to serving users with electronic resources are considered. The evidences of cooperation of the Central Scientific Library of the V.N. Karazin Kharkiv National University with the largest world digital libraries: World Digital Library and Europeana are provided.

  13. The use of quality benchmarking in assessing web resources for the dermatology virtual branch library of the National electronic Library for Health (NeLH).

    Science.gov (United States)

    Kamel Boulos, M N; Roudsari, A V; Gordon, C; Muir Gray, J A

    2001-01-01

    In 1998, the U.K. National Health Service Information for Health Strategy proposed the implementation of a National electronic Library for Health to provide clinicians, healthcare managers and planners, patients and the public with easy, round the clock access to high quality, up-to-date electronic information on health and healthcare. The Virtual Branch Libraries are among the most important components of the National electronic Library for Health. They aim at creating online knowledge based communities, each concerned with some specific clinical and other health-related topics. This study is about the envisaged Dermatology Virtual Branch Libraries of the National electronic Library for Health. It aims at selecting suitable dermatology Web resources for inclusion in the forthcoming Virtual Branch Libraries after establishing preliminary quality benchmarking rules for this task. Psoriasis, being a common dermatological condition, has been chosen as a starting point. Because quality is a principal concern of the National electronic Library for Health, the study includes a review of the major quality benchmarking systems available today for assessing health-related Web sites. The methodology of developing a quality benchmarking system has been also reviewed. Aided by metasearch Web tools, candidate resources were hand-selected in light of the reviewed benchmarking systems and specific criteria set by the authors. Over 90 professional and patient-oriented Web resources on psoriasis and dermatology in general are suggested for inclusion in the forthcoming Dermatology Virtual Branch Libraries. The idea of an all-in knowledge-hallmarking instrument for the National electronic Library for Health is also proposed based on the reviewed quality benchmarking systems. Skilled, methodical, organized human reviewing, selection and filtering based on well-defined quality appraisal criteria seems likely to be the key ingredient in the envisaged National electronic Library for

  14. Barriers to electronic access and delivery of educational information in resource constrained public schools: a case of Greater Tubatse Municipality

    CSIR Research Space (South Africa)

    Pholotho, T

    2016-05-01

    Full Text Available Information and Communication Technologies (ICTs) are capable of expanding access to quality education, educational resources and provide teachers with new skills. Nevertheless, a majority of rural public schools have limited ICTs, mainly due...

  15. Electronic Grey Literature in Accelerator Science and Its Allied Subjects : Selected Web Resources for Scientists and Engineers

    CERN Document Server

    Rajendiran, P

    2006-01-01

    Grey literature Web resources in the field of accelerator science and its allied subjects are collected for the scientists and engineers of RRCAT (Raja Ramanna Centre for Advanced Technology). For definition purposes the different types of grey literature are described. The Web resources collected and compiled in this article (with an overview and link for each) specifically focus on technical reports, preprints or e-prints, which meet the main information needs of RRCAT users.

  16. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  17. Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method

    International Nuclear Information System (INIS)

    Lestelle, L.C.; Mobrand, L.E.; Lichatowich, J.A.; Vogel, T.S.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual

  18. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  19. The astrobiology primer: an outline of general knowledge--version 1, 2006.

    Science.gov (United States)

    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-10-01

    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  20. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  1. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  2. The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

    Energy Technology Data Exchange (ETDEWEB)

    Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

    2011-01-15

    Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

  3. The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

    International Nuclear Information System (INIS)

    Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

    2011-01-01

    Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

  4. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  5. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  6. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  7. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  8. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  9. Clinician‐selected Electronic Information Resources do not Guarantee Accuracy in Answering Primary Care Physicians’ Information Needs. A review of: McKibbon, K. Ann, and Douglas B. Fridsma. “Effectiveness of Clinician‐selected Electronic Information Resources for Answering Primary Care Physicians’ Information Needs.” Journal of the American Medical Informatics Association 13.6 (2006: 653‐9.

    Directory of Open Access Journals (Sweden)

    Martha Ingrid Preddie

    2008-03-01

    Full Text Available Objective – To determine if electronic information resources selected by primary care physicians improve their ability to answer simulated clinical questions.Design – An observational study utilizing hour‐long interviews and think‐aloud protocols.Setting – The offices and clinics of primary care physicians in Canada and the United States.Subjects – Twenty‐five primary care physicians of whom 4 were women, 17 were from Canada, 22 were family physicians,and 24 were board certified.Methods – Participants provided responses to 23 multiple‐choice questions. Each physician then chose two questions and looked for the answers utilizing information resources of their own choice. The search processes, chosen resources and search times were noted. These were analyzed along with data on the accuracy of the answers and certainties related to the answer to each clinical question prior to the search.Main results – Twenty‐three physicians sought answers to 46 simulated clinical questions. Utilizing only electronic information resources, physicians spent a mean of 13.0 (SD 5.5 minutes searching for answers to the questions, an average of 7.3(SD 4.0 minutes for the first question and 5.8 (SD 2.2 minutes to answer the second question. On average, 1.8 resources were utilized per question. Resources that summarized information, such as the Cochrane Database of Systematic Reviews, UpToDate and Clinical Evidence, were favored 39.2% of the time, MEDLINE (Ovid and PubMed 35.7%, and Internet resources including Google 22.6%. Almost 50% of the search and retrieval strategies were keyword‐based, while MeSH, subheadings and limiting were used less frequently. On average, before searching physicians answered 10 of 23 (43.5% questions accurately. For questions that were searched using clinician‐selected electronic resources, 18 (39.1% of the 46 answers were accurate before searching, while 19 (42.1% were accurate after searching. The difference of

  10. Self-Paced Interactive Multimedia Courseware: A Learning Support Resource for Enhancing Electronic Theses and Dissertations Development

    Science.gov (United States)

    Essel, Harry Barton; Osei-Poku, Patrick; Tachie-Menson, Akosua; Opoku-Asare, Nana Afia

    2016-01-01

    Submission of Electronic Theses and Dissertations (ETDs) by postgraduate students has become a common phenomenon in learning environments globally. The purpose of ETDs is to train postgraduate students as knowledge workers in online publishing and also extend their skills beyond word processing. The challenge however, is that many postgraduate…

  11. Web Accessibility Issues for Higher & Further Education. EDNER (Formative Evaluation of the Distributed National Electronic Resource) Project. Issues Paper.

    Science.gov (United States)

    Manchester Metropolitan Univ. (England).

    This issues paper, sixth in a series of eight, is intended to distill formative evaluation questions on topics that are central to the development of the higher and further education information environment in the United Kingdom. In undertaking formative evaluation studies, the Formative Evaluation of the Distributed National Electronic Resource…

  12. Analyzing the Academic Research Trends by Using University Digital Resources: A Bibliometric Study of Electronic Commerce in China

    Science.gov (United States)

    Fatima, Anam; Abbas, Asad; Ming, Wan; Zaheer, Ahmad Nawaz; Akhtar, Masood-ul-Hassan

    2017-01-01

    Technology plays a vital role in every field of life especially in business and education. Electronic commerce (EC) begins in the year of 1991 right after internet was introduced for commercial use. It is known to be the 12th five years' plan (2011 to 2015) of Chinese Ministry of Industry and Information Technology. The main "objective"…

  13. Green Supply Chain Collaboration for Fashionable Consumer Electronics Products under Third-Party Power Intervention—A Resource Dependence Perspective

    OpenAIRE

    Jiuh-Biing Sheu

    2014-01-01

    Under third-party power intervention (TPPI), which increases uncertainty in task environments, complex channel power interplays and restructuring are indispensable among green supply chain members as they move toward sustainable collaborative relationships for increased viability and competitive advantage. From the resource dependence perspective, this work presents a novel conceptual model to investigate the influence of political and social power on channel power restructuring and induced ...

  14. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  15. Share and share alike: encouraging the reuse of academic resources through the Scottish electronic Staff Development Library

    Directory of Open Access Journals (Sweden)

    Lorna M. Campbell

    2001-12-01

    Full Text Available The Scottish electronic Staff Development Library (http://www.sesdl.scotcit.acuk is an ongoing collaborative project involving the Universities of Edinburgh, Paisley and Strathclyde which has been funded by SHEFC as part of their current ScotCIT Programme (http:llwww.scotcit.ac.uk. This project is being developed in response to the increasing demand for flexible, high-quality staff development materials.

  16. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  17. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  18. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  19. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  20. Improvement of Protective Properties of Top Coatings Applied on Zinc-Rich Primer by 3-Aminopropyl-Triethoxysilan and 2-(Benzothialylthio) Succinic acid

    International Nuclear Information System (INIS)

    Truc, Trinh Anh; Hang, Thi Xuan; Oanh, Vu Ke; Dung, Nguyen Tuan

    2004-01-01

    Corrosion resistance of coating system consisting of zinc-rich primer (ZRP) and topcoat based on polyurethane resin with the presence of 3-aminopropyl-triethoxysilan (APS) and 2-(benzothialylthio) succinic acid (BSA) was studied by electrochemical impedance and wet adhesion. The interface metal/primer/topcoat was analyzed by scanning electronic microscopy. It was found that the presence of APS and BSA improved adhesion and barrier property of the topcoats

  1. In vivo effect of a self-etching primer on dentin.

    Science.gov (United States)

    Milia, E; Lallai, M R; García-Godoy, F

    1999-08-01

    To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

  2. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  3. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  4. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  5. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  6. Success factors for implementing and sustaining a mature electronic medical record in a low-resource setting: a case study of iSanté in Haiti.

    Science.gov (United States)

    deRiel, E; Puttkammer, N; Hyppolite, N; Diallo, J; Wagner, S; Honoré, J G; Balan, J G; Celestin, N; Vallès, J S; Duval, N; Thimothé, G; Boncy, J; Coq, N R L; Barnhart, S

    2018-03-01

    Electronic health information systems, including electronic medical records (EMRs), have the potential to improve access to information and quality of care, among other things. Success factors and challenges for novel EMR implementations in low-resource settings have increasingly been studied, although less is known about maturing systems and sustainability. One systematic review identified seven categories of implementation success factors: ethical, financial, functionality, organizational, political, technical and training. This case study applies this framework to iSanté, Haiti's national EMR in use in more than 100 sites and housing records for more than 750 000 patients. The author group, consisting of representatives of different agencies within the Haitian Ministry of Health (MSPP), funding partner the Centers for Disease Control and Prevention (CDC) Haiti, and implementing partner the International Training and Education Center for Health (I-TECH), identify successes and lessons learned according to the seven identified categories, and propose an additional cross-cutting category, sustainability. Factors important for long-term implementation success of complex information systems are balancing investments in hardware and software infrastructure upkeep, user capacity and data quality control; designing and building a system within the context of the greater eHealth ecosystem with a plan for interoperability and data exchange; establishing system governance and strong leadership to support local system ownership and planning for system financing to ensure sustainability. Lessons learned from 10 years of implementation of the iSanté EMR system are relevant to sustainability of a full range of increasingly interrelated information systems (e.g. for laboratory, supply chain, pharmacy and human resources) in the health sector in low-resource settings. © The Author 2017. Published by Oxford University Press in association with The London School of Hygiene

  7. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  8. Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2011 - 30 November 2011

    KAUST Repository

    Abreu, Aluana Gonç alves; Albaina, A.; Alpermann, Tilman J.; Apkenas, Vanessa E.; Bankhead-Dronnet, Sté phanie; Bergek, Sara; Berumen, Michael L.; Cho, Changhung; Clobert, Jean; Coulon, Auré lie; De Feraudy, D.; Estonba, Andone; Hankeln, Thomas M A; Hochkirch, Axel; Hsu, Tsaiwen; Huang, Tsurngjuhn; Irigoien, Xabier; Iriondo, Mikel; Kay, Kathleen M.; Kinitz, Tim; Kothera, Linda; Le Hé nanff, Maxime; Lieutier, Franç ois; Lourdais, Olivier; Macrini, Camila M T; Manzano, Carmen; Martin, Carine; Morris, Veronica Ruth Franco; Nanninga, Gerrit B.; Pardo, D.; Plieske, Jö rg; Pointeau, Sophie; Prestegaard, Tore; Quack, Markus; Richard, Murielle; Savage, Harry M.; Schwarcz, Kaiser D.; Shade, Jessica; Simms, Ellen L.; Solferini, Vera Nisaka; Stevens, Virginie M.; Veith, Michael W.; Wen, Meijuan; Wicker, Florian; Yost, Jenn M.; Zarraonaindia, Iratxe

    2012-01-01

    This article documents the addition of 139 microsatellite marker loci and 90 pairs of single-nucleotide polymorphism sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Aglaoctenus lagotis, Costus pulverulentus, Costus scaber, Culex pipiens, Dascyllus marginatus, Lupinus nanus Benth, Phloeomyzus passerini, Podarcis muralis, Rhododendron rubropilosum Hayata var. taiwanalpinum and Zoarces viviparus. These loci were cross-tested on the following species: Culex quinquefasciatus, Rhododendron pseudochrysanthum Hay. ssp. morii (Hay.) Yamazaki and R. pseudochrysanthum Hayata. This article also documents the addition of 48 sequencing primer pairs and 90 allele-specific primers for Engraulis encrasicolus. © 2012 Blackwell Publishing Ltd.

  9. Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2011 - 30 November 2011

    KAUST Repository

    Abreu, Aluana Gonçalves

    2012-02-01

    This article documents the addition of 139 microsatellite marker loci and 90 pairs of single-nucleotide polymorphism sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Aglaoctenus lagotis, Costus pulverulentus, Costus scaber, Culex pipiens, Dascyllus marginatus, Lupinus nanus Benth, Phloeomyzus passerini, Podarcis muralis, Rhododendron rubropilosum Hayata var. taiwanalpinum and Zoarces viviparus. These loci were cross-tested on the following species: Culex quinquefasciatus, Rhododendron pseudochrysanthum Hay. ssp. morii (Hay.) Yamazaki and R. pseudochrysanthum Hayata. This article also documents the addition of 48 sequencing primer pairs and 90 allele-specific primers for Engraulis encrasicolus. © 2012 Blackwell Publishing Ltd.

  10. Selection and Evaluation of Electronic Resources Elektronik Kaynakların Seçimi ve Değerlendirilmesi

    Directory of Open Access Journals (Sweden)

    Doğan Atılgan

    2009-12-01

    Full Text Available Publication boom and issues related to controlling and accession of printed sources have created some problems after World War II. Consequently, publishing industry has encountered the problem of finding possible solution for emerged situation. Industry of electronic publishing has started to improve with the rapid increase of the price of printed sources as well as the problem of publication boom. The first effects of electronic publishing were appeared on the academic and scholarly publications then electronic publishing became a crucial part of all types of publications. As a result of these developments, collection developments and service policies of information centers were also significantly changed. In this article, after a general introduction about selection and evaluation processes of electronic publications, the subscribed databases by a state and a privately owned university in Turkey and their usage were examined. İkinci dünya savaşından sonra görülen yayın patlaması, basılı kaynakların denetim ve erişiminde sorunlar yaşanmasına neden olmuştur. Bu da yayıncılık sektöründe yeni arayışlara yol açmıştır. 1980’li yıllardan sonra basılı yayın fiyatlarındaki hızlı artış da bu etmenlere eklenince elektronik yayıncılık sektörü gelişmeye başlamıştır. Öncelikle bilimsel ve akademik yayınlarla başlayan elektronik yayın günümüzde tüm yayın türlerini kapsamaktadır. Yayıncılıktaki bu gelişim bilgi merkezlerinin derme geliştirme ve hizmet politikalarını da önemli ölçüde değiştirmiştir. Bu çalışmada elektronik yayınların seçim, değerlendirme ve sağlama konularında genel bir girişten sonra bir devlet üniversitesinin bir de özel üniversitenin abone olduğu veritabanları ve bu veri tabanlarının kullanımının değerlendirilmesi yapılmaktadır.

  11. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  12. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  13. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  14. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  15. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  16. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  17. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  18. Utility of the electronic information resource UpToDate for clinical decision-making at bedside rounds.

    Science.gov (United States)

    Phua, J; See, K C; Khalizah, H J; Low, S P; Lim, T K

    2012-02-01

    Clinical questions often arise at daily hospital bedside rounds. Yet, little information exists on how the search for answers may be facilitated. The aim of this prospective study was, therefore, to evaluate the overall utility, including the feasibility and usefulness of incorporating searches of UpToDate, a popular online information resource, into rounds. Doctors searched UpToDate for any unresolved clinical questions during rounds for patients in general medicine and respiratory wards, and in the medical intensive care unit of a tertiary teaching hospital. The nature of the questions and the results of the searches were recorded. Searches were deemed feasible if they were completed during the rounds and useful if they provided a satisfactory answer. A total of 157 UpToDate searches were performed during the study period. Questions were raised by all ranks of clinicians from junior doctors to consultants. The searches were feasible and performed immediately during rounds 44% of the time. Each search took a median of three minutes (first quartile: two minutes, third quartile: five minutes). UpToDate provided a useful and satisfactory answer 75% of the time, a partial answer 17% of the time and no answer 9% of the time. It led to a change in investigations, diagnosis or management 37% of the time, confirmed what was originally known or planned 38% of the time and had no effect 25% of the time. Incorporating UpToDate searches into daily bedside rounds was feasible and useful in clinical decision-making.

  19. Early Identification of Psychosis: A Primer

    OpenAIRE

    Early Psychosis Initiative of British Columbia

    2000-01-01

    This document is an educational resource concerning the early identification of psychosis. Primary topics addressed include: an outline of the importance of early intervention; signs and symptoms of psychosis; and strategies for recognizing psychosis.  

  20. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  1. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  2. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  3. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  4. A primer on industrial ecosystems : a strategy for sustainable industrial development

    Energy Technology Data Exchange (ETDEWEB)

    Cote, R P [Dalhousie Univ., Halifax, NS (Canada). Eco-Efficiency Centre; [Dalhousie Univ., Halifax, NS (Canada). Faculty of Management, School for Resource and Environmental Studies

    2003-07-01

    Industrial ecology incorporates ecological theories, functions and limits into the design of industrial production systems, processes and products. The main objective is to enhance environmental and economic performance through collaboration in managing environmental resource issues such as energy, water and materials. Industrial ecology recognizes the connectedness and synergies of materials, products and infrastructure. As such, it considers the life cycle of products, the design of buildings, infrastructure and industrial parks. By working together, businesses gain a collective benefit which is greater than the total of the individual benefits each company could achieve on its own. Industrial ecology also considers the reuse, recovery and recycling of resources. The benefits include: efficiency of resource use; cost reduction for industrial infrastructure; sustainable development support; and, new opportunities in economic development, technology development, manufacturing, and business management. This primer also presents guidelines for win-win projects in industrial ecology. refs., figs.

  5. Comprehensive evaluation of electronic medical record system use and user satisfaction at five low-resource setting hospitals in ethiopia.

    Science.gov (United States)

    Tilahun, Binyam; Fritz, Fleur

    2015-05-25

    Electronic medical record (EMR) systems are increasingly being implemented in hospitals of developing countries to improve patient care and clinical service. However, only limited evaluation studies are available concerning the level of adoption and determinant factors of success in those settings. The objective of this study was to assess the usage pattern, user satisfaction level, and determinants of health professional's satisfaction towards a comprehensive EMR system implemented in Ethiopia where parallel documentation using the EMR and the paper-based medical records is in practice. A quantitative, cross-sectional study design was used to assess the usage pattern, user satisfaction level, and determinant factors of an EMR system implemented in Ethiopia based on the DeLone and McLean model of information system success. Descriptive statistical methods were applied to analyze the data and a binary logistic regression model was used to identify determinant factors. Health professionals (N=422) from five hospitals were approached and 406 responded to the survey (96.2% response rate). Out of the respondents, 76.1% (309/406) started to use the system immediately after implementation and user training, but only 31.7% (98/309) of the professionals reported using the EMR during the study (after 3 years of implementation). Of the 12 core EMR functions, 3 were never used by most respondents, and they were also unaware of 4 of the core EMR functions. It was found that 61.4% (190/309) of the health professionals reported over all dissatisfaction with the EMR (median=4, interquartile range (IQR)=1) on a 5-level Likert scale. Physicians were more dissatisfied (median=5, IQR=1) when compared to nurses (median=4, IQR=1) and the health management information system (HMIS) staff (median=2, IQR=1). Of all the participants, 64.4% (199/309) believed that the EMR had no positive impact on the quality of care. The participants indicated an agreement with the system and information

  6. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  7. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  8. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  9. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  10. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  11. Cycle-Based Budgeting Toolkit: A Primer

    Science.gov (United States)

    Yan, Bo

    2016-01-01

    At the core, budgeting is about distributing and redistributing limited financial resources for continuous improvement. Incremental budgeting is limited in achieving the goal due to lack of connection between outcomes and budget decisions. Zero-based budgeting fills the gap, but is cumbersome to implement, especially for large urban school…

  12. Randomized Controlled Trial of Electronic Care Plan Alerts and Resource Utilization by High Frequency Emergency Department Users with Opioid Use Disorder

    Directory of Open Access Journals (Sweden)

    Niels Rathlev, MD

    2016-01-01

    Full Text Available Introduction: There is a paucity of literature supporting the use of electronic alerts for patients with high frequency emergency department (ED use. We sought to measure changes in opioid prescribing and administration practices, total charges and other resource utilization using electronic alerts to notify providers of an opioid-use care plan for high frequency ED patients. Methods: This was a randomized, non-blinded, two-group parallel design study of patients who had 1 opioid use disorder and 2 high frequency ED use. Three affiliated hospitals with identical electronic health records participated. Patients were randomized into “Care Plan” versus “Usual Care groups”. Between the years before and after randomization, we compared as primary outcomes the following: 1 opioids (morphine mg equivalents prescribed to patients upon discharge and administered to ED and inpatients; 2 total medical charges, and the numbers of; 3 ED visits, 4 ED visits with advanced radiologic imaging (computed tomography [CT] or magnetic resonance imaging [MRI] studies, and 5 inpatient admissions. Results: A total of 40 patients were enrolled. For ED and inpatients in the “Usual Care” group, the proportion of morphine mg equivalents received in the post-period compared with the pre-period was 15.7%, while in the “Care Plan” group the proportion received in the post-period compared with the pre-period was 4.5% (ratio=0.29, 95% CI [0.07-1.12]; p=0.07. For discharged patients in the “Usual Care” group, the proportion of morphine mg equivalents prescribed in the post-period compared with the pre-period was 25.7% while in the “Care Plan” group, the proportion prescribed in the post-period compared to the pre-period was 2.9%. The “Care Plan” group showed an 89% greater proportional change over the periods compared with the “Usual Care” group (ratio=0.11, 95% CI [0.01-0.092]; p=0.04. Care plans did not change the total charges, or, the numbers

  13. There is a Relationship between Resource Expenditures and Reference Transactions in Academic Libraries. A Review of: Dubnjakovic, A. (2012. Electronic resource expenditure and the decline in reference transaction statistics in academic libraries. Journal of Academic Librarianship, 38(2, 94-100. doi:10.1016/j.acalib.2012.01.001

    Directory of Open Access Journals (Sweden)

    Annie M. Hughes

    2013-03-01

    Full Text Available Objective – To provide an analysis of the impact of expenditures on electronic resourcesand gate counts on the increase or decrease in reference transactions.Design – Analysis of results of existing survey data from the National Center for Educational Statistics (NCES 2006 Academic Library Survey(ALS.Setting – Academic libraries in the United States.Subjects – 3925 academic library respondents.Methods – The author chose to use survey data collected from the 2006 ALS conducted bythe NCES. The survey included data on various topics related to academic libraries, but in the case of this study, the author chose to analyze three of the 193 variables included. The three variables: electronic books expenditure, computer hardware and software, and expenditures on bibliographic utilities, were combined into one variable called electronic resource expenditure. Gate counts were also considered as a variable. Electronic resource expenditure was also split as a variable into three groups: low, medium, and high. Multiple regression analysis and general linear modeling, along with tests of reliability, were employed. Main Results – The author determined that low, medium, and high spenders with regard to electronic resources exhibited differences in gate counts, and gate counts have an effect on reference transactions in any given week. Gate counts tend to not have much of an effect on reference transactions for the higher spenders, and higher spenders tend to have a higher number of reference transactions overall. Low spenders have lower gate counts and also a lower amount of reference transactions.Conclusion – The findings from this study show that academic libraries spending more on electronic resources also tend to have an increase with regard to reference transactions. The author also concludes that library spaces are no longer the determining factor with regard to number of reference transactions. Spending more on electronic resources is

  14. Global application of disorders of sex development-related electronic resources: e-learning, e-consultation and e-information sharing.

    Science.gov (United States)

    Muscarella, Miriam; Kranenburg-van Koppen, Laura; Grijpink-van den Biggelaar, Kalinka; Drop, Stenvert L S

    2014-01-01

    The past 20 years have seen proliferation of electronic (e) resources that promote improved understanding of disorders of sex development (DSD): e-learning for physicians and trainees, e-consultation between clinicians, and e-information for families and affected individuals. Recent e-learning advances have emerged from the European Society for Pediatric Endocrinology's online learning portal for current physicians and trainees. Developed with attention to developing clinical competencies incorporating learning theory, and presenting material that represents international best practice, this e-learning portal offers advances in training, making information more accessible for clinicians and trainees. Multiple levels of instruction, authentic case examples, collaborative forums for physicians and trainees, individualized feedback and user-friendly tools represent advances in trainee and physician learning that can take place in any location. e-consultation is an emerging tool that aims to connect physicians with specialists experienced in DSD care. Although it faces logistical challenges, e-consultation carries the potential to improve DSD care, especially in remote areas with limited access to DSD specialists. e-information for families and patients of all ages is widely accessible online, often with focus on DSD biology, medical care, and psychological and social support. e-information tools aid self-management and support of those affected by DSD. Efforts to improve these resources should aim to map information to individual users, incorporate optimally clear nomenclature, and continue as a 'shared enterprise' of clinicians, affected individuals, families and researchers. Improving the quality of DSD-related e-learning and e-information and developing e-consultation carries the potential to transform DSD care and support for patients, families and physicians worldwide. © 2014 S. Karger AG, Basel.

  15. Ranking Medical Terms to Support Expansion of Lay Language Resources for Patient Comprehension of Electronic Health Record Notes: Adapted Distant Supervision Approach.

    Science.gov (United States)

    Chen, Jinying; Jagannatha, Abhyuday N; Fodeh, Samah J; Yu, Hong

    2017-10-31

    Medical terms are a major obstacle for patients to comprehend their electronic health record (EHR) notes. Clinical natural language processing (NLP) systems that link EHR terms to lay terms or definitions allow patients to easily access helpful information when reading through their EHR notes, and have shown to improve patient EHR comprehension. However, high-quality lay language resources for EHR terms are very limited in the public domain. Because expanding and curating such a resource is a costly process, it is beneficial and even necessary to identify terms important for patient EHR comprehension first. We aimed to develop an NLP system, called adapted distant supervision (ADS), to rank candidate terms mined from EHR corpora. We will give EHR terms ranked as high by ADS a higher priority for lay language annotation-that is, creating lay definitions for these terms. Adapted distant supervision uses distant supervision from consumer health vocabulary and transfer learning to adapt itself to solve the problem of ranking EHR terms in the target domain. We investigated 2 state-of-the-art transfer learning algorithms (ie, feature space augmentation and supervised distant supervision) and designed 5 types of learning features, including distributed word representations learned from large EHR data for ADS. For evaluating ADS, we asked domain experts to annotate 6038 candidate terms as important or nonimportant for EHR comprehension. We then randomly divided these data into the target-domain training data (1000 examples) and the evaluation data (5038 examples). We compared ADS with 2 strong baselines, including standard supervised learning, on the evaluation data. The ADS system using feature space augmentation achieved the best average precision, 0.850, on the evaluation set when using 1000 target-domain training examples. The ADS system using supervised distant supervision achieved the best average precision, 0.819, on the evaluation set when using only 100 target

  16. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  17. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  18. Impact of two interventions on timeliness and data quality of an electronic disease surveillance system in a resource limited setting (Peru: a prospective evaluation

    Directory of Open Access Journals (Sweden)

    Quispe Jose A

    2009-03-01

    Full Text Available Abstract Background A timely detection of outbreaks through surveillance is needed in order to prevent future pandemics. However, current surveillance systems may not be prepared to accomplish this goal, especially in resource limited settings. As data quality and timeliness are attributes that improve outbreak detection capacity, we assessed the effect of two interventions on such attributes in Alerta, an electronic disease surveillance system in the Peruvian Navy. Methods 40 Alerta reporting units (18 clinics and 22 ships were included in a 12-week prospective evaluation project. After a short refresher course on the notification process, units were randomly assigned to either a phone, visit or control group. Phone group sites were called three hours before the biweekly reporting deadline if they had not sent their report. Visit group sites received supervision visits on weeks 4 & 8, but no phone calls. The control group sites were not contacted by phone or visited. Timeliness and data quality were assessed by calculating the percentage of reports sent on time and percentage of errors per total number of reports, respectively. Results Timeliness improved in the phone group from 64.6% to 84% in clinics (+19.4 [95% CI, +10.3 to +28.6]; p Conclusion Regular phone reminders significantly improved timeliness of reports in clinics and ships, whereas supervision visits led to improved data quality only among clinics. Further investigations are needed to establish the cost-effectiveness and optimal use of each of these strategies.

  19. Health economic assessment: a methodological primer.

    Science.gov (United States)

    Simoens, Steven

    2009-12-01

    This review article aims to provide an introduction to the methodology of health economic assessment of a health technology. Attention is paid to defining the fundamental concepts and terms that are relevant to health economic assessments. The article describes the methodology underlying a cost study (identification, measurement and valuation of resource use, calculation of costs), an economic evaluation (type of economic evaluation, the cost-effectiveness plane, trial- and model-based economic evaluation, discounting, sensitivity analysis, incremental analysis), and a budget impact analysis. Key references are provided for those readers who wish a more advanced understanding of health economic assessments.

  20. Health Economic Assessment: A Methodological Primer

    Directory of Open Access Journals (Sweden)

    Steven Simoens

    2009-11-01

    Full Text Available This review article aims to provide an introduction to the methodology of health economic assessment of a health technology. Attention is paid to defining the fundamental concepts and terms that are relevant to health economic assessments. The article describes the methodology underlying a cost study (identification, measurement and valuation of resource use, calculation of costs, an economic evaluation (type of economic evaluation, the cost-effectiveness plane, trial- and model-based economic evaluation, discounting, sensitivity analysis, incremental analysis, and a budget impact analysis. Key references are provided for those readers who wish a more advanced understanding of health economic assessments.

  1. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  2. Image Sharing in Radiology-A Primer.

    Science.gov (United States)

    Chatterjee, Arindam R; Stalcup, Seth; Sharma, Arjun; Sato, T Shawn; Gupta, Pushpender; Lee, Yueh Z; Malone, Christopher; McBee, Morgan; Hotaling, Elise L; Kansagra, Akash P

    2017-03-01

    By virtue of its information technology-oriented infrastructure, the specialty of radiology is uniquely positioned to be at the forefront of efforts to promote data sharing across the healthcare enterprise, including particularly image sharing. The potential benefits of image sharing for clinical, research, and educational applications in radiology are immense. In this work, our group-the Association of University Radiologists (AUR) Radiology Research Alliance Task Force on Image Sharing-reviews the benefits of implementing image sharing capability, introduces current image sharing platforms and details their unique requirements, and presents emerging platforms that may see greater adoption in the future. By understanding this complex ecosystem of image sharing solutions, radiologists can become important advocates for the successful implementation of these powerful image sharing resources. Copyright © 2017 The Association of University Radiologists. Published by Elsevier Inc. All rights reserved.

  3. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  4. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  5. Online Resources

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Online Resources. Journal of Genetics. Online Resources. Volume 97. 2018 | Online resources. Volume 96. 2017 | Online resources. Volume 95. 2016 | Online resources. Volume 94. 2015 | Online resources. Volume 93. 2014 | Online resources. Volume 92. 2013 | Online resources ...

  6. Interactive Electronic Decision Trees for the Integrated Primary Care Management of Febrile Children in Low Resource Settings - Review of existing tools.

    Science.gov (United States)

    Keitel, Kristina; D'Acremont, Valérie

    2018-04-20

    The lack of effective, integrated diagnostic tools pose a major challenge to the primary care management of febrile childhood illnesses. These limitations are especially evident in low-resource settings and are often inappropriately compensated by antimicrobial over-prescription. Interactive electronic decision trees (IEDTs) have the potential to close these gaps: guiding antibiotic use and better identifying serious disease. This narrative review summarizes existing IEDTs, to provide an overview of their degree of validation, as well as to identify gaps in current knowledge and prospects for future innovation. Structured literature review in PubMed and Embase complemented by google search and contact with developers. Six integrated IEDTs were identified: three (eIMCI, REC, and Bangladesh digital IMCI) based on Integrated Management of Childhood Illnesses (IMCI); four (SL eCCM, MEDSINC, e-iCCM, and D-Tree eCCM) on Integrated Community Case Management (iCCM); two (ALMANACH, MSFeCARE) with a modified IMCI content; and one (ePOCT) that integrates novel content with biomarker testing. The types of publications and evaluation studies varied greatly: the content and evidence-base was published for two (ALMANACH and ePOCT), ALMANACH and ePOCT were validated in efficacy studies. Other types of evaluations, such as compliance, acceptability were available for D-Tree eCCM, eIMCI, ALMANACH. Several evaluations are still ongoing. Future prospects include conducting effectiveness and impact studies using data gathered through larger studies to adapt the medical content to local epidemiology, improving the software and sensors, and Assessing factors that influence compliance and scale-up. IEDTs are valuable tools that have the potential to improve management of febrile children in primary care and increase the rational use of diagnostics and antimicrobials. Next steps in the evidence pathway should be larger effectiveness and impact studies (including cost analysis) and

  7. A primer on precision medicine informatics.

    Science.gov (United States)

    Sboner, Andrea; Elemento, Olivier

    2016-01-01

    In this review, we describe key components of a computational infrastructure for a precision medicine program that is based on clinical-grade genomic sequencing. Specific aspects covered in this review include software components and hardware infrastructure, reporting, integration into Electronic Health Records for routine clinical use and regulatory aspects. We emphasize informatics components related to reproducibility and reliability in genomic testing, regulatory compliance, traceability and documentation of processes, integration into clinical workflows, privacy requirements, prioritization and interpretation of results to report based on clinical needs, rapidly evolving knowledge base of genomic alterations and clinical treatments and return of results in a timely and predictable fashion. We also seek to differentiate between the use of precision medicine in germline and cancer. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  8. Feline dental radiography and radiology: A primer.

    Science.gov (United States)

    Niemiec, Brook A

    2014-11-01

    Information crucial to the diagnosis and treatment of feline oral diseases can be ascertained using dental radiography and the inclusion of this technology has been shown to be the best way to improve a dental practice. Becoming familar with the techniques required for dental radiology and radiography can, therefore, be greatly beneficial. Novices to dental radiography may need some time to adjust and become comfortable with the techniques. If using dental radiographic film, the generally recommended 'E' or 'F' speeds may be frustrating at first, due to their more specific exposure and image development requirements. Although interpreting dental radiographs is similar to interpreting a standard bony radiograph, there are pathologic states that are unique to the oral cavity and several normal anatomic structures that may mimic pathologic changes. Determining which teeth have been imaged also requires a firm knowledge of oral anatomy as well as the architecture of dental films/digital systems. This article draws on a range of dental radiography and radiology resources, and the benefit of the author's own experience, to review the basics of taking and interpreting intraoral dental radiographs. A simplified method for positioning the tubehead is explained and classic examples of some common oral pathologies are provided. © ISFM and AAFP 2014.

  9. Library resources on the Internet

    Science.gov (United States)

    Buchanan, Nancy L.

    1995-07-01

    Library resources are prevalent on the Internet. Library catalogs, electronic books, electronic periodicals, periodical indexes, reference sources, and U.S. Government documents are available by telnet, Gopher, World Wide Web, and FTP. Comparatively few copyrighted library resources are available freely on the Internet. Internet implementations of library resources can add useful features, such as full-text searching. There are discussion lists, Gophers, and World Wide Web pages to help users keep up with new resources and changes to existing ones. The future will bring more library resources, more types of library resources, and more integrated implementations of such resources to the Internet.

  10. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  11. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  12. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  13. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  14. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  15. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  16. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  17. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  18. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  19. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  20. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  1. Herpes - resources

    Science.gov (United States)

    Genital herpes - resources; Resources - genital herpes ... following organizations are good resources for information on genital herpes : March of Dimes -- www.marchofdimes.org/complications/sexually- ...

  2. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  3. The Use of Quality Benchmarking in Assessing Web Resources for the Dermatology Virtual Branch Library of the National electronic Library for Health (NeLH)

    OpenAIRE

    Boulos, MN Kamel; Roudsari, AV; Gordon, C; Gray, JA Muir

    2001-01-01

    Background In 1998, the U.K. National Health Service Information for Health Strategy proposed the implementation of a National electronic Library for Health to provide clinicians, healthcare managers and planners, patients and the public with easy, round the clock access to high quality, up-to-date electronic information on health and healthcare. The Virtual Branch Libraries are among the most important components of the National electronic Library for Health . They aim at creating online kno...

  4. Genetics on the Fly: A Primer on the Drosophila Model System

    Science.gov (United States)

    Hales, Karen G.; Korey, Christopher A.; Larracuente, Amanda M.; Roberts, David M.

    2015-01-01

    Fruit flies of the genus Drosophila have been an attractive and effective genetic model organism since Thomas Hunt Morgan and colleagues made seminal discoveries with them a century ago. Work with Drosophila has enabled dramatic advances in cell and developmental biology, neurobiology and behavior, molecular biology, evolutionary and population genetics, and other fields. With more tissue types and observable behaviors than in other short-generation model organisms, and with vast genome data available for many species within the genus, the fly’s tractable complexity will continue to enable exciting opportunities to explore mechanisms of complex developmental programs, behaviors, and broader evolutionary questions. This primer describes the organism’s natural history, the features of sequenced genomes within the genus, the wide range of available genetic tools and online resources, the types of biological questions Drosophila can help address, and historical milestones. PMID:26564900

  5. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.

    Science.gov (United States)

    Duina, Andrea A; Miller, Mary E; Keeney, Jill B

    2014-05-01

    The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.

  6. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  7. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  8. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  9. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  10. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  11. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  12. Analysis on Current Situation and Countermeasure of Domestic Electronic Commerce Logistics in the Internet Age——Based on Resource Dependence Theory

    Directory of Open Access Journals (Sweden)

    Zhang Jiapeng

    2017-01-01

    Full Text Available This paper analyzes the status of electric business logistics in the current Internet era in China, and combines the SWOT analysis with AHP to do the empirical analysis, then puts forward the countermeasure that the electric business logistics resource should be shared based on the resource dependence theory. Through the empirical analysis, it is found that the disadvantages and opportunities of the logistics status are important in the Internet era.The resource sharing strategy based on the resource dependence theory is more scientific. The rational use of Internet technology in electric business logistics industry can achieve “sharing”. It is of great significance for its balanced development, intelligent development and optimization and development.

  13. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  14. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  15. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  16. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  17. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  18. Planning your first wind power project. A primer for utilities: Everything you need to know to bring your first wind power plant on-line

    International Nuclear Information System (INIS)

    Conover, K.; Davis, E.

    1994-12-01

    This primer has been prepared to help utility personnel become familiar with some or the details relative to wind power technology and project development. It is written as a series of relatively independent chapters to address specific topics or phases of wind power evaluation and development as they might occur within a utility. The topics include: wind prospecting and the first pass analysis, resource validation, project feasibility, resource planning and evaluation, resource acquisition, project development, equipment selection, project design and construction, and plant operation and maintenance

  19. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  20. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  1. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  2. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  3. An optoelectronic detecting based environment perception experiment for primer students using multiple-layer laser scanner

    Science.gov (United States)

    Wang, Shifeng; Wang, Rui; Zhang, Pengfei; Dai, Xiang; Gong, Dawei

    2017-08-01

    One of the motivations of OptoBot Lab is to train primer students into qualified engineers or researchers. The series training programs have been designed by supervisors and implemented with tutoring for students to test and practice their knowledge from textbooks. An environment perception experiment using a 32 layers laser scanner is described in this paper. The training program design and laboratory operation is introduced. The four parts of the experiments which are preparation, sensor calibration, 3D space reconstruction, and object recognition, are the participating students' main tasks for different teams. This entire program is one of the series training programs that play significant role in establishing solid research skill foundation for opto-electronic students.

  4. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  5. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  6. Peran Keluarga dalam Pengelolaan Kasus di Layanan Primer Melalui Five Family Oriented Questions

    Directory of Open Access Journals (Sweden)

    Retno Asti Werdhani

    2017-04-01

    Full Text Available Pengelolaan kasus di layanan primer dengan pendekatan kedokteran keluarga memperhatikan potensi keluarga sebagai sumber daya pendukung dan atau penghambat keberhasilan penatalaksanaan pasien. Penelitian ini bertujuan untuk melihat gambaran kasus di layanan primer dan persepsi keluarga mengenai pasien melalui five family oriented question (FFOQ. Pengambilan data dilakukan menggunakan kuesioner pada 162 pasien Puskesmas dan Klinik di DKI Jakarta pada tahun 2015–2016. Kuesioner terdiri atas karakteristik pasien dan 5 pertanyaan terbuka FFOQ. Analisis dilakukan secara kuantitatif dan kualitatif. Hasilnya menunjukkan sebagian besar kasus di layanan primer adalah penyakit non-infeksi (82,7% dengan proporsi usia terbanyak adalah >40 tahun (76,5%. Persepsi pasien dan keluarga tentang penyebab penyakit dan cara mengatasinya masih bervariasi. Orang tua, pasangan, dan anak merupakan anggota keluarga yang paling menguatirkan kondisi pasien. Sebanyak 71,6% responden merasa ada stresor dalam keluarganya. Sumber stresor bervariasi antara lain sosial ekonomi, keluarga, pekerjaan, dan diri sendiri. Dukungan kepada pasien berupa dukungan emosional dan finansial yang diberikan oleh anggota keluarga sesuai kemampuan masing-masing. Disimpulkan keluarga berperan sebagai faktor pendukung dan penghambat dalam pengelolaan kasus di layanan primer untuk menunjang pengelolaan lebih berorientasi kepada pasien dan keluarga. Kata Kunci: five family oriented question, keluarga, layanan primer     Family Acts in Cases Management In Primary Care through The Five Family Oriented Question   Abstract Family oriented in primary care sees family as supporting resources/inhibiting case management accomplishment. The aim of this study was describing cases in primary care and family perception of the patient through the five family oriented question (FFOQ. Interviews were conducted in 162 patients from public health centers and clinics in DKI Jakarta year 2015–2016. Data were

  7. White-nose syndrome in bats: a primer for resource managers

    Science.gov (United States)

    Castle, K.T.; Cryan, P.M.

    2010-01-01

    White-nose syndrome emerged as a devastating new disease of North American hibernating bats over the past four winters. The disease has spread more than 1,600 kilometers (1,000 mi) since it was first observed in a small area of upstate New York, and has affected six species of bats in the caves and mines they rely on for winter survival. A newly discovered, cold-loving fungus (Geomyces destructans) causes the characteristic skin infection of white-nose syndrome and can infect presumably healthy bats when they hibernate. Although clear links between skin infection by G. destructans and death have not yet been established, the fungus is the most plausible cause of the disease. Thousands of caves and mines are administered by the National Park Service. Although bats testing positive for white-nose syndrome have been detected only at two sites in the National Park System thus far, the National Park Service (NPS) has been preparing for the spread and effects of white-nose syndrome through a proactive national program of response coordination, research support and interpretation, and education. National park areas across the nation are uniquely situated to help understand white-nose syndrome and its ecosystem impacts, and assist in the conservation and recovery of affected bat species.

  8. How Students Learn: Ways of Thinking about "Good Learning" in HE. EDNER (Formative Evaluation of the Distributed National Electronic Resource) Project. Issues Paper.

    Science.gov (United States)

    Manchester Metropolitan Univ. (England).

    This issues paper, one of a series of eight, is intended to distill formative evaluation questions on topics that are central to the development of the higher and further education information environment in the United Kingdom. The topic of this first issues paper is a conceptual framework that can help members of a project (information resource)…

  9. 大學圖書館電子資源之需求分析與行銷策略之研究 A Study of Demands Analysis and Marketing Strategy of Electronic Resources in University Library

    Directory of Open Access Journals (Sweden)

    Huang-Yu Liu

    2008-03-01

    Full Text Available 電子資源的出現,使得知識載體有了新的突破,提高了使用者的便利性與即時性。對於圖書館而言,如何使電子資源的使用效益達到最高,必須思考一套有效的行銷策略。電子資源行銷概念應以讀者為導向,尊重讀者的資訊需求,並利用各種宣傳技巧,行銷電子資源,使圖書館能提供更完善的服務。本研究之目的旨在探討讀者的使用需求及電子資源的推廣策略,以獲致最有效益的行銷方式。研究對象以開南大學日間部四學院(商學院、運輸觀光學院、資訊學院、人文社會學院)學生為樣本,佐以缺口分析模型為分析架構,藉以找出個案中讀者/學生對於電子資源使用的真實需求,並進而歸納出提供服務的大學圖書館在其推廣或行銷服務上可有的因應策略。The emergence of electronic resources has made new breakthrough in knowledge carriers because of their ease of use, instant availability, and the characteristic of no time and space constraints. For public libraries to achieve maximum efficiency in its electronic resources, it is necessary to seek the most effective marketing strategies. Therefore, the marketing concept of the electronic resources should be reader oriented, such as respecting and understanding library user’s information needs. Libraries also need to utilize various media and techniques to market the electronic resources, so that more comprehensive services and experiences can be provided to readers. The purpose of this study is to investigate library user’s needs and promotion strategies of electronic resources in order to identify the most effective ways of marketing. This study focuses on the students of the four colleges (College of Business, College of Tourism, College of Information, and College of Humanities and Social Science in Kainan University as subjects in the survey questionnaire. It uses the Gap Analysis

  10. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  11. Forensic Scanning Electron Microscope

    Science.gov (United States)

    Keeley, R. H.

    1983-03-01

    The scanning electron microscope equipped with an x-ray spectrometer is a versatile instrument which has many uses in the investigation of crime and preparation of scientific evidence for the courts. Major applications include microscopy and analysis of very small fragments of paint, glass and other materials which may link an individual with a scene of crime, identification of firearms residues and examination of questioned documents. Although simultaneous observation and chemical analysis of the sample is the most important feature of the instrument, other modes of operation such as cathodoluminescence spectrometry, backscattered electron imaging and direct x-ray excitation are also exploited. Marks on two bullets or cartridge cases can be compared directly by sequential scanning with a single beam or electronic linkage of two instruments. Particles of primer residue deposited on the skin and clothing when a gun is fired can be collected on adhesive tape and identified by their morphology and elemental composition. It is also possible to differentiate between the primer residues of different types of ammunition. Bullets may be identified from the small fragments left behind as they pass through the body tissues. In the examination of questioned documents the scanning electron microscope is used to establish the order in which two intersecting ink lines were written and to detect traces of chemical markers added to the security inks on official documents.

  12. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  13. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  14. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  15. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  16. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  17. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  18. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  19. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  20. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  1. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  2. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  3. Application of electronic learning tools for training of specialists in the field of information technologies for enterprises of mineral resources sector

    Directory of Open Access Journals (Sweden)

    Е. В. Катунцов

    2017-08-01

    Full Text Available The article shows the advantages of using modern electronic learning tools in the training of specialists for the mineral and raw materials complex and considers the basic principles of organizing training using these tools. The experience of using electronic learning tools using foreign teaching materials and involving foreign professors is described. A special attention is given to the electronic learning environment of the Cisco Networking Academy – Cisco NetAcad. The experience of teaching at the Networking Academy of the Saint-Petersburg Mining University is described. Details are given to modern virtual environments for laboratory work, such as Cisco Packet Tracer, GNS3 and Emulated Virtual Environment. The experience of using electronic learning technologies at the University of Economics of Bratislava is considered. It actively cooperates with a number of universities of other countries, such as the University of International Business (Almaty, the Eurasian National University named after LN Gumilyov (Astana and the Institute of Social and Humanitarian Knowledge (Kazan.

  4. An operational utility assessment [electronic resource]: measuring the effectiveness of the Joint Concept Technology Demonstration (JCTD), Joint Forces Protection Advance Security System (JFPASS)

    OpenAIRE

    McGovern, Mark; Mayor, Jeffrey D.; Symmes, Joseph

    2008-01-01

    MBA Professional Report Planning modern military operations requires an accurate intelligence assessment of potential threats, combined with a detailed assessment of the physical theater of operations. This information can then be combined with equipment and manpower resources to set up a logistically supportable operation that mitigates as much of the enemy threat as possible. Given such a daunting challenge, military planners often turn to intelligent software agents to support their...

  5. Positive Perceptions of Access to Online Library Resources Correlates with Quality and Quantity of Scholarly Publications among Finnish Academics. A Review of: Vakkari, Pertti. “Perceived Influence of the Use of Electronic Information Resources on Scholarly Work and Publication Productivity.” Journal of the American Society for Information Science and Technology 59.4 (Feb. 15, 2008: 602-12.

    Directory of Open Access Journals (Sweden)

    Scott Marsalis

    2008-12-01

    Full Text Available Objective – To investigate the relationship between academics’ use of library electronic resources and their opinions regarding how these resources have impacted their work, and to investigate the association between this perceived influence and publication productivity during the previous two years.Design – Two specific questions added to an annual online user-survey questionnaire; additional data mined from surveySetting – Twenty-two Finnish Universities served by FinELib, the Finnish Electronic Library.Subjects – Seven hundred and sixty seven academic staff and full-time doctoral students.Methods – A questionnaire was posted in April 2007 on FinELib’s homepage and advertised on each university library’s mainpage, and focused on respondents’ experience in the previous two years. Participants selected answers either from a list of category choices, or, when measuring perceptions, by rating agreement with statements along a four-point scale. Controlled variables measured were the respondents’ academic position, their discipline, membership in a research group, whether their literature use was discipline-specific or interdisciplinary, and their perception of the availability online of the relevant core literature. The independent variable measured was the scholars’ perception of the impact of the use of electronic library resources on their work. The dependent variable measured was the scholars’ self-reported publications in the two years preceding the survey.Main Results – Participants reported a positive impact on the efficiency of their work, most strongly in areas of ease of access, with lesser impacts in the range of materials available to them and the ease with which they can keep up-to-date in their field. To a lesser extent, the scholars perceived a positive impact on the quality of their work. Upon analysis, the study found that access to online library resources improved scholars’ work by the interconnected

  6. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  7. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  8. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  9. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  10. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  11. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  12. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  13. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  14. Power Electronics

    DEFF Research Database (Denmark)

    Iov, Florin; Ciobotaru, Mihai; Blaabjerg, Frede

    2008-01-01

    is to change the electrical power production sources from the conventional, fossil (and short term) based energy sources to renewable energy resources. The other is to use high efficient power electronics in power generation, power transmission/distribution and end-user application. This paper discuss the most...... emerging renewable energy sources, wind energy, which by means of power electronics are changing from being a minor energy source to be acting as an important power source in the energy system. Power electronics is the enabling technology and the presentation will cover the development in wind turbine...... technology from kW to MW, discuss which power electronic solutions are most feasible and used today....

  15. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  16. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  18. Merge of terminological resources

    DEFF Research Database (Denmark)

    Henriksen, Lina; Braasch, Anna

    2012-01-01

    In our globalized world, the amount of cross-national communication increases rapidly, which also calls for easy access to multi-lingual high quality terminological resources. Sharing of terminology resources is currently becoming common practice, and efficient strategies for integration...... – or merging – of terminology resources are strongly needed. This paper discusses prerequisites for successful merging with the focus on identification of candidate duplicates of a subject domain found in the resources to be merged, and it describes automatic merging strategies to be applied to such duplicates...... in electronic terminology resources. Further, some perspectives of manual, supplementary assessment methods supporting the automatic procedures are sketched. Our considerations are primarily based on experience gained in the IATE and EuroTermBank projects, as merging was a much discussed issue in both projects....

  19. Renewable energy resources

    DEFF Research Database (Denmark)

    Ellabban, Omar S.; Abu-Rub, Haitham A.; Blaabjerg, Frede

    2014-01-01

    Electric energy security is essential, yet the high cost and limited sources of fossil fuels, in addition to the need to reduce greenhouse gasses emission, have made renewable resources attractive in world energy-based economies. The potential for renewable energy resources is enormous because...... they can, in principle, exponentially exceed the world's energy demand; therefore, these types of resources will have a significant share in the future global energy portfolio, much of which is now concentrating on advancing their pool of renewable energy resources. Accordingly, this paper presents how...... renewable energy resources are currently being used, scientific developments to improve their use, their future prospects, and their deployment. Additionally, the paper represents the impact of power electronics and smart grid technologies that can enable the proportionate share of renewable energy...

  20. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  1. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  2. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  3. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  4. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  5. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  6. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  7. EFFECTIVE ELECTRONIC TUTORIAL

    Directory of Open Access Journals (Sweden)

    Andrei A. Fedoseev

    2014-01-01

    Full Text Available The article analyzes effective electronic tutorials creation and application based on the theory of pedagogy. Herewith the issues of necessary electronic tutorial functional, ways of the educational process organization with the use of information and communication technologies and the logistics of electronic educational resources are touched upon. 

  8. Permanent genetic resources added to molecular ecology resources database 1 june 2011–31 july 2011

    DEFF Research Database (Denmark)

    Barker, F. Keith; Bell, James J.; Bogdanowicz, Steven M.

    2011-01-01

    This article documents the addition of 112 microsatellite marker loci and 24 pairs of single nucleotide polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Agelaius phoeniceus, Austrolittorina cincta, Circus cyaneus......, Circus macrourus, Circus pygargus, Cryptocoryne · purpurea Ridl. nothovar. purpurea, Mya arenaria, Patagioenas squamosa, Prochilodus mariae, Scylla serrata and Scytalopus speluncae. These loci were cross-tested on the following species: Cryptocoryne · purpurea nothovar. purpurea, Cryptocoryne affinis...

  9. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  10. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  11. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  12. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  13. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  14. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  15. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  16. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  17. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  18. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  19. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  20. Real-world health outcomes in adults with moderate-to-severe psoriasis in the United States: a population study using electronic health records to examine patient-perceived treatment effectiveness, medication use, and healthcare resource utilization.

    Science.gov (United States)

    Armstrong, April W; Foster, Shonda A; Comer, Brian S; Lin, Chen-Yen; Malatestinic, William; Burge, Russel; Goldblum, Orin

    2018-06-28

    Little is known regarding real-world health outcomes data among US psoriasis patients, but electronic health records (EHR) that collect structured data at point-of-care may provide opportunities to investigate real-world health outcomes among psoriasis patients. Our objective was to investigate patient-perceived treatment effectiveness, patterns of medication use (duration, switching, and/or discontinuation), healthcare resource utilization, and medication costs using real-world data from psoriasis patients. Data for adults (≥18-years) with a dermatology provider-given diagnosis of psoriasis from 9/2014-9/2015 were obtained from dermatology practices using a widely used US dermatology-specific EHR containing over 500,000 psoriasis patients. Disease severity was captured by static physician's global assessment and body surface area. Patient-perceived treatment effectiveness was assessed by a pre-defined question. Treatment switching and duration were documented. Reasons for discontinuations were assessed using pre-defined selections. Healthcare resource utilization was defined by visit frequency and complexity. From 82,621 patients with psoriasis during the study period, patient-perceived treatment effectiveness was investigated in 2200 patients. The proportion of patients reporting "strongly agree" when asked if their treatment was effective was highest for biologics (73%) and those reporting treatment adherence (55%). In 16,000 patients who received oral systemics and 21,087 patients who received biologics, median treatment duration was longer for those who received biologics (160 vs. 113 days, respectively). Treatment switching was less frequent among patients on systemic monotherapies compared to those on combination therapies. The most common reason for discontinuing biologics was loss of efficacy; the most common reason for discontinuing orals was side effects. In 28,754 patients, higher disease severity was associated with increased healthcare resource

  1. Water Resources

    International Nuclear Information System (INIS)

    Abira, M.A.

    1997-01-01

    Water is essential for life and ecological sustenance; its availability is essential component of national welfare and productivity.The country's socio-economic activities are largely dependent on the natural endowment of water resources. Kenya's water resources comprises of surface waters (rivers, lakes and wetlands) and ground water. Surface water forms 86% of total water resources while the rest is ground water Geological, topographical and climatic factors influence the natural availability and distribution of water with the rainfall distribution having the major influence. Water resources in Kenya are continuously under threat of depletion and quality degradation owing to rising population, industrialization, changing land use and settlement activities as well as natural changes. However, the anticipated climate change is likely to exacerbate the situation resulting in increased conflict over water use rights in particular, and, natural resource utilisation in general. The impacts of climate change on the water resources would lead to other impacts on environmental and socio-economic systems

  2. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  3. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  4. Quality assurance and quality control of geochemical data—A primer for the research scientist

    Science.gov (United States)

    Geboy, Nicholas J.; Engle, Mark A.

    2011-01-01

    Geochemistry is a constantly expanding science. More and more, scientists are employing geochemical tools to help answer questions about the Earth and earth system processes. Scientists may assume that the responsibility of examining and assessing the quality of the geochemical data they generate is not theirs but rather that of the analytical laboratories to which their samples have been submitted. This assumption may be partially based on knowledge about internal and external quality assurance and quality control (QA/QC) programs in which analytical laboratories typically participate. Or there may be a perceived lack of time or resources to adequately examine data quality. Regardless of the reason, the lack of QA/QC protocols can lead to the generation and publication of erroneous data. Because the interpretations drawn from the data are primary products to U.S. Geological Survey (USGS) stakeholders, the consequences of publishing erroneous results can be significant. The principal investigator of a scientific study ultimately is responsible for the quality and interpretation of the project's findings, and thus must also play a role in the understanding, implementation, and presentation of QA/QC information about the data. Although occasionally ignored, QA/QC protocols apply not only to procedures in the laboratory but also in the initial planning of a research study and throughout the life of the project. Many of the tenets of developing a sound QA/QC program or protocols also parallel the core concepts of developing a good study: What is the main objective of the study? Will the methods selected provide data of enough resolution to answer the hypothesis? How should samples be collected? Are there known or unknown artifacts or contamination sources in the sampling and analysis methods? Assessing data quality requires communication between the scientists responsible for designing the study and those collecting samples, analyzing samples, treating data, and

  5. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  6. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  7. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  8. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  9. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  10. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  11. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  12. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  13. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  14. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  15. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  16. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  17. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  18. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  19. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  20. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  1. Electronics and electronic systems

    CERN Document Server

    Olsen, George H

    1987-01-01

    Electronics and Electronic Systems explores the significant developments in the field of electronics and electronic devices. This book is organized into three parts encompassing 11 chapters that discuss the fundamental circuit theory and the principles of analog and digital electronics. This book deals first with the passive components of electronic systems, such as resistors, capacitors, and inductors. These topics are followed by a discussion on the analysis of electronic circuits, which involves three ways, namely, the actual circuit, graphical techniques, and rule of thumb. The remaining p

  2. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  3. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  4. Uranium resources

    International Nuclear Information System (INIS)

    Gangloff, A.

    1978-01-01

    It is first indicated how to evaluate the mining resources as a function of the cost of production and the degree of certainty in the knowledge of the deposit. A table is given of the world resources (at the beginning 1977) and resources and reserves are compared. There is a concordance between requirements and possible production until 1990. The case of France is examined: known reserves, present and future prospection, present production (In 1978 2200 T of U metal will be produced from 3 French processing plants), production coming from Cogema. A total production of 2000 T in 1980 and 10.000 in 1985 is expected [fr

  5. Permanent genetic resources added to Molecular Ecology Resources Database 1 December 2011-31 January 2012.

    Science.gov (United States)

    Arias, M C; Arnoux, E; Bell, James J; Bernadou, Abel; Bino, Giorgia; Blatrix, R; Bourguet, Denis; Carrea, Cecilia; Clamens, Anne-Laure; Cunha, Haydée A; d'Alençon, E; Ding, Yi; Djieto-Lordon, C; Dubois, M P; Dumas, P; Eraud, C; Faivre, B; Francisco, F O; Françoso, E; Garcia, M; Gardner, Jonathan P A; Garnier, S; Gimenez, S; Gold, John R; Harris, D J; He, Guangcun; Hellemans, B; Hollenbeck, Christopher M; Jing, Shengli; Kergoat, G J; Liu, Bingfang; McDowell, Jan R; McKey, D; Miller, Terrence L; Newton, Erica; Pagenkopp Lohan, Katrina M; Papetti, Chiara; Paterson, Ian; Peccoud, J; Peng, Xinxin; Piatscheck, F; Ponsard, Sergine; Reece, Kimberly S; Reisser, Céline M O; Renshaw, Mark A; Ruzzante, Daniel E; Sauve, M; Shields, Jeffrey D; Solé-Cava, Antonio; Souche, E L; Van Houdt, J K J; Vasconcellos, Anderson; Volckaert, F A M; Wang, Shuzhen; Xiao, Jie; Yu, Hangjin; Zane, Lorenzo; Zannato, Barbara; Zemlak, Tyler S; Zhang, Chunxiao; Zhao, Yan; Zhou, Xi; Zhu, Lili

    2012-05-01

    This article documents the addition of 473 microsatellite marker loci and 71 pairs of single-nucleotide polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Barteria fistulosa, Bombus morio, Galaxias platei, Hematodinium perezi, Macrocentrus cingulum Brischke (a.k.a. M. abdominalis Fab., M. grandii Goidanich or M. gifuensis Ashmead), Micropogonias furnieri, Nerita melanotragus, Nilaparvata lugens Stål, Sciaenops ocellatus, Scomber scombrus, Spodoptera frugiperda and Turdus lherminieri. These loci were cross-tested on the following species: Barteria dewevrei, Barteria nigritana, Barteria solida, Cynoscion acoupa, Cynoscion jamaicensis, Cynoscion leiarchus, Cynoscion nebulosus, Cynoscion striatus, Cynoscion virescens, Macrodon ancylodon, Menticirrhus americanus, Nilaparvata muiri and Umbrina canosai. This article also documents the addition of 116 sequencing primer pairs for Dicentrarchus labrax. © 2012 Blackwell Publishing Ltd.

  6. Seaweed resources

    Digital Repository Service at National Institute of Oceanography (India)

    Deshmukhe, G.V.; Dhargalkar, V.K.; Untawale, A.G.

    The chapter summarizes our present knowledge of the seaweed resources of the Indian Ocean region with regard to the phytogeographical distribution, composition, biomass, utilization, cultivation, conservation and management. The voluminous data...

  7. Arthritis - resources

    Science.gov (United States)

    Resources - arthritis ... The following organizations provide more information on arthritis : American Academy of Orthopaedic Surgeons -- orthoinfo.aaos.org/menus/arthritis.cfm Arthritis Foundation -- www.arthritis.org Centers for Disease Control and Prevention -- www. ...

  8. Mineral resources

    Digital Repository Service at National Institute of Oceanography (India)

    Valsangkar, A.B.

    (placers), biogenous (ooze, limestone) or chemogenous (phosphorites and polymetallic nodules) type. In recent years, hydrothermal deposits, cobalt crust and methane gas hydrates are considered as frontier resources. Their distribution depends upon proximity...

  9. Depression - resources

    Science.gov (United States)

    Resources - depression ... Depression is a medical condition. If you think you may be depressed, see a health care provider. ... following organizations are good sources of information on depression : American Psychological Association -- www.apa.org/topics/depression/ ...

  10. Hemophilia - resources

    Science.gov (United States)

    Resources - hemophilia ... The following organizations provide further information on hemophilia : Centers for Disease Control and Prevention -- www.cdc.gov/ncbddd/hemophilia/index.html National Heart, Lung, and Blood Institute -- www.nhlbi.nih.gov/ ...

  11. Diabetes - resources

    Science.gov (United States)

    Resources - diabetes ... The following sites provide further information on diabetes: American Diabetes Association -- www.diabetes.org Juvenile Diabetes Research Foundation International -- www.jdrf.org National Center for Chronic Disease Prevention and Health Promotion -- ...

  12. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  13. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  14. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  15. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  16. Forest Resources

    Energy Technology Data Exchange (ETDEWEB)

    None

    2016-06-01

    Forest biomass is an abundant biomass feedstock that complements the conventional forest use of wood for paper and wood materials. It may be utilized for bioenergy production, such as heat and electricity, as well as for biofuels and a variety of bioproducts, such as industrial chemicals, textiles, and other renewable materials. The resources within the 2016 Billion-Ton Report include primary forest resources, which are taken directly from timberland-only forests, removed from the land, and taken to the roadside.

  17. Making the connection: advancing traffic incident management in transportation planning : a primer.

    Science.gov (United States)

    2013-07-01

    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  18. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  19. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  20. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  1. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  2. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  3. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  4. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  5. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  6. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  7. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  8. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    Science.gov (United States)

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  9. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  10. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  12. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  13. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  14. MS&G, When Worlds Collide: A Primer for Potential

    Science.gov (United States)

    2006-07-01

    120 Broad Area Announcement ( BAA ) ................................................................ 121 Small...nor do they track or have the resources to monitor RFPs, BAAs , MURIs, SBIRs, STTRs, etc. Game companies find the maze of government contracting...in 1974, and 1 Beck , John, C. and Mitchell Wade. Got Game. Boston, MA: Harvard Business School

  15. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  16. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul

    2017-04-01

    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  17. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  18. Consumption Taxation in a Digital World : A Primer

    NARCIS (Netherlands)

    Ligthart, J.E.

    2004-01-01

    The paper reviews the economic and administrative issues that arise in the taxation of electronic commerce; addresses how best to meet the criteria of an ideal tax system; and examines recent policy developments.It is argued that destination-based taxation-is presently the norm for goods taxation is

  19. A primer for electroweak induced low-energy nuclear reactions

    Indian Academy of Sciences (India)

    paper is devoted to delineating the unifying features and to an overall synthesis of .... reaction e− + p → n + νe for electrons and protons of very low kinetic energy ..... of Z protons and N = (A − Z) neutrons where A is the total number of nucleons.

  20. Teaching Resources

    Science.gov (United States)

    Physics?" Poster Pamphlets/Books/SPIN-UP Resources Making and Sustaining Changes in Undergraduate AAPT.org - American Association of Physics Teachers Skip to content Skip to navigation Skip to local navigation AAPT - American Association of Physics Teachers Go Sign In / Online Services Join

  1. Resource Mobilization

    International Development Research Centre (IDRC) Digital Library (Canada)

    constitute endorsement of the product and is given only for information. ..... point where they could significantly impact an organization's financial viability. This alternative ... putting in place internal systems and processes that enable the resource .... control over the incorporation of non-profit organizations. ..... Accounting.

  2. Resource Mobilization

    International Development Research Centre (IDRC) Digital Library (Canada)

    Annex 1: The Scoping Study on Donor Funding for. Development Research in ... publication of the Resource Mobilization: A Practical Guide for Research .... applied the concept or technique, which validates the practical application of ... some other staff member would write up a grant application addressed to one, two, or a ...

  3. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  4. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  5. A systems engineering primer for every engineer and scientist

    Energy Technology Data Exchange (ETDEWEB)

    Edwards, William R.

    2001-12-10

    The Systems Engineering (SE) staff at LBNL has generated the following artifacts to assist projects with implementing a systems approach: (1) The present document that focuses on the what, why, and when of SE. It also provides a simple case-study to illustrate several SE tasks. (2) A web site with primary emphasis on the project life-cycle and workflow, (http://www-eng.LBNL.gov/Systems/index.html). It includes: SE guidelines and principles; A list of in-house tools; Templates; Case studies with ''how to'' examples; and Links to useful SE material. These sources are living documents to be updated as necessary. The viewpoint adopted in this document is that what LBNL engineers and scientists need is a set of principles and guiding practices for developing R and D systems rather than a ''cookbook''. There are many excellent ''how to'' resources such as the ''INCOSE Systems Engineering Handbook'' to guide those in search of more details. The SE staff is another resource available to consult and support projects. This document specifies SE principles and activities that are applicable to all LBNL projects independent of their specific differences. Each project should tailor the SE implementation to meet its individual needs and culture including project-specific resources, procedures, products, and tools.

  6. A systems engineering primer for every engineer and scientist

    International Nuclear Information System (INIS)

    Edwards, William R.

    2001-01-01

    The Systems Engineering (SE) staff at LBNL has generated the following artifacts to assist projects with implementing a systems approach: (1) The present document that focuses on the what, why, and when of SE. It also provides a simple case-study to illustrate several SE tasks. (2) A web site with primary emphasis on the project life-cycle and workflow, (http://www-eng.LBNL.gov/Systems/index.html). It includes: SE guidelines and principles; A list of in-house tools; Templates; Case studies with ''how to'' examples; and Links to useful SE material. These sources are living documents to be updated as necessary. The viewpoint adopted in this document is that what LBNL engineers and scientists need is a set of principles and guiding practices for developing R and D systems rather than a ''cookbook''. There are many excellent ''how to'' resources such as the ''INCOSE Systems Engineering Handbook'' to guide those in search of more details. The SE staff is another resource available to consult and support projects. This document specifies SE principles and activities that are applicable to all LBNL projects independent of their specific differences. Each project should tailor the SE implementation to meet its individual needs and culture including project-specific resources, procedures, products, and tools

  7. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani

    2015-12-01

    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  8. Chemical dependence - resources

    Science.gov (United States)

    Substance use - resources, Drug abuse - resources; Resources - chemical dependence ... are a good resource for information on drug dependence: National Council on Alcoholism and Drug Dependence -- ncadd. ...

  9. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  10. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  11. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  12. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  13. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    Science.gov (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  14. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  15. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  17. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  18. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  19. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  20. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  1. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  2. Algae Resources

    Energy Technology Data Exchange (ETDEWEB)

    None

    2016-06-01

    Algae are highly efficient at producing biomass, and they can be found all over the planet. Many use sunlight and nutrients to create biomass, which contain key components—including lipids, proteins, and carbohydrates— that can be converted and upgraded to a variety of biofuels and products. A functional algal biofuels production system requires resources such as suitable land and climate, sustainable management of water resources, a supplemental carbon dioxide (CO2) supply, and other nutrients (e.g., nitrogen and phosphorus). Algae can be an attractive feedstock for many locations in the United States because their diversity allows for highpotential biomass yields in a variety of climates and environments. Depending on the strain, algae can grow by using fresh, saline, or brackish water from surface water sources, groundwater, or seawater. Additionally, they can grow in water from second-use sources such as treated industrial wastewater; municipal, agricultural, or aquaculture wastewater; or produced water generated from oil and gas drilling operations.

  3. Uranium resources

    International Nuclear Information System (INIS)

    1976-01-01

    This is a press release issued by the OECD on 9th March 1976. It is stated that the steep increases in demand for uranium foreseen in and beyond the 1980's, with doubling times of the order of six to seven years, will inevitably create formidable problems for the industry. Further substantial efforts will be needed in prospecting for new uranium reserves. Information is given in tabular or graphical form on the following: reasonably assured resources, country by country; uranium production capacities, country by country; world nuclear power growth; world annual uranium requirements; world annual separative requirements; world annual light water reactor fuel reprocessing requirements; distribution of reactor types (LWR, SGHWR, AGR, HWR, HJR, GG, FBR); and world fuel cycle capital requirements. The information is based on the latest report on Uranium Resources Production and Demand, jointly issued by the OECD's Nuclear Energy Agency (NEA) and the International Atomic Energy Agency. (U.K.)

  4. Water resources

    International Nuclear Information System (INIS)

    2002-01-01

    The report entitled Climate Change Impacts and Adaptation : A Canadian Perspective, presents a summary of research regarding the impacts of climate change on key sectors over the past five years as it relates to Canada. This chapter on water resources describes how climate change will affect the supply of water in Canada. Water is one of Canada's greatest resources, which contributes about $7.5 to 23 billion per year to the Canadian economy. The decisions taken to adapt to climate change within the water resources sector will have profound implications in many other areas such as agriculture, human health, transportation and industry. The water related problems include water quality issues that relate to water shortages from droughts, or excesses from floods. The Intergovernmental Panel on Climate Change forecasts an increase in global average surface air temperatures of 1.4 to 5.8 degrees C by 2100. Such a change would impact the hydrological cycle, affecting runoff, evaporation patterns, and the amount of water stored in glaciers, lakes, wetlands and groundwater. The uncertainty as to the magnitude of these changes is due to the difficulty that climate models have in projecting future changes in regional precipitation patterns and extreme events. This chapter presents potential impacts of climate change on water resources in the Yukon, British Columbia, the Prairies, the Great Lakes basin, the Atlantic provinces, and the Arctic and Subarctic. The associated concerns for each region were highlighted. Adaptation research has focused on the impacts of supply and demand, and on options to adapt to these impacts. 60 refs., 2 tabs., 1 fig

  5. Resource Abundance and Resource Dependence in China

    NARCIS (Netherlands)

    Ji, K.; Magnus, J.R.; Wang, W.

    2010-01-01

    This paper reconsiders the ‘curse of resources’ hypothesis for the case of China, and distinguishes between resource abundance, resource rents, and resource dependence. Resource abundance and resource rents are shown to be approximately equivalent, and their association with resource dependence

  6. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  7. Internet and Electronic Information Management

    Science.gov (United States)

    2004-12-01

    centers to form consortia and share electronic information sources. Although traditional resource sharing arrangements encouraged competition rather...outside world, through public relations and through marketing information products or services, to its own competitive advantage (Davenport 1997: 193-217... electronic information sources are a challenge for electronic information managers. Libraries and information centers are no longer “the only game in town

  8. Automotive electronics design fundamentals

    CERN Document Server

    Zaman, Najamuz

    2015-01-01

    This book explains the topology behind automotive electronics architectures and examines how they can be profoundly augmented with embedded controllers. These controllers serve as the core building blocks of today’s vehicle electronics. Rather than simply teaching electrical basics, this unique resource focuses on the fundamental concepts of vehicle electronics architecture, and details the wide variety of Electronic Control Modules (ECMs) that enable the increasingly sophisticated "bells & whistles" of modern designs.  A must-have for automotive design engineers, technicians working in automotive electronics repair centers and students taking automotive electronics courses, this guide bridges the gap between academic instruction and industry practice with clear, concise advice on how to design and optimize automotive electronics with embedded controllers.

  9. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  10. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  11. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  12. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  13. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  14. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  15. RFID explained a primer on radio frequency identification technologies

    CERN Document Server

    Want, Roy

    2006-01-01

    This lecture provides an introduction to Radio Frequency Identification (RFID), a technology enabling automatic identification of objects at a distance without requiring line-of-sight. Electronic tagging can be divided into technologies that have a power source (active tags), and those that are powered by the tag interrogation signal (passive tags); the focus here is on passive tags. An overview of the principles of the technology divides passive tags into devices that use either near field or far field coupling to communicate with a tag reader. The strengths and weaknesses of the approaches a

  16. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  17. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  18. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  19. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari

    2015-05-01

    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  20. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.