WorldWideScience

Sample records for primary erythroid cells

  1. Human primary erythroid cells as a more sensitive alternative in vitro hematological model for nanotoxicity studies: Toxicological effects of silver nanoparticles.

    Science.gov (United States)

    Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan

    2015-12-01

    Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. CTCF and CohesinSA-1 Mark Active Promoters and Boundaries of Repressive Chromatin Domains in Primary Human Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Laurie A Steiner

    Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.

  3. A hanging drop culture method to study terminal erythroid differentiation.

    Science.gov (United States)

    Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

    2005-10-01

    To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

  4. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna

    2017-01-01

    are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark

  5. Recombinant human parvovirus B19 vectors: erythroid cell-specific delivery and expression of transduced genes.

    Science.gov (United States)

    Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A

    1998-06-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and

  6. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    Science.gov (United States)

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited

  7. Identification of Cell Type-Specific Differences in Erythropoietin Receptor Signaling in Primary Erythroid and Lung Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Ruth Merkle

    2016-08-01

    Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in

  8. Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis

    KAUST Repository

    Barbarani, Gloria

    2017-10-20

    The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.

  9. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  10. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  11. Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation

    International Nuclear Information System (INIS)

    Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella

    2010-01-01

    Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment

  12. A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

    Directory of Open Access Journals (Sweden)

    Ikuta T

    2013-12-01

    Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

  13. Studies of globin gene expression in differentiating erythroid cells

    International Nuclear Information System (INIS)

    Sullivan, T.D.

    1985-01-01

    The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation

  14. Establishment of immortalized human erythroid progenitor cell lines able to produce enucleated red blood cells.

    Directory of Open Access Journals (Sweden)

    Ryo Kurita

    Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.

  15. Erythroid differentiation of human induced pluripotent stem cells is independent of donor cell type of origin.

    Science.gov (United States)

    Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm

    2015-01-01

    Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.

  16. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

    Science.gov (United States)

    Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

  17. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2013-12-15

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.

  18. The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

    2013-01-01

    Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation

  19. Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.

    Science.gov (United States)

    Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A

    2004-10-01

    A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.

  20. Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells

    International Nuclear Information System (INIS)

    Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)

  1. Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)

    1976-01-01

    Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.

  2. Serum-free Erythroid Differentiation for Efficient Genetic Modification and High-Level Adult Hemoglobin Production.

    Science.gov (United States)

    Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F

    2018-06-15

    In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.

  3. Dimethyl sulfoxide-inducible cytoplasmic factor involved in erythroid differentiation in mouse erythroleukemia (Friend) cells

    International Nuclear Information System (INIS)

    Watanabe, T.; Oishi, M.

    1987-01-01

    A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed

  4. Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.

    Directory of Open Access Journals (Sweden)

    Eyayu Belay

    Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.

  5. Molecular pathways of early CD105-positive erythroid cells as compared with CD34-positive common precursor cells by flow cytometric cell-sorting and gene expression profiling

    International Nuclear Information System (INIS)

    Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P

    2013-01-01

    Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository

  6. Generation of a High Number of Healthy Erythroid Cells from Gene-Edited Pyruvate Kinase Deficiency Patient-Specific Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Zita Garate

    2015-12-01

    Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.

  7. Generation of erythroid cells from polyploid giant cancer cells: re-thinking about tumor blood supply.

    Science.gov (United States)

    Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu

    2018-04-01

    During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.

  8. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  9. Erythroid cells in vitro: from developmental biology to blood transfusion products.

    Science.gov (United States)

    Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni

    2009-07-01

    Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.

  10. Carbon monoxide induced erythroid differentiation of K562 cells mimics the central macrophage milieu in erythroblastic islands.

    Directory of Open Access Journals (Sweden)

    Shlomi Toobiak

    Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.

  11. MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B

    Directory of Open Access Journals (Sweden)

    Dongsheng Wang

    2018-03-01

    Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.

  12. Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle

    International Nuclear Information System (INIS)

    Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella

    2012-01-01

    Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.

  13. Erythroid differentiation and commitment in rat erythroleukemia cells with hypertonic culture conditions.

    OpenAIRE

    Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M

    1981-01-01

    Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...

  14. Monomethylfumarate induces γ-globin expression and fetal hemoglobin production in cultured human retinal pigment epithelial (RPE) and erythroid cells, and in intact retina.

    Science.gov (United States)

    Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M

    2014-05-13

    Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  15. Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells

    International Nuclear Information System (INIS)

    Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.

    1987-01-01

    The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes

  16. DJ-1 Modulates Nuclear Erythroid 2-Related Factor-2-Mediated Protection in Human Primary Alveolar Type II Cells in Smokers.

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M; Zhou, Wenbo; Tuder, Rubin M; Freed, Curt R; Chu, Hong Wei; Kelsen, Steven G; Bowler, Russell P; Mason, Robert J; Kosmider, Beata

    2016-09-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2-related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases.

  17. Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.

    Directory of Open Access Journals (Sweden)

    Abigail A Lamikanra

    2009-12-01

    Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that

  18. Parvovirus B19 integration into human CD36+ erythroid progenitor cells.

    Science.gov (United States)

    Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik

    2017-11-01

    The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Leukemic blast cell colony formation in semisolid culture with erythropoietin: a case report of acute poorly differentiated erythroid leukemia.

    Science.gov (United States)

    Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T

    1987-02-01

    The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.

  20. Expression of assayable residual stem cell damage in erythroid differentiation

    International Nuclear Information System (INIS)

    Huebner, G.E.; Miller, M.E.; Cronkite, E.P.

    1985-01-01

    In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)

  1. Biosynthesis of heme in immature erythroid cells. The regulatory step for heme formation in the human erythron

    International Nuclear Information System (INIS)

    Gardner, L.C.; Cox, T.M.

    1988-01-01

    Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation

  2. MLL-ENL cooperates with SCF to transform primary avian multipotent cells.

    Science.gov (United States)

    Schulte, Cathleen E; von Lindern, Marieke; Steinlein, Peter; Beug, Hartmut; Wiedemann, Leanne M

    2002-08-15

    The MLL gene is targeted by chromosomal translocations, which give rise to heterologous MLL fusion proteins and are associated with distinct types of acute lymphoid and myeloid leukaemia. To determine how MLL fusion proteins alter the proliferation and/or differentiation of primary haematopoietic progenitors, we introduced the MLL-AF9 and MLL-ENL fusion proteins into primary chicken bone marrow cells. Both fusion proteins caused the sustained outgrowth of immature haematopoietic cells, which was strictly dependent on stem cell factor (SCF). The renewing cells have a long in vitro lifespan exceeding the Hayflick limit of avian cells. Analysis of clonal cultures identified the renewing cells as immature, multipotent progenitors, expressing erythroid, myeloid, lymphoid and stem cell surface markers. Employing a two-step commitment/differentiation protocol involving the controlled withdrawal of SCF, the MLL-ENL-transformed progenitors could be induced to terminal erythroid or myeloid differentiation. Finally, in cooperation with the weakly leukaemogenic receptor tyrosine kinase v-Sea, the MLL-ENL fusion protein gave rise to multilineage leukaemia in chicks, suggesting that other activated, receptor tyrosine kinases can substitute for ligand-activated c-Kit in vivo.

  3. Erythroblastic Sarcoma Presenting as Bilateral Ovarian Masses in an Infant with Pure Erythroid Leukemia

    Science.gov (United States)

    Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.

    2010-01-01

    Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494

  4. TMEM14C is required for erythroid mitochondrial heme metabolism.

    Science.gov (United States)

    Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H

    2014-10-01

    The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.

  5. DJ-1 Modulates Nuclear Erythroid 2–Related Factor-2–Mediated Protection in Human Primary Alveolar Type II Cells in Smokers

    Science.gov (United States)

    Bahmed, Karim; Messier, Elise M.; Zhou, Wenbo; Tuder, Rubin M.; Freed, Curt R.; Chu, Hong Wei; Kelsen, Steven G.; Bowler, Russell P.; Mason, Robert J.

    2016-01-01

    Cigarette smoke (CS) is a main source of oxidative stress and a key risk factor for emphysema, which consists of alveolar wall destruction. Alveolar type (AT) II cells are in the gas exchange regions of the lung. We isolated primary ATII cells from deidentified organ donors whose lungs were not suitable for transplantation. We analyzed the cell injury obtained from nonsmokers, moderate smokers, and heavy smokers. DJ-1 protects cells from oxidative stress and induces nuclear erythroid 2–related factor-2 (Nrf2) expression, which activates the antioxidant defense system. In ATII cells isolated from moderate smokers, we found DJ-1 expression by RT-PCR, and Nrf2 and heme oxygenase (HO)-1 translocation by Western blotting and immunocytofluorescence. In ATII cells isolated from heavy smokers, we detected Nrf2 and HO-1 cytoplasmic localization. Moreover, we found high oxidative stress, as detected by 4-hydroxynonenal (4-HNE) (immunoblotting), inflammation by IL-8 and IL-6 levels by ELISA, and apoptosis by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay in ATII cells obtained from heavy smokers. Furthermore, we detected early DJ-1 and late Nrf2 expression after ATII cell treatment with CS extract. We also overexpressed DJ-1 by adenovirus construct and found that this restored Nrf2 and HO-1 expression and induced nuclear translocation in heavy smokers. Moreover, DJ-1 overexpression also decreased ATII cell apoptosis caused by CS extract in vitro. Our results indicate that DJ-1 activates the Nrf2-mediated antioxidant defense system. Furthermore, DJ-1 overexpression can restore the impaired Nrf2 pathway, leading to ATII cell protection in heavy smokers. This suggests a potential therapeutic strategy for targeting DJ-1 in CS-related lung diseases. PMID:27093578

  6. RECOMBINANT HUMAN MAST-CELL GROWTH-FACTOR SUPPORTS ERYTHROID COLONY FORMATION IN POLYCYTHEMIA-VERA IN THE PRESENCE AND ABSENCE OF ERYTHROPOIETIN AND SERUM

    NARCIS (Netherlands)

    MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral

  7. Identification of a human erythroid progenitor cell population which expresses the CD34 antigen and binds the plant lectin Ulex europaeus I.

    Science.gov (United States)

    Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G

    1996-01-01

    Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.

  8. Induction of erythroid differentiation in human erythroleukemia cells by depletion of malic enzyme 2.

    Directory of Open Access Journals (Sweden)

    Jian-Guo Ren

    2010-09-01

    Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel

  9. Possible interaction between B1 retrotransposon-containing sequences and β(major) globin gene transcriptional activation during MEL cell erythroid differentiation.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S

    2012-01-01

    Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited

  10. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  11. Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies.

    Science.gov (United States)

    Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S

    2015-07-01

    Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.

  12. Natural killer cells recognize friend retrovirus-infected erythroid progenitor cells through NKG2D-RAE-1 interactions In Vivo.

    Science.gov (United States)

    Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki

    2011-06-01

    Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.

  13. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.

    Directory of Open Access Journals (Sweden)

    Gloria Bua

    Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.

  14. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells

    Science.gov (United States)

    Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio

    2016-01-01

    The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771

  15. No changes in heme synthesis in human Friedreich´s ataxia erythroid progenitor cells.

    Science.gov (United States)

    Steinkellner, Hannes; Singh, Himanshu Narayan; Muckenthaler, Martina U; Goldenberg, Hans; Moganty, Rajeswari R; Scheiber-Mojdehkar, Barbara; Sturm, Brigitte

    2017-07-20

    Friedreich's ataxia (FRDA) is a neurodegenerative disease caused by reduced expression of the protein frataxin. Frataxin is thought to play a role in iron-sulfur cluster biogenesis and heme synthesis. In this study, we used erythroid progenitor stem cells obtained from FRDA patients and healthy donors to investigate the putative role, if any, of frataxin deficiency in heme synthesis. We used electrochemiluminescence and qRT-PCR for frataxin protein and mRNA quantification. We used atomic absorption spectrophotometry for iron levels and a photometric assay for hemoglobin levels. Protoporphyrin IX and Ferrochelatase were analyzed using auto-fluorescence. An "IronChip" microarray analysis followed by a protein-protein interaction analysis was performed. FRDA patient cells showed no significant changes in iron levels, hemoglobin synthesis, protoporphyrin IX levels, and ferrochelatase activity. Microarray analysis presented 11 genes that were significantly changed in all patients compared to controls. The genes are especially involved in oxidative stress, iron homeostasis and angiogenesis. The mystery about the involvement of frataxin on iron metabolism raises the question why frataxin deficiency in primary FRDA cells did not lead to changes in biochemical parameters of heme synthesis. It seems that alternative pathways can circumvent the impact of frataxin deficiency on heme synthesis. We show for the first time in primary FRDA patient cells that reduced frataxin levels are still sufficient for heme synthesis and possibly other mechanisms can overcome reduced frataxin levels in this process. Our data strongly support the fact that so far no anemia in FRDA patients was reported. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Acute erythroid neoplastic proliferations. A biological study based on 62 patients.

    Science.gov (United States)

    Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad

    2002-02-01

    The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was

  17. Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

    Science.gov (United States)

    Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

    2011-01-01

    Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

  18. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation.

    Science.gov (United States)

    Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique

    2017-07-11

    Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Nuclear Factor Erythroid 2 Regulates Human HSC Self-Renewal and T Cell Differentiation by Preventing NOTCH1 Activation

    Directory of Open Access Journals (Sweden)

    Alessandro Di Tullio

    2017-07-01

    Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.

  20. PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.

    Science.gov (United States)

    Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C

    2017-05-01

    Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.

  1. Generation and Characterization of Erythroid Cells from Human Embryonic Stem Cells and Induced Pluripotent Stem Cells: An Overview

    Directory of Open Access Journals (Sweden)

    Kai-Hsin Chang

    2011-01-01

    Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.

  2. PI3 kinase is important for Ras, MEK and Erk activation of Epo-stimulated human erythroid progenitors

    Directory of Open Access Journals (Sweden)

    Schmidt Enrico K

    2004-05-01

    Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.

  3. Iron overload promotes erythroid apoptosis through regulating HIF-1a/ROS signaling pathway in patients with myelodysplastic syndrome.

    Science.gov (United States)

    Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang

    2017-07-01

    Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. [Update on the biology of heme synthesis in erythroid cells].

    Science.gov (United States)

    Fujiwara, Tohru; Harigae, Hideo

    2015-02-01

    Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.

  5. Proteomic analysis of erythroid differentiation induced by hexamethylene bisacetamide in murine erythroleukemia cells

    Czech Academy of Sciences Publication Activity Database

    Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.

    2007-01-01

    Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007

  6. Comparison of different methods for erythroid differentiation in the K562 cell line.

    Science.gov (United States)

    Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

    2016-08-01

    To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

  7. Synergistic Effect of Sodium Butyrate and Thalidomide in the Induction of Fetal Hemoglobin Expression in Erythroid Progenitors Derived from Cord Blood CD133 + Cells

    Directory of Open Access Journals (Sweden)

    Ali Dehghanifard

    2012-07-01

    Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.

  8. Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.

    Science.gov (United States)

    Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem

    2016-12-01

    In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis

    NARCIS (Netherlands)

    von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.

    2001-01-01

    Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal

  10. Dexamethasone targeted directly to macrophages induces macrophage niches that promote erythroid expansion

    DEFF Research Database (Denmark)

    Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio

    2015-01-01

    Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...

  11. Hypoxia-inducible factor 1-mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions.

    Science.gov (United States)

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-08-01

    Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

  12. Delayed Mesoderm and Erythroid Differentiation of Murine Embryonic Stem Cells in the Absence of the Transcriptional Regulator FUBP1

    Directory of Open Access Journals (Sweden)

    Josephine Wesely

    2017-01-01

    Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.

  13. Enhanced inhibition of parvovirus B19 replication by cidofovir in extendedly exposed erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio

    2016-07-15

    Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage

    DEFF Research Database (Denmark)

    Järås, Marcus; Johnels, Petra; Agerstam, Helena

    2009-01-01

    OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...

  15. Dynamics of GATA1 binding and expression response in a GATA1-induced erythroid differentiation system

    Directory of Open Access Journals (Sweden)

    Deepti Jain

    2015-06-01

    Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.

  16. Role of the mitochondrial amino acid pool in the differential sensitivity of erythroid and myeloid cells to chloramphenicol

    International Nuclear Information System (INIS)

    Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.

    1986-01-01

    Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells

  17. Bmi-1 Regulates Extensive Erythroid Self-Renewal

    Directory of Open Access Journals (Sweden)

    Ah Ram Kim

    2015-06-01

    Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.

  18. Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.

    Science.gov (United States)

    Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio

    2017-07-15

    Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice

    Directory of Open Access Journals (Sweden)

    Ibrahim Mansur

    2016-01-01

    Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.

  20. Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.

    Science.gov (United States)

    Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali

    2017-03-01

    Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.

  1. Hydroxymethylation at Gene Regulatory Regions Directs Stem/Early Progenitor Cell Commitment during Erythropoiesis

    Directory of Open Access Journals (Sweden)

    Jozef Madzo

    2014-01-01

    Full Text Available Hematopoietic stem cell differentiation involves the silencing of self-renewal genes and induction of a specific transcriptional program. Identification of multiple covalent cytosine modifications raises the question of how these derivatized bases influence stem cell commitment. Using a replicative primary human hematopoietic stem/progenitor cell differentiation system, we demonstrate dynamic changes of 5-hydroxymethylcytosine (5-hmC during stem cell commitment and differentiation to the erythroid lineage. Genomic loci that maintain or gain 5-hmC density throughout erythroid differentiation contain binding sites for erythroid transcription factors and several factors not previously recognized as erythroid-specific factors. The functional importance of 5-hmC was demonstrated by impaired erythroid differentiation, with augmentation of myeloid potential, and disrupted 5-hmC patterning in leukemia patient-derived CD34+ stem/early progenitor cells with TET methylcytosine dioxygenase 2 (TET2 mutations. Thus, chemical conjugation and affinity purification of 5-hmC-enriched sequences followed by sequencing serve as resources for deciphering functional implications for gene expression during stem cell commitment and differentiation along a particular lineage.

  2. The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice

    International Nuclear Information System (INIS)

    Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.

    1981-01-01

    The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)

  3. Reduction of erythroid progenitors in protein-energy malnutrition.

    Science.gov (United States)

    Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio

    2007-02-01

    Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.

  4. Fusion of ZMYND8 and RELA genes in acute erythroid leukemia

    DEFF Research Database (Denmark)

    Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim

    2013-01-01

    Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...

  5. Extended flow cytometry characterization of normal bone marrow progenitor cells by simultaneous detection of aldehyde dehydrogenase and early hematopoietic antigens: implication for erythroid differentiation studies

    Directory of Open Access Journals (Sweden)

    Pascariello Caterina

    2008-05-01

    Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of

  6. Two different in vitro growth patterns for erythroid precursors in 18 patients with pure erythrocytosis

    International Nuclear Information System (INIS)

    Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.

    1982-01-01

    Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)

  7. In Vitro Large Scale Production of Human Mature Red Blood Cells from Hematopoietic Stem Cells by Coculturing with Human Fetal Liver Stromal Cells

    Directory of Open Access Journals (Sweden)

    Jiafei Xi

    2013-01-01

    Full Text Available In vitro models of human erythropoiesis are useful in studying the mechanisms of erythroid differentiation in normal and pathological conditions. Here we describe an erythroid liquid culture system starting from cord blood derived hematopoietic stem cells (HSCs. HSCs were cultured for more than 50 days in erythroid differentiation conditions and resulted in a more than 109-fold expansion within 50 days under optimal conditions. Homogeneous erythroid cells were characterized by cell morphology, flow cytometry, and hematopoietic colony assays. Furthermore, terminal erythroid maturation was improved by cosculturing with human fetal liver stromal cells. Cocultured erythroid cells underwent multiple maturation events, including decrease in size, increase in glycophorin A expression, and nuclear condensation. This process resulted in extrusion of the pycnotic nuclei in up to 80% of the cells. Importantly, they possessed the capacity to express the adult definitive β-globin chain upon further maturation. We also show that the oxygen equilibrium curves of the cord blood-differentiated red blood cells (RBCs are comparable to normal RBCs. The large number and purity of erythroid cells and RBCs produced from cord blood make this method useful for fundamental research in erythroid development, and they also provide a basis for future production of available RBCs for transfusion.

  8. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria

    NARCIS (Netherlands)

    Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.

    Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired

  9. Inhibition of erythroid cell growth by allogeneic murine lymphocytes. Evidence for a synergism between lymph node cells and thymocytes

    International Nuclear Information System (INIS)

    Blomgren, H.; Jacobsson, H.

    1974-01-01

    Murine lymphoid cells from thymus and lymph nodes were tested for synergistic response in a graft-vs-host test. The test is based on the principle that allogeneic lymphocytes inhibit erythroid cell proliferation in the spleens of irradiated mice infused with syngeneic bone marrow cells. Mixtures of thymocytes and lymph node cells from the same parental strain yielded graft-vs-host responses in irradiated F 1 -hybrids higher than expected by summing the responses of the two cell populations tested separately. A similar synergistic response was obtained using mixtures of thymocytes and lymph node cells obtained from the two parental strains of the hybrid, whereas such an effect was not detected using mixtures of lymph node cells or mixtures of thymocytes from the two parental strains. Nor could synergy be demonstrated between parental strain lymph node cells and thymocytes syngeneic with the bone marrow target cells. Thymocytes obtained from one parental strain which was injected into its irradiated F 1 -hybrid transformed into a population of sensitized cells in the spleens of the recipients. This transformation was suppressed by the simultaneous injection of lymph node cells from the second parental strain. Since there is a synergistic immune response by such cell mixtures it is concluded that thymocytes may enhance the graft-vs-host response of lymph node cells. Parental strain thymocytes and lymph node cells, the latter being specifically immunologically tolerant to the bone marrow target cells, failed to give a synergistic response indicating that thymocytes do not transform unresponsive lymphocytes into responsive, but rather enhance the reactivity of existing, specifically responsive cells. The results thus show that thymocytes may enhance the response of lymph node cells in this specific graft-vs-host assay

  10. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    International Nuclear Information System (INIS)

    Uziel, Orit; Kanfer, Gil; Beery, Einat; Yelin, Dana; Shepshelovich, Daniel; Bakhanashvili, Mary; Nordenberg, Jardena; Lahav, Meir

    2014-01-01

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway

  11. The effects of erythropoietin signaling on telomerase regulation in non-erythroid malignant and non-malignant cells

    Energy Technology Data Exchange (ETDEWEB)

    Uziel, Orit, E-mail: Oritu@clalit.org.il [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Kanfer, Gil [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Beery, Einat [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Yelin, Dana; Shepshelovich, Daniel [Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Bakhanashvili, Mary [Unit of Infectious Diseases, Sheba Medical Center, Tel-Hashomer (Israel); Nordenberg, Jardena [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Dep. of Human Molecular Genetics and Biochemistry, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Endocrinology Laboratory, Beilinson Medical Center, Petah-Tikva (Israel); Lahav, Meir [Felsenstein Medical Research Center, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel); Medicine A, Sackler School of Medicine, Tel-Aviv University, Ramat-Aviv (Israel)

    2014-07-18

    Highlights: • We assumed that some of erythropoietin adverse effects may be mediated by telomerase activity. • EPO administration increased telomerase activity, cells proliferation and migration. • The inhibition of telomerase modestly repressed the proliferative effect of erythropoietin. • Telomere shortening caused by long term inhibition of the enzyme totally abolished that effect. • This effect was mediated via the Lyn–AKT axis and not by the canonical JAK2–STAT pathway. - Abstract: Treatment with erythropoietin (EPO) in several cancers is associated with decreased survival due to cancer progression. Due to the major importance of telomerase in cancer biology we hypothesized that some of these effects may be mediated through EPO effect on telomerase. For this aim we explored the possible effects of EPO on telomerase regulation, cell migration and chemosensitivity in non-erythroid malignant and non-malignant cells. Cell proliferation, telomerase activity (TA) and cell migration increased in response to EPO. EPO had no effect on cancer cells sensitivity to cisplatinum and on the cell cycle status. The inhibition of telomerase modestly repressed the proliferative effect of EPO. Telomere shortening caused by long term inhibition of the enzyme abolished the effect of EPO, suggesting that EPO effects on cancer cells are related to telomere dynamics. TA was correlated with the levels of Epo-R. The increase in TA was mediated post-translationally through the Lyn-Src and not the canonical JAK2 pathway.

  12. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  13. Characterization of human erythroid burst-promoting activity derived from bone marrow conditioned media

    International Nuclear Information System (INIS)

    Porter, P.N.; Ogawa, M.

    1982-01-01

    Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture

  14. Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.

    Science.gov (United States)

    Sherazi, Syed Furqan Haider; Butt, Zeeshan

    2012-09-01

    AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.

  15. Prospective identification of erythroid elements in cultured peripheral blood.

    Science.gov (United States)

    Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P

    1999-04-01

    We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.

  16. Enhancement of erythroid colony growth in culture by hemin

    International Nuclear Information System (INIS)

    Porter, P.N.; Meints, R.H.; Mesner, K.

    1979-01-01

    Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)

  17. The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.

    Science.gov (United States)

    Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A

    2010-10-28

    Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.

  18. Nuclear factor erythroid 2-related factor-2 activity controls 4-hydroxynonenal metabolism and activity in prostate cancer cells.

    Science.gov (United States)

    Pettazzoni, Piergiorgio; Ciamporcero, Eric; Medana, Claudio; Pizzimenti, Stefania; Dal Bello, Federica; Minero, Valerio Giacomo; Toaldo, Cristina; Minelli, Rosalba; Uchida, Koji; Dianzani, Mario Umberto; Pili, Roberto; Barrera, Giuseppina

    2011-10-15

    4-Hydroxynonenal (HNE) is an end product of lipoperoxidation with antiproliferative and proapoptotic properties in various tumors. Here we report a greater sensitivity to HNE in PC3 and LNCaP cells compared to DU145 cells. In contrast to PC3 and LNCaP cells, HNE-treated DU145 cells showed a smaller reduction in growth and did not undergo apoptosis. In DU145 cells, HNE did not induce ROS production and DNA damage and generated a lower amount of HNE-protein adducts. DU145 cells had a greater GSH and GST A4 content and GSH/GST-mediated HNE detoxification. Nuclear factor erythroid 2-related factor-2 (Nrf2) is a regulator of the antioxidant response. Nrf2 protein content and nuclear accumulation were higher in DU145 cells compared to PC3 and LNCaP cells, whereas the expression of KEAP1, the main negative regulator of Nrf2 activity, was lower. Inhibition of Nrf2 expression with specific siRNA resulted in a reduction in GST A4 expression and GS-HNE formation, indicating that Nrf2 controls HNE metabolism. In addition, Nrf2 knockdown sensitized DU145 cells to HNE-mediated antiproliferative and proapoptotic activity. In conclusion, we demonstrated that increased Nrf2 activity resulted in a reduction in HNE sensitivity in prostate cancer cells, suggesting a potential mechanism of resistance to pro-oxidant therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage

    OpenAIRE

    Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.

    2013-01-01

    Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...

  20. Role of Nuclear Factor (Erythroid-Derived 2-Like 2 Signaling for Effects of Fumaric Acid Esters on Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Anna Hammer

    2017-12-01

    Full Text Available To date, the intracellular signaling pathways involved in dendritic cell (DC function are poorly understood. The antioxidative transcription factor nuclear factor (erythroid-derived 2-like 2 (Nrf2 has been shown to affect maturation, function, and subsequent DC-mediated T cell responses of murine and human DCs. In experimental autoimmune encephalomyelitis (EAE, as prototype animal model for a T helper cell-mediated autoimmune disease, antigen presentation, cytokine production, and costimulation by DCs play a major role. We explore the role of Nrf2 in DC function, and DC-mediated T cell responses during T cell-mediated autoimmunity of the central nervous system using genetic ablation and pharmacological activation in mice and men to corroborate our data in a translational setting. In murine and human DCs, monomethyl fumarate induced Nrf2 signaling inhibits DC maturation and DC-mediated T cell proliferation by reducing inflammatory cytokine production and expression of costimulatory molecules. In contrast, Nrf2-deficient DCs generate more activated T helper cells (Th1/Th17 but fewer regulatory T cells and foster T cell proliferation. Transfer of DCs with Nrf2 activation during active EAE reduces disease severity and T cell infiltration. Our data demonstrate that Nrf2 signaling modulates autoimmunity in murine and human systems via inhibiting DC maturation and function thus shedding further light on the mechanism of action of antioxidative stress pathways in antigen-presenting cells.

  1. ABO alleles are linked with haplotypes of an erythroid cell-specific regulatory element in intron 1 with a few exceptions attributable to genetic recombination.

    Science.gov (United States)

    Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y

    2016-01-01

    Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.

  2. The negative impact of Wnt signaling on megakaryocyte and primitive erythroid progenitors derived from human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Prasuna Paluru

    2014-03-01

    Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.

  3. The glucocorticoid receptor cooperates with the erythropoietin receptor and c-Kit to enhance and sustain proliferation of erythroid progenitors in vitro

    NARCIS (Netherlands)

    von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.

    1999-01-01

    Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors

  4. Hemolytic disease of the fetus and newborn due to anti-Ge3: combined antibody-dependent hemolysis and erythroid precursor cell growth inhibition.

    Science.gov (United States)

    Blackall, Douglas P; Pesek, Gina D; Montgomery, Matthew M; Oza, Krishna K; Arndt, Patricia A; Garratty, George; Shahcheraghi, Ali; Denomme, Gregory A

    2008-10-01

    The Gerbich (Ge) antigens are a collection of high-incidence antigens carried on the red blood cell membrane glycoproteins, glycophorins C and D. Antibodies against these antigens are uncommon, and there have been only rare case reports of hemolytic disease of the fetus and newborn due to anti-Ge. In this case report, we present a neonate with severe anemia and hyperbilirubinemia due to anti-Ge3. Routine and special laboratory studies undertaken in this case suggested two mechanisms for the patient's hemolysis and persistent anemia. Antibody-dependent hemolysis was associated with early-onset hyperbilirubinemia, anemia, and a mild reticulocytosis, and inhibition of erythroid progenitor cell growth was associated with late anemia and normal bilirubin and reticulocyte values. Though rare, anti-Ge3 can be a dangerous antibody in pregnancy. Affected neonates may require intensive initial therapy and close follow-up for at least several weeks after delivery.

  5. Identification of Stages of Erythroid Differentiation in Bone Marrow and Erythrocyte Subpopulations in Blood Circulation that Are Preferentially Lost in Autoimmune Hemolytic Anemia in Mouse.

    Directory of Open Access Journals (Sweden)

    Sreoshi Chatterjee

    Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.

  6. Andrographolide stimulates p38 mitogen-activated protein kinase-nuclear factor erythroid-2-related factor 2-heme oxygenase 1 signaling in primary cerebral endothelial cells for definite protection against ischemic stroke in rats.

    Science.gov (United States)

    Yen, Ting-Lin; Chen, Ray-Jade; Jayakumar, Thanasekaran; Lu, Wan-Jung; Hsieh, Cheng-Ying; Hsu, Ming-Jen; Yang, Chih-Hao; Chang, Chao-Chien; Lin, Yen-Kuang; Lin, Kuan-Hung; Sheu, Joen-Rong

    2016-04-01

    Stroke pathogenesis involves complex oxidative stress-related pathways. The nuclear factor erythroid-2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) pathways have been considered molecular targets in pharmacologic intervention for ischemic diseases. Andrographolide, a labdane diterpene, has received increasing attention in recent years because of its various pharmacologic activities. We determined that andrographolide modulates the mitogen-activated protein kinase (MAPK)-Nrf2-HO-1 signaling cascade in primary cerebral endothelial cells (CECs) to provide positive protection against middle cerebral artery occlusion (MCAO)-induced ischemic stroke in rats. In the present study, andrographolide (10 μM) increased HO-1 protein and messenger RNA expressions, Nrf2 phosphorylation, and nuclear translocation in CECs, and these activities were disrupted by a p38 MAPK inhibitor, SB203580, but not by the extracellular signal-regulated kinase inhibitor PD98059 or c-Jun amino-terminal kinase inhibitor SP600125. Similar results were observed in confocal microscopy analysis. Moreover, andrographolide-induced Nrf2 and HO-1 protein expressions were significantly inhibited by Nrf2 small interfering RNA. Moreover, HO-1 knockdown attenuated the protective effect of andrographolide against oxygen-glucose deprivation-induced CEC death. Andrographolide (0.1 mg/kg) significantly suppressed free radical formation, blood-brain barrier disruption, and brain infarction in MCAO-insulted rats, and these effects were reversed by the HO-1 inhibitor zinc protoporphyrin IX. The mechanism is attributable to HO-1 activation, as directly evidenced by andrographolide-induced pronounced HO-1 expression in brain tissues, which was highly localized in the cerebral capillary. In conclusion, andrographolide increased Nrf2-HO-1 expression through p38 MAPK regulation, confirming that it provides protection against MCAO-induced brain injury. These findings provide strong evidence that andrographolide could

  7. THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA

    NARCIS (Netherlands)

    DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E

    1994-01-01

    Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using

  8. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    Science.gov (United States)

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  9. Sustained enhancement of OCTN1 transporter expression in association with hydroxyurea induced gamma-globin expression in erythroid progenitors

    OpenAIRE

    Walker, Aisha L.; Ofori-Acquah, Solomon

    2016-01-01

    The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...

  10. Heme-dependent up-regulation of the α-globin gene expression by transcriptional repressor Bach1 in erythroid cells

    International Nuclear Information System (INIS)

    Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru

    2004-01-01

    The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells

  11. Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

    Science.gov (United States)

    Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

    2013-01-01

    In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

  12. Probing Conformational Stability and Dynamics of Erythroid and Nonerythroid Spectrin: Effects of Urea and Guanidine Hydrochloride

    Science.gov (United States)

    Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit

    2015-01-01

    We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632

  13. Cellular function reinstitution of offspring red blood cells cloned from the sickle cell disease patient blood post CRISPR genome editing

    Directory of Open Access Journals (Sweden)

    Jianguo Wen

    2017-06-01

    Full Text Available Abstract Background Sickle cell disease (SCD is a disorder of red blood cells (RBCs expressing abnormal hemoglobin-S (HbS due to genetic inheritance of homologous HbS gene. However, people with the sickle cell trait (SCT carry a single allele of HbS and do not usually suffer from SCD symptoms, thus providing a rationale to treat SCD. Methods To validate gene therapy potential, hematopoietic stem cells were isolated from the SCD patient blood and treated with CRISPR/Cas9 approach. To precisely dissect genome-editing effects, erythroid progenitor cells were cloned from single colonies of CRISPR-treated cells and then expanded for simultaneous gene, protein, and cellular function studies. Results Genotyping and sequencing analysis revealed that the genome-edited erythroid progenitor colonies were converted to SCT genotype from SCD genotype. HPLC protein assays confirmed reinstallation of normal hemoglobin at a similar level with HbS in the cloned genome-edited erythroid progenitor cells. For cell function evaluation, in vitro RBC differentiation of the cloned erythroid progenitor cells was induced. As expected, cell sickling assays indicated function reinstitution of the genome-edited offspring SCD RBCs, which became more resistant to sickling under hypoxia condition. Conclusions This study is an exploration of genome editing of SCD HSPCs.

  14. EPO Receptor Gain-of-Function Causes Hereditary Polycythemia, Alters CD34+ Cell Differentiation and Increases Circulating Endothelial Precursors

    Science.gov (United States)

    Perrotta, Silverio; Cucciolla, Valeria; Ferraro, Marcella; Ronzoni, Luisa; Tramontano, Annunziata; Rossi, Francesca; Scudieri, Anna Chiara; Borriello, Adriana; Roberti, Domenico; Nobili, Bruno; Cappellini, Maria Domenica; Oliva, Adriana; Amendola, Giovanni; Migliaccio, Anna Rita; Mancuso, Patrizia; Martin-Padura, Ines; Bertolini, Francesco; Yoon, Donghoon; Prchal, Josef T.; Della Ragione, Fulvio

    2010-01-01

    Background Gain-of-function of erythropoietin receptor (EPOR) mutations represent the major cause of primary hereditary polycythemia. EPOR is also found in non-erythroid tissues, although its physiological role is still undefined. Methodology/Principal Findings We describe a family with polycythemia due to a heterozygous mutation of the EPOR gene that causes a G→T change at nucleotide 1251 of exon 8. The novel EPOR G1251T mutation results in the replacement of a glutamate residue by a stop codon at amino acid 393. Differently from polycythemia vera, EPOR G1251T CD34+ cells proliferate and differentiate towards the erythroid phenotype in the presence of minimal amounts of EPO. Moreover, the affected individuals show a 20-fold increase of circulating endothelial precursors. The analysis of erythroid precursor membranes demonstrates a heretofore undescribed accumulation of the truncated EPOR, probably due to the absence of residues involved in the EPO-dependent receptor internalization and degradation. Mutated receptor expression in EPOR-negative cells results in EPOR and Stat5 phosphorylation. Moreover, patient erythroid precursors present an increased activation of EPOR and its effectors, including Stat5 and Erk1/2 pathway. Conclusions/Significance Our data provide an unanticipated mechanism for autosomal dominant inherited polycythemia due to a heterozygous EPOR mutation and suggest a regulatory role of EPO/EPOR pathway in human circulating endothelial precursors homeostasis. PMID:20700488

  15. A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Pablo Manresa

    2017-12-01

    Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.

  16. Levels of 2,3-diphosphoglycerate in Friend leukaemic cells.

    Science.gov (United States)

    Yeoh, G C

    1980-05-08

    Most cells are thought to contain trace amounts of 2,3-diphosphoglycerate (DPG), as it acts as a cofactor in the interconversion of 2-phosphoglycerate and 3-phosphoglycerate by the glycolytic enzyme phosphoglyceromutase. DPG is synthesized from 1,3-diphosphoglycerate by the action of diphosphoglycerate mutase. Lowry et al. reported levels of 29 mumol DPG per kg wet weight brain tissue which is approximately 3 pmol per 10(8) cells, assuming that 1 g of brain tissue contains 10(9) cells. In contrast, erythroid cells contain 50-100 nmol DPG per 10(8) cells, depending on the species and the stage of development. This is of the order of a 1,000-fold more DPG compared with non-erythroid cells. In red cells DPG concentration modulates the binding of oxygen to haemoglobin. I show here that erythroid precurser cells also contain markedly raised levels of DPG.

  17. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    Energy Technology Data Exchange (ETDEWEB)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)

    2009-12-11

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  18. Eto2/MTG16 and MTGR1 are heteromeric corepressors of the TAL1/SCL transcription factor in murine erythroid progenitors

    International Nuclear Information System (INIS)

    Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.

    2009-01-01

    The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.

  19. The cytoprotective role of DJ-1 and p45 NFE2 against human primary alveolar type II cell injury and emphysema.

    Science.gov (United States)

    Tan, Li Hui; Bahmed, Karim; Lin, Chih-Ru; Marchetti, Nathaniel; Bolla, Sudhir; Criner, Gerard J; Kelsen, Steven; Madesh, Muniswamy; Kosmider, Beata

    2018-02-23

    Emphysema is characterized by irreversibly enlarged airspaces and destruction of alveolar walls. One of the factors contributing to this disease pathogenesis is an elevation in extracellular matrix (ECM) degradation in the lung. Alveolar type II (ATII) cells produce and secrete pulmonary surfactants and proliferate to restore the epithelium after damage. We isolated ATII cells from control non-smokers, smokers and patients with emphysema to determine the role of NFE2 (nuclear factor, erythroid-derived 2). NFE2 is a heterodimer composed of two subunits, a 45 kDa (p45 NFE2) and 18 kDa (p18 NFE2) polypeptides. Low expression of p45 NFE2 in patients with emphysema correlated with a high ECM degradation. Moreover, we found that NFE2 knockdown increased cell death induced by cigarette smoke extract. We also studied the cross talk between p45 NFE2 and DJ-1. DJ-1 protein is a redox-sensitive chaperone that protects cells from oxidative stress. We detected that cigarette smoke significantly increased p45 NFE2 levels in DJ-1 KO mice compared to wild-type mice. Our results indicate that p45 NFE2 expression is induced by exposure to cigarette smoke, has a cytoprotective activity against cell injury, and its downregulation in human primary ATII cells may contribute to emphysema pathogenesis.

  20. ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN

    Directory of Open Access Journals (Sweden)

    Marco Gabbianelli

    2009-11-01

    In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF. In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.

  1. NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

    Directory of Open Access Journals (Sweden)

    Xingguo Zhu

    Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

  2. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7

    International Nuclear Information System (INIS)

    Goupille, Olivier; Penglong, Tipparat; Lefèvre, Carine; Granger, Marine; Kadri, Zahra; Fucharoen, Suthat; Maouche-Chrétien, Leila; Leboulch, Philippe; Chrétien, Stany

    2012-01-01

    Highlights: ► UT7 erythroleukemia cells are known to be refractory to differentiate. ► Brief JQ1 treatment initiates the first steps of erythroid differentiation program. ► Engaged UT7 cells then maturate in the presence of erythropoietin. ► Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.

  3. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7

    Energy Technology Data Exchange (ETDEWEB)

    Goupille, Olivier [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Penglong, Tipparat [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Lefevre, Carine; Granger, Marine; Kadri, Zahra [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Fucharoen, Suthat [Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Maouche-Chretien, Leila [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Leboulch, Philippe [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Genetics Division, Department of Medicine, Brigham and Women' s Hospital and Harvard Medical School, Boston, MA (United States); Chretien, Stany, E-mail: stany.chretien@cea.fr [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France)

    2012-12-07

    Highlights: Black-Right-Pointing-Pointer UT7 erythroleukemia cells are known to be refractory to differentiate. Black-Right-Pointing-Pointer Brief JQ1 treatment initiates the first steps of erythroid differentiation program. Black-Right-Pointing-Pointer Engaged UT7 cells then maturate in the presence of erythropoietin. Black-Right-Pointing-Pointer Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.

  4. Hemopoietic cell precursor responses to erythropoietin in plasma clot cultures

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, W.L.

    1979-01-01

    The time dependence of the response of mouse bone marrow cells to erythropoietin (Ep) in vitro was studied. Experiments include studies on the Ep response of marrow cells from normal, plethoric, or bled mice. Results with normal marrow reveal: (1) Not all erythroid precursors (CFU-E) are alike in their response to Ep. A significant number of the precursors develop to a mature erythroid colony after very short Ep exposures, but they account for only approx. 13% of the total colonies generated when Ep is active for 48 hrs. If Ep is active more than 6 hrs, a second population of erythroid colonies emerges at a nearly constant rate until the end of the culture. Full erythroid colony production requires prolonged exposure to erythropoietin. (2) The longer erythropoietin is actively present, the larger the number of erythroid colonies that reach 17 cells or more. Two distinct populations of immediate erythroid precursors are also present in marrow from plethoric mice. In these mice, total colony numbers are equal to or below those obtained from normal mice. However, the population of fast-responding CFU-E is consistently decreased to 10 to 20% of that found in normal marrow. The remaining colonies are formed from plethoric marrow at a rate equal to normal marrow. With increasing Ep exposures, the number of large colonies produced increases. From the marrow of bled mice, total erythroid colony production is equal to or above that of normal marrow. Two populations of colony-forming cells are again evident, with the fast-responding CFU-E being below normal levels. The lack of colonies from this group was compensated in bled mice by rapid colony production in the second population. A real increase in numbers of precursors present in this pool increased the rate of colony production in culture to twice that of normal marrow. The number of large colonies obtained from bled mice was again increased as the Ep exposure was lengthened. (ERB)

  5. Hemopoietic regeneration in murine spleen following transfusion of normal and irradiated marrow: different response of granulocyte/macrophage and erythroid precursors

    International Nuclear Information System (INIS)

    Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.

    1987-01-01

    To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)

  6. Single-Cell Network Analysis Identifies DDIT3 as a Nodal Lineage Regulator in Hematopoiesis

    Directory of Open Access Journals (Sweden)

    Cristina Pina

    2015-06-01

    Full Text Available We explore cell heterogeneity during spontaneous and transcription-factor-driven commitment for network inference in hematopoiesis. Since individual genes display discrete OFF states or a distribution of ON levels, we compute and combine pairwise gene associations from binary and continuous components of gene expression in single cells. Ddit3 emerges as a regulatory node with positive linkage to erythroid regulators and negative association with myeloid determinants. Ddit3 loss impairs erythroid colony output from multipotent cells, while forcing Ddit3 in granulo-monocytic progenitors (GMPs enhances self-renewal and impedes differentiation. Network analysis of Ddit3-transduced GMPs reveals uncoupling of myeloid networks and strengthening of erythroid linkages. RNA sequencing suggests that Ddit3 acts through development or stabilization of a precursor upstream of GMPs with inherent Meg-E potential. The enrichment of Gata2 target genes in Ddit3-dependent transcriptional responses suggests that Ddit3 functions in an erythroid transcriptional network nucleated by Gata2.

  7. An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes

    International Nuclear Information System (INIS)

    Evans, T.; Reitman, M.; Felsenfeld, G.

    1988-01-01

    The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites

  8. A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

    Science.gov (United States)

    Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

    2015-04-01

    We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

  9. Concise review: stem cell-derived erythrocytes as upcoming players in blood transfusion.

    Science.gov (United States)

    Zeuner, Ann; Martelli, Fabrizio; Vaglio, Stefania; Federici, Giulia; Whitsett, Carolyn; Migliaccio, Anna Rita

    2012-08-01

    Blood transfusions have become indispensable to treat the anemia associated with a variety of medical conditions ranging from genetic disorders and cancer to extensive surgical procedures. In developed countries, the blood supply is generally adequate. However, the projected decline in blood donor availability due to population ageing and the difficulty in finding rare blood types for alloimmunized patients indicate a need for alternative red blood cell (RBC) transfusion products. Increasing knowledge of processes that govern erythropoiesis has been translated into efficient procedures to produce RBC ex vivo using primary hematopoietic stem cells, embryonic stem cells, or induced pluripotent stem cells. Although in vitro-generated RBCs have recently entered clinical evaluation, several issues related to ex vivo RBC production are still under intense scrutiny: among those are the identification of stem cell sources more suitable for ex vivo RBC generation, the translation of RBC culture methods into clinical grade production processes, and the development of protocols to achieve maximal RBC quality, quantity, and maturation. Data on size, hemoglobin, and blood group antigen expression and phosphoproteomic profiling obtained on erythroid cells expanded ex vivo from a limited number of donors are presented as examples of the type of measurements that should be performed as part of the quality control to assess the suitability of these cells for transfusion. New technologies for ex vivo erythroid cell generation will hopefully provide alternative transfusion products to meet present and future clinical requirements. Copyright © 2012 AlphaMed Press.

  10. The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

    Science.gov (United States)

    Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

    2008-07-01

    Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

  11. [Distribution of abnormal cell clone with deletion of chromosome 20q in marrow cell lineages and apoptosis cells in myelodysplastic syndrome].

    Science.gov (United States)

    Qin, Ling; Wang, Chun; Qin, You-Wen; Xie, Kuang-Cheng; Yan, Shi-Ke; Gao, Yan-Rong; Wang, Xiao-Rui; Zhao, Chu-Xian

    2008-06-01

    This study was aimed to investigate the distribution of abnormal clone in marrow cell lineages and apoptosis cells in myelodysplastic syndrome (MDS) with deletion of chromosome 20q. Monoclonal antibodies recognizing myeloid precursors (CD15), erythroid precursors (GPA), T cells (CD3(+)CD56(-)CD16(-)), B cells (CD19), NK cells (CD3(-)CD56(+)CD16(+)) were used to sort bone marrow cells in a MDS patient with del (20q) by fluorescence activated cell sorting (FACS). Annexin V-FITC and PI were used to sort bone marrow Annexin V(+)PI(-) and Annexin V(-)PI(-) cells by FACS. The sorted positive cells were detected by interphase dual-color fluorescence in situ hybridization (D-FISH) using a LSI D20S108 probe (Spectrum Orange) and a Telvysion TM 20p probe (Spectrum Green). FACS and FISH analysis were also performed on the samples from 4 cases with normal karyotype. The results showed that the proportions of MDS clone in the myeloid and erythroid precursors were 70.50% and 93.33% respectively, in the RAEB-1 patient with del (20q) and were obviously higher than that in control group (5.39% and 6.17%). The proportions of abnormal clone in T, B and NK cells were 3.23%, 4.32% and 5.77% respectively and were less than that in control group (5.76%, 4.85%, 6.36%). The percentage of apoptotic cells in the bone marrow nucleated cells was 16.09%. The proportions of MDS clone in Annexin V(+)PI(-) and Annexin V(-)PI(-) cells were 32.48% and 70.11%, respectively. It is concluded that most myeloid and erythroid precursors are originated from the abnormal clone in MDS with del (20q). A little part of apoptotic cells are derived from the abnormal clone.

  12. T cell-B cell interactions in primary immunodeficiencies.

    Science.gov (United States)

    Tangye, Stuart G; Deenick, Elissa K; Palendira, Umaimainthan; Ma, Cindy S

    2012-02-01

    Regulated interactions between cells of the immune system facilitate the generation of successful immune responses, thereby enabling efficient neutralization and clearance of pathogens and the establishment of both cell- and humoral-mediated immunological memory. The corollary of this is that impediments to efficient cell-cell interactions, normally necessary for differentiation and effector functions of immune cells, underly the clinical features and disease pathogenesis of primary immunodeficiencies. In affected individuals, these defects manifest as impaired long-term humoral immunity and susceptibility to infection by specific pathogens. In this review, we discuss the importance of, and requirements for, effective interactions between B cells and T cells during the formation of CD4(+) T follicular helper cells and the elicitation of cytotoxic function of virus-specific CD8(+) T cells, as well as how these processes are abrogated in primary immunodeficiencies due to loss-of-function mutations in defined genes. © 2012 New York Academy of Sciences.

  13. Primary clear cell sarcoma of bone

    International Nuclear Information System (INIS)

    Choi, J.H.; Gu, M.J.; Kim, M.J.; Bae, Y.K.; Choi, W.H.; Shin, D.S.; Cho, K.H.

    2003-01-01

    Clear cell sarcoma is a rare soft tissue sarcoma of young adults with melanocytic differentiation. It occurs predominantly in the soft tissue of extremities, typically involving tendons and aponeuroses. Primary clear cell sarcoma of bone is extremely rare. We report a case of primary clear cell sarcoma of the right first metatarsal in a 48-year-old woman and provide a literature review of the entity. (orig.)

  14. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    OpenAIRE

    Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan

    2015-01-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...

  15. Epigenetic and molecular profiles of erythroid cells after hydroxyurea treatment in sickle cell anemia

    Science.gov (United States)

    Steward, Shirley; Howard, Thad A.; Mortier, Nicole; Smeltzer, Matthew; Wang, Yong-Dong; Ware, Russell E.

    2011-01-01

    Hydroxyurea has been shown to be efficacious for the treatment of sickle cell anemia (SCA), primarily through the induction of fetal hemoglobin (HbF). However, the exact mechanisms by which hydroxyurea can induce HbF remain incompletely defined, although direct transcriptional effects and altered cell cycle kinetics have been proposed. In this study, we investigated potential epigenetic and alternative molecular mechanisms of hydroxyurea-mediated HbF induction by examining methylation patterns within the Gγ-globin promoter and miRNA expression within primary CD71+ erythrocytes of patients with SCA, both at baseline before beginning hydroxyurea therapy and after reaching maximum tolerated dose (MTD). Using both cross-sectional analysis and paired-sample analysis, we found that the highly methylated Gγ-globin promoter was inversely correlated to baseline HbF levels, but only slightly altered by hydroxyurea treatment. Conversely, expression of several specific miRNAs was significantly increased after hydroxyurea treatment, and expression of miR-26b and miR-151-3p were both associated with HbF levels at MTD. The significant associations identified in these studies suggest that methylation may be important for regulation of baseline HbF, but not after hydroxyurea treatment, whereas changes in miRNA expression may be associated with hydroxyurea-mediated HbF induction. This study was registered at ClinicalTrials.gov (NCT00305175). PMID:21921042

  16. OPD4-positive T-cell lymphoma of the liver in systemic lupus erythematosus.

    Science.gov (United States)

    Tsutsumi, Y; Deng, Y L; Uchiyama, M; Kawano, K; Ikeda, Y

    1991-11-01

    Primary malignant lymphoma of the liver occupying the right lobe, 14 x 9 x 7 cm in size, developed in a 30-year-old man with a 4-year history of autoimmune hemolytic anemia. The diagnosis of systemic lupus erythematosus (SLE) accompanying thrombocytopenia had been made clinically 10 months earlier. The liver biopsy specimen revealed diffuse proliferation of large lymphoma cells expressing the activated helper/inducer T-cell phenotype (LCA+, UCHL1+, OPD4+, LN3+, MT1-, L26-, MB1-, Leu M1-, Ki-1-, KP1-). The lymphoma was successfully treated by chemotherapy and irradiation. Intractable thrombocytopenia provoked fatal esophageal hemorrhage. At autopsy, no lymphomatous lesion was identified, and the hepatic right lobe contained an encapsulated necrotic lesion without any viable tumor cells. The bone marrow revealed marked hyperplasia of erythroid and megakaryocytic series. Extramedullary hematopoiesis was demonstrated in the liver, spleen and lymph nodes. This is the second case of primary hepatic T-cell lymphoma associated with SLE.

  17. Whole transcriptome analysis of human erythropoietic cells during ontogenesis suggests a role of VEGFA gene as modulator of fetal hemoglobin and pharmacogenomic biomarker of treatment response to hydroxyurea in β-type hemoglobinopathy patients

    DEFF Research Database (Denmark)

    Chondrou, Vasiliki; Kolovos, Petros; Sgourou, Argyro

    2017-01-01

    from whole transcriptome analysis of erythroid cells, isolated from erythroid tissues at various developmental stages in an effort to identify distinct molecular signatures of each erythroid tissue. Results: From our in-depth data analysis, pathway analysis, and text mining, we opted to focus...

  18. Primary orbital squamous cell carcinoma

    Directory of Open Access Journals (Sweden)

    Ana L. Campos Arbulú

    2017-02-01

    Full Text Available Primary orbital squamous cell carcinoma is a rare entity. There is little published literature. We report a case of primary squamous cell carcinoma of the orbital soft tissues. Surgical resection offered the best treatment for the patient. Complete resection of the lesion was achieved. The patient received adjuvant radiotherapy due to the proximity of the lesion to the surgical margins. Surgical treatment is feasible and should be considered as part of the surgeon's arsenal. However, therapeutic decisions must be made on a case-by-case basis

  19. Effect of Co-Culturing of Mice Liver Cells and Embryonic Carcinomatous Stem Cells on the Rate of Differentiation to Hematopoietic Cells

    Directory of Open Access Journals (Sweden)

    AA Pourfatollah

    2005-10-01

    Full Text Available Introduction: Considering the importance of co-culture in differentiation of embryonic stem cells, the aim of this study was evaluation of the effect of co-culturing fetal liver stroma cells with P19 cells on the line of differentiation. Materials and Methods: For this purpose, P19 cells were cultured directly in semisolid medium. These cells proliferated and primarily differentiated to colonies know as embryoid bodies (EBs after 8-12 days. The Ebs cells were trypsinized and dissociated to single or double cells. Then these cells were co-cultured on the mouse fetal liver feeder layer in the absence of exogenous factors. After 14-18 days, the colonies were studied morphologically by benzidine and giemsa staining and also counted under invert microscope. Results: The percentages of benzidine positive (or erythroid and negative colonies were 94% and 6% respectively and also the cells of colonies were studied by Giemsa staining. Results showed that they were myeloid or lymphoid type cells. Thus, the results show that in the presence of mouse fetal liver feeder layer, the number of erythroid colonies was increased. Conclusions: Therefore, this technique may be effective for differentiation of stem cells from different sources into hematopoietic cells and can be used in future for human cell therapy.

  20. Increased Levels of Erythropoietin in Nipple Aspirate Fluid and in Ductal Cells from Breast Cancer Patients

    Directory of Open Access Journals (Sweden)

    Ferdinando Mannello

    2008-01-01

    Full Text Available Background: Erythropoietin (Epo is an important regulator of erythropoiesis, and controls proliferation and differentiation of both erythroid and non-erythroid tissues. Epo is actively synthesized by breast cells during lactation, and also plays a role in breast tissues promoting hypoxia-induced cancer initiation. Our aims are to perform an exploratory investigation on the Epo accumulation in breast secretions from healthy and cancer patients and its localization in breast cancer cells.

  1. Detection of trans-acting factors for hemoglobin switching by cell fusions

    International Nuclear Information System (INIS)

    Broyles, R.H.; Palmer, J.C.; Smith, D.J.; Ramseyer, T.H.

    1986-01-01

    The authors have devised protocols for chemically fusing erythroid cells from amphibians of different developmental stages, so that we may study the short-term effects of trans-acting factors on globin gene expression. The authors are performing both homospecifc (Rana x Rana) and heterospecific (Rana x Xenopus) fusions; and they are detecting the expression of specific globin genes with selective radioactive labeling ( 35 S-methionine is incorporated only into adult globins), polyacrylamide gel electrophoresis, monospecific antisera, and cDNA probes that are species-and developmental stage-specific. Their results indicate that: (1) there are factors in tadpole erythroblasts that can reactivate adult Hb synthesis in mature, synthetically-inactive adult RBCs; (2) there are factors in tadpole erythroblasts that can reactivate tadpole globin genes in adult RBCs; and (3) there are factors in adult erythroid cells that apparently activate adult globin genes in tadpole RBCs. These results suggests that erythroid cells from animals of different developmental stages possess different sets of globin gene-specific trans-acting factors which can be studied with a system that exhibits normal developmental Hb switching

  2. Single-cell qPCR on dispersed primary pituitary cells -an optimized protocol

    Directory of Open Access Journals (Sweden)

    Haug Trude M

    2010-11-01

    Full Text Available Abstract Background The incidence of false positives is a potential problem in single-cell PCR experiments. This paper describes an optimized protocol for single-cell qPCR measurements in primary pituitary cell cultures following patch-clamp recordings. Two different cell harvesting methods were assessed using both the GH4 prolactin producing cell line from rat, and primary cell culture from fish pituitaries. Results Harvesting whole cells followed by cell lysis and qPCR performed satisfactory on the GH4 cell line. However, harvesting of whole cells from primary pituitary cultures regularly produced false positives, probably due to RNA leakage from cells ruptured during the dispersion of the pituitary cells. To reduce RNA contamination affecting the results, we optimized the conditions by harvesting only the cytosol through a patch pipette, subsequent to electrophysiological experiments. Two important factors proved crucial for reliable harvesting. First, silanizing the patch pipette glass prevented foreign extracellular RNA from attaching to charged residues on the glass surface. Second, substituting the commonly used perforating antibiotic amphotericin B with β-escin allowed efficient cytosol harvest without loosing the giga seal. Importantly, the two harvesting protocols revealed no difference in RNA isolation efficiency. Conclusion Depending on the cell type and preparation, validation of the harvesting technique is extremely important as contaminations may give false positives. Here we present an optimized protocol allowing secure harvesting of RNA from single cells in primary pituitary cell culture following perforated whole cell patch clamp experiments.

  3. Expression of the transcription factor Evi-1 in human erythroleukemia cell lines and in leukemias.

    Science.gov (United States)

    Fontenay-Roupie, M; Bouscary, D; Melle, J; Viguié, F; Picard, F; Guesnu, M; Dreyfus, F

    1997-02-01

    The Evi-1 proto-oncogene is a zinc finger DNA binding protein. Although activation of the Evi-1 gene has been associated with chromosomal rearrangements of the 3q25-q28 region, ectopic expression of Evi-1 could also be observed in acute myelogenous leukemias and myelodysplastic syndromes without cytogenetic abnormalities of the 3q26 locus. In this study, human erythroleukemic cell lines were screened for the expression of Evi-1 mRNA by northern blotting. Evi-1 was expressed in all the erythroid cell lines, whether undifferentiated (K 562, HEL, LAMA 84) or exhibiting spontaneous terminal erythroid differentiation (KU 812, JK-1). Evi-1 mRNA levels were constant or elevated in hemoglobin-synthesizing KU 812 or K 562 cells in response to erythropoietin or hemin treatment, respectively. In human acute myeloblastic leukemias (AML), 11/30 expressed Evi-1 by RT-PCR. Among these cases, 4/6 erythroleukemias without abnormalities of the 3q25-q28 region were found positive. The presence of acidophilic erythroblasts (15-47% of bone marrow cells) accounted for the existence of a terminal erythroid differentiation in all Evi-1-positive AML M6, whereas one negative case was poorly differentiated and referred to as AML M6 variant. These results suggest that Evi-1 mRNA expression can coexist with erythroid differentiation.

  4. Inflammatory Cell Distribution in Primary Merkel Cell Carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Wheat, Rachel [School of Cancer Sciences and CR UK Centre for Cancer Research, College of Medical and Dental Sciences, University of Birmingham, Birmingham, B15 2TT (United Kingdom); Roberts, Claudia [School of Cancer Sciences and CR UK Centre for Cancer Research, College of Medical and Dental Sciences, University of Birmingham, Birmingham, B15 2TT (United Kingdom); University Hospitals Birmingham NHS Foundation Trust, New Queen Elizabeth Hospital Birmingham, Mindelsohn Way, Edgbaston, Birmingham, B15 2WB (United Kingdom); Waterboer, Tim [Infection and Cancer Program, DKFZ (German Cancer Research Centre), 69120 Heidelberg (Germany); Steele, Jane [Human Biomaterials Resource Centre, College of Medical and Dental Sciences, University of Birmingham, Birmingham, B15 2TT (United Kingdom); Marsden, Jerry [University Hospitals Birmingham NHS Foundation Trust, New Queen Elizabeth Hospital Birmingham, Mindelsohn Way, Edgbaston, Birmingham, B15 2WB (United Kingdom); Steven, Neil M., E-mail: n.m.steven@bham.ac.uk [School of Cancer Sciences and CR UK Centre for Cancer Research, College of Medical and Dental Sciences, University of Birmingham, Birmingham, B15 2TT (United Kingdom); University Hospitals Birmingham NHS Foundation Trust, New Queen Elizabeth Hospital Birmingham, Mindelsohn Way, Edgbaston, Birmingham, B15 2WB (United Kingdom); Blackbourn, David J., E-mail: n.m.steven@bham.ac.uk [Department of Microbial and Cellular Sciences, Faculty of Health and Medical Sciences, University of Surrey, Guildford, Surrey, GU2 7XH (United Kingdom)

    2014-05-06

    Merkel cell carcinoma (MCC) is an aggressive poorly differentiated neuroendocrine cutaneous carcinoma associated with older age, immunodeficiency and Merkel cell polyomavirus (MCPyV) integrated within malignant cells. The presence of intra-tumoural CD8+ lymphocytes reportedly predicts better MCC-specific survival. In this study, the distribution of inflammatory cells and properties of CD8+ T lymphocytes within 20 primary MCC specimens were characterised using immunohistochemistry and multicolour immunofluorescent staining coupled to confocal microscopy. CD8+ cells and CD68+ macrophages were identified in 19/20 primary MCC. CD20+ B cells were present in 5/10, CD4+ cells in 10/10 and FoxP3+ cells in 7/10 specimens. Only two specimens had almost no inflammatory cells. Within specimens, inflammatory cells followed the same patchy distribution, focused at the edge of sheets and nodules and, in some cases, more intense in trabecular areas. CD8+ cells were outside vessels on the edge of tumour. Those few within malignant sheets typically lined up in fine septa not contacting MCC cells expressing MCPyV large T antigen. The homeostatic chemokine CXCL12 was expressed outside malignant nodules whereas its receptor CXCR4 was identified within tumour but not on CD8+ cells. CD8+ cells lacked CXCR3 and granzyme B expression irrespective of location within stroma versus malignant nodules or of the intensity of the intra-tumoural infiltrate. In summary, diverse inflammatory cells were organised around the margin of malignant deposits suggesting response to aberrant signaling, but were unable to penetrate the tumour microenvironment itself to enable an immune response against malignant cells or their polyomavirus.

  5. Inflammatory Cell Distribution in Primary Merkel Cell Carcinoma

    International Nuclear Information System (INIS)

    Wheat, Rachel; Roberts, Claudia; Waterboer, Tim; Steele, Jane; Marsden, Jerry; Steven, Neil M.; Blackbourn, David J.

    2014-01-01

    Merkel cell carcinoma (MCC) is an aggressive poorly differentiated neuroendocrine cutaneous carcinoma associated with older age, immunodeficiency and Merkel cell polyomavirus (MCPyV) integrated within malignant cells. The presence of intra-tumoural CD8+ lymphocytes reportedly predicts better MCC-specific survival. In this study, the distribution of inflammatory cells and properties of CD8+ T lymphocytes within 20 primary MCC specimens were characterised using immunohistochemistry and multicolour immunofluorescent staining coupled to confocal microscopy. CD8+ cells and CD68+ macrophages were identified in 19/20 primary MCC. CD20+ B cells were present in 5/10, CD4+ cells in 10/10 and FoxP3+ cells in 7/10 specimens. Only two specimens had almost no inflammatory cells. Within specimens, inflammatory cells followed the same patchy distribution, focused at the edge of sheets and nodules and, in some cases, more intense in trabecular areas. CD8+ cells were outside vessels on the edge of tumour. Those few within malignant sheets typically lined up in fine septa not contacting MCC cells expressing MCPyV large T antigen. The homeostatic chemokine CXCL12 was expressed outside malignant nodules whereas its receptor CXCR4 was identified within tumour but not on CD8+ cells. CD8+ cells lacked CXCR3 and granzyme B expression irrespective of location within stroma versus malignant nodules or of the intensity of the intra-tumoural infiltrate. In summary, diverse inflammatory cells were organised around the margin of malignant deposits suggesting response to aberrant signaling, but were unable to penetrate the tumour microenvironment itself to enable an immune response against malignant cells or their polyomavirus

  6. Primary Cilia, Signaling Networks and Cell Migration

    DEFF Research Database (Denmark)

    Veland, Iben Rønn

    Primary cilia are microtubule-based, sensory organelles that emerge from the centrosomal mother centriole to project from the surface of most quiescent cells in the human body. Ciliary entry is a tightly controlled process, involving diffusion barriers and gating complexes that maintain a unique...... this controls directional cell migration as a physiological response. The ciliary pocket is a membrane invagination with elevated activity of clathrin-dependent endocytosis (CDE). In paper I, we show that the primary cilium regulates TGF-β signaling and the ciliary pocket is a compartment for CDE...... on formation of the primary cilium and CDE at the pocket region. The ciliary protein Inversin functions as a molecular switch between canonical and non-canonical Wnt signaling. In paper II, we show that Inversin and the primary cilium control Wnt signaling and are required for polarization and cell migration...

  7. Transdifferentiation of Human Hair Follicle Mesenchymal Stem Cells into Red Blood Cells by OCT4

    Directory of Open Access Journals (Sweden)

    Zhijing Liu

    2015-01-01

    Full Text Available Shortage of red blood cells (RBCs, erythrocytes can have potentially life-threatening consequences for rare or unusual blood type patients with massive blood loss resulting from various conditions. Erythrocytes have been derived from human pluripotent stem cells (PSCs, but the risk of potential tumorigenicity cannot be ignored, and a majority of these cells produced from PSCs express embryonic ε- and fetal γ-globins with little or no adult β-globin and remain nucleated. Here we report a method to generate erythrocytes from human hair follicle mesenchymal stem cells (hHFMSCs by enforcing OCT4 gene expression and cytokine stimulation. Cells generated from hHFMSCs expressed mainly the adult β-globin chain with minimum level of the fetal γ-globin chain. Furthermore, these cells also underwent multiple maturation events and formed enucleated erythrocytes with a biconcave disc shape. Gene expression analyses showed that OCT4 regulated the expression of genes associated with both pluripotency and erythroid development during hHFMSC transdifferentiation toward erythroid cells. These findings show that mature erythrocytes can be generated from adult somatic cells, which may serve as an alternative source of RBCs for potential autologous transfusion.

  8. Primary clear cell sarcoma of rib

    International Nuclear Information System (INIS)

    Hersekli, Murat Ali; Ozkoc, Gurkan; Akpinar, Sercan; Ozalay, Metin; Tandogan, Reha N.; Bircan, Sema; Tuncer, Ilhan

    2005-01-01

    Clear cell sarcoma (malignant melanoma of soft tissues) is a very rare soft tissue neoplasm. It generally arises in tendons and aponeuroses. Although metastasis of malignant melanoma to bone is not uncommon, primary clear cell sarcoma of bone is an extremely rare neoplasm. To our knowledge five cases have been reported in the English literature. We present a case of primary clear cell sarcoma of bone in a 28-year-old woman arising in the left ninth rib. We treated the patient with total excision of the mass and postoperative radiotherapy. The patient is alive and well without local recurrence or distant metastasis at 33 months after surgery. (orig.)

  9. Multicentric primary extramammary Paget disease: a Toker cell disorder?

    Science.gov (United States)

    Hashemi, Pantea; Kao, Grace F; Konia, Thomas; Kauffman, Lisa C; Tam, Christine C; Sina, Bahram

    2014-07-01

    Toker cells are epithelial clear cells found in the areolar and nipple areas of the breast, vulvar region, and other apocrine gland-bearing areas of the skin. Toker cells have been implicated in the pathogenesis of clear cell papulosis, cutaneous hamartoma with pagetoid cells, and rare cases of primary extramammary Paget disease (EMPD) but not in secondary EMPD with underlying adenocarcinoma. The pathogenesis of primary EMPD is not well defined. We report a case of multicentric primary EMPD with evidence of Toker cell proliferation and nonaggressive biologic behavior in a 63-year-old white man. A detailed description of the morphologic and biologic features of Toker cells and their possible carcinogenetic links also are discussed. Based on the observation and follow-up of our patient, we hypothesize that multicentric primary EMPD starts with Toker cell hyperplasia and can potentially evolve to carcinoma in the genital region.

  10. Primary Hepatosplenic Large B-Cell Lymphoma

    Directory of Open Access Journals (Sweden)

    M.R. Morales-Polanco

    2008-03-01

    Full Text Available Diffuse large B-cell lymphoma is the most common form of lymphoma. It usually begins in the lymph nodes; up to 40% may have an extranodal presentation. According to a definition of primary extranodal lymphoma with presentation only in extranodal sites, there are reports of large B-cell lymphomas limited to liver or spleen as separate entities, and to date there have been only three documented cases of primary hepatosplenic presentation. This paper reports a fourth case. Due to a review of the literature and the clinical course of the case reported, we conclude that primary hepatosplenic large B-cell lymphoma has been found predominantly in females older than 60 years. The patients reported had <2 months of evolution prior to diagnosis, prominent B symptoms, splenomegaly in three and hepatomegaly in two, none with lymph node involvement. All had thrombocytopenia and abnormal liver function tests; three had anemia and elevated serum lactic dehydrogenase levels, two with hemophagocytosis in bone marrow. Because of the previously mentioned data, it can be stated that primary hepatosplenic lymphoma is an uncommon and aggressive form of disease that requires immediate recognition and treatment.

  11. Primary ciliogenesis defects are associated with human astrocytoma/glioblastoma cells

    Directory of Open Access Journals (Sweden)

    Rattner Jerome B

    2009-12-01

    Full Text Available Abstract Background Primary cilia are non-motile sensory cytoplasmic organelles that have been implicated in signal transduction, cell to cell communication, left and right pattern embryonic development, sensation of fluid flow, regulation of calcium levels, mechanosensation, growth factor signaling and cell cycle progression. Defects in the formation and/or function of these structures underlie a variety of human diseases such as Alström, Bardet-Biedl, Joubert, Meckel-Gruber and oral-facial-digital type 1 syndromes. The expression and function of primary cilia in cancer cells has now become a focus of attention but has not been studied in astrocytomas/glioblastomas. To begin to address this issue, we compared the structure and expression of primary cilia in a normal human astrocyte cell line with five human astrocytoma/glioblastoma cell lines. Methods Cultured normal human astrocytes and five human astrocytoma/glioblastoma cell lines were examined for primary cilia expression and structure using indirect immunofluorescence and electron microscopy. Monospecific antibodies were used to detect primary cilia and map the relationship between the primary cilia region and sites of endocytosis. Results We show that expression of primary cilia in normal astrocytes is cell cycle related and the primary cilium extends through the cell within a unique structure which we show to be a site of endocytosis. Importantly, we document that in each of the five astrocytoma/glioblastoma cell lines fully formed primary cilia are either expressed at a very low level, are completely absent or have aberrant forms, due to incomplete ciliogenesis. Conclusions The recent discovery of the importance of primary cilia in a variety of cell functions raises the possibility that this structure may have a role in a variety of cancers. Our finding that the formation of the primary cilium is disrupted in cells derived from astrocytoma/glioblastoma tumors provides the first

  12. Primary cutaneous anaplastic large-cell lymphoma.

    Science.gov (United States)

    Perry, Edward; Karajgikar, Jay; Tabbara, Imad A

    2013-10-01

    Since the recognition of the anaplastic large-cell lymphomas in the 1980s, much has been learned about the diagnosis, clinical presentation, and treatment of these malignant conditions. The systemic and primary cutaneous types of anaplastic large cell lymphomas have been differentiated on clinical and immunophenotypical findings, but further research is required to elucidate their exact etiologies and pathogeneses. Primary cutaneous anaplastic large-cell lymphoma has a 95% disease-specific 5-year survival, owing partly to the relatively benign course of the disease and partly to the variety of effective treatments that are available. As with many other oncological diseases, new drugs are continually being tested and developed, with immunotherapy and biological response modifiers showing promise.

  13. Lenalidomide induces lipid raft assembly to enhance erythropoietin receptor signaling in myelodysplastic syndrome progenitors.

    Science.gov (United States)

    McGraw, Kathy L; Basiorka, Ashley A; Johnson, Joseph O; Clark, Justine; Caceres, Gisela; Padron, Eric; Heaton, Ruth; Ozawa, Yukiyasu; Wei, Sheng; Sokol, Lubomir; List, Alan F

    2014-01-01

    Anemia remains the principal management challenge for patients with lower risk Myelodysplastic Syndromes (MDS). Despite appropriate cytokine production and cellular receptor display, erythropoietin receptor (EpoR) signaling is impaired. We reported that EpoR signaling is dependent upon receptor localization within lipid raft microdomains, and that disruption of raft integrity abolishes signaling capacity. Here, we show that MDS erythroid progenitors display markedly diminished raft assembly and smaller raft aggregates compared to normal controls (p = 0.005, raft number; p = 0.023, raft size). Because lenalidomide triggers raft coalescence in T-lymphocytes promoting immune synapse formation, we assessed effects of lenalidomide on raft assembly in MDS erythroid precursors and UT7 cells. Lenalidomide treatment rapidly induced lipid raft formation accompanied by EpoR recruitment into raft fractions together with STAT5, JAK2, and Lyn kinase. The JAK2 phosphatase, CD45, a key negative regulator of EpoR signaling, was displaced from raft fractions. Lenalidomide treatment prior to Epo stimulation enhanced both JAK2 and STAT5 phosphorylation in UT7 and primary MDS erythroid progenitors, accompanied by increased STAT5 DNA binding in UT7 cells, and increased erythroid colony forming capacity in both UT7 and primary cells. Raft induction was associated with F-actin polymerization, which was blocked by Rho kinase inhibition. These data indicate that deficient raft integrity impairs EpoR signaling, and provides a novel strategy to enhance EpoR signal fidelity in non-del(5q) MDS.

  14. Teaching Cell Biology in Primary Schools

    Directory of Open Access Journals (Sweden)

    Francele de Abreu Carlan

    2014-01-01

    Full Text Available Basic concepts of cell biology are essential for scientific literacy. However, because many aspects of cell theory and cell functioning are quite abstract, students experience difficulties understanding them. In this study, we investigated whether diverse teaching resources such as the use of replicas of Leeuwenhoek’s microscope, visualization of cells using an optical microscope, construction of three-dimensional cell models, and reading of a comic book about cells could mitigate the difficulties encountered when teaching cell biology to 8th-grade primary school students. The results suggest that these didactic activities improve students’ ability to learn concrete concepts about cell biology, such as the composition of living beings, growth, and cicatrization. Also, the development of skills was observed, as, for example, the notion of cell size. However, no significant improvements were observed in students’ ability to learn about abstract topics, such as the structures of subcellular organelles and their functions. These results suggest that many students in this age have not yet concluded Piaget’s concrete operational stage, indicating that the concepts required for the significant learning of abstract subjects need to be explored more thoroughly in the process of designing programs that introduce primary school students to cell biology.

  15. Cytomegalovirus infection induces a stem cell phenotype in human primary glioblastoma cells

    DEFF Research Database (Denmark)

    Fornara, O; Bartek, J; Rahbar, A

    2016-01-01

    Glioblastoma (GBM) is associated with poor prognosis despite aggressive surgical resection, chemotherapy, and radiation therapy. Unfortunately, this standard therapy does not target glioma cancer stem cells (GCSCs), a subpopulation of GBM cells that can give rise to recurrent tumors. GBMs express...... human cytomegalovirus (HCMV) proteins, and previously we found that the level of expression of HCMV immediate-early (IE) protein in GBMs is a prognostic factor for poor patient survival. In this study, we investigated the relation between HCMV infection of GBM cells and the presence of GCSCs. Primary...... GBMs were characterized by their expression of HCMV-IE and GCSCs marker CD133 and by patient survival. The extent to which HCMV infection of primary GBM cells induced a GCSC phenotype was evaluated in vitro. In primary GBMs, a large fraction of CD133-positive cells expressed HCMV-IE, and higher co...

  16. Different Chondrogenic Potential among Human Induced Pluripotent Stem Cells from Diverse Origin Primary Cells

    Directory of Open Access Journals (Sweden)

    Yeri Alice Rim

    2018-01-01

    Full Text Available Scientists have tried to reprogram various origins of primary cells into human induced pluripotent stem cells (hiPSCs. Every somatic cell can theoretically become a hiPSC and give rise to targeted cells of the human body. However, there have been debates on the controversy about the differentiation propensity according to the origin of primary cells. We reprogrammed hiPSCs from four different types of primary cells such as dermal fibroblasts (DF, n=3, peripheral blood mononuclear cells (PBMC, n=3, cord blood mononuclear cells (CBMC, n=3, and osteoarthritis fibroblast-like synoviocytes (OAFLS, n=3. Established hiPSCs were differentiated into chondrogenic pellets. All told, cartilage-specific markers tended to express more by the order of CBMC > DF > PBMC > FLS. Origin of primary cells may influence the reprogramming and differentiation thereafter. In the context of chondrogenic propensity, CBMC-derived hiPSCs can be a fairly good candidate cell source for cartilage regeneration. The differentiation of hiPSCs into chondrocytes may help develop “cartilage in a dish” in the future. Also, the ideal cell source of hiPSC for chondrogenesis may contribute to future application as well.

  17. In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.

    Science.gov (United States)

    Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A

    2008-01-01

    Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.

  18. Mantle cell lymphoma of the larynx: Primary case report

    Directory of Open Access Journals (Sweden)

    Naciri Sarah

    2012-07-01

    Full Text Available Abstract Introduction Primary laryngeal lymphomas are exceedingly rare. Only about a hundred cases have been reported. They consist mainly of non-Hodgkin lymphoma, especially of diffuse large B-cell lymphoma and mucosa-associated lymphoid tissue. We report the first case of a primary laryngeal mantle cell lymphoma. Case presentation We report a case of a primary mantle cell lymphoma of the larynx in a 70-year-old North African non-smoker male. We present a detailed report of his clinical and paraclinical data as well as treatment options. Conclusions Mantle cell lymphoma is a very aggressive lymphoma subset associated with poor prognosis. Laryngeal mantle cell lymphoma is exceedingly rare. To the best of our knowledge, this is the first case to ever be reported.

  19. PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia

    DEFF Research Database (Denmark)

    Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta

    2004-01-01

    markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...

  20. Cerebellar T-cell lymphoma: an unusual primary intracranial neoplasm

    International Nuclear Information System (INIS)

    Knorr, J.R.; Ragland, R.L.; Stone, B.B.; Woda, B.A.; Gelber, N.D.

    1992-01-01

    Primary T-cell lymphoma within the central nervous system is extremely rare. Imaging characteristics appear indistinguishable from the more common B-cell lymphoma. A case of such a primary tumor is discussed and the MRI and CT findings presented. (orig.)

  1. Control of heme synthesis during Friend cell differentiation: role of iron and transferrin

    International Nuclear Information System (INIS)

    Laskey, J.D.; Ponka, P.; Schulman, H.M.

    1986-01-01

    In many types of cells the synthesis of σ-aminolevulinic acid (ALA) limits the rate of heme formation. However, results from this laboratory with reticulocytes suggest that the rate of iron uptake from 125 I-transferrin (Tf), rather than ALA synthase activity, limits the rate of heme synthesis in erythroid cells. To determine whether changes occur in iron metabolism and the control of heme synthesis during erythroid cell development Friend erythroleukemia cells induced to erythroid differentiation by dimethylsulfoxide (DMSO) were studied. While added ALA stimulated heme synthesis in uninduced Friend cells (suggesting ALA synthase is limiting) it did not do so in induced cells. Therefore the possibility was investigated that, in induced cells, iron uptake from Tf limits and controls heme synthesis. Several aspects of iron metabolism were investigated using the synthetic iron chelator salicylaldehyde isonicotinoyl hydrazone (SIH). Both induced and uninduced Friend cells take up and utilize Fe for heme synthesis directly from Fe-SIH without the involvement of transferrin and transferrin receptors and to a much greater extent than from saturating levels or 59 Fe-Tf (20 μM). Furthermore, in induced Friend cells 100 μM Fe-SIH stimulated 2- 14 C-glycine incorporation into heme up to 3.6-fold as compared to the incorporation observed with saturating concentrations of Fe-Tf. These results indicate that some step(s) in the pathway of iron from extracellular Tf to protoporphyrin, rather than the activity of ALA synthase, limits and controls the overall rate of heme and possibly hemoglobin synthesis in differentiating Friend erythroleukemia cells

  2. Production of erythrocytes from directly isolated or Delta1 Notch ligand expanded CD34+ hematopoietic progenitor cells: process characterization, monitoring and implications for manufacture.

    Science.gov (United States)

    Glen, Katie E; Workman, Victoria L; Ahmed, Forhad; Ratcliffe, Elizabeth; Stacey, Adrian J; Thomas, Robert J

    2013-09-01

    Economic ex vivo manufacture of erythrocytes at 10(12) cell doses requires an efficiently controlled bio-process capable of extensive proliferation and high terminal density. High-resolution characterization of the process would identify production strategies for increased efficiency, monitoring and control. CD34(+) cord blood cells or equivalent cells that had been pre-expanded for 7 days with Delta1 Notch ligand were placed in erythroid expansion and differentiation conditions in a micro-scale ambr suspension bioreactor. Multiple culture parameters were varied, and phenotype markers and metabolites measured to identify conserved trends and robust monitoring markers. The cells exhibited a bi-modal erythroid differentiation pattern with an erythroid marker peak after 2 weeks and 3 weeks of culture; differentiation was comparatively weighted toward the second peak in Delta1 pre-expanded cells. Both differentiation events were strengthened by omission of stem cell factor and dexamethasone. The cumulative cell proliferation and death, or directly measured CD45 expression, enabled monitoring of proliferative rate of the cells. The metabolic activities of the cultures (glucose, glutamine and ammonia consumption or production) were highly variable but exhibited systematic change synchronized with the change in differentiation state. Erythroid differentiation chronology is partly determined by the heterogeneous CD34(+) progenitor compartment with implications for input control; Delta1 ligand-mediated progenitor culture can alter differentiation profile with control benefits for engineering production strategy. Differentiation correlated changes in cytokine response, markers and metabolic state will enable scientifically designed monitoring and timing of manufacturing process steps. Copyright © 2013 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  3. Ubiquitous expression of MAKORIN-2 in normal and malignant hematopoietic cells and its growth promoting activity.

    Directory of Open Access Journals (Sweden)

    King Yiu Lee

    Full Text Available Makorin-2 (MKRN2 is a highly conserved protein and yet its functions are largely unknown. We investigated the expression levels of MKRN2 and RAF1 in normal and malignant hematopoietic cells, and leukemia cell lines. We also attempted to delineate the role of MKRN2 in umbilical cord blood CD34+ stem/progenitor cells and K562 cell line by over-expression and inhibition of MKRN2 through lentivirus transduction and shRNA nucleofection, respectively. Our results provided the first evidence on the ubiquitous expression of MKRN2 in normal hematopoietic cells, embryonic stem cell lines, primary leukemia and leukemic cell lines of myeloid, lymphoid, erythroid and megakaryocytic lineages. The expression levels of MKRN2 were generally higher in primary leukemia samples compared with those in age-matched normal BM cells. In all leukemia subtypes, there was no significant correlation between expression levels of MKRN2 and RAF1. sh-MKRN2-silenced CD34+ cells had a significantly lower proliferation capacity and decreased levels of the early stem/progenitor subpopulation (CFU-GEMM compared with control cultures. Over-expression of MKRN2 in K562 cells increased cell proliferation. Our results indicated possible roles of MKRN2 in normal and malignant hematopoiesis.

  4. Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

    International Nuclear Information System (INIS)

    Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.

    1991-01-01

    These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase

  5. Hematopoietic defects in response to reduced Arhgap21

    Directory of Open Access Journals (Sweden)

    Juliana Xavier-Ferrucio

    2018-01-01

    Full Text Available Arhgap21 is a member of the Rho GTPase activating protein (RhoGAP family, which function as negative regulators of Rho GTPases. Arhgap21 has been implicated in adhesion and migration of cancer cells. However, the role of Arhgap21 has never been investigated in hematopoietic cells. Herein, we evaluated functional aspects of hematopoietic stem and progenitor cells (HSPC using a haploinsufficient (Arhgap21+/− mouse. Our results show that Arhgap21+/− mice have an increased frequency of phenotypic HSC, impaired ability to form progenitor colonies in vitro and decreased hematopoietic engraftment in vivo, along with a decrease in LSK cell frequency during serial bone marrow transplantation. Arhgap21+/− hematopoietic progenitor cells have impaired adhesion and enhanced mobilization of immature LSK and myeloid progenitors. Arhgap21+/− mice also exhibit reduced erythroid commitment and differentiation, which was recapitulated in human primary cells, in which knockdown of ARHGAP21 in CMP and MEP resulted in decreased erythroid commitment. Finally, we observed enhanced RhoC activity in the bone marrow cells of Arhgap21+/− mice, indicating that Arhgap21 functions in hematopoiesis may be at least partially mediated by RhoC inactivation. Keywords: Arhgap21, Hematopoiesis, Erythroid cells, Hematopoietic stem and progenitor cells, Fate decision

  6. Characterization of transcription factor networks involved in umbilical cord blood CD34+ stem cells-derived erythropoiesis.

    Directory of Open Access Journals (Sweden)

    Biaoru Li

    Full Text Available Fetal stem cells isolated from umbilical cord blood (UCB possess a great capacity for proliferation and differentiation and serve as a valuable model system to study gene regulation. Expanded knowledge of the molecular control of hemoglobin synthesis will provide a basis for rational design of therapies for β-hemoglobinopathies. Transcriptome data are available for erythroid progenitors derived from adult stem cells, however studies to define molecular mechanisms controlling globin gene regulation during fetal erythropoiesis are limited. Here, we utilize UCB-CD34+ stem cells induced to undergo erythroid differentiation to characterize the transcriptome and transcription factor networks (TFNs associated with the γ/β-globin switch during fetal erythropoiesis. UCB-CD34+ stem cells grown in the one-phase liquid culture system displayed a higher proliferative capacity than adult CD34+ stem cells. The γ/β-globin switch was observed after day 42 during fetal erythropoiesis in contrast to adult progenitors where the switch occurred around day 21. To gain insights into transcription factors involved in globin gene regulation, microarray analysis was performed on RNA isolated from UCB-CD34+ cell-derived erythroid progenitors harvested on day 21, 42, 49 and 56 using the HumanHT-12 Expression BeadChip. After data normalization, Gene Set Enrichment Analysis identified transcription factors (TFs with significant changes in expression during the γ/β-globin switch. Forty-five TFs were silenced by day 56 (Profile-1 and 30 TFs were activated by day 56 (Profile-2. Both GSEA datasets were analyzed using the MIMI Cytoscape platform, which discovered TFNs centered on KLF4 and GATA2 (Profile-1 and KLF1 and GATA1 for Profile-2 genes. Subsequent shRNA studies in KU812 leukemia cells and human erythroid progenitors generated from UCB-CD34+ cells supported a negative role of MAFB in γ-globin regulation. The characteristics of erythroblasts derived from UCB-CD34

  7. Primary radiation damage and disturbance in cell divisions

    International Nuclear Information System (INIS)

    Kim, Jin Kyu; Lee, Yun-Jong; Kim, Jae-Hun; Petin, Vladislav G.; Nili, Mohammad

    2008-01-01

    Survived cells from a homogeneous population exposed to ionizing radiation form various colonies of different sizes and morphology on a solid nutrient medium, which appear at different time intervals after irradiation. Such a phenomenon agrees well with the modern theory of microdosimetry and classical hit-and-target models of radiobiology. According to the hit-principle, individual cells exposed to the same dose of radiation are damaged in different manners. It means that the survived cells can differ in the content of sublethal damage (hits) produced by the energy absorbed into the cell and which is not enough to give rise to effective radiation damage which is responsible for cell killing or inactivation. In diploid yeast cells, the growth rate of cells from 250 colonies of various sizes appeared at different time intervals after irradiation with 600 Gy of gamma radiation from a 60 Co isotopic source was analyzed. The survival rate after irradiation was 20%. Based on the analyses results, it was possible to categorize the clones grown from irradiated cells according to the number of sub-lesions from 1 to 4. The clones with various numbers of sub-lesions were shown to be different in their viability, radiosensitivity, sensitivity to environmental conditions, and the frequency of recombination and respiratory deficient mutations. Cells from unstable clones exhibited an enhanced radiosensitivity, and an increased portion of morphologically changed cells, nonviable cells and respiration mutants, as well. The degree of expression of the foregoing effects was higher if the number of primary sublethal lesions was greater in the originally irradiated cell. Disturbance in cell division can be characterized by cell inactivation or incorrect distribution of mitochondria between daughter cells. Thus, the suggested methodology of identification of cells with a definite number of primary sublethal lesions will promote further elucidation of the nature of primary radiation

  8. Pulmonary squamous cell carcinoma following head and neck squamous cell carcinoma: Metastasis or second primary?

    NARCIS (Netherlands)

    Geurts, Tom W.; Nederlof, Petra M.; van den Brekel, Michiel W. M.; van't Veer, Laura J.; de Jong, Daphne; Hart, August A. M.; van Zandwijk, Nico; Klomp, Houke; Balm, Alfons J. M.; van Velthuysen, Marie-Louise F.

    2005-01-01

    Purpose: To distinguish a metastasis from a second primary tumor in patients with a history of head and neck squamous cell carcinoma and subsequent pulmonary squamous cell carcinoma. Experimental Design: For 44 patients with a primary squamous cell carcinoma of the head and neck followed by a

  9. Growth of primary embryo cells in a microculture system.

    Science.gov (United States)

    Villa, Max; Pope, Sara; Conover, Joanne; Fan, Tai-Hsi

    2010-04-01

    We present optimal perfusion conditions for the growth of primary mouse embryonic fibroblasts (mEFs) and mouse embryonic stem cells (mESCs) using a microfluidic perfusion culture system. In an effort to balance nutrient renewal while ensuring the presence of cell secreted factors, we found that the optimal perfusion rate for culturing primary embryonic fibroblasts (mEFs) in our experimental setting is 10 nL/min with an average flow velocity 0.55 microm/s in the microchannel. Primary mEFs may have a greater dependence on cell secreted factors when compared to their immortalized counterpart 3T3 fibroblasts cultured under similar conditions. Both the seeding density and the perfusion rate are critical for the proliferation of primary cells. A week long cultivation of mEFs and mESCs using the microculture system exhibited similar morphology and viability to those grown in a petri dish. Both mEFs and mESCs were analyzed using fluorescence immunoassays to determine their proliferative status and protein expression. Our results demonstrate that a perfusion-based microculture environment is capable of supporting the highly proliferative status of pluripotent embryonic stem cells.

  10. Radiosensitivity of primary cultured fish cells with different ploidy

    International Nuclear Information System (INIS)

    Mitani, Hiroshi; Egami, Nobuo; Kobayashi, Hiromu.

    1986-01-01

    The radiosensitivity of primary cultured goldfish cells (Carassius auratus) was investigated by colony formation assay. The radiosensitivity of cells from two varieties of goldfish, which show different sensitivity to lethal effect of ionizing radiation in vivo, was almost identical. Primary cultured cells from diploid, triploid and tetraploid fish retained their DNA content as measured by microfluorometry, and the nuclear size increases as ploidy increases. However, radiosensitivity was not related to ploidy. (author)

  11. Differential heat shock response of primary human cell cultures and established cell lines

    DEFF Research Database (Denmark)

    Richter, W W; Issinger, O G

    1986-01-01

    degrees C treatment, whereas in immortalized cell lines usually 90% of the cells were found in suspension. Enhanced expression of the major heat shock protein (hsp 70) was found in all heat-treated cells. In contrast to the primary cell cultures, established and transformed cell lines synthesized...

  12. Primary cilium - antenna-like structure on the surface of most mammalian cell types

    International Nuclear Information System (INIS)

    Dvorak, J; Kasaova, L; Filip, S; Petera, J; Sitorova, V; Nikolov, D Hadzi; Ryska, A; Mokry, J; Richter, I

    2011-01-01

    The primary cilium is a sensory solitary non-motile microtubule-based organelle protruding in the quiescent phase of the cell cycle from the surface of the majority of human cells, including embryonic cells, stem cells and stromal cells of malignant tumors. The presence of a primary cilium on the surface of a cell is transient, limited to the quiescent G 1 (G 0 ) phase and the beginning of the S phase of the cell cycle. The primary cilium is formed from the mother centriole. Primary cilia are key coordinators of signaling pathways during development and tissue homeostasis and, when deffective, they are a major cause of human diseases and developmental disorders, now commonly referred to as ciliopathies. Most cancer cells do not possess a primary cilium. The loss of the primary cilium is a regular feature of neoplastic transformation in the majority of solid tumors. The primary cilium could serve as a tumor suppressor organelle. The aim of this paper was to provide a review of the current knowledge of the primary cilium.

  13. Primary cilium - antenna-like structure on the surface of most mammalian cell types

    Science.gov (United States)

    Dvorak, J.; Sitorova, V.; Hadzi Nikolov, D.; Mokry, J.; Richter, I.; Kasaova, L.; Filip, S.; Ryska, A.; Petera, J.

    2011-12-01

    The primary cilium is a sensory solitary non-motile microtubule-based organelle protruding in the quiescent phase of the cell cycle from the surface of the majority of human cells, including embryonic cells, stem cells and stromal cells of malignant tumors. The presence of a primary cilium on the surface of a cell is transient, limited to the quiescent G1(G0) phase and the beginning of the S phase of the cell cycle. The primary cilium is formed from the mother centriole. Primary cilia are key coordinators of signaling pathways during development and tissue homeostasis and, when deffective, they are a major cause of human diseases and developmental disorders, now commonly referred to as ciliopathies. Most cancer cells do not possess a primary cilium. The loss of the primary cilium is a regular feature of neoplastic transformation in the majority of solid tumors. The primary cilium could serve as a tumor suppressor organelle. The aim of this paper was to provide a review of the current knowledge of the primary cilium.

  14. Primary Squamous Cell Carcinoma of Stomach: A Rare Entity ...

    African Journals Online (AJOL)

    Schmidt C, Schmid A, Lüttges JE, Kremer B, Henne-Bruns D. Primary squamous cell carcinoma of the stomach. Report of a case and review of literature. Hepatogastroenterology 2001;48:1033-6. 5. Muto M, Hasebe T, Muro K, Boku N, Ohtsu A, Fujii T, et al. Primary squamous cell carcinoma of the stomach: A case report with ...

  15. Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

    Science.gov (United States)

    Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

    2015-01-01

    Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

  16. Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow

    International Nuclear Information System (INIS)

    Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.

    1976-01-01

    The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors

  17. Tumor necrosis factor (cachetin) decreases adipose cell differentiation in primary cell culture

    International Nuclear Information System (INIS)

    Martin, R.J.; Jones, D.D.; Jewell, D.E.; Hausman, G.J.

    1986-01-01

    Cachetin has been shown to effect gene product expression in the established adipose cell line 3T3-L1. Expression of messenger RNA for lipoprotein lipase is suppressed in cultured adipocytes. The purpose of this study was to determine the effect of Cachetin on adipose cell differentiation in primary cell culture. Stromalvascular cells obtained from the inguinal fat pad of 4-5 week old Sprague-Dawley rats were grown in culture for two weeks. During the proliferative growth phase all cells were grown on the same medium and labelled with 3 H-thymidine. Cachetin treatment (10 -6 to 10 -10 M) was initiated on day 5, the initial phase of preadipocyte differentiation. Adipocytes and stromal cells were separated using density gradient, and 3 H-thymidine was determined for both cell types. Thymidine incorporation into adipose cells was decreased maximally (∼ 50%) at 10 -10 M. Stromalvascular cells were not influenced at any of the doses tested. Adipose cell lipid content as indicated by oil red-O staining was decreased by Cachetin. Esterase staining by adipose cells treated with Cachetin was increased indicating an increase in intracellular lipase. These studies show that Cachetin has specific effects on primary adipose cell differentiation

  18. Diffusion chamber culture of mouse bone marrow cells, (1)

    International Nuclear Information System (INIS)

    Sigeta, Chiharu; Tanaka, Kimio; Kawakami, Masahito; Takahashi, Hiroshi; Ohkita, Takeshi

    1980-01-01

    Mouse bone marrow cells were cultured in diffusion chambers (DC) implanted in the peritoneal cavity of host mice. Host mice were subjected to (1) irradiation ( 60 Co 800 rad) and/or (2) phenylhydrazine induced anemia and then receiving irradiation ( 60 Co 600 rad). After culture periods of 3-7 days, the total number of cells in DC was increased. A marked increase in DC is due to the proliferation of granulocyte series. When host mice were subjected to anemia and irradiation, the start of cell proliferation in DC was delay about two days. On the whole, anemia and irradiation host reduced a little cell growth in DC. The number of immature granulocytes grown in DC in irradiated hosts or anemia and irradiated hosts increased and reached a plateu at day 5. During the plateu period, the proportions between immature and mature granulocytes in DC were kept constantly. The number of macrophages showed a two-phase increasing. Erythroid cells and lymphocytes rapidly disappeared from the chambers during 3 days. The number of erythroid cells was not significantly influenced even in anemia and irradiation hosts. (author)

  19. ROLE OF STEM CELL FACTOR IN THE REACTIVATION OF HUMAN FETAL HEMOGLOBIN

    Directory of Open Access Journals (Sweden)

    Ugo Testa

    2009-06-01

    Full Text Available

    In humans the switch from fetal to adult  hemoglobin (HbF→ HbA takes place in the perinatal and postnatal period, determining the progressive replacement of HbF with HbA synthesis ( i.e., the relative HbF content in red blood cells decreases from 80-90% to <1%. In spite of more than twenty years of intensive investigations on this classic model, the molecular mechanisms regulating the Hb switching, as well as HbF synthesis in adults, has been only in part elucidated. In adult life, the residual HbF, restricted to F cell compartment, may be reactivated up to 10-20% of total Hb synthesis in various conditions associated with “stress erythropoiesis”: this reactivation represented until now an interesting model of partial Hb switch reverse with important therapeutic implications in patients with hemoglobinopathies, and particularly in -thalassemia.
    In vitro and in vivo models have led to the identification of several chemical compounds able to reactivate HbF synthesis in adult erythroid cells. Although the impact of these HbF inducers, including hypomethylating agents, histone deacetylase inhibitors and hydroxyurea, was clear on the natural history of sickle cell anemia, the benefit on the clinical course of -thalassemia was only limited: particularly, the toxicity and the modest increase in γ-globin reactivation indicated the need for improved agents able to induce higher levels of HbF.
    In the present review we describe the biologic properties of Stem Cell Factor (SCF, a cytokine sustaining the survival and proliferation of erythroid cells, that at pharmacological doses acts as a potent stimulator of HbF synthesis in adult erythroid cells.

  20. Effect of cell phone-like electromagnetic radiation on primary human thyroid cells.

    Science.gov (United States)

    Silva, Veronica; Hilly, Ohad; Strenov, Yulia; Tzabari, Cochava; Hauptman, Yirmi; Feinmesser, Raphael

    2016-01-01

    To evaluate the potential carcinogenic effects of radiofrequency energy (RFE) emitted by cell phones on human thyroid primary cells. Primary thyroid cell culture was prepared from normal thyroid tissue obtained from patients who underwent surgery at our department. Subconfluent thyroid cells were irradiated under different conditions inside a cell incubator using a device that simulates cell phone-RFE. Proliferation of control and irradiated cells was assessed by the immunohistochemical staining of antigen Kiel clone-67 (Ki-67) and tumor suppressor p53 (p53) expression. DNA ploidy and the stress biomarkers heat shock protein 70 (HSP70) and reactive oxygen species (ROS) was evaluated by fluorescence-activated cell sorting (FACS). Our cells highly expressed thyroglobulin (Tg) and sodium-iodide symporter (NIS) confirming the origin of the tissue. None of the irradiation conditions evaluated here had an effect neither on the proliferation marker Ki-67 nor on p53 expression. DNA ploidy was also not affected by RFE, as well as the expression of the biomarkers HSP70 and ROS. Our conditions of RFE exposure seem to have no potential carcinogenic effect on human thyroid cells. Moreover, common biomarkers usually associated to environmental stress also remained unchanged. We failed to find an association between cell phone-RFE and thyroid cancer. Additional studies are recommended.

  1. Neoexpression of a functional primary cilium in colorectal cancer cells

    Directory of Open Access Journals (Sweden)

    Blanche Sénicourt

    2016-05-01

    Full Text Available The Hedgehog (HH signaling pathway is involved in the maintenance of numerous cell types both during development and in the adult. Often deregulated in cancers, its involvement in colorectal cancer has come into view during the last few years, although its role remains poorly defined. In most tissues, the HH pathway is highly connected to the primary cilium (PC, an organelle that recruits functional components and regulates the HH pathway. However, normal epithelial cells of the colon display an inactive HH pathway and lack a PC. In this study, we report the presence of the PC in adenocarcinoma cells of primary colorectal tumors at all stages. Using human colorectal cancer cell lines we found a clear correlation between the presence of the PC and the expression of the final HH effector, GLI1, and provide evidence of a functional link between the two by demonstrating the recruitment of the SMO receptor to the membrane of the primary cilium. We conclude that the primary cilium directly participates in the HH pathway in colorectal cancer cells.

  2. Bradykinin stimulation of nitric oxide production is not sufficient for gamma-globin induction

    Directory of Open Access Journals (Sweden)

    Čokić Vladan P.

    2014-01-01

    Full Text Available Introduction. Hydroxycarbamide, used in therapy of hemoglobinopathies, enhances nitric oxide (NO production both in primary human umbilical vein endothelial cells (HUVECs and human bone marrow endothelial cell line (TrHBMEC. Moreover, NO increases γ-globin and fetal hemoglobin levels in human erythroid progenitors. Objective. In order to find out whether simple physiologic stimulation of NO production by components of hematopoietic microenvironment can increase γ-globin gene expression, the effects of NO-inducer bradykinin were examined in endothelial cells. Methods. The study was performed in co-cultures of human erythroid progenitors, TrHBMEC and HUVECs by ozone-based chemiluminescent determination of NO and real-time quantitative RT-PCR. Results. In accordance with previous reports, the endogenous factor bradykinin increased endothelial cell production of NO in a dose- and time-dependent manner (0.1-0.6 μM up to 30 minutes. This induction of NO in HUVECs and TrHBMEC by bradykinin was blocked by competitive inhibitors of NO synthase (NOS, demonstrating NOS-dependence. It has been shown that bradykinin significantly reduced endothelial NOS (eNOS mRNA level and eNOS/Я-actin ratio in HUVEC (by twofold. In addition, bradykinin failed to increase γ-globin mRNA expression in erythroid progenitors only, as well as in co-culture studies of erythroid progenitors with TrHBMEC and HUVEC after 24 hours of treatment. Furthermore, bradykinin did not induce γ/β globin ratio in erythroid progenitors in co-cultures with HUVEC. Conclusion. Bradykinin mediated eNOS activation leads to short time and low NO production in endothelial cells, insufficient to induce γ-globin gene expression. These results emphasized the significance of elevated and extended NO production in augmentation of γ-globin gene expression. [Projekat Ministarstva nauke Republike Srbije, br. 175053

  3. Chemical Inhibition of Histone Deacetylases 1 and 2 Induces Fetal Hemoglobin through Activation of GATA2.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Shearstone

    Full Text Available Therapeutic intervention aimed at reactivation of fetal hemoglobin protein (HbF is a promising approach for ameliorating sickle cell disease (SCD and β-thalassemia. Previous studies showed genetic knockdown of histone deacetylase (HDAC 1 or 2 is sufficient to induce HbF. Here we show that ACY-957, a selective chemical inhibitor of HDAC1 and 2 (HDAC1/2, elicits a dose and time dependent induction of γ-globin mRNA (HBG and HbF in cultured primary cells derived from healthy individuals and sickle cell patients. Gene expression profiling of erythroid progenitors treated with ACY-957 identified global changes in gene expression that were significantly enriched in genes previously shown to be affected by HDAC1 or 2 knockdown. These genes included GATA2, which was induced greater than 3-fold. Lentiviral overexpression of GATA2 in primary erythroid progenitors increased HBG, and reduced adult β-globin mRNA (HBB. Furthermore, knockdown of GATA2 attenuated HBG induction by ACY-957. Chromatin immunoprecipitation and sequencing (ChIP-Seq of primary erythroid progenitors demonstrated that HDAC1 and 2 occupancy was highly correlated throughout the GATA2 locus and that HDAC1/2 inhibition led to elevated histone acetylation at well-known GATA2 autoregulatory regions. The GATA2 protein itself also showed increased binding at these regions in response to ACY-957 treatment. These data show that chemical inhibition of HDAC1/2 induces HBG and suggest that this effect is mediated, at least in part, by histone acetylation-induced activation of the GATA2 gene.

  4. Evaluation of effects of various drugs on platelet functions using phorbol 12-myristate 13-acetate-induced megakaryocytic human erythroid leukemia cells

    Directory of Open Access Journals (Sweden)

    Tada T

    2016-09-01

    Full Text Available Tomoki Tada,1 Kensaku Aki,2 Wataru Oboshi,1,3 Kazuyoshi Kawazoe,4 Toshiyuki Yasui,5 Eiji Hosoi2 1Subdivision of Biomedical Laboratory Sciences, Graduate School of Health Sciences, Tokushima University, 2Department of Cells and Immunity Analytics, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, 3Department of Medical Technology, Kagawa Prefectural University of Health Sciences, Kagawa, 4Department of Clinical Pharmacy Practice Pedagogy, Institute of Biomedical Sciences, 5Department of Reproductive and Menopausal Medicine, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, Japan Background: The hyperfunction and activation of platelets have been strongly implicated in the development and recurrence of arterial occlusive disease, and various antiplatelet drugs are used to treat and prevent such diseases. New antiplatelet drugs and many other drugs have been developed, but some drugs may have adverse effects on platelet functions. Objective: The aim of this study was to establish an evaluation method for evaluating the effect and adverse effect of various drugs on platelet functions. Materials and methods: Human erythroid leukemia (HEL cells were used after megakaryocytic differentiation with phorbol 12-myristate 13-acetate as an alternative to platelets. Drugs were evaluated by changes in intracellular Ca2+ concentration ([Ca2+]i mobilization in Fura2-loaded phorbol 12-myristate 13-acetate-induced HEL cells. Aspirin and cilostazol were selected as antiplatelet drugs and ibuprofen and sodium valproate as other drugs. Results: There was a positive correlation between [Ca2+]i and platelet aggregation induced by thrombin. Aspirin (5.6–560 µM and cilostazol (5–10 µM significantly inhibited thrombin-induced increases in [Ca2+]i in a concentration-dependent manner. On the other hand, ibuprofen (8–200 µM and sodium valproate (50–1,000 µg/mL also significantly inhibited

  5. Tumor-Induced Generation of Splenic Erythroblast-like Ter-Cells Promotes Tumor Progression.

    Science.gov (United States)

    Han, Yanmei; Liu, Qiuyan; Hou, Jin; Gu, Yan; Zhang, Yi; Chen, Zhubo; Fan, Jia; Zhou, Weiping; Qiu, Shuangjian; Zhang, Yonghong; Dong, Tao; Li, Ning; Jiang, Zhengping; Zhu, Ha; Zhang, Qian; Ma, Yuanwu; Zhang, Lianfeng; Wang, Qingqing; Yu, Yizhi; Li, Nan; Cao, Xuetao

    2018-04-19

    Identifying tumor-induced leukocyte subsets and their derived circulating factors has been instrumental in understanding cancer as a systemic disease. Nevertheless, how primary tumor-induced non-leukocyte populations in distal organs contribute to systemic spread remains poorly defined. Here, we report one population of tumor-inducible, erythroblast-like cells (Ter-cells) deriving from megakaryocyte-erythroid progenitor cells with a unique Ter-119 + CD45 - CD71 + phenotype. Ter-cells are enriched in the enlarged spleen of hosts bearing advanced tumors and facilitate tumor progression by secreting neurotrophic factor artemin into the blood. Transforming growth factor β (TGF-β) and Smad3 activation are important in Ter-cell generation. In vivo blockade of Ter-cell-derived artemin inhibits hepatocellular carcinoma (HCC) growth, and artemin deficiency abolishes Ter-cells' tumor-promoting ability. We confirm the presence of splenic artemin-positive Ter-cells in human HCC patients and show that significantly elevated serum artemin correlates with poor prognosis. We propose that Ter-cells and the secreted artemin play important roles in cancer progression with prognostic and therapeutic implications. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Primary Small Cell Neuroendocrine Carcinoma of Vagina: A Rare Case Report

    Directory of Open Access Journals (Sweden)

    Jignasa N. Bhalodia

    2011-01-01

    Full Text Available Primary small cell neuroendocrine carcinoma of vagina is an extremely rare disease. There have been only 26 previously reported cases in literature. Here, we report a case of primary small cell neuroendocrine carcinoma of vagina. Immunohistochemistry (IHC showed tumor cells positive for synaptophysin, chromogranin, and neuron-specific enolase (NSE.

  7. The role of tumor suppressor p15Ink4b in the regulation of hematopoietic progenitor cell fate

    International Nuclear Information System (INIS)

    Humeniuk, R; Rosu-Myles, M; Fares, J; Koller, R; Bies, J; Wolff, L

    2013-01-01

    Epigenetic silencing of the tumor suppressor gene p15Ink4b (CDKN2B) is a frequent event in blood disorders like acute myeloid leukemia and myelodysplastic syndromes. The molecular function of p15Ink4b in hematopoietic differentiation still remains to be elucidated. Our previous study demonstrated that loss of p15Ink4b in mice results in skewing of the differentiation pattern of the common myeloid progenitor towards the myeloid lineage. Here, we investigated a function of p15Ink4b tumor suppressor gene in driving erythroid lineage commitment in hematopoietic progenitors. It was found that p15Ink4b is expressed more highly in committed megakaryocyte–erythroid progenitors than granulocyte–macrophage progenitors. More importantly, mice lacking p15Ink4b have lower numbers of primitive red cell progenitors and a severely impaired response to 5-fluorouracil- and phenylhydrazine-induced hematopoietic stress. Introduction of p15Ink4b into multipotential progenitors produced changes at the molecular level, including activation of mitogen-activated protein kinase/extracellular signal-regulated kinase (MEK/ERK) signaling, increase GATA-1, erythropoietin receptor (EpoR) and decrease Pu1, GATA-2 expression. These changes rendered cells more permissive to erythroid commitment and less permissive to myeloid commitment, as demonstrated by an increase in early burst-forming unit-erythroid formation with concomitant decrease in myeloid colonies. Our results indicate that p15Ink4b functions in hematopoiesis, by maintaining proper lineage commitment of progenitors and assisting in rapid red blood cells replenishment following stress

  8. Metabolic responses of primary and transformed cells to intracellular Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Nadine Gillmaier

    Full Text Available The metabolic response of host cells, in particular of primary mammalian cells, to bacterial infections is poorly understood. Here, we compare the carbon metabolism of primary mouse macrophages and of established J774A.1 cells upon Listeria monocytogenes infection using (13C-labelled glucose or glutamine as carbon tracers. The (13C-profiles of protein-derived amino acids from labelled host cells and intracellular L. monocytogenes identified active metabolic pathways in the different cell types. In the primary cells, infection with live L. monocytogenes increased glycolytic activity and enhanced flux of pyruvate into the TCA cycle via pyruvate dehydrogenase and pyruvate carboxylase, while in J774A.1 cells the already high glycolytic and glutaminolytic activities hardly changed upon infection. The carbon metabolism of intracellular L. monocytogenes was similar in both host cells. Taken together, the data suggest that efficient listerial replication in the cytosol of the host cells mainly depends on the glycolytic activity of the hosts.

  9. Establishment of primary cell culture from the temperate symbiotic cnidarian, Anemonia viridis.

    Science.gov (United States)

    Barnay-Verdier, Stéphanie; Dall'osso, Diane; Joli, Nathalie; Olivré, Juliette; Priouzeau, Fabrice; Zamoum, Thamilla; Merle, Pierre-Laurent; Furla, Paola

    2013-10-01

    The temperate symbiotic sea anemone Anemonia viridis, a member of the Cnidaria phylum, is a relevant experimental model to investigate the molecular and cellular events involved in the preservation or in the rupture of the symbiosis between the animal cells and their symbiotic microalgae, commonly named zooxanthellae. In order to increase research tools for this model, we developed a primary culture from A. viridis animal cells. By adapting enzymatic dissociation protocols, we isolated animal host cells from a whole tentacle in regeneration state. Each plating resulted in a heterogeneous primary culture consisted of free zooxanthellae and many regular, small rounded and adherent cells (of 3-5 μm diameter). Molecular analyses conducted on primary cultures, maintained for 2 weeks, confirmed a specific signature of A. viridis cells. Further serial dilutions and micromanipulation allowed us to obtain homogenous primary cultures of the small rounded cells, corresponding to A. viridis "epithelial-like cells". The maintenance and the propagation over a 4 weeks period of primary cells provide, for in vitro cnidarian studies, a preliminary step for further investigations on cnidarian cellular pathways notably in regard to symbiosis interactions.

  10. Purification and characterization of fetal hematopoietic cells that express the common acute lymphoblastic leukemia antigen (CALLA)

    DEFF Research Database (Denmark)

    Hokland, P; Rosenthal, P; Griffin, J D

    1983-01-01

    lymphoblastic leukemia cell with respect to surface marker phenotype. A population of CALLA- cells devoid of mature erythroid and myeloid surface markers was found to contain higher numbers of TdT+ cells but lower numbers of cyto-mu, B1, and Ia+ cells than the CALLA+ subset. In vitro analysis of normal...

  11. Cultivate Primary Nasal Epithelial Cells from Children and Reprogram into Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Ulm, Ashley; Mayhew, Christopher N; Debley, Jason; Khurana Hershey, Gurjit K; Ji, Hong

    2016-03-10

    Nasal epithelial cells (NECs) are the part of the airways that respond to air pollutants and are the first cells infected with respiratory viruses. They are also involved in many airway diseases through their innate immune response and interaction with immune and airway stromal cells. NECs are of particular interest for studies in children due to their accessibility during clinical visits. Human induced pluripotent stem cells (iPSCs) have been generated from multiple cell types and are a powerful tool for modeling human development and disease, as well as for their potential applications in regenerative medicine. This is the first protocol to lay out methods for successful generation of iPSCs from NECs derived from pediatric participants for research purposes. It describes how to obtain nasal epithelial cells from children, how to generate primary NEC cultures from these samples, and how to reprogram primary NECs into well-characterized iPSCs. Nasal mucosa samples are useful in epidemiological studies related to the effects of air pollution in children, and provide an important tool for studying airway disease. Primary nasal cells and iPSCs derived from them can be a tool for providing unlimited material for patient-specific research in diverse areas of airway epithelial biology, including asthma and COPD research.

  12. Longevity in vivo of primary cell wall cellulose synthases.

    Science.gov (United States)

    Hill, Joseph Lee; Josephs, Cooper; Barnes, William J; Anderson, Charles T; Tien, Ming

    2018-02-01

    Our work focuses on understanding the lifetime and thus stability of the three main cellulose synthase (CESA) proteins involved in primary cell wall synthesis of Arabidopsis. It had long been thought that a major means of CESA regulation was via their rapid degradation. However, our studies here have uncovered that AtCESA proteins are not rapidly degraded. Rather, they persist for an extended time in the plant cell. Plant cellulose is synthesized by membrane-embedded cellulose synthase complexes (CSCs). The CSC is composed of cellulose synthases (CESAs), of which three distinct isozymes form the primary cell wall CSC and another set of three isozymes form the secondary cell wall CSC. We determined the stability over time of primary cell wall (PCW) CESAs in Arabidopsis thaliana seedlings, using immunoblotting after inhibiting protein synthesis with cycloheximide treatment. Our work reveals very slow turnover for the Arabidopsis PCW CESAs in vivo. Additionally, we show that the stability of all three CESAs within the PCW CSC is altered by mutations in individual CESAs, elevated temperature, and light conditions. Together, these results suggest that CESA proteins are very stable in vivo, but that their lifetimes can be modulated by intrinsic and environmental cues.

  13. Integrative analysis of copy number and gene expression data suggests novel pathogenetic mechanisms in primary myelofibrosis.

    Science.gov (United States)

    Salati, Simona; Zini, Roberta; Nuzzo, Simona; Guglielmelli, Paola; Pennucci, Valentina; Prudente, Zelia; Ruberti, Samantha; Rontauroli, Sebastiano; Norfo, Ruggiero; Bianchi, Elisa; Bogani, Costanza; Rotunno, Giada; Fanelli, Tiziana; Mannarelli, Carmela; Rosti, Vittorio; Salmoiraghi, Silvia; Pietra, Daniela; Ferrari, Sergio; Barosi, Giovanni; Rambaldi, Alessandro; Cazzola, Mario; Bicciato, Silvio; Tagliafico, Enrico; Vannucchi, Alessandro M; Manfredini, Rossella

    2016-04-01

    Primary myelofibrosis (PMF) is a Myeloproliferative Neoplasm (MPN) characterized by megakaryocyte hyperplasia, progressive bone marrow fibrosis, extramedullary hematopoiesis and transformation to Acute Myeloid Leukemia (AML). A number of phenotypic driver (JAK2, CALR, MPL) and additional subclonal mutations have been described in PMF, pointing to a complex genomic landscape. To discover novel genomic lesions that can contribute to disease phenotype and/or development, gene expression and copy number signals were integrated and several genomic abnormalities leading to a concordant alteration in gene expression levels were identified. In particular, copy number gain in the polyamine oxidase (PAOX) gene locus was accompanied by a coordinated transcriptional up-regulation in PMF patients. PAOX inhibition resulted in rapid cell death of PMF progenitor cells, while sparing normal cells, suggesting that PAOX inhibition could represent a therapeutic strategy to selectively target PMF cells without affecting normal hematopoietic cells' survival. Moreover, copy number loss in the chromatin modifier HMGXB4 gene correlates with a concomitant transcriptional down-regulation in PMF patients. Interestingly, silencing of HMGXB4 induces megakaryocyte differentiation, while inhibiting erythroid development, in human hematopoietic stem/progenitor cells. These results highlight a previously un-reported, yet potentially interesting role of HMGXB4 in the hematopoietic system and suggest that genomic and transcriptional imbalances of HMGXB4 could contribute to the aberrant expansion of the megakaryocytic lineage that characterizes PMF patients. © 2015 UICC.

  14. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca

    2013-07-15

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  15. The aryl hydrocarbon receptor and estrogen receptor alpha differentially modulate nuclear factor erythroid-2-related factor 2 transactivation in MCF-7 breast cancer cells

    International Nuclear Information System (INIS)

    Lo, Raymond; Matthews, Jason

    2013-01-01

    Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.

  16. Regulated proliferation of primitive hematopoietic progenitor cells in long-term human marrow cultures

    International Nuclear Information System (INIS)

    Cashman, J.; Eaves, A.C.; Eaves, C.J.

    1985-01-01

    We have examined the cycling status of various classes of erythroid and granulopoietic progenitor populations maintained for many weeks in standard normal long-term human marrow cultures. These were initiated with a single inoculum of marrow aspirate and were routinely fed by weekly removal of half of the nonadherent cells and replacement of half of the growth medium. Progenitors of large erythroid colonies (more than eight erythroblast clusters) present in the nonadherent fraction and progenitors of small granulocyte/macrophage colonies (fewer than 500 cells) present in both the nonadherent and adherent fractions were found to be actively cycling at all times examined (28% to 63% kill following a 20-minute exposure to 20 microCi/mL of high specific activity 3 H-thymidine). In contrast, progenitors of large granulocyte/macrophage colonies (more than 500 cells) and progenitors of large erythroid colonies (more than eight erythroblast clusters), present in the adherent layer, consistently alternated between a quiescent state at the time of each weekly medium change and a proliferating state two to three days later (0% to 13% kill and 21% to 49% kill, respectively). Additional experiments revealed that the activation of primitive progenitors in the adherent layer was not dependent on the addition of fresh glutamine or hydrocortisone, nor on the physical manipulations involved in changing the growth medium. These studies provide the first direct evidence that normal long-term human marrow cultures support the continued turnover of a variety of early hematopoietic progenitor cell types. Further, they indicate that the proliferative activity of the most primitive of these progenitors is regulated by stage-specific cell-cell interactions that are subject to manipulation

  17. Transfection in Primary Cultured Neuronal Cells.

    Science.gov (United States)

    Marwick, Katie F M; Hardingham, Giles E

    2017-01-01

    Transfection allows the introduction of foreign nucleic acid into eukaryotic cells. It is an important tool in understanding the roles of NMDARs in neurons. Here, we describe using lipofection-mediated transfection to introduce cDNA encoding NMDAR subunits into postmitotic rodent primary cortical neurons maintained in culture.

  18. Reliability Evaluation of Primary Cells | Anyaka | Nigerian Journal of ...

    African Journals Online (AJOL)

    Evaluation of the reliability of a primary cell took place in three stages: 192 cells went through a slow-discharged test. A designed experiment was conducted on 144 cells; there were three factors in the experiment: Storage temperature (three levels), thermal shock (two levels) and date code (two levels). 16 cells ...

  19. Thrombopoietin has a differentiative effect on late-stage human erythropoiesis.

    Science.gov (United States)

    Liu, W; Wang, M; Tang, D C; Ding, I; Rodgers, G P

    1999-05-01

    To further explore the mechanism of the effect of thrombopoietin (TPO) on erythropoiesis, we used a two-phase culture system to investigate the effect of TPO on late-stage human erythroid lineage differentiation. In serum-free suspension and semisolid cultures of human peripheral blood derived erythroid progenitors, TPO alone did not produce benzidine-positive cells. However, in serum-containing culture, TPO alone stimulated erythroid cell proliferation and differentiation, demonstrated by erythroid colony formation, production of benzidine-positive cells and haemoglobin (Hb) synthesis. Monoclonal anti-human erythropoietin antibody and anti-human erythropoietin receptor antibody completely abrogated the erythroid differentiative ability of TPO in the serum-containing systems. This implied that binding of EPO and EPO-R was essential for erythropoiesis and the resultant signal transduction may be augmented by the signals emanating from TPO-c-Mpl interaction. Experiment of withdrawal of TPO further demonstrated the involvement of TPO in late-stage erythropoiesis. RT-PCR results showed that there was EPO-R but not c-Mpl expression on developing erythroblasts induced by TPO in serum-containing system. Our results establish that TPO affects not only the proliferation of erythroid progenitors but also the differentiation of erythroid progenitors to mature erythroid cells.

  20. Primary Small Cell Carcinoma of the Upper Urinary Tract

    Directory of Open Access Journals (Sweden)

    Victor Ka-Siong Kho

    2010-03-01

    Full Text Available We report a case of primary extrapulmonary small cell carcinoma of the distal ureter, with a synchronous small cell carcinoma of the ipsilateral renal pelvis. These tumors, rarely reported in the urinary tract, are locally aggressive and have a poor prognosis. A 77-year-old male bedridden patient presented with fever and chills with left side-flank pain for 3 days. Following a diagnosis of ureteral urothelial carcinoma, hand-assisted laparoscopic nephroureterectomy with bladder cuff excision was carried out. Adjuvant chemotherapy was given after pathologic report of primary small cell carcinoma of the distal ureter and a synchronous small cell carcinoma of the ipsilateral renal pelvis. After 3 cycles of combination chemotherapy, the patient died 4 months postoperatively due to sepsis.

  1. Direct Cytoskeleton Forces Cause Membrane Softening in Red Blood Cells

    Science.gov (United States)

    Rodríguez-García, Ruddi; López-Montero, Iván; Mell, Michael; Egea, Gustavo; Gov, Nir S.; Monroy, Francisco

    2015-01-01

    Erythrocytes are flexible cells specialized in the systemic transport of oxygen in vertebrates. This physiological function is connected to their outstanding ability to deform in passing through narrow capillaries. In recent years, there has been an influx of experimental evidence of enhanced cell-shape fluctuations related to metabolically driven activity of the erythroid membrane skeleton. However, no direct observation of the active cytoskeleton forces has yet been reported to our knowledge. Here, we show experimental evidence of the presence of temporally correlated forces superposed over the thermal fluctuations of the erythrocyte membrane. These forces are ATP-dependent and drive enhanced flickering motions in human erythrocytes. Theoretical analyses provide support for a direct force exerted on the membrane by the cytoskeleton nodes as pulses of well-defined average duration. In addition, such metabolically regulated active forces cause global membrane softening, a mechanical attribute related to the functional erythroid deformability. PMID:26083919

  2. Rituximab in the treatment of primary cutaneous B-cell lymphoma: a review.

    Science.gov (United States)

    Fernández-Guarino, M; Ortiz-Romero, P L; Fernández-Misa, R; Montalbán, C

    2014-06-01

    Rituximab is a chimeric mouse-human antibody that targets the CD20 antigen, which is found in both normal and neoplastic B cells. In recent years, it has been increasingly used to treat cutaneous B-cell lymphoma and is now considered an alternative to classic treatment (radiotherapy and surgery) of 2 types of indolent lymphoma, namely, primary cutaneous follicle center lymphoma and primary cutaneous marginal zone B-cell lymphoma. Rituximab is also administered as an alternative to polychemotherapy in the treatment of primary cutaneous large B-cell lymphoma, leg type. Its use as an alternative drug led to it being administered intralesionally, with beneficial effects. In the present article, we review the literature published on the use of rituximab to treat primary cutaneous B-cell lymphoma. Copyright © 2012 Elsevier España, S.L. and AEDV. All rights reserved.

  3. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    International Nuclear Information System (INIS)

    Kim, Jiyoung; Cha, Young-Nam; Surh, Young-Joon

    2010-01-01

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  4. Graphene Films Show Stable Cell Attachment and Biocompatibility with Electrogenic Primary Cardiac Cells

    OpenAIRE

    Kim, Taeyong; Kahng, Yung Ho; Lee, Takhee; Lee, Kwanghee; Kim, Do Han

    2013-01-01

    Graphene has attracted substantial attention due to its advantageous materialistic applicability. In the present study, we tested the biocompatibility of graphene films synthesized by chemical vapor deposition with electrogenic primary adult cardiac cells (cardiomyocytes) by measuring the cell properties such as cell attachment, survival, contractility and calcium transients. The results show that the graphene films showed stable cell attachment and excellent biocompatibility with the electro...

  5. Uhrf1 controls the self-renewal versus differentiation of hematopoietic stem cells by epigenetically regulating the cell-division modes.

    Science.gov (United States)

    Zhao, Jingyao; Chen, Xufeng; Song, Guangrong; Zhang, Jiali; Liu, Haifeng; Liu, Xiaolong

    2017-01-10

    Hematopoietic stem cells (HSCs) are able to both self-renew and differentiate. However, how individual HSC makes the decision between self-renewal and differentiation remains largely unknown. Here we report that ablation of the key epigenetic regulator Uhrf1 in the hematopoietic system depletes the HSC pool, leading to hematopoietic failure and lethality. Uhrf1-deficient HSCs display normal survival and proliferation, yet undergo erythroid-biased differentiation at the expense of self-renewal capacity. Notably, Uhrf1 is required for the establishment of DNA methylation patterns of erythroid-specific genes during HSC division. The expression of these genes is enhanced in the absence of Uhrf1, which disrupts the HSC-division modes by promoting the symmetric differentiation and suppressing the symmetric self-renewal. Moreover, overexpression of one of the up-regulated genes, Gata1, in HSCs is sufficient to phenocopy Uhrf1-deficient HSCs, which show impaired HSC symmetric self-renewal and increased differentiation commitment. Taken together, our findings suggest that Uhrf1 controls the self-renewal versus differentiation of HSC through epigenetically regulating the cell-division modes, thus providing unique insights into the relationship among Uhrf1-mediated DNA methylation, cell-division mode, and HSC fate decision.

  6. Ebola virus glycoprotein-mediated anoikis of primary human cardiac microvascular endothelial cells

    International Nuclear Information System (INIS)

    Ray, Ratna B.; Basu, Arnab; Steele, Robert; Beyene, Aster; McHowat, Jane; Meyer, Keith; Ghosh, Asish K.; Ray, Ranjit

    2004-01-01

    Ebola virus glycoprotein (EGP) has been implicated for the induction of cytotoxicity and injury in vascular cells. On the other hand, EGP has also been suggested to induce massive cell rounding and detachment from the plastic surface by downregulating cell adhesion molecules without causing cytotoxicity. In this study, we have examined the cytotoxic role of EGP in primary endothelial cells by transduction with a replication-deficient recombinant adenovirus expressing EGP (Ad-EGP). Primary human cardiac microvascular endothelial cells (HCMECs) transduced with Ad-EGP displayed loss of cell adhesion from the plastic surface followed by cell death. Transfer of conditioned medium from EGP-transduced HCMEC into naive cells did not induce loss of adhesion or cell death, suggesting that EGP needs to be expressed intracellularly to exert its cytotoxic effect. Subsequent studies suggested that HCMEC death occurred through apoptosis. Results from this study shed light on the EGP-induced anoikis in primary human cardiac endothelial cells, which may have significant pathological consequences

  7. Radiation Gene-expression Signatures in Primary Breast Cancer Cells.

    Science.gov (United States)

    Minafra, Luigi; Bravatà, Valentina; Cammarata, Francesco P; Russo, Giorgio; Gilardi, Maria C; Forte, Giusi I

    2018-05-01

    In breast cancer (BC) care, radiation therapy (RT) is an efficient treatment to control localized tumor. Radiobiological research is needed to understand molecular differences that affect radiosensitivity of different tumor subtypes and the response variability. The aim of this study was to analyze gene expression profiling (GEP) in primary BC cells following irradiation with doses of 9 Gy and 23 Gy delivered by intraoperative electron radiation therapy (IOERT) in order to define gene signatures of response to high doses of ionizing radiation. We performed GEP by cDNA microarrays and evaluated cell survival after IOERT treatment in primary BC cell cultures. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to validate candidate genes. We showed, for the first time, a 4-gene and a 6-gene signature, as new molecular biomarkers, in two primary BC cell cultures after exposure at 9 Gy and 23 Gy respectively, for which we observed a significantly high survival rate. Gene signatures activated by different doses of ionizing radiation may predict response to RT and contribute to defining a personalized biological-driven treatment plan. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  8. Imprint lithography provides topographical nanocues to guide cell growth in primary cortical cell culture

    NARCIS (Netherlands)

    Xie, S.; Luttge, R.

    2014-01-01

    In this paper, we describe a technology platform to study the effect of nanocues on the cell growth direction in primary cortical cell culture. Topographical cues to cells are provided using nanoscale features created by Jet and Flash Imprint Lithography, coated with polyethylenimine. We

  9. Method and cell lines for the production of monoclonal antibodies to human glycophorin A

    Science.gov (United States)

    Bigbee, W.L.; Fong, S.S.N.; Jensen, R.H.; Vanderlaan, M.

    Cloned mouse hybridoma cell lines have been established which continuously produce antibodies that differentiate between the M and N forms of human glycophorin A. These antibodies have potential application as human blood group reagents, as markers for terminally differentiated erythroid cells and as immunofluorescent labels of somatically variant human erythrocytes.

  10. Feed-Back Regulation of Haemopoiesis

    Energy Technology Data Exchange (ETDEWEB)

    Feldman, M. [Department of Cell Biology, Weizmann Institute of Science, Rehovoth (Israel)

    1968-08-15

    Studies ate reported on the feed-back regulation of erythropoiesis by means of the intrasplenic cloning system of haemopoietic cells. Polycythaemia, produced by passive transfusion of synzeneic, allogeneic or xenogeneic red blood cells, inhibited the formation of bone-marrow derived erythroid clones. Polycythaemia also inhibited the formation of erythroid clones of endogenous stem cells. Oxygen overloading was found to be a necessary factor in the suppression of erythroid clone formation: no suppression of erythroid colonies was observed when polycythaemic animals were kept under hypoxic conditions. Erythropoietin, either of exogenous or of endogenous origin, elicited a reformation of erythroid clones in 'suppressed' animals. Studies on the kinetics of reformation of erythroid clones after the administration of erythropoietin suggested that the colony-forming stem cell can replicate a few times in the absence of erythropoietin and the cell progeny thus formed are the target cells for erythropoietin action. If, indeed, the colony-forming cell replicates in the absence of the specific inducer, then the cells thus formed should themselves be stem cells. This was substantiated by demonstrating that the cloning efficiency of spleens of polycythaemic recipients was higher than that of non-polycythaemic animals. Experiments indicating that erythroid clones produced by erythropoietin in polycythaemic animals disappeared after the discontinuance of erythropoietin application demonstrated the distinction between the 'mitogenic' and the 'morphogenetic' effects of erythropoietin. The latter seemed to be operated by an early transcription of RNA for proteins necessary for the complete maturation of the red blood cell, Erythroid clones produced by foetal haemopoietic stem cells seemed to be regulated by a different mechanism from that which controls the formation of bone-marrow derived clones. Clones produced by foetal cells were only partially suppressed in the polycythaemic

  11. Primary cutaneous marginal zone B-cell lymphoma: clinical and histological aspects.

    Science.gov (United States)

    Khaled, A; Sassi, S; Fazaa, B; Ben Hassouna, J; Ben Romdhane, K; Kamoun, M R

    2009-02-01

    According to the WHO-EORTC classification of cutaneous lymphomas, primary cutaneous marginal zone B-cell lymphoma are now well characterized. We report here a case of primary cutaneous marginal zone B-cell lymphoma in a 51 year-old man in which the diagnosis was made using both histology and immunopathology. The patient had no remarkable medical history, no history of either acute inflammation or insect bite, and presented with a 5 cm solitary asymptomatic erythematous firm, multinodular and infiltrated plaque on the back for 12 months. Histological examination and immunohistochemical study of a cutaneous biopsy provided a differential diagnosis between B cell lymphoma and lymphocytoma cutis. Full body work up revealed no signs of extracutaneous dissemination. The patient underwent surgical excision of the nodule. Histological examination showed a histological and immunophenotyping profile typical of primary cutaneous marginal zone B-cell lymphoma. The lesion was completely excised with clear margins and no recurrence occurred after a 12 month-follow-up period. Primary cutaneous marginal zone B-cell lymphoma are low-grade lymphomas that have an indolent course and a high tendency to recur. They should be differentiated from lymphocytoma cutis and from the other types of cutaneous B cell lymphomas that have a different course and prognosis.

  12. Immunocytochemical characterization of primary cell culture in canine transmissible venereal tumor

    Directory of Open Access Journals (Sweden)

    Luis M.M. Flórez

    Full Text Available Abstract: Immunochemistry with anti-vimentin, anti-lysozyme, anti-alpha 1 antitrypsin, anti-CD3 and anti-CD79α antibodies has been used for characterization of primary cell culture in the transmissible venereal tumor (TVT. Samples for primary cell culture and immunohistochemistry assays were taken from eight dogs with cytological and clinical diagnosis of TVT. To validate the immunochemical results in the primary cell culture of TVT, a chromosome count was performed. For the statistical analysis, the Mann-Whitney test with p<0.05 was used. TVT tissues and culture cells showed intense anti-vimentin immunoreactivity, lightly to moderate immunoreactivity for anti-lysozyme, and mild for anti-alpha-antitrypsin. No marking was achieved for CD3 and CD79α. All culture cells showed chromosomes variable number of 56 to 68. This is the first report on the use of immunocytochemical characterization in cell culture of TVT. Significant statistic difference between immunochemistry in tissue and culture cell was not established, what suggests that the use of this technique may provide greater certainty for the confirmation of tumors in the primary culture. This fact is particularly important because in vitro culture of tumor tissues has been increasingly used to provide quick access to drug efficacy and presents relevant information to identify potential response to anticancer medicine; so it is possible to understand the behavior of the tumor.

  13. Erythropoiesis in the aged mouse. I. Response to stimulation in vivo

    International Nuclear Information System (INIS)

    Udupa, K.B.; Lipschitz, D.A.

    1984-01-01

    Changes in erythropoiesis with age were studied by examining the hematocrit increase in response to hypoxia in aged mice and by assessing the change in erythropoiesis following the injection of erythropoietin in young and old polycythemic mice. The increase in hematocrit after exposure to hypoxia was more variable and generally lower in old mice than in young mice. When erythropoietin was injected into polycythemic animals, the increase in differentiated erythroid cells and 59 Fe incorporation into erythroid marrow and peripheral blood cells was significantly lower in old mice than in young mice. In contrast to differentiated erythroid cells, there was less evidence of a reduced response to simulation of the more primitive erythroid progenitor cells of aged animals. The early undifferentiated erythroid progenitor, burst-forming units, did not decrease when either young or aged mice were made polycythemic, and no change following erythropoietin injection was noted. Polycythemia suppressed the late-differentiated erythroid progenitor, erythroid colony-forming units, to a greater extent in aged animals, but when erythropoietin was injected, the percent increase over the subsequent 24 hours was identical to that in young mice. These observations indicate a reduced erythropoietic capacity with age, the abnormality being most obvious in the more mature erythroid precursors

  14. Primary intraosseous squamous cell carcinoma of the mandible arising de novo.

    Science.gov (United States)

    Shamim, Thorakkal

    2009-07-01

    Primary intraosseous squamous cell carcinoma is an odontogenic tumour with aggressive behaviour usually noticed in 6th to 7th decades of life. The tumour is characterized by progressive swelling of the jaw, pain and loosening of teeth. Microscopically, the lesion is showing foci of keratinising cells separated by collagenous connective tissue stroma. A case of primary intraosseous squamous cell carcinoma of mandible arising de novo in a 40-year-old man is reported.

  15. Sulforaphane Inhibits Lipopolysaccharide-Induced Inflammation, Cytotoxicity, Oxidative Stress, and miR-155 Expression and Switches to Mox Phenotype through Activating Extracellular Signal-Regulated Kinase 1/2-Nuclear Factor Erythroid 2-Related Factor 2/Antioxidant Response Element Pathway in Murine Microglial Cells.

    Science.gov (United States)

    Eren, Erden; Tufekci, Kemal Ugur; Isci, Kamer Burak; Tastan, Bora; Genc, Kursad; Genc, Sermin

    2018-01-01

    Sulforaphane (SFN) is a natural product with cytoprotective, anti-inflammatory, and antioxidant effects. In this study, we evaluated the mechanisms of its effects on lipopolysaccharide (LPS)-induced cell death, inflammation, oxidative stress, and polarization in murine microglia. We found that SFN protects N9 microglial cells upon LPS-induced cell death and suppresses LPS-induced levels of secreted pro-inflammatory cytokines, tumor necrosis factor-alpha, interleukin-1 beta, and interleukin-6. SFN is also a potent inducer of redox sensitive transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2), which is responsible for the transcription of antioxidant, cytoprotective, and anti-inflammatory genes. SFN induced translocation of Nrf2 to the nucleus via extracellular signal-regulated kinase 1/2 (ERK1/2) pathway activation. siRNA-mediated knockdown study showed that the effects of SFN on LPS-induced reactive oxygen species, reactive nitrogen species, and pro-inflammatory cytokine production and cell death are partly Nrf2 dependent. Mox phenotype is a novel microglial phenotype that has roles in oxidative stress responses. Our results suggested that SFN induced the Mox phenotype in murine microglia through Nrf2 pathway. SFN also alleviated LPS-induced expression of inflammatory microRNA, miR-155. Finally, SFN inhibits microglia-mediated neurotoxicity as demonstrated by conditioned medium and co-culture experiments. In conclusion, SFN exerts protective effects on microglia and modulates the microglial activation state.

  16. Acute erythremic myelosis (true erythroleukaemia): a variant of AML FAB-M6.

    Science.gov (United States)

    Hasserjian, R P; Howard, J; Wood, A; Henry, K; Bain, B

    2001-03-01

    Classic erythroleukaemia (acute myeloid leukaemia M6, or M6 AML) is defined as an excess of myeloblasts in an erythroid predominant background. Leukaemia variants in which the primitive blast cells are demonstrably erythroid are extremely rare and poorly characterised. Variably referred to as "true erythroleukaemia" or "acute erythremic myelosis", they are often included within the M6 AML category even though they do not meet strict criteria for this type of AML. Two cases of acute erythroid neoplasia are presented with clinical, morphological, immunophenotypic, and cytogenetic analysis. Both patients presented with profound anaemia, one in a setting of long standing myelodysplasia. Bone marrow examination revealed a predominant population of highly dysplastic erythroid cells in both cases. In one case, the liver was infiltrated by neoplastic erythroid cells. Both patients died within four months of diagnosis. This report illustrates that cases of acute leukaemia occur in which the dominant neoplastic cell is a primitive erythroid cell without an accompanying increase in myeloblasts. This does not preclude the neoplastic clone originating in a multipotent haemopoietic stem cell, as suggested by cases arising in patients with myelodysplasia. Acute erythremic myelosis should be recognised as a distinct variant of M6 AML.

  17. Modulating Leukemia-Initiating Cell Quiescence to Improve Leukemia Treatment

    Science.gov (United States)

    2015-09-01

    T- cells and in innate immunity (Lacorazza et al., 2002). It controls the proliferation and homing of CD8+ T- cells via the Kruppel-like factors...Lin2Sca12IL7R2Kit1FccRII/ IIIhighCD34high), megakaryocyte-erythroid progenitor cell (MEP) (Lin2Sca12IL7R2Kit1FccRII/IIIlowCD34low), and common lymphoid ...to this model, the first wave gives rise exclusively to innate immune B cells in early embryonic life and may be derived from progenitor cells

  18. Epo receptors are not detectable in primary human tumor tissue samples.

    Directory of Open Access Journals (Sweden)

    Steve Elliott

    Full Text Available Erythropoietin (Epo is a cytokine that binds and activates an Epo receptor (EpoR expressed on the surface of erythroid progenitor cells to promote erythropoiesis. While early studies suggested EpoR transcripts were expressed exclusively in the erythroid compartment, low-level EpoR transcripts were detected in nonhematopoietic tissues and tumor cell lines using sensitive RT-PCR methods. However due to the widespread use of nonspecific anti-EpoR antibodies there are conflicting data on EpoR protein expression. In tumor cell lines and normal human tissues examined with a specific and sensitive monoclonal antibody to human EpoR (A82, little/no EpoR protein was detected and it was not functional. In contrast, EpoR protein was reportedly detectable in a breast tumor cell line (MCF-7 and breast cancer tissues with an anti-EpoR polyclonal antibody (M-20, and functional responses to rHuEpo were reported with MCF-7 cells. In another study, a functional response was reported with the lung tumor cell line (NCI-H838 at physiological levels of rHuEpo. However, the specificity of M-20 is in question and the absence of appropriate negative controls raise questions about possible false-positive effects. Here we show that with A82, no EpoR protein was detectable in normal human and matching cancer tissues from breast, lung, colon, ovary and skin with little/no EpoR in MCF-7 and most other breast and lung tumor cell lines. We show further that M-20 provides false positive staining with tissues and it binds to a non-EpoR protein that migrates at the same size as EpoR with MCF-7 lysates. EpoR protein was detectable with NCI-H838 cells, but no rHuEpo-induced phosphorylation of AKT, STAT3, pS6RP or STAT5 was observed suggesting the EpoR was not functional. Taken together these results raise questions about the hypothesis that most tumors express high levels of functional EpoR protein.

  19. Can widely used cell type markers predict the suitability of immortalized or primary mammary epithelial cell models?

    Directory of Open Access Journals (Sweden)

    Edgar Corneille Ontsouka

    Full Text Available BACKGROUND: Mammary cell cultures are convenient tools for in vitro studies of mammary gland biology. However, the heterogeneity of mammary cell types, e.g., glandular milk secretory epithelial or myoepithelial cells, often complicates the interpretation of cell-based data. The present study was undertaken to determine the relevance of bovine primary mammary epithelial cells isolated from American Holstein (bMEC US or Swiss Holstein-Friesian (bMEC CH cows, and of primary bovine mammary alveolar epithelial cells stably transfected with simian virus-40 (SV-40 large T-antigen (MAC-T for in vitro analyses. This was evaluated by testing their expression pattern of cytokeratin (CK 7, 18, 19, vimentin, and α-smooth muscle actin (α-SMA. RESULTS: The expression of the listed markers was assessed using real-time quantitative PCR, flow cytometry and immunofluorescence microscopy. Characteristic markers of the mesenchymal (vimentin, myoepithelial (α-SMA and glandular secretory cells (CKs showed differential expression among the studied cell cultures, partly depending on the analytical method used. The relative mRNA expression of vimentin, CK7 and CK19, respectively, was lower (P < 0.05 in immortalized than in primary mammary cell cultures. The stain index (based on flow cytometry of CK7 and CK19 protein was lower (P < 0.05 in MAC-T than in bMECs, while the expression of α-SMA and CK18 showed an inverse pattern. Immunofluorescence microscopy analysis mostly confirmed the mRNA data, while partly disagreed with flow cytometry data (e.g., vimentin level in MAC-T. The differential expression of CK7 and CK19 allowed discriminating between immortal and primary mammary cultures. CONCLUSIONS: The expression of the selected widely used cell type markers in primary and immortalized MEC cells did not allow a clear preference between these two cell models for in vitro analyses studying aspects of milk composition. All tested cell models exhibited to a variable

  20. Drug discovery for Diamond-Blackfan anemia using reprogrammed hematopoietic progenitors

    Science.gov (United States)

    Doulatov, Sergei; Vo, Linda T.; Macari, Elizabeth R.; Wahlster, Lara; Kinney, Melissa A.; Taylor, Alison M.; Barragan, Jessica; Gupta, Manav; McGrath, Katherine; Lee, Hsiang-Ying; Humphries, Jessica M.; DeVine, Alex; Narla, Anupama; Alter, Blanche P.; Beggs, Alan H.; Agarwal, Suneet; Ebert, Benjamin L.; Gazda, Hanna T.; Lodish, Harvey F.; Sieff, Colin A.; Schlaeger, Thorsten M.; Zon, Leonard I.; Daley, George Q.

    2017-01-01

    Diamond-Blackfan anemia (DBA) is a congenital disorder characterized by the failure of erythroid progenitor differentiation, severely curtailing red blood cell production. Because many DBA patients fail to respond to corticosteroid therapy, there is considerable need for therapeutics for this disorder. Identifying therapeutics for DBA requires circumventing the paucity of primary patient blood stem and progenitor cells. To this end, we adopted a reprogramming strategy to generate expandable hematopoietic progenitor cells from induced pluripotent stem cells (iPSCs) from DBA patients. Reprogrammed DBA progenitors recapitulate defects in erythroid differentiation, which were rescued by gene complementation. Unbiased chemical screens identified SMER28, a small-molecule inducer of autophagy, which enhanced erythropoiesis in a range of in vitro and in vivo models of DBA. SMER28 acted through autophagy factor ATG5 to stimulate erythropoiesis and up-regulate expression of globin genes. These findings present an unbiased drug screen for hematological disease using iPSCs and identify autophagy as a therapeutic pathway in DBA. PMID:28179501

  1. Self-renewing Monolayer of Primary Colonic or Rectal Epithelial CellsSummary

    Directory of Open Access Journals (Sweden)

    Yuli Wang

    2017-07-01

    Full Text Available Background & Aims: Three-dimensional organoid culture has fundamentally changed the in vitro study of intestinal biology enabling novel assays; however, its use is limited because of an inaccessible luminal compartment and challenges to data gathering in a three-dimensional hydrogel matrix. Long-lived, self-renewing 2-dimensional (2-D tissue cultured from primary colon cells has not been accomplished. Methods: The surface matrix and chemical factors that sustain 2-D mouse colonic and human rectal epithelial cell monolayers with cell repertoires comparable to that in vivo were identified. Results: The monolayers formed organoids or colonoids when placed in standard Matrigel culture. As with the colonoids, the monolayers exhibited compartmentalization of proliferative and differentiated cells, with proliferative cells located near the peripheral edges of growing monolayers and differentiated cells predominated in the central regions. Screening of 77 dietary compounds and metabolites revealed altered proliferation or differentiation of the murine colonic epithelium. When exposed to a subset of the compound library, murine organoids exhibited similar responses to that of the monolayer but with differences that were likely attributable to the inaccessible organoid lumen. The response of the human primary epithelium to a compound subset was distinct from that of both the murine primary epithelium and human tumor cells. Conclusions: This study demonstrates that a self-renewing 2-D murine and human monolayer derived from primary cells can serve as a physiologically relevant assay system for study of stem cell renewal and differentiation and for compound screening. The platform holds transformative potential for personalized and precision medicine and can be applied to emerging areas of disease modeling and microbiome studies. Keywords: Colonic Epithelial Cells, Monolayer, Organoids, Compound Screening

  2. Results of radiotherapy for primary subglottic squamous cell carcinoma

    International Nuclear Information System (INIS)

    Paisley, Sonya; Warde, Padraig R.; O'Sullivan, Brian; Waldron, John; Gullane, Patrick J.; Payne, David; Liu, F.-F.; Bayley, Andrew; Ringash, Jolie; Cummings, Bernard J.

    2002-01-01

    Purpose: To retrospectively evaluate the outcome after radical radiotherapy (RT) and surgical salvage and assess the risk of late toxicity for patients with primary subglottic squamous cell carcinoma treated at our center. Methods and Materials: Between 1971 and 1996, 43 patients with primary squamous cell carcinoma of the subglottis (35 men, 8 women) were treated with radical RT. All received megavoltage irradiation, most commonly to a dose of 50-52 Gy in 20 fractions during 4 weeks (39 patients). The median follow-up was 4.2 years. Results: Local control was achieved with RT alone in 24 (56%) of the 43 patients: 7 of 11 with T1, 8 of 12 with T2, 4 of 8 with T3, and 5 of 12 with T4. The 5-year actuarial local relapse-free rate was 52%. Subsequent local control was achieved in 11 of the 13 patients with failed RT and attempted surgical salvage, for an ultimate local control rate of 81.4% (35 of 43). The 5-year overall and cause-specific actuarial survival rate was 50.3% and 66.9%, respectively. No patients developed Grade 3 or 4 late radiation morbidity. Conclusion: These data support the use of primary RT in the treatment of patients with primary squamous cell carcinoma of the subglottis as an appropriate treatment approach providing an option for laryngeal conservation

  3. Electromigration of cadmium in contaminated soils driven by single and multiple primary cells

    International Nuclear Information System (INIS)

    Yuan Songhu; Wu Chan; Wan Jinzhong; Lu Xiaohua

    2008-01-01

    This study tentatively used an iron (Fe) and carbon (C) primary cell, instead of dc electric power, to drive the electromigration of cadmium in contaminated soils. The addition of acid to C compartment increased the electric potential, while the addition of acid to Fe compartment had a slight influence on the potential. It was feasible using the primary cell to drive the electromigration of cadmium in kaolin. The electromigration efficiencies were highly related to the soil pH. Lower pH led to greater migration efficiency. The mechanisms involved the desorption of cadmium from soils to pore solution and the electromigration of cadmium in the pore solution. The desorption was critical to the electromigration process. The series of primary cells could expand the treatment area, but the electromigration efficiencies of cadmium in each cell were less than that achieved by single primary cell. Since the potential gradient produced by the primary cell was rather low, the electromigration rate of pollutants was very low and remediation duration was long. The application would be acceptable in some specific sites, such as acidic soils or artificially controlled acid conditions so that heavy metals have been desorbed from soils

  4. Primary signet cell adenocarcinoma of bladder

    Directory of Open Access Journals (Sweden)

    Prateek Kinra

    2017-01-01

    Full Text Available Primary signet cell cancer of the urinary bladder is a relatively rare entity. Since there is no mucinous epithelium in the bladder, It is proposed that the tumor arises from metaplastic urothelium. Two thirds of the tumours are mucin secreting, in most of which the site of the deposition is either extracellular or intracellular displacing the nucleus to a peripheral crescent, giving the cells a signet ring appearance. The tumours are most often infiltrative and diffusely involving the majority of the bladder akin to its name sake in stomach. It is essential to distinguish this carcinoma from gastrointestinal metastases as different therapeutic strategies are often necessary.

  5. Chicken major histocompatibility complex-encoded B-G antigens are found on many cell types that are important for the immune system

    DEFF Research Database (Denmark)

    Salomonsen, J; Dunon, D; Skjødt, K

    1991-01-01

    B-G antigens are a polymorphic multigene family of cell surface molecules encoded by the chicken major histocompatibility complex (MHC). They have previously been described only on cells of the erythroid lineage. By using flow cytometry, section staining, and immunoprecipitation with monoclonal a...

  6. Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

    Science.gov (United States)

    Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

    2017-07-11

    In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing

  7. Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.

    Science.gov (United States)

    Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong

    2017-02-03

    Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.

  8. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jiyoung [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cha, Young-Nam [Inha University College of Medicine, Incheon 382-751 (Korea, Republic of); Surh, Young-Joon, E-mail: surh@plaza.snu.ac.kr [National Research Laboratory, College of Pharmacy, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Department of Molecular Medicine and Biopharmaceutical Sciences, Graduate School of Convergence Science and Technology, Seoul National University, Seoul 151-742 (Korea, Republic of); Cancer Research Institute, Seoul National University, Seoul 110-799 (Korea, Republic of)

    2010-08-07

    Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor that plays a central role in cellular defense against oxidative and electrophilic insults by timely induction of antioxidative and phase-2 detoxifying enzymes and related stress-response proteins. The 5'-flanking regions of genes encoding these cytoprotective proteins contain a specific consensus sequence termed antioxidant response element (ARE) to which Nrf2 binds. Recent studies have demonstrated that Nrf2-ARE signaling is also involved in attenuating inflammation-associated pathogenesis, such as autoimmune diseases, rheumatoid arthritis, asthma, emphysema, gastritis, colitis and atherosclerosis. Thus, disruption or loss of Nrf2 signaling causes enhanced susceptibility not only to oxidative and electrophilic stresses but also to inflammatory tissue injuries. During the early-phase of inflammation-mediated tissue damage, activation of Nrf2-ARE might inhibit the production or expression of pro-inflammatory mediators including cytokines, chemokines, cell adhesion molecules, matrix metalloproteinases, cyclooxygenase-2 and inducible nitric oxide synthase. It is likely that the cytoprotective function of genes targeted by Nrf2 may cooperatively regulate the innate immune response and also repress the induction of pro-inflammatory genes. This review highlights the protective role of Nrf2 in inflammation-mediated disorders with special focus on the inflammatory signaling modulated by this redox-regulated transcription factor.

  9. A Cell Culture Platform to Maintain Long-term Phenotype of Primary Human Hepatocytes and Endothelial Cells.

    Science.gov (United States)

    Ware, Brenton R; Durham, Mitchell J; Monckton, Chase P; Khetani, Salman R

    2018-03-01

    Modeling interactions between primary human hepatocytes (PHHs) and primary human liver sinusoidal endothelial cells (LSECs) in vitro can help elucidate human-specific mechanisms underlying liver physiology/disease and drug responses; however, existing hepatocyte/endothelial coculture models are suboptimal because of their use of rodent cells, cancerous cell lines, and/or nonliver endothelial cells. Hence, we sought to develop a platform that could maintain the long-term phenotype of PHHs and primary human LSECs. Primary human LSECs or human umbilical vein endothelial cells as the nonliver control were cocultivated with micropatterned PHH colonies (to control homotypic interactions) followed by an assessment of PHH morphology and functions (albumin and urea secretion, and cytochrome P-450 2A6 and 3A4 enzyme activities) over 3 weeks. Endothelial phenotype was assessed via gene expression patterns and scanning electron microscopy to visualize fenestrations. Hepatic responses in PHH/endothelial cocultures were benchmarked against responses in previously developed PHH/3T3-J2 fibroblast cocultures. Finally, PHH/fibroblast/endothelial cell tricultures were created and characterized as described previously. LSECs, but not human umbilical vein endothelial cells, induced PHH albumin secretion for ∼11 days; however, neither endothelial cell type could maintain PHH morphology and functions to the same magnitude/longevity as the fibroblasts. In contrast, both PHHs and endothelial cells displayed stable phenotype for 3 weeks in PHH/fibroblast/endothelial cell tricultures; furthermore, layered tricultures in which PHHs and endothelial cells were separated by a protein gel to mimic the space of Disse displayed similar functional levels as the coplanar tricultures. PHH/fibroblast/endothelial tricultures constitute a robust platform to elucidate reciprocal interactions between PHHs and endothelial cells in physiology, disease, and after drug exposure.

  10. Resveratrol Differentially Regulates NAMPT and SIRT1 in Hepatocarcinoma Cells and Primary Human Hepatocytes

    Science.gov (United States)

    Schuster, Susanne; Penke, Melanie; Gorski, Theresa; Petzold-Quinque, Stefanie; Damm, Georg; Gebhardt, Rolf; Kiess, Wieland; Garten, Antje

    2014-01-01

    Resveratrol is reported to possess chemotherapeutic properties in several cancers. In this study, we wanted to investigate the molecular mechanisms of resveratrol-induced cell cycle arrest and apoptosis as well as the impact of resveratrol on NAMPT and SIRT1 protein function and asked whether there are differences in hepatocarcinoma cells (HepG2, Hep3B cells) and non-cancerous primary human hepatocytes. We found a lower basal NAMPT mRNA and protein expression in hepatocarcinoma cells compared to primary hepatocytes. In contrast, SIRT1 was significantly higher expressed in hepatocarcinoma cells than in primary hepatocytes. Resveratrol induced cell cycle arrest in the S- and G2/M- phase and apoptosis was mediated by activation of p53 and caspase-3 in HepG2 cells. In contrast to primary hepatocytes, resveratrol treated HepG2 cells showed a reduction of NAMPT enzymatic activity and increased p53 acetylation (K382). Resveratrol induced NAMPT release from HepG2 cells which was associated with increased NAMPT mRNA expression. This effect was absent in primary hepatocytes where resveratrol was shown to function as NAMPT and SIRT1 activator. SIRT1 inhibition by EX527 resembled resveratrol effects on HepG2 cells. Furthermore, a SIRT1 overexpression significantly decreased both p53 hyperacetylation and resveratrol-induced NAMPT release as well as S-phase arrest in HepG2 cells. We could show that NAMPT and SIRT1 are differentially regulated by resveratrol in hepatocarcinoma cells and primary hepatocytes and that resveratrol did not act as a SIRT1 activator in hepatocarcinoma cells. PMID:24603648

  11. Resveratrol differentially regulates NAMPT and SIRT1 in Hepatocarcinoma cells and primary human hepatocytes.

    Directory of Open Access Journals (Sweden)

    Susanne Schuster

    Full Text Available Resveratrol is reported to possess chemotherapeutic properties in several cancers. In this study, we wanted to investigate the molecular mechanisms of resveratrol-induced cell cycle arrest and apoptosis as well as the impact of resveratrol on NAMPT and SIRT1 protein function and asked whether there are differences in hepatocarcinoma cells (HepG2, Hep3B cells and non-cancerous primary human hepatocytes. We found a lower basal NAMPT mRNA and protein expression in hepatocarcinoma cells compared to primary hepatocytes. In contrast, SIRT1 was significantly higher expressed in hepatocarcinoma cells than in primary hepatocytes. Resveratrol induced cell cycle arrest in the S- and G2/M- phase and apoptosis was mediated by activation of p53 and caspase-3 in HepG2 cells. In contrast to primary hepatocytes, resveratrol treated HepG2 cells showed a reduction of NAMPT enzymatic activity and increased p53 acetylation (K382. Resveratrol induced NAMPT release from HepG2 cells which was associated with increased NAMPT mRNA expression. This effect was absent in primary hepatocytes where resveratrol was shown to function as NAMPT and SIRT1 activator. SIRT1 inhibition by EX527 resembled resveratrol effects on HepG2 cells. Furthermore, a SIRT1 overexpression significantly decreased both p53 hyperacetylation and resveratrol-induced NAMPT release as well as S-phase arrest in HepG2 cells. We could show that NAMPT and SIRT1 are differentially regulated by resveratrol in hepatocarcinoma cells and primary hepatocytes and that resveratrol did not act as a SIRT1 activator in hepatocarcinoma cells.

  12. Decellularized extracellular matrices produced from immortal cell lines derived from different parts of the placenta support primary mesenchymal stem cell expansion.

    Directory of Open Access Journals (Sweden)

    Gina D Kusuma

    Full Text Available Mesenchymal stem/stromal cells (MSCs exhibit undesired phenotypic changes during ex vivo expansion, limiting production of the large quantities of high quality primary MSCs needed for both basic research and cell therapies. Primary MSCs retain many desired MSC properties including proliferative capacity and differentiation potential when expanded on decellularized extracellular matrix (dECM prepared from primary MSCs. However, the need to use low passage number primary MSCs (passage 3 or lower to produce the dECM drastically limits the utility and impact of this technology. Here, we report that primary MSCs expanded on dECM prepared from high passage number (passage 25 human telomerase reverse transcriptase (hTERT transduced immortal MSC cell lines also exhibit increased proliferation and osteogenic differentiation. Two hTERT-transduced placenta-derived MSC cell lines, CMSC29 and DMSC23 [derived from placental chorionic villi (CMSCs and decidua basalis (DMSCs, respectively], were used to prepare dECM-coated substrates. These dECM substrates showed structural and biochemical differences. Primary DMSCs cultured on dECM-DMSC23 showed a three-fold increase in cell number after 14 days expansion in culture and increased osteogenic differentiation compared with controls. Primary CMSCs cultured on the dECM-DMSC23 exhibited a two-fold increase in cell number and increased osteogenic differentiation. We conclude that immortal MSC cell lines derived from different parts of the placenta produce dECM with varying abilities for supporting increased primary MSC expansion while maintaining important primary MSC properties. Additionally, this is the first demonstration of using high passage number cells to produce dECM that can promote primary MSC expansion, and this advancement greatly increases the feasibility and applicability of dECM-based technologies.

  13. Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells

    OpenAIRE

    Lee, Jonghyeob; Snyder, Emily R.; Liu, Yinghua; Gu, Xueying; Wang, Jing; Flowers, Brittany M.; Kim, Yoo Jung; Park, Sangbin; Szot, Gregory L.; Hruban, Ralph H.; Longacre, Teri A.; Kim, Seung K.

    2017-01-01

    Development of systems that reconstitute hallmark features of human pancreatic intraepithelial neoplasia (PanINs), the precursor to pancreatic ductal adenocarcinoma, could generate new strategies for early diagnosis and intervention. However, human cell-based PanIN models with defined mutations are unavailable. Here, we report that genetic modification of primary human pancreatic cells leads to development of lesions resembling native human PanINs. Primary human pancreas duct cells harbouring...

  14. Induction of multipotential hematopoietic progenitors from human pluripotent stem cells via re-specification of lineage-restricted precursors

    Science.gov (United States)

    Doulatov, Sergei; Vo, Linda T.; Chou, Stephanie S.; Kim, Peter G.; Arora, Natasha; Li, Hu; Hadland, Brandon K.; Bernstein, Irwin D.; Collins, James J.; Zon, Leonard I.; Daley, George Q.

    2013-01-01

    Summary Human pluripotent stem cells (hPSCs) represent a promising source of patient-specific cells for disease modeling, drug screens, and cellular therapies. However, the inability to derive engraftable human hematopoietic stem and progenitor (HSPCs) has limited their characterization to in vitro assays. We report a strategy to re-specify lineage-restricted CD34+CD45+ myeloid precursors derived from hPSCs into multilineage progenitors that can be expanded in vitro and engraft in vivo. HOXA9, ERG, and RORA conferred self-renewal and multilineage potential in vitro and maintained primitive CD34+CD38− cells. Screening cells via transplantation revealed that two additional factors, SOX4 and MYB, were required for engraftment. Progenitors specified with all five factors gave rise to reproducible short-term engraftment with myeloid and erythroid lineages. Erythroid precursors underwent hemoglobin switching in vivo, silencing embryonic and activating adult globin expression. Our combinatorial screening approach establishes a strategy for obtaining transcription factor-mediated engraftment of blood progenitors from human pluripotent cells. PMID:24094326

  15. Primary orbital precursor T-cell lymphoblastic lymphoma

    DEFF Research Database (Denmark)

    Stenman, Lisa; Persson, Marta; Enlund, Fredrik

    2016-01-01

    Primary T-cell lymphoblastic lymphoma (T-LBL) in the eye region is very rare. The present study described a unique case of T-LBL involving the extraocular muscles. A 22-year-old male patient presented with a 3-week history of headache, reduced visual acuity and edema of the left eye. Clinical...... knowledge, this is the first report of a case of T-LBL involving the extraocular muscles. Although primary T-LBL in the eye region is very rare, our findings demonstrate that lymphoma should be considered in the differential diagnosis of patients with similar symptoms....

  16. Heme and erythropoieis: more than a structural role.

    Science.gov (United States)

    Chiabrando, Deborah; Mercurio, Sonia; Tolosano, Emanuela

    2014-06-01

    Erythropoiesis is the biological process that consumes the highest amount of body iron for heme synthesis. Heme synthesis in erythroid cells is finely coordinated with that of alpha (α) and beta (β)-globin, resulting in the production of hemoglobin, a tetramer of 2α- and 2β-globin chains, and heme as the prosthetic group. Heme is not only the structural component of hemoglobin, but it plays multiple regulatory roles during the differentiation of erythroid precursors since it controls its own synthesis and regulates the expression of several erythroid-specific genes. Heme is synthesized in developing erythroid progenitors by the stage of proerythroblast, through a series of eight enzymatic reactions divided between mitochondria and cytosol. Defects of heme synthesis in the erythroid lineage result in sideroblastic anemias, characterized by microcytic anemia associated to mitochondrial iron overload, or in erythropoietic porphyrias, characterized by porphyrin deposition in erythroid cells. Here, we focus on the heme biosynthetic pathway and on human erythroid disorders due to defective heme synthesis. The regulatory role of heme during erythroid differentiation is discussed as well as the heme-mediated regulatory mechanisms that allow the orchestration of the adaptive cell response to heme deficiency. Copyright© Ferrata Storti Foundation.

  17. CYT387, a selective JAK1/JAK2 inhibitor: in vitro assessment of kinase selectivity and preclinical studies using cell lines and primary cells from polycythemia vera patients.

    Science.gov (United States)

    Pardanani, A; Lasho, T; Smith, G; Burns, C J; Fantino, E; Tefferi, A

    2009-08-01

    Somatic mutations in Janus kinase 2 (JAK2), including JAK2V617F, result in dysregulated JAK-signal transducer and activator transcription (STAT) signaling, which is implicated in myeloproliferative neoplasm (MPN) pathogenesis. CYT387 is an ATP-competitive small molecule that potently inhibits JAK1/JAK2 kinases (IC(50)=11 and 18 nM, respectively), with significantly less activity against other kinases, including JAK3 (IC(50)=155 nM). CYT387 inhibits growth of Ba/F3-JAK2V617F and human erythroleukemia (HEL) cells (IC(50) approximately 1500 nM) or Ba/F3-MPLW515L cells (IC(50)=200 nM), but has considerably less activity against BCR-ABL harboring K562 cells (IC=58 000 nM). Cell lines harboring mutated JAK2 alleles (CHRF-288-11 or Ba/F3-TEL-JAK2) were inhibited more potently than the corresponding pair harboring mutated JAK3 alleles (CMK or Ba/F3-TEL-JAK3), and STAT-5 phosphorylation was inhibited in HEL cells with an IC(50)=400 nM. Furthermore, CYT387 selectively suppressed the in vitro growth of erythroid colonies harboring JAK2V617F from polycythemia vera (PV) patients, an effect that was attenuated by exogenous erythropoietin. Overall, our data indicate that the JAK1/JAK2 selective inhibitor CYT387 has potential for efficacious treatment of MPN harboring mutated JAK2 and MPL alleles.

  18. Alginate-Poly(ethylene glycol Hybrid Microspheres for Primary Cell Microencapsulation

    Directory of Open Access Journals (Sweden)

    Redouan Mahou

    2014-01-01

    Full Text Available The progress of medical therapies, which rely on the transplantation of microencapsulated living cells, depends on the quality of the encapsulating material. Such material has to be biocompatible, and the microencapsulation process must be simple and not harm the cells. Alginate-poly(ethylene glycol hybrid microspheres (alg-PEG-M were produced by combining ionotropic gelation of sodium alginate (Na-alg using calcium ions with covalent crosslinking of vinyl sulfone-terminated multi-arm poly(ethylene glycol (PEG-VS. In a one-step microsphere formation process, fast ionotropic gelation yields spherical calcium alginate gel beads, which serve as a matrix for simultaneously but slowly occurring covalent cross-linking of the PEG-VS molecules. The feasibility of cell microencapsulation was studied using primary human foreskin fibroblasts (EDX cells as a model. The use of cell culture media as polymer solvent, gelation bath, and storage medium did not negatively affect the alg-PEG-M properties. Microencapsulated EDX cells maintained their viability and proliferated. This study demonstrates the feasibility of primary cell microencapsulation within the novel microsphere type alg-PEG-M, serves as reference for future therapy development, and confirms the suitability of EDX cells as control model.

  19. Identification of differences in gene expression in primary cell cultures of human endometrial epithelial cells and trophoblast cells following their interaction

    DEFF Research Database (Denmark)

    Høgh, Mette; Islin, Henrik; Møller, Charlotte

    2006-01-01

    The interaction between the cell types was simulated in vitro by growing primary cell cultures of human endometrial epithelial cells and trophoblast cells together (co-culture) and separately (control cultures). Gene expression in the cell cultures was compared using the Differential Display method and confirmed...

  20. Circulating CXCR5+CD4+ T cells assist in the survival and growth of primary diffuse large B cell lymphoma cells through interleukin 10 pathway

    International Nuclear Information System (INIS)

    Cha, Zhanshan; Qian, Guangfang; Zang, Yan; Gu, Haihui; Huang, Yanyan; Zhu, Lishuang; Li, Jinqi; Liu, Yang; Tu, Xiaohua; Song, Haihan; Qian, Baohua

    2017-01-01

    Diffuse large B cell lymphoma (DLBCL) is a common and aggressive cancer caused by the malignant transformation of B cells. Although it has been established that the follicular helper T (Tfh) cells play a central role in B cell development, little information is available on their involvement in DLBCL pathogenesis. We studied the role of the peripheral Tfh equivalent, the CXCR5"+ CD4"+ T cells, in DLBCL. Data showed that compared to CXCR5"- CD4"+ T cells, CXCR5"+ CD4"+ T cells were significantly more effective at promoting the proliferation as well as inhibiting the apoptosis of primary autologous DLBCL tumor cells. Surprisingly, we found that at equal cell numbers, CXCR5"+ CD4"+ T cells in DLBCL patients secreted significantly less interleukin (IL)-21 than CXCR5"- CD4"+ T cells, while the level of IL-10 secretion was significant elevated in the CXCR5"+ compartment compared to the CXCR5"- compartment. Neutralization of IL-10 in the primary DLBCL-CXCR5"+ CD4"+ T cell coculture compromised the CXCR5"+ CD4"+ T cell-mediated pro-tumor effects, in a manner that was dependent on the concentration of anti-IL-10 antibodies. The CXCR5"+ compartment also contained significantly lower frequencies of cytotoxic CD4"+ T cells than the CXCR5"- compartment. In conclusion, our investigations discovered a previously unknown pro-tumor role of CXCR5-expressing circulating CD4"+ T cells, which assisted the survival and proliferation of primary DLBCL cells through IL-10. - Highlights: • We studied the role of the peripheral Tfh in DLBCL. • Tfh were effective at promoting the proliferation of primary DLBCL tumor cells. • Tfh were effective at inhibiting the apoptosis of primary DLBCL tumor cells. • IL-10 secretion in Tfh was significant elevated in DLBCL. • Neutralization of IL-10 compromised Tfh-mediated pro-tumor effects.

  1. Survey and evaluation of mutations in the human KLF1 transcription unit.

    Science.gov (United States)

    Gnanapragasam, Merlin Nithya; Crispino, John D; Ali, Abdullah M; Weinberg, Rona; Hoffman, Ronald; Raza, Azra; Bieker, James J

    2018-04-26

    Erythroid Krüppel-like Factor (EKLF/KLF1) is an erythroid-enriched transcription factor that plays a global role in all aspects of erythropoiesis, including cell cycle control and differentiation. We queried whether its mutation might play a role in red cell malignancies by genomic sequencing of the KLF1 transcription unit in cell lines, erythroid neoplasms, dysplastic disorders, and leukemia. In addition, we queried published databases from a number of varied sources. In all cases we only found changes in commonly notated SNPs. Our results suggest that if there are mutations in KLF1 associated with erythroid malignancies, they are exceedingly rare.

  2. Spontaneous regression of primary diffuse large B-cell lymphoma, leg type.

    Science.gov (United States)

    Alcántara-González, J; González-García, C; Fernández-Guarino, M; Jaén-Olasolo, P

    2014-01-01

    Primary cutaneous diffuse large B-cell lymphoma, leg type (PCLBCL LT) accounts for approximately 20% of all primary cutaneous B-cell lymphomas and tends to present as infiltrated nodules, tumors, and plaques on the legs in the elderly. Unlike other primary cutaneous large B-cell lymphomas, it has a poor prognosis and tends to require treatment with systemic chemotherapy. We present the case of an 82-year-old patient with a 1-year history of nodules and plaques on her right leg. Biopsy led to a diagnosis of PCLBCL LT and the lesions resolved without treatment within 1 month of the first visit. This is an atypical course of PCLBCL LT and we believe that it is the first such case to be reported in the literature. Copyright © 2012 Elsevier España, S.L. and AEDV. All rights reserved.

  3. Does Erythropoietin Regulate TRPC Channels in Red Blood Cells?

    Directory of Open Access Journals (Sweden)

    Jens Danielczok

    2017-03-01

    Full Text Available Background: Cation channels play an essential role in red blood cells (RBCs ion homeostasis. One set of ion channels are the transient receptor potential channels of canonical type (TRPC channels. The abundance of these channels in primary erythroblasts, erythroid cell lines and RBCs was associated with an increase in intracellular Ca2+ upon stimulation with Erythropoietin (Epo. In contrast two independent studies on Epo-treated patients revealed diminished basal Ca2+ concentration or reduced phosphatidylserine exposure to the outer membrane leaflet. Methods: To resolve the seemingly conflicting reports we challenged mature human and mouse RBCs of several genotypes with Epo and Prostaglandin E2 (PGE2 and recorded the intracellular Ca2+ content. Next Generation Sequencing was utilised to approach a molecular analysis of reticulocytes. Results/Conclusions: Our results allow concluding that Epo and PGE2 regulation of the Ca2+ homeostasis is distinctly different between murine and human RBCs and that changes in intracellular Ca2+ upon Epo treatment is a primary rather than a compensatory effect. In human RBCs, Epo itself has no effect on Ca2+ fluxes but inhibits the PGE2-induced Ca2+ entry. In murine mature RBCs functional evidence indicates TRPC4/C5 mediated Ca2+ entry activated by Epo whereas PGE2 leads to a TRPC independent Ca2+ entry.

  4. Adenosine formation in contracting primary rat skeletal muscle cells and endothelial cells in culture

    DEFF Research Database (Denmark)

    Hellsten, Ylva; Frandsen, Ulrik

    1997-01-01

    1. The present study examined the capacity for adenosine formation, uptake and metabolism in contracting primary rat muscle cells and in microvascular endothelial cells in culture. 2. Strong and moderate electrical simulation of skeletal muscle cells led to a significantly greater increase....... 3. Addition of microvascular endothelial cells to the cultured skeletal muscle cells enhanced the contraction-induced accumulation of extracellular adenosine (P Skeletal muscle cells were...... in the extracellular adenosine concentration (421 +/- 91 and 235 +/- 30 nmol (g protein)-1, respectively; P muscle cells (161 +/- 20 nmol (g protein)-1). The ATP concentration was lower (18%; P contracted, but not in the moderately contracted muscle cells...

  5. Tapak liman (Elephantopus scaber L) extract-induced CD4+ and CD8+ differentiation from hematopoietic stem cells and progenitor cell proliferation in mice (Mus musculus L)

    Science.gov (United States)

    Djati, Muhammad Sasmito; Habibu, Hindun; Jatiatmaja, Nabilah A.; Rifa'i, Muhaimin

    2017-11-01

    Tapak Liman (Elephantopus scaber L) is a traditional medicinal plant containing several active compounds that potentially affecting hematopoietic stem cells, such as epifrieelinol, lupeol, stigmasterol, triacontane-1-ol, dotriacontane-1-ol, lupeol acetate, deoxyelephan-topin, isodeoxyelephantopin, polyphenol luteolin-7, as well as various flavonoids and glucosides. The aim of this study was to elucidate the effect of leaf extract of Tapak Liman on hematopoietic stem cells in mice BALB/c, by observation of the relative number of cells expressing CD4/CD8, CD4/CD62L, and TER119/B220 in the spleen, and TER119/B220, TER119/VLA-4 and TER119/CD34 in bone marrow, after being administered leaf extract for 2 weeks. This experiment used 12 female mice, which were divided into three treatment groups, P1= 0.5 g.g bw-1.day-1, P2= 1.0 g.g bw-1.day-1 and P3=2.0 g.g bw-1.day-1 Tapak Liman leaf extract as well as a control. The relative numbers of cells expressing surface molecules were analyzed by flowcytometry and quantitative data were tested using one-way ANOVA. The results showed that the leaf extract of Tapak Liman has no significant effect on erythrocyte proliferation; on the other hand, it had a significant effect on both proliferation and differentiation of B lymphocytes (B220+) in bone marrow (p=0.044) and increased the expression of CD4+, CD8+ molecule in B cells (p=0.026) and erythroid cells in spleen and bone marrow, based on the estimation of cells that expressed TER119+VLA-4+, identified as important in the development pathway of erythrocytes. An increased cell percentage of TER11+VLA-4+ occurred for treatment P2, 12% higher than the control. The increased expression of TER119+VLA-4+ was assumed to be due to the iron content in Tapak Liman, which functioned to stimulate the progenitor hematopoietic cells to proliferate and differentiate into a precursor of erythroid cells (TER119+VLA-4+). There was an increasing number of cells expressing the surface molecules TER119

  6. Cytotoxicity and accumulation of ergot alkaloids in human primary cells.

    Science.gov (United States)

    Mulac, Dennis; Humpf, Hans-Ulrich

    2011-04-11

    Ergot alkaloids are secondary metabolites produced by fungi of the species Claviceps. Toxic effects after consumption of contaminated grains are described since mediaeval times. Of the more than 40 known ergot alkaloids six are found predominantly. These are ergotamine, ergocornine, ergocryptine, ergocristine, ergosine and ergometrine, along with their corresponding isomeric forms (-inine-forms). Toxic effects are known to be induced by an interaction of the ergot alkaloids as neurotransmitters, like dopamine or serotonin. Nevertheless data concerning cytotoxic effects are missing and therefore a screening of the six main ergot alkaloids was performed in human primary cells in order to evaluate the toxic potential. As it is well known that ergot alkaloids isomerize easily the stability was tested in the cell medium. Based on these results factors were calculated to correct the used concentration values to the biologically active lysergic (-ine) form. These factors range from 1.4 for the most stable compound ergometrine to 5.0 for the most unstable ergot alkaloid ergocristine. With these factors, reflecting the instability, several controverse literature data concerning the toxicity could be explained. To evaluate the cytotoxic effects of ergot alkaloids, human cells in primary culture were used. These cells remain unchanged in contrast to cell lines and the data allow a better comparison to the in vivo situation than using immortalized cell lines. To characterize the effects on primary cells, renal proximal tubule epithelial cells (RPTEC) and normal human astrocytes (NHA) were used. The parameters necrosis (LDH-release) and apoptosis (caspase-3-activation, DNA condensation and fragmentation) were distinguished. The results show that depending on the individual structure of the peptide ergot alkaloids the toxic properties change. While ergometrine as a lysergic acid amide did not show any effect, the peptide ergot alkaloids revealed a different toxic potential. Of

  7. A characterization of the ZFL cell line and primary hepatocytes as in vitro liver cell models for the zebrafish (Danio rerio)

    International Nuclear Information System (INIS)

    Eide, Marta; Rusten, Marte; Male, Rune; Jensen, Knut Helge Midtbø; Goksøyr, Anders

    2014-01-01

    Highlights: •The ZFL cell line and primary hepatocytes were characterized. •Basic and induced expression of nuclear receptors and target genes were found. •The ZFL cell line expresses very low basic levels of most genes. •The ZFL cells have low induction of gene expression following exposures. •Primary hepatocytes show large sex-dependent differences in gene expression. -- Abstract: The zebrafish (Danio rerio) is a widely used model species in biomedical research. The ZFL cell line, established from zebrafish liver, and freshly isolated primary hepatocytes from zebrafish have been used in several toxicological studies. However, no previous report has compared and characterized these two systems at the level of gene expression. The aim of this study was to evaluate the ZFL cell line in comparison to primary hepatocytes as in vitro models for studying effects of environmental contaminants in zebrafish liver. Using quantitative real-time PCR, the basal level and transcriptional induction potential of key genes involved in toxic responses in the ZFL cell line, primary hepatocytes and whole liver from zebrafish were compared. The study showed that the ZFL cells have lower levels of mRNA of most selected genes compared to zebrafish liver. The induced gene transcription following exposure to ligand was much lower in ZFL cells compared to zebrafish primary hepatocytes at the doses tested. Importantly, oestrogen receptor and vitellogenin genes showed low basal transcription and no induction response in the ZFL cell line. In conclusion, it appears that primary hepatocytes are well suited for studying environmental contaminants including xenoestrogens, but may show large sex-dependent differences in gene transcription. The ZFL cell line shows potential in toxicological studies involving the aryl hydrocarbon receptor pathway. However, low potential for transcriptional induction of genes in general should be expected, especially notable when studying estrogenic

  8. A characterization of the ZFL cell line and primary hepatocytes as in vitro liver cell models for the zebrafish (Danio rerio)

    Energy Technology Data Exchange (ETDEWEB)

    Eide, Marta, E-mail: marta.eide@bio.uib.no [Department of Biology, University of Bergen, Bergen (Norway); Rusten, Marte; Male, Rune [Department of Molecular Biology, University of Bergen, Bergen (Norway); Jensen, Knut Helge Midtbø; Goksøyr, Anders [Department of Biology, University of Bergen, Bergen (Norway)

    2014-02-15

    Highlights: •The ZFL cell line and primary hepatocytes were characterized. •Basic and induced expression of nuclear receptors and target genes were found. •The ZFL cell line expresses very low basic levels of most genes. •The ZFL cells have low induction of gene expression following exposures. •Primary hepatocytes show large sex-dependent differences in gene expression. -- Abstract: The zebrafish (Danio rerio) is a widely used model species in biomedical research. The ZFL cell line, established from zebrafish liver, and freshly isolated primary hepatocytes from zebrafish have been used in several toxicological studies. However, no previous report has compared and characterized these two systems at the level of gene expression. The aim of this study was to evaluate the ZFL cell line in comparison to primary hepatocytes as in vitro models for studying effects of environmental contaminants in zebrafish liver. Using quantitative real-time PCR, the basal level and transcriptional induction potential of key genes involved in toxic responses in the ZFL cell line, primary hepatocytes and whole liver from zebrafish were compared. The study showed that the ZFL cells have lower levels of mRNA of most selected genes compared to zebrafish liver. The induced gene transcription following exposure to ligand was much lower in ZFL cells compared to zebrafish primary hepatocytes at the doses tested. Importantly, oestrogen receptor and vitellogenin genes showed low basal transcription and no induction response in the ZFL cell line. In conclusion, it appears that primary hepatocytes are well suited for studying environmental contaminants including xenoestrogens, but may show large sex-dependent differences in gene transcription. The ZFL cell line shows potential in toxicological studies involving the aryl hydrocarbon receptor pathway. However, low potential for transcriptional induction of genes in general should be expected, especially notable when studying estrogenic

  9. Phosphoproteomics of Primary Cells Reveals Druggable Kinase Signatures in Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Chiara Francavilla

    2017-03-01

    Full Text Available Our understanding of the molecular determinants of cancer is still inadequate because of cancer heterogeneity. Here, using epithelial ovarian cancer (EOC as a model system, we analyzed a minute amount of patient-derived epithelial cells from either healthy or cancerous tissues by single-shot mass-spectrometry-based phosphoproteomics. Using a multi-disciplinary approach, we demonstrated that primary cells recapitulate tissue complexity and represent a valuable source of differentially expressed proteins and phosphorylation sites that discriminate cancer from healthy cells. Furthermore, we uncovered kinase signatures associated with EOC. In particular, CDK7 targets were characterized in both EOC primary cells and ovarian cancer cell lines. We showed that CDK7 controls cell proliferation and that pharmacological inhibition of CDK7 selectively represses EOC cell proliferation. Our approach defines the molecular landscape of EOC, paving the way for efficient therapeutic approaches for patients. Finally, we highlight the potential of phosphoproteomics to identify clinically relevant and druggable pathways in cancer.

  10. Farnesyltransferase inhibitor tipifarnib (R115777) preferentially inhibits in vitro autonomous erythropoiesis of polycythemia vera patient cells.

    Science.gov (United States)

    Larghero, Jérôme; Gervais, Nathalie; Cassinat, Bruno; Rain, Jean-Didier; Schlageter, Marie-Hélène; Padua, Rose Ann; Chomienne, Christine; Rousselot, Philippe

    2005-05-01

    Polycythemia vera (PV) is an acquired myeloproliferative disorder with primary expansion of the red cell mass leading to an increased risk of thrombosis and less frequently to myelofibrosis and secondary acute leukemia. Standard therapies include cytoreduction with either phlebotomy or chemotherapeutic agents and antithrombotic drugs. Because long-term exposure to cytotoxic chemotherapy may increase the risk of acute transformation, new therapeutic options are needed. Tipifarnib is a nonpeptidomimetic inhibitor of farnesyl transferase that was developed as a potential inhibitor of RAS signaling. In the present study we report that tipifarnib used at pharmacologically achievable concentrations strongly inhibits the erythroid burst-forming unit (BFU-E) autonomous growth that characterizes patients with PV. Moreover, at low tipifarnib concentrations (0.15 muM), the inhibitory effect was preferentially observed in PV BFU-E progenitors and not in normal BFU-E progenitors and was not rescued by erythropoietin (EPO). Thus tipifarnib may specifically target PV stem cells and may be of clinical interest in the treatment of patients with PV.

  11. Controlled cell morphology and liver-specific function of engineered primary hepatocytes by fibroblast layer cell densities.

    Science.gov (United States)

    Sakai, Yusuke; Koike, Makiko; Kawahara, Daisuke; Hasegawa, Hideko; Murai, Tomomi; Yamanouchi, Kosho; Soyama, Akihiko; Hidaka, Masaaki; Takatsuki, Mitsuhisa; Fujita, Fumihiko; Kuroki, Tamotsu; Eguchi, Susumu

    2018-03-05

    Engineered primary hepatocytes, including co-cultured hepatocyte sheets, are an attractive to basic scientific and clinical researchers because they maintain liver-specific functions, have reconstructed cell polarity, and have high transplantation efficiency. However, co-culture conditions regarding engineered primary hepatocytes were suboptimal in promoting these advantages. Here we report that the hepatocyte morphology and liver-specific function levels are controlled by the normal human diploid fibroblast (TIG-118 cell) layer cell density. Primary rat hepatocytes were plated onto TIG-118 cells, previously plated 3 days before at 1.04, 5.21, and 26.1×10 3  cells/cm 2 . Hepatocytes plated onto lower TIG-118 cell densities expanded better during the early culture period. The hepatocytes gathered as colonies and only exhibited small adhesion areas because of the pushing force from proliferating TIG-118 cells. The smaller areas of each hepatocyte result in the development of bile canaliculi. The highest density of TIG-118 cells downregulated albumin synthesis activity of hepatocytes. The hepatocytes may have undergone apoptosis associated with high TGF-β1 concentration and necrosis due to a lack of oxygen. These occurrences were supported by apoptotic chromatin condensation and high expression of both proteins HIF-1a and HIF-1b. Three types of engineered hepatocyte/fibroblast sheets comprising different TIG-118 cell densities were harvested after 4 days of hepatocyte culture and showed a complete cell sheet format without any holes. Hepatocyte morphology and liver-specific function levels are controlled by TIG-118 cell density, which helps to design better engineered hepatocytes for future applications such as in vitro cell-based assays and transplantable hepatocyte tissues. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  12. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells

    DEFF Research Database (Denmark)

    Yang, Hsiao Yin; Vonk, Lucienne A.; Licht, Ruud

    2014-01-01

    % amidation), for siRNA delivery into primary mesenchymal cells including nucleus pulposus cells, articular chondrocytes and mesenchymal stem cells (MSCs). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous model gene to evaluate the extent of silencing by 20 nM or 200 nM siRNA at day...

  13. Double-hit or dual expression of MYC and BCL2 in primary cutaneous large B-cell lymphomas.

    Science.gov (United States)

    Menguy, Sarah; Frison, Eric; Prochazkova-Carlotti, Martina; Dalle, Stephane; Dereure, Olivier; Boulinguez, Serge; Dalac, Sophie; Machet, Laurent; Ram-Wolff, Caroline; Verneuil, Laurence; Gros, Audrey; Vergier, Béatrice; Beylot-Barry, Marie; Merlio, Jean-Philippe; Pham-Ledard, Anne

    2018-03-26

    In nodal diffuse large B-cell lymphoma, the search for double-hit with MYC and BCL2 and/or BCL6 rearrangements or for dual expression of BCL2 and MYC defines subgroups of patients with altered prognosis that has not been evaluated in primary cutaneous large B-cell lymphoma. Our objectives were to assess the double-hit and dual expressor status in a cohort of 44 patients with primary cutaneous large B-cell lymphoma according to the histological subtype and to evaluate their prognosis relevance. The 44 cases defined by the presence of more than 80% of large B-cells in the dermis corresponded to 21 primary cutaneous follicle centre lymphoma with large cell morphology and 23 primary cutaneous diffuse large B-cell lymphoma, leg type. Thirty-one cases (70%) expressed BCL2 and 29 (66%) expressed MYC. Dual expressor profile was observed in 25 cases (57%) of either subtypes (n = 6 or n = 19, respectively). Only one primary cutaneous follicle centre lymphoma, large-cell case had a double-hit status (2%). Specific survival was significantly worse in primary cutaneous diffuse large B-cell lymphoma, leg type than in primary cutaneous follicle centre lymphoma, large cell (p = 0.021) and for the dual expressor primary cutaneous large B-cell lymphoma group (p = 0.030). Both overall survival and specific survival were worse for patients belonging to the dual expressor primary cutaneous diffuse large B-cell lymphoma, leg type subgroup (p = 0.001 and p = 0.046, respectively). Expression of either MYC and/or BCL2 negatively impacted overall survival (p = 0.017 and p = 0.018 respectively). As the differential diagnosis between primary cutaneous follicle centre lymphoma, large cell and primary cutaneous diffuse large B-cell lymphoma, leg type has a major impact on prognosis, dual-expression of BCL2 and MYC may represent a new diagnostic criterion for primary cutaneous diffuse large B-cell lymphoma, leg type subtype and further identifies patients with

  14. Primary Diffuse Large Cell Lymphoma of the Bladder: Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Mansour Ansari

    2017-01-01

    Full Text Available Most bladder tumors are epithelial in origin. Nonepithelial cancers are rarely located in the bladder. Sarcomas are the most common malignancies among nonepithelial cancers. Primary bladder lymphoma is rare and mostly low grade. Here, we have reported a case of diffuse large cell lymphoma of the bladder. The patient, a 64-year-old man, had urinary frequency for 18 months. Abdominal sonography indicated a thick bladder wall and transurethral biopsy showed diffuse large cell lymphoma. Immunohistochemistry (IHC results showed that the tumor was positive for CD20, CD45, and Pax-5 and negative for BCL-2, cytokeratin, and S100. He had a normal bone marrow biopsy, abdominal, pelvic and chest CT scans. He had no B symptoms. The patient received 6 cycles of R-CHOP followed by radiotherapy (36 Gy to the pelvis. Six months after treatment, the patient is well and has returned to work. We have searched PubMed for primary diffuse large cell lymphoma. Primary diffuse large cell lymphoma of the bladder is best treated according to treatment for diffuse large cell lymphoma of other sites, which includes chemotherapy and radiotherapy. As seen in our review, primary diffuse large cell lymphoma of the bladder has a similar clinical course to diffuse large cell lymphoma of other sites.

  15. Primary central nervous system B-cell lymphoma in a young dog

    Science.gov (United States)

    Kim, Na-Hyun; Ciesielski, Thomas; Kim, Jung H.; Yhee, Ji-Young; Im, Keum-Soon; Nam, Hae-Mi; Kim, Il-Hwan; Kim, Jong-Hyuk; Sur, Jung-Hyang

    2012-01-01

    This report describes a primary central nervous system B-cell lymphoma in a 3-year-old intact female Maltese dog. Canine primary central nervous system lymphomas constitute about 4% of all intracranial primary neoplasms, but comprehensive histopathologic classifications have rarely been carried out. This is the first report of this disease in a young adult dog. PMID:23115372

  16. Somatic cell genotoxicity at the glycophorin A locus in humans

    International Nuclear Information System (INIS)

    Jensen, R.H.; Grant, S.G.; Langlois, R.G.; Bigbee, W.L.

    1990-01-01

    We have developed an assay for detecting variant erythrocytes that occur as a result of in vivo allele loss at the glycophorin A (GPA) locus on chromosome 4 in humans. This gene codes for an erythroid- specific cell surface glycoprotein, and with our assay we are able to detect rare variant erythrocytes that have lost expression of one of the two GPA alleles. Two distinctly different variant cell types are detected with this assay. One variant cell type (called N OE) is hemizygous. Our assay also detects homozygous variant erythrocytes that have lost expression of the GPA(M) allele and express the GPA(N) allele at twice the heterozygous level. The results of this assay are an enumeration of the frequency of N OE and NN variant cell types for each individual analyzed. These variant cell frequencies provide a measure of the amount of somatic cell genotoxicity that has occurred at the GPA locus. Such genotoxicity could be the result of (1) reactions of toxic chemicals to which the individual has been exposed, or (2) high energy radiation effects on erythroid precursor cells, or (3) errors in DNA replication or repair in these cells of the bone marrow. Thus, the GPA-based variant cell frequency can serve as a biodosimeter that indicates the amount of genotoxic exposure each individual has received. Because two very different kinds of variant cells are enumerated, different kinds of genotoxicity should be distinguishable. Results of the GPA somatic genotoxicity assay may also provide valuable information for cancer-risk estimation on each individual. 16 refs

  17. Primary endometrial squamous cell carcinoma with extensive squamous metaplasia and dysplasia

    Directory of Open Access Journals (Sweden)

    Bagga Permeet

    2008-04-01

    Full Text Available Primary squamous cell carcinoma of endometrium is a rare entity. Only 64 cases have been documented in the literature. We report a case of 60-year-old postmenopausal woman who presented with abdominal distention and blood-stained vaginal discharge for 6-7 months. Clinically, chronic pyometra was considered. Total abdominal hysterectomy was performed and histopathologically, it was diagnosed as a case of primary squamous cell carcinoma of endometrium with extensive squamous metaplasia and dysplasia.

  18. Cellular lead toxicity and metabolism in primary and clonal osteoblastic bone cells

    International Nuclear Information System (INIS)

    Long, G.J.; Rosen, J.F.; Pounds, J.G.

    1990-01-01

    A knowledge of bone lead metabolism is critical for understanding the toxicological importance of bone lead, as a toxicant both to bone cells and to soft tissues of the body, as lead is mobilized from large reservoirs in hard tissues. To further understand the processes that mediate metabolism of lead in bone, it is necessary to determine lead metabolism at the cellular level. Experiments were conducted to determine the intracellular steady-state 210 Pb kinetics in cultures of primary and clonal osteoblastic bone cells. Osteoblastic bone cells obtained by sequential collagenase digestion of mouse calvaria or rat osteosarcoma (ROS 17/2.8) cells were labeled with 210 Pb as 5 microM lead acetate for 20 hr, and kinetic parameters were determined by measuring the efflux of 210 Pb from the cells over a 210 -min period. The intracellular metabolism of 210 Pb was characterized by three kinetic pools of 210 Pb in both cell types. Although the values of these parameters differed between the primary osteoblastic cells and ROS cells, the profile of 210 Pb was remarkably similar in both cell types. Both types exhibited one large, slowly exchanging pool (S3), indicative of mitochondrial lead. These data show that primary osteoblastic bone cells and ROS cells exhibit similar steady-state lead kinetics, and intracellular lead distribution. These data also establish a working model of lead kinetics in osteoblastic bone cells and now permit an integrated view of lead kinetics in bone

  19. Histone deacetylase inhibitors epigenetically promote reparative events in primary dental pulp cells

    Energy Technology Data Exchange (ETDEWEB)

    Duncan, Henry F., E-mail: Hal.Duncan@dental.tcd.ie [Division of Restorative Dentistry and Periodontology, Dublin Dental University Hospital, Trinity College Dublin, Lincoln Place, Dublin 2 (Ireland); Smith, Anthony J. [Oral Biology, School of Dentistry, College of Medical and Dental Sciences, University of Birmingham, Birmingham (United Kingdom); Fleming, Garry J.P. [Material Science Unit, Division of Oral Biosciences, Dublin Dental University Hospital, Trinity College Dublin, Dublin (Ireland); Cooper, Paul R. [Oral Biology, School of Dentistry, College of Medical and Dental Sciences, University of Birmingham, Birmingham (United Kingdom)

    2013-06-10

    Application of histone deacetylase inhibitors (HDACi) to cells epigenetically alters their chromatin structure and induces transcriptional and cellular reparative events. This study investigated the application of two HDACi, valproic acid (VPA) and trichostatin A (TSA) on the induction of repair-associated responses in primary dental pulp cell (DPC) cultures. Flow cytometry demonstrated that TSA (100 nM, 400 nM) significantly increased cell viability. Neither HDACi was cytotoxic, although cell growth analysis revealed significant anti-proliferative effects at higher concentrations for VPA (>0.5 mM) and TSA (>50 nM). While high-content-analysis demonstrated that HDACi did not significantly induce caspase-3 or p21 activity, p53-expression was increased by VPA (3 mM, 5 mM) at 48 h. HDACi-exposure induced mineralization per cell dose-dependently to a plateau level (VPA-0.125 mM and TSA-25 nM) with accompanying increases in mineralization/dentinogenic-associated gene expression at 5 days (DMP-1, BMP-2/-4, Nestin) and 10 days (DSPP, BMP-2/-4). Both HDACis, at a range of concentrations, significantly stimulated osteopontin and BMP-2 protein expression at 10 and 14 days further supporting the ability of HDACi to promote differentiation. HDACi exert different effects on primary compared with transformed DPCs and promote mineralization and differentiation events without cytotoxic effects. These novel data now highlight the potential in restorative dentistry for applying low concentrations of HDACi in vital pulp treatment. -- Highlights: • Valproic acid and trichostatin A promoted mineralization in primary pulp cells. • Cell viability, apoptosis, caspase-3, p21 unaltered; p53 increased by valproic acid. • Trichostatin A increased cell viability at 24 h at selected concentrations. • Altered cell toxicity and differentiation between primary and transformed cells. • HDACi-induced the differentiation marker proteins osteopontin and BMP-2.

  20. Histone deacetylase inhibitors epigenetically promote reparative events in primary dental pulp cells

    International Nuclear Information System (INIS)

    Duncan, Henry F.; Smith, Anthony J.; Fleming, Garry J.P.; Cooper, Paul R.

    2013-01-01

    Application of histone deacetylase inhibitors (HDACi) to cells epigenetically alters their chromatin structure and induces transcriptional and cellular reparative events. This study investigated the application of two HDACi, valproic acid (VPA) and trichostatin A (TSA) on the induction of repair-associated responses in primary dental pulp cell (DPC) cultures. Flow cytometry demonstrated that TSA (100 nM, 400 nM) significantly increased cell viability. Neither HDACi was cytotoxic, although cell growth analysis revealed significant anti-proliferative effects at higher concentrations for VPA (>0.5 mM) and TSA (>50 nM). While high-content-analysis demonstrated that HDACi did not significantly induce caspase-3 or p21 activity, p53-expression was increased by VPA (3 mM, 5 mM) at 48 h. HDACi-exposure induced mineralization per cell dose-dependently to a plateau level (VPA-0.125 mM and TSA-25 nM) with accompanying increases in mineralization/dentinogenic-associated gene expression at 5 days (DMP-1, BMP-2/-4, Nestin) and 10 days (DSPP, BMP-2/-4). Both HDACis, at a range of concentrations, significantly stimulated osteopontin and BMP-2 protein expression at 10 and 14 days further supporting the ability of HDACi to promote differentiation. HDACi exert different effects on primary compared with transformed DPCs and promote mineralization and differentiation events without cytotoxic effects. These novel data now highlight the potential in restorative dentistry for applying low concentrations of HDACi in vital pulp treatment. -- Highlights: • Valproic acid and trichostatin A promoted mineralization in primary pulp cells. • Cell viability, apoptosis, caspase-3, p21 unaltered; p53 increased by valproic acid. • Trichostatin A increased cell viability at 24 h at selected concentrations. • Altered cell toxicity and differentiation between primary and transformed cells. • HDACi-induced the differentiation marker proteins osteopontin and BMP-2

  1. Primary Cutaneous Diffuse Large B-Cell Lymphoma – a Case Report

    Directory of Open Access Journals (Sweden)

    Milovanović Milena

    2017-06-01

    Full Text Available In 2005, the World Health Organization - European Organization for Research and Treatment of Cancer (WHOEORTC classified cutaneous B-cell lymphomas into 4 categories: primary cutaneous marginal zone B-cell lymphoma (PCMZL, primary cutaneous follicle center lymphoma (PCFCL, primary cutaneous diffuse large B-cell lymphoma, leg type (PCDLBCL-LT, and primary cutaneous diffuse large B-cell lymphoma, other (PCDLBCL-O. The absence of evident extra-cutaneous disease is a necessary condition for the diagnosis of primary cutaneous B-cell lymphomas, because they have a completely different clinical behavior and prognosis from their nodal counterparts. PCDLBCL-O basically represents a morphological variation, lacking the typical features of PCDLBCLLT, neither confirming the definition of PCFCCL, but on the clinical ground, its behavior seems at least to partially overlap the indolent course of PCFCCL. In fact, the present WHO lymphoma classification from 2008 overcame the previous WHO-EORTC classification, including at least a part of PCDLBCL-O within the spectrum of PCFCCL. However, owing to the rarity and heterogeneity of the PCDLBCL-O, the precise clinicopathological characteristics have not been well characterized and the optimal treatment for this group of lymphomas is yet to be defined. Nevertheless, dermatologists and pathologists should be aware of this entity in order to avoid unnecessary aggressive treatment. We present a case of a 46-year-old Caucasian male with one large round-shaped tumor and a few scattered nodules localized on the back. The histopathological features of the lesion corresponded to PCDLBCL-O. The patient follow-up showed that he was disease-free three months after surgical excision of the lesions and adjuvant local radiotherapy. No additional therapy was introduced, including chemotherapy with rituximab, cyclophosphamide, doxorubicin hydrochloride, oncovin, prednisolone (R-CHOP.

  2. Hemistepsin A ameliorates acute inflammation in macrophages via inhibition of nuclear factor-κB and activation of nuclear factor erythroid 2-related factor 2.

    Science.gov (United States)

    Kim, Jae Kwang; Lee, Ji Eun; Jung, Eun Hye; Jung, Ji Yun; Jung, Dae Hwa; Ku, Sae Kwang; Cho, Il Je; Kim, Sang Chan

    2018-01-01

    Hemistepsin A (HsA) is a sesquiterpene lactone isolated from Hemistepta lyrata (Bunge) Bunge. We investigated the anti-inflammatory effects of HsA and sought to determine its mechanisms of action in macrophages. HsA pretreatment inhibited nitric oxide production, and reduced the expression of iNOS and COX-2 in Toll-like receptor ligand-stimulated RAW 264.7 cells. Additionally, HsA decreased the secretion of proinflammatory cytokines in lipopolysaccharide (LPS)-stimulated Kupffer cells as well as in RAW 264.7 cells. HsA inhibited phosphorylation of IKKα/β and degradation of IκBα, resulting in decreased nuclear translocation of nuclear factor-κB (NF-κB) and its transcriptional activity. Moreover, HsA phosphorylated nuclear factor erythroid 2-related factor 2 (Nrf2), increased expression levels of antioxidant genes, and attenuated LPS-stimulated H 2 O 2 production. Phosphorylation of p38 and c-Jun N-terminal kinase was required for HsA-mediated Nrf2 phosphorylation. In a D-galactosamine/LPS-induced liver injury model, HsA ameliorated D-galactosamine/LPS-induced hepatocyte degeneration and inflammatory cells infiltration. Moreover, immunohistochemical analyses using nitrotyrosine, 4-hydroxynonenal, and cleaved poly (ADP-ribose) polymerase antibodies revealed that HsA protected the liver from oxidative stress. Furthermore, HsA reduced the numbers of proinflammatory cytokine-positive cells in hepatic tissues. Thus, these results suggest HsA may be a promising natural product to manage inflammation-mediated tissue injuries through inhibition of NF-κB and activation of Nrf2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Primary mucinous adenocarcinoma of the bladder with signet-ring cells: case report

    Directory of Open Access Journals (Sweden)

    Marcelo Lorenzi Marques

    Full Text Available CONTEXT: Primary adenocarcinomas of the bladder are uncommon and usually occur by contiguity with or hematogenic dissemination of other adenocarcinomas such as colorectal, prostate and gynecological tract carcinomas. Mucinous and signet-ring cell histological patterns are even rarer and it is often difficult to morphologically distinguish them from metastatic colorectal adenocarcinoma. CASE REPORT: We present and discuss a rare case of primary mucinous adenocarcinoma of the bladder with signet-ring cells in a 57-year-old male patient. Other primary sites for the tumor had been excluded and, in the absence of digestive tract tumor and for confirmation that it was a primary bladder tumor, an immunohistochemistry study was performed.

  4. MicroRNA profiling of primary cutaneous large B-cell lymphomas.

    Directory of Open Access Journals (Sweden)

    Lianne Koens

    Full Text Available Aberrant expression of microRNAs is widely accepted to be pathogenetically involved in nodal diffuse large B-cell lymphomas (DLBCLs. However, the microRNAs profiles of primary cutaneous large B-cell lymphomas (PCLBCLs are not yet described. Its two main subtypes, i.e., primary cutaneous diffuse large B-cell lymphoma, leg type (PCLBCL-LT and primary cutaneous follicle center lymphoma (PCFCL are characterized by an activated B-cell (ABC-genotype and a germinal center B-cell (GCB-genotype, respectively. We performed high-throughput sequencing analysis on frozen tumor biopsies from 19 cases of PCFCL and PCLBCL-LT to establish microRNA profiles. Cluster analysis of the complete microRNome could not distinguish between the two subtypes, but 16 single microRNAs were found to be differentially expressed. Single microRNA RT-qPCR was conducted on formalin-fixed paraffin-embedded tumor biopsies of 20 additional cases, confirming higher expression of miR-9-5p, miR-31-5p, miR-129-2-3p and miR-214-3p in PCFCL as compared to PCLBCL-LT. MicroRNAs previously described to be higher expressed in ABC-type as compared to GCB-type nodal DLBCL were not differentially expressed between PCFCL and PCLBCL-LT. In conclusion, PCFCL and PCLBCL-LT differ in their microRNA profiles. In contrast to their gene expression profile, they only show slight resemblance with the microRNA profiles found in GCB- and ABC-type nodal DLBCL.

  5. Precise Temporal Profiling of Signaling Complexes in Primary Cells Using SWATH Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Etienne Caron

    2017-03-01

    Full Text Available Spatiotemporal organization of protein interactions in cell signaling is a fundamental process that drives cellular functions. Given differential protein expression across tissues and developmental stages, the architecture and dynamics of signaling interaction proteomes is, likely, highly context dependent. However, current interaction information has been almost exclusively obtained from transformed cells. In this study, we applied an advanced and robust workflow combining mouse genetics and affinity purification (AP-SWATH mass spectrometry to profile the dynamics of 53 high-confidence protein interactions in primarycells, using the scaffold protein GRB2 as a model. The workflow also provided a sufficient level of robustness to pinpoint differential interaction dynamics between two similar, but functionally distinct, primarycell populations. Altogether, we demonstrated that precise and reproducible quantitative measurements of protein interaction dynamics can be achieved in primary cells isolated from mammalian tissues, allowing resolution of the tissue-specific context of cell-signaling events.

  6. Primary clear cell sarcoma of bone: a unique site of origin

    International Nuclear Information System (INIS)

    Gelczer, R.K.; Wenger, D.E.; Wold, L.E.

    1999-01-01

    Clear cell sarcoma is a rare soft tissue neoplasm, accounting for less than 1% of soft tissue sarcomas. We are presenting a case of a clear cell sarcoma of bone which, to our knowledge, is the only report of a primary clear cell sarcoma of bone. (orig.)

  7. Circulating CXCR5+CD4+ T cells assist in the survival and growth of primary diffuse large B cell lymphoma cells through interleukin 10 pathway

    Energy Technology Data Exchange (ETDEWEB)

    Cha, Zhanshan [Department of Transfusion, Changhai Hospital, Second Military Medical University, Shanghai 200433 (China); Qian, Guangfang [Department of Endocrinology, Zhangqiu Municipal Hospital of Traditional Chinese Medicine, Zhangqiu, Shandong 250200 (China); Zang, Yan; Gu, Haihui; Huang, Yanyan; Zhu, Lishuang; Li, Jinqi; Liu, Yang; Tu, Xiaohua [Department of Transfusion, Changhai Hospital, Second Military Medical University, Shanghai 200433 (China); Song, Haihan [Emergency Center, East Hospital, Shanghai 200120 (China); Qian, Baohua, E-mail: qianbhl963@163.com [Department of Transfusion, Changhai Hospital, Second Military Medical University, Shanghai 200433 (China)

    2017-01-01

    Diffuse large B cell lymphoma (DLBCL) is a common and aggressive cancer caused by the malignant transformation of B cells. Although it has been established that the follicular helper T (Tfh) cells play a central role in B cell development, little information is available on their involvement in DLBCL pathogenesis. We studied the role of the peripheral Tfh equivalent, the CXCR5{sup +} CD4{sup +} T cells, in DLBCL. Data showed that compared to CXCR5{sup -} CD4{sup +} T cells, CXCR5{sup +} CD4{sup +} T cells were significantly more effective at promoting the proliferation as well as inhibiting the apoptosis of primary autologous DLBCL tumor cells. Surprisingly, we found that at equal cell numbers, CXCR5{sup +} CD4{sup +} T cells in DLBCL patients secreted significantly less interleukin (IL)-21 than CXCR5{sup -} CD4{sup +} T cells, while the level of IL-10 secretion was significant elevated in the CXCR5{sup +} compartment compared to the CXCR5{sup -} compartment. Neutralization of IL-10 in the primary DLBCL-CXCR5{sup +} CD4{sup +} T cell coculture compromised the CXCR5{sup +} CD4{sup +} T cell-mediated pro-tumor effects, in a manner that was dependent on the concentration of anti-IL-10 antibodies. The CXCR5{sup +} compartment also contained significantly lower frequencies of cytotoxic CD4{sup +} T cells than the CXCR5{sup -} compartment. In conclusion, our investigations discovered a previously unknown pro-tumor role of CXCR5-expressing circulating CD4{sup +} T cells, which assisted the survival and proliferation of primary DLBCL cells through IL-10. - Highlights: • We studied the role of the peripheral Tfh in DLBCL. • Tfh were effective at promoting the proliferation of primary DLBCL tumor cells. • Tfh were effective at inhibiting the apoptosis of primary DLBCL tumor cells. • IL-10 secretion in Tfh was significant elevated in DLBCL. • Neutralization of IL-10 compromised Tfh-mediated pro-tumor effects.

  8. Primary mesenchymal stem cells in human transplanted lungs are CD90/CD105 perivascularly located tissue-resident cells

    DEFF Research Database (Denmark)

    Rolandsson, Sara; Andersson Sjöland, Annika; Brune, Jan C

    2014-01-01

    BACKGROUND: Mesenchymal stem cells (MSC) have not only been implicated in the development of lung diseases, but they have also been proposed as a future cell-based therapy for lung diseases. However, the cellular identity of the primary MSC in human lung tissues has not yet been reported. This st......BACKGROUND: Mesenchymal stem cells (MSC) have not only been implicated in the development of lung diseases, but they have also been proposed as a future cell-based therapy for lung diseases. However, the cellular identity of the primary MSC in human lung tissues has not yet been reported...

  9. Gene transfer to primary corneal epithelial cells with an integrating lentiviral vector

    Directory of Open Access Journals (Sweden)

    Lauro Augusto de Oliveira

    2010-10-01

    Full Text Available PURPOSE: To evaluate the transfer of heterologous genes carrying a Green Fluorescent Protein (GFP reporter cassette to primary corneal epithelial cells ex vivo. METHODS: Freshly enucleated rabbit corneoscleral tissue was used to obtain corneal epithelial cell suspension via enzymatic digestion. Cells were plated at a density of 5×10³ cells/cm² and allowed to grow for 5 days (to 70-80% confluency prior to transduction. Gene transfer was monitored using fluorescence microscopy and fluorescence activated cell sorter (FACS. We evaluated the transduction efficiency (TE over time and the dose-response effect of different lentiviral particles. One set of cells were dual sorted by fluorescence activated cell sorter for green fluorescent protein expression as well as Hoechst dye exclusion to evaluate the transduction of potentially corneal epithelial stem cells (side-population phenotypic cells. RESULTS: Green fluorescent protein expressing lentiviral vectors were able to effectively transduce rabbit primary epithelial cells cultured ex vivo. Live cell imaging post-transduction demonstrated GFP-positive cells with normal epithelial cell morphology and growth. The transduction efficiency over time was higher at the 5th post-transduction day (14.1% and tended to stabilize after the 8th day. The number of transduced cells was dose-dependent, and at the highest lentivirus concentrations approached 7%. When double sorted by fluorescence activated cell sorter to isolate both green fluorescent protein positive and side population cells, transduced side population cells were identified. CONCLUSIONS: Lentiviral vectors can effectively transfer heterologous genes to primary corneal epithelial cells expanded ex vivo. Genes were stably expressed over time, transferred in a dose-dependence fashion, and could be transferred to mature corneal cells as well as presumable putative stem cells.

  10. Control of erythropoiesis by erythropoietin and stem cell factor: a novel role for Bruton's tyrosine kinase

    NARCIS (Netherlands)

    von Lindern, Marieke; Schmidt, Uwe; Beug, Hartmut

    2004-01-01

    Erythropoietin (Epo) and stem cell factor (SCF) are essential factors in the control of survival, expansion and differentiation of erythroid progenitors. Upon activation, their receptors, the EpoR and c-Kit, initiate multiple signalling pathways that control many cellular processes. To control

  11. A Case of Primary Gastric Small-Cell Carcinoma in an Elderly Patient

    Directory of Open Access Journals (Sweden)

    Fa-Chang Yu

    2012-03-01

    Full Text Available We report a case of primary small-cell carcinoma of the stomach in a 75-year-old man. The patient was admitted to our hospital with a 1-week history of intermittent tarry stool. An upper gastrointestinal examination revealed a large stage A2 ulcer in the greater curvature of the body of the stomach, and pathological findings from biopsy specimens revealed small-cell carcinoma. The tumor cells were small-sized, composed of hyperchromatic nuclei with scant cytoplasm, and stained positive for cytokeratin, synaptophysin, and chromogranin A. The patient was diagnosed with primary small-cell carcinoma of the stomach. He declined further evaluation and received palliative management. This is a rare carcinoma of the stomach, with aggressive manifestations and a poor prognosis. The mean survival of patients with primary gastric small-cell carcinoma is reported to be 7 months. The choice of treatment for this disease is still controversial. This rare gastric tumor should be listed in the differential diagnosis of gastric carcinoma in the elderly.

  12. Nanoscaffold's stiffness affects primary cortical cell network formation

    NARCIS (Netherlands)

    Xie, Sijia; Schurink, Bart; Wolbers, F.; Lüttge, Regina; Hassink, Gerrit Cornelis

    2014-01-01

    Networks of neurons cultured on-chip can provide insights into both normal and disease-state brain function. The ability to guide neuronal growth in specific, artificially designed patterns allows us to study how brain function follows form. Primary cortical cells cultured on nanograting scaffolds,

  13. Synchronous sigmoid and caecal cancers together with a primary renal cell carcinoma.

    LENUS (Irish Health Repository)

    Bhargava, A

    2012-06-01

    Multiple primary neoplasms, a common clinical entity, can be classified as synchronous or metachronous. Renal cell carcinoma, in particular, is associated with a high rate of multiple primary neoplasms.

  14. Definitive hematopoietic stem/progenitor cells manifest distinct differentiation output in the zebrafish VDA and PBI.

    Science.gov (United States)

    Jin, Hao; Sood, Raman; Xu, Jin; Zhen, Fenghua; English, Milton A; Liu, P Paul; Wen, Zilong

    2009-02-01

    One unique feature of vertebrate definitive hematopoiesis is the ontogenic switching of hematopoietic stem cells from one anatomical compartment or niche to another. In mice, hematopoietic stem cells are believed to originate in the aorta-gonad-mesonephros (AGM), subsequently migrate to the fetal liver (FL) and finally colonize the bone marrow (BM). Yet, the differentiation potential of hematopoietic stem cells within early niches such as the AGM and FL remains incompletely defined. Here, we present in vivo analysis to delineate the differentiation potential of definitive hematopoietic stem/progenitor cells (HSPCs) in the zebrafish AGM and FL analogies, namely the ventral wall of dorsal aorta (VDA) and the posterior blood island (PBI), respectively. Cell fate mapping and analysis of zebrafish runx1(w84x) and vlad tepes (vlt(m651)) mutants revealed that HSPCs in the PBI gave rise to both erythroid and myeloid lineages. However, we surprisingly found that HSPCs in the VDA were not quiescent but were uniquely adapted to generate myeloid but not erythroid lineage cells. We further showed that such distinct differentiation output of HSPCs was, at least in part, ascribed to the different micro-environments present in these two niches. Our results highlight the importance of niche in shaping the differentiation output of developing HSPCs.

  15. Characterization of primary human mammary epithelial cells isolated and propagated by conditional reprogrammed cell culture.

    Science.gov (United States)

    Jin, Liting; Qu, Ying; Gomez, Liliana J; Chung, Stacey; Han, Bingchen; Gao, Bowen; Yue, Yong; Gong, Yiping; Liu, Xuefeng; Amersi, Farin; Dang, Catherine; Giuliano, Armando E; Cui, Xiaojiang

    2018-02-20

    Conditional reprogramming methods allow for the inexhaustible in vitro proliferation of primary epithelial cells from human tissue specimens. This methodology has the potential to enhance the utility of primary cell culture as a model for mammary gland research. However, few studies have systematically characterized this method in generating in vitro normal human mammary epithelial cell models. We show that cells derived from fresh normal breast tissues can be propagated and exhibit heterogeneous morphologic features. The cultures are composed of CK18, desmoglein 3, and CK19-positive luminal cells and vimentin, p63, and CK14-positive myoepithelial cells, suggesting the maintenance of in vivo heterogeneity. In addition, the cultures contain subpopulations with different CD49f and EpCAM expression profiles. When grown in 3D conditions, cells self-organize into distinct structures that express either luminal or basal cell markers. Among these structures, CK8-positive cells enclosing a lumen are capable of differentiation into milk-producing cells in the presence of lactogenic stimulus. Furthermore, our short-term cultures retain the expression of ERα, as well as its ability to respond to estrogen stimulation. We have investigated conditionally reprogrammed normal epithelial cells in terms of cell type heterogeneity, cellular marker expression, and structural arrangement in two-dimensional (2D) and three-dimensional (3D) systems. The conditional reprogramming methodology allows generation of a heterogeneous culture from normal human mammary tissue in vitro . We believe that this cell culture model will provide a valuable tool to study mammary cell function and malignant transformation.

  16. Advances in understanding the pathogenesis of primary familial and congenital polycythemia

    Science.gov (United States)

    Huang, Lily Jun-shen; Shen, Yu-Min; Bulut, Gamze B.

    2010-01-01

    Summary Primary familial and congenital polycythemia (PFCP) is an autosomal-dominant proliferative disorder characterized by erythrocytosis and hypersensitivity of erythroid progenitors to erythropoietin (Epo). Several lines of evidence suggest a causal role of truncated erythropoietin receptor (EpoR) in this disease. In this review, we discuss PFCP in the context of erythrocytosis and EpoR signaling. We focus on recent studies describing mechanisms underlying Epo-dependent EpoR down-regulation. One mechanism depends on internalization mediated through the p85 regulatory subunit of the Phosphoinositide 3-Kinase, and the other utilizes ubiquitin-based proteasomal degradation. Truncated PFCP EpoRs are not properly down-regulated upon stimulation, underscoring the importance of these mechanisms in the pathogenesis of PFCP. PMID:20096014

  17. Phosphoproteomics of Primary Cells Reveals Druggable Kinase Signatures in Ovarian Cancer.

    Science.gov (United States)

    Francavilla, Chiara; Lupia, Michela; Tsafou, Kalliopi; Villa, Alessandra; Kowalczyk, Katarzyna; Rakownikow Jersie-Christensen, Rosa; Bertalot, Giovanni; Confalonieri, Stefano; Brunak, Søren; Jensen, Lars J; Cavallaro, Ugo; Olsen, Jesper V

    2017-03-28

    Our understanding of the molecular determinants of cancer is still inadequate because of cancer heterogeneity. Here, using epithelial ovarian cancer (EOC) as a model system, we analyzed a minute amount of patient-derived epithelial cells from either healthy or cancerous tissues by single-shot mass-spectrometry-based phosphoproteomics. Using a multi-disciplinary approach, we demonstrated that primary cells recapitulate tissue complexity and represent a valuable source of differentially expressed proteins and phosphorylation sites that discriminate cancer from healthy cells. Furthermore, we uncovered kinase signatures associated with EOC. In particular, CDK7 targets were characterized in both EOC primary cells and ovarian cancer cell lines. We showed that CDK7 controls cell proliferation and that pharmacological inhibition of CDK7 selectively represses EOC cell proliferation. Our approach defines the molecular landscape of EOC, paving the way for efficient therapeutic approaches for patients. Finally, we highlight the potential of phosphoproteomics to identify clinically relevant and druggable pathways in cancer. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  18. Establishment of primary bovine intestinal epithelial cell culture and clone method.

    Science.gov (United States)

    Zhan, Kang; Lin, Miao; Liu, Ming-Mei; Sui, Yang-Nan; Zhao, Guo-Qi

    2017-01-01

    The aim of this study was to establish bovine intestinal epithelial cell (BIEC) line and provide a novel clone cell method. Although various strategies of bovine cell culture and clone techniques have been reported, these methods remain not established. Here, we culture successfully primary BIECs and establish a novel clone cell method. Our result showed that BIECs could be successfully cultured and passaged about generation 5. These cellular aggregates and clusters were adherent loosely at day 2 of culture. Cell aggregates and clusters start to proliferate after approximately 4 d. The BIECs showed positive reaction against cytokeratin 18, E-cadherin, and characteristics of epithelial-like morphology. In addition, the fatty acid-binding proteins (FABPs), villin, and intestinal peptidase (IP) band were positive in BIECs. Our results suggest that the establishment of culturing and clone BIEC methods will apply to isolate and clone other primary cells. These BIECs could therefore contribute to the study of bovine intestinal nutrient absorption and regulation, immune regulation, and the pathogenesis of the bovine intestinal disease, which will provide intestinal cell model in vitro.

  19. In vitro studies of the sensitivity of canine bone-marrow erythroid burst-forming units (BFU-E) and fibroblast colony-forming units (CFU-F) to X-irradiation

    International Nuclear Information System (INIS)

    Kreja, Ludwika; Baltschukat, Klaus; Nothdurft, Wilhelm

    1989-01-01

    The radiosensitivity of the early erythroid progenitor cells (BFU-E) and the progenitor cells of the stroma (CFU-F) in canine bone marrow was studied under steady-state conditions by in vitro irradiation with 280 kV X-rays. The dose-effect relationship for colony formation was determined for BFU-E obtained from the iliac crest marrow, and for CFU-F in bone marrow collected from the iliac crest and the humerus of adult beagles. The BFU-E were adequately stimulated with serum from lethally irradiated dogs to obtain a source of BPA (burst-promoting activity). The BFU-E proved to be extremely radiosensitive, (the survival curve was exponential (D o 15.3 ± 1.8 cGY)). Buffy-coat leukocytes separated from bone marrow leukocytes obtained by aspiration were an optimum source of CFU-F. A curve was fitted to data obtained for CFU-F obtained from iliac crest or humerus, resulting in D o = 241 ± 38 cGY and an extrapolation number n = 1.38 ± 0.62 or D o = 261 ± 40 cGY and n = 1.04 ± 0.42, respectively. (author)

  20. Dimethyl fumarate is highly cytotoxic in KRAS mutated cancer cells but spares non-tumorigenic cells

    Science.gov (United States)

    Bennett Saidu, Nathaniel Edward; Bretagne, Marie; Mansuet, Audrey Lupo; Just, Pierre-Alexandre; Leroy, Karen; Cerles, Olivier; Chouzenoux, Sandrine; Nicco, Carole; Damotte, Diane; Alifano, Marco; Borghese, Bruno; Goldwasser, François; Batteux, Frédéric; Alexandre, Jérôme

    2018-01-01

    KRAS mutation, one of the most common molecular alterations observed in adult carcinomas, was reported to activate the anti-oxidant program driven by the transcription factor NRF2 (Nuclear factor-erythroid 2-related factor 2). We previously observed that the antitumoral effect of Dimethyl fumarate (DMF) is dependent of NRF2 pathway inhibition. We used in vitro methods to examine the effect of DMF on cell death and the activation of the NRF2/DJ-1 antioxidant pathway. We report here that DMF is preferentially cytotoxic against KRAS mutated cancer cells. This effect was observed in patient-derived cancer cell lines harbouring a G12V KRAS mutation, compared with cell lines without such a mutation. In addition, KRAS*G12V over-expression in the human Caco-2 colon cancer cell line significantly promoted DMF-induced cell death, as well as DMF-induced- reactive oxygen species (ROS) formation and -glutathione (GSH) depletion. Moreover, in contrast to malignant cells, our data confirms that the same concentration of DMF has no significant cytotoxic effects on non-tumorigenic human ARPE-19 retinal epithelial, murine 3T3 fibroblasts and primary mice bone marrow cells; but is rather associated with NRF2 activation, decreased ROS and increased GSH levels. Furthermore, DJ-1 down-regulation experiments showed that this protein does not play a protective role against NRF2 in non-tumorigenic cells, as it does in malignant ones. This, interestingly, could be at the root of the differential effect of DMF observed between malignant and non-tumorigenic cells. Our results suggest for the first time that the dependence on NRF2 observed in mutated KRAS malignant cells makes them more sensitive to the cytotoxic effect of DMF, which thus opens up new prospects for the therapeutic applications of DMF. PMID:29507676

  1. Dimethyl fumarate is highly cytotoxic in KRAS mutated cancer cells but spares non-tumorigenic cells.

    Science.gov (United States)

    Bennett Saidu, Nathaniel Edward; Bretagne, Marie; Mansuet, Audrey Lupo; Just, Pierre-Alexandre; Leroy, Karen; Cerles, Olivier; Chouzenoux, Sandrine; Nicco, Carole; Damotte, Diane; Alifano, Marco; Borghese, Bruno; Goldwasser, François; Batteux, Frédéric; Alexandre, Jérôme

    2018-02-06

    KRAS mutation, one of the most common molecular alterations observed in adult carcinomas, was reported to activate the anti-oxidant program driven by the transcription factor NRF2 (Nuclear factor-erythroid 2-related factor 2). We previously observed that the antitumoral effect of Dimethyl fumarate (DMF) is dependent of NRF2 pathway inhibition. We used in vitro methods to examine the effect of DMF on cell death and the activation of the NRF2/DJ-1 antioxidant pathway. We report here that DMF is preferentially cytotoxic against KRAS mutated cancer cells. This effect was observed in patient-derived cancer cell lines harbouring a G12V KRAS mutation, compared with cell lines without such a mutation. In addition, KRAS*G12V over-expression in the human Caco-2 colon cancer cell line significantly promoted DMF-induced cell death, as well as DMF-induced- reactive oxygen species (ROS) formation and -glutathione (GSH) depletion. Moreover, in contrast to malignant cells, our data confirms that the same concentration of DMF has no significant cytotoxic effects on non-tumorigenic human ARPE-19 retinal epithelial, murine 3T3 fibroblasts and primary mice bone marrow cells; but is rather associated with NRF2 activation, decreased ROS and increased GSH levels. Furthermore, DJ-1 down-regulation experiments showed that this protein does not play a protective role against NRF2 in non-tumorigenic cells, as it does in malignant ones. This, interestingly, could be at the root of the differential effect of DMF observed between malignant and non-tumorigenic cells. Our results suggest for the first time that the dependence on NRF2 observed in mutated KRAS malignant cells makes them more sensitive to the cytotoxic effect of DMF, which thus opens up new prospects for the therapeutic applications of DMF.

  2. Primary signet ring cell carcinoma of the appendix mimicking acute appendicitis

    Directory of Open Access Journals (Sweden)

    Mario Fusari

    2012-10-01

    Full Text Available Primary signet ring cell carcinoma of the appendix is a very rare neoplasm that usually presents with signs and symptoms of acute appendicitis and in particular with a right lower abdominal pain. Preoperative imaging detection of appendiceal adenocarcinoma has an important value because it may result in an appropriate surgical procedure. We report a rare case of primary signet ring cell carcinoma of the vermiform appendix in an 80-year-old man who was misdiagnosed on computed tomography (CT scan as acute appendicitis.

  3. Development of Functional Microfold (M Cells from Intestinal Stem Cells in Primary Human Enteroids.

    Directory of Open Access Journals (Sweden)

    Joshua D Rouch

    Full Text Available Intestinal microfold (M cells are specialized epithelial cells that act as gatekeepers of luminal antigens in the intestinal tract. They play a critical role in the intestinal mucosal immune response through transport of viruses, bacteria and other particles and antigens across the epithelium to immune cells within Peyer's patch regions and other mucosal sites. Recent studies in mice have demonstrated that M cells are generated from Lgr5+ intestinal stem cells (ISCs, and that infection with Salmonella enterica serovar Typhimurium increases M cell formation. However, it is not known whether and how these findings apply to primary human small intestinal epithelium propagated in an in vitro setting.Human intestinal crypts were grown as monolayers with growth factors and treated with recombinant RANKL, and assessed for mRNA transcripts, immunofluorescence and uptake of microparticles and S. Typhimurium.Functional M cells were generated by short-term culture of freshly isolated human intestinal crypts in a dose- and time-dependent fashion. RANKL stimulation of the monolayer cultures caused dramatic induction of the M cell-specific markers, SPIB, and Glycoprotein-2 (GP2 in a process primed by canonical WNT signaling. Confocal microscopy demonstrated a pseudopod phenotype of GP2-positive M cells that preferentially take up microparticles. Furthermore, infection of the M cell-enriched cultures with the M cell-tropic enteric pathogen, S. Typhimurium, led to preferential association of the bacteria with M cells, particularly at lower inoculum sizes. Larger inocula caused rapid induction of M cells.Human intestinal crypts containing ISCs can be cultured and differentiate into an epithelial layer with functional M cells with characteristic morphological and functional properties. This study is the first to demonstrate that M cells can be induced to form from primary human intestinal epithelium, and that S. Typhimurium preferentially infect these cells in an

  4. Proliferation and mineralization ability of dental pulp cells derived from primary and permanent teeth

    Directory of Open Access Journals (Sweden)

    Suttatip Kamolmatyakul

    2011-04-01

    Full Text Available The aims of this study were to compare the proliferation and mineralization ability of CFU-F selected dental pulp cellsderived from primary and permanent teeth. Those cells were isolated by enzyme digestion and analyzed for their colonyformingcapacity. The cell proliferation was measured by the MTT assay on day 1, day 7, and day14. Alizarin Red S stainingwas used to detect mineralized nodule formation of the cells on day 7, 14, 21, and 28. Proliferation of CFU-F selected pulpcells from primary teeth was significantly higher than that of CFU-F selected pulp cells from permanent teeth in all periods ofthe experiment. Upon cultured cells in mineralization inducing media, the mineralized nodules appeared as early as day 14 inCFU-F selected pulp cells from primary teeth and MG-63, whereas those of CFU-F selected pulp cells from permanent teethcan be found at day 21. On day 21 and day 28, the mineralized nodules of the CFU-F selected pulp cells from the primaryteeth group were more than those in the CFU-F selected pulp cells from the permanent teeth group. Mineralized noduleformation in the CFU-F selected pulp cells from the permanent teeth group appeared later and were less than those ofCFU-F selected pulp cells from primary teeth. However, mineralized nodules in CFU-F selected pulp cells from the permanentteeth group increased very fast after their appearance. Those results suggest that CFU-F selected pulp cells from primaryteeth had a higher proliferation rate and mineralization rate when compared to CFU-F selected pulp cells from permanentteeth.

  5. Primary tonsillar mast cell tumour in a dog.

    Science.gov (United States)

    Shekell, C C; Thomson, M J; Miller, R I; Mackie, J T

    2018-05-01

    A 6-year-old speyed female Bull Arab-cross dog was found to have a small tonsillar nodule. Histological examination revealed a well-differentiated mast cell tumour (MCT). At initial staging, no evidence of concurrent cutaneous or visceral MCTs was found on a complete blood count, a single lateral thoracic radiograph, abdominal ultrasound or cytology of the spleen and regional lymph nodes. A diagnosis of primary tonsillar MCT was made. At 40 months postoperatively, the dog is alive with no evidence of gross tumour progression, in contrast to some previous reports of rapid disease progression and metastasis in dogs with primary oral MCTs. To the authors' knowledge, no previous reports of a primary MCT of the tonsil in dogs exist in the veterinary literature. © 2018 Australian Veterinary Association.

  6. Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P; Vishwanatha, Jamboor K, E-mail: Jamboor.vishwanatha@unthsc.edu [Department of Molecular Biology and Immunology and Institute for Cancer Research, Graduate School of Biomedical Sciences, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States)

    2011-11-04

    Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high ({approx}97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

  7. Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

    Science.gov (United States)

    Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P.; Vishwanatha, Jamboor K.

    2011-11-01

    Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high (~97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

  8. Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

    International Nuclear Information System (INIS)

    Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P; Vishwanatha, Jamboor K

    2011-01-01

    Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high (∼97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

  9. Inefficiency in macromolecular transport of SCS-based microcapsules affects viability of primary human mesenchymal stem cells but not of immortalized cells

    DEFF Research Database (Denmark)

    Sanz-Nogués, Clara; Horan, Jason; Thompson, Kerry

    2015-01-01

    mesenchymal stem cells (hMSCs). Human MSCs are of interest in regenerative medicine applications due to pro-angiogenic, anti-inflammatory and immunomodulatory properties, which result from paracrine effects of this cell type. In the present work we have encapsulated primary hMSCs and hMSC-TERT immortalized...... nutrients and had a more detrimental effect on the viability of primary cell cultures compared to cell lines and immortalized cells. This article is protected by copyright. All rights reserved....

  10. Uptake of gold nanoparticles in primary human endothelial cells

    DEFF Research Database (Denmark)

    Klingberg, Henrik; Oddershede, Lene B.; Löschner, Katrin

    2015-01-01

    Gold nanoparticles (AuNPs) are relevant in nanomedicine for drug delivery in the vascular system, where endothelial cells are the first point of contact. We investigated the uptake of 80 nm AuNPs in primary human umbilical vein endothelial cells (HUVECs) by flow cytometry, 3D confocal microscopy......–3 or more particles. Pre-treatment with chlorpromazine inhibited the AuNP-uptake in HUVECs, indicating that internalisation occurred mainly by clathrin-mediated endocytosis. Cell activation by exposure to tumour necrosis factor or lipopolysaccharide had a slight or no effect on the uptake of Au...

  11. Primitive and definitive erythropoiesis in mammals

    Directory of Open Access Journals (Sweden)

    James ePalis

    2014-01-01

    Full Text Available Red blood cells (RBCs, which constitute the most abundant cell type in the body, come in two distinct flavors- primitive and definitive. Definitive RBCs in mammals circulate as smaller, anucleate cells during fetal and postnatal life, while primitive RBCs circulate transiently in the early embryo as large, nucleated cells before ultimately enucleating. Both cell types are formed from lineage-committed progenitors that generate a series of morphologically identifiable precursors that enucleate to form mature RBCs. While definitive erythroid precursors mature extravascularly in the fetal liver and postnatal marrow in association with macrophage cells, primitive erythroid precursors mature as a semi-synchronous cohort in the embryonic bloodstream. While the cytoskeletal network is critical for the maintenance of cell shape and the deformability of definitive RBCs, little is known about the components and function of the cytoskeleton in primitive erythroblasts. Erythropoietin (EPO is a critical regulator of late-stage definitive, but not primitive, erythroid progenitor survival. However, recent studies indicate that EPO regulates multiple aspects of terminal maturation of primitive murine and human erythroid precursors, including cell survival, proliferation, and the rate of terminal maturation. Primitive and definitive erythropoiesis share central transcriptional regulators, including Gata1 and Klf1, but are also characterized by the differential expression and function of other regulators, including myb, Sox6, and Bcl11A. Flow cytometry-based methodologies, developed to purify murine and human stage-specific erythroid precursors, have enabled comparative global gene expression studies and are providing new insights into the biology of erythroid maturation.

  12. Peripheral Red Blood Cell Split Chimerism as a Consequence of Intramedullary Selective Apoptosis of Recipient Red Blood Cells in a Case of Sickle Cell Disease

    Directory of Open Access Journals (Sweden)

    Marco Marziali

    2014-08-01

    Full Text Available Allogeneic cellular gene therapy through hematopoietic stem cell transplantation is the only radical cure for congenital hemoglobinopathies like thalassemia and sickle cell anemia. Persistent mixed hematopoietic chimerism (PMC has been described in thalassemia and sickle cell anemia. Here, we describe the clinical course of a 6-year-old girl who had received bone marrow transplant for sickle cell anemia. After the transplant, the patient showed 36% donor hematopoietic stem cells in the bone marrow, whereas in the peripheral blood there was evidence of 80%  circulating donor red blood cells (RBC. The analysis of apoptosis at the Bone Marrow  level suggests that Fas might contribute to the cell death of host erythroid precursors. The increase in NK cells and the regulatory T cell population observed in this patient suggests that these cells might contribute to the condition of mixed chimerism.

  13. Transcriptional regulation of Hb-α and Hb-β through nuclear factor E2-related factor-2 (Nrf2) activation in human vaginal cells: A novel mechanism of cellular adaptability to oxidative stress.

    Science.gov (United States)

    Saha, Debarchana; Koli, Swanand; Reddy, Kudumula Venkata Rami

    2017-06-01

    Hemoglobin (Hb), a major protein involved in transport of oxygen (O 2 ), is expressed by erythroid lineages. Until recently, it was not known whether non-erythroid cells express Hb. The objective was to evaluate the expression and functional significance of Hb-α and Hb-β in human primary vaginal epithelial cells (hPVECs) and decipher downstream signaling. RT-PCR, qRT-PCR, flow cytometry, Western blot, immunofluorescence were used to evaluate the expression of Hb-α, Hb-β, and nuclear factor E2-related factor-2(Nrf2) after hydrogen peroxide (H 2 O 2 ) induction. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay were used to determine the binding efficiency of Nrf2 on the Hb-α promoter. Stimulation of hPVECs and human vaginal epithelial cell line, VK2/E6E7 with H 2 O 2 augmented the expression of Hb-α, Hb-β, Nrf2, heme oxygenase-1 (HO-1), and reactive oxygen species (ROS). Treatment of these cells with Nrf2 inhibitor, trigonelline (Trig) inhibited Hb-α and Hb-β expressions. Hb-α and Hb-β overexpression downregulated H 2 O 2 -induced ROS. The presence of Nrf2 binding domain was demonstrated within Hb-α promoter. The results revealed for the first time that Hb-α and Hb-β were induced by oxidative stress through the activation of Nrf2. Overexpression of Hb-α and Hb-β ameliorated H 2 O 2 -induced oxidative stress, indicating one of the possible mechanism(s) to protect hPVECS from oxidative stress. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Cutaneous features seen in primary liver cell (Hepatocellular ...

    African Journals Online (AJOL)

    Primary liver cell carcinoma (PLCC), predominantly hepatocellular carcinoma is a killer. In the southwestern region of Nigeria it occupies the second position, behind prostate cancer in males. Females account for about a third of diagnosed cases. Children are not spared. Over 80 % of PLCC cases present to the hospital at ...

  15. Measurement of the capability of DNA synthesis of human fetal liver cells by the assay of 3H-TdR incorporation

    International Nuclear Information System (INIS)

    Wang Tao; Ma Xiangrui; Wang Hongyun; Cao Xia

    1987-01-01

    The fetal liver is one of the major sites of hematopoiesis during gestation. Under erythropoietin (EPO) stimulation, in erythroid precusor cells of fetal liver, proliferation and differentiation occurred and function of metabolism was enhanced. The technique of 3 H-TdR incorporation was used to measure the function of fetal liver cellular DNA synthesis. As EPO concentration at the range of approximately 20 ∼ 100 mU/ml, the counts of 3 H-TdR incorporation into fetal liver cells increased. As the concentration of EPO increased, however, its incorporation counts are lower than that in bone marrow of either the fetal or the adult. It suggested that precusors of erythrocyte of fetal liver has differentiated to later phases with the progressive accumulation of mature cells, therefore, both proliferation and function of metabolism are more or less decreased respectively. Under EPO stimulation, however, precusor of erythroid of fetal liver can greatly increase potential effects on DNA synthesis

  16. Copper deficiency alters cell bioenergetics and induces mitochondrial fusion through up-regulation of MFN2 and OPA1 in erythropoietic cells

    International Nuclear Information System (INIS)

    Bustos, Rodrigo I.; Jensen, Erik L.; Ruiz, Lina M.; Rivera, Salvador; Ruiz, Sebastián; Simon, Felipe; Riedel, Claudia; Ferrick, David; Elorza, Alvaro A.

    2013-01-01

    Highlights: •In copper deficiency, cell proliferation is not affected. In turn, cell differentiation is impaired. •Enlarged mitochondria are due to up-regulation of MNF2 and OPA1. •Mitochondria turn off respiratory chain and ROS production. •Energy metabolism switch from mitochondria to glycolysis. -- Abstract: Copper is essential in cell physiology, participating in numerous enzyme reactions. In mitochondria, copper is a cofactor for respiratory complex IV, the cytochrome c oxidase. Low copper content is associated with anemia and the appearance of enlarged mitochondria in erythropoietic cells. These findings suggest a connection between copper metabolism and bioenergetics, mitochondrial dynamics and erythropoiesis, which has not been explored so far. Here, we describe that bathocuproine disulfonate-induced copper deficiency does not alter erythropoietic cell proliferation nor induce apoptosis. However it does impair erythroid differentiation, which is associated with a metabolic switch between the two main energy-generating pathways. That is, from mitochondrial function to glycolysis. Switching off mitochondria implies a reduction in oxygen consumption and ROS generation along with an increase in mitochondrial membrane potential. Mitochondrial fusion proteins MFN2 and OPA1 were up-regulated along with the ability of mitochondria to fuse. Morphometric analysis of mitochondria did not show changes in total mitochondrial biomass but rather bigger mitochondria because of increased fusion. Similar results were also obtained with human CD34+, which were induced to differentiate into red blood cells. In all, we have shown that adequate copper levels are important for maintaining proper mitochondrial function and for erythroid differentiation where the energy metabolic switch plus the up-regulation of fusion proteins define an adaptive response to copper deprivation to keep cells alive

  17. Copper deficiency alters cell bioenergetics and induces mitochondrial fusion through up-regulation of MFN2 and OPA1 in erythropoietic cells

    Energy Technology Data Exchange (ETDEWEB)

    Bustos, Rodrigo I.; Jensen, Erik L.; Ruiz, Lina M.; Rivera, Salvador; Ruiz, Sebastián [Center for Biomedical Research, Faculty of Biological Sciences and Faculty of Medicine, Universidad Andres Bello, Santiago (Chile); Simon, Felipe; Riedel, Claudia [Center for Biomedical Research, Faculty of Biological Sciences and Faculty of Medicine, Universidad Andres Bello, Santiago (Chile); Millennium Institute of Immunology and Immunotherapy, Santiago (Chile); Ferrick, David [Seahorse Bioscience, Billerica, MA (United States); Elorza, Alvaro A., E-mail: aelorza@unab.cl [Center for Biomedical Research, Faculty of Biological Sciences and Faculty of Medicine, Universidad Andres Bello, Santiago (Chile); Millennium Institute of Immunology and Immunotherapy, Santiago (Chile)

    2013-08-02

    Highlights: •In copper deficiency, cell proliferation is not affected. In turn, cell differentiation is impaired. •Enlarged mitochondria are due to up-regulation of MNF2 and OPA1. •Mitochondria turn off respiratory chain and ROS production. •Energy metabolism switch from mitochondria to glycolysis. -- Abstract: Copper is essential in cell physiology, participating in numerous enzyme reactions. In mitochondria, copper is a cofactor for respiratory complex IV, the cytochrome c oxidase. Low copper content is associated with anemia and the appearance of enlarged mitochondria in erythropoietic cells. These findings suggest a connection between copper metabolism and bioenergetics, mitochondrial dynamics and erythropoiesis, which has not been explored so far. Here, we describe that bathocuproine disulfonate-induced copper deficiency does not alter erythropoietic cell proliferation nor induce apoptosis. However it does impair erythroid differentiation, which is associated with a metabolic switch between the two main energy-generating pathways. That is, from mitochondrial function to glycolysis. Switching off mitochondria implies a reduction in oxygen consumption and ROS generation along with an increase in mitochondrial membrane potential. Mitochondrial fusion proteins MFN2 and OPA1 were up-regulated along with the ability of mitochondria to fuse. Morphometric analysis of mitochondria did not show changes in total mitochondrial biomass but rather bigger mitochondria because of increased fusion. Similar results were also obtained with human CD34+, which were induced to differentiate into red blood cells. In all, we have shown that adequate copper levels are important for maintaining proper mitochondrial function and for erythroid differentiation where the energy metabolic switch plus the up-regulation of fusion proteins define an adaptive response to copper deprivation to keep cells alive.

  18. Analysis of T Cell Subsets in Adult Primary/Idiopathic Minimal Change Disease: A Pilot Study

    Directory of Open Access Journals (Sweden)

    Francisco Salcido-Ochoa

    2017-01-01

    Full Text Available Aim. To characterise infiltrating T cells in kidneys and circulating lymphocyte subsets of adult patients with primary/idiopathic minimal change disease. Methods. In a cohort of 9 adult patients with primary/idiopathic minimal change recruited consecutively at disease onset, we characterized (1 infiltrating immune cells in the kidneys using immunohistochemistry and (2 circulating lymphocyte subsets using flow cytometry. As an exploratory analysis, association of the numbers and percentages of both kidney-infiltrating immune cells and the circulating lymphocyte subsets with kidney outcomes including deterioration of kidney function and proteinuria, as well as time to complete clinical remission up to 48 months of follow-up, was investigated. Results. In the recruited patients with primary/idiopathic minimal change disease, we observed (a a dominance of infiltrating T helper 17 cells and cytotoxic cells, comprising cytotoxic T cells and natural killer cells, over Foxp3+ Treg cells in the renal interstitium; (b an increase in the circulating total CD8+ T cells in peripheral blood; and (c an association of some of these parameters with kidney function and proteinuria. Conclusions. In primary/idiopathic minimal change disease, a relative numerical dominance of effector over regulatory T cells can be observed in kidney tissue and peripheral blood. However, larger confirmatory studies are necessary.

  19. Posttransplantation primary cutaneous CD30 (Ki-1)-positive large-cell lymphoma.

    Science.gov (United States)

    Seçkin, D; Demirhan, B; Oğuz Güleç, T; Arikan, U; Haberal, M

    2001-12-01

    We describe the case of a 51-year-old female renal transplant recipient with primary cutaneous CD30-positive large-cell lymphoma of T-cell origin. Cutaneous T-cell lymphomas are rarely reported in organ transplant recipients, and we believe they should be considered in the differential diagnosis of cutaneous neoplastic and infectious diseases affecting this patient group.

  20. Therapeutic hemoglobin levels after gene transfer in β-thalassemia mice and in hematopoietic cells of β-thalassemia and sickle cells disease patients.

    Directory of Open Access Journals (Sweden)

    Laura Breda

    Full Text Available Preclinical and clinical studies demonstrate the feasibility of treating β-thalassemia and Sickle Cell Disease (SCD by lentiviral-mediated transfer of the human β-globin gene. However, previous studies have not addressed whether the ability of lentiviral vectors to increase hemoglobin synthesis might vary in different patients.We generated lentiviral vectors carrying the human β-globin gene with and without an ankyrin insulator and compared their ability to induce hemoglobin synthesis in vitro and in thalassemic mice. We found that insertion of an ankyrin insulator leads to higher, potentially therapeutic levels of human β-globin through a novel mechanism that links the rate of transcription of the transgenic β-globin mRNA during erythroid differentiation with polysomal binding and efficient translation, as reported here for the first time. We also established a preclinical assay to test the ability of this novel vector to synthesize adult hemoglobin in erythroid precursors and in CD34(+ cells isolated from patients affected by β-thalassemia and SCD. Among the thalassemic patients, we identified a subset of specimens in which hemoglobin production can be achieved using fewer copies of the vector integrated than in others. In SCD specimens the treatment with AnkT9W ameliorates erythropoiesis by increasing adult hemoglobin (Hb A and concurrently reducing the sickling tetramer (Hb S.Our results suggest two major findings. First, we discovered that for the purpose of expressing the β-globin gene the ankyrin element is particularly suitable. Second, our analysis of a large group of specimens from β-thalassemic and SCD patients indicates that clinical trials could benefit from a simple test to predict the relationship between the number of vector copies integrated and the total amount of hemoglobin produced in the erythroid cells of prospective patients. This approach would provide vital information to select the best candidates for these

  1. Identification and characterization of cells with cancer stem cell properties in human primary lung cancer cell lines.

    Directory of Open Access Journals (Sweden)

    Ping Wang

    Full Text Available Lung cancer (LC with its different subtypes is generally known as a therapy resistant cancer with the highest morbidity rate worldwide. Therapy resistance of a tumor is thought to be related to cancer stem cells (CSCs within the tumors. There have been indications that the lung cancer is propagated and maintained by a small population of CSCs. To study this question we established a panel of 15 primary lung cancer cell lines (PLCCLs from 20 fresh primary tumors using a robust serum-free culture system. We subsequently focused on identification of lung CSCs by studying these cell lines derived from 4 representative lung cancer subtypes such as small cell lung cancer (SCLC, large cell carcinoma (LCC, squamous cell carcinoma (SCC and adenocarcinoma (AC. We identified a small population of cells strongly positive for CD44 (CD44(high and a main population which was either weakly positive or negative for CD44 (CD44(low/-. Co-expression of CD90 further narrowed down the putative stem cell population in PLCCLs from SCLC and LCC as spheroid-forming cells were mainly found within the CD44(highCD90(+ sub-population. Moreover, these CD44(highCD90(+ cells revealed mesenchymal morphology, increased expression of mesenchymal markers N-Cadherin and Vimentin, increased mRNA levels of the embryonic stem cell related genes Nanog and Oct4 and increased resistance to irradiation compared to other sub-populations studied, suggesting the CD44(highCD90(+ population a good candidate for the lung CSCs. Both CD44(highCD90(+ and CD44(highCD90(- cells in the PLCCL derived from SCC formed spheroids, whereas the CD44(low/- cells were lacking this potential. These results indicate that CD44(highCD90(+ sub-population may represent CSCs in SCLC and LCC, whereas in SCC lung cancer subtype, CSC potentials were found within the CD44(high sub-population.

  2. Identification and Characterization of Cells with Cancer Stem Cell Properties in Human Primary Lung Cancer Cell Lines

    Science.gov (United States)

    Suo, Zhenhe; Munthe, Else; Solberg, Steinar; Ma, Liwei; Wang, Mengyu; Westerdaal, Nomdo Anton Christiaan; Kvalheim, Gunnar; Gaudernack, Gustav

    2013-01-01

    Lung cancer (LC) with its different subtypes is generally known as a therapy resistant cancer with the highest morbidity rate worldwide. Therapy resistance of a tumor is thought to be related to cancer stem cells (CSCs) within the tumors. There have been indications that the lung cancer is propagated and maintained by a small population of CSCs. To study this question we established a panel of 15 primary lung cancer cell lines (PLCCLs) from 20 fresh primary tumors using a robust serum-free culture system. We subsequently focused on identification of lung CSCs by studying these cell lines derived from 4 representative lung cancer subtypes such as small cell lung cancer (SCLC), large cell carcinoma (LCC), squamous cell carcinoma (SCC) and adenocarcinoma (AC). We identified a small population of cells strongly positive for CD44 (CD44high) and a main population which was either weakly positive or negative for CD44 (CD44low/−). Co-expression of CD90 further narrowed down the putative stem cell population in PLCCLs from SCLC and LCC as spheroid-forming cells were mainly found within the CD44highCD90+ sub-population. Moreover, these CD44highCD90+ cells revealed mesenchymal morphology, increased expression of mesenchymal markers N-Cadherin and Vimentin, increased mRNA levels of the embryonic stem cell related genes Nanog and Oct4 and increased resistance to irradiation compared to other sub-populations studied, suggesting the CD44highCD90+ population a good candidate for the lung CSCs. Both CD44highCD90+ and CD44highCD90− cells in the PLCCL derived from SCC formed spheroids, whereas the CD44low/− cells were lacking this potential. These results indicate that CD44highCD90+ sub-population may represent CSCs in SCLC and LCC, whereas in SCC lung cancer subtype, CSC potentials were found within the CD44high sub-population. PMID:23469181

  3. Identification of genuine primary pulmonary NK cell lymphoma via clinicopathologic observation and clonality assay.

    Science.gov (United States)

    Gong, Li; Wei, Long-Xiao; Huang, Gao-Sheng; Zhang, Wen-Dong; Wang, Lu; Zhu, Shao-Jun; Han, Xiu-Juan; Yao, Li; Lan, Miao; Li, Yan-Hong; Zhang, Wei

    2013-08-19

    Extranodal natural killer (NK)/T-cell lymphoma, nasal type, is an uncommon lymphoma associated with the Epstein-Barr virus (EBV). It most commonly involves the nasal cavity and upper respiratory tract. Primary pulmonary NK/T cell lymphoma is extremely rare. If a patient with a NK or T-cell tumor has an unusual reaction to treatment or an unusual prognosis, it is wise to differentiate NK from T-cell tumors. The clinicopathologic characteristics, immunophenotype, EBV in situ hybridization, and T cell receptor (TCR) gene rearrangement of primary pulmonary NK cell lymphoma from a 73-year-old Chinese woman were investigated and the clonal status was determined using female X-chromosomal inactivation mosaicism and polymorphisms at the phosphoglycerate kinase (PGK) gene. The lesion showed the typical histopathologic characteristics and immunohistochemical features of NK/T cell lymphoma. However, the sample was negative for TCR gene rearrangement. A clonality assay demonstrated that the lesion was monoclonal. It is concluded that this is the first recorded case of genuine primary pulmonary NK cell lymphoma. The purpose of the present work is to recommend that pathologists carefully investigate the whole lesion to reduce the likelihood that primary pulmonary NK cell lymphoma will be misdiagnosed as an infectious lesion. In addition, TCR gene rearrangement and clonal analysis, which is based on female X-chromosomal inactivation mosaicism and polymorphisms at PGK and androgen receptor (AR) loci, were found to play important roles in differentiating NK cell lymphoma from T cell lymphoma. The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/5205300349457729.

  4. Simultaneous Expression of Cancer Stem Cell-Like Properties and Cancer-Associated Fibroblast-Like Properties in a Primary Culture of Breast Cancer Cells

    Energy Technology Data Exchange (ETDEWEB)

    Ishikawa, Mami; Inoue, Takahiro; Shirai, Takuma; Takamatsu, Kazuhiko; Kunihiro, Shiori; Ishii, Hirokazu [Frontiers of Innovative Research in Science and Technology (FIRST), Konan University, Kobe 650-0047 (Japan); Nishikata, Takahito, E-mail: nisikata@konan-u.ac.jp [Frontiers of Innovative Research in Science and Technology (FIRST), Konan University, Kobe 650-0047 (Japan); Frontier Institute for Biomolecular Engineering Research (FIBER), Konan University, Kobe 650-0047 (Japan)

    2014-07-31

    The importance of cancer-associated fibroblasts (CAFs) in cancer biology has been recently highlighted owing to their critical roles in cancer growth, progression, metastasis, and therapeutic resistance. We have previously established a primary culture of breast cancer cells, which showed epithelial-mesenchymal transition and cancer stem cell-like properties. In this study, we found that the primary culture also showed CAF-like properties. For example, hypoxia inducible factor 1α (HIF1A) and its downstream genes, nuclear factor-kappa B2 (NF-κB2) and BCL2/adenovirus E1B 19 kd-interacting protein 3 (BNIP3), and many enzymes involved in glycolysis, such as GAPDH, LDH, PGAM1, and PKM2, were highly overexpressed in the primary culture. Moreover, media conditioned with the primary culture cells enhanced the growth of breast cancer cells. Similar to previous CAF studies, this enhancement suggested to be occurred through fibroblast growth factor signaling. This MCKH primary culture cell, which showed simultaneous expression of tumorigenic and CAF properties, offers a unique experimental system for studying the biology of CAFs.

  5. Primary Squamous Cell Carcinoma of the Thyroid: A Population-Based Analysis.

    Science.gov (United States)

    Au, Joshua K; Alonso, Jose; Kuan, Edward C; Arshi, Armin; St John, Maie A

    2017-07-01

    Objectives To analyze the epidemiology and describe the prognostic indicators of patients with primary squamous cell carcinoma of the thyroid. Study Design and Setting Retrospective cohort study based on a national database. Methods The US National Cancer Institute's SEER registry (Surveillance, Epidemiology, and End Results) was reviewed for patients with primary squamous cell carcinoma of the thyroid from 1973 to 2012. Study variables included age, sex, race, tumor size, tumor grade, regional and distant metastases, and treatment modality. Survival measures included overall survival (OS) and disease-specific survival (DSS). Results A total of 199 cases of primary squamous cell carcinoma of the thyroid were identified. Mean age at diagnosis was 68.1 years; 58.3% were female; and 79.4% were white. Following diagnosis, 46.3% of patients underwent surgery; 55.7%, radiation therapy; and 45.8%, surgery with radiation therapy. Kaplan-Meier analysis demonstrated OS and DSS of 16% and 21% at 5 years, respectively. Median survival after diagnosis was 9.1 months. Multivariate Cox regression analysis showed that predictors of OS and DSS included age ( P Squamous cell carcinoma of the thyroid is a rare malignancy with a very poor prognosis. Surgical resection confers an overall survival benefit. Age, tumor grade, and tumor size are predictors of OS and DSS.

  6. Spontaneous regression of primary cutaneous diffuse large B-cell lymphoma, leg type with significant T-cell immune response

    Directory of Open Access Journals (Sweden)

    Paul M. Graham, DO

    2018-05-01

    Full Text Available We report a case of histologically confirmed primary cutaneous diffuse large B-cell lymphoma, leg type (PCDLBCL-LT that subsequently underwent spontaneous regression in the absence of systemic treatment. The case showed an atypical lymphoid infiltrate that was CD20+ and MUM-1+ and CD10–. A subsequent biopsy of the spontaneously regressed lesion showed fibrosis associated with a lymphocytic infiltrate comprising reactive T cells. PCDLBCL-LT is a cutaneous B-cell lymphoma with a poor prognosis, which is usually treated with chemotherapy. We describe a case of clinical and histologic spontaneous regression in a patient with PCDLBCL-LT who had a negative systemic workup but a recurrence over a year after his initial presentation. Key words: B cell, lymphoma, primary cutaneous diffuse large B-cell lymphoma, leg type, regression

  7. Cell surface of sea urchin micromeres and primary mesenchyme

    International Nuclear Information System (INIS)

    DeSimone, D.W.

    1985-01-01

    The cell surface and extracellular matrix (ECM) of the sea urchin embryo were studied during the early morphogenetic events involved in the differentiation of the micromere cell lineage. Sixteen-cell and early cleavage stage blastomeres were isolated and the protein composition of their cell surfaces examined by 125 I-labelling followed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Micromere-specific cell surface proteins are reported for Arbacia punctulata, Strongylocentrotus droebachiensis, and Strongylocentrotus purpuratus. Cell surface glycoproteins were characterized on the basis of lectin binding specificity with a novel lectin affinity transfer technique. Using this procedure, cell-type specific surface proteins, which are also lectin-binding specific, can be detected. In addition, fluorescein conjugated lectins were microinjected into the blastocoels of living S. drobachiensis and Lytechinus pictus embryos and the patterns of lectin bindings observed by fluorescence microscopy. The evidence presented in this thesis suggests that the differentiation of the primary mesenchyme cells is correlated with changes in the molecular composition of the cell-surface and the ECM

  8. The influence of 60Co gamma rays to cell reproduction (An experiment using low dose levels on vero and primary monkey kidney cells)

    International Nuclear Information System (INIS)

    Danusupadmo, C.J. Sugiarto

    1985-01-01

    Vero and primary monkey kidney cells in culture were gamma irradiated with doses of 0, 0.4 and 0.8 Gy at a dose-rate of 1.30-1.45x10 3 Gy/hour. At harvest time 3 days post irradiation, 0.4 Gy proved to be able to lower the number of vero cells in such a degree that it became significantly different from the control, whereas 0.8 Gy could not suppress the number of primary cells to a level that differed significantly from its control. At harvest time of 7 days post irradiation, 0.4 Gy was found effective in lowering both vero and primary cells so that the number of the harvested cells were significantly different from the controls. At harvest time of 3 days post irradiation, 0.8 Gy caused both cell types reached levels that were not significantly different from 0.4 Gy, but at 7 days post irradiation the number of vero cells was very significantly different from that of 0.4 Gy, while the number of primary cells remained equal to that of 0.4 Gy. This phenomenon showed that irradiation could cause greater injurious effect at more advanced post irradiation times, while the more proliferative vero cells proved to be more susceptible to irradiation than primary cells, but at the same time more potential in performing repair. (author)

  9. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Science.gov (United States)

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  10. A Case of Mature Natural Killer-Cell Neoplasm Manifesting Multiple Choroidal Lesions: Primary Intraocular Natural Killer-Cell Lymphoma

    Directory of Open Access Journals (Sweden)

    Yoshiaki Tagawa

    2015-11-01

    Full Text Available Purpose: Natural killer (NK cell neoplasm is a rare disease that follows an acute course and has a poor prognosis. It usually emerges from the nose and appears in the ocular tissue as a metastasis. Herein, we describe a case of NK-cell neoplasm in which the eye was considered to be the primary organ. Case: A 50-year-old female displayed bilateral anterior chamber cells, vitreous opacity, bullous retinal detachment, and multiple white choroidal mass lesions. Although malignant lymphoma or metastatic tumor was suspected, various systemic examinations failed to detect any positive results. A vitrectomy was performed OS; however, histocytological analyses from the vitreous sample showed no definite evidence of malignancy, and IL-10 concentration was low. Enlarged choroidal masses were fused together. Three weeks after the first visit, the patient suddenly developed an attack of fever, night sweat, and hepatic dysfunction, and 5 days later, she passed away due to multiple organ failure. Immunohistochemisty and in situ hybridization revealed the presence of atypical cells positive for CD3, CD56, and Epstein-Barr virus-encoded RNAs, resulting in the diagnosis of NK-cell neoplasm. With the characteristic clinical course, we concluded that this neoplasm was a primary intraocular NK-cell lymphoma. Conclusions: This is the first report to describe primary intraocular NK-cell neoplasm. When we encounter atypical choroidal lesions, we should consider the possibility of NK-cell lymphoma, even though it is a rare disease.

  11. Rhabdomyosarcoma cells show an energy producing anabolic metabolic phenotype compared with primary myocytes

    Directory of Open Access Journals (Sweden)

    Higashi Richard M

    2008-10-01

    Full Text Available Abstract Background The functional status of a cell is expressed in its metabolic activity. We have applied stable isotope tracing methods to determine the differences in metabolic pathways in proliferating Rhabdomysarcoma cells (Rh30 and human primary myocytes in culture. Uniformly 13C-labeled glucose was used as a source molecule to follow the incorporation of 13C into more than 40 marker metabolites using NMR and GC-MS. These include metabolites that report on the activity of glycolysis, Krebs' cycle, pentose phosphate pathway and pyrimidine biosynthesis. Results The Rh30 cells proliferated faster than the myocytes. Major differences in flux through glycolysis were evident from incorporation of label into secreted lactate, which accounts for a substantial fraction of the glucose carbon utilized by the cells. Krebs' cycle activity as determined by 13C isotopomer distributions in glutamate, aspartate, malate and pyrimidine rings was considerably higher in the cancer cells than in the primary myocytes. Large differences were also evident in de novo biosynthesis of riboses in the free nucleotide pools, as well as entry of glucose carbon into the pyrimidine rings in the free nucleotide pool. Specific labeling patterns in these metabolites show the increased importance of anaplerotic reactions in the cancer cells to maintain the high demand for anabolic and energy metabolism compared with the slower growing primary myocytes. Serum-stimulated Rh30 cells showed higher degrees of labeling than serum starved cells, but they retained their characteristic anabolic metabolism profile. The myocytes showed evidence of de novo synthesis of glycogen, which was absent in the Rh30 cells. Conclusion The specific 13C isotopomer patterns showed that the major difference between the transformed and the primary cells is the shift from energy and maintenance metabolism in the myocytes toward increased energy and anabolic metabolism for proliferation in the Rh30 cells

  12. Early events associated with infection of Epstein-Barr virus infection of primary B-cells.

    Directory of Open Access Journals (Sweden)

    Sabyasachi Halder

    2009-09-01

    Full Text Available Epstein Barr virus (EBV is closely associated with the development of a vast number of human cancers. To develop a system for monitoring early cellular and viral events associated with EBV infection a self-recombining BAC containing 172-kb of the Epstein Barr virus genome BAC-EBV designated as MD1 BAC (Chen et al., 2005, J.Virology was used to introduce an expression cassette of green fluorescent protein (GFP by homologous recombination, and the resultant BAC clone, BAC-GFP-EBV was transfected into the HEK 293T epithelial cell line. The resulting recombinant GFP EBV was induced to produce progeny virus by chemical inducer from the stable HEK 293T BAC GFP EBV cell line and the virus was used to immortalize human primary B-cell as monitored by green fluorescence and outgrowth of the primary B cells. The infection, B-cell activation and cell proliferation due to GFP EBV was monitored by the expression of the B-cell surface antigens CD5, CD10, CD19, CD23, CD39, CD40 , CD44 and the intercellular proliferation marker Ki-67 using Flow cytometry. The results show a dramatic increase in Ki-67 which continues to increase by 6-7 days post-infection. Likewise, CD40 signals showed a gradual increase, whereas CD23 signals were increased by 6-12 hours, maximally by 3 days and then decreased. Monitoring the viral gene expression pattern showed an early burst of lytic gene expression. This up-regulation of lytic gene expression prior to latent genes during early infection strongly suggests that EBV infects primary B-cell with an initial burst of lytic gene expression and the resulting progeny virus is competent for infecting new primary B-cells. This process may be critical for establishment of latency prior to cellular transformation. The newly infected primary B-cells can be further analyzed for investigating B cell activation due to EBV infection.

  13. Metastatic Signet-Ring Cell Gastric Carcinoma Masquerading as Breast Primary

    Directory of Open Access Journals (Sweden)

    Dinesh Chandra Doval

    2009-03-01

    Full Text Available Metastasis to the breast from an extra-mammary primary is a rare phenomenon; metastasis from gastric carcinoma to the breast is extremely so. We report a case who initially presented as mucin-secreting and signet-ring cell tumor of the ovary, and after an interval of 8 months with breast and chest wall metastatic nodules. The covert gastric primary eluded the oncologists at both presentations.

  14. A novel three-dimensional cell culture method enhances antiviral drug screening in primary human cells.

    Science.gov (United States)

    Koban, Robert; Neumann, Markus; Daugs, Aila; Bloch, Oliver; Nitsche, Andreas; Langhammer, Stefan; Ellerbrok, Heinz

    2018-02-01

    Gefitinib is a specific inhibitor of the epidermal growth factor receptor (EGFR) and FDA approved for treatment of non-small cell lung cancer. In a previous study we could show the in vitro efficacy of gefitinib for treatment of poxvirus infections in monolayer (2D) cultivated cell lines. Permanent cell lines and 2D cultures, however, are known to be rather unphysiological; therefore it is difficult to predict whether determined effective concentrations or the drug efficacy per se are transferable to the in vivo situation. 3D cell cultures, which meanwhile are widely distributed across all fields of research, are a promising tool for more predictive in vitro investigations of antiviral compounds. In this study the spreading of cowpox virus and the antiviral efficacy of gefitinib were analyzed in primary human keratinocytes (NHEK) grown in a novel 3D extracellular matrix-based cell culture model and compared to the respective monolayer culture. 3D-cultivated NHEK grew in a polarized and thus a more physiological manner with altered morphology and close cell-cell contact. Infected cultures showed a strongly elevated sensitivity towards gefitinib. EGFR phosphorylation, cell proliferation, and virus replication were significantly reduced in 3D cultures at gefitinib concentrations which were at least 100-fold lower than those in monolayer cultures and well below the level of cytotoxicity. Our newly established 3D cell culture model with primary human cells is an easy-to-handle alternative to conventional monolayer cell cultures and previously described more complex 3D cell culture systems. It can easily be adapted to other cell types and a broad spectrum of viruses for antiviral drug screening and many other aspects of virus research under more in vivo-like conditions. In consequence, it may contribute to a more targeted realization of necessary in vivo experiments. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Vaginal type-II mucosa is an inductive site for primary CD8+ T-cell mucosal immunity

    Science.gov (United States)

    Wang, Yichuan; Sui, Yongjun; Kato, Shingo; Hogg, Alison E.; Steel, Jason C.; Morris, John C.; Berzofsky, Jay A.

    2014-01-01

    The structured lymphoid tissues are considered the only inductive sites where primary T cell immune responses occur. The naïve T cells in structured lymphoid tissues, once being primed by antigen -bearing dendritic cells, differentiate into memory T cells and traffic back to the mucosal sites through the bloodstream. Contrary to this belief, here we show that the vaginal type-II mucosa itself, despite lack of structured lymphoid tissues, can act as an inductive site during primary CD8+ T cell immune responses. We provide evidence that the vaginal mucosa supports both the local immune priming of naïve CD8+ T cells and the local expansion of antigen-specific CD8+ T cells, thereby demonstrating a different paradigm for primary mucosal T cell immune induction. PMID:25600442

  16. Pulp tissue from primary teeth: new source of stem cells

    Directory of Open Access Journals (Sweden)

    Paloma Dias Telles

    2011-06-01

    Full Text Available SHED (stem cells from human exfoliated deciduous teeth represent a population of postnatal stem cells capable of extensive proliferation and multipotential differentiation. Primary teeth may be an ideal source of postnatal stem cells to regenerate tooth structures and bone, and possibly to treat neural tissue injury or degenerative diseases. SHED are highly proliferative cells derived from an accessible tissue source, and therefore hold potential for providing enough cells for clinical applications. In this review, we describe the current knowledge about dental pulp stem cells and discuss tissue engineering approaches that use SHED to replace irreversibly inflamed or necrotic pulps with a healthy and functionally competent tissue that is capable of forming new dentin.

  17. Cell context-specific expression of primary cilia in the human testis and ciliary coordination of Hedgehog signalling in mouse Leydig cells

    DEFF Research Database (Denmark)

    Berg Nygaard, Marie; Almstrup, Kristian; Lindbæk, Louise

    2015-01-01

    Primary cilia are sensory organelles that coordinate numerous cellular signalling pathways during development and adulthood. Defects in ciliary assembly or function lead to a series of developmental disorders and diseases commonly referred to as ciliopathies. Still, little is known about...... cells of mature seminiferous epithelium, but present in Sertoli cell-only tubules in Klinefelter syndrome testis. Peritubular cells in atrophic testis produce overly long cilia. Furthermore cultures of growth-arrested immature mouse Leydig cells express primary cilia that are enriched in components...

  18. Primary leiomyoma of ureter coexisting with renal cell carcinoma: A case report

    International Nuclear Information System (INIS)

    Baek, Seung Hwan; Kim, Hee Jin; Han, Hyun Young

    2014-01-01

    Mesenchymal origin of ureter tumors account for less than 3 percent of all primary ureteral tumors. Among mesenchymal tumors, primary leiomyoma of ureter is extremely rare. Here, we present a case of primary leiomyoma of ureter coexisting with renal cell carcinoma. When encountering well-defined homogeneously enhanced mass of ureter on computed tomography, radiologist should keep in mind that ureteral leiomyoma should be considered as differential diagnosis.

  19. Primary leiomyoma of ureter coexisting with renal cell carcinoma: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Baek, Seung Hwan; Kim, Hee Jin; Han, Hyun Young [Dept. of Radiology, Eulji University Hospital, Daejeon (Korea, Republic of)

    2014-12-15

    Mesenchymal origin of ureter tumors account for less than 3 percent of all primary ureteral tumors. Among mesenchymal tumors, primary leiomyoma of ureter is extremely rare. Here, we present a case of primary leiomyoma of ureter coexisting with renal cell carcinoma. When encountering well-defined homogeneously enhanced mass of ureter on computed tomography, radiologist should keep in mind that ureteral leiomyoma should be considered as differential diagnosis.

  20. Effects of Tyrosine Kinase inhibitor Imatinib (Glivec) on PDGFR-positive primary and metastatic melanoma cells

    International Nuclear Information System (INIS)

    Straface, E.; Gambardella, L.; Vona, R.

    2009-01-01

    In summary these preliminary results indicate that Imatinib is able to induce apoptosis in metastatic cells and to sensitize these cells to pro-apoptotic agents commonly used in melanoma therapy, e.g. radiation or Cisplatin. Conversely, primary melanoma cells seem to be intrinsically resistant either to Imatinib given alone or in combination with Cisplatin or radiation. By contrast, these cells underwent autophagy and replicative senescence boostering their survival. Interestingly, the use of Imatinib in combination with anti-CD95/Fas antibodies sensitizes primary melanoma cells to apoptosis

  1. Cancer Stem Cells in Primary Liver Cancers: Pathological Concepts and Imaging Findings

    Energy Technology Data Exchange (ETDEWEB)

    Joo, Ijin [Department of Radiology, Seoul National University Hospital, Seoul 110-744 (Korea, Republic of); Kim, Haeryoung [Department of Pathology, Seoul National University Bundang Hospital, Seongnam 463-707 (Korea, Republic of); Lee, Jeong Min [Department of Radiology, Seoul National University Hospital, Seoul 110-744 (Korea, Republic of)

    2015-11-01

    There is accumulating evidence that cancer stem cells (CSCs) play an integral role in the initiation of hepatocarcinogenesis and the maintaining of tumor growth. Liver CSCs derived from hepatic stem/progenitor cells have the potential to differentiate into either hepatocytes or cholangiocytes. Primary liver cancers originating from CSCs constitute a heterogeneous histopathologic spectrum, including hepatocellular carcinoma, combined hepatocellular-cholangiocarcinoma, and intrahepatic cholangiocarcinoma with various radiologic manifestations. In this article, we reviewed the recent concepts of CSCs in the development of primary liver cancers, focusing on their pathological and radiological findings. Awareness of the pathological concepts and imaging findings of primary liver cancers with features of CSCs is critical for accurate diagnosis, prediction of outcome, and appropriate treatment options for patients.

  2. Cancer Stem Cells in Primary Liver Cancers: Pathological Concepts and Imaging Findings

    International Nuclear Information System (INIS)

    Joo, Ijin; Kim, Haeryoung; Lee, Jeong Min

    2015-01-01

    There is accumulating evidence that cancer stem cells (CSCs) play an integral role in the initiation of hepatocarcinogenesis and the maintaining of tumor growth. Liver CSCs derived from hepatic stem/progenitor cells have the potential to differentiate into either hepatocytes or cholangiocytes. Primary liver cancers originating from CSCs constitute a heterogeneous histopathologic spectrum, including hepatocellular carcinoma, combined hepatocellular-cholangiocarcinoma, and intrahepatic cholangiocarcinoma with various radiologic manifestations. In this article, we reviewed the recent concepts of CSCs in the development of primary liver cancers, focusing on their pathological and radiological findings. Awareness of the pathological concepts and imaging findings of primary liver cancers with features of CSCs is critical for accurate diagnosis, prediction of outcome, and appropriate treatment options for patients

  3. Efficient generation of patient-matched malignant and normal primary cell cultures from clear cell renal cell carcinoma patients: clinically relevant models for research and personalized medicine

    International Nuclear Information System (INIS)

    Lobo, Nazleen C.; Gedye, Craig; Apostoli, Anthony J.; Brown, Kevin R.; Paterson, Joshua; Stickle, Natalie; Robinette, Michael; Fleshner, Neil; Hamilton, Robert J.; Kulkarni, Girish; Zlotta, Alexandre; Evans, Andrew; Finelli, Antonio; Moffat, Jason; Jewett, Michael A. S.; Ailles, Laurie

    2016-01-01

    Patients with clear cell renal cell carcinoma (ccRCC) have few therapeutic options, as ccRCC is unresponsive to chemotherapy and is highly resistant to radiation. Recently targeted therapies have extended progression-free survival, but responses are variable and no significant overall survival benefit has been achieved. Commercial ccRCC cell lines are often used as model systems to develop novel therapeutic approaches, but these do not accurately recapitulate primary ccRCC tumors at the genomic and transcriptional levels. Furthermore, ccRCC exhibits significant intertumor genetic heterogeneity, and the limited cell lines available fail to represent this aspect of ccRCC. Our objective was to generate accurate preclinical in vitro models of ccRCC using tumor tissues from ccRCC patients. ccRCC primary single cell suspensions were cultured in fetal bovine serum (FBS)-containing media or defined serum-free media. Established cultures were characterized by genomic verification of mutations present in the primary tumors, expression of renal epithelial markers, and transcriptional profiling. The apparent efficiency of primary cell culture establishment was high in both culture conditions, but genotyping revealed that the majority of cultures contained normal, not cancer cells. ccRCC characteristically shows biallelic loss of the von Hippel Lindau (VHL) gene, leading to accumulation of hypoxia-inducible factor (HIF) and expression of HIF target genes. Purification of cells based on expression of carbonic anhydrase IX (CA9), a cell surface HIF target, followed by culture in FBS enabled establishment of ccRCC cell cultures with an efficiency of >80 %. Culture in serum-free conditions selected for growth of normal renal proximal tubule epithelial cells. Transcriptional profiling of ccRCC and matched normal cell cultures identified up- and down-regulated networks in ccRCC and comparison to The Cancer Genome Atlas confirmed the clinical validity of our cell cultures. The ability

  4. Heterozygous and homozygous JAK2(V617F states modeled by induced pluripotent stem cells from myeloproliferative neoplasm patients.

    Directory of Open Access Journals (Sweden)

    Joseph Saliba

    Full Text Available JAK2(V617F is the predominant mutation in myeloproliferative neoplasms (MPN. Modeling MPN in a human context might be helpful for the screening of molecules targeting JAK2 and its intracellular signaling. We describe here the derivation of induced pluripotent stem (iPS cell lines from 2 polycythemia vera patients carrying a heterozygous and a homozygous mutated JAK2(V617F, respectively. In the patient with homozygous JAK2(V617F, additional ASXL1 mutation and chromosome 20 allowed partial delineation of the clonal architecture and assignation of the cellular origin of the derived iPS cell lines. The marked difference in the response to erythropoietin (EPO between homozygous and heterozygous cell lines correlated with the constitutive activation level of signaling pathways. Strikingly, heterozygous iPS cells showed thrombopoietin (TPO-independent formation of megakaryocytic colonies, but not EPO-independent erythroid colony formation. JAK2, PI3K and HSP90 inhibitors were able to block spontaneous and EPO-induced growth of erythroid colonies from GPA(+CD41(+ cells derived from iPS cells. Altogether, this study brings the proof of concept that iPS can be used for studying MPN pathogenesis, clonal architecture, and drug efficacy.

  5. Effect of 5-aminolevulinic acid on erythropoiesis: A preclinical in vitro characterization for the treatment of congenital sideroblastic anemia

    International Nuclear Information System (INIS)

    Fujiwara, Tohru; Okamoto, Koji; Niikuni, Ryoyu; Takahashi, Kiwamu; Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi; Ishizawa, Kenichi; Ichinohasama, Ryo; Nakamura, Yukio; Nakajima, Motowo; Tanaka, Tohru; Harigae, Hideo

    2014-01-01

    Highlights: • Treatment with ALA induces erythroid differentiation of K562 cells. • Transportation of ALA into erythroid cells occurs predominantly via SLC36A1. • ALA restores defects in ALAS2 in human iPS cell-derived erythroblasts. • ALA may represent a novel therapeutic option for CSA caused by ALAS2 mutations. - Abstract: Congenital sideroblastic anemia (CSA) is a hereditary disorder characterized by microcytic anemia and bone marrow sideroblasts. The most common form of CSA is attributed to mutations in the X-linked gene 5-aminolevulinic acid synthase 2 (ALAS2). ALAS2 is a mitochondrial enzyme, which utilizes glycine and succinyl-CoA to form 5-aminolevulinic acid (ALA), a crucial precursor in heme synthesis. Therefore, ALA supplementation could be an effective therapeutic strategy to restore heme synthesis in CSA caused by ALAS2 defects. In a preclinical study, we examined the effects of ALA in human erythroid cells, including K562 cells and human induced pluripotent stem cell-derived erythroid progenitor (HiDEP) cells. ALA treatment resulted in significant dose-dependent accumulation of heme in the K562 cell line. Concomitantly, the treatment substantially induced erythroid differentiation as assessed using benzidine staining. Quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis confirmed significant upregulation of heme-regulated genes, such as the globin genes [hemoglobin alpha (HBA) and hemoglobin gamma (HBG)] and the heme oxygenase 1 (HMOX1) gene, in K562 cells. Next, to investigate the mechanism by which ALA is transported into erythroid cells, quantitative RT-PCR analysis was performed on previously identified ALA transporters, including solute carrier family 15 (oligopeptide transporter), member (SLC15A) 1, SLC15A2, solute carrier family 36 (proton/amino acid symporter), member (SLC36A1), and solute carrier family 6 (neurotransmitter transporter), member 13 (SLC6A13). Our analysis revealed that SLC36A1 was abundantly

  6. Effect of 5-aminolevulinic acid on erythropoiesis: A preclinical in vitro characterization for the treatment of congenital sideroblastic anemia

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Tohru [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Department of Molecular Hematology/Oncology, Tohoku University Graduate School, Sendai (Japan); Okamoto, Koji; Niikuni, Ryoyu [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Takahashi, Kiwamu [SBI Pharmaceuticals Co., Ltd., Tokyo (Japan); Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Ishizawa, Kenichi [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Clinical Research, Innovation and Education Center, Tohoku University Hospital, Sendai (Japan); Ichinohasama, Ryo [Department of Hematopathology, Tohoku University Graduate School, Sendai (Japan); Nakamura, Yukio [Cell Engineering Division, RIKEN BioResource Center, Tsukuba, Ibaraki (Japan); Nakajima, Motowo; Tanaka, Tohru [SBI Pharmaceuticals Co., Ltd., Tokyo (Japan); Harigae, Hideo, E-mail: harigae@med.tohoku.ac.jp [Department of Hematology and Rheumatology, Tohoku University Graduate School, Sendai (Japan); Department of Molecular Hematology/Oncology, Tohoku University Graduate School, Sendai (Japan)

    2014-11-07

    Highlights: • Treatment with ALA induces erythroid differentiation of K562 cells. • Transportation of ALA into erythroid cells occurs predominantly via SLC36A1. • ALA restores defects in ALAS2 in human iPS cell-derived erythroblasts. • ALA may represent a novel therapeutic option for CSA caused by ALAS2 mutations. - Abstract: Congenital sideroblastic anemia (CSA) is a hereditary disorder characterized by microcytic anemia and bone marrow sideroblasts. The most common form of CSA is attributed to mutations in the X-linked gene 5-aminolevulinic acid synthase 2 (ALAS2). ALAS2 is a mitochondrial enzyme, which utilizes glycine and succinyl-CoA to form 5-aminolevulinic acid (ALA), a crucial precursor in heme synthesis. Therefore, ALA supplementation could be an effective therapeutic strategy to restore heme synthesis in CSA caused by ALAS2 defects. In a preclinical study, we examined the effects of ALA in human erythroid cells, including K562 cells and human induced pluripotent stem cell-derived erythroid progenitor (HiDEP) cells. ALA treatment resulted in significant dose-dependent accumulation of heme in the K562 cell line. Concomitantly, the treatment substantially induced erythroid differentiation as assessed using benzidine staining. Quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis confirmed significant upregulation of heme-regulated genes, such as the globin genes [hemoglobin alpha (HBA) and hemoglobin gamma (HBG)] and the heme oxygenase 1 (HMOX1) gene, in K562 cells. Next, to investigate the mechanism by which ALA is transported into erythroid cells, quantitative RT-PCR analysis was performed on previously identified ALA transporters, including solute carrier family 15 (oligopeptide transporter), member (SLC15A) 1, SLC15A2, solute carrier family 36 (proton/amino acid symporter), member (SLC36A1), and solute carrier family 6 (neurotransmitter transporter), member 13 (SLC6A13). Our analysis revealed that SLC36A1 was abundantly

  7. Primary intraosseous squamous cell carcinoma in odontogenic keratocyst: A rare entity

    Science.gov (United States)

    Saxena, Chitrapriya; Aggarwal, Pooja; Wadhwan, Vijay; Bansal, Vishal

    2015-01-01

    Squamous cell carcinoma (SCC) arising from the wall of an odontogenic cyst (also known as primary intraosseous carcinoma) is a rare tumor which occurs only in jaw bones. This tumor was first described by Loos in 1913 as a central epidermoid carcinoma of the jaw. Primary intraosseous carcinomas (PIOC) may theoretically arise from the lining of an odontogenic cyst or de novo from presumed odontogenic cell rests. According to the new histological classification of tumors of the World Health Organization, odontogenic keratocyst is nowadays considered a specific odontogenic tumor and the PIOC derived from it is considered as a specific entity which is different from other PIOCs derived from the odontogenic cysts. The following report describes a case of such extremely rare entity that is primary intraosseous SCC of the mandible derived from an OKC in a 60-year-old male patient with brief review of literature. PMID:26980976

  8. Primary diffuse large B cell lymphoma arising from a leiomyoma of the uterine corpus.

    Science.gov (United States)

    Zhao, Lianhua; Ma, Qiang; Wang, Qiushi; Zeng, Ying; Luo, Qingya; Xiao, Hualiang

    2016-01-20

    Primary diffuse large B cell lymphoma (DLBCL) of the uterus is rare, and primary DLBCL arising from a uterine leiomyoma (collision tumor) has not been reported in the literature. We describe the clinical, histological, immunohistochemical, and molecular features of primary DLBCL arising from a leiomyoma in the uterine corpus. A 73-year-old female patient had a uterine mass for 23 years. An ultrasound scan revealed marked enlargement of the uterus, measuring 18.2 × 13 × 16.3 cm, with a 17.6 × 10.9 × 11.6 cm hypoechoic mass in the uterine corpus. The tumors consisted of medium- to large-sized cells exhibiting a diffuse pattern of growth with a well-circumscribed leiomyoma. The neoplastic cells strongly expressed CD79α, CD20 and PAX5. Molecular analyses indicated clonal B-cell receptor gene rearrangement. To the best of our knowledge, no previous cases of primary DLBCL arising from a leiomyoma have been reported. It is necessary to differentiate a diagnosis of primary DLBCL arising from a leiomyoma from that of leiomyoma with florid reactive lymphocytic infiltration (lymphoma-like lesion). Careful analysis of clinical, histological, immunophenotypic, and genetic features is required to establish the correct diagnosis.

  9. The influence of gender- and age-related differences in the radiosensitivity of hematopoietic progenitor cells detected in steady-state human peripheral blood

    International Nuclear Information System (INIS)

    Kato, Kengo; Kashiwakura, Ikuo; Kuwabara, Mikinori

    2011-01-01

    To investigate the importance of gender and aging on the individual radiosensitivity of lineage-committed myeloid hematopoietic stem/progenitor cells (HSPCs) detected in mononuclear cells (MNCs) of steady-state human peripheral blood (PB), the clonogenic survival of HPCs, including colony-forming unit-granulocyte macrophage; burst-forming unit-erythroid; colony-forming unit-granulocyte-erythroid-macrophage-megakaryocyte cells derived from MNCs exposed to 0.5 Gy and 2 Gy X-irradiation were estimated. MNCs were prepared from the buffy-coats of 59 healthy individual blood donors. The results showed that large individual differences exist in the number of HSPCs, as well as in the surviving fraction of cells. Furthermore, the number of progenitor cells strongly correlated with their surviving fraction, suggesting that the radiosensitivity of hematopoietic progenitor cells decreases with the number of cells in the 10 5 cells population. A statistically significant negative correlation was observed between the surviving fraction observed at a dose of 0.5 Gy and the age of an individual, however, none of these correlations were observed after 2 Gy irradiation. No statistically significant difference was observed in individual radiosensitivity between males and females at either radiation dose. The present results indicated a correlation between the individual responsiveness of HSPCs to ionizing irradiation, especially to low dose irradiation, and aging. (author)

  10. Targeting of beta-arrestin2 to the centrosome and primary cilium: role in cell proliferation control.

    Directory of Open Access Journals (Sweden)

    Anahi Molla-Herman

    Full Text Available The primary cilium is a sensory organelle generated from the centrosome in quiescent cells and found at the surface of most cell types, from where it controls important physiological processes. Specific sets of membrane proteins involved in sensing the extracellular milieu are concentrated within cilia, including G protein coupled receptors (GPCRs. Most GPCRs are regulated by beta-arrestins, betaarr1 and betaarr2, which control both their signalling and endocytosis, suggesting that betaarrs may also function at primary cilium.In cycling cells, betaarr2 was observed at the centrosome, at the proximal region of the centrioles, in a microtubule independent manner. However, betaarr2 did not appear to be involved in classical centrosome-associated functions. In quiescent cells, both in vitro and in vivo, betaarr2 was found at the basal body and axoneme of primary cilia. Interestingly, betaarr2 was found to interact and colocalize with 14-3-3 proteins and Kif3A, two proteins known to be involved in ciliogenesis and intraciliary transport. In addition, as suggested for other centrosome or cilia-associated proteins, betaarrs appear to control cell cycle progression. Indeed, cells lacking betaarr2 were unable to properly respond to serum starvation and formed less primary cilia in these conditions.Our results show that betaarr2 is localized to the centrosome in cycling cells and to the primary cilium in quiescent cells, a feature shared with other proteins known to be involved in ciliogenesis or primary cilium function. Within cilia, betaarr2 may participate in the signaling of cilia-associated GPCRs and, therefore, in the sensory functions of this cell "antenna".

  11. Cell-surface proteoglycan in sea urchin primary mesenchyme cell migration

    International Nuclear Information System (INIS)

    Lane, M.C.

    1989-01-01

    Early in the development of the sea urchin embryo, the primary mesenchyme cells (PMC) migrate along the basal lamina of the blastocoel. Migration is inhibited in L. pictus embryos cultured in sulfate-free seawater and in S. purpuratus embryos exposed to exogenous β-D-xylosides. An in vitro assay was developed to test the migratory capacity of normal PMC on normal and treated blastocoelic matrix. Sulfate deprivation and exposure to exogenous xyloside render PMC nonmotile on either matrix. Materials removed from the surface of normal PMC by treatment with 1 M urea restored migratory ability to defective cells, whereas a similar preparation isolated from the surface of epithelial cells at the same stage did not. Migration also resumed when cells were removed from the xyloside or returned to normal seawater. The urea extract was partially purified and characterized by radiolabeling, gel electrophoresis, fluorography, ion exchange chromatography, and western blotting. The PMC synthesize a large chondroitin sulfate/dermatan sulfate proteoglycan that is present in an active fraction isolated by chromatography. Chondroitinase ABC digestion of live cells blocked migration reversibly, further supporting the identification of the chondroitin sulfate/dermatan sulfate proteoglycan as the active component in the urea extract. Much of the incorporated sulfate was distributed along the filopodia in 35 SO 4 -labelled PMC by autoradiography. The morphology of normal and treated S. purpuratus PMC was examined by scanning electron microscopy, and differences in spreading, particularly of the extensive filopodia present on the cells, was observed. A model for the role of the chondroitin sulfate/dermatan sulfate proteoglycan in cell detachment during migration is proposed

  12. Growth hormone-releasing factor induces c-fos expression in cultured primary pituitary cells

    DEFF Research Database (Denmark)

    Billestrup, Nils; Mitchell, R L; Vale, W

    1987-01-01

    GH-releasing factor (GRF) and somatostatin regulates the secretion and biosynthesis of GH as well as the proliferation of GH-producing cells. In order to further characterize the mitogenic effect of GRF, we studied the expression of the proto-oncogene c-fos in primary pituitary cells. Maximal...... induction of c-fos mRNA was observed 20-60 min after stimulation with 5 nM GRF, returning to basal levels after 2 h. Somatostatin-14 (5 nM) partially inhibited the GRF induced c-fos expression. Forskolin and phorbol 12, 13 dibutyrate induced c-fos gene in cultured primary pituitary cells with similar...

  13. Chemo-radioresistance of small cell lung cancer cell lines derived from untreated primary tumors obtained by diagnostic bronchofiberscopy

    International Nuclear Information System (INIS)

    Tanio, Yoshiro; Watanabe, Masatoshi; Inoue, Tamotsu

    1990-01-01

    New cell lines of small cell lung cancer (SCLC) were established from specimens of untreated primary tumors biopsied by diagnostic bronchofiberscopy. The advantage of this method was ease of obtaining specimens from lung tumors. Establishment of cell lines was successful with 4 of 13 specimens (30%). Clinical responses of the tumors showed considerable variation, but were well correlated with the in vitro sensitivity of the respective cell lines to chemotherapeutic drugs and irradiation. One of the cell lines was resistant to all drugs tested and irradiation, while another was sensitive to all of them. Although the acquired resistance of SCLC is the biggest problem in treatment, the natural resistance to therapy is another significant problem. Either acquired or natural, resistance mechanisms of SCLC may be elucidated by the use of such cell lines derived from untreated tumors. This method and these SCLC cell lines are expected to be useful for the serial study of biologic and genetic changes of untreated and pre-treated tumors, or primary and secondary tumors. (author)

  14. Dengue virus activates polyreactive, natural IgG B cells after primary and secondary infection.

    Directory of Open Access Journals (Sweden)

    Thavamalar Balakrishnan

    Full Text Available BACKGROUND: Dengue virus is transmitted by mosquitoes and has four serotypes. Cross-protection to other serotypes lasting for a few months is observed following infection with one serotype. There is evidence that low-affinity T and/or B cells from primary infections contribute to the severe syndromes often associated with secondary dengue infections. such pronounced immune-mediated enhancement suggests a dengue-specific pattern of immune cell activation. This study investigates the acute and early convalescent B cell response leading to the generation of cross-reactive and neutralizing antibodies following dengue infection. METHODOLOGY/PRINCIPAL FINDINGS: We assayed blood samples taken from dengue patients with primary or secondary infection during acute disease and convalescence and compared them to samples from patients presenting with non-dengue related fever. Dengue induced massive early plasmablast formation, which correlated with the appearance of polyclonal, cross-reactive IgG for both primary and secondary infection. Surprisingly, the contribution of IgG to the neutralizing titer 4-7 days after fever onset was more than 50% even after primary infection. CONCLUSIONS/SIGNIFICANCE: Poly-reactive and virus serotype cross-reactive IgG are an important component of the innate response in humans during both primary and secondary dengue infection, and "innate specificities" seem to constitute part of the adaptive response in dengue. While of potential importance for protection during secondary infection, cross-reactive B cells will also compete with highly neutralizing B cells and possibly interfere with their development.

  15. rhEPO Enhances Cellular Anti-oxidant Capacity to Protect Long-Term Cultured Aging Primary Nerve Cells.

    Science.gov (United States)

    Wang, Huqing; Fan, Jiaxin; Chen, Mengyi; Yao, Qingling; Gao, Zhen; Zhang, Guilian; Wu, Haiqin; Yu, Xiaorui

    2017-08-01

    Erythropoietin (EPO) may protect the nervous system of animals against aging damage, making it a potential anti-aging drug for the nervous system. However, experimental evidence from natural aging nerve cell models is lacking, and the efficacy of EPO and underlying mechanism of this effect warrant further study. Thus, the present study used long-term cultured primary nerve cells to successfully mimic the natural aging process of nerve cells. Starting on the 11th day of culture, cells were treated with different concentrations of recombinant human erythropoietin (rhEPO). Using double immunofluorescence labeling, we found that rhEPO significantly improved the morphology of long-term cultured primary nerve cells and increased the total number of long-term cultured primary cells. However, rhEPO did not improve the ratio of nerve cells. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to measure nerve cell activity and showed that rhEPO significantly improved the activity of long-term cultured primary nerve cells. Moreover, Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) double immunofluorescence labeling flow cytometry revealed that rhEPO reduced the apoptotic rate of long-term cultured primary nerve cells. Senescence-associated β-galactosidase (SA-β-gal) immunohistochemistry staining showed that rhEPO significantly reduced the aging rate of long-term cultured primary nerve cells. Immunochemistry revealed that rhEPO enhanced intracellular superoxide dismutase (SOD) activity and glutathione (GSH) abundance and reduced the intracellular malondialdehyde (MDA) level. In addition, this effect depended on the dose, was maximized at a dose of 100 U/ml and was more pronounced than that of vitamin E. In summary, this study finds that rhEPO protects long-term cultured primary nerve cells from aging in a dose-dependent manner. The mechanism of this effect may be associated with the enhancement of the intracellular anti

  16. Induced Pluripotent Stem Cells: A novel frontier in the study of human primary immunodeficiencies

    Science.gov (United States)

    Pessach, Itai M.; Ordovas-Montanes, Jose; Zhang, Shen-Ying; Casanova, Jean-Laurent; Giliani, Silvia; Gennery, Andrew R.; Al-Herz, Waleed; Manos, Philip D.; Schlaeger, Thorsten M.; Park, In-Hyun; Rucci, Francesca; Agarwal, Suneet; Mostoslavsky, Gustavo; Daley, George Q.; Notarangelo, Luigi D.

    2010-01-01

    Background The novel ability to epigenetically reprogram somatic cells into induced pluripotent stem cells through the exogenous expression of transcription promises to revolutionize the study of human diseases. Objective Here we report on the generation of 25 induced pluripotent stem cell lines from 6 patients with various forms of Primary Immunodeficiencies, affecting adaptive and/or innate immunity. Methods Patients’ dermal fibroblasts were reprogrammed by expression of four transcription factors, OCT4, SOX2, KLF4, and c-MYC using a single excisable polycistronic lentiviral vector. Results Induced pluripotent stem cells derived from patients with primary immunodeficiencies show a stemness profile that is comparable to that observed in human embryonic stem cells. Following in vitro differentiation into embryoid bodies, pluripotency of the patient-derived indiced pluripotent stem cells lines was demonstrated by expression of genes characteristic of each of the three embryonic layers. We have confirmed the patient-specific origin of the induced pluripotent stem cell lines, and ascertained maintenance of karyotypic integrity. Conclusion By providing a limitless source of diseased stem cells that can be differentiated into various cell types in vitro, the repository of induced pluripotent stem cell lines from patients with primary immunodeficiencies represents a unique resource to investigate the pathophysiology of hematopoietic and extra-hematopoietic manifestations of these diseases, and may assist in the development of novel therapeutic approaches based on gene correction. PMID:21185069

  17. Dedifferentiation of Human Primary Thyrocytes into Multilineage Progenitor Cells without Gene Introduction

    Science.gov (United States)

    Saenko, Vladimir; Suzuki, Masatoshi; Matsuse, Michiko; Ohtsuru, Akira; Kumagai, Atsushi; Uga, Tatsuya; Yano, Hiroshi; Nagayama, Yuji; Yamashita, Shunichi

    2011-01-01

    While identification and isolation of adult stem cells have potentially important implications, recent reports regarding dedifferentiation/reprogramming from differentiated cells have provided another clue to gain insight into source of tissue stem/progenitor cells. In this study, we developed a novel culture system to obtain dedifferentiated progenitor cells from normal human thyroid tissues. After enzymatic digestion, primary thyrocytes, expressing thyroglobulin, vimentin and cytokeratin-18, were cultured in a serum-free medium called SAGM. Although the vast majority of cells died, a small proportion (∼0.5%) survived and proliferated. During initial cell expansion, thyroglobulin/cytokeratin-18 expression was gradually declined in the proliferating cells. Moreover, sorted cells expressing thyroid peroxidase gave rise to proliferating clones in SAGM. These data suggest that those cells are derived from thyroid follicular cells or at least thyroid-committed cells. The SAGM-grown cells did not express any thyroid-specific genes. However, after four-week incubation with FBS and TSH, cytokeratin-18, thyroglobulin, TSH receptor, PAX8 and TTF1 expressions re-emerged. Moreover, surprisingly, the cells were capable of differentiating into neuronal or adipogenic lineage depending on differentiating conditions. In summary, we have developed a novel system to generate multilineage progenitor cells from normal human thyroid tissues. This seems to be achieved by dedifferentiation of thyroid follicular cells. The presently described culture system may be useful for regenerative medicine, but the primary importance will be as a tool to elucidate the mechanisms of thyroid diseases. PMID:21556376

  18. Global investigation of interleukin-1β signaling in primary β-cells using quantitative phosphoproteomics

    DEFF Research Database (Denmark)

    Engholm-Keller, Kasper; Størling, Joachim; Pociot, Flemming

    in β-cells by which this cytokine can modulate cell-matrix interactions during inflammation, a regulation shown in other cell types. Further data analysis is currently ongoing, and the collective results of the experiments will hopefully facilitate additional insights into the effect of IL-1β......Novel Aspect: Global phosphoproteomic analysis of cytokine signaling in primary β-cells Introduction The insulin-producing β-cells of the pancreatic islets of Langerhans are targeted by aberrant immune system responses in diabetes mellitus involving cytokines, especially interleukin-1β (IL-1 β......), which initiate apoptosis of the β-cells. As only limited amounts of primary β-cells can be isolated from model organisms like mouse and rat, global phosphoproteomic analysis of these signaling events by mass spectrometry has generally been unfeasible. We have therefore developed a strategy...

  19. Decreased expression of cell adhesion genes in cancer stem-like cells isolated from primary oral squamous cell carcinomas.

    Science.gov (United States)

    Mishra, Amrendra; Sriram, Harshini; Chandarana, Pinal; Tanavde, Vivek; Kumar, Rekha V; Gopinath, Ashok; Govindarajan, Raman; Ramaswamy, S; Sadasivam, Subhashini

    2018-05-01

    The goal of this study was to isolate cancer stem-like cells marked by high expression of CD44, a putative cancer stem cell marker, from primary oral squamous cell carcinomas and identify distinctive gene expression patterns in these cells. From 1 October 2013 to 4 September 2015, 76 stage III-IV primary oral squamous cell carcinoma of the gingivobuccal sulcus were resected. In all, 13 tumours were analysed by immunohistochemistry to visualise CD44-expressing cells. Expression of CD44 within The Cancer Genome Atlas-Head and Neck Squamous Cell Carcinoma RNA-sequencing data was also assessed. Seventy resected tumours were dissociated into single cells and stained with antibodies to CD44 as well as CD45 and CD31 (together referred as Lineage/Lin). From 45 of these, CD44 + Lin - and CD44 - Lin - subpopulations were successfully isolated using fluorescence-activated cell sorting, and good-quality RNA was obtained from 14 such sorted pairs. Libraries from five pairs were sequenced and the results analysed using bioinformatics tools. Reverse transcription quantitative polymerase chain reaction was performed to experimentally validate the differential expression of selected candidate genes identified from the transcriptome sequencing in the same 5 and an additional 9 tumours. CD44 was expressed on the surface of poorly differentiated tumour cells, and within the The Cancer Genome Atlas-Head and Neck Squamous Cell Carcinoma samples, its messenger RNA levels were higher in tumours compared to normal. Transcriptomics revealed that 102 genes were upregulated and 85 genes were downregulated in CD44 + Lin - compared to CD44 - Lin - cells in at least 3 of the 5 tumours sequenced. The upregulated genes included those involved in immune regulation, while the downregulated genes were enriched for genes involved in cell adhesion. Decreased expression of PCDH18, MGP, SPARCL1 and KRTDAP was confirmed by reverse transcription quantitative polymerase chain reaction. Lower expression of

  20. Phosphoinositide-3-Kinase Signaling in Human Natural Killer Cells: New Insights from Primary Immunodeficiency

    Directory of Open Access Journals (Sweden)

    Emily M. Mace

    2018-03-01

    Full Text Available Human natural killer (NK cells play a critical role in the control of viral infections and malignancy. Their importance in human health and disease is illustrated by severe viral infections in patients with primary immunodeficiencies that affect NK cell function and/or development. The recent identification of patients with phosphoinositide-3-kinase (PI3K-signaling pathway mutations that can cause primary immunodeficiency provides valuable insight into the role that PI3K signaling plays in human NK cell maturation and lytic function. There is a rich literature that demonstrates a requirement for PI3K in multiple key aspects of NK cell biology, including development/maturation, homing, priming, and function. Here, I briefly review these previous studies and place them in context with recent findings from the study of primary immunodeficiency patients, particularly those with hyperactivating mutations in PI3Kδ signaling.

  1. Aberrant TAL1 activation is mediated by an interchromosomal interaction in human T-cell acute lymphoblastic leukemia.

    Science.gov (United States)

    Patel, B; Kang, Y; Cui, K; Litt, M; Riberio, M S J; Deng, C; Salz, T; Casada, S; Fu, X; Qiu, Y; Zhao, K; Huang, S

    2014-02-01

    Long-range chromatin interactions control metazoan gene transcription. However, the involvement of intra- and interchromosomal interactions in development and oncogenesis remains unclear. TAL1/SCL is a critical transcription factor required for the development of all hematopoietic lineages; yet, aberrant TAL1 transcription often occurs in T-cell acute lymphoblastic leukemia (T-ALL). Here, we report that oncogenic TAL1 expression is regulated by different intra- and interchromosomal loops in normal hematopoietic and leukemic cells, respectively. These intra- and interchromosomal loops alter the cell-type-specific enhancers that interact with the TAL1 promoter. We show that human SET1 (hSET1)-mediated H3K4 methylations promote a long-range chromatin loop, which brings the +51 enhancer in close proximity to TAL1 promoter 1 in erythroid cells. The CCCTC-binding factor (CTCF) facilitates this long-range enhancer/promoter interaction of the TAL1 locus in erythroid cells while blocking the same enhancer/promoter interaction of the TAL1 locus in human T-cell leukemia. In human T-ALL, a T-cell-specific transcription factor c-Maf-mediated interchromosomal interaction brings the TAL1 promoter into close proximity with a T-cell-specific regulatory element located on chromosome 16, activating aberrant TAL1 oncogene expression. Thus, our study reveals a novel molecular mechanism involving changes in three-dimensional chromatin interactions that activate the TAL1 oncogene in human T-cell leukemia.

  2. Primary peritoneal clear cell carcinoma versus ovarian carcinoma versus malignant transformation of endometriosis: a vexing issue.

    Science.gov (United States)

    Insabato, Luigi; Natella, Valentina; Somma, Anna; Persico, Marcello; Camera, Luigi; Losito, Nunzia Simona; Masone, Stefania

    2015-05-01

    Peritoneum is a site for both primary and secondary tumors. Primary peritoneal tumors are fairly rare. The most common primary tumors of the peritoneum are malignant mesothelioma and serous papillary adenocarcinoma. Clear cell carcinoma of the peritoneum is extremely rare and often misdiagnosed as mesothelioma, serous carcinoma, or metastatic adenocarcinoma, so it represents a diagnostic challenge for both clinicians and pathologists. Up to date, to the best of our knowledge, only 11 cases of primary peritoneal clear cell carcinoma have been reported in the English literature. Distinguishing this tumor of the peritoneum versus ovarian carcinoma can be problematic. Herein, we report a rare case of primary peritoneal clear cell carcinoma occurring in a 49-year-old woman, along with a review of the literature. © The Author(s) 2015.

  3. Rat primary embryo fibroblast cells suppress transformation by the E6 and E7 genes of human papillomavirus type 16 in somatic hybrid cells.

    OpenAIRE

    Miyasaka, M; Takami, Y; Inoue, H; Hakura, A

    1991-01-01

    The E6 and E7 genes of human papillomavirus type 16 (HPV-16) transform established lines of rat cells but not rat cells in primary culture irrespective of the expression of the two genes. The reason for this difference between the susceptibilities of cell lines and primary cells was examined by using hybrid cells obtained by somatic cell fusion of rat cell lines transformed by the E6 and E7 genes of HPV-16 and freshly isolated rat embryo fibroblast cells. In these hybrid cells, transformed ph...

  4. Variation in pestivirus growth in testicle primary cell culture is more dependent on the individual cell donor than cattle breed.

    Science.gov (United States)

    Weber, Matheus N; Bauermann, Fernando V; Gómez-Romero, Ninnet; Herring, Andy D; Canal, Cláudio W; Neill, John D; Ridpath, Julia F

    2017-03-01

    The causes of bovine respiratory disease complex (BRDC) are multifactorial and include infection with both viral and bacterial pathogens. Host factors are also involved as different breeds of cattle appear to have different susceptibilities to BRDC. Infection with bovine pestiviruses, including bovine viral diarrhea virus 1 (BVDV1), BVDV2 and 'HoBi'-like viruses, is linked to the development of BRDC. The aim of the present study was to compare the growth of different bovine pestiviruses in primary testicle cell cultures obtained from taurine, indicine and mixed taurine and indicine cattle breeds. Primary cells strains, derived from testicular tissue, were generated from three animals from each breed. Bovine pestivirus strains used were from BVDV-1a, BVDV-1b, BVDV-2a and 'HoBi'-like virus. Growth was compared by determining virus titers after one passage in primary cells. All tests were run in triplicate. Virus titers were determined by endpoint dilution and RT-qPCR. Statistical analysis was performed using one way analysis of variance (ANOVA) followed by the Tukey's Multiple Comparison Test (P˂0.05). Significant differences in virus growth did not correlate with cattle breed. However, significant differences were observed between cells derived from different individuals regardless of breed. Variation in the replication of virus in primary cell strains may reflect a genetic predisposition that favors virus replication.

  5. Primary testicular diffuse large B-cell lymphoma: A case report

    Directory of Open Access Journals (Sweden)

    Muhammad Sadiq

    2017-12-01

    Full Text Available Primary testicular diffuse large-B cell lymphoma (DLBCL is an uncommon and aggressive disease with predominant manifestation in the older age. Herein, we report a case of 47-year-old male patient who presented with three months history of left testis swelling. The patient underwent unilateral (left radical orchiectomy. Histopathological examination revealed extensive involvement and replacement of testicular parenchyma by a tumor composed of large discohesive sheets of cells with pleomorphic, hyperchromatic nuclei and prominent nucleoli. Immunohistochemical (IHC staining showed reactivity for LCA & Pan B (CD20 and negativity for OCT 3/4, SALL4 and Inhibin. Moreover, Pan T (CD3 highlighted reactive T-cells. These features rendered the diagnosis of DLBCL of testis. The hybrid 2-[fluorine-18] fluoro-2-deoxy-d-glucose (FDG positron emission tomography/computed tomography (PET/CT demonstrated two para-aortic FDG avid lymph nodes on the left side at the level of L2 vertebra. Presently, the patient has been planned for doxorubicin-based chemotherapy (i.e., cyclophosphamide, doxorubicin, vincristine and prednisone; CHOP along with intrathecal Methroxate (MTX, which would presumably improve the prognosis. Our study would expand the pool of this uncommon tumor towards its better understanding. Keywords: Primary testicular lymphoma, Diffuse large-B cell lymphoma, Orchiectomy, Doxorubicin-based chemotherapy

  6. Hematopoietic Stem Cell Transplantation in Primary Immunodeficiency Patients in the Black Sea Region of Turkey

    Directory of Open Access Journals (Sweden)

    Alişan Yıldıran

    2017-12-01

    Full Text Available Hematopoietic stem cell transplantation is a promising curative therapy for many combined primary immunodeficiencies and phagocytic disorders. We retrospectively reviewed pediatric cases of patients diagnosed with primary immunodeficiencies and scheduled for hematopoietic stem cell transplantation. We identified 22 patients (median age, 6 months; age range, 1 month to 10 years with various diagnoses who received hematopoietic stem cell transplantation. The patient diagnoses included severe combined immunodeficiency (n=11, Chediak-Higashi syndrome (n=2, leukocyte adhesion deficiency (n=2, MHC class 2 deficiency (n=2, chronic granulomatous syndrome (n=2, hemophagocytic lymphohistiocytosis (n=1, Wiskott-Aldrich syndrome (n=1, and Omenn syndrome (n=1. Of the 22 patients, 7 received human leukocyte antigen-matched related hematopoietic stem cell transplantation, 12 received haploidentical hematopoietic stem cell transplantation, and 2 received matched unrelated hematopoietic stem cell transplantation. The results showed that 5 patients had graft failure. Fourteen patients survived, yielding an overall survival rate of 67%. Screening newborn infants for primary immunodeficiency diseases may result in timely administration of hematopoietic stem cell transplantation.

  7. Hematopoietic Stem Cell Transplantation in Primary Immunodeficiency Patients in the Black Sea Region of Turkey.

    Science.gov (United States)

    Yıldıran, Alişan; Çeliksoy, Mehmet Halil; Borte, Stephan; Güner, Şükrü Nail; Elli, Murat; Fışgın, Tunç; Özyürek, Emel; Sancak, Recep; Oğur, Gönül

    2017-12-01

    Hematopoietic stem cell transplantation is a promising curative therapy for many combined primary immunodeficiencies and phagocytic disorders. We retrospectively reviewed pediatric cases of patients diagnosed with primary immunodeficiencies and scheduled for hematopoietic stem cell transplantation. We identified 22 patients (median age, 6 months; age range, 1 month to 10 years) with various diagnoses who received hematopoietic stem cell transplantation. The patient diagnoses included severe combined immunodeficiency (n=11), Chediak-Higashi syndrome (n=2), leukocyte adhesion deficiency (n=2), MHC class 2 deficiency (n=2), chronic granulomatous syndrome (n=2), hemophagocytic lymphohistiocytosis (n=1), Wiskott-Aldrich syndrome (n=1), and Omenn syndrome (n=1). Of the 22 patients, 7 received human leukocyte antigen-matched related hematopoietic stem cell transplantation, 12 received haploidentical hematopoietic stem cell transplantation, and 2 received matched unrelated hematopoietic stem cell transplantation. The results showed that 5 patients had graft failure. Fourteen patients survived, yielding an overall survival rate of 67%. Screening newborn infants for primary immunodeficiency diseases may result in timely administration of hematopoietic stem cell transplantation.

  8. Cellular Microenvironment Dictates Androgen Production by Murine Fetal Leydig Cells in Primary Culture1

    Science.gov (United States)

    Carney, Colleen M.; Muszynski, Jessica L.; Strotman, Lindsay N.; Lewis, Samantha R.; O'Connell, Rachel L.; Beebe, David J.; Theberge, Ashleigh B.; Jorgensen, Joan S.

    2014-01-01

    ABSTRACT Despite the fact that fetal Leydig cells are recognized as the primary source of androgens in male embryos, the mechanisms by which steroidogenesis occurs within the developing testis remain unclear. A genetic approach was used to visualize and isolate fetal Leydig cells from remaining cells within developing mouse testes. Cyp11a1-Cre mice were bred to mT/mG dual reporter mice to target membrane-tagged enhanced green fluorescent protein (GFP) within steroidogenic cells, whereas other cells expressed membrane-tagged tandem-dimer tomato red. Fetal Leydig cell identity was validated using double-labeled immunohistochemistry against GFP and the steroidogenic enzyme 3beta-HSD, and cells were successfully isolated as indicated by qPCR results from sorted cell populations. Because fetal Leydig cells must collaborate with neighboring cells to synthesize testosterone, we hypothesized that the fetal Leydig cell microenvironment defined their capacity for androgen production. Microfluidic culture devices were used to measure androstenedione and testosterone production of fetal Leydig cells that were cultured in cell-cell contact within a mixed population, were isolated but remained in medium contact via compartmentalized co-culture with other testicular cells, or were isolated and cultured alone. Results showed that fetal Leydig cells maintained their identity and steroidogenic activity for 3–5 days in primary culture. Microenvironment dictated proficiency of testosterone production. As expected, fetal Leydig cells produced androstenedione but not testosterone when cultured in isolation. More testosterone accumulated in medium from mixed cultures than from compartmentalized co-cultures initially; however, co-cultures maintained testosterone synthesis for a longer time. These data suggest that a combination of cell-cell contact and soluble factors constitute the ideal microenvironment for fetal Leydig cell activity in primary culture. PMID:25143354

  9. Evaluation of high-energy lithium thionyl chloride primary cells

    Science.gov (United States)

    Frank, H. A.

    1980-02-01

    An advanced commercial primary lithium cell (LiSoCl2) was evaluated in order to establish baseline data for improved lithium batteries for aerospace applications. The cell tested had nominal capacity of 6 Ah. Maximum energy density at low rates (less than C/30, where C is the cell capacity in amp-hrs and 30 corresponds to a 30 hr discharge time) was found to be near 300 Wh/kg. An equation which predicts the operating voltage of these cells as a function of current and state of charge is presented. Heat generation rates of these cells were determined as a function of current in a calorimeter. It was found that heat rates could be theoretically predicted with some degree of accuracy at currents less than 1 amp or the C/6 rate. No explosions were observed in the cells during the condition of overdischarge or reversal nor during high rate discharge. It was found, however, that the cells can vent when overdischarge currents are greater than C/30 and when discharge rates are greater than 1.5C.

  10. A case with primary signet ring cell adenocarcinoma of the prostate and review of the literature

    Directory of Open Access Journals (Sweden)

    Orcun Celik

    2014-06-01

    Full Text Available Primary signet cell carcinoma of the prostate is a rare histological variant of prostate malignancies. It is commonly originated from the stomach, colon, pancreas, and less commonly in the bladder. Prognosis of the classical type is worse than the adenocarcinoma of the prostate. Primary signet cell adenocarcinoma is diagnosed by eliminating the adenocarcinomas of other organs such as gastrointestinal tract organs. In this case report, we present a case with primary signet cell adenocarcinoma of the prostate who received docetaxel chemotherapy because of short prostate specific antigen doubling time.

  11. Automatic detection and quantitative analysis of cells in the mouse primary motor cortex

    Science.gov (United States)

    Meng, Yunlong; He, Yong; Wu, Jingpeng; Chen, Shangbin; Li, Anan; Gong, Hui

    2014-09-01

    Neuronal cells play very important role on metabolism regulation and mechanism control, so cell number is a fundamental determinant of brain function. Combined suitable cell-labeling approaches with recently proposed three-dimensional optical imaging techniques, whole mouse brain coronal sections can be acquired with 1-μm voxel resolution. We have developed a completely automatic pipeline to perform cell centroids detection, and provided three-dimensional quantitative information of cells in the primary motor cortex of C57BL/6 mouse. It involves four principal steps: i) preprocessing; ii) image binarization; iii) cell centroids extraction and contour segmentation; iv) laminar density estimation. Investigations on the presented method reveal promising detection accuracy in terms of recall and precision, with average recall rate 92.1% and average precision rate 86.2%. We also analyze laminar density distribution of cells from pial surface to corpus callosum from the output vectorizations of detected cell centroids in mouse primary motor cortex, and find significant cellular density distribution variations in different layers. This automatic cell centroids detection approach will be beneficial for fast cell-counting and accurate density estimation, as time-consuming and error-prone manual identification is avoided.

  12. Renal cell carcinoma primary cultures maintain genomic and phenotypic profile of parental tumor tissues

    International Nuclear Information System (INIS)

    Cifola, Ingrid; Magni, Fulvio; Signorini, Stefano; Battaglia, Cristina; Perego, Roberto A; Bianchi, Cristina; Mangano, Eleonora; Bombelli, Silvia; Frascati, Fabio; Fasoli, Ester; Ferrero, Stefano; Di Stefano, Vitalba; Zipeto, Maria A

    2011-01-01

    Clear cell renal cell carcinoma (ccRCC) is characterized by recurrent copy number alterations (CNAs) and loss of heterozygosity (LOH), which may have potential diagnostic and prognostic applications. Here, we explored whether ccRCC primary cultures, established from surgical tumor specimens, maintain the DNA profile of parental tumor tissues allowing a more confident CNAs and LOH discrimination with respect to the original tissues. We established a collection of 9 phenotypically well-characterized ccRCC primary cell cultures. Using the Affymetrix SNP array technology, we performed the genome-wide copy number (CN) profiling of both cultures and corresponding tumor tissues. Global concordance for each culture/tissue pair was assayed evaluating the correlations between whole-genome CN profiles and SNP allelic calls. CN analysis was performed using the two CNAG v3.0 and Partek software, and comparing results returned by two different algorithms (Hidden Markov Model and Genomic Segmentation). A very good overlap between the CNAs of each culture and corresponding tissue was observed. The finding, reinforced by high whole-genome CN correlations and SNP call concordances, provided evidence that each culture was derived from its corresponding tissue and maintained the genomic alterations of parental tumor. In addition, primary culture DNA profile remained stable for at least 3 weeks, till to third passage. These cultures showed a greater cell homogeneity and enrichment in tumor component than original tissues, thus enabling a better discrimination of CNAs and LOH. Especially for hemizygous deletions, primary cultures presented more evident CN losses, typically accompanied by LOH; differently, in original tissues the intensity of these deletions was weaken by normal cell contamination and LOH calls were missed. ccRCC primary cultures are a reliable in vitro model, well-reproducing original tumor genetics and phenotype, potentially useful for future functional approaches

  13. Elimination of clonogenic tumor cells from HL-60, Daudi, and U-937 cell lines by laser photoradiation therapy: implications for autologous bone marrow purging

    International Nuclear Information System (INIS)

    Gulliya, K.S.; Pervaiz, S.

    1989-01-01

    Laser photoradiation therapy was tested in an in vitro model for its efficacy in the elimination of non-Hodgkin's lymphoma cells. Results show that at 31.2 J/cm2 of laser light in the presence of 20 micrograms/mL of merocyanine 540 (MC540) there was greater than 5 log reduction in Burkitt's lymphoma (Daudi) cells. Similar tumor cell kill was obtained for leukemia (HL-60) cells at a laser light dose of 93.6 J/cm2. However, to obtain the same efficiency of killing for histiocytic lymphoma (U-937) cells, a higher dose of MC540 (25 micrograms/mL) was required. Clonogenic tumor stem cell colony formation was reduced by greater than 5 logs after laser photoradiation therapy. Under identical conditions for each cell line the percent survival for granulocyte-macrophage colony-forming units (CFU-GM, 45.9%, 40%, 17.5%), granulocyte/erythroid/macrophage/megakaryocyte (GEMM, 40.1%, 20.1%, 11.5%), colony-forming units (CFU-C, 16.2%, 9.1%, 1.8%), and erythroid burst-forming units (BFU-E, 33.4%, 17.8%, 3.9%) was significantly higher than the tumor cells. Mixing of gamma ray-irradiated normal marrow cells with tumor cells (1:1 and 10:1 ratio) did not interfere with the elimination of tumor cells. The effect of highly purified recombinant interferon alpha (rIFN) on laser photoradiation therapy of tumor cells was also investigated. In the presence of rIFN (30 to 3,000 U/mL), the viability of leukemic cells was observed to increase from 0% to 1.5% with a concurrent decrease in membrane polarization, suggesting an increase in fluidity of cell membrane in response to rIFN. However, at higher doses of rIFN (6,000 to 12,000 U/mL) this phenomenon was not observed. The viability of lymphoma cells remained unaffected at all doses of rIFN tested

  14. Primary culture of glial cells from mouse sympathetic cervical ganglion: a valuable tool for studying glial cell biology.

    Science.gov (United States)

    de Almeida-Leite, Camila Megale; Arantes, Rosa Maria Esteves

    2010-12-15

    Central nervous system glial cells as astrocytes and microglia have been investigated in vitro and many intracellular pathways have been clarified upon various stimuli. Peripheral glial cells, however, are not as deeply investigated in vitro despite its importance role in inflammatory and neurodegenerative diseases. Based on our previous experience of culturing neuronal cells, our objective was to standardize and morphologically characterize a primary culture of mouse superior cervical ganglion glial cells in order to obtain a useful tool to study peripheral glial cell biology. Superior cervical ganglia from neonatal C57BL6 mice were enzymatically and mechanically dissociated and cells were plated on diluted Matrigel coated wells in a final concentration of 10,000cells/well. Five to 8 days post plating, glial cell cultures were fixed for morphological and immunocytochemical characterization. Glial cells showed a flat and irregular shape, two or three long cytoplasm processes, and round, oval or long shaped nuclei, with regular outline. Cell proliferation and mitosis were detected both qualitative and quantitatively. Glial cells were able to maintain their phenotype in our culture model including immunoreactivity against glial cell marker GFAP. This is the first description of immunocytochemical characterization of mouse sympathetic cervical ganglion glial cells in primary culture. This work discusses the uses and limitations of our model as a tool to study many aspects of peripheral glial cell biology. Copyright © 2010 Elsevier B.V. All rights reserved.

  15. Primary cutaneous anaplastic large cell lymphoma masquerading as large pyogenic granuloma

    Directory of Open Access Journals (Sweden)

    Anupama Bains

    2016-01-01

    Full Text Available Primary cutaneous anaplastic large cell lymphoma (pcALCL forms 9% of the cutaneous T-cell lymphomas. It usually presents as solitary reddish brown ulcerating nodule or indurated plaque. Sometimes, it mimics other dermatological diseases such as eczema, pyoderma gangrenosum, pyogenic granuloma, morphea, and squamous cell carcinoma. Our case presented with large pyogenic granuloma like lesion with regional lymphadenopathy. Since pcALCL is rare, one can misdiagnose such cases and therefore high index of suspicion is necessary.

  16. The Effect of VPA on Increasing Radiosensitivity in Osteosarcoma Cells and Primary-Culture Cells from Chemical Carcinogen-Induced Breast Cancer in Rats.

    Science.gov (United States)

    Liu, Guochao; Wang, Hui; Zhang, Fengmei; Tian, Youjia; Tian, Zhujun; Cai, Zuchao; Lim, David; Feng, Zhihui

    2017-05-10

    This study explored whether valproic acid (VPA, a histone deacetylase inhibitor) could radiosensitize osteosarcoma and primary-culture tumor cells, and determined the mechanism of VPA-induced radiosensitization. The working system included osteosarcoma cells (U2OS) and primary-culture cells from chemical carcinogen (DMBA)-induced breast cancer in rats; and clonogenic survival, immunofluorescence, fluorescent in situ hybridization (FISH) for chromosome aberrations, and comet assays were used in this study. It was found that VPA at the safe or critical safe concentration of 0.5 or 1.0 mM VPA could result in the accumulation of more ionizing radiation (IR)-induced DNA double strand breaks, and increase the cell radiosensitivity. VPA-induced radiosensitivity was associated with the inhibition of DNA repair activity in the working systems. In addition, the chromosome aberrations including chromosome breaks, chromatid breaks, and radial structures significantly increased after the combination treatment of VPA and IR. Importantly, the results obtained by primary-culture cells from the tissue of chemical carcinogen-induced breast cancer in rats further confirmed our findings. The data in this study demonstrated that VPA at a safe dose was a radiosensitizer for osteosarcoma and primary-culture tumor cells through suppressing DNA-double strand breaks repair function.

  17. Lithium treatment elongates primary cilia in the mouse brain and in cultured cells

    Energy Technology Data Exchange (ETDEWEB)

    Miyoshi, Ko, E-mail: miyoshi@cc.okayama-u.ac.jp [Department of Brain Science, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikatacho, Okayama 700-8558 (Japan); Kasahara, Kyosuke; Miyazaki, Ikuko; Asanuma, Masato [Department of Brain Science, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, 2-5-1 Shikatacho, Okayama 700-8558 (Japan)

    2009-10-30

    The molecular mechanisms underlying the therapeutic effects of lithium, a first-line antimanic mood stabilizer, have not yet been fully elucidated. Treatment of the algae Chlamydomonas reinhardtii with lithium has been shown to induce elongation of their flagella, which are analogous structures to vertebrate cilia. In the mouse brain, adenylyl cyclase 3 (AC3) and certain neuropeptide receptors colocalize to the primary cilium of neuronal cells, suggesting a chemosensory function for the primary cilium in the nervous system. Here we show that lithium treatment elongates primary cilia in the mouse brain and in cultured cells. Brain sections from mice chronically fed with Li{sub 2}CO{sub 3} were subjected to immunofluorescence study. Primary cilia carrying both AC3 and the receptor for melanin-concentrating hormone (MCH) were elongated in the dorsal striatum and nucleus accumbens of lithium-fed mice, as compared to those of control animals. Moreover, lithium-treated NIH3T3 cells and cultured striatal neurons exhibited elongation of the primary cilia. The present results provide initial evidence that a psychotropic agent can affect ciliary length in the central nervous system, and furthermore suggest that lithium exerts its therapeutic effects via the upregulation of cilia-mediated MCH sensing. These findings thus contribute novel insights into the pathophysiology of bipolar mood disorder and other psychiatric diseases.

  18. Lithium treatment elongates primary cilia in the mouse brain and in cultured cells

    International Nuclear Information System (INIS)

    Miyoshi, Ko; Kasahara, Kyosuke; Miyazaki, Ikuko; Asanuma, Masato

    2009-01-01

    The molecular mechanisms underlying the therapeutic effects of lithium, a first-line antimanic mood stabilizer, have not yet been fully elucidated. Treatment of the algae Chlamydomonas reinhardtii with lithium has been shown to induce elongation of their flagella, which are analogous structures to vertebrate cilia. In the mouse brain, adenylyl cyclase 3 (AC3) and certain neuropeptide receptors colocalize to the primary cilium of neuronal cells, suggesting a chemosensory function for the primary cilium in the nervous system. Here we show that lithium treatment elongates primary cilia in the mouse brain and in cultured cells. Brain sections from mice chronically fed with Li 2 CO 3 were subjected to immunofluorescence study. Primary cilia carrying both AC3 and the receptor for melanin-concentrating hormone (MCH) were elongated in the dorsal striatum and nucleus accumbens of lithium-fed mice, as compared to those of control animals. Moreover, lithium-treated NIH3T3 cells and cultured striatal neurons exhibited elongation of the primary cilia. The present results provide initial evidence that a psychotropic agent can affect ciliary length in the central nervous system, and furthermore suggest that lithium exerts its therapeutic effects via the upregulation of cilia-mediated MCH sensing. These findings thus contribute novel insights into the pathophysiology of bipolar mood disorder and other psychiatric diseases.

  19. Rh antigen expression during erythropoeisis: Comparison of cord and adult derived CD34 + cells

    Directory of Open Access Journals (Sweden)

    Gupta Namita

    2008-01-01

    Full Text Available Objectives: Concentrations of O 2 and CO 2 in the fetal circulation differ to that in maternal blood. Previous studies done in algae demonstrate the functional role of Rh antigen as CO 2 transporter. As a preliminary study, it was the aim of this project to compare the expression of Rh polypeptides on cord and adult red blood cell progenitors during ex vivo proliferation and differentiation of CD34 + cells during erythropoeisis. Materials and Methods: CD34 positive hematopoeitic progenitor cells were isolated from umbilical cord blood and adult peripheral blood using an immunomagnetic system and cultured in serum free medium containing erythropoietin in order to compel them along the erythroid lineage. Cultured cells were analyzed for cell surface marker expression by flow cytometry, using monoclonal antibodies to RhAG, Glycophorin A, Rh polypeptides, CD47 and Band 3. Cytospin analysis was also done to study the morphology of cultured cells. Results: The appearance of cell surface markers analyzed on different days of culture varied slightly between samples. There was no evidence to suggest that RhAG, GPA, CD47 and Band 3 expression was any different between adult and cord derived cells. Nevertheless, the results of Rh antigenic expression suggest a reasonable difference between the two groups with adult sample derived cells showing higher and earlier expression than cord blood derived cells. These preliminary findings require further investigation. Conclusion: Comparing the expression of cell surface markers especially Rh polypeptides between adult and cord blood derived erythroid progenitors might assist in discerning their functions and could be valuable in the study of erythropoeisis.

  20. Transcriptional and Cell Cycle Alterations Mark Aging of Primary Human Adipose-Derived Stem Cells.

    Science.gov (United States)

    Shan, Xiaoyin; Roberts, Cleresa; Kim, Eun Ji; Brenner, Ariana; Grant, Gregory; Percec, Ivona

    2017-05-01

    Adult stem cells play a critical role in the maintenance of tissue homeostasis and prevention of aging. While the regenerative potential of stem cells with low cellular turnover, such as adipose-derived stem cells (ASCs), is increasingly recognized, the study of chronological aging in ASCs is technically difficult and remains poorly understood. Here, we use our model of chronological aging in primary human ASCs to examine genome-wide transcriptional networks. We demonstrate first that the transcriptome of aging ASCs is distinctly more stable than that of age-matched fibroblasts, and further, that age-dependent modifications in cell cycle progression and translation initiation specifically characterize aging ASCs in conjunction with increased nascent protein synthesis and a distinctly shortened G1 phase. Our results reveal novel chronological aging mechanisms in ASCs that are inherently different from differentiated cells and that may reflect an organismal attempt to meet the increased demands of tissue and organ homeostasis during aging. Stem Cells 2017;35:1392-1401. © 2017 AlphaMed Press.

  1. Increased risk of gastric adenocarcinoma after treatment of primary gastric diffuse large B-cell lymphoma

    International Nuclear Information System (INIS)

    Inaba, Koji; Morota, Madoka; Mayahara, Hiroshi; Ito, Yoshinori; Sumi, Minako; Uno, Takashi; Itami, Jun; Kushima, Ryoji; Murakami, Naoya; Kuroda, Yuuki; Harada, Ken; Kitaguchi, Mayuka; Yoshio, Kotaro; Sekii, Shuhei; Takahashi, Kana

    2013-01-01

    There have been sporadic reports about synchronous as well as metachronous gastric adenocarcinoma and primary gastric lymphoma. Many reports have dealt with metachronous gastric adenocarcinoma in mucosa-associated lymphoid tissue lymphoma of stomach. But to our knowledge, there have been no reports that document the increased incidence of metachronous gastric adenocarcinoma in patients with gastric diffuse large B-cell lymphoma. This retrospective study was conducted to estimate the incidence of metachronous gastric adenocarcinoma after primary gastric lymphoma treatment, especially in diffuse large B-cell lymphoma. The retrospective cohort study of 139 primary gastric lymphoma patients treated with radiotherapy at our hospital. Mean observation period was 61.5 months (range: 3.7-124.6 months). Patients profile, characteristics of primary gastric lymphoma and metachronous gastric adenocarcinoma were retrieved from medical records. The risk of metachronous gastric adenocarcinoma was compared with the risk of gastric adenocarcinoma in Japanese population. There were 10 (7.2%) metachronous gastric adenocarcinoma patients after treatment of primary gastric lymphomas. It was quite high risk compared with the risk of gastric carcinoma in Japanese population of 54.7/100,000. Seven patients of 10 were diffuse large B-cell lymphoma and other 3 patients were mixed type of diffuse large B-cell lymphoma and mucosa associated lymphoid tissue lymphoma. Four patients of 10 metachronous gastric adenocarcinomas were signet-ring cell carcinoma and two patients died of gastric adenocarcinoma. Metachronous gastric adenocarcinoma may have a more malignant potential than sporadic gastric adenocarcinoma. Old age, Helicobacter pylori infection and gastric mucosal change of chronic gastritis and intestinal metaplasia were possible risk factors for metachronous gastric adenocarcinoma. There was an increased risk of gastric adenocarcinoma after treatment of primary gastric lymphoma

  2. Primary Endometrial Squamous Cell Carcinoma In Situ; Report of a rare disease

    Directory of Open Access Journals (Sweden)

    Sujata Jetley

    2015-11-01

    Full Text Available Squamous cell carcinoma (SCC of the endometrium, whether primary or secondary to cervical cancer, is a rare entity. Primary endometrial squamous cell carcinoma in situ is even more uncommon; it usually occurs in postmenopausal women and has a strong association with pyometra. We report a 60-year-old multiparous postmenopausal woman who presented to the Hakeem Abdul Hameed Centenary Hospital, New Delhi, India, in May 2014 with a lower abdominal swelling corresponding in size to a pregnancy of 26 gestational weeks and vaginal discharge of one year’s duration. A total abdominal hysterectomy with a bilateral salpingooophorectomy was performed, which revealed an enlarged uterus with pyometra. Histopathology showed that the entire endometrial lining had been replaced with malignant squamous cells without invasion of the myometrium. Immunohistochemistry revealed that the tumour cells were positive for p63 with a high Ki-67 labelling index. No adjuvant therapy was required and the patient was disease-free at a seven-month follow-up.

  3. Primary Endometrial Squamous Cell Carcinoma In Situ: Report of a rare disease.

    Science.gov (United States)

    Jetley, Sujata; Jairajpuri, Zeeba S; Hassan, Mohammad J; Madaan, Garima; Jain, Reena

    2015-11-01

    Squamous cell carcinoma (SCC) of the endometrium, whether primary or secondary to cervical cancer, is a rare entity. Primary endometrial squamous cell carcinoma in situ is even more uncommon; it usually occurs in postmenopausal women and has a strong association with pyometra. We report a 60-year-old multiparous postmenopausal woman who presented to the Hakeem Abdul Hameed Centenary Hospital, New Delhi, India, in May 2014 with a lower abdominal swelling corresponding in size to a pregnancy of 26 gestational weeks and vaginal discharge of one year's duration. A total abdominal hysterectomy with a bilateral salpingooophorectomy was performed, which revealed an enlarged uterus with pyometra. Histopathology showed that the entire endometrial lining had been replaced with malignant squamous cells without invasion of the myometrium. Immunohistochemistry revealed that the tumour cells were positive for p63 with a high Ki-67 labelling index. No adjuvant therapy was required and the patient was disease-free at a seven-month follow-up.

  4. Relationship between Ga-67 uptake and radiotherapeutic response of primary lung cancer (squamous cell carcinoma)

    International Nuclear Information System (INIS)

    Higashi, Kotaro; Takase, Shuko; Ohguchi, Manabu; Seki, Hiroyasu; Okimura, Tetsuro; Miyamura, Toshio; Yamamoto, Itaru; Rikimaru, Shigeho.

    1992-01-01

    This investigation was undertaken to evaluate the relationship between Ga-67 uptake and radiotherapeutic response of primary lung cancer (squamous cell carcinoma), Ga-67 uptake of tumor was estimated on 16 patients with untreated primary lung cancer (squamous cell carcinoma). Ga-67 uptake was then compared with the response to radiation therapy (tumor reduction ratio). There was statistically significant inverse correlation between Ga-67 uptake and response to radiation therapy (r=-0.701, p<0.01). The fewer the Ga-67 accumulation in the tumor, the more effective radiotherapy in reducing tumor size. In conclusion, Ga-67 scintigraphy appears to be able to predict the response of primary lung cancer (squamous cell carcinoma) to radiation therapy. (author)

  5. The separation of a mixture of bone marrow stem cells from tumor cells: an essential step for autologous bone marrow transplantation

    International Nuclear Information System (INIS)

    Rubin, P.; Wheeler, K.T.; Keng, P.C.; Gregory, P.K.; Croizat, H.

    1981-01-01

    KHT tumor cells were mixed with mouse bone marrow to simulate a sample of bone marrow containing metastatic tumor cells. This mixture was separated into a bone marrow fraction and a tumor cell fraction by centrifugal elutriation. Elutriation did not change the transplantability of the bone marrow stem cells as measured by a spleen colony assay and an in vitro erythroid burst forming unit assay. The tumorogenicity of the KHT cells was similarly unaffected by elutriation. The data showed that bone marrow cells could be purified to less than 1 tumor cell in more than 10 6 bone marrow cells. Therefore, purification of bone marrow removed prior to lethal radiation-drug combined therapy for subsequent autologous transplantation appears to be feasible using modifications of this method if similar physical differences between human metastatic tumor cells and human bone marrow cells exist. This possibility is presently being explored

  6. Primary NK/T cell lymphoma nasal type of the stomach with skin involvement: a case report

    Directory of Open Access Journals (Sweden)

    Sebastian Kobold

    2009-12-01

    Full Text Available Since nasal NK/T cell lymphoma and NK/T cell lymphoma nasal type are rare diseases, gastric involvement has seldom been seen. We report a unique case of a patient with a primary NK/T cell lymphoma nasal type of the stomach with skin involvement. The patient had no history of malignant diseases and was diagnosed with hematemesis and intense bleeding from his gastric primary site. Shortly after this event, exanthemic skin lesions appeared with concordant histology to the primary site. Despite chemotherapy, the patient died one month after the first symptomatic appearance of disease.

  7. A rare case of primary clear cell sarcoma of the pubic bone resembling small round cell tumor: an unusual morphological variant

    International Nuclear Information System (INIS)

    Nakayama, Shoko; Tsuji, Motomu; Hanafusa, Toshiaki; Yokote, Taiji; Iwaki, Kazuki; Akioka, Toshikazu; Miyoshi, Takuji; Hirata, Yuji; Takayama, Ayami; Nishiwaki, Uta; Masuda, Yuki

    2012-01-01

    Clear cell sarcoma (CCS) and malignant melanoma share overlapping immunohistochemistry with regard to the melanocytic markers HMB45, S100, and Melan-A. However, the translocation t(12; 22)(q13; q12) is specific to CCS. Therefore, although these neoplasms are closely related, they are now considered to be distinct entities. However, the translocation is apparently detectable only in 50%–70% of CCS cases. Therefore, the absence of a detectable EWS/AFT1 rearrangement may occasionally lead to erroneous exclusion of a translocation-negative CCS. Therefore, histological assessment is essential for the correct diagnosis of CCS. Primary CCS of the bone is exceedingly rare. Only a few cases of primary CCS arising in the ulna, metatarsals, ribs, radius, sacrum, and humerus have been reported, and primary CCS arising in the pubic bone has not been reported till date. We present the case of an 81-year-old man with primary CCS of the pubic bone. Histological examination of the pubic bone revealed monomorphic small-sized cells arranged predominantly as a diffuse sheet with round, hyperchromatic nuclei and inconspicuous nucleoli. The cells had scant cytoplasm, and the biopsy findings indicated small round cell tumor (SRCT). Immunohistochemical staining revealed the tumor cells to be positive for HMB45, S100, and Melan-A but negative for cytokeratin (AE1/AE3) and epithelial membrane antigen. To the best of our knowledge, this is the first case report of primary CCS of the pubic bone resembling SRCT. This ambiguous appearance underscores the difficulties encountered during the histological diagnosis of this rare variant of CCS. Awareness of primary CCS of the bone is clinically important for accurate diagnosis and management when the tumor is located in unusual locations such as the pubic bone and when the translocation t(12; 22)(q13; q12) is absent

  8. Primary cutaneous large B-cell lymphoma of scalp: Case report of a rare variant

    Directory of Open Access Journals (Sweden)

    Yasmeen Khatib

    2017-01-01

    Full Text Available Primary cutaneous large B-cell lymphoma (Bcl is defined as a lymphoma composed of large cells constituting more than 80% of the infiltrate and absence of extracutaneous involvement after staging investigations. In the new World Health Organization/European Organization for Research and Treatment of Cancer classification, cutaneous Bcls with large cells are of three types - primary cutaneous large Bcl leg type (PCLBCLLT, primary cutaneous follicle center lymphoma diffuse type (PCFCLDT, and primary cutaneous large Bcls other (PCLBCLO. These three different types are distinct in terms of their clinicopathological features and survival. The PCLBCLO has intermediate features between those of PCLBCLLT and PCFCLDT. We present a case of PCLBCLO in a 57-year-old male who presented with a scalp swelling. Ultrasonography examination was suggestive of a sebaceous cyst. Computed tomography scan revealed the presence of an ill-defined hyperdense region in the soft tissue of the scalp region extending into the deeper layers of the scalp. Fine-needle aspiration cytology (FNAC revealed the presence of atypical lymphoid cells. Diagnosis was confirmed by biopsy and immunohistochemistry. Patient received rituximab combined with doxorubicin, vincristine, cyclophosphamide, and prednisolone regimen with complete resolution of the lesion. We present this case for its rarity, the utility of FNAC in early diagnosis, and to discuss the differential diagnosis.

  9. Primary Germ Cell Tumors of the Mediastinum: 10 Years of Experience in a Tertiary Teaching Hospital

    Directory of Open Access Journals (Sweden)

    Chih-Jen Yang

    2005-09-01

    Full Text Available Germ cell tumors occur mostly in the gonad. Extragonadal germ cell tumors are rare, and most occur in the retroperitoneum and mediastinum. Primary mediastinal germ cell tumors are often found in the anterior portion of the mediastinum and include teratomas and non-teratomatous tumors. Non-teratomatous tumors include seminomas and malignant non-seminomatous germ cell tumors (MNSGCTs. MNSGCTs include yolk sac tumors, choriocarcinomas, embryonal carcinomas, and mixed type germ cell tumors. Teratomas are the most common germ cell tumors of the mediastinum, and seminomas are the most common non-teratomatous germ cell tumors of the mediastinum. Cases of primary mediastinal MNSGCT reported in the literature are rare. In this report, we review all primary mediastinal germ cell tumors from a 10-year period at the Chung-Ho Memorial Hospital of Kaohsiung Medical University. A total of 14 cases were reviewed, including 11 patients with mature teratomas, two with yolk sac tumors, and one with seminoma. We discuss the differences in clinical presentation, histopathologic characteristics, treatment, and prognosis.

  10. Identification of cancer stem-like side population cells in purified primary cultured human laryngeal squamous cell carcinoma epithelia.

    Directory of Open Access Journals (Sweden)

    Chun-Ping Wu

    Full Text Available Cancer stem-like side population (SP cells have been identified in many solid tumors; however, most of these investigations are performed using established cancer cell lines. Cancer cells in tumor tissue containing fibroblasts and many other types of cells are much more complex than any cancer cell line. Although SP cells were identified in the laryngeal squamous cell carcinoma (LSCC cell line Hep-2 in our pilot study, it is unknown whether the LSCC tissue contains SP cells. In this study, LSCC cells (LSCCs were primary cultured and purified from a surgically resected LSCC specimen derived from a well-differentiated epiglottic neoplasm of a Chinese male. This was followed by the verification of epithelium-specific characteristics, such as ultrastructure and biomarkers. A distinct SP subpopulation (4.45±1.07% was isolated by Hoechst 33342 efflux analysis from cultured LSCCs by using a flow cytometer. Cancer stem cell (CSC-associated assays, including expression of self-renewal and CSC marker genes, proliferation, differentiation, spheroid formation, chemotherapy resistance, and tumorigenicity were then conducted between SP and non-SP (NSP LSCCs. In vitro and in vivo assays revealed that SP cells manifested preferential expression of self-renewal and CSC marker genes, higher capacity for proliferation, differentiation, and spheroid formation; enhanced resistance to chemotherapy; and greater xenograft tumorigenicity in immunodeficient mice compared with NSP cells. These findings suggest that the primary cultured and purified LSCCs contain cancer stem-like SP cells, which may serve as a valuable model for CSC research in LSCC.

  11. Enhanced transduction and replication of RGD-fiber modified adenovirus in primary T cells.

    Directory of Open Access Journals (Sweden)

    Sadhak Sengupta

    2011-03-01

    Full Text Available Adenoviruses are often used as vehicles to mediate gene delivery for therapeutic purposes, but their research scope in hematological cells remains limited due to a narrow choice of host cells that express the adenoviral receptor (CAR. T cells, which are attractive targets for gene therapy of numerous diseases, remain resistant to adenoviral infection because of the absence of CAR expression. Here, we demonstrate that this resistance can be overcome when murine or human T cells are transduced with an adenovirus incorporating the RGD-fiber modification (Ad-RGD.A luciferase-expressing replication-deficient Ad-RGD infected 3-fold higher number of activated primary T cells than an adenovirus lacking the RGD-fiber modification in vitro. Infection with replication-competent Ad-RGD virus also caused increased cell cycling, higher E1A copy number and enriched hexon antigen expression in both human and murine T cells. Transduction with oncolytic Ad-RGD also resulted in higher titers of progeny virus and enhanced the killing of T cells. In vivo, 35-45% of splenic T cells were transduced by Ad-RGD.Collectively, our results prove that a fiber modified Ad-RGD successfully transduces and replicates in primary T cells of both murine and human origin.

  12. Mielograma de ratas com disfunção tireoidiana

    Directory of Open Access Journals (Sweden)

    R.D Castro

    2011-10-01

    Full Text Available The cells of the myelo id, lymphoid , and erythroid lineage s of the bone marrow were quantified in rats with hypo and hyperthyroidism. Fifteen Wistar rats were divided into three groups: hypothyroid (n=5, hyperthyroid (n=5 , and control (n=5. Three months after the onset of the treatment s, euthanasia was performed . Bone marrow was aspirated from femurs of each animal to perform smear s that were stained with Quick Panoptic. T he percentage s of rubroblast, prorubrocyte, metarubrocyte, myeloblast, promyelocytes, metamyelocytes, myel ocytes, segmented, eosinophils, basophils, lymphocytes, plasma cells and monocytes in were determined a total of 500 cells. The bone marrow of animals with hypothyroidism had hypoplasia. The myeloid:erythroid ratio was higher in animals with thyroid dysfun ction. In hypo and hyperthyroidism, there was a significant reduction of the percentage of rubrocyte, metarubrocyte , and lymphocytes and increase of myelocytes and segmented cells. In hypothyroidism, there was a significant increase in the percentage of me tamyelocytes. It is c oncluded that both hypo and hyperfunction of thyroid increase the myeloid:erythroid ratio by increasing the number of cells of the myeloid lineage and reducing the cells of the erythroid lineage.

  13. Primary culture of human Schwann and schwannoma cells: improved and simplified protocol.

    Science.gov (United States)

    Dilwali, Sonam; Patel, Pratik B; Roberts, Daniel S; Basinsky, Gina M; Harris, Gordon J; Emerick, Kevin S; Stankovic, Konstantina M

    2014-09-01

    Primary culture of human Schwann cells (SCs) and vestibular schwannoma (VS) cells are invaluable tools to investigate SC physiology and VS pathobiology, and to devise effective pharmacotherapies against VS, which are sorely needed. However, existing culture protocols, in aiming to create robust, pure cultures, employ methods that can lead to loss of biological characteristics of the original cells, potentially resulting in misleading biological findings. We have developed a minimally manipulative method to culture primary human SC and VS cells, without the use of selective mitogens, toxins, or time-consuming and potentially transformative laboratory techniques. Schwann cell purity was quantified longitudinally using S100 staining in SC cultures derived from the great auricular nerve and VS cultures followed for 7 and 12 weeks, respectively. SC cultures retained approximately ≥85% purity for 2 weeks. VS cultures retained approximately ≥80% purity for the majority of the span of 12 weeks, with maximal purity of 87% at 2 weeks. The VS cultures showed high level of biological similarity (68% on average) to their respective parent tumors, as assessed using a protein array featuring 41 growth factors and receptors. Apoptosis rate in vitro negatively correlated with tumor volume. Our results, obtained using a faster, simplified culturing method than previously utilized, indicate that highly pure, primary human SC and VS cultures can be established with minimal manipulation, reaching maximal purity at 2 weeks of culture. The VS cultures recapitulate the parent tumors' biology to a great degree, making them relevant models to investigate VS pathobiology. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Self-targeting of TNF-releasing cancer cells in preclinical models of primary and metastatic tumors.

    Science.gov (United States)

    Dondossola, Eleonora; Dobroff, Andrey S; Marchiò, Serena; Cardó-Vila, Marina; Hosoya, Hitomi; Libutti, Steven K; Corti, Angelo; Sidman, Richard L; Arap, Wadih; Pasqualini, Renata

    2016-02-23

    Circulating cancer cells can putatively colonize distant organs to form metastases or to reinfiltrate primary tumors themselves through a process termed "tumor self-seeding." Here we exploit this biological attribute to deliver tumor necrosis factor alpha (TNF), a potent antitumor cytokine, directly to primary and metastatic tumors in a mechanism that we have defined as "tumor self-targeting." For this purpose, we genetically engineered mouse mammary adenocarcinoma (TSA), melanoma (B16-F10), and Lewis lung carcinoma cells to produce and release murine TNF. In a series of intervention trials, systemic administration of TNF-expressing tumor cells was associated with reduced growth of both primary tumors and metastatic colonies in immunocompetent mice. We show that these malignant cells home to tumors, locally release TNF, damage neovascular endothelium, and induce massive cancer cell apoptosis. We also demonstrate that such tumor-cell-mediated delivery avoids or minimizes common side effects often associated with TNF-based therapy, such as acute inflammation and weight loss. Our study provides proof of concept that genetically modified circulating tumor cells may serve as targeted vectors to deliver anticancer agents. In a clinical context, this unique paradigm represents a personalized approach to be translated into applications potentially using patient-derived circulating tumor cells as self-targeted vectors for drug delivery.

  15. Breast Carcinoma Cells in Primary Tumors and Effusions Have Different Gene Array Profiles

    Directory of Open Access Journals (Sweden)

    Sophya Konstantinovsky

    2010-01-01

    Full Text Available The detection of breast carcinoma cells in effusions is associated with rapidly fatal outcome, but these cells are poorly characterized at the molecular level. This study compared the gene array signatures of breast carcinoma cells in primary carcinomas and effusions. The genetic signature of 10 primary tumors and 10 effusions was analyzed using the Array-Ready Oligo set for the Human Genome platform. Results for selected genes were validated using PCR, Western blotting, and immunohistochemistry. Array analysis identified 255 significantly downregulated and 96 upregulated genes in the effusion samples. The majority of differentially expressed genes were part of pathways involved in focal adhesion, extracellular matrix-cell interaction, and the regulation of the actin cytoskeleton. Genes that were upregulated in effusions included KRT8, BCAR1, CLDN4, VIL2, while DCN, CLDN19, ITGA7, and ITGA5 were downregulated at this anatomic site. PCR, Western blotting, and immunohistochemistry confirmed the array findings for BCAR1, CLDN4, VIL2, and DCN. Our data show that breast carcinoma cells in primary carcinomas and effusions have different gene expression signatures, and differentially express a large number of molecules related to adhesion, motility, and metastasis. These differences may have a critical role in designing therapy and in prognostication for patients with metastatic disease localized to the serosal cavities.

  16. Analysis of primary cilia in directional cell migration in fibroblasts

    DEFF Research Database (Denmark)

    Christensen, Søren Tvorup; Veland, Iben; Schwab, Albrecht

    2013-01-01

    summarize selected methods in analyzing ciliary function in directional cell migration, including immunofluorescence microscopy, scratch assay, and chemotaxis assay by micropipette addition of PDGFRα ligands to cultures of fibroblasts. These methods should be useful not only in studying cell migration....... In particular, platelet-derived growth factor receptor alpha (PDGFRα) is compartmentalized to the primary cilium to activate signaling pathways that regulate reorganization of the cytoskeleton required for lamellipodium formation and directional migration in the presence of a specific ligand gradient. We...

  17. Growth inhibitory activity of Ankaferd hemostat on primary melanoma cells and cell lines

    Directory of Open Access Journals (Sweden)

    Seyhan Turk

    2017-02-01

    Full Text Available Objective: Ankaferd hemostat is the first topical hemostatic agent about the red blood cell–fibrinogen relations tested in the clinical trials. Ankaferd hemostat consists of standardized plant extracts including Alpinia officinarum, Glycyrrhiza glabra, Thymus vulgaris, Urtica dioica, and Vitis vinifera. The aim of this study was to determine the effect of Ankaferd hemostat on viability of melanoma cell lines. Methods: Dissimilar melanoma cell lines and primary cells were used in this study. These cells were treated with different concentrations of Ankaferd hemostat to assess the impact of different dosages of the drug. All cells treated with different concentrations were incubated for different time intervals. After the data had been obtained, one-tailed T-test was used to determine whether the Ankaferd hemostat would have any significant inhibitory impact on cell growth. Results: We demonstrated in this study that cells treated with Ankaferd hemostat showed a significant decrease in cell viability compared to control groups. The cells showed different resistances against Ankaferd hemostat which depended on the dosage applied and the time treated cells had been incubated. We also demonstrated an inverse relationship between the concentration of the drug and the incubation time on one hand and the viability of the cells on the other hand, that is, increasing the concentration of the drug and the incubation time had a negative impact on cell viability. Conclusion: The findings in our study contribute to our knowledge about the anticancer impact of Ankaferd hemostat on different melanoma cells.

  18. Decreased "ineffective erythropoiesis" preserves polycythemia in mice under long-term hypoxia.

    Science.gov (United States)

    Harada, Tomonori; Tsuboi, Isao; Hirabayashi, Yukio; Kosaku, Kazuhiro; Naito, Michiko; Hara, Hiroyuki; Inoue, Tohru; Aizawa, Shin

    2015-05-01

    Hypoxia induces innumerable changes in humans and other animals, including an increase in peripheral red blood cells (polycythemia) caused by the activation of erythropoiesis mediated by increased erythropoietin (EPO) production. However, the elevation of EPO is limited and levels return to normal ranges under normoxia within 5-7 days of exposure to hypoxia, whereas polycythemia continues for as long as hypoxia persists. We investigated erythropoiesis in bone marrow and spleens from mouse models of long-term normobaric hypoxia (10 % O2) to clarify the mechanism of prolonged polycythemia in chronic hypoxia. The numbers of erythroid colony-forming units (CFU-E) in the spleen remarkably increased along with elevated serum EPO levels indicating the activation of erythropoiesis during the first 7 days of hypoxia. After 14 days of hypoxia, the numbers of CFU-E returned to normoxic levels, whereas polycythemia persisted for >140 days. Flow cytometry revealed a prolonged increase in the numbers of TER119-positive cells (erythroid cells derived from pro-erythroblasts through mature erythrocyte stages), especially the TER119 (high) CD71 (high) population, in bone marrow. The numbers of annexin-V-positive cells among the TER119-positive cells particularly declined under chronic hypoxia, suggesting that the numbers of apoptotic cells decrease during erythroid cell maturation. Furthermore, RT-PCR analysis showed that the RNA expression of BMP-4 and stem cell factor that reduces apoptotic changes during erythroid cell proliferation and maturation was increased in bone marrow under hypoxia. These findings indicated that decreased apoptosis of erythroid cells during erythropoiesis contributes to polycythemia in mice during chronic exposure to long-term hypoxia.

  19. Primary Human Blood Dendritic Cells for Cancer Immunotherapy—Tailoring the Immune Response by Dendritic Cell Maturation

    Directory of Open Access Journals (Sweden)

    Simone P. Sittig

    2015-12-01

    Full Text Available Dendritic cell (DC-based cancer vaccines hold the great promise of tipping the balance from tolerance of the tumor to rejection. In the last two decades, we have gained tremendous knowledge about DC-based cancer vaccines. The maturation of DCs has proven indispensable to induce immunogenic T cell responses. We review the insights gained from the development of maturation cocktails in monocyte derived DC-based trials. More recently, we have also gained insights into the functional specialization of primary human blood DC subsets. In peripheral human blood, we can distinguish at least three primary DC subsets, namely CD1c+ and CD141+ myeloid DCs and plasmacytoid DCs. We reflect the current knowledge on maturation and T helper polarization by these blood DC subsets in the context of DC-based cancer vaccines. The maturation stimulus in combination with the DC subset will determine the type of T cell response that is induced. First trials with these natural DCs underline their excellent in vivo functioning and mark them as promising tools for future vaccination strategies.

  20. Renal cell carcinoma primary cultures maintain genomic and phenotypic profile of parental tumor tissues.

    Science.gov (United States)

    Cifola, Ingrid; Bianchi, Cristina; Mangano, Eleonora; Bombelli, Silvia; Frascati, Fabio; Fasoli, Ester; Ferrero, Stefano; Di Stefano, Vitalba; Zipeto, Maria A; Magni, Fulvio; Signorini, Stefano; Battaglia, Cristina; Perego, Roberto A

    2011-06-13

    Clear cell renal cell carcinoma (ccRCC) is characterized by recurrent copy number alterations (CNAs) and loss of heterozygosity (LOH), which may have potential diagnostic and prognostic applications. Here, we explored whether ccRCC primary cultures, established from surgical tumor specimens, maintain the DNA profile of parental tumor tissues allowing a more confident CNAs and LOH discrimination with respect to the original tissues. We established a collection of 9 phenotypically well-characterized ccRCC primary cell cultures. Using the Affymetrix SNP array technology, we performed the genome-wide copy number (CN) profiling of both cultures and corresponding tumor tissues. Global concordance for each culture/tissue pair was assayed evaluating the correlations between whole-genome CN profiles and SNP allelic calls. CN analysis was performed using the two CNAG v3.0 and Partek software, and comparing results returned by two different algorithms (Hidden Markov Model and Genomic Segmentation). A very good overlap between the CNAs of each culture and corresponding tissue was observed. The finding, reinforced by high whole-genome CN correlations and SNP call concordances, provided evidence that each culture was derived from its corresponding tissue and maintained the genomic alterations of parental tumor. In addition, primary culture DNA profile remained stable for at least 3 weeks, till to third passage. These cultures showed a greater cell homogeneity and enrichment in tumor component than original tissues, thus enabling a better discrimination of CNAs and LOH. Especially for hemizygous deletions, primary cultures presented more evident CN losses, typically accompanied by LOH; differently, in original tissues the intensity of these deletions was weaken by normal cell contamination and LOH calls were missed. ccRCC primary cultures are a reliable in vitro model, well-reproducing original tumor genetics and phenotype, potentially useful for future functional approaches

  1. Structure of cellulose microfibrils in primary cell walls from Collenchyma

    Czech Academy of Sciences Publication Activity Database

    Thomas, L. H.; Forsyth, V. T.; Šturcová, Adriana; Kennedy, C. J.; May, R. P.; Altaner, C. M.; Apperley, D. C.; Wess, T. J.; Jarvis, M. C.

    2013-01-01

    Roč. 161, č. 1 (2013), s. 465-476 ISSN 0032-0889 R&D Projects: GA ČR GAP108/12/0703 Institutional support: RVO:61389013 Keywords : primary cell wall * cellulose microfibril structure * chain packing disorder Subject RIV: CD - Macromolecular Chemistry Impact factor: 7.394, year: 2013

  2. Surface topography regulates wnt signaling through control of primary cilia structure in mesenchymal stem cells

    Science.gov (United States)

    McMurray, R. J.; Wann, A. K. T.; Thompson, C. L.; Connelly, J. T.; Knight, M. M.

    2013-01-01

    The primary cilium regulates cellular signalling including influencing wnt sensitivity by sequestering β-catenin within the ciliary compartment. Topographic regulation of intracellular actin-myosin tension can control stem cell fate of which wnt is an important mediator. We hypothesized that topography influences mesenchymal stem cell (MSC) wnt signaling through the regulation of primary cilia structure and function. MSCs cultured on grooves expressed elongated primary cilia, through reduced actin organization. siRNA inhibition of anterograde intraflagellar transport (IFT88) reduced cilia length and increased active nuclear β-catenin. Conversely, increased primary cilia assembly in MSCs cultured on the grooves was associated with decreased levels of nuclear active β-catenin, axin-2 induction and proliferation, in response to wnt3a. This negative regulation, on grooved topography, was reversed by siRNA to IFT88. This indicates that subtle regulation of IFT and associated cilia structure, tunes the wnt response controlling stem cell differentiation. PMID:24346024

  3. A mathematical model of a lithium/thionyl chloride primary cell

    Science.gov (United States)

    Evans, T. I.; Nguyen, T. V.; White, R. E.

    1987-08-01

    A 1-D mathematical model for the lithium/thionyl chloride primary cell was developed to investigate methods of improving its performance and safety. The model includes many of the components of a typical lithium/thionyl chloride cell such as the porous lithium chloride film which forms on the lithium anode surface. The governing equations are formulated from fundamental conservation laws using porous electrode theory and concentrated solution theory. The model is used to predict 1-D, time dependent profiles of concentration, porosity, current, and potential as well as cell temperature and voltage. When a certain discharge rate is required, the model can be used to determine the design criteria and operating variables which yield high cell capacities. Model predictions can be used to establish operational and design limits within which the thermal runaway problem, inherent in these cells, can be avoided.

  4. Primary clear cell carcinoma of parotid gland: Case report and review of literature.

    Science.gov (United States)

    Rodríguez, Marta Saldaña; Reija, Maria Fe García; Rodilla, Irene González

    2013-01-01

    Clear cell carcinoma (CCC) is a rare low-grade carcinoma that represents only 1% to 2% of all salivary glands tumors. The finding of a clear cell tumor in a parotid gland involves the necessity of differential diagnosis between primary clear cell parotid tumors and metastases, mainly from kidney. The biological behavior is not very aggressive and development, which is very slow, is usually asymptomatic and indeed, the tumor often reaches considerable dimensions before being diagnosed. The treatment of choice is the surgical excision. There are rare cases of local recurrence and distant metastases. The aim of this article is to report a primary CCC in the parotid gland that microscopically closely resembled a metastatic CCC of renal origin, making microscopic differentiation difficult.

  5. [Primary peripheral T-cell lymphoma of the penis: a case report and review of the literature].

    Science.gov (United States)

    Shi, Yan-Lin; Yin, Hong-Lin; Zhou, Xiao-Jun; Zhou, Hang-Bo; Lu, Zhen-Feng

    2008-11-01

    To report a case of primary peripheral T-cell lymphoma of the penis. We analyzed the clinicopathological characteristics of the case of primary peripheral T-cell lymphoma using histological, cytochemical and immunohistochemical methods and by review of the literature. The patient was a 65 years old man and presented with a diffuse enlargement of the penis as the initial sign, followed by erosive ulcer in the caput penis and inguinal lymphadenectasis. The tumor was pathohistologically manifested as an epidermal ulcer, with tumorous necrosis around the capillary, infiltrative growth and atypical changes of the neoplastic cells and proliferation of capillaries. Immunohistochemically, the tumor cells were positive for CD43 and CD3, but negative for CD20, CD79a, CD34, CD30, CD56 and CD34. Clinically it responded to the chemotherapy designed for peripheral T-cell lymphoma. Primary peripheral T-cell lymphoma of the penis is an extremely rare malignant tumor, the diagnosis of which relies on histopathological examination, immunohistochemical staining and differentiation between squamous cell carcinoma and other types of lymphoma.

  6. Cdc42 controls primary mesenchyme cell morphogenesis in the sea urchin embryo.

    Science.gov (United States)

    Sepúlveda-Ramírez, Silvia P; Toledo-Jacobo, Leslie; Henson, John H; Shuster, Charles B

    2018-05-15

    In the sea urchin embryo, gastrulation is characterized by the ingression and directed cell migration of primary mesenchyme cells (PMCs), as well as the primary invagination and convergent extension of the endomesoderm. Like all cell shape changes, individual and collective cell motility is orchestrated by Rho family GTPases and their modulation of the actomyosin cytoskeleton. And while endomesoderm specification has been intensively studied in echinoids, much less is known about the proximate regulators driving cell motility. Toward these ends, we employed anti-sense morpholinos, mutant alleles and pharmacological inhibitors to assess the role of Cdc42 during sea urchin gastrulation. While inhibition of Cdc42 expression or activity had only mild effects on PMC ingression, PMC migration, alignment and skeletogenesis were disrupted in the absence of Cdc42, as well as elongation of the archenteron. PMC migration and patterning of the larval skeleton relies on the extension of filopodia, and Cdc42 was required for filopodia in vivo as well as in cultured PMCs. Lastly, filopodial extension required both Arp2/3 and formin actin-nucleating factors, supporting models of filopodial nucleation observed in other systems. Together, these results suggest that Cdc42 plays essential roles during PMC cell motility and organogenesis. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Generation of a Nrf2 homozygous knockout human embryonic stem cell line using CRISPR/Cas9

    Directory of Open Access Journals (Sweden)

    So-Jung Kim

    2017-03-01

    Full Text Available Nuclear factor erythroid 2-related factor 2 (NFE2L2 or Nrf2 is a well-known transcription factor that regulates the expression of a large number of anti-oxidant genes in mammalian cells (J.H. Kim et al., 2014. Here, we generated a homozygous Nrf2 knockout human embryonic stem cell (hESC line, H9Nrf2KO-A13, using the CRISPR/Cas9 genome editing method. The Nrf2 homozygous knockout H9 cell line maintains pluripotency, differentiation potential into three germ layers, and a normal karyotype.

  8. Primary Intra-aortic Epstein-Barr Virus-Positive Large B-Cell Lymphoma Presenting as Aortic Mural Thrombosis: An Entity Distinct From Intravascular Large B-Cell Lymphoma.

    Science.gov (United States)

    Nakao, Ryuta; Sakashita, Aki; Omoto, Atsushi; Sato, Osamu; Hino, Yoko; Yanagisawa, Akio; Urata, Yoji

    2017-12-01

    Intravascular selective growth of neoplastic B lymphocytes is a characteristic finding of intravascular large B-cell lymphoma (IVLBCL). However, because neoplastic B cells of IVLBCL grow merely in the lumina of capillaries or small vessels, primary IVLBCL of the great vessels is considered exceptional. To our knowledge, only 2 primary B-cell lymphomas in the lumina of the vena cava have been reported. However, there has been no report of primary B-cell lymphoma with intra-aortic growth. We describe a novel manifestation of primary Epstein-Barr virus-positive large B-cell lymphoma mainly affecting the lumina of the aorta and its major branches in a 76-year-old man. He had a long-term fever that was refractory to antibiotics and aortic mural thrombosis with visceral embolization. Because he had no detectable mass suggesting a malignancy, it was difficult to diagnose while he was alive. He died without anticancer treatment, and the confirmed diagnosis was made at autopsy.

  9. Effect of water-soluble P-chitosan and S-chitosan on human primary osteoblasts and giant cell tumor of bone stromal cells

    Energy Technology Data Exchange (ETDEWEB)

    Tang, T; Zhang, G; PY Lau, Carol; Zheng, L Z; Xie, X H; Wang, X L; Patrick, Y; Qin, L; Kumta, Shekhar M [Department of Orthopaedics and Traumatology, Chinese University of Hong Kong (Hong Kong); Wang, X H; He, K, E-mail: kumta@cuhk.edu.hk [Department of Mechanical Engineering, Institute of Bio-manufacturing Engineering, Tsinghua University, Beijing (China)

    2011-02-15

    Water-soluble phosphorylated chitosan (P-chitosan) and disodium (1 {yields} 4)-2-deoxy-2-sulfoamino-{beta}-D-glucopyranuronan (S-chitosan) are two chemically modified chitosans. In this study, we found that P-chitosan significantly promotes cell proliferation of both human primary osteoblasts (OBs) and the OB like stromal cell component of the giant cell tumor of bone (GCTB) cells at the concentration from 125 to 1000 {mu}g ml{sup -1} at all time points of 1, 3, 5 and 7 days after treatment. Further investigation of the osteogenic effect of the P-chitosan suggested that it regulates the levels of osteoclastogenic factors, receptor activator of nuclear factor kappa B ligand and osteoprotegerin expression. An interesting finding is that S-chitosan at lower concentration (100 {mu}g ml{sup -1}) stimulates cell proliferation while a higher dose (1000 {mu}g ml{sup -1}) of S-chitosan inhibits it. The inhibitory effect of S-chitosan on human primary GCT stromal cells was greater than that of OBs (p < 0.05). Taken together, our findings elucidated the osteogenic effect of P-chitosan and the varying effects of S-chitosan on the proliferation of human primary OBs and GCT stromal cells and provided us the rationale for the construction of novel bone repair biomaterials with the dual properties of bone induction and bone tumor inhibition.

  10. Primary Lung Signet Ring Cell Carcinoma Presenting as a Cavitary Pancoast Tumor in a 32-Year-Old Man.

    Science.gov (United States)

    Corvini, Michael; Koorji, Alysha; Sgroe, Erica; Nguyen, Uyen

    2018-06-01

    Signet ring cell carcinoma, a subtype of adenocarcinoma, is a rare cause of primary lung cancer. The authors report a case of primary lung signet ring cell carcinoma presenting as a cavitary Pancoast tumor in a 32-year-old male smoker. Beyond the rarity of primary lung signet ring cell carcinoma itself, the youth of the patient, his smoking status, the presence of cavitation, and the location of the tumor in the superior sulcus make it especially atypical.

  11. Compound heterozygous TYK2 mutations underlie primary immunodeficiency with T-cell lymphopenia.

    Science.gov (United States)

    Nemoto, Michiko; Hattori, Hiroyoshi; Maeda, Naoko; Akita, Nobuhiro; Muramatsu, Hideki; Moritani, Suzuko; Kawasaki, Tomonori; Maejima, Masami; Ode, Hirotaka; Hachiya, Atsuko; Sugiura, Wataru; Yokomaku, Yoshiyuki; Horibe, Keizo; Iwatani, Yasumasa

    2018-05-03

    Complete tyrosine kinase 2 (TYK2) deficiency has been previously described in patients with primary immunodeficiency diseases. The patients were infected with various pathogens, including mycobacteria and/or viruses, and one of the patients developed hyper-IgE syndrome. A detailed immunological investigation of these patients revealed impaired responses to type I IFN, IL-10, IL-12 and IL-23, which are associated with increased susceptibility to mycobacterial and/or viral infections. Herein, we report a recessive partial TYK2 deficiency in two siblings who presented with T-cell lymphopenia characterized by low naïve CD4 + T-cell counts and who developed Epstein-Barr virus (EBV)-associated B-cell lymphoma. Targeted exome-sequencing of the siblings' genomes demonstrated that both patients carried novel compound heterozygous mutations (c.209_212delGCTT/c.691C > T, p.Cys70Serfs*21/p.Arg231Trp) in the TYK2. The TYK2 protein levels were reduced by 35% in the T cells of the patient. Unlike the response under complete TYK2 deficiency, the patient's T cells responded normally to type I IFN, IL-6, IL-10 and IL-12, whereas the cells displayed an impaired response to IL-23. Furthermore, the level of STAT1 was low in the cells of the patient. These studies reveal a new clinical entity of a primary immunodeficiency with T-cell lymphopenia that is associated with compound heterozygous TYK2 mutations in the patients.

  12. Effects of aflibercept on primary RPE cells: toxicity, wound healing, uptake and phagocytosis.

    Science.gov (United States)

    Klettner, Alexa; Tahmaz, Nihat; Dithmer, Michaela; Richert, Elisabeth; Roider, Johann

    2014-10-01

    Anti-VEGF treatment is the therapy of choice in age-related macular degeneration, and is also applied in diabetic macular oedema or retinal vein occlusion. Recently, the fusion protein, aflibercept, has been approved for therapeutic use. In this study, we investigate the effects of aflibercept on primary RPE cells. Primary RPE cells were prepared from freshly slaughtered pigs' eyes. The impact of aflibercept on cell viability was investigated with MTT and trypan blue exclusion assay. The influence of aflibercept on wound healing was assessed with a scratch assay. Intracellular uptake of aflibercept was investigated in immunohistochemistry and its influence on phagocytosis with a phagocytosis assay using opsonised latex beads. Aflibercept displays no cytotoxicity on RPE cells but impairs its wound healing ability. It is taken up into RPE cells and can be intracellularly detected for at least 7 days. Intracellular aflibercept impairs the phagocytic capacity of RPE cells. Aflibercept interferes with the physiology of RPE cells, as it is taken up into RPE cells, which is accompanied by a reduction of the phagocytic ability. Additionally, it impairs the wound healing capacity of RPE cells. These effects on the physiology of RPE cells may indicate possible side effects. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  13. Immunocytochemical investigation of immune cells within human primary and permanent tooth pulp.

    Science.gov (United States)

    Rodd, H D; Boissonade, F M

    2006-01-01

    The aim of this study was to determine whether there are any differences in the number and distribution of immune cells within human primary and permanent tooth pulp, both in health and disease. The research took the form of a quantitative immunocytochemical study. One hundred and twenty-four mandibular first permanent molars and second primary molars were obtained from children requiring dental extractions under general anaesthesia. Following exodontia, 10-microm-thick frozen pulp sections were processed for indirect immunofluorescence. Triple-labelling regimes were employed using combinations of the following: (1) protein gene product 9.5, a general neuronal marker; (2) leucocyte common antigen (LCA); and (3) Ulex europaeus I lectin, a marker of vascular endothelium. Image analysis was then used to determine the percentage area of immunostaining for LCA. Leucocytes were significantly more abundant in the pulp horn and mid-coronal region of intact and carious primary teeth, as compared to permanent teeth (P < 0.05, anova). Both dentitions demonstrated the presence of well-localized inflammatory cell infiltrates and marked aborization of pulpal nerves in areas of dense leucocyte accumulation. Primary and permanent tooth pulps appear to have a similar potential to mount inflammatory responses to gross caries The management of the compromised primary tooth pulp needs to be reappraised in the light of these findings.

  14. Magnetic cell labeling of primary and stem cell-derived pig hepatocytes for MRI-based cell tracking of hepatocyte transplantation.

    Directory of Open Access Journals (Sweden)

    Dwayne R Roach

    Full Text Available Pig hepatocytes are an important investigational tool for optimizing hepatocyte transplantation schemes in both allogeneic and xenogeneic transplant scenarios. MRI can be used to serially monitor the transplanted cells, but only if the hepatocytes can be labeled with a magnetic particle. In this work, we describe culture conditions for magnetic cell labeling of cells from two different pig hepatocyte cell sources; primary pig hepatocytes (ppHEP and stem cell-derived hepatocytes (PICM-19FF. The magnetic particle is a micron-sized iron oxide particle (MPIO that has been extensively studied for magnetic cell labeling for MRI-based cell tracking. ppHEP could endocytose MPIO with labeling percentages as high as 70%, achieving iron content as high as ~55 pg/cell, with >75% viability. PICM-19FF had labeling >97%, achieving iron content ~38 pg/cell, with viability >99%. Extensive morphological and functional assays indicated that magnetic cell labeling was benign to the cells. The results encourage the use of MRI-based cell tracking for the development and clinical use of hepatocyte transplantation methodologies. Further, these results generally highlight the importance of functional cell assays in the evaluation of contrast agent biocompatibility.

  15. The activation pattern of macrophages in giant cell (temporal) arteritis and primary angiitis of the central nervous system.

    Science.gov (United States)

    Mihm, Bernhard; Bergmann, Markus; Brück, Wolfgang; Probst-Cousin, Stefan

    2014-06-01

    To determine if the pattern of macrophage activation reflects differences in the pathogenesis and clinical presentation of giant cell arteritis and primary angiitis of the central nervous system, specimens of 10 patients with giant cell arteritis and five with primary angiitis of the central nervous system were immunohistochemically studied and the expression of the macrophage activation markers 27E10, MRP14, MRP8 and 25F9 was determined in the vasculitic infiltrates. Thus, a partly different expression pattern of macrophage activation markers in giant cell arteritis and primary angiitis of the central nervous system was observed. The group comparison revealed that giant cell arteritis cases had significantly higher numbers of acute activated MRP14-positive macrophages, whereas primary angiitis of the central nervous system is characterized by a tendency toward more MRP8-positive intermediate/late activated macrophages. Furthermore, in giant cell arteritis comparably fewer CD8-positive lymphocytes were observed. These observations suggest, that despite their histopathological similarities, giant cell arteritis and primary angiitis of the central nervous system appear to represent either distinct entities within the spectrum of granulomatous vasculitides or different stages of similar disease processes. Their discrete clinical presentation is reflected by different activation patterns of macrophages, which may characterize giant cell arteritis as a more acute process and primary angiitis of the central nervous system as a more advanced inflammatory process. © 2013 Japanese Society of Neuropathology.

  16. CRISPR/Cas9-Mediated Correction of the FANCD1 Gene in Primary Patient Cells

    Directory of Open Access Journals (Sweden)

    Karolina Skvarova Kramarzova

    2017-06-01

    Full Text Available Fanconi anemia (FA is an inherited condition characterized by impaired DNA repair, physical anomalies, bone marrow failure, and increased incidence of malignancy. Gene editing holds great potential to precisely correct the underlying genetic cause such that gene expression remains under the endogenous control mechanisms. This has been accomplished to date only in transformed cells or their reprogrammed induced pluripotent stem cell counterparts; however, it has not yet been reported in primary patient cells. Here we show the ability to correct a mutation in Fanconi anemia D1 (FANCD1 primary patient fibroblasts. The clustered regularly interspaced short palindromic repeats (CRISPR/Cas9 system was employed to target and correct a FANCD1 gene deletion. Homologous recombination using an oligonucleotide donor was achieved and a pure population of modified cells was obtained by using inhibitors of poly adenosine diphosphate-ribose polymerase (poly ADP-ribose polymerase. FANCD1 function was restored and we did not observe any promiscuous cutting of the CRISPR/Cas9 at off target sites. This consideration is crucial in the context of the pre-malignant FA phenotype. Altogether we show the ability to correct a patient mutation in primary FANCD1 cells in a precise manner. These proof of principle studies support expanded application of gene editing for FA.

  17. Esophageal Large-Cell Neuroendocrine Carcinoma with Inconsistent Response to Treatment in the Primary and Metastatic Lesions

    Directory of Open Access Journals (Sweden)

    Takashi Tomiyama

    2018-05-01

    Full Text Available Esophageal large-cell neuroendocrine carcinoma (NEC is a rare malignant tumor that is characterized by high-grade malignancy and a poor prognosis. However, the rarity of esophageal NEC has prevented the development of an established treatment, and no reports have described a discrepancy in the effectiveness of cisplatin plus irinotecan between primary and metastatic lesions. A 43-year-old Japanese man was referred to our hospital with refractory epigastralgia. A previous gastrointestinal endoscopy had revealed a 50-mm type 2 tumor in the abdominal esophagus. The pathological findings indicated poorly differentiated squamous cell carcinoma. Contrast-enhanced computed tomography revealed a metastatic liver tumor. One cycle of fluorouracil and cisplatin was not effective, and endoscopy was repeatedly performed. The pathological findings indicated a large-cell malignant tumor with tumor cells that were positive for CD56, synaptophysin, and Ki-67 (> 80%. Based on a diagnosis of esophageal large-cell NEC with a metastatic liver tumor, the patient received cisplatin plus irinotecan biweekly. After 4 months, computed tomography revealed marked shrinkage of the metastatic tumor, but the patient complained of dysphagia. Endoscopy revealed enlargement of the primary tumor, which was then treated using radiotherapy plus fluorouracil and cisplatin. The primary tumor subsequently shrank, and the patient’s symptoms were relieved, but the metastatic tumor grew. Thus, chemoradiotherapy could be an option for managing a primary esophageal large-cell NEC that does not respond to chemotherapy alone. However, the possibility of an inconsistent response to therapy in primary and metastatic lesions should be considered.

  18. Improved Activation toward Primary Colorectal Cancer Cells by Antigen-Specific Targeting Autologous Cytokine-Induced Killer Cells

    Directory of Open Access Journals (Sweden)

    Claudia Schlimper

    2012-01-01

    Full Text Available Adoptive therapy of malignant diseases with cytokine-induced killer (CIK cells showed promise in a number of trials; the activation of CIK cells from cancer patients towards their autologous cancer cells still needs to be improved. Here, we generated CIK cells ex vivo from blood lymphocytes of colorectal cancer patients and engineered those cells with a chimeric antigen receptor (CAR with an antibody-defined specificity for carcinoembryonic antigen (CEA. CIK cells thereby gained a new specificity as defined by the CAR and showed increase in activation towards CEA+ colon carcinoma cells, but less in presence of CEA− cells, indicated by increased secretion of proinflammatory cytokines. Redirected CIK activation was superior by CAR-mediated CD28-CD3ζ than CD3ζ signaling only. CAR-engineered CIK cells from colon carcinoma patients showed improved activation against their autologous, primary carcinoma cells from biopsies resulting in more efficient tumour cell lysis. We assume that adoptive therapy with CAR-modified CIK cells shows improved selectivity in targeting autologous tumour lesions.

  19. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  20. 2-Dodecylcyclobutanone, a radiolytic product of palmitic acid, is genotoxic in primary human colon cells and in cells from preneoplastic lesions

    International Nuclear Information System (INIS)

    Knoll, Nadine; Weise, Anja; Claussen, Uwe; Sendt, Wolfgang; Marian, Brigitte; Glei, Michael; Pool-Zobel, Beatrice L.

    2006-01-01

    The irradiation of fat results in the formation of 2-alkylcyclobutanones, a new class of food contaminants. Results of previous in vitro studies with primary human colon cells and in vivo experiments with rats fed with 2-alkylcyclobutanones indicated that these radiolytic derivatives may be genotoxic and enhance the progression of colon tumors. The underlying mechanisms of these effects, however, are not clearly understood. Therefore we performed additional investigations to elucidate the genotoxic potential of 2-dodecylcyclobutanone (2dDCB) that is generated from palmitic acid. In particular, we explored the relative sensitivities of human colon cells, representing different stages of tumor development and healthy colon tissues, respectively. HT29clone19A cells, LT97 adenoma cells and primary human epithelial cells were exposed to 2dDCB (150-2097 μM). We determined cytotoxic effects using trypan blue exclusion. Genotoxicity, reflected as strand breaks, was assessed using the alkaline version of the comet assay and chromosomal abnormalities were investigated by 24-color fluorescence-in-situ-hybridization. 2dDCB was cytotoxic in a time- and dose-dependent manner in LT97 adenoma cells and in freshly isolated primary cells but not in the human colon tumor cell line. Associated with this was a marked induction of DNA damage by 2dDCB in LT97 adenoma cells and in freshly isolated colonocytes, whereas in the HT29clone19A cells no strand breaks were detectable. A long-term incubation of LT97 adenoma cells with lower concentrations of 2dDCB revealed cytogenetic effects. In summary, 2dDCB was clearly genotoxic in healthy human colon epithelial cells and in cells representing preneoplastic colon adenoma. These findings provide additional evidence that this compound may be regarded as a possible risk factor for processes in colon carcinogenesis related to initiation and progression

  1. Bufalin Inhibits the Differentiation and Proliferation of Cancer Stem Cells Derived from Primary Osteosarcoma Cells through Mir-148a.

    Science.gov (United States)

    Chang, Yuewen; Zhao, Yongfang; Gu, Wei; Cao, Yuelong; Wang, Shuqiang; Pang, Jian; Shi, Yinyu

    2015-01-01

    Osteosarcoma (OS) is the second leading cause of cancer-related death in children and young adults. Chemoresistance is the most important cause of treatment failure in OS, largely resulting from presence of cancer stem cells (CSCs). However, CSCs isolated from cancer cell lines do not necessarily represent those from primary human tumors due to accumulation of genetic aberrations that increase with passage number. Therefore, studies on CSCs from primary OS may be more important for understanding the mechanisms driving the chemoresistance of CSCs in OS. We established a primary culture of OS cells, known as C1OS, from freshly resected tumor tissue. We further isolated CSCs from C1OS cells (C1OS-CSCs). We analyzed the effects of bufalin, a traditional Chinese medicine, on the stemness of C1OS-CSCs. We also analyzed the microRNA (miR) targets of bufalin on the stemness of C1OS-CSCs. Moreover, we examined these findings in the OS specimen. Bufalin inhibited the stemness of C1OS-CSCs. Moreover, we found that miR-148a appeared to be a target of bufalin, and miR-148a further regulated DNMT1 and p27 to control the stemness of OS cells. This mechanism was further confirmed in OS specimen. Our data suggest that bufalin may be a promising treatment for OS, and its function may be conducted through regulation of miR-148a. © 2015 S. Karger AG, Basel.

  2. Bufalin Inhibits the Differentiation and Proliferation of Cancer Stem Cells Derived from Primary Osteosarcoma Cells through Mir-148a

    Directory of Open Access Journals (Sweden)

    Yuewen Chang

    2015-06-01

    Full Text Available Background/Aims: Osteosarcoma (OS is the second leading cause of cancer-related death in children and young adults. Chemoresistance is the most important cause of treatment failure in OS, largely resulting from presence of cancer stem cells (CSCs. However, CSCs isolated from cancer cell lines do not necessarily represent those from primary human tumors due to accumulation of genetic aberrations that increase with passage number. Therefore, studies on CSCs from primary OS may be more important for understanding the mechanisms driving the chemoresistance of CSCs in OS. Methods: We established a primary culture of OS cells, known as C1OS, from freshly resected tumor tissue. We further isolated CSCs from C1OS cells (C1OS-CSCs. We analyzed the effects of bufalin, a traditional Chinese medicine, on the stemness of C1OS-CSCs. We also analyzed the microRNA (miR targets of bufalin on the stemness of C1OS-CSCs. Moreover, we examined these findings in the OS specimen. Results: Bufalin inhibited the stemness of C1OS-CSCs. Moreover, we found that miR-148a appeared to be a target of bufalin, and miR-148a further regulated DNMT1 and p27 to control the stemness of OS cells. This mechanism was further confirmed in OS specimen. Conclusion: Our data suggest that bufalin may be a promising treatment for OS, and its function may be conducted through regulation of miR-148a.

  3. An optimized protocol for isolating primary epithelial cell chromatin for ChIP.

    Directory of Open Access Journals (Sweden)

    James A Browne

    Full Text Available A critical part of generating robust chromatin immunoprecipitation (ChIP data is the optimization of chromatin purification and size selection. This is particularly important when ChIP is combined with next-generation sequencing (ChIP-seq to identify targets of DNA-binding proteins, genome-wide. Current protocols refined by the ENCODE consortium generally use a two-step cell lysis procedure that is applicable to a wide variety of cell types. However, the isolation and size selection of chromatin from primary human epithelial cells may often be particularly challenging. These cells tend to form sheets of formaldehyde cross-linked material in which cells are resistant to membrane lysis, nuclei are not released and subsequent sonication produces extensive high molecular weight contamination. Here we describe an optimized protocol to prepare high quality ChIP-grade chromatin from primary human bronchial epithelial cells. The ENCODE protocol was used as a starting point to which we added the following key steps to separate the sheets of formaldehyde-fixed cells prior to lysis. (1 Incubation of the formaldehyde-fixed adherent cells in Trypsin-EDTA (0.25% room temperature for no longer than 5 min. (2 Equilibration of the fixed cells in detergent-free lysis buffers prior to each lysis step. (3 The addition of 0.5% Triton X-100 to the complete cell membrane lysis buffer. (4 Passing the cell suspension (in complete cell membrane lysis buffer through a 25-gauge needle followed by continuous agitation on ice for 35 min. Each step of the modified protocol was documented by light microscopy using the Methyl Green-Pyronin dual dye, which stains cytoplasm red (Pyronin and the nuclei grey-blue (Methyl green. This modified method is reproducibly effective at producing high quality sheared chromatin for ChIP and is equally applicable to other epithelial cell types.

  4. Mycoplasma hyorhinis-Contaminated Cell Lines Activate Primary Innate Immune Cells via a Protease-Sensitive Factor.

    Directory of Open Access Journals (Sweden)

    Simon Heidegger

    Full Text Available Mycoplasma are a frequent and occult contaminant of cell cultures, whereby these prokaryotic organisms can modify many aspects of cell physiology, rendering experiments that are conducted with such contaminated cells problematic. Chronic Mycoplasma contamination in human monocytic cells lines has been associated with suppressed Toll-like receptor (TLR function. In contrast, we show here that components derived from a Mycoplasma hyorhinis-infected cell line can activate innate immunity in non-infected primary immune cells. Release of pro-inflammatory cytokines such as IL-6 by dendritic cells in response to Mycoplasma hyorhinis-infected cell components was critically dependent on the adapter protein MyD88 but only partially on TLR2. Unlike canonical TLR2 signaling that is triggered in response to the detection of Mycoplasma infection, innate immune activation by components of Mycoplasma-infected cells was inhibited by chloroquine treatment and sensitive to protease treatment. We further show that in plasmacytoid dendritic cells, soluble factors from Mycoplasma hyorhinis-infected cells induce the production of large amounts of IFN-α. We conclude that Mycoplasma hyorhinis-infected cell lines release protein factors that can potently activate co-cultured innate immune cells via a previously unrecognized mechanism, thus limiting the validity of such co-culture experiments.

  5. Susceptibility of Primary Human Choroid Plexus Epithelial Cells and Meningeal Cells to Infection by JC Virus.

    Science.gov (United States)

    O'Hara, Bethany A; Gee, Gretchen V; Atwood, Walter J; Haley, Sheila A

    2018-04-15

    JC polyomavirus (JCPyV) establishes a lifelong persistence in roughly half the human population worldwide. The cells and tissues that harbor persistent virus in vivo are not known, but renal tubules and other urogenital epithelial cells are likely candidates as virus is shed in the urine of healthy individuals. In an immunosuppressed host, JCPyV can become reactivated and cause progressive multifocal leukoencephalopathy (PML), a fatal demyelinating disease of the central nervous system. Recent observations indicate that JCPyV may productively interact with cells in the choroid plexus and leptomeninges. To further study JCPyV infection in these cells, primary human choroid plexus epithelial cells and meningeal cells were challenged with virus, and their susceptibility to infection was compared to the human glial cell line, SVG-A. We found that JCPyV productively infects both choroid plexus epithelial cells and meningeal cells in vitro Competition with the soluble receptor fragment LSTc reduced virus infection in these cells. Treatment of cells with neuraminidase also inhibited both viral infection and binding. Treatment with the serotonin receptor antagonist, ritanserin, reduced infection in SVG-A and meningeal cells. We also compared the ability of wild-type and sialic acid-binding mutant pseudoviruses to transduce these cells. Wild-type pseudovirus readily transduced all three cell types, but pseudoviruses harboring mutations in the sialic acid-binding pocket of the virus failed to transduce the cells. These data establish a novel role for choroid plexus and meninges in harboring virus that likely contributes not only to meningoencephalopathies but also to PML. IMPORTANCE JCPyV infects greater than half the human population worldwide and causes central nervous system disease in patients with weakened immune systems. Several recent reports have found JCPyV in the choroid plexus and leptomeninges of patients with encephalitis. Due to their role in forming the blood

  6. Generation of iPSC lines from primary human chorionic villi cells

    Directory of Open Access Journals (Sweden)

    Björn Lichtner

    2015-11-01

    Full Text Available Primary human chorionic villi (CV cells were used to generate the iPSC line by retroviral transduction of the four Yamanaka-factors OCT4, SOX2, KLF4 and c-MYC. Pluripotency was confirmed both in vivo and in vitro. The transcriptomes of the CV-derived iPSC lines and the human embryonic stem cell lines—H1 and H9 have a Pearson correlation of 0.929 and 0.943 respectively.

  7. Interactions of virulent and avirulent leptospires with primary cultures of renal epithelial cells

    DEFF Research Database (Denmark)

    Ballard, S A; Williamson, M; Adler, B

    1986-01-01

    A primary culture system for the cells of mouse renal-tubular epithelium was established and used to observe the adhesion of leptospires. Virulent strains of serovars copenhageni and ballum attached themselves to epithelial cells within 3 h of infection whereas an avirulent variant of serovar cop...

  8. Effect of anabolics on bovine granulosa-luteal cell primary cultures.

    Directory of Open Access Journals (Sweden)

    Bartolomeo Biolatti

    2007-10-01

    Full Text Available Granulosa cell tumours are observed with increased frequency among calves slaughtered in Northern Italy. The use of illegal anabolics in breeding was taken into account as a cause of this pathology. An in vitro approach was used to detect the possible alterations of cell proliferation induced by anabolics on primary cultures of bovine granulosa-luteal cells. Cultures were treated with different concentrations of substances illegally used in cattle (17beta-estradiol, clenbuterol and boldione. Cytotoxicity was determined by means of MTT test, to exclude toxic effects induced by anabolics and to determine the highest concentration to be tested. Morphological changes were evaluated by means of routine cytology, while PCNA expression was quantified in order to estimate cell proliferation. Cytotoxic effects were revealed at the highest concentrations. The only stimulating effect on cell proliferation was detected in boldione treated cultures: after 48 h treated cells, compared to controls, showed a doubled expression of PCNA. In clenbuterol and 17beta-estradiol treated cells PCNA expression was similar to controls or even decreased. As the data suggest an alteration in cell proliferation, boldione could have a role in the early stage of pathogenesis of granulosa cell tumour in cattle.

  9. Transfection of brain capillary endothelial cells in primary culture with defined blood-brain barrier properties.

    Science.gov (United States)

    Burkhart, Annette; Thomsen, Louiza Bohn; Thomsen, Maj Schneider; Lichota, Jacek; Fazakas, Csilla; Krizbai, István; Moos, Torben

    2015-08-07

    Primary brain capillary endothelial cells (BCECs) are a promising tool to study the blood-brain barrier (BBB) in vitro, as they maintain many important characteristics of the BBB in vivo, especially when co-cultured with pericytes and/or astrocytes. A novel strategy for drug delivery to the brain is to transform BCECs into protein factories by genetic modifications leading to secretion of otherwise BBB impermeable proteins into the central nervous system. However, a huge challenge underlying this strategy is to enable transfection of non-mitotic BCECs, taking a non-viral approach. We therefore aimed to study transfection in primary, non-mitotic BCECs cultured with defined BBB properties without disrupting the cells' integrity. Primary cultures of BCECs, pericytes and astrocytes were generated from rat brains and used in three different in vitro BBB experimental arrangements, which were characterised based on a their expression of tight junction proteins and other BBB specific proteins, high trans-endothelial electrical resistance (TEER), and low passive permeability to radiolabeled mannitol. Recombinant gene expression and protein synthesis were examined in primary BCECs. The BCECs were transfected using a commercially available transfection agent Turbofect™ to express the red fluorescent protein HcRed1-C1. The BCECs were transfected at different time points to monitor transfection in relation to mitotic or non-mitotic cells, as indicated by fluorescence-activated cell sorting analysis after 5-and 6-carboxylfluorescein diacetate succinidyl ester incorporation. The cell cultures exhibited important BBB characteristics judged from their expression of BBB specific proteins, high TEER values, and low passive permeability. Among the three in vitro BBB models, co-culturing with BCECs and astrocytes was well suited for the transfection studies. Transfection was independent of cell division and with equal efficacy between the mitotic and non-mitotic BCECs. Importantly

  10. Regulator of differentiation 1 (ROD1) binds to the amphipathic C-terminal peptide of thrombospondin-4 and is involved in its mitogenic activity.

    Science.gov (United States)

    Sadvakassova, Gulzhakhan; Dobocan, Monica C; Difalco, Marcos R; Congote, Luis F

    2009-09-01

    The matrix protein thrombospondin-4 has an acidic amphipathic C-terminal peptide (C21) which stimulates erythroid cell proliferation. Here we show that C21 stimulates red cell formation in anemic mice in vivo. In vitro experiments indicated that the peptide-mediated increase of erythroid colony formation in cultures of human CD34+ hematopoietic progenitor cells was possible only under continuous presence of erythropoietin. In the absence of this cytokine, C21 stimulated exclusively myeloid colony formation. Therefore, the peptide is not a specific erythroid differentiation factor. In fact, it is mitogenic in non-erythroid cells, such as skin fibroblasts and kidney epithelial cells. In erythroleukemic TF-1 cells, it actually decreased the production of the erythroid differentiation marker glycophorin A. C21-affinity chromatography revealed regulator of differentiation 1 (ROD1) as a major C21-binding protein. ROD1 is the hematopoietic cell paralog of polypyrimidine tract binding proteins (PTBs), RNA splice regulators which regulate differentiation by repressing tissue-specific exons. ROD1 binding to C21 was strongly inhibited by synthetic RNAs in the order poly A > poly U > poly G = poly C and was weakly inhibited by a synthetic phosphorylated peptide mimicking the C-terminal domain of RNA polymerase II. Cellular overexpression or knockdown experiments of ROD1 suggest a role for this protein in the mitogenic activity of C21. Since the nuclear proteins ROD1 and PTBs regulate differentiation at a posttranscriptional level and there is a fast nuclear uptake of C21, we put forward the idea that the peptide is internalized, goes to the nucleus and maintains cells in a proliferative state by supporting ROD1-mediated inhibition of differentiation.

  11. Phytohemagglutinin (PHA) stimulation of peripheral-blood lymphocytes and stem cell take

    Energy Technology Data Exchange (ETDEWEB)

    Astaldi, G [Blood Research Foundation Center, Tortona, Italy; Karanovic, D; Vettori, P P; Karanovic, J; Piletic, O

    1974-01-01

    The effect of PHA-stimulation of peripheral-blood lymphocytes on the spleen-colony formation in irradiated rats was examined. 25-day old Wistar rats underwent total-body irradiation (600 R), and they were used as recipients. On the other hand, 2 and /sup 1///sub 2/ month old untreated Wistar rats were used as donors of peripheral-blood lymphocytes, which were obtained by sedimentation with Dextraven from defibrinated blood. Four rat lots were used. The 1st one did not receive irradiation, and was kept as ''blank control.'' The 2nd one was just irradiated and kept as ''radiated control.'' The 3rd and the 4th rat lots of the series were irradiated, but the former lot was injected i.v. with 5 x 10/sup 7/ peripheral-blood untreated lymphocytes, whereas the fourth lot was injected i.v. with the same amount of lymphocytes, which were previously incubated in vitro for 24 hrs with PHA-M (Difco). The results showed that the PHA-incubation of transplanted peripheral-blood lymphocytes significantly increases the number and size of the macroscopic spleen colonies, in relationship to the colonies which occurs after transplantation of untreated lymphocytes. Histo-cytological observation clearly showed that the colonies formed after injection of mitogen-pretreated peripheral-blood lymphocytes were predominantly of erythroid type and, then, of non-differentiated cells. Only a few of them were of a mixed type, consisting of both undifferentiated cells and erythroid cells.

  12. Post-transcriptional regulation of osteoblastic platelet-derived growth factor receptor-alpha expression by co-cultured primary endothelial cells

    DEFF Research Database (Denmark)

    Finkenzeller, Günter; Mehlhorn, Alexander T; Schmal, Hagen

    2010-01-01

    -alpha downregulation is dependent on time and cell number. This effect was specific to endothelial cells and was not observed when hOBs were co-cultured with human primary chondrocytes or fibroblasts. Likewise, HUVEC-mediated suppression of PDGFR-alpha expression was only seen in hOBs and mesenchymal stem cells......Platelet-derived growth factor receptor (PDGFR) signaling plays an important role in osteoblast function. Inhibition of PDGFR activity leads to a suppression of osteoblast proliferation, whereas mineralized matrix production is enhanced. In previous experiments, we showed that co......-cultivation of human primary endothelial cells and human primary osteoblasts (hOBs) leads to a cell contact-dependent downregulation of PDGFR-alpha expression in the osteoblasts. In this study, we investigated this effect in more detail, revealing that human umbilical vein endothelial cell (HUVEC)-mediated PDGFR...

  13. Primary B cell lymphoma of the tongue base: a case report

    Science.gov (United States)

    Bechir, Achour; Asma, Achour; Haifa, Regaieg; Nesrine, Abdessayed; Yosra, Ben Youssef; Badreddine, Sriha; Abderrahim, Khelif

    2016-01-01

    Primary non-Hodgkin’s lymphoma’s of the tongue is very rare and accounts for 1% of all malignant tumor of the oral cavity. Clinical features are non-specific ulcerative lesions that do not heal. In the literature, the majority of cases are diffuse large B cell type however, T cell phenotype also may occur. We describe a 77 years old man, who presented with an ulcerative mass in the left margin of the tongue the diagnosis diffuse large B cell lymphoma was confirmed. The patient is actually on treatment R-mini CEOP and has favorable evolution. PMID:28292136

  14. Diabetes increases susceptibility of primary cultures of rat proximal tubular cells to chemically induced injury

    International Nuclear Information System (INIS)

    Zhong Qing; Terlecky, Stanley R.; Lash, Lawrence H.

    2009-01-01

    Diabetic nephropathy is characterized by increased oxidative stress and mitochondrial dysfunction. In the present study, we prepared primary cultures of proximal tubular (PT) cells from diabetic rats 30 days after an ip injection of streptozotocin and compared their susceptibility to oxidants (tert-butyl hydroperoxide, methyl vinyl ketone) and a mitochondrial toxicant (antimycin A) with that of PT cells isolated from age-matched control rats, to test the hypothesis that PT cells from diabetic rats exhibit more cellular and mitochondrial injury than those from control rats when exposed to these toxicants. PT cells from diabetic rats exhibited higher basal levels of reactive oxygen species (ROS) and higher mitochondrial membrane potential, demonstrating that the PT cells maintain the diabetic phenotype in primary culture. Incubation with either the oxidants or mitochondrial toxicant resulted in greater necrotic and apoptotic cell death, greater evidence of morphological damage, greater increases in ROS, and greater decreases in mitochondrial membrane potential in PT cells from diabetic rats than in those from control rats. Pretreatment with either the antioxidant N-acetyl-L-cysteine or a catalase mimetic provided equivalent protection of PT cells from both diabetic and control rats. Despite the greater susceptibility to oxidative and mitochondrial injury, both cytoplasmic and mitochondrial glutathione concentrations were markedly higher in PT cells from diabetic rats, suggesting an upregulation of antioxidant processes in diabetic kidney. These results support the hypothesis that primary cultures of PT cells from diabetic rats are a valid model in which to study renal cellular function in the diabetic state.

  15. Primary NK/T cell lymphoma nasal type of the colon

    Directory of Open Access Journals (Sweden)

    Ana María Chirife

    2013-02-01

    Full Text Available Since nasal NK/T-cell lymphoma and NK/T-cell lymphoma nasal type are rare diseases, colonic involvement has seldom been seen. We report a case of a patient with a primary NK/T-cell lymphoma nasal type of the colon. The patient had no history of malignant diseases and was diagnosed after exhaustive study in the context of fever of unknown origin. The first therapeutic approach followed the DAEPOCH-protocol: etoposide, prednisone, doxor-rubicin, vincristine and cyclophosphamide. The persistence of constitutional symptoms after the first treatment course motivated the switch to a second line following the SMILE-protocol: dexamethasone, metotrexate, ifosfamide, E.coli L-asparaginase, and etoposide. Despite intensive chemotherapy, the patient died 2 months after the diagnose of an extranodal NK/T-cell lymphoma of the colon and 4 months after the first symptomatic appearance of disease.

  16. Edge Detection Based On the Characteristic of Primary Visual Cortex Cells

    Science.gov (United States)

    Zhu, M. M.; Xu, Y. L.; Ma, H. Q.

    2018-01-01

    Aiming at the problem that it is difficult to balance the accuracy of edge detection and anti-noise performance, and referring to the dynamic and static perceptions of the primary visual cortex (V1) cells, a V1 cell model is established to perform edge detection. A spatiotemporal filter is adopted to simulate the receptive field of V1 simple cells, the model V1 cell is obtained after integrating the responses of simple cells by half-wave rectification and normalization, Then the natural image edge is detected by using static perception of V1 cells. The simulation results show that, the V1 model can basically fit the biological data and has the universality of biology. What’s more, compared with other edge detection operators, the proposed model is more effective and has better robustness

  17. Unexpected Anemia and Reticulocytopenia in an Adolescent With Sickle Cell Anemia Receiving Chronic Transfusion Therapy.

    Science.gov (United States)

    Blauel, Emily R; Grossmann, Lily T; Vissa, Madhav; Miller, Scott T

    2015-10-01

    In a patient with sickle cell disease receiving chronic transfusion, exacerbation of anemia with reticulocytopenia must prompt consideration of a delayed hemolytic transfusion reaction with hyperhemolysis, as further transfusion may worsen this condition; definitive diagnosis is sometimes difficult. Anemia evolving during parvovirus B19-induced erythroid hypoplasia (transient aplastic crisis) should be attenuated in chronic transfusion patients due to superior survival of transfused over endogenous red blood cells. A 16-year-old with sickle cell disease receiving chronic transfusion of modified intensity (goal to maintain hemoglobin S<50%) who developed symptomatic anemia with reticulocytopenia was later shown to have had transient aplastic crisis.

  18. Adenoviral Gene Delivery to Primary Human Cutaneous Cells and Burn Wounds

    OpenAIRE

    Hirsch, Tobias; von Peter, Sebastian; Dubin, Grzegorz; Mittler, Dominik; Jacobsen, Frank; Lehnhardt, Markus; Eriksson, Elof; Steinau, Hans-Ulrich; Steinstraesser, Lars

    2006-01-01

    The adenoviral transfer of therapeutic genes into epidermal and dermal cells is an interesting approach to treat skin diseases and to promote wound healing. The aim of this study was to assess the in vitro and in vivo transfection efficacy in skin and burn wounds after adenoviral gene delivery. Primary keratinocytes (HKC), fibroblasts (HFB), and HaCaT cells were transfected using different concentrations of an adenoviral construct (eGFP). Transfection efficiency and cytotoxicity was determine...

  19. Cytotoxic effects of denture adhesives on primary human oral keratinocytes, fibroblasts and permanent L929 cell lines.

    Science.gov (United States)

    Chen, Fengying; Wu, Tianfu; Cheng, Xiangrong

    2014-03-01

    To date, there have been very little data on the cytotoxic responses of different cell lines to denture adhesives. To determine the cytotoxicity of three denture adhesives on primary human oral keratinocytes (HOKs), fibroblasts (HOFs) and permanent mouse fibroblasts cell lines (L929). Three commercial denture adhesives (two creams and one powder) were prepared for indirect contact using the agar diffusion test, as well as extracts in MTT assay. The results of the MTT assay were statistically analysed by one-way anova and Tukey's test (p adhesives showed mild to moderate cytotoxicity to primary HOKs (p  0.05) in both assays. For primary HOFs cultures, slight cytotoxicity was observed for one of the products from the agar diffusion test and undiluted eluates of all tested adhesives with MTT assay (p adhesives are toxic to the primary HOKs and HOFs cultures, whereas non-toxic to L929 cells. The results suggest that primary human oral mucosal cells may provide more valuable information in toxicity screening of denture adhesives. © 2012 John Wiley & Sons A/S and The Gerodontology Association. Published by John Wiley & Sons Ltd.

  20. Primary candidiasis and squamous cell carcinoma of the larynx: report of a case.

    Science.gov (United States)

    Lee, Dong Hoon; Cho, Hyong Ho

    2013-02-01

    Primary candidiasis is rare and often confused with a pre-cancerous lesion, squamous cell carcinoma, or verrucous carcinoma. We report an extremely rare case of squamous cell carcinoma of the vocal cord following primary candidiasis. A 62-year-old man presented to our department reporting a 1-month history of hoarseness. He underwent laryngeal microscopic surgery for a presumptive diagnosis of glottic carcinoma. Histopathologic examination revealed candidiasis and scattered moderate dysplasia. He was treated with itraconazole for 4 weeks, and followed up without any recurrence of candidiasis. However, the 42-month follow-up examination revealed a focal whitish lesion on the right true vocal cord, and a repeat biopsy of this area revealed squamous cell carcinoma without evidence of candidiasis. The patient was treated with radiotherapy and remains well with no signs of tumor recurrence or candidiasis.

  1. Pure primary small cell carcinoma of urinary bladder: A rare diagnostic entity

    Directory of Open Access Journals (Sweden)

    Sonia Gon

    2013-01-01

    Full Text Available Small cell carcinoma of the bladder is a rare, aggressive, poorly differentiated neuroendocrine neoplasm accounting for only 0.3-0.7% of all bladder tumors. Since the tumor is very rare, pathogenesis is uncertain. Small cell carcinomas of the urinary bladder are mixed with classic urothelial carcinomas or adenocarcinomas of the bladder in 68% cases, making pure primary small cell carcinoma even a rarer entity. The unknown etiology and natural history of small cell carcinoma of the urinary bladder represent a challenge both to the pathologist and urologists for its diagnosis and treatment, respectively.

  2. Alginate foam-based three-dimensional culture to investigate drug sensitivity in primary leukaemia cells.

    Science.gov (United States)

    Karimpoor, Mahroo; Yebra-Fernandez, Eva; Parhizkar, Maryam; Orlu, Mine; Craig, Duncan; Khorashad, Jamshid S; Edirisinghe, Mohan

    2018-04-01

    The development of assays for evaluating the sensitivity of leukaemia cells to anti-cancer agents is becoming an important aspect of personalized medicine. Conventional cell cultures lack the three-dimensional (3D) structure of the bone marrow (BM), the extracellular matrix and stromal components which are crucial for the growth and survival of leukaemia stem cells. To accurately predict the sensitivity of the leukaemia cells in an in vitro assay a culturing system containing the essential components of BM is required. In this study, we developed a porous calcium alginate foam-based scaffold to be used for 3D culture. The new 3D culture was shown to be cell compatible as it supported the proliferation of both normal haematopoietic and leukaemia cells. Our cell differential assay for myeloid markers showed that the porous foam-based 3D culture enhanced myeloid differentiation in both leukaemia and normal haematopoietic cells compared to two-dimensional culture. The foam-based scaffold reduced the sensitivity of the leukaemia cells to the tested antileukaemia agents in K562 and HL60 leukaemia cell line model and also primary myeloid leukaemia cells. This observation supports the application of calcium alginate foams as scaffold components of the 3D cultures for investigation of sensitivity to antileukaemia agents in primary myeloid cells. © 2018 The Author(s).

  3. Mathematical modeling of a zinc/bromine flow cell and a lithium/thionyl chloride primary cell

    Energy Technology Data Exchange (ETDEWEB)

    Evans, T.I.

    1988-01-01

    Three mathematical models are presented, one for the secondary zinc/bromine flow cell and two for the lithium/thionyl chloride primary cell. The objectives in this modeling work are to aid in understanding the physical phenomena affecting cell performance, determine methods of improving cell performance and safety, and reduce the experimental efforts needed to develop these electrochemical systems. The zinc/bromine cell model is the first such model to include a porous layer on the bromine electrode and to predict discharge behavior. The model is used to solve simultaneously the component material balances and the electroneutrality condition for the unknowns, species concentrations and the solution potential. Two models are presented for the lithium/thionyl chloride cell. The first model is a detailed one-dimensional model which is used to solve simultaneously the component material balances, Ohm's law relations, and current balance. The independent design criteria are identified from the model development. The second model presented here is a two-dimensional thermal model for the spirally would configuration of the lithium/thionyl chloride cell. This is the first model to address the effects of the spiral geometry on heat transfer in the cell.

  4. Primary desmoplastic small round cell tumor of the femur

    International Nuclear Information System (INIS)

    Yoshida, Akihiko; Garcia, Joaquin; Edgar, Mark A.; Meyers, Paul A.; Morris, Carol D.; Panicek, David M.

    2008-01-01

    Desmoplastic small round cell tumor (DSRCT) is a rare malignant neoplasm typically involving the abdominal cavity of a young male. Extra-abdominal occurrence of this tumor is very rare. We report a 10-year-old girl with primary DSRCT arising within the left femur. The patient presented with knee pain, and radiological findings were strongly suggestive of osteogenic sarcoma. In addition to the typical microscopic appearance and immunophenotype, RT-PCR demonstrated the chimeric transcript of EWS-WT1, which is diagnostic of DSRCT. Pulmonary metastases were present at initial staging studies, but no abdominal or pelvic lesion was present. Despite chemotherapy and complete tumor excision, the patient developed progressive lung and bone metastases and died 3 years after initial presentation. This is the second reported case of primary DSRCT of bone with genetic confirmation. (orig.)

  5. Primary desmoplastic small round cell tumor of the femur

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Akihiko; Garcia, Joaquin [Memorial Sloan-Kettering Cancer Center, Department of Pathology, New York, NY (United States); Edgar, Mark A. [Memorial Sloan-Kettering Cancer Center, Department of Pathology, New York, NY (United States); Weill Medical College of Cornell University, New York, NY (United States); Meyers, Paul A. [Weill Medical College of Cornell University, New York, NY (United States); Memorial Sloan-Kettering Cancer Center, Department of Pediatrics, New York, NY (United States); Morris, Carol D. [Weill Medical College of Cornell University, New York, NY (United States); Memorial Sloan-Kettering Cancer Center, Department of Surgery, Orthopaedic Service, New York, NY (United States); Panicek, David M. [Weill Medical College of Cornell University, New York, NY (United States); Memorial Sloan-Kettering Cancer Center, Department of Radiology, New York, NY (United States)

    2008-09-15

    Desmoplastic small round cell tumor (DSRCT) is a rare malignant neoplasm typically involving the abdominal cavity of a young male. Extra-abdominal occurrence of this tumor is very rare. We report a 10-year-old girl with primary DSRCT arising within the left femur. The patient presented with knee pain, and radiological findings were strongly suggestive of osteogenic sarcoma. In addition to the typical microscopic appearance and immunophenotype, RT-PCR demonstrated the chimeric transcript of EWS-WT1, which is diagnostic of DSRCT. Pulmonary metastases were present at initial staging studies, but no abdominal or pelvic lesion was present. Despite chemotherapy and complete tumor excision, the patient developed progressive lung and bone metastases and died 3 years after initial presentation. This is the second reported case of primary DSRCT of bone with genetic confirmation. (orig.)

  6. Methods Development for the Isolation and Culture of Primary Corneal Endothelial Cells

    Science.gov (United States)

    2017-02-01

    a cell population particularly suitable for low serum propagation, provided that appropriate growth factors are available. A low serum medium...of MGK. 15. SUBJECT TERMS Cornea, chemical warfare agent, corneal endothelial cell, endothelium, growth , isolation, mouse, rabbit, porcine, in...with corneal SM exposure.2 A primary requirement in achieving this goal is to develop methods that enable the isolation of a pure CEC population and

  7. Integrated economic and experimental framework for screening of primary recovery technologies for high cell density CHO cultures.

    Science.gov (United States)

    Popova, Daria; Stonier, Adam; Pain, David; Titchener-Hooker, Nigel J; Farid, Suzanne S

    2016-07-01

    Increases in mammalian cell culture titres and densities have placed significant demands on primary recovery operation performance. This article presents a methodology which aims to screen rapidly and evaluate primary recovery technologies for their scope for technically feasible and cost-effective operation in the context of high cell density mammalian cell cultures. It was applied to assess the performance of current (centrifugation and depth filtration options) and alternative (tangential flow filtration (TFF)) primary recovery strategies. Cell culture test materials (CCTM) were generated to simulate the most demanding cell culture conditions selected as a screening challenge for the technologies. The performance of these technology options was assessed using lab scale and ultra scale-down (USD) mimics requiring 25-110mL volumes for centrifugation and depth filtration and TFF screening experiments respectively. A centrifugation and depth filtration combination as well as both of the alternative technologies met the performance selection criteria. A detailed process economics evaluation was carried out at three scales of manufacturing (2,000L, 10,000L, 20,000L), where alternative primary recovery options were shown to potentially provide a more cost-effective primary recovery process in the future. This assessment process and the study results can aid technology selection to identify the most effective option for a specific scenario. © 2016 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. The primary immune response to Vaccinia virus vaccination includes cells with a distinct cytotoxic effector CD4 T-cell phenotype.

    Science.gov (United States)

    Munier, C Mee Ling; van Bockel, David; Bailey, Michelle; Ip, Susanna; Xu, Yin; Alcantara, Sheilajen; Liu, Sue Min; Denyer, Gareth; Kaplan, Warren; Suzuki, Kazuo; Croft, Nathan; Purcell, Anthony; Tscharke, David; Cooper, David A; Kent, Stephen J; Zaunders, John J; Kelleher, Anthony D

    2016-10-17

    Smallpox was eradicated by a global program of inoculation with Vaccinia virus (VV). Robust VV-specific CD4 T-cell responses during primary infection are likely essential to controlling VV replication. Although there is increasing interest in cytolytic CD4 T-cells across many viral infections, the importance of these cells during acute VV infection is unclear. We undertook a detailed functional and genetic characterization of CD4 T-cells during acute VV-infection of humans. VV-specific T-cells were identified by up-regulation of activation markers directly ex vivo and through cytokine and co-stimulatory molecule expression. At day-13-post primary inoculation with VV, CD38highCD45RO+ CD4 T-cells were purified by cell sorting, RNA isolated and analysed by microarray. Differential expression of up-regulated genes in activated CD4 T-cells was confirmed at the mRNA and protein levels. We compared analyses of VV-specific CD4 T-cells to studies on 12 subjects with primary HIV infection (PHI). VV-specific T-cells lines were established from PBMCs collected post vaccination and checked for cytotoxicity potential. A median 11.9% CD4 T-cells were CD38highCD45RO+ at day-13 post-VV inoculation, compared to 3.0% prior and 10.4% during PHI. Activated CD4 T-cells had an up-regulation of genes related to cytolytic function, including granzymes K and A, perforin, granulysin, TIA-1, and Rab27a. No difference was seen between CD4 T-cell expression of perforin or TIA-1 to VV and PHI, however granzyme k was more dominant in the VV response. At 25:1 effector to target ratio, two VV-specific T-cell lines exhibited 62% and 30% cytotoxicity respectively and CD107a degranulation. We show for the first time that CD4 CTL are prominent in the early response to VV. Understanding the role of CD4 CTL in the generation of an effective anti-viral memory may help develop more effective vaccines for diseases such as HIV. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

  9. BAG3 promotes the phenotypic transformation of primary rat vascular smooth muscle cells via TRAIL.

    Science.gov (United States)

    Fu, Yao; Chang, Ye; Chen, Shuang; Li, Yuan; Chen, Yintao; Sun, Guozhe; Yu, Shasha; Ye, Ning; Li, Chao; Sun, Yingxian

    2018-05-01

    Under normal physiological condition, the mature vascular smooth muscle cells (VSMCs) show differentiated phenotype. In response to various environmental stimuluses, VSMCs convert from the differentiated phenotype to dedifferentiated phenotype characterized by the increased ability of proliferation/migration and the reduction of contractile ability. The phenotypic transformation of VSMCs played an important role in atherosclerosis. Both Bcl-2-associated athanogene 3 (BAG3) and tumor necrosis factor-related apopt-osis inducing ligand (TRAIL) involved in apoptosis. The relationship between BAG3 and TRAIL and their effects the proliferation and migration in VSMCs are rarely reported. This study investigated the effects of BAG3 on the phenotypic modulation and the potential underlying mechanisms in primary rat VSMCs. Primary rat VSMCs were extracted and cultured in vitro. Cell proliferation was detected by cell counting, real-time cell analyzer (RTCA) and EdU incorporation. Cell migration was detected by wound healing, Transwell and RTCA. BAG3 and TRAIL were detected using real-time PCR and western blotting and the secreted proteins in the cultured media by dot blot. The expression of BAG3 increased with continued passages in cultured primary VSMCs. BAG3 promoted the proliferation and migration of primary rat VSMC in a time-dependent manner. BAG3 significantly increased the expression of TRAIL while had no effects on its receptors. TRAIL knockdown or blocking by neutralizing antibody inhibited the proliferation of VSMCs induced by BAG3. TRAIL knockdown exerted no obvious influence on the migration of VSMCs. Based on this study, we report for the first time that BAG3 was expressed in cultured primary rat VSMCs and the expression of BAG3 increased with continued passages. Furthermore, BAG3 promoted the proliferation of VSMCs via increasing the expression of TRAIL. In addition, we also demonstrated that BAG3 promoted the migration of VSMCs independent of TRAIL

  10. Rate of primary refractory disease in B and T-cell non-Hodgkin's lymphoma: correlation with long-term survival.

    Directory of Open Access Journals (Sweden)

    Corrado Tarella

    Full Text Available BACKGROUND: Primary refractory disease is a main challenge in the management of non-Hodgkin's Lymphoma (NHL. This survey was performed to define the rate of refractory disease to first-line therapy in B and T-cell NHL subtypes and the long-term survival of primary refractory compared to primary responsive patients. METHODS: Medical records were reviewed of 3,106 patients who had undergone primary treatment for NHL between 1982 and 2012, at the Hematology Centers of Torino and Bergamo, Italy. Primary treatment included CHOP or CHOP-like regimens (63.2%, intensive therapy with autograft (16.9%, or other therapies (19.9%. Among B-cell NHL, 1,356 (47.8% received first-line chemotherapy with rituximab. Refractory disease was defined as stable/progressive disease, or transient response with disease progression within six months. RESULTS: Overall, 690 (22.2% patients showed primary refractory disease, with a higher incidence amongst T-cell compared to B-cell NHL (41.9% vs. 20.5%, respectively, p<0.001. Several other clinico-pathological factors at presentation were variably associated with refractory disease, including histological aggressive disease, unfavorable clinical presentation, Bone Marrow involvement, low lymphocyte/monocyte ration and male gender. Amongst B-cell NHL, the addition of rituximab was associated with a marked reduction of refractory disease (13.6% vs. 26.7% for non-supplemented chemotherapy, p<0.001. Overall, primary responsive patients had a median survival of 19.8 years, compared to 1.3 yr. for refractory patients. A prolonged survival was consistently observed in all primary responsive patients regardless of the histology. The long life expectancy of primary responsive patients was documented in both series managed before and after 2.000. Response to first line therapy resulted by far the most predictive factor for long-term outcome (HR for primary refractory disease: 16.52, p<0.001. CONCLUSION: Chemosensitivity to primary

  11. A CASE REPORT OF MULTIPLE PRIMARY SQUAMOUS CELL CARCINOMAS OF THE OVARY AND SIGMOID COLON

    Directory of Open Access Journals (Sweden)

    A. B. Villert

    2016-01-01

    Full Text Available Squamous cell ovarian and sigmoid colon carcinomas are extremely rare malignancies. Because of their rarity, it is difficult to investigate the clinical characteristics and prognosis of patients with theses malignancies, and therefore, the increased interest in each clinical case report is highly relevant. Multiple primary squamous cell ovarian and sigmoid colon carcinomas are the subject of discussion and differential diagnosis of sigmoid colon cancer with secondary ovarian cancer. Histopathological and clinical characteristics of the tumors were present and evidences in favor of the multiple primary malignancies were given. The association of squamous cell ovarian and sigmoid colon carcinomas with human papilloma virus type 16 was shown.

  12. Primary cilia: the chemical antenna regulating human adipose-derived stem cell osteogenesis.

    Directory of Open Access Journals (Sweden)

    Josephine C Bodle

    Full Text Available Adipose-derived stem cells (ASC are multipotent stem cells that show great potential as a cell source for osteogenic tissue replacements and it is critical to understand the underlying mechanisms of lineage specification. Here we explore the role of primary cilia in human ASC (hASC differentiation. This study focuses on the chemosensitivity of the primary cilium and the action of its associated proteins: polycystin-1 (PC1, polycystin-2 (PC2 and intraflagellar transport protein-88 (IFT88, in hASC osteogenesis. To elucidate cilia-mediated mechanisms of hASC differentiation, siRNA knockdown of PC1, PC2 and IFT88 was performed to disrupt cilia-associated protein function. Immunostaining of the primary cilium structure indicated phenotypic-dependent changes in cilia morphology. hASC cultured in osteogenic differentiation media yielded cilia of a more elongated conformation than those cultured in expansion media, indicating cilia-sensitivity to the chemical environment and a relationship between the cilium structure and phenotypic determination. Abrogation of PC1, PC2 and IFT88 effected changes in both hASC proliferation and differentiation activity, as measured through proliferative activity, expression of osteogenic gene markers, calcium accretion and endogenous alkaline phosphatase activity. Results indicated that IFT88 may be an early mediator of the hASC differentiation process with its knockdown increasing hASC proliferation and decreasing Runx2, alkaline phosphatase and BMP-2 mRNA expression. PC1 and PC2 knockdown affected later osteogenic gene and end-product expression. PC1 knockdown resulted in downregulation of alkaline phosphatase and osteocalcin gene expression, diminished calcium accretion and reduced alkaline phosphatase enzymatic activity. Taken together our results indicate that the structure of the primary cilium is intimately associated with the process of hASC osteogenic differentiation and that its associated proteins are critical

  13. Comparative Analysis of the Hematopoietic Progenitor Cells from Placenta, Cord Blood, and Fetal Liver, Based on Their Immunophenotype

    Directory of Open Access Journals (Sweden)

    Maria D. Kuchma

    2015-01-01

    Full Text Available We have investigated the characteristics of human hematopoietic progenitor cells (HPCs with the CD34+CD45lowSSClow phenotype from full-term placental tissue (FTPT as compared to cord blood (CB and fetal liver (FL cells. We demonstrated the presence of cell subpopulations at various stages of the differentiation with such immunophenotypes as CD34+/lowCD45low/-, CD34++CD45low/-, CD34+++CD45low/-, CD34+/lowCD45hi, and CD34++CD45hi in both first trimester placental tissue (FiTPT and FTPT which implies their higher phenotypic heterogeneity compared to CB. HPCs of the FTPT origin expressed the CD90 antigen at a higher level compared to its expression by the CB HPCs and the CD133 antigen expression being at the same level in both cases. The HPCs compartment of FTPT versus CB contained higher number of myeloid and erythroid committed cells but lower number of myeloid and lymphoid ones compared to FL HPCs. HPCs of the FTPT and CB origin possess similar potentials for the multilineage differentiation in vitro and similar ratios of myeloid and erythroid progenitors among the committed cells. This observation suggests that the active hematopoiesis occurs in the FTPT. We obtained viable HPCs from cryopreserved placental tissue fragments allowing us to develop procedures for banking and testing of placenta-derived HPCs for clinical use.

  14. High-throughput gene expression profiling of memory differentiation in primary human T cells

    Directory of Open Access Journals (Sweden)

    Russell Kate

    2008-08-01

    Full Text Available Abstract Background The differentiation of naive T and B cells into memory lymphocytes is essential for immunity to pathogens. Therapeutic manipulation of this cellular differentiation program could improve vaccine efficacy and the in vitro expansion of memory cells. However, chemical screens to identify compounds that induce memory differentiation have been limited by 1 the lack of reporter-gene or functional assays that can distinguish naive and memory-phenotype T cells at high throughput and 2 a suitable cell-line representative of naive T cells. Results Here, we describe a method for gene-expression based screening that allows primary naive and memory-phenotype lymphocytes to be discriminated based on complex genes signatures corresponding to these differentiation states. We used ligation-mediated amplification and a fluorescent, bead-based detection system to quantify simultaneously 55 transcripts representing naive and memory-phenotype signatures in purified populations of human T cells. The use of a multi-gene panel allowed better resolution than any constituent single gene. The method was precise, correlated well with Affymetrix microarray data, and could be easily scaled up for high-throughput. Conclusion This method provides a generic solution for high-throughput differentiation screens in primary human T cells where no single-gene or functional assay is available. This screening platform will allow the identification of small molecules, genes or soluble factors that direct memory differentiation in naive human lymphocytes.

  15. Squamous cell carcinoma presenting with trigeminal anesthesia: An uncommon presentation of head & neck cancer with unknown primary.

    Science.gov (United States)

    Shah, Ameer T; Dagher, Walid I; O'Leary, Miriam A; Wein, Richard O

    The differential diagnosis of facial anesthesia is vast. This may be secondary to trauma, neoplasm, both intracranial and extracranial, infection, and neurologic disease. When evaluating a patient with isolated facial anesthesia, the head and neck surgeon often thinks of adenoid cystic carcinoma, which has a propensity for perineural invasion and spread. When one thinks of head and neck squamous cell carcinoma with or without unknown primary, the typical presentation involves dysphagia, odynophagia, weight loss, hoarseness, or more commonly, a neck mass. Squamous cell carcinoma presenting as facial anesthesia and perineural spread, with no primary site is quite rare. Case presentations and review of the literature. Trigeminal anesthesia is an uncommon presentation of head and neck squamous cell carcinoma with unknown primary. We present two interesting cases of invasive squamous cell carcinoma of the trigeminal nerve, with no primary site identified. We will also review the literature of head and neck malignancies with perineural spread and the management techniques for the two different cases presented. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Phase 1 Study of a Sulforaphane-Containing Broccoli Sprout Homogenate for Sickle Cell Disease.

    Directory of Open Access Journals (Sweden)

    Jennifer F Doss

    Full Text Available Sickle cell disease (SCD is the most common inherited hemoglobinopathy worldwide. Our previous results indicate that the reduced oxidative stress capacity of sickle erythrocytes may be caused by decreased expression of NRF2 (Nuclear factor (erythroid-derived 2-like 2, an oxidative stress regulator. We found that activation of NRF2 with sulforaphane (SFN in erythroid progenitors significantly increased the expression of NRF2 targets HMOX1, NQO1, and HBG1 (subunit of fetal hemoglobin in a dose-dependent manner. Therefore, we hypothesized that NRF2 activation with SFN may offer therapeutic benefits for SCD patients by restoring oxidative capacity and increasing fetal hemoglobin concentration. To test this hypothesis, we performed a Phase 1, open-label, dose-escalation study of SFN, contained in a broccoli sprout homogenate (BSH that naturally contains SFN, in adults with SCD. The primary and secondary study endpoints were safety and physiological response to NRF2 activation, respectively. We found that BSH was well tolerated, and the few adverse events that occurred during the trial were not likely related to BSH consumption. We observed an increase in the mean relative whole blood mRNA levels for the NRF2 target HMOX1 (p = 0.02 on the last day of BSH treatment, compared to pre-treatment. We also observed a trend toward increased mean relative mRNA levels of the NRF2 target HBG1 (p = 0.10 from baseline to end of treatment, but without significant changes in HbF protein. We conclude that BSH, in the provided doses, is safe in stable SCD patients and may induce changes in gene expression levels. We therefore propose investigation of more potent NRF2 inducers, which may elicit more robust physiological changes and offer clinical benefits to SCD patients. Trial registration: ClinicalTrials.gov NCT01715480.

  17. Primary Human Uterine Leiomyoma Cell Culture Quality Control: Some Properties of Myometrial Cells Cultured under Serum Deprivation Conditions in the Presence of Ovarian Steroids.

    Science.gov (United States)

    Bonazza, Camila; Andrade, Sheila Siqueira; Sumikawa, Joana Tomomi; Batista, Fabrício Pereira; Paredes-Gamero, Edgar J; Girão, Manoel J B C; Oliva, Maria Luiza V; Castro, Rodrigo Aquino

    2016-01-01

    Cell culture is considered the standard media used in research to emulate the in vivo cell environment. Crucial in vivo experiments cannot be conducted in humans and depend on in vitro methodologies such as cell culture systems. However, some procedures involving the quality control of cells in culture have been gradually neglected by failing to acknowledge that primary cells and cell lines change over time in culture. Thus, we report methods based on our experience for monitoring primary cell culture of human myometrial cells derived from uterine leiomyoma. We standardized the best procedure of tissue dissociation required for the study of multiple genetic marker systems that include species-specific antigens, expression of myofibroblast or myoblast markers, growth curve, serum deprivation, starvation by cell cycle synchronization, culture on collagen coated plates, and 17 β-estradiol (E2) and progesterone (P4) effects. The results showed that primary myometrial cells from patients with uterine leiomyoma displayed myoblast phenotypes before and after in vitro cultivation, and leiomyoma cells differentiated into mature myocyte cells under the appropriate differentiation-inducing conditions (serum deprivation). These cells grew well on collagen coated plates and responded to E2 and P4, which may drive myometrial and leiomyoma cells to proliferate and adhere into a focal adhesion complex involvement in a paracrine manner. The establishment of these techniques as routine procedures will improve the understanding of the myometrial physiology and pathogenesis of myometrium-derived diseases such as leiomyoma. Mimicking the in vivo environment of fibrotic conditions can prevent false results and enhance results that are based on cell culture integrity.

  18. Defining the Minimal Factors Required for Erythropoiesis through Direct Lineage Conversion

    Directory of Open Access Journals (Sweden)

    Sandra Capellera-Garcia

    2016-06-01

    Full Text Available Erythroid cell commitment and differentiation proceed through activation of a lineage-restricted transcriptional network orchestrated by a group of well characterized genes. However, the minimal set of factors necessary for instructing red blood cell (RBC development remains undefined. We employed a screen for transcription factors allowing direct lineage reprograming from fibroblasts to induced erythroid progenitors/precursors (iEPs. We show that Gata1, Tal1, Lmo2, and c-Myc (GTLM can rapidly convert murine and human fibroblasts directly to iEPs. The transcriptional signature of murine iEPs resembled mainly that of primitive erythroid progenitors in the yolk sac, whereas addition of Klf1 or Myb to the GTLM cocktail resulted in iEPs with a more adult-type globin expression pattern. Our results demonstrate that direct lineage conversion is a suitable platform for defining and studying the core factors inducing the different waves of erythroid development.

  19. Differential expression of c-Met between primary and metastatic sites in clear-cell renal cell carcinoma and its association with PD-L1 expression.

    Science.gov (United States)

    Lalani, Aly-Khan A; Gray, Kathryn P; Albiges, Laurence; Callea, Marcella; Pignon, Jean-Christophe; Pal, Soumitro; Gupta, Mamta; Bhatt, Rupal S; McDermott, David F; Atkins, Michael B; Woude, G F Vande; Harshman, Lauren C; Choueiri, Toni K; Signoretti, Sabina

    2017-11-28

    In preclinical models, c-Met promotes survival of renal cancer cells through the regulation of programmed death-ligand 1 (PD-L1). However, this relationship in human clear cell renal cell carcinoma (ccRCC) is not well characterized. We evaluated c-Met expression in ccRCC patients using paired primary and metastatic samples and assessed the association with PD-L1 expression and other clinical features. Areas with predominant and highest Fuhrman nuclear grade (FNG) were selected. c-Met expression was evaluated by IHC using an anti-Met monoclonal antibody (MET4 Ab) and calculated by a combined score (CS, 0-300): intensity of c-Met staining (0-3) x % of positive cells (0-100). PD-L1 expression in tumor cells was previously assessed by IHC and PD-L1+ was defined as PD-L1 > 0% positive cells. Our cohort consisted of 45 pairs of primary and metastatic ccRCC samples. Overall, c-Met expression was higher in metastatic sites compared to primary sites (average c-Met CS: 55 vs. 28, p = 0.0003). Higher c-Met expression was associated with higher FNG (4 vs. 3) in primary tumors (average c-Met CS: 52 vs. 20, p = 0.04). c-Met expression was numerically greater in PD-L1+ vs. PD-L1- tumors. Higher c-Met expression in metastatic sites compared to primary tumors suggests that testing for biomarkers of response to c-Met inhibitors should be conducted in metastases. While higher c-Met expression in PD-L1+ tumors requires further investigation, it supports exploring these targets in combination clinical trials.

  20. Multiple Primary Merkel Cell Carcinomas Presenting as Pruritic, Painful Lower Leg Tumors

    Science.gov (United States)

    Blumenthal, Laura; VandenBoom, Timothy; Melian, Edward; Peterson, Anthony; Hutchens, Kelli A.

    2015-01-01

    Merkel cell carcinoma (MCC) is a rare and highly aggressive neuroendocrine tumor of the skin which almost exclusively presents as a solitary tumor. It is most often seen on sun-exposed regions, historically almost exclusively on the head and neck, with only rare case reports on the extremities. Although recent studies have shown increased incidence with up to 20% on the extremities, here we present one of these rare emerging presentations, with the addition of a unique treatment option. Our patient is an 80-year-old male with a 3-month history of multiple raised, rapidly enlarging tumors on the right ankle. Two separate biopsies were performed and demonstrated sheets and clusters of small blue cells filling the dermis with scant cytoplasm, dusty chromatin, and nuclear molding. Subsequent immunohistochemical stains confirmed the diagnosis of multiple primary MCC. Despite the characteristic immunohistochemical profile of primary MCC, the possibility of a metastatic neuroendocrine carcinoma from an alternate primary site was entertained, given his unusual clinical presentation. A complete clinical workup including CT scans of the chest, abdomen, and pelvis showed no evidence of disease elsewhere. Instead of amputation, the patient opted for nonsurgical treatment with radiation therapy alone, resulting in a rapid and complete response. This case represents an unusual presentation of primary MCC and demonstrates further evidence that radiation as monotherapy is an effective local treatment option for inoperable MCC. PMID:26594171

  1. Protein kinase Cɛ inhibition restores megakaryocytic differentiation of hematopoietic progenitors from primary myelofibrosis patients.

    Science.gov (United States)

    Masselli, E; Carubbi, C; Gobbi, G; Mirandola, P; Galli, D; Martini, S; Bonomini, S; Crugnola, M; Craviotto, L; Aversa, F; Vitale, M

    2015-11-01

    Among the three classic Philadelphia chromosome-negative myeloproliferative neoplasms, primary myelofibrosis (PMF) is the most severe in terms of disease biology, survival and quality of life. Abnormalities in the process of differentiation of PMF megakaryocytes (MKs) are a hallmark of the disease. Nevertheless, the molecular events that lead to aberrant megakaryocytopoiesis have yet to be clarified. Protein kinase Cɛ (PKCɛ) is a novel serine/threonine kinase that is overexpressed in a variety of cancers, promoting aggressive phenotype, invasiveness and drug resistance. Our previous findings on the role of PKCɛ in normal (erythroid and megakaryocytic commitment) and malignant (acute myeloid leukemia) hematopoiesis prompted us to investigate whether it could be involved in the pathogenesis of PMF MK-impaired differentiation. We demonstrate that PMF megakaryocytic cultures express higher levels of PKCɛ than healthy donors, which correlate with higher disease burden but not with JAK2V617F mutation. Inhibition of PKCɛ function (by a negative regulator of PKCɛ translocation) or translation (by target small hairpin RNA) leads to reduction in PMF cell growth, restoration of PMF MK differentiation and inhibition of PKCɛ-related anti-apoptotic signaling (Bcl-xL). Our data suggest that targeting PKCɛ directly affects the PMF neoplastic clone and represent a proof-of-concept for PKCɛ inhibition as a novel therapeutic strategy in PMF.

  2. Human Primary Trophoblast Cell Culture Model to Study the Protective Effects of Melatonin Against Hypoxia/reoxygenation-induced Disruption.

    Science.gov (United States)

    Sagrillo-Fagundes, Lucas; Clabault, Hélène; Laurent, Laetitia; Hudon-Thibeault, Andrée-Anne; Salustiano, Eugênia Maria Assunção; Fortier, Marlène; Bienvenue-Pariseault, Josianne; Wong Yen, Philippe; Sanderson, J Thomas; Vaillancourt, Cathy

    2016-07-30

    This protocol describes how villous cytotrophoblast cells are isolated from placentas at term by successive enzymatic digestions, followed by density centrifugation, media gradient isolation and immunomagnetic purification. As observed in vivo, mononucleated villous cytotrophoblast cells in primary culture differentiate into multinucleated syncytiotrophoblast cells after 72 hr. Compared to normoxia (8% O2), villous cytotrophoblast cells that undergo hypoxia/reoxygenation (0.5% / 8% O2) undergo increased oxidative stress and intrinsic apoptosis, similar to that observed in vivo in pregnancy complications such as preeclampsia, preterm birth, and intrauterine growth restriction. In this context, primary villous trophoblasts cultured under hypoxia/reoxygenation conditions represent a unique experimental system to better understand the mechanisms and signalling pathways that are altered in human placenta and facilitate the search for effective drugs that protect against certain pregnancy disorders. Human villous trophoblasts produce melatonin and express its synthesizing enzymes and receptors. Melatonin has been suggested as a treatment for preeclampsia and intrauterine growth restriction because of its protective antioxidant effects. In the primary villous cytotrophoblast cell model described in this paper, melatonin has no effect on trophoblast cells in normoxic state but restores the redox balance of syncytiotrophoblast cells disrupted by hypoxia/reoxygenation. Thus, human villous trophoblast cells in primary culture are an excellent approach to study the mechanisms behind the protective effects of melatonin on placental function during hypoxia/reoxygenation.

  3. CT findings of primary squamous cell carcinoma of the stomach: a case report

    International Nuclear Information System (INIS)

    Kim, Kyoung Min; Lee, Chang Hee; Kim, Kyeong Ah; Park, Cheol Min

    2008-01-01

    Primary squamous cell carcinoma is a rare tumor of the stomach with an incidence ranging from 0.04% to 0.4% of all diagnosed gastric cancers. We report a case of squamous cell carcinoma in the stomach associated with hypertrophic gastropathy and observed as a huge mass and wall thickening on the greater curvature site by a multidetector CT

  4. Factors associated with a primary surgical approach for sinonasal squamous cell carcinoma.

    Science.gov (United States)

    Cracchiolo, Jennifer R; Patel, Krupa; Migliacci, Jocelyn C; Morris, Luc T; Ganly, Ian; Roman, Benjamin R; McBride, Sean M; Tabar, Viviane S; Cohen, Marc A

    2018-03-01

    Primary surgery is the preferred treatment of T1-T4a sinonasal squamous cell carcinoma (SNSCC). Patients with SNSCC in the National Cancer Data Base (NCDB) were analyzed. Factors that contributed to selecting primary surgical treatment were examined. Overall survival (OS) in surgical patients was analyzed. Four-thousand seven hundred and seventy patients with SNSCC were included. In T1-T4a tumors, lymph node metastases, maxillary sinus location, and treatment at high-volume centers were associated with selecting primary surgery. When primary surgery was utilized, tumor factors and positive margin guided worse OS. Adjuvant therapy improved OS in positive margin resection and advanced T stage cases. Tumor and non-tumor factors are associated with selecting surgery for the treatment of SNSCC. When surgery is selected, tumor factors drive OS. Negative margin resection should be the goal of a primary surgical approach. When a positive margin resection ensues, adjuvant therapy may improve OS. © 2017 Wiley Periodicals, Inc.

  5. Multivalent dendrimeric compounds containing carbohydrates expressed on immune cells inhibit infection by primary isolates of HIV-1

    International Nuclear Information System (INIS)

    Rosa Borges, Andrew; Wieczorek, Lindsay; Johnson, Benitra; Benesi, Alan J.; Brown, Bruce K.; Kensinger, Richard D.; Krebs, Fred C.; Wigdahl, Brian; Blumenthal, Robert; Puri, Anu; McCutchan, Francine E.; Birx, Deborah L.; Polonis, Victoria R.; Schengrund, Cara-Lynne

    2010-01-01

    Specific glycosphingolipids (GSL), found on the surface of target immune cells, are recognized as alternate cell surface receptors by the human immunodeficiency virus type 1 (HIV-1) external envelope glycoprotein. In this study, the globotriose and 3'-sialyllactose carbohydrate head groups found on two GSL were covalently attached to a dendrimer core to produce two types of unique multivalent carbohydrates (MVC). These MVC inhibited HIV-1 infection of T cell lines and primary peripheral blood mononuclear cells (PBMC) by T cell line-adapted viruses or primary isolates, with IC 50 s ranging from 0.1 to 7.4 μg/ml. Inhibition of Env-mediated membrane fusion by MVC was also observed using a dye-transfer assay. These carbohydrate compounds warrant further investigation as a potential new class of HIV-1 entry inhibitors. The data presented also shed light on the role of carbohydrate moieties in HIV-1 virus-host cell interactions. -- Research Highlights: →Multivalent carbohydrates (MVCs) inhibited infection of PBMCs by HIV-1. →MVCs inhibited infection by T cell line-adapted viruses. →MVCs inhibited infection by primary isolates of HIV-1. →MVCs inhibited Env-mediated membrane fusion.

  6. Different surface sensing of the cell body and nucleus in healthy primary cells and in a cancerous cell line on nanogrooves.

    Science.gov (United States)

    Davidson, Patricia M; Bigerelle, Maxence; Reiter, Günter; Anselme, Karine

    2015-10-01

    Cancer cells are known to have alterations compared to healthy cells, but can these differences extend to the way cells interact with their environment? Here, the authors focused on the alignment on an array of grooves of nanometer depth using two cell types: healthy osteoprogenitor primary cells (HOP) and a cancerous osteosarcoma (SaOs-2) cell line. Another concern was how this alignment affects the cell's interior, namely, the nucleus. Based on the results, it is proposed that these two cell types respond to different size regimes: SaOs-2 cells are more sensitive to shallow grooves while HOP cells are strongly aligned with deep grooves. As a measure of the impact of cell alignment on the nucleus the orientation and elongation of the nucleus were determined. Compared to HOP cells, the cell nucleus of SaOs-2 cells is more aligned and elongated in response to grooves, suggesting a softer nucleus and/or increased force transmission. These results support the hypothesis that cancer cells have reduced nucleus rigidity compared to healthy ones and further indicate differences in sensing, which may be important during metastasis.

  7. Glucocorticoids promote a glioma stem cell-like phenotype and resistance to chemotherapy in human glioblastoma primary cells

    DEFF Research Database (Denmark)

    Kostopoulou, Ourania N; Mohammad, Abdul-Aleem; Bartek, Jiri

    2018-01-01

    Glioma stem cells (GSCs) are glioblastoma (GBM) cells that are resistant to therapy and can give rise to recurrent tumors. The identification of patient-related factors that support GSCs is thus necessary to design effective therapies for GBM patients. Glucocorticoids (GCs) are used to treat GBM......-associated edema. However, glucocorticoids participate in the physiological response to psychosocial stress, which has been linked to poor cancer prognosis. This raises concern that glucocorticoids affect the tumor and GSCs. Here, we treated primary human GBM cells with dexamethasone and evaluated GC......-driven changes in cell morphology, proliferation, migration, gene expression, secretory activity and growth as neurospheres. Dexamethasone treatment of GBM cells appeared to promote the development of a GSC-like phenotype and conferred resistance to physiological stress and chemotherapy. We also analyzed...

  8. Concise review: stem cell-based approaches to red blood cell production for transfusion.

    Science.gov (United States)

    Shah, Siddharth; Huang, Xiaosong; Cheng, Linzhao

    2014-03-01

    Blood transfusion is a common procedure in modern medicine, and it is practiced throughout the world; however, many countries report a less than sufficient blood supply. Even in developed countries where the supply is currently adequate, projected demographics predict an insufficient supply as early as 2050. The blood supply is also strained during occasional widespread disasters and crises. Transfusion of blood components such as red blood cells (RBCs), platelets, or neutrophils is increasingly used from the same blood unit for multiple purposes and to reduce alloimmune responses. Even for RBCs and platelets lacking nuclei and many antigenic cell-surface molecules, alloimmunity could occur, especially in patients with chronic transfusion requirements. Once alloimmunization occurs, such patients require RBCs from donors with a different blood group antigen combination, making it a challenge to find donors after every successive episode of alloimmunization. Alternative blood substitutes such as synthetic oxygen carriers have so far proven unsuccessful. In this review, we focus on current research and technologies that permit RBC production ex vivo from hematopoietic stem cells, pluripotent stem cells, and immortalized erythroid precursors.

  9. Chapter 10 the primary cilium coordinates signaling pathways in cell cycle control and migration during development and tissue repair

    DEFF Research Database (Denmark)

    Christensen, Søren T; Pedersen, Stine F; Satir, Peter

    2008-01-01

    Cell cycle control and migration are critical processes during development and maintenance of tissue functions. Recently, primary cilia were shown to take part in coordination of the signaling pathways that control these cellular processes in human health and disease. In this review, we present...... an overview of the function of primary cilia and the centrosome in the signaling pathways that regulate cell cycle control and migration with focus on ciliary signaling via platelet-derived growth factor receptor alpha (PDGFRalpha). We also consider how the primary cilium and the centrosome interact...... with the extracellular matrix, coordinate Wnt signaling, and modulate cytoskeletal changes that impinge on both cell cycle control and cell migration....

  10. FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia

    International Nuclear Information System (INIS)

    Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K

    2011-01-01

    The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6

  11. MET Expression in Primary and Metastatic Clear Cell Renal Cell Carcinoma: Implications of Correlative Biomarker Assessment to MET Pathway Inhibitors

    Directory of Open Access Journals (Sweden)

    Brian Shuch

    2015-01-01

    Full Text Available Aims. Inhibitors of the MET pathway hold promise in the treatment for metastatic kidney cancer. Assessment of predictive biomarkers may be necessary for appropriate patient selection. Understanding MET expression in metastases and the correlation to the primary site is important, as distant tissue is not always available. Methods and Results. MET immunofluorescence was performed using automated quantitative analysis and a tissue microarray containing matched nephrectomy and distant metastatic sites from 34 patients with clear cell renal cell carcinoma. Correlations between MET expressions in matched primary and metastatic sites and the extent of heterogeneity were calculated. The mean expression of MET was not significantly different between primary tumors when compared to metastases (P=0.1. MET expression weakly correlated between primary and matched metastatic sites (R=0.5 and a number of cases exhibited very high levels of discordance between these tumors. Heterogeneity within nephrectomy specimens compared to the paired metastatic tissues was not significantly different (P=0.39. Conclusions. We found that MET expression is not significantly different in primary tumors than metastatic sites and only weakly correlates between matched sites. Moderate concordance of MET expression and significant expression heterogeneity may be a barrier to the development of predictive biomarkers using MET targeting agents.

  12. Phenotypic characterization of telomerase-immortalized primary non-malignant and malignant tumor-derived human prostate epithelial cell lines

    International Nuclear Information System (INIS)

    Gu Yongpeng; Li Hongzhen; Miki, Jun; Kim, Kee-Hong; Furusato, Bungo; Sesterhenn, Isabell A.; Chu, Wei-Sing; McLeod, David G.; Srivastava, Shiv; Ewing, Charles M.; Isaacs, William B.; Rhim, Johng S.

    2006-01-01

    In vitro human prostate cell culture models are critical for clarifying the mechanism of prostate cancer progression and for testing preventive and therapeutic agents. Cell lines ideal for the study of human primary prostate tumors would be those derived from spontaneously immortalized tumor cells; unfortunately, explanted primary prostate cells survive only short-term in culture, and rarely immortalize spontaneously. Therefore, we recently have generated five immortal human prostate epithelial cell cultures derived from both the benign and malignant tissues of prostate cancer patients with telomerase, a gene that prevents cellular senescence. Examination of these cell lines for their morphologies and proliferative capacities, their abilities to grow in low serum, to respond to androgen stimulation, to grow above the agar layer, to form tumors in SCID mice, suggests that they may serve as valid, useful tools for the elucidation of early events in prostate tumorigenesis. Furthermore, the chromosome alterations observed in these immortalized cell lines expressing aspects of the malignant phenotypes imply that these cell lines accurately recapitulate the genetic composition of primary tumors. These novel in vitro models may offer unique models for the study of prostate carcinogenesis and also provide the means for testing both chemopreventive and chemotherapeutic agents

  13. Analysis of the receptor-mediated B19V mechanism of internalization in the endothelial B19V infection and adenovirus-mediated reactivation of B19V in endothelial cells

    OpenAIRE

    Pozzuto, Tanja

    2012-01-01

    Human Parvovirus B19 (B19V) is the causative agent of erythema infectiosum, hydrops fetalis, aplastic crises and polyarthritis. B19V displays a very narrow cell and tissue tropism with productive infection thought to be restricted exclusively to erythroid progenitor cells in the bone marrow and fetal liver. However, over the last years increasing evidence for the presence of B19V DNA in other cell types and tissues such as synovial fibroblasts, tonsilles and skin as well as endothelial cells ...

  14. TGF-β signaling is an effective target to impair survival and induce apoptosis of human cholangiocarcinoma cells: A study on human primary cell cultures.

    Directory of Open Access Journals (Sweden)

    Anna Maria Lustri

    Full Text Available Cholangiocarcinoma (CCA and its subtypes (mucin- and mixed-CCA arise from the neoplastic transformation of cholangiocytes, the epithelial cells lining the biliary tree. CCA has a high mortality rate owing to its aggressiveness, late diagnosis and high resistance to radiotherapy and chemotherapeutics. We have demonstrated that CCA is enriched for cancer stem cells which express epithelial to mesenchymal transition (EMT traits, with these features being associated with aggressiveness and drug resistance. TGF-β signaling is upregulated in CCA and involved in EMT. We have recently established primary cell cultures from human mucin- and mixed-intrahepatic CCA. In human CCA primary cultures with different levels of EMT trait expression, we evaluated the anticancer effects of: (i CX-4945, a casein kinase-2 (CK2 inhibitor that blocks TGF-β1-induced EMT; and (ii LY2157299, a TGF-β receptor I kinase inhibitor. We tested primary cell lines expressing EMT trait markers (vimentin, N-cadherin and nuclear catenin but negative for epithelial markers, and cell lines expressing epithelial markers (CK19-positive in association with EMT traits. Cell viability was evaluated by MTS assays, apoptosis by Annexin V FITC and cell migration by wound-healing assay.at a dose of 10 μM, CX4945 significantly decreased cell viability of primary human cell cultures from both mucin and mixed CCA, whereas in CK19-positive cell cultures, the effect of CX4945 on cell viability required higher concentrations (>30μM. At the same concentrations, CX4945 also induced apoptosis (3- fold increase vs controls which correlated with the expression level of CK2 in the different CCA cell lines (mucin- and mixed-CCA. Indeed, no apoptotic effects were observed in CK19-positive cells expressing lower CK2 levels. The effects of CX4945 on viability and apoptosis were associated with an increased number of γ-H2ax (biomarker for DNA double-strand breaks foci, suggesting the active role of CK2 as

  15. Differential effect of L3T4+ cells on recovery from total-body irradiation

    International Nuclear Information System (INIS)

    Pantel, K.; Nakeff, A.

    1990-01-01

    We have examined the importance of L3T4+ (murine equivalent to CD4+) cells for hematopoietic regulation in vivo in unperturbed mice and mice recovering from total-body irradiation (TBI) using a cytotoxic monoclonal antibody (MoAb) raised with the GK 1.5 hybridoma. Ablating L3T4+ cells in normal (unperturbed) B6D2F1 mice substantially decreased the S-phase fraction (determined by in vivo hydroxyurea suicide) of erythroid progenitor cells (erythroid colony-forming units, CFU-E) as compared to the pretreatment level (10% +/- 14.1% [day 3 following depletion] vs 79.8% +/- 15.9%, respectively) with a corresponding decrease in the marrow content of CFU-E at this time to approximately 1% of the pretreatment value. Although the S-phase fraction of CFU-GM was decreased to 2.2% +/- 3.1% 3 days after L3T4+ cell ablation from the 21.3% +/- 8.3% pretreatment value, CFU-GM cellularity showed little change over the 3 days following anti-L3T4 treatment. Anti-L3T4 MoAb treatment had little or no effect on either the S-phase fraction or the marrow content of hematopoietic stem cells (spleen colony-forming units, CFU-S) committed to myeloerythroid differentiation. Ablating L3T4+ cells prior to a single dose of 2 Gy TBI resulted in significantly reduced marrow contents of CFU-S on day 3 and granulocyte-macrophage colony-forming units (CFU-GM) on day 6 following TBI, with little or no effect on the corresponding recovery of CFU-E. The present findings provide the first in vivo evidence that L3T4+ cells are involved in: (1) maintaining the proliferative activity of CFU-E and CFU-GM in unperturbed mice and (2) supporting the restoration of CFU-S and CFU-GM following TBI-induced myelosuppression

  16. Effects of trichostatins on differentiation of murine erythroleukemia cells

    International Nuclear Information System (INIS)

    Yoshida, M.; Nomura, S.; Beppu, T.

    1987-01-01

    The fungistatic antibiotics trichostatins (TS) A and C were isolated from culture broth of Streptomyces platensis No. 145 and were found to be potent inducers of differentiation in murine erythroleukemia (Friend and RV133) cells at concentrations of 1.5 X 10(-8) M for TSA and 5 X 10(-7) M for TSC. Differentiation induced by TS was cooperatively enhanced by UV irradiation but not by treatment with dimethyl sulfoxide. This enhanced activity was completely inhibited by adding cycloheximide to the culture medium 2 h after exposure to TS, suggesting that TS are dimethyl sulfoxide-type inducers of erythroid differentiation. No inhibitory effect of TS was observed on macromolecular synthesis in cultured cells

  17. The Silencing of Pokemon Attenuates the Proliferation of Hepatocellular Carcinoma Cells In Vitro and In Vivo by Inhibiting the PI3K/Akt Pathway

    OpenAIRE

    Lin, Chan-Chan; Zhou, Jing-Ping; Liu, Yun-Peng; Liu, Jing-Jing; Yang, Xiao-Ning; Jazag, Amarsanaa; Zhang, Zhi-Ping; Guleng, Bayasi; Ren, Jian-Lin

    2012-01-01

    Pokemon (POK erythroid myeloid ontogenic factor), which belongs to the POK protein family, is also called LRF, OCZF and FBI-1. As a transcriptional repressor, Pokemon assumes a critical function in cellular differentiation and oncogenesis. Our study identified an oncogenic role for Pokemon in human hepatocellular carcinoma (HCC). We successfully established human HepG2 and Huh-7 cell lines in which Pokemon was stably knocked down. We demonstrated that Pokemon silencing inhibited cell prolifer...

  18. Primary Human Uterine Leiomyoma Cell Culture Quality Control: Some Properties of Myometrial Cells Cultured under Serum Deprivation Conditions in the Presence of Ovarian Steroids.

    Directory of Open Access Journals (Sweden)

    Camila Bonazza

    Full Text Available Cell culture is considered the standard media used in research to emulate the in vivo cell environment. Crucial in vivo experiments cannot be conducted in humans and depend on in vitro methodologies such as cell culture systems. However, some procedures involving the quality control of cells in culture have been gradually neglected by failing to acknowledge that primary cells and cell lines change over time in culture. Thus, we report methods based on our experience for monitoring primary cell culture of human myometrial cells derived from uterine leiomyoma. We standardized the best procedure of tissue dissociation required for the study of multiple genetic marker systems that include species-specific antigens, expression of myofibroblast or myoblast markers, growth curve, serum deprivation, starvation by cell cycle synchronization, culture on collagen coated plates, and 17 β-estradiol (E2 and progesterone (P4 effects. The results showed that primary myometrial cells from patients with uterine leiomyoma displayed myoblast phenotypes before and after in vitro cultivation, and leiomyoma cells differentiated into mature myocyte cells under the appropriate differentiation-inducing conditions (serum deprivation. These cells grew well on collagen coated plates and responded to E2 and P4, which may drive myometrial and leiomyoma cells to proliferate and adhere into a focal adhesion complex involvement in a paracrine manner. The establishment of these techniques as routine procedures will improve the understanding of the myometrial physiology and pathogenesis of myometrium-derived diseases such as leiomyoma. Mimicking the in vivo environment of fibrotic conditions can prevent false results and enhance results that are based on cell culture integrity.

  19. Phytohemagglutinin (PHA) stimulation of peripheral-blood lymphocytes and stem cell take

    Energy Technology Data Exchange (ETDEWEB)

    Astaldi, G. (Blood Research Foundation Center, Tortona, Italy); Karanovic, D.; Vettori, P.P.; Karanovic, J.; Piletic, O.

    1974-01-01

    The effect of PHA-stimulation of peripheral-blood lymphocytes on the spleen-colony formation in irradiated rats was examined. 25-day old Wistar rats underwent total-body irradiation (600 R), and they were used as recipients. On the other hand, 2 and /sup 1///sub 2/ month old untreated Wistar rats were used as donors of peripheral-blood lymphocytes, which were obtained by sedimentation with Dextraven from defibrinated blood. Four rat lots were used. The 1st one did not receive irradiation, and was kept as ''blank control.'' The 2nd one was just irradiated and kept as ''radiated control.'' The 3rd and the 4th rat lots of the series were irradiated, but the former lot was injected i.v. with 5 x 10/sup 7/ peripheral-blood untreated lymphocytes, whereas the fourth lot was injected i.v. with the same amount of lymphocytes, which were previously incubated in vitro for 24 hrs with PHA-M (Difco). The results showed that the PHA-incubation of transplanted peripheral-blood lymphocytes significantly increases the number and size of the macroscopic spleen colonies, in relationship to the colonies which occurs after transplantation of untreated lymphocytes. Histo-cytological observation clearly showed that the colonies formed after injection of mitogen-pretreated peripheral-blood lymphocytes were predominantly of erythroid type and, then, of non-differentiated cells. Only a few of them were of a mixed type, consisting of both undifferentiated cells and erythroid cells.

  20. Cnidarian Primary Cell Culture as a Tool to Investigate the Effect of Thermal Stress at Cellular Level.

    Science.gov (United States)

    Ventura, P; Toullec, G; Fricano, C; Chapron, L; Meunier, V; Röttinger, E; Furla, P; Barnay-Verdier, S

    2018-04-01

    In the context of global change, symbiotic cnidarians are largely affected by seawater temperature elevation leading to symbiosis breakdown. This process, also called bleaching, is triggered by the dysfunction of the symbiont photosystems causing an oxidative stress and cell death to both symbiont and host cells. In our study, we wanted to elucidate the intrinsic capacity of isolated animal cells to deal with thermal stress in the absence of symbiont. In that aim, we have characterized an animal primary cell culture form regenerating tentacles of the temperate sea anemone Anemonia viridis. We first compared the potential of whole tissue tentacle or separated epidermal or gastrodermal monolayers as tissue sources to settle animal cell cultures. Interestingly, only isolated cells extracted from whole tentacles allowed establishing a viable and proliferative primary cell culture throughout 31 days. The analysis of the expression of tissue-specific and pluripotency markers defined cultivated cells as differentiated cells with gastrodermal origin. The characterization of the animal primary cell culture allowed us to submit the obtained gastrodermal cells to hyperthermal stress (+ 5 and + 8 °C) during 1 and 7 days. Though cell viability was not affected at both hyperthermal stress conditions, cell growth drastically decreased. In addition, only a + 8 °C hyperthermia induced a transient increase of antioxidant defences at 1 day but no ubiquitin or carbonylation protein damages. These results demonstrated an intrinsic resistance of cnidarian gastrodermal cells to hyperthermal stress and then confirmed the role of symbionts in the hyperthermia sensitivity leading to bleaching.

  1. Distinct angiotensin II receptor in primary cultures of glial cells from rat brain

    International Nuclear Information System (INIS)

    Raizada, M.K.; Phillips, M.I.; Crews, F.T.; Sumners, C.

    1987-01-01

    Angiotensin II (Ang-II) has profound effects on the brain. Receptors for Ang-II have been demonstrated on neurons, but no relationship between glial cells and Agn-II has been established. Glial cells (from the hypothalamus and brain stem of 1-day-old rat brains) in primary culture have been used to demonstrate the presence of specific Ang-II receptors. Binding of 125 I-Ang-II to glial cultures was rapid, reversible, saturable, and specific for Ang-II. The rank order of potency of 125 I-Ang-II binding was determined. Scatchard analysis revealed a homogeneous population of high-affinity binding sites with a B/sub max/ of 110 fmol/mg of protein. Light-microscopic autoradiography of 125 I-Ang-II binding supported the kinetic data, documenting specific Ang-II receptors on the glial cells. Ang-II stimulated a dose-dependent hydrolysis of phosphatidylinositols in glial cells, an effect mediated by Ang-II receptors. However, Ang-II failed to influence [ 3 H] norepinephrine uptake, and catecholamines failed to regulate Ang-II receptors, effects that occur in neurons. These observations demonstrate the presence of specific Ang-II receptors on the glial cells in primary cultures derived from normotensive rat brain. The receptors are kinetically similar to, but functionally distinct from, the neuronal Ang-II receptors

  2. Cell longevity and sustained primary growth in palm stems.

    Science.gov (United States)

    Tomlinson, P Barry; Huggett, Brett A

    2012-12-01

    Longevity, or organismal life span, is determined largely by the period over which constituent cells can function metabolically. Plants, with modular organization (the ability continually to develop new organs and tissues) differ from animals, with unitary organization (a fixed body plan), and this difference is reflected in their respective life spans, potentially much longer in plants than animals. We draw attention to the observation that palm trees, as a group of monocotyledons without secondary growth comparable to that of lignophytes (plants with secondary growth from a bifacial cambium), retain by means of sustained primary growth living cells in their trunks throughout their organismal life span. Does this make palms the longest-lived trees because they can grow as individuals for several centuries? No conventional lignophyte retains living metabolically active differentiated cell types in its trunk for this length of time, even though the tree as a whole can exist for millennia. Does this contrast also imply that the long-lived cells in a palm trunk have exceptional properties, which allows this seeming immortality? We document the long-life of many tall palm species and their inherent long-lived stem cell properties, comparing such plants to conventional trees. We provide a summary of aspects of cell age and life span in animals and plants. Cell replacement is a feature of animal function, whereas conventional trees rely on active growth centers (meristems) to sustain organismal development. However, the long persistence of living cells in palm trunks is seen not as evidence for unique metabolic processes that sustain longevity, but is a consequence of unique constructional features. This conclusion suggests that the life span of plant cells is not necessarily genetically determined.

  3. Primary Small Cell Carcinoma of the Stomach Successfully Treated With Cisplatin and Etoposide

    Directory of Open Access Journals (Sweden)

    Shu-Chen Kuo

    2009-11-01

    Full Text Available We report a 44-year-old man with primary gastric small cell carcinoma who showed a remarkable response to chemotherapy specific for pulmonary small cell carcinoma. The patient had been admitted to another local hospital because of intermittent epigastralgia. An upper gastrointestinal examination there revealed an ulcerative tumor, 5 cm in diameter, on the lesser curvature side of the cardia, and endoscopic biopsy reported adenocarcinoma. Computed tomography revealed a mass over the lesser curvature of the stomach and some enlarged regional lymph nodes. Radical total gastrectomy, lymph node dissection, Roux-en-Y esophagojejunostomy and splenectomy were performed at our hospital. Pathology revealed gastric mucosa infiltrated by small-sized tumor cells with scanty cytoplasm and hyperchromatic nuclei. Immunohisto- chemically, the tumor cells were positive for synaptophysin, chromogranin A, and CD56. Primary gastric small cell carcinoma was diagnosed. The postoperative course, complicated by shock due to bleeding, wound infection and intra-abdominal abscess, took more than 2 months to resolve. Follow-up computed tomography showed tumor recurrence with multiple enlarged lymph nodes in the aortocaval region and hepatic hilum. The patient received palliative chemotherapy consisting of cisplatin 80 mg/m2 on day 1 and etoposide 80 mg/m2 on days 1–3 every 28 days, and had partial response to the chemotherapy, with a progression-free survival of 10 months. Chemotherapy with cisplatin and etoposide used for small cell carcinoma of the lung is a good treatment for gastric small cell carcinoma.

  4. Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

    Science.gov (United States)

    Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina

    2018-01-01

    The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430

  5. Delayed globin synthesis leads to excess heme and the macrocytic anemia of Diamond Blackfan anemia and del(5q) myelodysplastic syndrome.

    Science.gov (United States)

    Yang, Zhantao; Keel, Siobán B; Shimamura, Akiko; Liu, Li; Gerds, Aaron T; Li, Henry Y; Wood, Brent L; Scott, Bart L; Abkowitz, Janis L

    2016-05-11

    Diamond Blackfan anemia (DBA) and myelodysplastic syndrome (MDS) with isolated del(5q) are severe macrocytic anemias; although both are associated with impaired ribosome assembly, why the anemia occurs is not known. We cultured marrow cells from DBA (n = 3) and del(5q) MDS (n = 6) patients and determined how heme (a toxic chemical) and globin (a protein) are coordinated. We show that globin translation initiates slowly, whereas heme synthesis proceeds normally. This results in insufficient globin protein, excess heme and excess reactive oxygen species in early erythroid precursors, and CFU-E (colony-forming unit-erythroid)/proerythroblast cell death. The cells that can more rapidly and effectively export heme or can slow heme synthesis preferentially survive and appropriately mature. Consistent with these observations, treatment with 10 μM succinylacetone, a specific inhibitor of heme synthesis, improved the erythroid cell output of DBA and del(5q) MDS marrow cultures by 68 to 95% (P = 0.03 to 0.05), whereas the erythroid cell output of concurrent control marrow cultures decreased by 4 to 13%. Our studies demonstrate that erythropoiesis fails when heme exceeds globin. Our data further suggest that therapies that decrease heme synthesis (or facilitate heme export) could improve the red blood cell production of persons with DBA, del(5q) MDS, and perhaps other macrocytic anemias. Copyright © 2016, American Association for the Advancement of Science.

  6. Primary cutaneous smoldering adult T-cell leukemia/ lymphoma.

    Science.gov (United States)

    Gittler, Julia; Martires, Kathryn; Terushkin, Vitaly; Brinster, Nooshin; Ramsay, David

    2016-12-15

    HTLV-1 is a virus that is endemic in southwesternJapan and the Caribbean and has been implicatedin the development of ATLL. ATLL, which is anuncommon malignant condition of peripheralT-lymphocytes, is characterized by four clinicalsubtypes, which include acute, lymphomatous,chronic, and smoldering types, that are based onLDH levels, calcium levels, and extent of organinvolvement. We present a 52-year- old woman withpruritic patches with scale on the buttocks and withtender, hyperpigmented macules and papules oftwo-years duration. Histopathologic examinationwas suggestive of mycosis fungoides, laboratoryresults showed HTLV-I and II, and the patient wasdiagnosed with primary cutaneous ATLL. We reviewthe literature on HTLV-1 and ATLL and specifically theprognosis of cutaneous ATLL. The literature suggeststhat a diagnosis of ATLL should be considered amongpatients of Caribbean origin or other endemicareas with skin lesions that suggest a cutaneousT-cell lymphoma, with clinicopathologic features ofmycosis fungoides. Differentiation between ATLLand cutaneous T-cell lymphoma is imperative as theyhave different prognoses and treatment approaches.

  7. Primary intravascular large B-cell lymphoma of pituitary

    Directory of Open Access Journals (Sweden)

    K R Anila

    2012-01-01

    Full Text Available A 68-year-old retired nurse, who was a known hypertensive on medication, presented with prolonged fever of 2-month duration without any clinical evidence of infection. On examination she had altered mental status. She also had other nonspecific complaints such as sleep disturbances, loss of weight, etc. On investigation, she was found to have anemia, thrombocytopenia, raised erythrocyte sedimentation rate (ESR, C-reactive protein (CRP, and lactate dehydrogenase (LDH values. She also had electrolyte imbalance. Radiological evaluation of brain showed mass lesion in the sella turcica, suggestive of pituitary adenoma. Biochemical evaluation showed hypopituitarism. Trans-sphenoidal biopsy was done. Based on histopathological and immunohistochemical findings a diagnosis of intravascular large B-cell lymphoma (IVLBCL of pituitary was made. Our patient′s condition deteriorated rapidly and she succumbed to her illness before therapy could be initiated. We are reporting this case because of the rare subtype of large B-cell lymphoma presenting at an extremely unusual primary site.

  8. Comparative biology of the ubiquitous Na+/H+ exchanger, NHE1: lessons from erythrocytes

    DEFF Research Database (Denmark)

    Pedersen, Stine Falsig; Cala, Peter Michael

    2004-01-01

    of NHE1 in erythrocytes, in their own right and as model systems, but pertinent findings from non-erythroid cells are also discussed. NHE1 plays a key role in the regulation of cell volume and pH, and consequently in the control of such diverse processes as blood O2/CO2 transport, and cell proliferation......, motility, and survival. Disturbances in NHE1 function are involved in important pathological states such as hypoxic cell damage and cancer development. NHE1 has a predicted topology of 12 transmembrane domains, and a hydrophilic C-terminus thought to be the major site for NHE1 regulation. NHE1 is highly...... conserved throughout the vertebrate phylum, particularly in the transmembrane region and the proximal part of the C-terminus. In non-erythroid, and probably also in erythroid cells, this part of the hydrophilic C-terminus interacts with multiple binding partners important for NHE1 function. Erythrocyte NHE1...

  9. The human ankyrin 1 promoter insulator sustains gene expression in a β-globin lentiviral vector in hematopoietic stem cells

    Directory of Open Access Journals (Sweden)

    Zulema Romero

    Full Text Available Lentiviral vectors designed for the treatment of the hemoglobinopathies require the inclusion of regulatory and strong enhancer elements to achieve sufficient expression of the β-globin transgene. Despite the inclusion of these elements, the efficacy of these vectors may be limited by transgene silencing due to the genomic environment surrounding the integration site. Barrier insulators can be used to give more consistent expression and resist silencing even with lower vector copies. Here, the barrier activity of an insulator element from the human ankyrin-1 gene was analyzed in a lentiviral vector carrying an antisickling human β-globin gene. Inclusion of a single copy of the Ankyrin insulator did not affect viral titer, and improved the consistency of expression from the vector in murine erythroleukemia cells. The presence of the Ankyrin insulator element did not change transgene expression in human hematopoietic cells in short-term erythroid culture or in vivo in primary murine transplants. However, analysis in secondary recipients showed that the lentiviral vector with the Ankyrin element preserved transgene expression, whereas expression from the vector lacking the Ankyrin insulator decreased in secondary recipients. These studies demonstrate that the Ankyrin insulator may improve long-term β-globin expression in hematopoietic stem cells for gene therapy of hemoglobinopathies.

  10. Long-Lasting Production of New T and B Cells and T-Cell Repertoire Diversity in Patients with Primary Immunodeficiency Who Had Undergone Stem Cell Transplantation: A Single-Centre Experience

    Directory of Open Access Journals (Sweden)

    Monica Valotti

    2014-01-01

    Full Text Available Levels of Kappa-deleting recombination excision circles (KRECs, T-cell receptor excision circles (TRECs, and T-cell repertoire diversity were evaluated in 1038 samples of 124 children with primary immunodeficiency, of whom 102 (54 with severe combined immunodeficiency and 48 with other types of immunodeficiency underwent hematopoietic stem cell transplantation. Twenty-two not transplanted patients with primary immunodeficiency were used as controls. Only data of patients from whom at least five samples were sent to the clinical laboratory for routine monitoring of lymphocyte reconstitutions were included in the analysis. The mean time of the follow-up was 8 years. The long-lasting posttransplantation kinetics of KREC and TREC production occurred similarly in patients with severe combined immunodeficiency and with other types of immunodeficiency and, in both groups, the T-cell reconstitution was more efficient than in nontransplanted children. Although thymic output decreased in older transplanted patients, the degree of T-cell repertoire diversity, after an initial increase, remained stable during the observation period. However, the presence of graft-versus-host disease and ablative conditioning seemed to play a role in the time-related shaping of T-cell repertoire. Overall, our data suggest that long-term B- and T-cell reconstitution was equally achieved in children with severe combined immunodeficiency and with other types of primary immunodeficiency.

  11. Primary clear cell ductal adenocarcinoma of the pancreas: A case report and clinicopathologic literature review

    Directory of Open Access Journals (Sweden)

    Yashpal Modi

    2014-01-01

    Full Text Available We present a very rare, interesting case of a carcinoma of the pancreas with predominantly abundant clear cell morphology. According to the WHO classification, primary clear cell carcinoma of the pancreas is classified as a rare "miscellaneous" carcinoma. The tumor was observed in the distal body and tail of the pancreas of a 74-year-old woman. The histopathology of tumor cells showed well-defined cell membranes, clear cytoplasm, and prominent cell boundaries. Immunohistochemical (IHC staining showed positive reactions to antibodies against vimentin, cytokeratin 7 (CK-7, mucicarmine (MUC-1, periodic acid-Schiff (PAS, periodic acid-Schiff with diastase (PASD, carcinoembryonic antigen (CEA, and Carbohydrate Antigen 19-9 (CA 19-9. On the other hand, IHC staining was negative for alpha-fetoprotein (AFP, cytokeratin 20 (CK-20, HMB45, chromogranin, and synaptophysin. The patient was subsequently diagnosed with a primary solid-type pancreatic clear cell carcinoma with hepatic metastasis. Herein, we report this rare case and include a review of the current literature of this tumor.

  12. [Primary cutaneous B-cell lymphomas: study of 22 cases].

    Science.gov (United States)

    Martín Carrasco, Pablo; Morillo Andújar, Mercedes; Pérez Ruiz, Carmen; de Zulueta Dorado, Teresa; Cabrera Pérez, Rocío; Conejo-Mir, Julián

    2016-09-02

    Primary cutaneous B-cell lymphoma (CBCL) is a very low prevalence neoplasm and constitutes 25% of all primary cutaneous lymphomas. Our objective was to discover the epidemiological, clinic and histologic characteristics of CBCL in our area. Retrospective descriptive study with patients with histologic diagnosis of CBCL followed up in our department between 2004 and 2015. Twenty-two patients with CBCL were included; 65% were men and 35% were women. Follicle centre lymphoma was the most common subtype (41%). Only 3 cases presented with node involvement and one with bone marrow invasion. Five recurrences were detected and one patient died because of the CBCL. This is one of the first CBCL series in theSpanish population. The incidence, sex, age, subtype distribution, clinical features and immunohistochemical patterns are very similar to those of the other series. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

  13. Resonant Soft X-ray Scattering of Cellulose Microstructure in Plant Primary Cell Walls

    Science.gov (United States)

    Ye, Dan; Kiemle, Sarah N.; Wang, Cheng; Cosgrove, Daniel J.; Gomez, Esther W.; Gomez, Enrique D.

    Cellulosic biomass is the most abundant raw material available for the production of renewable and sustainable biofuels. Breaking down cellulose is the rate-limiting step in economical biofuel production; therefore, a detailed understanding of the microscopic structure of plant cell walls is required to develop efficient biofuel conversion methods. Primary cell walls are key determinants of plant growth and mechanics. Their structure is complex and heterogeneous, making it difficult to elucidate how various components such as pectin, hemicellulose, and cellulose contribute to the overall structure. The electron density of these wall components is similar; such that conventional hard X-ray scattering does not generate enough contrast to resolve the different elements of the polysaccharide network. The chemical specificity of resonant soft X-ray scattering allows contrast to be generated based on differences in chemistry of the different polysaccharides. By varying incident X-ray energies, we have achieved increased scattering contrast between cellulose and other polysaccharides from primary cell walls of onions. By performing scattering at certain energies, features of the network structure of the cell wall are resolved. From the soft X-ray scattering results, we obtained the packing distance of cellulose microfibrils embedded in the polysaccharide network.

  14. Multiple Primary Merkel Cell Carcinomas Presenting as Pruritic, Painful Lower Leg Tumors

    Directory of Open Access Journals (Sweden)

    Laura Blumenthal

    2015-10-01

    Full Text Available Merkel cell carcinoma (MCC is a rare and highly aggressive neuroendocrine tumor of the skin which almost exclusively presents as a solitary tumor. It is most often seen on sun-exposed regions, historically almost exclusively on the head and neck, with only rare case reports on the extremities. Although recent studies have shown increased incidence with up to 20% on the extremities, here we present one of these rare emerging presentations, with the addition of a unique treatment option. Our patient is an 80-year-old male with a 3-month history of multiple raised, rapidly enlarging tumors on the right ankle. Two separate biopsies were performed and demonstrated sheets and clusters of small blue cells filling the dermis with scant cytoplasm, dusty chromatin, and nuclear molding. Subsequent immunohistochemical stains confirmed the diagnosis of multiple primary MCC. Despite the characteristic immunohistochemical profile of primary MCC, the possibility of a metastatic neuroendocrine carcinoma from an alternate primary site was entertained, given his unusual clinical presentation. A complete clinical workup including CT scans of the chest, abdomen, and pelvis showed no evidence of disease elsewhere. Instead of amputation, the patient opted for nonsurgical treatment with radiation therapy alone, resulting in a rapid and complete response. This case represents an unusual presentation of primary MCC and demonstrates further evidence that radiation as monotherapy is an effective local treatment option for inoperable MCC.

  15. Primary cultures of glomerular parietal epithelial cells or podocytes with proven origin.

    NARCIS (Netherlands)

    Kabgani, N.; Grigoleit, T.; Schulte, K.; Sechi, A.; Sauer-Lehnen, S.; Tag, C.; Boor, P.; Kuppe, C.; Warsow, G.; Schordan, S.; Mostertz, J.; Chilukoti, R.K.; Homuth, G.; Endlich, N.; Tacke, F.; Weiskirchen, R.; Fuellen, G.; Endlich, K.; Floege, J.; Smeets, B.; Moeller, M.J.

    2012-01-01

    Parietal epithelial cells (PECs) are crucially involved in the pathogenesis of rapidly progressive glomerulonephritis (RPGN) as well as in focal and segmental glomerulosclerosis (FSGS). In this study, transgenic mouse lines were used to isolate pure, genetically tagged primary cultures of PECs or

  16. The influence of Listeria monocytogenes cells on the primary immunologic response in irradiated mice

    International Nuclear Information System (INIS)

    Borowski, J.; Jokoniuk, P.

    1977-01-01

    The influence of killed Listeria monocytogenes cells on the primary immunologic response in mice irradiated with 300 or 500 R was studied. The immunologic response of the mice to sheep red blood cells used as antigen was assessed at the cellular level (by counting PFC) and humoral level. Injection of killed Listeria monocytogenes cells before irradiation of the mice diminished the immunosuppressive effect of roentgen radiation. Injection of the cells after irradiation accelerated regeneration of immunologic reactivity in the irradiated mice. (author)

  17. A primary cell model of HIV-1 latency that uses activation through the T cell receptor and return to quiescence to establish latent infection

    Science.gov (United States)

    Kim, Michelle; Hosmane, Nina N.; Bullen, C. Korin; Capoferri, Adam; Yang, Hung-Chih; Siliciano, Janet D.; Siliciano, Robert F.

    2015-01-01

    A mechanistic understanding of HIV-1 latency depends upon a model system that recapitulates the in vivo condition of latently infected, resting CD4+ T lymphocytes. Latency appears to be established after activated CD4+ T cells, the principal targets of HIV-1 infection, become productively infected and survive long enough to return to a resting memory state in which viral expression is inhibited by changes in the cellular environment. This protocol describes an ex vivo primary cell system that is generated under conditions that reflect the in vivo establishment of latency. Creation of these latency model cells takes 12 weeks and, once established, the cells can be maintained and used for several months. The resulting cell population contains both uninfected and latently infected cells. This primary cell model can be used to perform drug screens, study CTL responses to HIV-1, compare viral alleles, or to expand the ex vivo lifespan of cells from HIV-1 infected individuals for extended study. PMID:25375990

  18. Transcriptomic profiling of primary alveolar epithelial cell differentiation in human and rat

    Directory of Open Access Journals (Sweden)

    Crystal N. Marconett

    2014-12-01

    Full Text Available Cell-type specific gene regulation is a key to gaining a full understanding of how the distinct phenotypes of differentiated cells are achieved and maintained. Here we examined how changes in transcriptional activation during alveolar epithelial cell (AEC differentiation determine phenotype. We performed transcriptomic profiling using in vitro differentiation of human and rat primary AEC. This model recapitulates in vitro an in vivo process in which AEC transition from alveolar type 2 (AT2 cells to alveolar type 1 (AT1 cells during normal maintenance and regeneration following lung injury. Here we describe in detail the quality control, preprocessing, and normalization of microarray data presented within the associated study (Marconett et al., 2013. We also include R code for reproducibility of the referenced data and easily accessible processed data tables.

  19. H4 histamine receptors mediate cell cycle arrest in growth factor-induced murine and human hematopoietic progenitor cells.

    Directory of Open Access Journals (Sweden)

    Anne-France Petit-Bertron

    Full Text Available The most recently characterized H4 histamine receptor (H4R is expressed preferentially in the bone marrow, raising the question of its role during hematopoiesis. Here we show that both murine and human progenitor cell populations express this receptor subtype on transcriptional and protein levels and respond to its agonists by reduced growth factor-induced cell cycle progression that leads to decreased myeloid, erythroid and lymphoid colony formation. H4R activation prevents the induction of cell cycle genes through a cAMP/PKA-dependent pathway that is not associated with apoptosis. It is mediated specifically through H4R signaling since gene silencing or treatment with selective antagonists restores normal cell cycle progression. The arrest of growth factor-induced G1/S transition protects murine and human progenitor cells from the toxicity of the cell cycle-dependent anticancer drug Ara-C in vitro and reduces aplasia in a murine model of chemotherapy. This first evidence for functional H4R expression in hematopoietic progenitors opens new therapeutic perspectives for alleviating hematotoxic side effects of antineoplastic drugs.

  20. Immunohistochemical demonstration of a hitherto undescribed localization of hemoglobin A and F in endodermal cells of normal human yolk sac and endodermal sinus tumor

    DEFF Research Database (Denmark)

    Albrechtsen, R; Wewer, U; Wimberley, P D

    1980-01-01

    In this study of 4 human yolk sacs, the presence of hemoglobin A and F (HbA and HbF) is demonstrated for the first time in epithelial cells (type 1) and erythroid-like cells (type 2) in the endodermal layer by immunoperoxidase technique. Our findings strongly support the hypothesis previously...... proposed that the red blood cells formed in the yolk sac are of endodermal origin. Tumor with yolk sac differentiation (8 endodermal sinus tumors and 1 embryonal carcinoma with vitelline areas) similarly showed HbA and HbF localisation in endodermal cells. None of 59 germ cell tumors of other types...

  1. Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Yue [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Handong, E-mail: njhdwang@hotmail.com [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Qiang [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Ding, Hui [Department of Neurosurgery, Jinling Hospital, School of Medicine, Southern Medical University (Guangzhou), 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wu, Heming [Department of Neurosurgery, Nanjing Jingdu Hospital, No. 34, Biao 34, Yanggongjing Road, Nanjing 210002, Jiangsu Province (China); Pan, Hao [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China)

    2016-01-15

    Gliomas are the leading cause of death among adults with primary brain malignancies. Treatment for malignant gliomas remains limited, and targeted therapies have been incompletely explored. Nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription regulator for antioxidant and detoxification enzymes, is abundantly expressed in cancer cells. In this study, the role and mechanism of Nrf2 in cancer cell proliferation was investigated in multiple glioma cell lines. We first evaluated the expression patterns of Nrf2 in four glioma cell lines and found all four cell lines expressed Nrf2, but the highest level was observed in U251 cells. We further evaluated the biological functions of Nrf2 in U251 glioma cell proliferation by specific inhibition of Nrf2 using short hairpin RNA (shRNA). We found that Nrf2 depletion inhibited glioma cell proliferation. Nrf2 depletion also decreased colony formation in U251 cells stably expressing Nrf2 shRNA compared to scrambled control shRNA. Moreover, suppression of Nrf2 expression could lead to ATP depletion (with concomitant rise in AMP/ATP ratio) and consequently to AMPK-activated mTOR inhibition. Finally, activation of adenosine monophosphate–activated protein kinase (AMPK) by treated with phenformin, an AMPK agonist, can mimic the inhibitory effect of Nrf2 knockdown in U251 cells. In conclusion, our findings will shed light to the role and mechanism of Nrf2 in regulating glioma proliferation via ATP-depletion-induced AMPK activation and consequent mTOR inhibition, a novel insight into our understanding the role and mechanism of Nrf2 in glioma pathoetiology. To our knowledge, this is also the first report to provide a rationale for the implication of cross-linking between Nrf2 and mTOR signaling.

  2. Biophysical effects in off-resonant gold nanoparticle mediated (GNOME) laser transfection of cell lines, primary- and stem cells using fs laser pulses.

    Science.gov (United States)

    Schomaker, Markus; Killian, Doreen; Willenbrock, Saskia; Heinemann, Dag; Kalies, Stefan; Ngezahayo, Anaclet; Nolte, Ingo; Ripken, Tammo; Junghanß, Christian; Meyer, Heiko; Murua Escobar, Hugo; Heisterkamp, Alexander

    2015-08-01

    Gold nanoparticle mediated (GNOME) laser transfection is a powerful technique to deliver small biologically relevant molecules into cells. However, the transfection of larger and especially negatively charged DNA remains challenging. The efficiency for pDNA was 0.57% using parameter that does not influence the endo- and exogenous DNA. In order to gain a deeper understanding of the actual molecule uptake process, the uptake efficiency was determined using molecules of different sizes. It was evaluated that uncharged dextran molecules (2000 kDa) were delivered with an efficiency of 68%. The intracellular distribution of injected molecules was visualized and larger molecules were primary found in the cytoplasm. Patch clamp measurements suggested a permeabilization time up to 15 minutes. The uptake efficiency depended on the size and charge of the molecule to deliver as well as the cell size. A minor role for transfection plays the cell type since primary stem cells were successfully transfected. The perforation efficiency of semi-adherent and suspension cells is influenced by the cell and molecule size. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Study of Engraftment of human cord blood cells to rescue the sublethal radiation damage mice

    International Nuclear Information System (INIS)

    Cao Xiangshan; Zou Zhenghui; Yu Fei; Zhang Zhilin; Lin Baojue

    1997-01-01

    To investigate alternative source of hematopoiesis stem cells to rescue the sublethal radiation damage (SRD) casualties. Human-umbilical cord blood hematopoietic cells were transplanted into SRD mice, the survival rate and the hematopoiesis reconstitution of bone marrow were assessed. The survival rate, in the mice transplanted and the untransplanted, were 90% and 10% respectively. Bone marrow and spleen of survival mice showed human leukocytic antigen CD45 + cells. Presence of multilineage engraftment, including myeloid and erythroid lineages, were found indicating that immature human cells home to the mouse bone marrow. conclusion: engraftment of umbilical cord blood cells is very useful to reconstitute hematopoiesis of SRD casualties. As cord blood has many advantages over bone marrow and peripheral blood, it is important in rescuing radiation accidental casualties

  4. Prostaglandin E2 regulates hematopoietic stem cell

    International Nuclear Information System (INIS)

    Wang Yingying; Zhou Daohong; Meng Aimin

    2013-01-01

    Prostaglandin E2 (PGE2) is a bioactive lipid molecule produced by cyclooxygenase (COX), which plays an important role on hematopoiesis. While it can block differentiation of myeloid progenitors but enhance proliferation of erythroid progenitors. Recent research found that PGE2 have the effects on hematopoietic stem cell (HSC) function and these effects were independent from effects on progenitor cells. Exposure of HSC cells to PGE2 in vitro can increase homing efficiency of HSC to the murine bone marrow compartment and decrease HSC apoptosis, meanwhile increase long-term stem cell engraftment. In-vivo treatment with PGE2 expands short-term HSC and engraftment in murine bone marrow but not long-term HSC.In addition, PGE2 increases HSC survival after radiation injury and enhance hematopoietic recovery, resulting maintains hematopoietic homeostasis. PGE2 regulates HSC homeostasis by reactive oxygen species and Wnt pathway. Clinical beneficial of 16, 16-dimethyl-prostaglandin E2 treatment to enhance engraftment of umbilical cord blood suggest important improvements to therapeutic strategies. (authors)

  5. Primary cerebral non-Langerhans cell histiocytosis: MRI and differential diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Ernemann, U.; Skalej, M.; Voigt, K. [Department of Neuroradiology, University Hospital Tuebingen, Hoppe-Seyler-Strasse 3, 72076 Tuebingen (Germany); Hermisson, M.; Platten, M. [Department of Neurology, University Hospital Tuebingen, Hoppe-Seyler-Strasse 3, 72076 Tuebingen (Germany); Jaffe, R. [Pathology Department, Children' s Hospital of Pittsburgh, 3705 Fifth Avenue, Pittsburgh, PA 15213 (United States)

    2002-09-01

    We report a young woman with primary cerebral non-Langerhans cell histiocytosis of the juvenile xanthogranuloma family. The clinical course was complicated by extensive infiltration of cranial nerves and meninges and epi- and intramedullary spinal dissemination. Whereas the cutaneous form of juvenile xanthogranuloma is usually benign and self-limited, central nervous system involvement is associated with high morbidity and mortality and might therefore be considered a separate clinical entity. (orig.)

  6. Conditionally reprogrammed cells (CRC) methodology does not allow the in vitro expansion of patient-derived primary and metastatic lung cancer cells.

    Science.gov (United States)

    Sette, Giovanni; Salvati, Valentina; Giordani, Ilenia; Pilozzi, Emanuela; Quacquarini, Denise; Duranti, Enrico; De Nicola, Francesca; Pallocca, Matteo; Fanciulli, Maurizio; Falchi, Mario; Pallini, Roberto; De Maria, Ruggero; Eramo, Adriana

    2018-07-01

    Availability of tumor and non-tumor patient-derived models would promote the development of more effective therapeutics for non-small cell lung cancer (NSCLC). Recently, conditionally reprogrammed cells (CRC) methodology demonstrated exceptional potential for the expansion of epithelial cells from patient tissues. However, the possibility to expand patient-derived lung cancer cells using CRC protocols is controversial. Here, we used CRC approach to expand cells from non-tumoral and tumor biopsies of patients with primary or metastatic NSCLC as well as pulmonary metastases of colorectal or breast cancers. CRC cultures were obtained from both tumor and non-malignant tissues with extraordinary high efficiency. Tumor cells were tracked in vitro through tumorigenicity assay, monitoring of tumor-specific genetic alterations and marker expression. Cultures were composed of EpCAM+ lung epithelial cells lacking tumorigenic potential. NSCLC biopsies-derived cultures rapidly lost patient-specific genetic mutations or tumor antigens. Similarly, pulmonary metastases of colon or breast cancer generated CRC cultures of lung epithelial cells. All CRC cultures examined displayed epithelial lung stem cell phenotype and function. In contrast, brain metastatic lung cancer biopsies failed to generate CRC cultures. In conclusion, patient-derived primary and metastatic lung cancer cells were negatively selected under CRC conditions, limiting the expansion to non-malignant lung epithelial stem cells from either tumor or non-tumor tissue sources. Thus, CRC approach cannot be applied for direct therapeutic testing of patient lung tumor cells, as the tumor-derived CRC cultures are composed of (non-tumoral) airway basal cells. © 2018 UICC.

  7. Primary central nervous system diffuse large B-cell lymphoma shows an activated B-cell-like phenotype with co-expression of C-MYC, BCL-2, and BCL-6.

    Science.gov (United States)

    Li, Xiaomei; Huang, Ying; Bi, Chengfeng; Yuan, Ji; He, Hong; Zhang, Hong; Yu, QiuBo; Fu, Kai; Li, Dan

    2017-06-01

    Diffuse large B-cell lymphoma (DLBCL) is the most common non-Hodgkin lymphoma, whose main prognostic factor is closely related to germinal center B-cell-like subtype (GCB- DLBCL) or activated B-cell-like type (non-GCB-DLBCL). The most common type of primary central nervous system lymphoma is diffuse large B-cell type with poor prognosis and the reason is unclear. This study aims to stratify primary central nervous system diffuse large B-cell lymphoma (PCNS-DLBCL) according to the cell-of-origin (COO) and to investigate the multiple proteins expression of C-MYC, BCL-6, BCL-2, TP53, further to elucidate the reason why primary central nervous system diffuse large B-cell lymphoma possesses a poor clinical outcome as well. Nineteen cases of primary central nervous system DLBCL were stratified according to immunostaining algorithms of Hans, Choi and Meyer (Tally) and we investigated the multiple proteins expression of C-MYC, BCL-6, BCL-2, TP53. The Epstein-Barr virus and Borna disease virus infection were also detected. Among nineteen cases, most (15-17 cases) were assigned to the activated B-cell-like subtype, highly expression of C-MYC (15 cases, 78.9%), BCL-2 (10 cases, 52.6%), BCL-6 (15 cases, 78.9%). Unfortunately, two cases were positive for PD-L1 while PD-L2 was not expressed in any case. Two cases infected with BDV but no one infected with EBV. In conclusion, most primary central nervous system DLBCLs show an activated B-cell-like subtype characteristic and have multiple expressions of C-MYC, BCL-2, BCL-6 protein, these features might be significant factor to predict the outcome and guide treatment of PCNS-DLBCLs. Copyright © 2017 Elsevier GmbH. All rights reserved.

  8. Establishment and Characterization of Primary Cultures from Iranian Oral Squamous Cell Carcinoma Patients by Enzymatic Method and Explant Culture

    Directory of Open Access Journals (Sweden)

    Meysam Ganjibakhsh

    2017-10-01

    Full Text Available Objectives: Oral Squamous Cell Carcinoma (OSCC is the most frequent oral cancer worldwide. It is known as the eighth most common cancer in men and as the fifth most common cancer in women. Cytogenetic and biochemical studies in recent decades have emphasized the necessity of providing an appropriate tool for such researches. Cancer cell culture is a useful tool for investigations on biochemical, genetic, molecular and immunological characteristics of different cancers, including oral cancer. Here, we explain the establishment process of five primary oral cancer cells derived from an Iranian population.Materials and Methods: The specimens were obtained from five oral cancer patients. Enzymatic, explant culture and magnetic-activated cell sorting (MACS methods were used for cell isolation. After quality control tests, characterization and authentication of primary oral cancer cells were performed by short tandem repeats (STR profiling, chromosome analysis, species identification, and monitoring the growth, morphology and the expression of CD326 and CD133 markers.Results: Five primary oral cancer cells were established from an Iranian population. The flow cytometry results showed that the isolated cells were positive for CD326 and CD133 markers. Furthermore, the cells were free from mycoplasma, bacterial and fungal contamination. No misidentified or cross-contaminated cells were detected by STR analysis.Conclusions: Human primary oral cancer cells provide an extremely useful platform for studying carcinogenesis pathways of oral cancer in Iranian population. They may be helpful in explaining the ethnic differences in cancer biology and the individuality in anticancer drug response in future studies.

  9. Glucosamine exposure reduces proteoglycan synthesis in primary human endothelial cells in vitro

    Directory of Open Access Journals (Sweden)

    Trine M. Reine

    2016-09-01

    Full Text Available Purpose: Glucosamine (GlcN supplements are promoted for medical reasons, for example, for patients with arthritis and other joint-related diseases. Oral intake of GlcN is followed by uptake in the intestine, transport in the circulation and thereafter delivery to chondrocytes. Here, it is postulated to have an effect on synthesis and turnover of extracellular matrix constituents expressed by these cells. Following uptake in the intestine, serum levels are transiently increased, and the endothelium is exposed to increased levels of GlcN. We investigated the possible effects of GlcN on synthesis of proteoglycans (PGs, an important matrix component, in primary human endothelial cells. Methods: Primary human endothelial cells were cultured in vitro in medium with 5 mM glucose and 0–10 mM GlcN. PGs were recovered and analysed by western blotting, or by SDS-PAGE, gel chromatography or ion-exchange chromatography of 35S-PGs after 35S-sulphate labelling of the cells. Results: The synthesis and secretion of 35S-PGs from cultured endothelial cells were reduced in a dose- and time-dependent manner after exposure to GlcN. PGs are substituted with sulphated glycosaminoglycan (GAG chains, vital for PG function. The reduction in 35S-PGs was not related to an effect on GAG chain length, number or sulphation, but rather to the total expression of PGs. Conclusion: Exposure of endothelial cells to GlcN leads to a general decrease in 35S-PG synthesis. These results suggest that exposure to high levels of GlcN can lead to decreased matrix synthesis, contrary to what has been claimed by supporters of such supplements.

  10. Chemosensitivity testing of primary human renal cell carcinoma by a tetrazolium based microculture assay (MTT).

    Science.gov (United States)

    Mickisch, G; Fajta, S; Keilhauer, G; Schlick, E; Tschada, R; Alken, P

    1990-01-01

    MTT staining procedures have been used in chemosensitivity testing of established cell lines of human and other sources as well as of human leukaemias, but only limited information on its application in primary solid human tumors is presently available. We have evaluated MTT staining in primary human Renal Cell Carcinomas (RCCs), studied various factors interfering with the optimal use, and finally applied it in subsequent chemosensitivity testing. The method depends on the conversion of a water-soluble tetrazolium salt (MTT) to a purple colored formazan precipitate, a reaction effected by enzymes active only in living cells. Single cell suspensions of RCCs were obtained either by enzymatic dispersion or by mechanical dissagregation, filtered through gauze, and purified by Ficoll density centrifugation. Tests were carried out in 96-well microculture plates. 10(4) viable tumor cells per well at 4 h incubation time with 20 micrograms MTT/100 microliters total medium volume yielded best results. Formazan crystals were dissolved with DMSO, and the plates were immediately measured on a microculture plate reader at 540 nm. Under these criteria, linearity of the system could be demonstrated. For chemosensitivity testing, cells were continuously exposed to a number of drugs prior to the MTT staining procedure. Reproducibility of results was assessed and confirmed by culturing RCCs in flasks additionally, resubmitting them after 1, 2, and 4 weeks to the MTT assay. We conclude that the semiautomated MTT assay offers a valid, rapid, reliable and simple method to determine the degree of chemoresistance in primary human RCCs.

  11. Novel primary thymic defect with T lymphocytes expressing gamma delta T cell receptor

    DEFF Research Database (Denmark)

    Geisler, C; Pallesen, G; Platz, P

    1989-01-01

    Flow cytometric analysis of the peripheral blood mononuclear cells in a six year old girl with a primary cellular immune deficiency showed a normal fraction of CD3 positive T cells. Most (70%) of the CD3 positive cells, however, expressed the gamma delta and not the alpha beta T cell receptor....... Immunoprecipitation and sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) showed that most of the gamma delta T cell receptors existed as disulphide-linked heterodimers. Proliferative responses to mitogens were severely reduced, but specific antibody responses after vaccination could be detected...... deficiency associated with a high proportion of T cells expressing the gamma delta T cell receptor has been described in nude mice, and it is suggested that the immune deficiency of this patient may represent a human analogue....

  12. Docosahexaenoic acid induces apoptosis in primary chronic lymphocytic leukemia cells

    Directory of Open Access Journals (Sweden)

    Romain Guièze

    2015-12-01

    Full Text Available Chronic lymphocytic leukemia is an indolent disorder with an increased infectious risk remaining one of the main causes of death. Development of therapies with higher safety profile is thus a challenging issue. Docosahexaenoic acid (DHA, 22:6 is an omega-3 fatty acid, a natural compound of normal cells, and has been shown to display antitumor potency in cancer. We evaluated the potential in vitro effect of DHA in primary CLL cells. DHA induces high level of in vitro apoptosis compared to oleic acid in a dose-dependent and time-dependent manner. Estimation of IC50 was only of 4.813 μM, which appears lower than those reported in solid cancers. DHA is highly active on CLL cells in vitro. This observation provides a rationale for further studies aiming to understand its mechanisms of action and its potent in vivo activity.

  13. Comparison of the Influence of Phospholipid-Coated Porous Ti-6Al-4V Material on the Osteosarcoma Cell Line Saos-2 and Primary Human Bone Derived Cells

    Directory of Open Access Journals (Sweden)

    Axel Deing

    2016-03-01

    Full Text Available Biomaterial surface functionalization remains of great interest in the promotion of cell osteogenic induction. Previous studies highlighted the positive effects of porous Ti-6Al-4V and phospholipid coating on osteoblast differentiation and bone remodeling. Therefore, the first objective of this study was to evaluate the potential synergistic effects of material porosity and phospholipid coating. Primary human osteoblasts and Saos-2 cells were cultured on different Ti-6Al-4V specimens (mirror-like polished or porous specimens and were coated or not with 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE for three weeks or five weeks. Selected gene expressions (e.g., classical bone markers: alkaline phosphatase, osteocalcin, osteoprotegerin (OPG, receptor activator of nuclear factor kappa-β ligand (RANKL and runt-related transcription factor 2 were estimated in vitro. Furthermore, the expressions of osteocalcin and osteopontin were examined via fluorescent microscopy at five weeks (immunocytochemistry. Consequently, it was observed that phospholipid coating potentiates preferences for low and high porosities in Saos-2 and primary cells, respectively, at the gene and protein levels. Additionally, RANKL and OPG exhibited different gene expression patterns; primary cells showed dramatically increased RANKL expression, whereas OPG expression was decreased in the presence of POPE. A synergistic effect of increased porosity and phospholipid coating was observed in primary osteoblasts in bone remodeling. This study showed the advantage of primary cells over the standard bone cell model.

  14. Distinct types of primary cutaneous large B-cell lymphoma identified by gene expression profiling.

    Science.gov (United States)

    Hoefnagel, Juliette J; Dijkman, Remco; Basso, Katia; Jansen, Patty M; Hallermann, Christian; Willemze, Rein; Tensen, Cornelis P; Vermeer, Maarten H

    2005-05-01

    In the European Organization for Research and Treatment of Cancer (EORTC) classification 2 types of primary cutaneous large B-cell lymphoma (PCLBCL) are distinguished: primary cutaneous follicle center cell lymphomas (PCFCCL) and PCLBCL of the leg (PCLBCL-leg). Distinction between both groups is considered important because of differences in prognosis (5-year survival > 95% and 52%, respectively) and the first choice of treatment (radiotherapy or systemic chemotherapy, respectively), but is not generally accepted. To establish a molecular basis for this subdivision in the EORTC classification, we investigated the gene expression profiles of 21 PCLBCLs by oligonucleotide microarray analysis. Hierarchical clustering based on a B-cell signature (7450 genes) classified PCLBCL into 2 distinct subgroups consisting of, respectively, 8 PCFCCLs and 13 PCLBCLsleg. PCLBCLs-leg showed increased expression of genes associated with cell proliferation; the proto-oncogenes Pim-1, Pim-2, and c-Myc; and the transcription factors Mum1/IRF4 and Oct-2. In the group of PCFCCL high expression of SPINK2 was observed. Further analysis suggested that PCFCCLs and PCLBCLs-leg have expression profiles similar to that of germinal center B-cell-like and activated B-cell-like diffuse large B-cell lymphoma, respectively. The results of this study suggest that different pathogenetic mechanisms are involved in the development of PCFCCLs and PCLBCLs-leg and provide molecular support for the subdivision used in the EORTC classification.

  15. A method for establishing human primary gastric epithelial cell culture from fresh surgical gastric tissues.

    Science.gov (United States)

    Aziz, Faisal; Yang, Xuesong; Wen, Qingping; Yan, Qiu

    2015-08-01

    At present, biopsy specimens, cancer cell lines and tissues obtained by gastric surgery are used in the study and analysis of gastric cancer, including the molecular mechanisms and proteomics. However, fibroblasts and other tissue components may interfere with these techniques. Therefore, the present study aimed to develop a procedure for the isolation of viable human gastric epithelial cells from gastric surgical tissues. A method was developed to culture human gastric epithelial cells using fresh, surgically excised tissues and was evaluated using immunocytochemistry, periodic acid-Schiff (PAS) staining and cell viability assays. Low cell growth was observed surrounding the gastric tissue on the seventh day of tissue explant culture. Cell growth subsequently increased, and at 12 days post-explant a high number of pure epithelial cells were detected. The gastric cancer cells exhibited rapid growth with a doubling time of 13-52 h, as compared to normal cells, which had a doubling time of 20-53 h. Immunocytochemical analyses of primary gastric cells revealed positive staining for cytokeratin 18 and 19, which indicated that the culture was comprised of pure epithelial cells and contained no fibroblasts. Furthermore, PAS staining demonstrated that the cultured gastric cells produced neutral mucin. Granulin and carbohydrate antigen 724 staining confirmed the purity of gastric cancer and normal cells in culture. This method of cell culture indicated that the gastric cells in primary culture consisted of mucin-secreting gastric epithelial cells, which may be useful for the study of gastric infection with Helicobacter pylori and gastric cancer.

  16. Experimental and computational tools for analysis of signaling networks in primary cells

    DEFF Research Database (Denmark)

    Schoof, Erwin M; Linding, Rune

    2014-01-01

    Cellular information processing in signaling networks forms the basis of responses to environmental stimuli. At any given time, cells receive multiple simultaneous input cues, which are processed and integrated to determine cellular responses such as migration, proliferation, apoptosis, or differ......Cellular information processing in signaling networks forms the basis of responses to environmental stimuli. At any given time, cells receive multiple simultaneous input cues, which are processed and integrated to determine cellular responses such as migration, proliferation, apoptosis......; this information is critical when trying to elucidate key proteins involved in specific cellular responses. Here, methods to generate high-quality quantitative phosphorylation data from cell lysates originating from primary cells, and how to analyze the generated data to construct quantitative signaling network...

  17. Multiple modes of action potential initiation and propagation in mitral cell primary dendrite

    DEFF Research Database (Denmark)

    Chen, Wei R; Shen, Gongyu Y; Shepherd, Gordon M

    2002-01-01

    recordings with computational modeling to analyze action-potential initiation and propagation in the primary dendrite. In response to depolarizing current injection or distal olfactory nerve input, fast Na(+) action potentials were recorded along the entire length of the primary dendritic trunk. With weak......-to-moderate olfactory nerve input, an action potential was initiated near the soma and then back-propagated into the primary dendrite. As olfactory nerve input increased, the initiation site suddenly shifted to the distal primary dendrite. Multi-compartmental modeling indicated that this abrupt shift of the spike......-initiation site reflected an independent thresholding mechanism in the distal dendrite. When strong olfactory nerve excitation was paired with strong inhibition to the mitral cell basal secondary dendrites, a small fast prepotential was recorded at the soma, which indicated that an action potential was initiated...

  18. Accurate and reproducible measurements of RhoA activation in small samples of primary cells.

    Science.gov (United States)

    Nini, Lylia; Dagnino, Lina

    2010-03-01

    Rho GTPase activation is essential in a wide variety of cellular processes. Measurement of Rho GTPase activation is difficult with limited material, such as tissues or primary cells that exhibit stringent culture requirements for growth and survival. We defined parameters to accurately and reproducibly measure RhoA activation (i.e., RhoA-GTP) in cultured primary keratinocytes in response to serum and growth factor stimulation using enzyme-linked immunosorbent assay (ELISA)-based G-LISA assays. We also established conditions that minimize RhoA-GTP in unstimulated cells without affecting viability, allowing accurate measurements of RhoA activation on stimulation or induction of exogenous GTPase expression. Copyright 2009 Elsevier Inc. All rights reserved.

  19. Clinical Significance of "Double-hit" and "Double-protein" expression in Primary Gastric B-cell Lymphomas.

    Science.gov (United States)

    He, Miaoxia; Chen, Keting; Li, Suhong; Zhang, Shimin; Zheng, Jianming; Hu, Xiaoxia; Gao, Lei; Chen, Jie; Song, Xianmin; Zhang, Weiping; Wang, Jianmin; Yang, Jianmin

    2016-01-01

    Primary gastric B-cell lymphoma is the second most common malignancy of the stomach. There are many controversial issues about its diagnosis, treatment and clinical management. "Double-hit" and "double-protein" involving gene rearrangement and protein expression of c-Myc and bcl2/bcl6 are the most used terms to describe DLBCL poor prognostic factors in recent years. However, very little is known about the role of these prognostic factors in primary gastric B-cell lymphomas. This study aims to obtain a molecular pathology prognostic model of gastric B-cell lymphoma for clinical stratified management by evaluating how the "double-hit" and "double-protein" in tumor cells as well as microenvironmental reaction of tumor stromal tissue affect clinical outcome in primary gastric B-cell lymphomas. Data and tissues of 188 cases diagnosed with gastric B-cell lymphomas were used in this study. Tumor tissue microarray (TMA) of formalin fixed and paraffin embedded (FFPE) tissues was constructed for fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) analysis with a serial of biomarkers containing MYC, BCL2, BCL6, CD31, SPARC, CD10, MUM1 and Ki-67. Modeled period analysis was used to estimate 3-year and 5-year overall survival (OS) and disease-free survival (DFS) distributions. There was no definite "double-hit" case though the gene rearrangement of c-Myc (5.9%), bcl2 (0.1%) and bcl6 (7.4%) was found in gastric B-cell lymphomas. The gene amplification or copy gains of c-Myc (10.1%), bcl-2 (17.0%) and bcl-6 (0.9%) were present in these lymphomas. There were 12 cases of the lymphomas with the "double-protein" expression of MYC and BCL2/BCL6. All patients with "double-protein" gastric B-cell lymphomas had poor outcome compared with those without. More importantly, "MYC-BCL2-BCL6" negative group of gastric B-cell lymphoma patients had favorable clinical outcome regardless clinical stage, pathological types and therapeutic modalities. And the similar better

  20. Betal-integrins in the primary cilium of MDCK cells potentiate fibronectin-induced Ca2+ signalling

    DEFF Research Database (Denmark)

    Prætorius, Helle; Prætorius, Jeppe; Nielsen, Søren

    2004-01-01

    observed that β1-integrin, α3-integrin, and perhaps α5-integrin were localized to the primary cilium of MDCK cells by combining lectin and immunofluorescence confocal microscopy. β1-Integrin was also colocalized with tubulin to the primary cilia of the rat renal collecting ducts, as well as to the cilia...