Oracle BAM 11gR1 Handbook

CERN Document Server

Wang, Pete

2012-01-01

"Oracle BAM 11gR1 Handbook" is a practical best practices tutorial focused entirely on Oracle Business Activity Monitoring. An intermediate-to-advanced guide, step-by-step instructions and an accompanying demo project will help SOA report developers through application development and producing dashboards and reports. If you are a developer/report developer or SOA Architect who wants to learn valuable Oracle BAM best practices for monitoring your operations in real time, then "Oracle BAM 11gR1 Handbook" is for you. Administrators will also find the book useful. You should already be comfortabl

[22q11.2 deletion: handicap-related problems and coping strategies of primary caregivers].

Science.gov (United States)

Briegel, Wolfgang; Schneider, Marco; Schwab, K Otfried

2009-11-01

To investigate handicap-related problems of children and adolescents with 22q11.2 deletion syndrome and their primary caregivers' coping strategies. Primary caregivers of 153 subjects aged 2-16 years were anonymously asked to fill out questionnaires, e.g., the Handicap Related Problems for Parents Inventory. Primary caregivers of 96 subjects (53 males, 43 females; mean age: 7;0 [2;1-16;11] years) sent back questionnaires. Patient's behaviour and discipline were the most important handicap-related problems. Significant correlations could be found between the patient's age and his/her relationship with the primary caregiver (rho=0.228; p=.029) and other family members (rho=0.293; p=.004). Compared to other parents of physically handicapped children or those with multiple handicaps, these parents did not experience increased stress. The more the coping strategies "self-fulfillment" and "intensification of partnership" were used, the lower parental stress was (p=.012, p=.025, respectively). "Focusing on the handicapped child" was positively correlated with high parental stress (p=.000). With regard to parental stress and coping strategies, primary caregivers of children and adolescents with 22q11.2 deletion do not significantly differ from other parents of physically handicapped children. As handicap-related family problems increase with the patient's age, a growing need for counseling, especially for aspects of parenting and discipline, and for treatment can be presumed.

Chemical, physical, profile and laboratory analysis oceanographic data collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-11 to 2010-09-13 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069110)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the OCEAN VERITAS in the Gulf of Mexico from 2010-09-11 to 2010-09-13 in...

2018-05-09T18:54:11Z https://www.ajol.info/index.php/all/oai oai:ojs ...

African Journals Online (AJOL)

article/92203 2018-05-09T18:54:11Z lwati:ART The Impact of Emotional Intelligence and Self-Efficacy on the Malleability of Job Performance and Job Involvement of Prison Personnel in Nigeria Mwantu, EN Agbo, PO Ngwama, JC Emotional ...

Chemical, physical, profile and laboratory analysis oceanographic data collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-07 to 2010-09-11 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0074853)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical, profile and laboratory analysis oceanographic data were collected aboard the Brooks McCall in the Gulf of Mexico from 2010-09-07 to 2010-09-11 in...

Partial ureterectomy for a huge primary leiomyoma of the ureter

International Nuclear Information System (INIS)

Nouralizadeh, A.; Tabib, A.; Taheri, M.; Torbati, P.M.

2010-01-01

A case of a huge primary leiomyoma of the ureter in which only partial ureterectomy was performed is presented. The benign nature of the mass was primarily confirmed with frozen section at the time of surgery and then with immunohistochemistry (IHC). To the best of our knowledge, this case is a unique form of leiomyoma of the ureter due to its large size. There have been only ten cases of primary leiomyoma of the ureter reported since 1955 and all of them were very small in size. Our case is considered to be the eleventh. (author)

ATLAS database application enhancements using Oracle 11g

International Nuclear Information System (INIS)

Dimitrov, G; Canali, L; Blaszczyk, M; Sorokoletov, R

2012-01-01

The ATLAS experiment at LHC relies on databases for detector online data-taking, storage and retrieval of configurations, calibrations and alignments, post data-taking analysis, file management over the grid, job submission and management, condition data replication to remote sites. Oracle Relational Database Management System (RDBMS) has been addressing the ATLAS database requirements to a great extent for many years. Ten database clusters are currently deployed for the needs of the different applications, divided in production, integration and standby databases. The data volume, complexity and demands from the users are increasing steadily with time. Nowadays more than 20 TB of data are stored in the ATLAS production Oracle databases at CERN (not including the index overhead), but the most impressive number is the hosted 260 database schemes (for the most common case each schema is related to a dedicated client application with its own requirements). At the beginning of 2012 all ATLAS databases at CERN have been upgraded to the newest Oracle version at the time: Oracle 11g Release 2. Oracle 11g come with several key improvements compared to previous database engine versions. In this work we present our evaluation of the most relevant new features of Oracle 11g of interest for ATLAS applications and use cases. Notably we report on the performance and scalability enhancements obtained in production since the Oracle 11g deployment during Q1 2012 and we outline plans for future work in this area.

Impact of Primary User Traffic on Adaptive Transmission for Cognitive Radio with Partial Relay Selection

KAUST Repository

Rao, Anlei; Ma, Hao; Alouini, Mohamed-Slim; Chen, Yunfei

2012-01-01

transmission, when the secondary user adopts adaptive transmission with a relay partially selected. From the numerical results, we can see that the primary user traffic seriously degrades average BER. The worse-link partial selection can perform almost as well

Gender equality in primary immunisation

Directory of Open Access Journals (Sweden)

Deepak S Khismatrao

2015-01-01

Full Text Available Context: Immunization, a well-known and effective method of preventing childhood illnesses is basic service under primary health care. Most surveys in India measure primary immunization coverage and quality, but no "Gender Equality." Aims: Assess "Gender Equality" in primary immunization with reference to coverage, quality, and place of immunization. Settings and Design: Cross-sectional survey in a primary health center, Pune, Maharashtra using World Health Organization 30-cluster sampling method with 14 beneficiaries (7 girls and 7 boys to be selected from each cluster. Instead of 420 children, data collected for 345 children, as requisite numbers of children were not available in low population villages and also children whose mothers were not present during survey were excluded. Materials and Methods: Vaccination data collected from either records and/or history by mother. Children born on or between 13-09-2009 and 13-09-2010, were included. Statistical Analysis Used: SPSS 14.01 version with Chi-square as test of significance. Results: Of the study population, 171 (49.6% were females and 174 (50.4% males. A total of 64.1% children had immunization records with female proportion 69.0% and males 59.2%. Primary immunization coverage was 80.0%, with female proportion 82.5% and males 77.6%. One male child was completely unimmunized and remaining partially immunized, with unaware of schedule and illness of child being major reasons for partial immunization. There was no gender wise statistically significant difference observed in Primary Immunization with reference to coverage, quality, and place of immunization. Conclusions: Immunization coverage is nearing 85% benchmark with major contribution from Universal Immunization Program. Gender Equality observed in primary immunization. Preservation of immunization records by community and timely vaccinations are areas for improvement.

Partial recovery of erythrocyte glycogen in diabetic rats treated with phenobarbital

Directory of Open Access Journals (Sweden)

da-Silva C.A.

1997-01-01

Full Text Available Erythrocytes may play a role in glucose homeostasis during the postprandial period. Erythrocytes from diabetic patients are defective in glucose transport and metabolism, functions that may affect glycogen storage. Phenobarbital, a hepatic enzyme inducer, has been used in the treatment of patients with non-insulin-dependent diabetes mellitus (NIDDM, increasing the insulin-mediated glucose disposal. We studied the effects of phenobarbital treatment in vivo on glycemia and erythrocyte glycogen content in control and alloxan-diabetic rats during the postprandial period. In control rats (blood glucose, 73 to 111 mg/dl in femoral and suprahepatic veins the erythrocyte glycogen content was 45.4 ± 1.1 and 39.1 ± 0.8 µg/g Hb (mean ± SEM, N = 4-6 in the femoral artery and vein, respectively, and 37.9 ± 1.1 in the portal vein and 47.5 ± 0.9 in the suprahepatic vein. Diabetic rats (blood glucose, 300-350 mg/dl presented low (P<0.05 erythrocyte glycogen content, i.e., 9.6 ± 0.1 and 7.1 ± 0.7 µg/g Hb in the femoral artery and vein, respectively, and 10.0 ± 0.7 and 10.7 ± 0.5 in the portal and suprahepatic veins, respectively. After 10 days of treatment, phenobarbital (0.5 mg/ml in the drinking water did not change blood glucose or erythrocyte glycogen content in control rats. In diabetic rats, however, it lowered (P<0.05 blood glucose in the femoral artery (from 305 ± 18 to 204 ± 45 mg/dl and femoral vein (from 300 ± 11 to 174 ± 48 mg/dl and suprahepatic vein (from 350 ± 10 to 174 ± 42 mg/dl, but the reduction was not sufficient for complete recovery. Phenobarbital also stimulated the glycogen synthesis, leading to a partial recovery of glycogen stores in erythrocytes. In treated rats, erythrocyte glycogen content increased to 20.7 ± 3.8 µg/g Hb in the femoral artery and 30.9 ± 0.9 µg/g Hb in the suprahepatic vein (P<0.05. These data indicate that phenobarbital activated some of the insulin-stimulated glucose metabolism steps which were

Performance modeling of a two-tier primary-secondary network with IEEE 802.11 broadcast scheme

KAUST Repository

Khabazian, Mehdi

2011-03-01

In this paper, we study the performance of a two-tier primary-secondary network based on IEEE 802.11 broadcast scheme. We assume that a number of primary and secondary users coexist in the radio environment and share a single band. To protect the primary users\\' priority, the secondary users are allowed to contend for the channel only if they sense it idle for a certain sensing time. Considering an exponential packet inter-arrival time for the primary network, we model each primary user as an independent M/G/1 queue. Subsequently, we determine the primary users\\' average medium access delay in the presence of secondary users as well as the hybrid network\\'s throughput. Numerical results and discussions show the effects of parameters pertaining to the secondary users, such as as sensing time, packet payload size and population size, on the performance of the primary network. Furthermore, we provide simulation results which confirm the accuracy of the proposed analysis. © 2011 IEEE.

Performance modeling of a two-tier primary-secondary network with IEEE 802.11 broadcast scheme

KAUST Repository

Khabazian, Mehdi; Aissa, Sonia; El Kefi, Rania

2011-01-01

In this paper, we study the performance of a two-tier primary-secondary network based on IEEE 802.11 broadcast scheme. We assume that a number of primary and secondary users coexist in the radio environment and share a single band. To protect the primary users' priority, the secondary users are allowed to contend for the channel only if they sense it idle for a certain sensing time. Considering an exponential packet inter-arrival time for the primary network, we model each primary user as an independent M/G/1 queue. Subsequently, we determine the primary users' average medium access delay in the presence of secondary users as well as the hybrid network's throughput. Numerical results and discussions show the effects of parameters pertaining to the secondary users, such as as sensing time, packet payload size and population size, on the performance of the primary network. Furthermore, we provide simulation results which confirm the accuracy of the proposed analysis. © 2011 IEEE.

New results on the Roper resonance and the P-11 partial wave

NARCIS (Netherlands)

Sarantsev, A. V.; Fuchs, M.; Kotulla, M.; Thoma, U.; Ahrens, J.; Annand, J. R. M.; Anisovich, A. V.; Anton, G.; Bantes, R.; Bartholomy, O.; Beck, R.; Beloglazov, Yu.; Castelijns, R.; Crede, V.; Ehmanns, A.; Ernst, J.; Fabry, I.; Flemming, H.; Foesel, A.; Funke, Chr.; Gothe, R.; Gridnev, A.; Gutz, E.; Hoeffgen, St.; Horn, I.; Hoessl, J.; Hornidge, D.; Janssen, S.; Junkersfeld, J.; Kalinowsky, H.; Klein, F.; Klempt, E.; Koch, H.; Konrad, M.; Kopf, B.; Krusche, B.; Langheinrich, J.; Loehner, H.; Lopatin, I.; Lotz, J.; McGeorge, J. C.; MacGregor, I. J. D.; Matthaey, H.; Menze, D.; Messchendorp, J. G.; Metag, V.; Nikonov, V. A.; Novinski, D.; Novotny, R.; Ostrick, M.; van Pee, H.; Pfeiffer, M.; Radkov, A.; Rosner, G.; Rost, M.; Schmidt, C.; Schoch, B.; Suft, G.; Sumachev, V.; Szczepanek, T.; Walther, D.; Watts, D. P.; Weinheimer, Chr.

2008-01-01

Properties of the Roper resonance, the first scalar excitation of the nucleon, are determined. Pole positions and residues of the P-11 partial wave are studied in a combined analysis of pion- and photo-induced reactions. We find the Roper pole at {(1371 +/- 7) - i(92 +/- 10)} MeV and an elasticity

Genome-wide DNA methylation profiling identifies ALDH1A3 promoter methylation as a prognostic predictor in G-CIMP- primary glioblastoma.

Science.gov (United States)

Zhang, Wei; Yan, Wei; You, Gan; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; You, Yongping; Jiang, Tao

2013-01-01

To date, the aberrations in the DNA methylation patterns that are associated with different prognoses of G-CIMP- primary GBMs remain to be elucidated. Here, DNA methylation profiling of primary GBM tissues from 13 long-term survivors (LTS; overall survival ⩾18months) and 20 short-term survivors (STS; overall survival ⩽9months) was performed. Then G-CIMP+ samples were excluded. The differentially expressed CpG loci were identified between residual 18 STS and 9 LTS G-CIMP- samples. Methylation levels of 11 CpG loci (10genes) were statistically significantly lower, and 43 CpG loci (40genes) were statistically significantly higher in the tumor tissues of LTS than those of STS G-CIMP- samples (PCIMP- samples, 3 CpG loci localized in the promoter of ALDH1A3. Furthermore, using an independent validation cohort containing 37 primary GBM samples without IDH1 mutation and MGMT promoter methylation, the hypermethylation status of ALDH1A3 promoter predicted a better prognosis with an accompanied low expression of ALDH1A3 protein. Taken together, our results defined prognosis-related methylation signatures systematically for the first time in G-CIMP- primary GBMs. ALDH1A3 promoter methylation conferred a favorable prognosis in G-CIMP- primary GBMs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Partial purification and characterization of alkaline proteases from ...

African Journals Online (AJOL)

Alkaline proteases from the digestive tract of anchovy were partially purified by ammonium sulfate fractionation, dialysis and Sephadex G-75 gel filtration. The purification fold and yield were 6.23 and 4.49%, respectively. The optimum activities of partially purified alkaline proteases were observed at 60°C and at pH 11.0.

Resolution of G(s)alpha and G(q)alpha/G(11)alpha proteins in membrane domains by two-dimensional electrophoresis: the effect of long-term agonist stimulation.

Science.gov (United States)

Matousek, P; Novotný, J; Svoboda, P

2004-01-01

Low-density membrane-domain fractions were prepared from S49 lymphoma cells and clone e2m11 of HEK293 cells expressing a large number of thyrotropin-releasing hormone receptor (TRH-R) and G(11)alpha by flotation on sucrose density gradients. The intact cell structure was broken by detergent-extraction, alkaline-treatment or drastic homogenization. Three types of low-density membranes were resolved by two-dimensional electrophoresis and analyzed for G(s)alpha (S49) or G(q)alpha/G11) (e2m11) content. Four individual immunoblot signals of Gsalpha protein were identified in S49 lymphoma cells indicating complete resolution of the long G(s)alpha L+/-ser and short G(s)alpha S+/-ser variants of G(s)alpha. All these were diminished by prolonged agonist (isoprenaline) stimulation. In e2m11-HEK cells, five different immunoblot signals were detected indicating post-translational modification of G proteins of G(q)alpha/G(11)alpha family. The two major spots corresponding to exogenously (over)expressed G(11)alpha and endogenous G(q)alpha were reduced; the minor spots diminished by hormonal stimulation. Parallel analysis by silver staining of the total protein content indicated that no major changes in protein composition occurred under these conditions. Our data thus indicate that agonist-stimulation of target cells results in down-regulation of all different members of G(s) and G(q)/G(11) families. This agonist-specific effect may be demonstrated in crude membrane as well as domain/raft preparations and it is not accompanied by changes in overall protein composition.

Oracle Data Integrator 11g cookbook

CERN Document Server

Dupupet, Christophe; Gray, Denis; Testut, Julien

2013-01-01

Written as a practical Cookbook, the recipes in this essential guide will help you make the most out of Oracle Data Integrator 11g.This book is meant for people who already possess a basic understanding of Oracle Data Integrator and want to take it to the next level by learning how to better leverage advanced ODI features and functionality as they continue to develop and manage their data integration projects.

A structural, magnetic and Moessbauer spectral study of the magnetocaloric Mn1.1Fe0.9P1-xGex compounds

International Nuclear Information System (INIS)

Sougrati, Moulay T; Hermann, Raphael P; Grandjean, Fernande; Long, Gary J; Brueck, E; Tegus, O; Trung, N T; Buschow, K H J

2008-01-01

The structural, magnetic and Moessbauer spectral properties of the magnetocaloric Mn 1.1 Fe 0.9 P 1-x Ge x compounds, with 0.19 1.1 Fe 0.9 P 0.74 Ge 0.26 . The temperature dependence of the magnetization reveals a ferromagnetic to paramagnetic transition with a Curie temperature between approximately 250 and 330 K and hysteresis width of 10 to 4 K, for 0.19 1.1 Fe 0.9 P 0.78 Ge 0.22 shows the largest isothermal entropy change of approximately 10 J/(kgKT) at 290 K. The Moessbauer spectra have been analysed with a binomial distribution of hyperfine fields correlated with a change in isomer shift and quadrupole shift, a distribution that results from the distribution of phosphorus and germanium among the near neighbours of the iron. The coexistence of paramagnetic and magnetically ordered phases in ranges of temperature of up to 50 K around the Curie temperature is observed in the Moessbauer spectra and is associated with the first-order character of the ferromagnetic to paramagnetic transition. The temperature dependence of the weighted average hyperfine field is well fitted within the magnetostrictive model of Bean and Rodbell. Good fits of the Moessbauer spectra could only be achieved by introducing a difference between the isomer shifts in the paramagnetic and ferromagnetic phases, a difference that is related to the magnetostriction and electronic structure change.

Partial deletion 11q

DEFF Research Database (Denmark)

Hertz, Jens Michael; Tommerup, N; Sørensen, F B

1995-01-01

We describe the cytogenetic findings and the dysmorphic features in a stillborn girl with a large de novo terminal deletion of the long arm of chromosome 11. The karyotype was 46,XX,del(11)(q21qter). By reviewing previous reports of deletion 11q, we found that cleft lip and palate are most...

Gadd45g is essential for primary sex determination, male fertility and testis development.

Directory of Open Access Journals (Sweden)

Heiko Johnen

Full Text Available In humans and most mammals, differentiation of the embryonic gonad into ovaries or testes is controlled by the Y-linked gene SRY. Here we show a role for the Gadd45g protein in this primary sex differentiation. We characterized mice deficient in Gadd45a, Gadd45b and Gadd45g, as well as double-knockout mice for Gadd45ab, Gadd45ag and Gadd45bg, and found a specific role for Gadd45g in male fertility and testis development. Gadd45g-deficient XY mice on a mixed 129/C57BL/6 background showed varying degrees of disorders of sexual development (DSD, ranging from male infertility to an intersex phenotype or complete gonadal dysgenesis (CGD. On a pure C57BL/6 (B6 background, all Gadd45g(-/- XY mice were born as completely sex-reversed XY-females, whereas lack of Gadd45a and/or Gadd45b did not affect primary sex determination or testis development. Gadd45g expression was similar in female and male embryonic gonads, and peaked around the time of sex differentiation at 11.5 days post-coitum (dpc. The molecular cause of the sex reversal was the failure of Gadd45g(-/- XY gonads to achieve the SRY expression threshold necessary for testes differentiation, resulting in ovary and Müllerian duct development. These results identify Gadd45g as a candidate gene for male infertility and 46,XY sex reversal in humans.

Evaluation of primary immunization coverage of infants under universal immunization programme in an urban area of bangalore city using cluster sampling and lot quality assurance sampling techniques.

Science.gov (United States)

K, Punith; K, Lalitha; G, Suman; Bs, Pradeep; Kumar K, Jayanth

2008-07-01

Is LQAS technique better than cluster sampling technique in terms of resources to evaluate the immunization coverage in an urban area? To assess and compare the lot quality assurance sampling against cluster sampling in the evaluation of primary immunization coverage. Population-based cross-sectional study. Areas under Mathikere Urban Health Center. Children aged 12 months to 23 months. 220 in cluster sampling, 76 in lot quality assurance sampling. Percentages and Proportions, Chi square Test. (1) Using cluster sampling, the percentage of completely immunized, partially immunized and unimmunized children were 84.09%, 14.09% and 1.82%, respectively. With lot quality assurance sampling, it was 92.11%, 6.58% and 1.31%, respectively. (2) Immunization coverage levels as evaluated by cluster sampling technique were not statistically different from the coverage value as obtained by lot quality assurance sampling techniques. Considering the time and resources required, it was found that lot quality assurance sampling is a better technique in evaluating the primary immunization coverage in urban area.

Evaluation of 11C-choline PET/CT for primary diagnosis and staging of urothelial carcinoma of the upper urinary tract: a pilot study

International Nuclear Information System (INIS)

Sassa, Naoto; Yamamoto, Tokunori; Gotoh, Momokazu; Kato, Katsuhiko; Ikeda, Mitsuru; Shimamoto, Kazuhiro; Yamamoto, Seiichi; Abe, Shinji; Iwano, Shingo; Ito, Shinji; Naganawa, Shinji

2014-01-01

We conducted a pilot study to prospectively evaluate the efficacy of PET/CT with 11 C-choline (choline PET/CT) for primary diagnosis and staging of urothelial carcinoma of the upper urinary tract (UUT-UC). Enrolled in this study were 16 patients (9 men, 7 women; age range 51 - 83 years, mean ± SD 69 ± 10.8 years) with suspected UUT-UC. The patients were examined by choline PET/CT, and 13 underwent laparoscopic nephroureterectomy and partial cystectomy. Lymphadenectomy and chemotherapy were also performed as necessary in some of the patients. Of the 16 patients, 12 were confirmed to have UUT-UC (7 renal pelvis carcinoma and 5 ureteral carcinoma), 1 had malignant lymphoma (ureter), 1 had IgG4-related disease (ureter), and 2 had other benign diseases (ureter). Of the 16 study patients, 13 showed definite choline uptake in urothelial lesions, and of these, 11 had UUT-UC, 1 had malignant lymphoma, and 1 had IgG4-related disease. Three patients without choline uptake comprised one with UUT-UC and two with benign diseases. Of the 12 patients with UUT-UC, 3 had distant metastases, 2 had metastases only in the regional lymph nodes, and 7 had no metastases. Distant metastases and metastases in the regional lymph nodes showed definite choline uptake. The outcome in patients with UUT-UC, which was evaluated 592 - 1,530 days after surgery, corresponded to the patient classification based on the presence or absence of metastases and locoregional or distant metastases. Choline uptake determined as SUVmax 10 min after administration was significantly higher than at 20 min in metastatic tumours of UUT-UC (p < 0.05), whereas there was no statistically significant difference between the SUVmax values at 10 and those at 20 min in primary tumours of UUT-UC. This study suggests that choline PET/CT is a promising tool for the primary diagnosis and staging of UUT-UC. (orig.)

A chiral quark model for meson electroproduction in the S11 partial wave

International Nuclear Information System (INIS)

Golli, B.; Sirca, S.

2011-01-01

We calculate the meson scattering and electroproduction amplitudes in the S11 partial wave in a coupled-channel approach that incorporates quasi-bound quark-model states. Using the quark wave functions and the quark-meson interaction from the Cloudy Bag Model, we obtain a good overall agreement with the available experimental results for the partial widths of the N(1535) and the N(1650) resonances as well as for the pion, eta and kaon electroproduction amplitudes. Our model is consistent with the N(1535) resonance being dominantly a genuine three-quark state rather than a quasi-bound state of mesons and baryons. (orig.)

Temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from PROFESSOR MULTANOVSKIY in the North Atlantic Ocean from 1993-09-11 to 1993-11-21 (NCEI Accession 0143931)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0143931 includes discrete sample and profile data collected from PROFESSOR MULTANOVSKIY in the North Atlantic Ocean from 1993-09-11 to 1993-11-21....

Changes in Gene Expression of Arabidopsis Thaliana Cell Cultures Upon Exposure to Real and Simulated Partial- g Forces

Science.gov (United States)

Fengler, Svenja; Spirer, Ina; Neef, Maren; Ecke, Margret; Hauslage, Jens; Hampp, Rüdiger

2016-06-01

Cell cultures of the plant model organism Arabidopsis thaliana were exposed to partial- g forces during parabolic flight and clinostat experiments (0.16 g, 0.38 g and 0.5 g were tested). In order to investigate gravity-dependent alterations in gene expression, samples were metabolically quenched by the fixative RNA later Ⓡ to stabilize nucleic acids and used for whole-genome microarray analysis. An attempt to identify the potential threshold acceleration for the gravity-dependent response showed that the smaller the experienced g-force, the greater was the susceptibility of the cell cultures. Compared to short-term μ g during a parabolic flight, the number of differentially expressed genes under partial- g was lower. In addition, the effect on the alteration of amounts of transcripts decreased during partial- g parabolic flight due to the sequence of the different parabolas (0.38 g, 0.16 g and μ g). A time-dependent analysis under simulated 0.5 g indicates that adaptation occurs within minutes. Differentially expressed genes (at least 2-fold up- or down-regulated in expression) under real flight conditions were to some extent identical with those affected by clinorotation. The highest number of homologuous genes was detected within seconds of exposure to 0.38 g (both flight and clinorotation). To a considerable part, these genes deal with cell wall properties. Additionally, responses specific for clinorotation were observed.

Transverse sphericity of primary charged particles in minimum bias proton–proton collisions at √s= 0.9, 2.76 and 7 TeV

NARCIS (Netherlands)

Abelev, B.I.; Adam, J.; Bjelogrlic, S; Chojnacki, M.; Christakoglou, P.; de Rooij, R. S.; Grelli, A.; La Pointe, S.L.; Luparello, G.; Mischke, A.; Nooren, G.J.L.; Peitzmann, T.; Reicher, M; Snellings, R.J.M.; Thomas, D; van Leeuwen, M.; Veldhoen, M; Verweij, M.; Zhou, Y.; Zyzak, M.

2012-01-01

Measurements of the sphericity of primary charged particles in minimum bias proton–proton collisions at √ s = 0.9, 2.76 and 7 TeV with the ALICE detector at the LHC are presented. The observable is measured in the plane perpendicular to the beam direction using primary charged tracks with pT > 0.5

The removable acrylic partial denture in primary care: the experience and satisfaction of dental surgeons

Directory of Open Access Journals (Sweden)

Rita de Cássia SILVA

2017-11-01

Full Text Available Abstract Introduction The guidelines of the National Politics of Oral Health have led to the inclusion of elemental prostheses in the list of Primary Care procedures. Objective This paper aimed to evaluate the performance and satisfaction of dental surgeons with the implementation of Acrylic Partial Dentures. Metodology The sample was composed by 159 dental surgeons (sample calculation, in Belo Horizonte, MG, Brazil, selected via raffle (simple random sampling. A structured questionnaire was built with 72 questions on the daily practice of the performance of dental surgeons, using the SurveyMonkey platform. Result The results showed that for most of dental surgeons, the inclusion on the list of primary care procedures was a positive initiative and they have enjoyed the experience of using Acrylic Partial Dentures. Dental surgeons who had graduated in private institutions reported to have had more failures than those who had graduated in public institutions. The better prepared dental surgeons reported less difficulties and failures, and the more satisfied professionals with the performance of Acrylic Partial Dentures related had also experienced fewer failures. Considering the indication, the majority of participants did it according to the protocol of the institution (only for anterior teeth but many revealed the use of dentures also for premolars. Conclusion Acrylic partial dentures have been a reality in the Brazilian social context even before their inclusion in the list of Primary Care procedures. Such inclusion indicates their relevance; however, it is necessary to have their confection systematized by a protocol in public services.

Predominance of HA-222D/G polymorphism in influenza A(H1N1pdm09 viruses associated with fatal and severe outcomes recently circulating in Germany.

Directory of Open Access Journals (Sweden)

Marianne Wedde

Full Text Available Influenza A(H1N1pdm09 viruses cause sporadically very severe disease including fatal clinical outcomes associated with pneumonia, viremia and myocarditis. A mutation characterized by the substitution of aspartic acid (wild-type to glycine at position 222 within the haemagglutinin gene (HA-D222G was recorded during the 2009 H1N1 pandemic in Germany and other countries with significant frequency in fatal and severe cases. Additionally, A(H1N1pdm09 viruses exhibiting the polymorphism HA-222D/G/N were detected both in the respiratory tract and in blood. Specimens from mild, fatal and severe cases were collected to study the heterogeneity of HA-222 in A(H1N1pdm09 viruses circulating in Germany between 2009 and 2011. In order to enable rapid and large scale analysis we designed a pyrosequencing (PSQ assay. In 2009/2010, the 222D wild-type of A(H1N1pdm09 viruses predominated in fatal and severe outcomes. Moreover, co-circulating virus mutants exhibiting a D222G or D222E substitution (8/6% as well as HA-222 quasispecies were identified (10%. Both the 222D/G and the 222D/G/N/V/Y polymorphisms were confirmed by TA cloning. PSQ analyses of viruses associated with mild outcomes revealed mainly the wild-type 222D and no D222G change in both seasons. However, an increase of variants with 222D/G polymorphism (60% was characteristic for A(H1N1pdm09 viruses causing fatal and severe cases in the season 2010/2011. Pure 222G viruses were not observed. Our results support the hypothesis that the D222G change may result from adaptation of viral receptor specificity to the lower respiratory tract. This could explain why transmission of the 222G variant is less frequent among humans. Thus, amino acid changes at HA position 222 may be the result of viral intra-host evolution leading to the generation of variants with an altered viral tropism.

CMOS analog baseband circuitry for an IEEE 802.11 b/g/n WLAN transceiver

International Nuclear Information System (INIS)

Gong Zheng; Chu Xiaojie; Shi Yin; Lei Qianqian; Lin Min

2012-01-01

An analog baseband circuit for a direct conversion wireless local area network (WLAN) transceiver in a standard 0.13-μm CMOS occupying 1.26 mm 2 is presented. The circuit consists of active-RC receiver (RX) 4th order elliptic lowpass filters(LPFs), transmit (PGAs) with DC offset cancellation (DCOC) servo loops, and on-chip output buffers. The RX baseband gain can be programmed in the range of −11 to 49 dB in 2 dB steps with 50–30.2 nV/√Hz input referred noise (IRN) and a 21 to −41 dBm in-band 3rd order interception point (IIP3). The RX/TX LPF cutoff frequencies can be switched between 5 MHz, 10 MHz, and 20 MHz to fulfill the multimode 802.11b/g/n requirements. The TX baseband gain of the I/Q paths are tuned separately from −1.6 to 0.9 dB in 0.1 dB steps to calibrate TX I/Q gain mismatches. By using an identical integrator based elliptic filter synthesis method together with global compensation applied to the LPF capacitor array, the power consumption of the RX LPF is considerably reduced and the proposed chip draws 26.8 mA/8 mA by the RX/TX baseband paths from a 1.2 V supply. (semiconductor integrated circuits)

CMOS analog baseband circuitry for an IEEE 802.11 b/g/n WLAN transceiver

Science.gov (United States)

Zheng, Gong; Xiaojie, Chu; Qianqian, Lei; Min, Lin; Yin, Shi

2012-11-01

An analog baseband circuit for a direct conversion wireless local area network (WLAN) transceiver in a standard 0.13-μm CMOS occupying 1.26 mm2 is presented. The circuit consists of active-RC receiver (RX) 4th order elliptic lowpass filters(LPFs), transmit (PGAs) with DC offset cancellation (DCOC) servo loops, and on-chip output buffers. The RX baseband gain can be programmed in the range of -11 to 49 dB in 2 dB steps with 50-30.2 nV/√Hz input referred noise (IRN) and a 21 to -41 dBm in-band 3rd order interception point (IIP3). The RX/TX LPF cutoff frequencies can be switched between 5 MHz, 10 MHz, and 20 MHz to fulfill the multimode 802.11b/g/n requirements. The TX baseband gain of the I/Q paths are tuned separately from -1.6 to 0.9 dB in 0.1 dB steps to calibrate TX I/Q gain mismatches. By using an identical integrator based elliptic filter synthesis method together with global compensation applied to the LPF capacitor array, the power consumption of the RX LPF is considerably reduced and the proposed chip draws 26.8 mA/8 mA by the RX/TX baseband paths from a 1.2 V supply.

New results on the Roper resonance and the P{sub 11} partial wave

Energy Technology Data Exchange (ETDEWEB)

Sarantsev, A.V. [Helmholtz-Institut fuer Strahlen- und Kernphysik der Universitaet Bonn (Germany); Petersburg Nuclear Physics Institute, Gatchina (Russian Federation); Fuchs, M. [Helmholtz-Institut fuer Strahlen- und Kernphysik der Universitaet Bonn (Germany); Kotulla, M. [Physikalisches Institut, Universitaet Basel (Switzerland); II. Physikalisches Institut, Universitaet Giessen (Germany); Thoma, U. [Helmholtz-Institut fuer Strahlen- und Kernphysik der Universitaet Bonn (Germany); II. Physikalisches Institut, Universitaet Giessen (Germany); Ahrens, J. [Institut fuer Kernphysik, Universitaet Mainz (Germany); Annand, J.R.M. [Department of Physics and Astronomy, University of Glasgow (United Kingdom); Anisovich, A.V. [Helmholtz-Institut fuer Strahlen- und Kernphysik der Universitaet Bonn (Germany); Petersburg Nuclear Physics Institute, Gatchina (Russian Federation); Anton, G. [Physikalisches Institut, Universitaet Erlangen (Germany); Bantes, R. [Physikalisches Institut, Universitaet Bonn (Germany); Bartholomy, O. [Helmholtz-Institut fuer Strahlen- und Kernphysik der Universitaet Bonn (Germany); Beck, R. [Helmholtz-Institut fuer Strahlen- und Kernphysik der Universitaet Bonn (Germany); Institut fuer Kernphysik, Universitaet Mainz (Germany); Beloglazov, Yu. [Petersburg Nuclear Physics Institute, Gatchina (Russian Federation); Castelijns, R. [KVI, Groningen (Netherlands); Crede, V. [Helmholtz-Institut fuer Strahlen- und Kernphysik der Universitaet Bonn (Germany); Department of Physics, Florida State University (United States); Ehmanns, A.; Ernst, J.; Fabry, I. [Helmholtz-Institut fuer Strahlen- und Kernphysik der Universitaet Bonn (Germany); Flemming, H. [Physikalisches Institut, Universitaet Bochum (Germany); Foesel, A. [Physikalisches Institut, Universitaet Erlangen (Germany); Funke, Chr. [Helmholtz-Institut fuer Strahlen- und Kernphysik der Universitaet Bonn (Germany)] (and others)

2008-01-17

Properties of the Roper resonance, the first scalar excitation of the nucleon, are determined. Pole positions and residues of the P{sub 11} partial wave are studied in a combined analysis of pion- and photo-induced reactions. We find the Roper pole at {l_brace}(1371{+-}7)-i(92{+-}10){r_brace} MeV and an elasticity of 0.61{+-}0.03. The largest decay coupling is found for the N{sigma} ({sigma}=({pi}{pi})-S-wave). The analysis is based on new data on {gamma}p{yields}p{pi}{sup 0}{pi}{sup 0} for photons in the energy range from the two-pion threshold to 820 MeV from TAPS at Mainz and from 0.4 to 1.3 GeV from Crystal Barrel at Bonn and includes further data from other experiments. The partial wave analysis excludes the possibility that the Roper resonance is split into two states with different partial decay widths.

Does the Maternal Serum IgG Level during Pregnancy in Primary Antibody Deficiency Influence the IgG Level in the Newborn?

Directory of Open Access Journals (Sweden)

Vasantha Nagendran

2015-01-01

Full Text Available Purpose. To find out if the serum IgG level in the newborn baby was affected by low maternal serum IgG during pregnancy in two newly diagnosed primary antibody deficient patients. Method. Infant cord blood IgG level was compared with maternal IgG level in 2 mothers with newly diagnosed primary antibody deficiency, who declined replacement IgG treatment during pregnancy. Results. Both mothers delivered healthy babies with normal IgG levels at birth. Conclusions. The normal IgG levels and sound health in these 2 babies in spite of low maternal IgG throughout pregnancy raise interesting discussion points about maternofoetal immunoglobulin transport mechanisms in primary antibody deficiency.

Oracle BI Publisher 11g A Practical Guide to Enterprise Reporting

CERN Document Server

Bozdoc, Daniela

2011-01-01

This is a practical guide with step-by step instructions for enhancing your application of Oracle BI Publisher 11g for enterprise reporting. If you are an Oracle BI Publisher 11g end user, be it a report developer, business analyst or consultant, this book is for you. You should have good knowledge of general reporting practices and XML/XSL programming, though experience of using BI/XML publisher is not essential.

Impact of Primary User Traffic on Adaptive Transmission for Cognitive Radio with Partial Relay Selection

KAUST Repository

Rao, Anlei

2012-09-08

In a cognitive relay system, the secondary user is permitted to transmit data via a relay when licensed frequency bands are detected to be free. Previous studies mainly focus on reducing or limiting the interference of the secondary transmission on the primary users. On the other hand, however, the primary user traffic will also affect the data transmission performance of the secondary users. In this paper, we investigate the impact of the primary user traffic on the bit error rate (BER) of the secondary transmission, when the secondary user adopts adaptive transmission with a relay partially selected. From the numerical results, we can see that the primary user traffic seriously degrades average BER. The worse-link partial selection can perform almost as well as the global selection when the channel conditions of the source-relay links and the relay-destination links differ a lot. In addition, although the relay selection improves the spectral efficiency of the secondary transmission, numerical results show that it only has slight impact on the overall average BER, so that the robustness of the system will not be affected by the relay selection.

Oracle Data Guard 11gR2 administration beginner's guide

CERN Document Server

Baransel, Emre

2013-01-01

Using real-world examples and hands-on tasks, Oracle Data Guard 11gR2 Administration Beginner's Guide will give you a solid foundation in Oracle Data Guard. It has been designed to teach you everything you need to know to successfully create and operate Data Guard environments with maximum flexibility, compatibility, and effectiveness.If you are an Oracle database administrator who wants to configure and administer Data Guard configurations, then ""Oracle Data Guard 11gR2 Administration Beginner's Guide"" is for you. With a basic understanding of Oracle database administration, you'll be able

Performance comparison of IEEE 802.11g and IEEE 802.11n in the presence of interference from 802.15.4 networks

OpenAIRE

Masood, Syed Haani

2013-01-01

In this paper we compare the packet error rate (PER) and maximum throughput of IEEE 802.11n and IEEE 802.11g under interference from IEEE 802.15.4 by using MATLAB to simulate the IEEE PHY for 802.11n and 802.11g networks.

Evaluation of primary immunization coverage of infants under universal immunization programme in an urban area of Bangalore city using cluster sampling and lot quality assurance sampling techniques

Directory of Open Access Journals (Sweden)

Punith K

2008-01-01

Full Text Available Research Question: Is LQAS technique better than cluster sampling technique in terms of resources to evaluate the immunization coverage in an urban area? Objective: To assess and compare the lot quality assurance sampling against cluster sampling in the evaluation of primary immunization coverage. Study Design: Population-based cross-sectional study. Study Setting: Areas under Mathikere Urban Health Center. Study Subjects: Children aged 12 months to 23 months. Sample Size: 220 in cluster sampling, 76 in lot quality assurance sampling. Statistical Analysis: Percentages and Proportions, Chi square Test. Results: (1 Using cluster sampling, the percentage of completely immunized, partially immunized and unimmunized children were 84.09%, 14.09% and 1.82%, respectively. With lot quality assurance sampling, it was 92.11%, 6.58% and 1.31%, respectively. (2 Immunization coverage levels as evaluated by cluster sampling technique were not statistically different from the coverage value as obtained by lot quality assurance sampling techniques. Considering the time and resources required, it was found that lot quality assurance sampling is a better technique in evaluating the primary immunization coverage in urban area.

Measurement of the isotopic composition of the primary cosmic radiation for the elements B-Ne

International Nuclear Information System (INIS)

Bjarle, C.; Herrstroem, N-Y.; Jacobsson, L.; Joensson, G.; Kristiansson, K.

1977-05-01

The results are given from an investigation of the isotopic composition of primary cosmic ray B, C, N and O. Preliminary result is also given from an investigation of Ne. The mass measurements are made in nuclear emulsions exposed at about 3 g/cm 2 atmospheric depth. The results for B-O represented as quotients extrapolated to the top of the atmosphere, are: 11 B/B=0.61+-0.10; 13 C/C=0.06+-0.03; 15 N/N=0.33+-0.09; 17 O/O=0.05+-0.03; 18 O/O=0.08+-0.03. The preliminary result from the Ne-measurements shows that nuclei with masses larger than 20 exist among the primary neon nuclei. (Auth.)

Zooplankton, chemical, and other data collected from THOMAS G. THOMPSON in Arabian Sea; 09 January 1995 to 07 April 1995 (NODC Accession 9800109)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Zooplankton, chemical, and other data were collected using zooplankton net casts in Arabian Sea from THOMAS G. THOMPSON. Data were collected from 09 January 1995 to...

Impact of stereotactic 11-g vacuum-assisted breast biopsy on cost of diagnosis in Austria

International Nuclear Information System (INIS)

Gruber, R.; Walter, E.; Helbich, T.H.

2011-01-01

Purpose: To determine the frequency with which stereotactic 11-g vacuum-assisted breast biopsy (11-g SVAB) obviates an open surgical biopsy (OSB), to compare the costs of these two biopsy methods, and to estimate the potential cost savings attributable to 11-g SVAB in the diagnosis of suspicious breast lesions in patients in Austria. Materials and methods: We retrospectively reviewed 318 consecutive breast lesions of BI-RADS categories IV and V (microcalcifications n = 166; masses n = 152) on which 11-g SVAB and OSB were performed. Cost savings were calculated using nationally allowed flat rates and patient charges. Costs were measured from a hospital and a socioeconomic perspective. Common clinical scenarios and sensitivity analyses assessed the extent of achievable cost savings. Results: 11-g SVAB obviated the need for an OSB in 93 (29%) of 318 women. Overall cost savings per 11-g SVAB over OSB were Euro 242 per case from a hospital perspective, and Euro 422 per case from a socioeconomic perspective. The use of 11-g SVAB decreased the cost of diagnosis by 7% from a hospital perspective, and by 10% from a socioeconomic perspective. Conclusion: In Austria, annual national savings of over 5 million Euro could be realized with the use of 11-g SVAB for the diagnosis of suspicious breast lesions. Although savings per case are modest, the national health care system realizes significant cost reduction as women benefit from a faster and less invasive approach to diagnosis.

Impact of stereotactic 11-g vacuum-assisted breast biopsy on cost of diagnosis in Austria.

Science.gov (United States)

Gruber, R; Walter, E; Helbich, T H

2011-01-01

To determine the frequency with which stereotactic 11-g vacuum-assisted breast biopsy (11-g SVAB) obviates an open surgical biopsy (OSB), to compare the costs of these two biopsy methods, and to estimate the potential cost savings attributable to 11-g SVAB in the diagnosis of suspicious breast lesions in patients in Austria. We retrospectively reviewed 318 consecutive breast lesions of BI-RADS categories IV and V (microcalcifications n=166; masses n=152) on which 11-g SVAB and OSB were performed. Cost savings were calculated using nationally allowed flat rates and patient charges. Costs were measured from a hospital and a socioeconomic perspective. Common clinical scenarios and sensitivity analyses assessed the extent of achievable cost savings. 11-g SVAB obviated the need for an OSB in 93 (29%) of 318 women. Overall cost savings per 11-g SVAB over OSB were € 242 per case from a hospital perspective, and € 422 per case from a socioeconomic perspective. The use of 11-g SVAB decreased the cost of diagnosis by 7% from a hospital perspective, and by 10% from a socioeconomic perspective. In Austria, annual national savings of over 5 million Euro could be realized with the use of 11-g SVAB for the diagnosis of suspicious breast lesions. Although savings per case are modest, the national health care system realizes significant cost reduction as women benefit from a faster and less invasive approach to diagnosis. Copyright © 2009 Elsevier Ireland Ltd. All rights reserved.

Impact of stereotactic 11-g vacuum-assisted breast biopsy on cost of diagnosis in Austria

Energy Technology Data Exchange (ETDEWEB)

Gruber, R., E-mail: renate.gruber@meduniwien.ac.at [Medical University of Vienna, Department of Radiology, Division of Molecular and Gender Imaging, Waehringer Guertel 18-20, A-1090 Vienna (Austria); Walter, E. [Institute of Pharmacoeconomic Research, Wolfengasse 4/7, A-1010 Vienna (Austria); Helbich, T.H. [Medical University of Vienna, Department of Radiology, Division of Molecular and Gender Imaging, Waehringer Guertel 18-20, A-1090 Vienna (Austria)

2011-01-15

Purpose: To determine the frequency with which stereotactic 11-g vacuum-assisted breast biopsy (11-g SVAB) obviates an open surgical biopsy (OSB), to compare the costs of these two biopsy methods, and to estimate the potential cost savings attributable to 11-g SVAB in the diagnosis of suspicious breast lesions in patients in Austria. Materials and methods: We retrospectively reviewed 318 consecutive breast lesions of BI-RADS categories IV and V (microcalcifications n = 166; masses n = 152) on which 11-g SVAB and OSB were performed. Cost savings were calculated using nationally allowed flat rates and patient charges. Costs were measured from a hospital and a socioeconomic perspective. Common clinical scenarios and sensitivity analyses assessed the extent of achievable cost savings. Results: 11-g SVAB obviated the need for an OSB in 93 (29%) of 318 women. Overall cost savings per 11-g SVAB over OSB were Euro 242 per case from a hospital perspective, and Euro 422 per case from a socioeconomic perspective. The use of 11-g SVAB decreased the cost of diagnosis by 7% from a hospital perspective, and by 10% from a socioeconomic perspective. Conclusion: In Austria, annual national savings of over 5 million Euro could be realized with the use of 11-g SVAB for the diagnosis of suspicious breast lesions. Although savings per case are modest, the national health care system realizes significant cost reduction as women benefit from a faster and less invasive approach to diagnosis.

3G Femto or 802.11g WiFi

DEFF Research Database (Denmark)

Jørgensen, Niels T.K.; Rodriguez Larrad, Ignacio; Elling, Jan

2014-01-01

In this paper HSPA Release 6 femto and IEEE 802.11g WiFi indoor data solutions are investigated from an end user perspective. Femto and WiFi access points are deployed at typical locations in an urban environment and end user performance is measured. Three key performance indicators (KPI) were...... defined - downlink and uplink user data rates, latency and mobile power consumption. These three KPIs are of high importance when choosing an indoor data solution. Our measurements show that the downlink and uplink data rates of the WiFi solution are significantly higher than femto data rates. Similarly...... active mode power consumption measurements. Based on our KPIs, the preferred indoor data solution today is WiFi. The deciding factor is the combined latency and power performance of the WiFi, where WiFi outperforms the femto....

Oracle SOA Suite 11g performance cookbook

CERN Document Server

Brasier, Matthew; Wright, Nicholas

2013-01-01

This is a Cookbook with interesting, hands-on recipes, giving detailed descriptions and lots of practical walkthroughs for boosting the performance of your Oracle SOA Suite.This book is for Oracle SOA Suite 11g administrators, developers, and architects who want to understand how they can maximise the performance of their SOA Suite infrastructure. The recipes contain easy to follow step-by-step instructions and include many helpful and practical tips. It is suitable for anyone with basic operating system and application server administration experience.

Hierarchical fragmentation and differential star formation in the Galactic `Snake': infrared dark cloud G11.11-0.12

NARCIS (Netherlands)

Wang, Ke; Zhang, Qizhou; Testi, Leonardo; van der Tak, Floris; Wu, Yuefang; Zhang, Huawei; Pillai, Thushara; Wyrowski, Friedrich; Carey, Sean; Ragan, Sarah E.; Henning, Thomas

We present Submillimeter Array (SMA) λ = 0.88 and 1.3 mm broad-band observations, and Very Large Array (VLA) observations in NH3 (J, K) = (1,1) up to (5,5), H2O and CH3OH maser lines towards the two most massive molecular clumps in infrared dark cloud (IRDC) G11.11-0.12. Sensitive high-resolution

Allelic imbalance modulates surface expression of the tolerance-inducing HLA-G molecule on primary trophoblast cells.

Science.gov (United States)

Djurisic, S; Teiblum, S; Tolstrup, C K; Christiansen, O B; Hviid, T V F

2015-03-01

The HLA-G molecule is expressed on trophoblast cells at the feto-maternal interface, where it interacts with local immune cells, and upholds tolerance against the semi-allogeneic fetus. Aberrant HLA-G expression in the placenta and reduced soluble HLA-G levels are observed in pregnancy complications, partly explained by HLA-G polymorphisms which are associated with differences in the alternative splicing pattern and of the stability of HLA-G mRNA. Of special importance is a 14 bp insertion/deletion polymorphism located in the 3'-untranslated region of the HLA-G gene. In the current study, we present novel evidence for allelic imbalance of the 14 bp insertion/deletion polymorphism, using a very accurate and sensitive Digital droplet PCR technique. Allelic imbalance in heterozygous samples was observed as differential expression levels of 14 bp insertion/deletion allele-specific mRNA transcripts, which was further associated with low levels of HLA-G surface expression on primary trophoblast cells. Full gene sequencing of HLA-G allowed us to study correlations between HLA-G extended haplotypes and single-nucleotide polymorphisms and HLA-G surface expression. We found that a 1:1 expression (allelic balance) of the 14 bp insertion/deletion mRNA alleles was associated with high surface expression of HLA-G and with a specific HLA-G extended haplotype. The 14 bp del/del genotype was associated with a significantly lower abundance of the G1 mRNA isoform, and a higher abundance of the G3 mRNA isoform. Overall, the present study provides original evidence for allelic imbalance of the 14 bp insertion/deletion polymorphism, which influences HLA-G surface expression on primary trophoblast cells, considered to be important in the pathogenesis of pre-eclampsia and other pregnancy complications. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Thyrocyte-specific Gq/G11 deficiency impairs thyroid function and prevents goiter development.

Science.gov (United States)

Kero, Jukka; Ahmed, Kashan; Wettschureck, Nina; Tunaru, Sorin; Wintermantel, Tim; Greiner, Erich; Schütz, Günther; Offermanns, Stefan

2007-09-01

The function of the adult thyroid is regulated by thyroid-stimulating hormone (TSH), which acts through a G protein-coupled receptor. Overactivation of the TSH receptor results in hyperthyroidism and goiter. The Gs-mediated stimulation of adenylyl cyclase-dependent cAMP formation has been regarded as the principal intracellular signaling mechanism mediating the action of TSH. Here we show that the Gq/G11-mediated signaling pathway plays an unexpected and essential role in the regulation of thyroid function. Mice lacking the alpha subunits of Gq and G11 specifically in thyroid epithelial cells showed severely reduced iodine organification and thyroid hormone secretion in response to TSH, and many developed hypothyroidism within months after birth. In addition, thyrocyte-specific Galphaq/Galpha11-deficient mice lacked the normal proliferative thyroid response to TSH or goitrogenic diet, indicating an essential role of this pathway in the adaptive growth of the thyroid gland. Our data suggest that Gq/G11 and their downstream effectors are promising targets to interfere with increased thyroid function and growth.

Frequency of respiratory virus infections and next-generation analysis of influenza A/H1N1pdm09 dynamics in the lower respiratory tract of patients admitted to the ICU.

Directory of Open Access Journals (Sweden)

Antonio Piralla

Full Text Available Recent molecular diagnostic methods have significantly improved the diagnosis of viral pneumonia in intensive care units (ICUs. It has been observed that 222G/N changes in the HA gene of H1N1pdm09 are associated with increased lower respiratory tract (LRT replication and worse clinical outcome. In the present study, the frequency of respiratory viruses was assessed in respiratory samples from 88 patients admitted to 16 ICUs during the 2014-2015 winter-spring season in Lombardy. Sixty-nine out of 88 (78.4% patients were positive for a respiratory viral infection at admission. Of these, 57/69 (82.6% were positive for influenza A (41 A/H1N1pdm09 and 15 A/H3N2, 8/69 (11.6% for HRV, 2/69 (2.9% for RSV and 2/69 (2.9% for influenza B. Phylogenetic analysis of influenza A/H1N1pdm09 strains from 28/41 ICU-patients and 21 patients with mild respiratory syndrome not requiring hospitalization, showed the clear predominance of subgroup 6B strains. The median influenza A load in LRT samples of ICU patients was higher than that observed in the upper respiratory tract (URT (p<0.05. Overall, a greater number of H1N1pdm09 virus variants were observed using next generation sequencing on partial HA sequences (codons 180-286 in clinical samples from the LRT as compared to URT. In addition, 222G/N/A mutations were observed in 30% of LRT samples from ICU patients. Finally, intra-host evolution analysis showed the presence of different dynamics of viral population in LRT of patients hospitalized in ICU with a severe influenza infection.

Cdk phosphorylation of the Ste11 transcription factor constrains differentiation-specific transcription to G1

DEFF Research Database (Denmark)

Kjaerulff, Søren; Andersen, Nicoline Resen; Borup, Mia Trolle

2007-01-01

Eukaryotic cells normally differentiate from G(1); here we investigate the mechanism preventing expression of differentiation-specific genes outside G(1). In fission yeast, induction of the transcription factor Ste11 triggers sexual differentiation. We find that Ste11 is only active in G(1) when...... Cdk activity is low. In the remaining part of the cell cycle, Ste11 becomes Cdk-phosphorylated at Thr 82 (T82), which inhibits its DNA-binding activity. Since the ste11 gene is autoregulated and the Ste11 protein is highly unstable, this Cdk switch rapidly extinguishes Ste11 activity when cells enter...... S phase. When we mutated T82 to aspartic acid, mimicking constant phosphorylation, cells no longer underwent differentiation. Conversely, changing T82 to alanine rendered Ste11-controlled transcription constitutive through the cell cycle, and allowed mating from S phase with increased frequency...

CpG Island Methylator Phenotype in Primary Gastric Carcinoma

OpenAIRE

TOJO Masayuki:筆頭著者; KONISHI Kazuo; YANO Yuichiro; KATAGIRI Atsushi; NOZAWA Hisako; KUBOTA Yutaro; MURAMOTO Takashi; KONDA Kenichi; SHINMURA Kensuke; TAKIMOTO Masafumi; IMAWARI Michio; YOSHIDA Hitoshi

2013-01-01

Gastric cancers (GC) with methylation of multiple CpG islands have a CpG island methylator phenotype (CIMP) and they can have different biological features. The aim of this study was to investigate the DNA methylation status of GCs and its association with their clinicopathological features. We evaluated the methylation status of four genes (MINT1, MINT2, MINT25 and MINT31) in 105 primary GCs using bisulfite-pyrosequencing analysis. We classified tumors as CIMP-high (CIMP-H), CIMP-low (CIMP-L...

Primary antiphospholipid antibody syndrome: neuroradiologic findings in 11 patients

International Nuclear Information System (INIS)

Kim, Jung Hoon; Choi, Choong Gon; Choi, Soo Jung; Lee, Ho Kyu; Suh, Dae Chul

2000-01-01

To describe the neuroradiologic findings of primary antiphospholipid antibody syndrome (PAPS). During a recent two-year period, abnormally elevated antiphospholipid antibodies were detected in a total of 751 patients. In any cases in which risk factors for stroke were detected - hypertension, diabetes mellitus, hyperlipidemia, smoking, and the presence of SLE or other connective tissue diseases - PAPS was not diagnosed. Neuroradiologic studies were performed in 11 of 32 patients with PAPS. We retrospectively reviewed brain CT (n = 7), MR (n = 8), and cerebral angiography (n = 8) in 11 patients with special attention to the presence of brain parenchymal lesions and cerebral arterial or venous abnormalities. CT or MR findings of PAPS included nonspecific multiple hyper-intensity foci in deep white matter on T2-weighted images (5/11), a large infarct in the territory of the middle cerebral artery (4/11), diffuse cortical atrophy (2/11), focal hemorrhage (2/11), and dural sinus thrombosis (1/11). Angiographic findings were normal (5/8) or reflected either occlusion of a large cerebral artery (2/8) or dural sinus thrombosis (1/8). Neuroradiologic findings of PAPS are nonspecific but in young or middle- aged adults who show the above mentioned CT or MR findings, and in whom risk factors for stroke are not present, the condition should be suspected

Primary antiphospholipid antibody syndrome: neuroradiologic findings in 11 patients

Energy Technology Data Exchange (ETDEWEB)

Kim, Jung Hoon; Choi, Choong Gon; Choi, Soo Jung; Lee, Ho Kyu; Suh, Dae Chul [Ulsan University College of Medicine, Seoul (Korea, Republic of)

2000-03-01

To describe the neuroradiologic findings of primary antiphospholipid antibody syndrome (PAPS). During a recent two-year period, abnormally elevated antiphospholipid antibodies were detected in a total of 751 patients. In any cases in which risk factors for stroke were detected - hypertension, diabetes mellitus, hyperlipidemia, smoking, and the presence of SLE or other connective tissue diseases - PAPS was not diagnosed. Neuroradiologic studies were performed in 11 of 32 patients with PAPS. We retrospectively reviewed brain CT (n = 7), MR (n = 8), and cerebral angiography (n = 8) in 11 patients with special attention to the presence of brain parenchymal lesions and cerebral arterial or venous abnormalities. CT or MR findings of PAPS included nonspecific multiple hyper-intensity foci in deep white matter on T2-weighted images (5/11), a large infarct in the territory of the middle cerebral artery (4/11), diffuse cortical atrophy (2/11), focal hemorrhage (2/11), and dural sinus thrombosis (1/11). Angiographic findings were normal (5/8) or reflected either occlusion of a large cerebral artery (2/8) or dural sinus thrombosis (1/8). Neuroradiologic findings of PAPS are nonspecific but in young or middle- aged adults who show the above mentioned CT or MR findings, and in whom risk factors for stroke are not present, the condition should be suspected.

76 FR 55842 - Partial Approval and Partial Disapproval of Air Quality Implementation Plans; California; San...

Science.gov (United States)

2011-09-09

...; Reasonably Available Control Technology for Ozone AGENCY: Environmental Protection Agency (EPA). ACTION... CFR Part 52 Environmental protection, Air pollution control, Intergovernmental relations, Nitrogen... ENVIRONMENTAL PROTECTION AGENCY 40 CFR Part 52 [EPA-R09-OAR-2011-0723; FRL-9462-3] Partial...

The Sequential Growth of Star Formation Seeds in the Galactic Snake : Infrared Dark Cloud G11.11-0.12

NARCIS (Netherlands)

Wang, Ke; Zhang, Qizhou; Testi, Leonardo; Wu, Yuefang; Zhang, Huawei; van der Tak, Floris; Pillai, Thushara; Wyrowski, Friedrich; Carey, Sean; Ragan, Sarah; Henning, Thomas

We present Submillimeter Array (SMA) 1.3 and 0.88 mm broad band observations, and Very Large Array (VLA) observations in NH3 (J,K) = (1,1) up to (5,5), as well as H2O and CH3OH maser lines toward the two most massive molecular clumps in Infrared Dark Cloud (IRDC) G11.11-0.12, also known as the Snake

Hydrogen Production via Synthetic Gas by Biomass/Oil Partial Oxidation

Czech Academy of Sciences Publication Activity Database

Hanika, Jiří; Lederer, J.; Tukač, V.; Veselý, Václav; Kováč, D.

176-177, - (2011), s. 286-290 ISSN 1385-8947. [International Conference on Chemical Reactors CHEMREACTOR-19 /19./. Vienna, 05.09.2010-09.09.2010] R&D Projects: GA MPO 2A-2TP1/024 Institutional research plan: CEZ:AV0Z40720504 Keywords : hydrogen * biomass * partial oxidation Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 3.461, year: 2011

Simulasi Kinerja Jaringan Nirkabel IEEE-802.11a dan IEEE-802.11g Menggunakan NS-2

Directory of Open Access Journals (Sweden)

Helm Fitriawan

2014-03-01

Full Text Available Wireless network uses transmission media based on radio waves. This type of networks is mainly useddue to its efficiency and mobility in data exchanging. This paper reports the modeling and simulation of wirelessnetworks based on Cisco Aironet 1130ag access point devices with IEEE 802.11a and IEEE 802.11g standards. Themodeling and simulation are performed using network simulator version 2 (NS-2 that is installed on operationsystem Linux Ubuntu v.10.10. The NS-2 is commonly used and works well in numerous types of network simulation. From simulation, we obtain quality of service parameters by employing several simulation scenarios in terms ofnumber of nodes, distances, and packet data sizes. It can be concluded from simulation results that the IEEE 802.11gnetworks transfer data with better quality than those of IEEE 802.11a networks.  Furthermore, the IEEE 802.11gnetworks provide a higher throughput, with smaller amount of delay and packet loss percentage compared to thoseof IEEE 802.11a networks.

Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

Science.gov (United States)

Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

2000-07-01

The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

ENVIRONMENTAL TECHNOLOGY VERIFICATION REPORT, REMOVAL OF ARSENIC IN DRINKING WATER: PHASE 1-ADI PILOT TEST UNIT NO. 2002-09 WITH MEDIA G2®

Science.gov (United States)

Integrity verification testing of the ADI International Inc. Pilot Test Unit No. 2002-09 with MEDIA G2® arsenic adsorption media filter system was conducted at the Hilltown Township Water and Sewer Authority (HTWSA) Well Station No. 1 in Sellersville, Pennsylvania from October 8...

F.D.G. PET role in the localisation of primary neoplasias

International Nuclear Information System (INIS)

Audigier, C.; Billotey, C.; Deshayes, E.; Banayan, S.; Janier, M.

2009-01-01

Carcinomas of unknown primary site (C.U.P.) and para neoplastic syndromes have the common characteristic that an extensive conventional biological and imaging analysis fails in some instance to detect the primary tumour. F.D.G.-PET becomes recognized to provide interesting information in the case of 'head and neck' C.U.P. as well as in the case of neurological para neoplastic syndromes biologically well defined. When, either C.U.P. or para neoplastic syndromes, are less defined, F.D.G.-PET will not provide as much information as in the previous situation, although it can help in the etiologic diagnosis (oncologic or not) in some cases. (authors)

A G Protein-biased Designer G Protein-coupled Receptor Useful for Studying the Physiological Relevance of Gq/11-dependent Signaling Pathways.

Science.gov (United States)

Hu, Jianxin; Stern, Matthew; Gimenez, Luis E; Wanka, Lizzy; Zhu, Lu; Rossi, Mario; Meister, Jaroslawna; Inoue, Asuka; Beck-Sickinger, Annette G; Gurevich, Vsevolod V; Wess, Jürgen

2016-04-08

Designerreceptorsexclusivelyactivated by adesignerdrug (DREADDs) are clozapine-N-oxide-sensitive designer G protein-coupled receptors (GPCRs) that have emerged as powerful novel chemogenetic tools to study the physiological relevance of GPCR signaling pathways in specific cell types or tissues. Like endogenous GPCRs, clozapine-N-oxide-activated DREADDs do not only activate heterotrimeric G proteins but can also trigger β-arrestin-dependent (G protein-independent) signaling. To dissect the relative physiological relevance of G protein-mediatedversusβ-arrestin-mediated signaling in different cell types or physiological processes, the availability of G protein- and β-arrestin-biased DREADDs would be highly desirable. In this study, we report the development of a mutationally modified version of a non-biased DREADD derived from the M3muscarinic receptor that can activate Gq/11with high efficacy but lacks the ability to interact with β-arrestins. We also demonstrate that this novel DREADD is activein vivoand that cell type-selective expression of this new designer receptor can provide novel insights into the physiological roles of G protein (Gq/11)-dependentversusβ-arrestin-dependent signaling in hepatocytes. Thus, this novel Gq/11-biased DREADD represents a powerful new tool to study the physiological relevance of Gq/11-dependent signaling in distinct tissues and cell types, in the absence of β-arrestin-mediated cellular effects. Such studies should guide the development of novel classes of functionally biased ligands that show high efficacy in various pathophysiological conditions but display a reduced incidence of side effects. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Activation of G protein-coupled estrogen receptor 1 induces coronary artery relaxation via Epac/Rap1-mediated inhibition of RhoA/Rho kinase pathway in parallel with PKA.

Directory of Open Access Journals (Sweden)

Xuan Yu

Full Text Available Previously, we reported that cAMP/PKA signaling is involved in GPER-mediated coronary relaxation by activating MLCP via inhibition of RhoA pathway. In the current study, we tested the hypothesis that activation of GPER induces coronary artery relaxation via inhibition of RhoA/Rho kinase pathway by cAMP downstream targets, exchange proteins directly activated by cAMP (Epac as well as PKA. Our results show that Epac inhibitors, brefeldin A (BFA, 50 μM, or ESI-09 (20 μM, or CE3F4 (100 μM, all partially inhibited porcine coronary artery relaxation response to the selective GPER agonist, G-1 (0.3-3 μM; while concurrent administration of BFA and PKI (5 μM, a PKA inhibitor, almost completely blocked the relaxation effect of G-1. The Epac specific agonist, 8-CPT-2Me-cAMP (007, 1-100 μM, induced a concentration-dependent relaxation response. Furthermore, the activity of Ras-related protein 1 (Rap1 was up regulated by G-1 (1 μM treatment of porcine coronary artery smooth muscle cells (CASMCs. Phosphorylation of vasodilator-stimulated phosphoprotein (p-VASP was elevated by G-1 (1 μM treatment, but not by 007 (50 μM; and the effect of G-1 on p-VASP was blocked by PKI, but not by ESI-09, an Epac antagonist. RhoA activity was similarly down regulated by G-1 and 007, whereas ESI-09 restored most of the reduced RhoA activity by G-1 treatment. Furthermore, G-1 decreased PGF2α-induced p-MYPT1, which was partially reversed with either ESI-09 or PKI; whereas, concurrent administration of ESI-09 and PKI totally prevented the inhibitory effect of G-1. The inhibitory effects of G-1 on p- MLC levels in CASMCs were mostly restored by either ESI-09 or PKI. These results demonstrate that activation of GPER induces coronary artery relaxation via concurrent inhibition of RhoA/Rho kinase by Epac/Rap1 and PKA. GPER could be a potential drug target for preventing and treating cardiovascular diseases.

Pro Oracle database 11g RAC on Linux

CERN Document Server

Shaw, Steve

2010-01-01

Pro Oracle Database 11g RAC on Linux provides full-life-cycle guidance on implementing Oracle Real Application Clusters in a Linux environment. Real Application Clusters, commonly abbreviated as RAC, is Oracle's industry-leading architecture for scalable and fault-tolerant databases. RAC allows you to scale up and down by simply adding and subtracting inexpensive Linux servers. Redundancy provided by those multiple, inexpensive servers is the basis for the failover and other fault-tolerance features that RAC provides. Written by authors well-known for their talent with RAC, Pro Oracle Database

The breathing of webs under repeated partial edge loading

Czech Academy of Sciences Publication Activity Database

Škaloud, Miroslav; Zörnerová, Marie; Urushadze, Shota

2012-01-01

Roč. 40, č. 1 (2012), s. 463-468 E-ISSN 1877-7058. [Steel structures and bridges. Podbanske, 26.09.2012-28.09.2012] R&D Projects: GA ČR GA103/08/1340 Institutional support: RVO:68378297 Keywords : slender webs * breathing * fatigue limit state * design * repeated partial edge loading Subject RIV: JM - Building Engineering

Microstructural evolution of nanostructured Ti0.9Al0.1N prepared by reactive ball-milling

International Nuclear Information System (INIS)

Bhaskar, U.K.; Bid, S.; Pradhan, S.K.

2011-01-01

Research highlights: → Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the 0.9 mol fraction of α-Ti (hcp) and 0.1 mol fraction of aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. The main features which are observed in the present study are stated below: 1.During ball-milling of α-Ti, the α-Ti phase partially converted to transient cubic β-Ti phase within 1 h of milling. 2.Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Complete formation of Ti 0.9 Al 0.1 N (fcc) is obtained at 7 h of milling which is lesser than complete formation time (9 h) of TiN. Doping Al atoms accelerates the formation of (TiAl)N phase. 3.The particle size of Ti 0.9 Al 0.1 N decrease rapidly up to 3 h and then increase slightly due to agglomeration effect. 4.The particle size of Ti 0.9 Al 0.1 N estimated from X-ray is in good agreement with that measured from HRTEM. - Abstract: Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the α-Ti (hcp) and aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient cubic β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. After 1 h of milling, all Al atoms are diffused into the α-Ti matrix. The transient β-Ti phase is noticed to form after 1 h of milling and disappears completely after 7 h of milling. Microstructure characterization of unmilled and ball-milled powders by analyzing XRD patterns employing the Rietveld structure refinement reveals the inclusion of Al and nitrogen atoms into the Ti lattice on the way to formation of Ti 0.9 Al 0.1 N

Implementation of DoS attack and mitigation strategies in IEEE 802.11b/g WLAN

Science.gov (United States)

Deng, Julia; Meng, Ke; Xiao, Yang; Xu, Roger

2010-04-01

IEEE 802.11 wireless Local Area Network (WLAN) becomes very prevalent nowadays. Either as a simple range extender for a home wired Ethernet interface, or as a wireless deployment throughout an enterprise, WLAN provides mobility, convenience, and low cost. However, an IEEE 802.11b/g wireless network uses the frequency of unlicensed 2.4GHz, which makes the network unsafe and more vulnerable than traditional Ethernet networks. As a result, anyone who is familiar with wireless network may initiate a Denial of Service (DoS) attack to influence the common communication of the network or even make it crash. In this paper, we present our studies on the DoS attacks and mitigation strategies for IEEE 802.11b/g WLANs and describe some initial implementations using IEEE 802.11b/g wireless devices.

Procedure to determine the optimal parameters of the main primary coolant pump after compacting the FRG-1 reactor. Pt. 2. Partial structures of the procedure

International Nuclear Information System (INIS)

Pihowicz, W.

1999-01-01

On the basis of an extensive physical and technical analysis the partial structures of the procedure had been developed. They represent a logical linkage of determination elements in the form of decision and result units. The developed partial structures enable to determine the physical parameters, which characterize the primary circuit together with the compact core as well as the main primary coolant pump coming into question after compacting the core. The report also contains a discussions and a comparison of the partial structures. (orig.) [de

Mutations Affecting G-Protein Subunit α11 in Hypercalcemia and Hypocalcemia

Science.gov (United States)

Babinsky, Valerie N.; Head, Rosie A.; Cranston, Treena; Rust, Nigel; Hobbs, Maurine R.; Heath, Hunter; Thakker, Rajesh V.

2013-01-01

BACKGROUND Familial hypocalciuric hypercalcemia is a genetically heterogeneous disorder with three variants: types 1, 2, and 3. Type 1 is due to loss-of-function mutations of the calcium-sensing receptor, a guanine nucleotide–binding protein (G-protein)–coupled receptor that signals through the G-protein subunit α11 (Gα11). Type 3 is associated with adaptor-related protein complex 2, sigma 1 subunit (AP2S1) mutations, which result in altered calcium-sensing receptor endocytosis. We hypothesized that type 2 is due to mutations effecting Gα11 loss of function, since Gα11 is involved in calcium-sensing receptor signaling, and its gene (GNA11) and the type 2 locus are colocalized on chromosome 19p13.3. We also postulated that mutations effecting Gα11 gain of function, like the mutations effecting calcium-sensing receptor gain of function that cause autosomal dominant hypocalcemia type 1, may lead to hypocalcemia. METHODS We performed GNA11 mutational analysis in a kindred with familial hypocalciuric hypercalcemia type 2 and in nine unrelated patients with familial hypocalciuric hypercalcemia who did not have mutations in the gene encoding the calcium-sensing receptor (CASR) or AP2S1. We also performed this analysis in eight unrelated patients with hypocalcemia who did not have CASR mutations. In addition, we studied the effects of GNA11 mutations on Gα11 protein structure and calcium-sensing receptor signaling in human embryonic kidney 293 (HEK293) cells. RESULTS The kindred with familial hypocalciuric hypercalcemia type 2 had an in-frame deletion of a conserved Gα11 isoleucine (Ile200del), and one of the nine unrelated patients with familial hypocalciuric hypercalcemia had a missense GNA11 mutation (Leu135Gln). Missense GNA11 mutations (Arg181Gln and Phe341Leu) were detected in two unrelated patients with hypocalcemia; they were therefore identified as having autosomal dominant hypocalcemia type 2. All four GNA11 mutations predicted disrupted protein

68Ga-PSMA-11 Dynamic PET/CT Imaging in Primary Prostate Cancer.

Science.gov (United States)

Sachpekidis, Christos; Kopka, Klaus; Eder, Matthias; Hadaschik, Boris A; Freitag, Martin T; Pan, Leyun; Haberkorn, Uwe; Dimitrakopoulou-Strauss, Antonia

2016-11-01

The aim of our study is to assess the pharmacokinetics and biodistribution of Ga-PSMA-11 in patients suffering from primary prostate cancer (PC) by means of dynamic and whole-body PET/CT. Twenty-four patients with primary, previously untreated PC were enrolled in the study. All patients underwent dynamic PET/CT (dPET/CT) scanning of the pelvis and whole-body PET/CT studies with Ga-PSMA-11. The evaluation of dPET/CT studies was based on qualitative evaluation, SUV calculation, and quantitative analysis based on two-tissue compartment modeling and a noncompartmental approach leading to the extraction of fractal dimension (FD). A total of 23/24 patients (95.8%) were Ga-PSMA-11 positive. In 9/24 patients (37.5%), metastatic lesions were detected. PC-associated lesions demonstrated the following mean values: SUVaverage = 14.3, SUVmax = 23.4, K1 = 0.24 (1/min), k3 = 0.34 (1/min), influx = 0.15 (1/min), and FD = 1.27. The parameters SUVaverage, SUVmax, k3, influx, and FD derived from PC-associated lesions were significantly higher than respective values derived from reference prostate tissue. Time-activity curves derived from PC-associated lesions revealed an increasing Ga-PSMA-11 accumulation during dynamic PET acquisition. Correlation analysis revealed a moderate but significant correlation between PSA levels and SUVaverage (r = 0.60) and SUVmax (r = 0.57), and a weak but significant correlation between Gleason score and SUVaverage (r = 0.33) and SUVmax (r = 0.28). Ga-PSMA-11 PET/CT confirmed its capacity in detecting primary PC with a detection rate of 95.8%. Dynamic PET/CT studies of the pelvis revealed an increase in tracer uptake in PC-associated lesions during the 60 minutes of dynamic PET acquisition, a finding with potential applications in anti-PSMA approaches.

The removable acrylic partial denture in primary care: the experience and satisfaction of dental surgeons

OpenAIRE

Rita de Cássia SILVA; Raquel Conceição FERREIRA; Denise Vieira TRAVASSOS; Andréa Maria Duarte VARGAS

2017-01-01

Abstract Introduction The guidelines of the National Politics of Oral Health have led to the inclusion of elemental prostheses in the list of Primary Care procedures. Objective This paper aimed to evaluate the performance and satisfaction of dental surgeons with the implementation of Acrylic Partial Dentures. Metodology The sample was composed by 159 dental surgeons (sample calculation), in Belo Horizonte, MG, Brazil, selected via raffle (simple random sampling). A structured questionnaire...

Deficient Rab11 activity underlies glucose hypometabolism in primary neurons of Huntington’s disease mice

International Nuclear Information System (INIS)

Li, Xueyi; Valencia, Antonio; McClory, Hollis; Sapp, Ellen; Kegel, Kimberly B.; DiFiglia, Marian

2012-01-01

Highlights: ► Primary Huntington’s disease neurons are impaired in taking up glucose. ► Rab11 modulates glucose uptake in neurons. ► Increasing Rab11 activity attenuates the glucose uptake defect in disease neurons. ► We provide a novel mechanism for glucose hypometabolism in Huntington’s disease. -- Abstract: Huntington’s disease (HD) is a progressive neurodegenerative disorder caused by a CAG repeat expansion in the huntingtin gene. Positron emission tomography studies have revealed a decline in glucose metabolism in the brain of patients with HD by a mechanism that has not been established. We examined glucose utilization in embryonic primary cortical neurons of wild-type (WT) and HD knock-in mice, which have 140 CAG repeats inserted in the endogenous mouse huntingtin gene (HD 140Q/140Q ). Primary HD 140Q/140Q cortical neurons took up significantly less glucose than did WT neurons. Expression of permanently inactive and permanently active forms of Rab11 correspondingly altered glucose uptake in WT neurons, suggesting that normal activity of Rab11 is needed for neuronal uptake of glucose. It is known that Rab11 activity is diminished in HD 140Q/140Q neurons. Expression of dominant active Rab11 to enhance the activity of Rab11 normalized glucose uptake in HD 140Q/140Q neurons. These results suggest that deficient activity of Rab11 is a novel mechanism for glucose hypometabolism in HD.

Interventional bleeding, hematoma and scar-formation after vacuum-biopsy under stereotactic guidance: Mammotome®-system 11g/8g vs. ATEC®-system 12g/9g

International Nuclear Information System (INIS)

Schaefer, F.K.W.; Order, B.M.; Eckmann-Scholz, C.; Strauss, A.; Hilpert, F.; Kroj, K.; Biernath-Wüpping, J.; Heller, M.; Jonat, W.; Schaefer, P.J.

2012-01-01

Purpose: To evaluate prospectively the correlation of scar-formations after vacuum-assisted biopsy with different systems and needle-sizes and interventional bleeding/post-interventional hematoma. Methods and materials: Between 01/2008 and 12/2009, 479 patients underwent vacuum-assisted biopsy under stereotactic-guidance, using the Mammotome ® -system with 11/8-gauge and ATEC ® -system with 12/9-gauge, whereas in 178 cases with representative benign histology no surgical-biopsy after vacuum-assisted biopsy was performed and at least a 2-plane-follow-up-mammogram after 6 month post-vacuum-assisted biopsy was available. Bleeding during intervention, hematoma post-intervention and scar-tissue was scored as minimal and moderate/severe. Statistical analysis included Chi-Square-trend-test, p-value ® -system vs. 11-gauge-Mammotome ® -system (41.9% vs. 8.4%, p ® -systems 9-gauge vs. 12-gauge (26.9% vs. 29.7%, p = 0.799/42.3% vs. 43.2%, p = 0.596). 11-gauge-Mammotome ® -system vs. ATEC ® -12-gauge-system revealed significantly less bleedings/hematomas (8.4% vs. 29.7%, p = 0.015/16.7% vs. 43.2%, p = 0.001), no significant differences for the large-systems (p = 0.135/p = 0.352). Follow-up of Mammotome ® -11/8-gauge-system system has shown 13.1/16.1% minimal scar-formation and 1.2/3.2% moderate/severe scars, whereas ATEC ® -12/9-gauge-system has shown 10.8/3.8% minimal scar-formation and 0/11.5% moderate/severe scars, no significant differences. No significant difference was found when comparing Mammotome ® -11/8-g-systems vs. ATEC ® -12/9-g-systems (p = 0.609/p = 0.823). There was also no correlation between risk of scar-formation after occurrence of bleeding or hematoma with any examined VAB-system or any needle size in this study (p = 0.800). Conclusion: Using larger needle-sizes significantly (Mammotome ®) /not significant for ATEC ® ) more interventional bleedings and post-interventional hematomas were detected, only a tendency concerning scar-formation.

Temperature dependence of Young's modulus and internal friction of G-10CR and G-11CR epoxy resins

International Nuclear Information System (INIS)

Ledbetter, H.M.; Maerz, G.

1980-01-01

The Young's moduli of the epoxy-resin matrix material used in NEMA-designation G-10CR and G-11CR fiberglass-cloth-reinforced composites were measured dynamically and semicontinuously between ambient and liquid-nitrogen temperatures. Both materials exhibit regular temperature behavior, showing large Young's-modulus changes, about 125 and 50%, respectively. Internal friction decreased about 80% during cooling to liquid-nitrogen temperature (76 0 K). The different thermoelastic coefficients of the two materials indicate a different internal structure

Is KCl(g) corrosive at temperatures above its dew point? Influence of KCl(g) on initial stages of the high temperature corrosion of 11% Cr steel at 600 C

Energy Technology Data Exchange (ETDEWEB)

Segerdahl, K.; Pettersson, J.; Svensson, J.E.; Johansson, L.G. [Dept. of Environmental Inorganic Chemistry, High Temperature Corrosion Centre, Chalmers Univ. of Technology, Goeteborg (Sweden)

2004-07-01

The influence of gaseous KCl on the high temperature oxidation of CrMoV11 1 (X20) steel at 600 C is reported. The sample temperature was above the dew point of KCl, the partial pressure of KCl being about 5ppm. The samples were investigated by a number of surface analytical techniques including grazing angle XRD, SEM/EDX, and SAM. CrMoV11 1 steel shows protective behaviour in clean dry O{sub 2} and O{sub 2}/H{sub 2}O environment because of the formation of a chromium-rich oxide ({alpha}-(Fe,Cr){sub 2}O{sub 3}). It is often considered that alkali salts accelerate the corrosion of steel only when present on the surface in solid or liquid form. In contrast, the present result shows that gaseous KCl is very corrosive, also in the absence of condensation. KCl(g) reacts with chromium in the scale, forming K{sub 2}CrO{sub 4}(s). This depletes the protective oxide in chromium and leads to the formation of non-protective hematite, Fe{sub 2}O{sub 3}. (orig.)

Local partial depletion of CD11b+ cells and their influence on choroidal neovascularization using the CD11b-HSVTK mouse model.

Science.gov (United States)

Brockmann, Claudia; Kociok, Norbert; Dege, Sabrina; Davids, Anja-Maria; Brockmann, Tobias; Miller, Kelly R; Joussen, Antonia M

2018-03-14

To assess the influence of retinal macrophages and microglia on the formation of choroidal neovascularization (CNV). Therefore, we used a transgenic mouse (CD11b-HSVTK) in which the application of ganciclovir (GCV) results in a depletion of CD11b + cells. We first investigated if a local depletion of CD11b + macrophages and microglia in the retina is feasible. In a second step, the influence of CD11b + cell depletion on CNV formation was analysed. One eye of each CD11b-HSVTK mouse was injected with GCV, and the fellow eye received sodium chloride solution (NaCl). Cell counting was performed at day 3 and 7 (one injection) or at day 14 and 21 (two injections). Choroidal neovascularization (CNV) was induced by argon laser and analysed at day 14. The most effective CD11b + cell depletion was achieved 7 days after a single injection and 14 days after two injections of GCV. After two injections of GCV, we found a significant reduction of CD11b + cells in central (52 ± 23.9 cells/mm 2 ) and peripheral retina (53 ± 20.6 cells/mm 2 ); compared to eyes received NaCl (216 ± 49.0 and 210 ± 50.5 cells/mm 2 , p depletion of CD11b + cells in the retina. Nevertheless, only a partial depletion of CD11b + cells could be achieved compared to baseline data without any intravitreal injections. Our results did not reveal a significant reduction in CNV areas. In the light of previous knowledge, the potential influence of systemic immune cells on CNV formation might be more relevant than expected. © 2018 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-HSAP-09-0074 ref|XP_001558290.1| hypothetical protein BC1G_02954 [Botryotinia fuck...eliana B05.10] gb|EDN18805.1| hypothetical protein BC1G_02954 [Botryotinia fuckeliana B05.10] XP_001558290.1 2.7 34% ...

Histopathological Diagnostic Value of the IgG4+/IgG+ Ratio of Plasmacytic Infiltration for IgG4-Related Diseases

Science.gov (United States)

Deng, Chuiwen; Li, Wenli; Chen, Si; Zhang, Wen; Li, Jing; Hu, Chaojun; Wen, Xiaoting; Zhang, Fengchun; Li, Yongzhe

2015-01-01

Abstract This article aims to perform a meta-analysis to evaluate the diagnostic value of the immunoglobulin G (IgG)4+/IgG+ ratio of plasmacytic infiltration for IgG4-related diseases. Four databases—EMBASE, ISI Web of Knowledge, PubMed, and the Cochrane Library—were systematically searched. Approximately 200 participants from several studies were included in this research. STATA 11.2 software (Stata Corporation, College Station, TX) and Meta-DiSc 1.4 (Unit of Clinical Biostatistics, Ramon y Cajal Hospital, Madrid, Spain) were used to perform the meta-analysis. Nine studies were included in the meta-analysis. The pooled diagnostic odds ratio was 18.94 [95% confidence interval (CI), 2.89–124.30]. The sensitivity was 58.80% (95% CI, 50.90–66.30) and the specificity was 90.20% (95% CI, 81.20–95.80). The positive and negative likelihood ratios were 3.12 (95% CI, 1.07–9.16) and 0.26 (95% CI, 0.09–0.70), respectively. The area under the curve of the summary receiver-operating characteristic was 0.88. To conclude, the IgG4+/IgG+ ratio of plasmacytic infiltration is modestly effective in diagnosing IgG-related disease. PMID:25738476

Characterization of partial and near full-length genomes of HIV-1 strains sampled from recently infected individuals in São Paulo, Brazil.

Directory of Open Access Journals (Sweden)

Sabri Saeed Sanabani

Full Text Available BACKGROUND: Genetic variability is a major feature of human immunodeficiency virus type 1 (HIV-1 and is considered the key factor frustrating efforts to halt the HIV epidemic. A proper understanding of HIV-1 genomic diversity is a fundamental prerequisite for proper epidemiology, genetic diagnosis, and successful drugs and vaccines design. Here, we report on the partial and near full-length genomic (NFLG variability of HIV-1 isolates from a well-characterized cohort of recently infected patients in São Paul, Brazil. METHODOLOGY: HIV-1 proviral DNA was extracted from the peripheral blood mononuclear cells of 113 participants. The NFLG and partial fragments were determined by overlapping nested PCR and direct sequencing. The data were phylogenetically analyzed. RESULTS: Of the 113 samples (90.3% male; median age 31 years; 79.6% homosexual men studied, 77 (68.1% NFLGs and 32 (29.3% partial fragments were successfully subtyped. Of the successfully subtyped sequences, 88 (80.7% were subtype B sequences, 12 (11% BF1 recombinants, 3 (2.8% subtype C sequences, 2 (1.8% BC recombinants and subclade F1 each, 1 (0.9% CRF02 AG, and 1 (0.9% CRF31 BC. Primary drug resistance mutations were observed in 14/101 (13.9% of samples, with 5.9% being resistant to protease inhibitors and nucleoside reverse transcriptase inhibitors (NRTI and 4.9% resistant to non-NRTIs. Predictions of viral tropism were determined for 86 individuals. X4 or X4 dual or mixed-tropic viruses (X4/DM were seen in 26 (30.2% of subjects. The proportion of X4 viruses in homosexuals was detected in 19/69 (27.5%. CONCLUSIONS: Our results confirm the existence of various HIV-1 subtypes circulating in São Paulo, and indicate that subtype B account for the majority of infections. Antiretroviral (ARV drug resistance is relatively common among recently infected patients. The proportion of X4 viruses in homosexuals was significantly higher than the proportion seen in other study populations.

Evaluation of IEEE 802.11g and 802.16 for Lunar Surface Exploration Missions Using MACHETE Simulations

Science.gov (United States)

Segui, John; Jennings, Esther; Vyas, Hemali

2009-01-01

In this paper, we investigated the suitability of terrestrial wireless networking technologies for lunar surface exploration missions. Specifically, the scenario we considered consisted of two teams of collaborating astronauts, one base station and one rover, where the base station and the rover have the capability of acting as relays. We focused on the evaluation of IEEE 802.11g and IEEE 802.16 protocols, simulating homogeneous 802.11g network, homogeneous 802.16 network, and heterogeneous network using both 802.11g and 802.16. A mix of traffic flows were simulated, including telemetry, caution and warning, voice, command and file transfer. Each traffic type had its own distribution profile, data volume, and priority. We analyzed the loss and delay trade-offs of these wireless protocols with various link-layer options. We observed that 802.16 network managed the channel better than an 802.11g network due to controlled infrastructure and centralized scheduling. However, due to the centralized scheduling, 802.16 also had a longer delay. The heterogeneous (hybrid) of 802.11/802.16 achieved a better balance of performance in terms of data loss and delay compared to using 802.11 or 802.16 alone.

Barium ionization mechanisms in the CRRES G-1 and G-11b releases

International Nuclear Information System (INIS)

Hunton, D.E.

1993-01-01

The G-11b chemical release experiment form the Combined Release and Radiation Effects Satellite (CRRES) was conducted in darkness below the solar UV terminator to test the Critical Ionization Velocity (CIV) hypothesis. The Quadrupole Ion Mass Spectrometer (QIMS) aboard CRRES measured fluxes of barium ions from this darkness release that were only a factor of ten smaller than the G-1 release measurements in full sunlight. Possible mechanisms for this significant barium ionization in darkness include CIV, charge exchange with O + , collisional ionization and associative ionization. The authors have evaluated the relative contributions of the collisional mechanisms by constructing a simple model of barium ions from the darkness release seem to be consistent with recent measurements of the charge transfer cross section. A collective plasma ionization mechanism such as CIV does not seem to necessary in order to explain the large barium ion fluxes observed. However, QIMS could only detect barium ions formed several seconds after the initial detonation of the release canister. A CIV process could still have occurred very early in the expansion of the barium neutral cloud and the mass spectrometer would not have detected these ions

In vitro characterization of gE negative bovine herpesvirus types 1.1 (BHV-1.1 and 1.2a (BHV-1.2a Caracterização in vitro de herpes vírus bovino tipos 1.1 (BHV-1.1 e 1.2a (BHV-1.2a gE negativos

Directory of Open Access Journals (Sweden)

Fernando R. Spilki

2004-09-01

Full Text Available This study aimed the in vitro growth characterization of a previously constructed Brazilian bovine herpesvirus 1.2a with a deletion in the glycoprotein E gene (BHV-1.2a gE-. The plaque sizes, penetration and growth kinetics of the Brazilian BHV-1.2a gE- were studied and compared with the parental virus, as well as with a BHV-1.1 gE- recombinant derived from an European BHV-1.1 strain. No statistical differences were observed between the gE- recombinants and the respective parental viruses penetration assays were performed. When single step growth curves were studied, no statistical differences were observed between gE- and parental viruses. However, it was observed that both gE- viruses were excreted from cells in significantly higher titres at 11 hours post infection in comparison with parental viruses. No statistical differences were observed when plaque sizes of parental viruses or gE- viruses we analyzed separately in each cell type. However, both gE- recombinants displayed a significantly reduced plaque areas on three different cell cultures, in comparison with parental viruses, indicating that the lack of gE had the same effect on both BHV-1 subtypes, manifested by a restricted cell-to-cell spread in infected cells.O presente estudo teve como objetivo a caracterização das propriedades de crescimento in vitro de uma amostra brasileira de herpesvírus bovino tipo 1.2a que apresenta uma deleção no gene que codifica a glicoproteína E (BHV-1.2a gE-. Os tamanhos de placa, cinética de penetração e cinética de multiplicação do vírus BHV-1.2a gE- foram estudados e comparados com o vírus parental, bem como com um vírus BHV-1.1 gE- recombinante, o qual é derivado de uma amostra européia de BHV-1.1. Em termos de cinética de penetração, não foram observadas diferenças significativas quando comparados os vírus gE- com os parentais. A determinação da cinética de multiplicação não demonstrou diferenças significativas entre os

Primary cytomegalovirus infection in pregnant Egyptian women confirmed by cytomegalovirus IgG avidity testing.

Science.gov (United States)

Kamel, N; Metwally, L; Gomaa, N; Sayed Ahmed, W A; Lotfi, M; Younis, S

2014-01-01

To determine the frequency of primary cytomegalovirus (CMV) infection in pregnant Egyptian women using CMV IgG avidity testing. A cross-sectional study was conducted at Suez Canal University Hospital, Ismailia, Egypt. A total of 546 pregnant women, presenting for routine antenatal screening, were tested for CMV IgG and IgM using a commercially available enzyme-linked immunosorbent assay (ELISA). Sera from CMV IgM-positive women were tested by CMV IgG avidity assay. All the 546 pregnant women were seropositive for anti-CMV IgG. Of the 546 women, 40 (7.3%) were positive or equivocal for IgM antibodies. All sera from the 40 women (IgG+/IgM+) showed a high or intermediate CMV IgG avidity index. Of the 40 women, 23 (57.5%) were in the second or third trimesters of pregnancy and had their first-trimester blood retrieved, and the tested CMV IgG avidity assay showed a high avidity index. Women who were IgM positive had no primary CMV infection in the index pregnancy as evidenced by the high CMV IgG avidity testing. © 2013 S. Karger AG, Basel.

ENVIRONMENTAL TECHNOLOGY VERIFICATION REPORT, REMOVAL OF ARSENIC IN DRINKING WATER: ADI INTERNATIONAL INC. ADI PILOT TEST UNIT NO. 2002-09 WITH MEDIA G2®; PHASE II

Science.gov (United States)

Verification testing of the ADI International Inc. Unit No. 2002-09 with MEDIA G2® arsenic adsorption media filter system was conducted at the Hilltown Township Water and Sewer Authority (HTWSA) Well Station No. 1 in Sellersville, Pennsylvania from October 8, 2003 through May 28,...

Imaging findings of primary immunoglobulin G4-related cervical lymphadenopathy

International Nuclear Information System (INIS)

Kawaguchi, Masaya; Kato, Hiroki; Goshima, Satoshi; Matsuo, Masayuki; Kito, Yusuke; Mizuta, Keisuke; Aoki, Mitsuhiro; Kato, Keizo

2017-01-01

The purpose of the present study was to assess imaging findings of primary immunoglobulin G4 (IgG4)-related cervical lymphadenopathy. Five consecutive patients with clinically, serologically, and histopathologically confirmed primary IgG4-related cervical lymphadenopathy without any other organ involvement were included. All patients underwent contrast-enhanced computed tomography (CT), and four underwent 18 F-fluorodeoxyglucose (FDG)-positron emission tomography (PET)/CT. We retrospectively reviewed the images and assessed the number, size, location, central necrosis, perinodal infiltration, penetrating vessels, and maximum standardized uptake values (SUVmax) of the enlarged cervical nodes. Thirteen enlarged cervical nodes measuring larger than 10 mm in minimum diameter were identified. The maximum and minimum diameter of enlarged nodes ranged from 1.2 to 3.2 cm (median, 1.8 cm) and from 1.0 to 1.9 cm (median, 1.2 cm), respectively. Lymphadenopathy was unilateral in all patients, and eight enlarged nodes were located at level IB (62%), one at level II (8%), three at level IV (23%), and one at level V (8%). Central necrosis was not seen in any nodes. Perinodal infiltration was seen in only one node (8%), and penetrating vessels were seen in seven nodes (54%). The median SUVmax of nine nodes was 4.45 (range, 2.08-12.44). Eight enlarged nodes (62%) were located in the submandibular region. Central necrosis was not observed in any nodes and perinodal infiltration was observed in one node (8%). (orig.)

Imaging findings of primary immunoglobulin G4-related cervical lymphadenopathy

Energy Technology Data Exchange (ETDEWEB)

Kawaguchi, Masaya; Kato, Hiroki; Goshima, Satoshi; Matsuo, Masayuki [Gifu University School of Medicine, Department of Radiology, Gifu (Japan); Kito, Yusuke [Gifu University School of Medicine, Department of Pathology and Translational Research, Gifu (Japan); Mizuta, Keisuke; Aoki, Mitsuhiro [Gifu University School of Medicine, Department of Otolaryngology, Gifu (Japan); Kato, Keizo [Gifu University School of Medicine, Department of Oral and Maxillofacial Sciences, Gifu (Japan)

2017-11-15

The purpose of the present study was to assess imaging findings of primary immunoglobulin G4 (IgG4)-related cervical lymphadenopathy. Five consecutive patients with clinically, serologically, and histopathologically confirmed primary IgG4-related cervical lymphadenopathy without any other organ involvement were included. All patients underwent contrast-enhanced computed tomography (CT), and four underwent {sup 18}F-fluorodeoxyglucose (FDG)-positron emission tomography (PET)/CT. We retrospectively reviewed the images and assessed the number, size, location, central necrosis, perinodal infiltration, penetrating vessels, and maximum standardized uptake values (SUVmax) of the enlarged cervical nodes. Thirteen enlarged cervical nodes measuring larger than 10 mm in minimum diameter were identified. The maximum and minimum diameter of enlarged nodes ranged from 1.2 to 3.2 cm (median, 1.8 cm) and from 1.0 to 1.9 cm (median, 1.2 cm), respectively. Lymphadenopathy was unilateral in all patients, and eight enlarged nodes were located at level IB (62%), one at level II (8%), three at level IV (23%), and one at level V (8%). Central necrosis was not seen in any nodes. Perinodal infiltration was seen in only one node (8%), and penetrating vessels were seen in seven nodes (54%). The median SUVmax of nine nodes was 4.45 (range, 2.08-12.44). Eight enlarged nodes (62%) were located in the submandibular region. Central necrosis was not observed in any nodes and perinodal infiltration was observed in one node (8%). (orig.)

Security and matching of partial fingerprint recognition systems

Science.gov (United States)

Jea, Tsai-Yang; Chavan, Viraj S.; Govindaraju, Venu; Schneider, John K.

2004-08-01

Despite advances in fingerprint identification techniques, matching incomplete or partial fingerprints still poses a difficult challenge. While the introduction of compact silicon chip-based sensors that capture only a part of the fingerprint area have made this problem important from a commercial perspective, there is also considerable interest on the topic for processing partial and latent fingerprints obtained at crime scenes. Attempts to match partial fingerprints using singular ridge structures-based alignment techniques fail when the partial print does not include such structures (e.g., core or delta). We present a multi-path fingerprint matching approach that utilizes localized secondary features derived using only the relative information of minutiae. Since the minutia-based fingerprint representation, is an ANSI-NIST standard, our approach has the advantage of being directly applicable to already existing databases. We also analyze the vulnerability of partial fingerprint identification systems to brute force attacks. The described matching approach has been tested on one of FVC2002"s DB1 database11. The experimental results show that our approach achieves an equal error rate of 1.25% and a total error rate of 1.8% (with FAR at 0.2% and FRR at 1.6%).

Deficient Rab11 activity underlies glucose hypometabolism in primary neurons of Huntington's disease mice

Energy Technology Data Exchange (ETDEWEB)

Li, Xueyi, E-mail: xli12@partners.org [Department of Neurology, Massachusetts General Hospital and Harvard Medical School, Charlestown, MA 02129 (United States); Valencia, Antonio; McClory, Hollis; Sapp, Ellen; Kegel, Kimberly B. [Department of Neurology, Massachusetts General Hospital and Harvard Medical School, Charlestown, MA 02129 (United States); DiFiglia, Marian, E-mail: difiglia@helix.mgh.harvard.edu [Department of Neurology, Massachusetts General Hospital and Harvard Medical School, Charlestown, MA 02129 (United States)

2012-05-18

Highlights: Black-Right-Pointing-Pointer Primary Huntington's disease neurons are impaired in taking up glucose. Black-Right-Pointing-Pointer Rab11 modulates glucose uptake in neurons. Black-Right-Pointing-Pointer Increasing Rab11 activity attenuates the glucose uptake defect in disease neurons. Black-Right-Pointing-Pointer We provide a novel mechanism for glucose hypometabolism in Huntington's disease. -- Abstract: Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a CAG repeat expansion in the huntingtin gene. Positron emission tomography studies have revealed a decline in glucose metabolism in the brain of patients with HD by a mechanism that has not been established. We examined glucose utilization in embryonic primary cortical neurons of wild-type (WT) and HD knock-in mice, which have 140 CAG repeats inserted in the endogenous mouse huntingtin gene (HD{sup 140Q/140Q}). Primary HD{sup 140Q/140Q} cortical neurons took up significantly less glucose than did WT neurons. Expression of permanently inactive and permanently active forms of Rab11 correspondingly altered glucose uptake in WT neurons, suggesting that normal activity of Rab11 is needed for neuronal uptake of glucose. It is known that Rab11 activity is diminished in HD{sup 140Q/140Q} neurons. Expression of dominant active Rab11 to enhance the activity of Rab11 normalized glucose uptake in HD{sup 140Q/140Q} neurons. These results suggest that deficient activity of Rab11 is a novel mechanism for glucose hypometabolism in HD.

Dengue virus activates polyreactive, natural IgG B cells after primary and secondary infection.

Directory of Open Access Journals (Sweden)

Thavamalar Balakrishnan

Full Text Available BACKGROUND: Dengue virus is transmitted by mosquitoes and has four serotypes. Cross-protection to other serotypes lasting for a few months is observed following infection with one serotype. There is evidence that low-affinity T and/or B cells from primary infections contribute to the severe syndromes often associated with secondary dengue infections. such pronounced immune-mediated enhancement suggests a dengue-specific pattern of immune cell activation. This study investigates the acute and early convalescent B cell response leading to the generation of cross-reactive and neutralizing antibodies following dengue infection. METHODOLOGY/PRINCIPAL FINDINGS: We assayed blood samples taken from dengue patients with primary or secondary infection during acute disease and convalescence and compared them to samples from patients presenting with non-dengue related fever. Dengue induced massive early plasmablast formation, which correlated with the appearance of polyclonal, cross-reactive IgG for both primary and secondary infection. Surprisingly, the contribution of IgG to the neutralizing titer 4-7 days after fever onset was more than 50% even after primary infection. CONCLUSIONS/SIGNIFICANCE: Poly-reactive and virus serotype cross-reactive IgG are an important component of the innate response in humans during both primary and secondary dengue infection, and "innate specificities" seem to constitute part of the adaptive response in dengue. While of potential importance for protection during secondary infection, cross-reactive B cells will also compete with highly neutralizing B cells and possibly interfere with their development.

[Chromosome study on chronic lymphocytic leukemia using CpG-oligodeoxynucleotide as immunostimulant agent].

Science.gov (United States)

Wu, Yafang; Xue, Yongquan; Chen, Suning; Yao, Li; Jiang, Hui; Zhang, Jun; Shen, Juan; Pan, Jinlan; Wang, Yong; Bai, Shuxiao

2010-02-01

To investigate whether CpG-oligodeoxynucleotide (CpG-ODN) can improve the detection rate of the karyotypic abnormalities in chronic lymphocytic leukemia (CLL). The bone marrow (BM) or peripheral blood (PB) cells from 57 cases of CLL were collected and cultured with CpG-ODN DSP30+interleukin-2 (IL-2), phytohemagglutinin (PHA), pokeweed (PWM) or IL-2, respectively. Five days later cells were harvested for chromosome preparation. Karyotypic analysis was done using R banding technique. Panel fluorescence in situ hybridization (FISH) was carried out on 19 cases of CLL with normal karyotypes using the following probes: Cen12, D13S25, Rb1, ATM, p53, MYB and IgH. Genomic DNA from 21 cases of them was extracted from BM or PB leukocytes. The immunoglobulin variable heavy chain (IgVH) was amplified by polymerase chain reaction (PCR) and sequenced. CD38 and ZAP70 expressions in the leukemic cells were determined by flow cytometry (FCM). The detection rate of karyotypic abnormalities in the CpG-ODN+IL-2 group (43.85%) was obviously higher than that in the PHA (15.09%), PWM (17.31%) and IL-2 (3.13%) groups (P<0.01). Fifty-two types of karyotypic abnormalities were found. Among them, trisomy12 (+12) or +12 with other abnormalities were the most common, while translocations were the most frequent structural abnormalities including 3 unbalanced and 11 balanced translocations, among them 7 had rearrangements involving 14q32. Thirteen cases showed one or more abnormalities on FISH including trisomy 12 and p53 deletion each in one case, IgH rearrangement and partial deletion each in one case, 13q14.3 deletion in 11 cases of which 5 cases also had Rb1 deletion, 1 case had Rb1 partial deletion. No case with ATM or MYB deletions was found. PCR detected IgVH mutations in 10/21 cases. FCM showed 10/45 cases were CD38 positive, but 35 /45 were CD38 negative, 11/27 cases expressed ZAP70, but 16/27 did not. Among the 26 cases examined for CD38 and ZAP70 expressions simultaneously, 5 cases

{sup 68}Ga-PSMA-11 PET/CT in primary staging of prostate cancer: PSA and Gleason score predict the intensity of tracer accumulation in the primary tumour

Energy Technology Data Exchange (ETDEWEB)

Uprimny, Christian; Kroiss, Alexander Stephan; Decristoforo, Clemens; Guggenberg, Elisabeth von; Kendler, Dorota; Scarpa, Lorenza; Di Santo, Gianpaolo; Roig, Llanos Geraldo; Maffey-Steffan, Johanna; Virgolini, Irene Johanna [Medical University Innsbruck, Department of Nuclear Medicine, Innsbruck (Austria); Fritz, Josef [Medical University Innsbruck, Department of Medical Statistics, Informatics and Health Economics, Innsbruck (Austria); Horninger, Wolfgang [Medical University Innsbruck, Department of Urology, Innsbruck (Austria)

2017-06-15

Prostate cancer (PC) cells typically show increased expression of prostate-specific membrane antigen (PSMA), which can be visualized by {sup 68}Ga-PSMA-11 PET/CT. The aim of this study was to assess the intensity of {sup 68}Ga-PSMA-11 uptake in the primary tumour and metastases in patients with biopsy-proven PC prior to therapy, and to determine whether a correlation exists between the primary tumour-related {sup 68}Ga-PSMA-11 accumulation and the Gleason score (GS) or prostate-specific antigen (PSA) level. Ninety patients with transrectal ultrasound biopsy-proven PC (GS 6-10; median PSA: 9.7 ng/ml) referred for {sup 68}Ga-PSMA-11 PET/CT were retrospectively analysed. PET images were analysed visually and semiquantitatively by measuring the maximum standardized uptake value (SUV{sub max}). The SUV{sub max} of the primary tumour and pathologic lesions suspicious for lymphatic or distant metastases were then compared to the physiologic background activity of normal prostate tissue and gluteal muscle. The SUV{sub max} of the primary tumour was assessed in relation to both PSA level and GS. Eighty-two patients (91.1%) demonstrated pathologic tracer accumulation in the primary tumour that exceeded physiologic tracer uptake in normal prostate tissue (median SUV{sub max}: 12.5 vs. 3.9). Tumours with GS of 6, 7a (3+4) and 7b (4+3) showed significantly lower {sup 68}Ga-PSMA-11 uptake, with median SUV{sub max} of 5.9, 8.3 and 8.2, respectively, compared to patients with GS >7 (median SUV{sub max}: 21.2; p < 0.001). PC patients with PSA ≥10.0 ng/ml exhibited significantly higher uptake than those with PSA levels <10.0 ng/ml (median SUV{sub max}: 17.6 versus 7.7; p < 0.001). In 24 patients (26.7%), 82 lymph nodes with pathologic tracer accumulation consistent with metastases were detected (median SUV{sub max}: 10.6). Eleven patients (12.2%) revealed 55 pathologic osseous lesions suspicious for bone metastases (median SUV{sub max}: 11.6). The GS and PSA level correlated with

The Interplay between QSAR/QSPR Studiesand Partial Order Ranking and Formal Concept Analyses

Directory of Open Access Journals (Sweden)

Lars Carlsen

2009-04-01

Full Text Available The often observed scarcity of physical-chemical and well as toxicological data hampers the assessment of potentially hazardous chemicals released to the environment. In such cases Quantitative Structure-Activity Relationships/Quantitative Structure-Property Relationships (QSAR/QSPR constitute an obvious alternative for rapidly, effectively and inexpensively generatng missing experimental values. However, typically further treatment of the data appears necessary, e.g., to elucidate the possible relations between the single compounds as well as implications and associations between the various parameters used for the combined characterization of the compounds under investigation. In the present paper the application of QSAR/QSPR in combination with Partial Order Ranking (POR methodologies will be reviewed and new aspects using Formal Concept Analysis (FCA will be introduced. Where POR constitutes an attractive method for, e.g., prioritizing a series of chemical substances based on a simultaneous inclusion of a range of parameters, FCA gives important information on the implications associations between the parameters. The combined approach thus constitutes an attractive method to a preliminary assessment of the impact on environmental and human health by primary pollutants or possibly by a primary pollutant well as a possible suite of transformation subsequent products that may be both persistent in and bioaccumulating and toxic.The present review focus on the environmental – and human health impact by residuals of the rocket fuel 1,1-dimethyl- hydrazine (heptyl and its transformation products as an illustrative example.

Primary Signet-Ring Cell Adenocarcinoma of the Urinary Bladder Treated with Partial Cystectomy: A Case Report and Review of the Literature

Directory of Open Access Journals (Sweden)

Umesh Jayarajah

2017-01-01

Full Text Available Primary signet-ring cell carcinoma is a variant of adenocarcinoma which is extremely rare, associated with poor prognosis and generally found to be resistant to chemotherapy and radiotherapy. We report a case of primary signet-ring cell carcinoma of the bladder which was successfully treated with partial cystectomy. A 71-year-old female with a history of type 2 diabetes, hypertension, and ischaemic heart disease presented with painless haematuria for 2 months’ duration. The abdominal ultrasonography showed a localised polypoidal vesical growth arising from the bladder dome. Cystoscopy revealed an exophytic solid tumour in the anterior fundal wall. A deep transurethral resection of bladder tumour was done and histology revealed an adenocarcinoma composed of mucinous and signet-ring cell components. Later, considering the patient’s age and the poor general condition, a partial cystectomy was done. Follow-up cystoscopy and ultrasonography were done at 12 months and there was no evidence of tumour recurrence and the patient is currently symptom-free. Partial cystectomy may be considered in patients with localised tumour without evidence of metastasis and poor general condition. Regular cystoscopies and ultrasound imaging are necessary for follow-up and early identification of recurrences.

Thyrocyte-specific Gq/G11 deficiency impairs thyroid function and prevents goiter development

OpenAIRE

Kero, Jukka; Ahmed, Kashan; Wettschureck, Nina; Tunaru, Sorin; Wintermantel, Tim; Greiner, Erich; Schütz, Günther; Offermanns, Stefan

2007-01-01

The function of the adult thyroid is regulated by thyroid-stimulating hormone (TSH), which acts through a G protein–coupled receptor. Overactivation of the TSH receptor results in hyperthyroidism and goiter. The Gs-mediated stimulation of adenylyl cyclase–dependent cAMP formation has been regarded as the principal intracellular signaling mechanism mediating the action of TSH. Here we show that the Gq/G11-mediated signaling pathway plays an unexpected and essential role in the regulation of th...

PRR11 regulates late-S to G2/M phase progression and induces premature chromatin condensation (PCC)

Energy Technology Data Exchange (ETDEWEB)

Zhang, Chundong; Zhang, Ying; Li, Yi; Zhu, Huifang; Wang, Yitao; Cai, Wei [Department of Biochemistry and Molecular Biology, Chongqing Medical University, Chongqing 400016 (China); Molecular Medicine and Cancer Research Center, Chongqing Medical University, Chongqing 400016 (China); Zhu, Jiang [Molecular Medicine and Cancer Research Center, Chongqing Medical University, Chongqing 400016 (China); Ozaki, Toshinori [Laboratory of DNA Damage Signaling, Chiba Cancer Center Research Institute, 666-2 Nitona, Chuohku, Chiba 260-8717 (Japan); Bu, Youquan, E-mail: buyqcn@aliyun.com [Department of Biochemistry and Molecular Biology, Chongqing Medical University, Chongqing 400016 (China); Molecular Medicine and Cancer Research Center, Chongqing Medical University, Chongqing 400016 (China)

2015-03-13

Recently, we have demonstrated that proline-rich protein 11 (PRR11) is a novel tumor-related gene product likely implicated in the regulation of cell cycle progression as well as lung cancer development. However, its precise role in cell cycle progression remains unclear. In the present study, we have further investigated the expression pattern and functional implication of PRR11 during cell cycle in detail in human lung carcinoma-derived H1299 cells. According to our immunofluorescence study, PRR11 was expressed largely in cytoplasm, the amount of PRR11 started to increase in the late S phase, and was retained until just before mitotic telophase. Consistent with those observations, siRNA-mediated knockdown of PRR11 caused a significant cell cycle arrest in the late S phase. Intriguingly, the treatment with dNTPs further augmented PRR11 silencing-mediated S phase arrest. Moreover, knockdown of PRR11 also resulted in a remarkable retardation of G2/M progression, and PRR11-knockdown cells subsequently underwent G2 phase cell cycle arrest accompanied by obvious mitotic defects such as multipolar spindles and multiple nuclei. In addition, forced expression of PRR11 promoted the premature Chromatin condensation (PCC), and then proliferation of PRR11-expressing cells was massively attenuated and induced apoptosis. Taken together, our current observations strongly suggest that PRR11, which is strictly regulated during cell cycle progression, plays a pivotal role in the regulation of accurate cell cycle progression through the late S phase to mitosis. - Highlights: • PRR11 started to increase in the late S phase and was retained until just before mitotic telophase. • PRR11-knockdown caused a significant cell cycle arrest in the late S phase and G2 phase. • The treatment with dNTPs further augmented PRR11 silencing-mediated S phase arrest. • PRR11-knockdown led to multipolar spindles and multiple nuclei. • Forced expression of PRR11 promoted the PCC and inhibited

PRR11 regulates late-S to G2/M phase progression and induces premature chromatin condensation (PCC)

International Nuclear Information System (INIS)

Zhang, Chundong; Zhang, Ying; Li, Yi; Zhu, Huifang; Wang, Yitao; Cai, Wei; Zhu, Jiang; Ozaki, Toshinori; Bu, Youquan

2015-01-01

Recently, we have demonstrated that proline-rich protein 11 (PRR11) is a novel tumor-related gene product likely implicated in the regulation of cell cycle progression as well as lung cancer development. However, its precise role in cell cycle progression remains unclear. In the present study, we have further investigated the expression pattern and functional implication of PRR11 during cell cycle in detail in human lung carcinoma-derived H1299 cells. According to our immunofluorescence study, PRR11 was expressed largely in cytoplasm, the amount of PRR11 started to increase in the late S phase, and was retained until just before mitotic telophase. Consistent with those observations, siRNA-mediated knockdown of PRR11 caused a significant cell cycle arrest in the late S phase. Intriguingly, the treatment with dNTPs further augmented PRR11 silencing-mediated S phase arrest. Moreover, knockdown of PRR11 also resulted in a remarkable retardation of G2/M progression, and PRR11-knockdown cells subsequently underwent G2 phase cell cycle arrest accompanied by obvious mitotic defects such as multipolar spindles and multiple nuclei. In addition, forced expression of PRR11 promoted the premature Chromatin condensation (PCC), and then proliferation of PRR11-expressing cells was massively attenuated and induced apoptosis. Taken together, our current observations strongly suggest that PRR11, which is strictly regulated during cell cycle progression, plays a pivotal role in the regulation of accurate cell cycle progression through the late S phase to mitosis. - Highlights: • PRR11 started to increase in the late S phase and was retained until just before mitotic telophase. • PRR11-knockdown caused a significant cell cycle arrest in the late S phase and G2 phase. • The treatment with dNTPs further augmented PRR11 silencing-mediated S phase arrest. • PRR11-knockdown led to multipolar spindles and multiple nuclei. • Forced expression of PRR11 promoted the PCC and inhibited

Representing 9/11: Alejandro González Iñárritu’s short film in 11'09"01: September 11

Directory of Open Access Journals (Sweden)

Marie-Christine CLEMENTE

2011-09-01

Full Text Available Dans son court-métrage 11'9"01: 11 Septembre, Alejandro González Iñárritu répond à la diffusion en boucle des images du World Trade Center en flammes qui caractérise les attentats du 11 septembre en confrontant son spectateur à un écran noir hanté par des sons enregistrés partout dans le monde le 11 septembre 2001. Après deux interminables minutes, une image apparaît enfin sur l’écran et le spectateur aperçoit une personne tombant des tours jumelles. Des flashes de nature similaire reviennent sporadiquement sur l’écran et, alors que ces visions sont extrêmement brèves, le spectateur peut se demander s’il a véritablement vu des ‘jumpers’. Regarder le court-métrage d’Iñárritu est une expérience intrinsèquement insaisissable et pourrait être comparé à l’expérience traumatique que Cathy Caruth définit comme ‘un événement dont … il est fait l’expérience trop tôt, trop subitement, pour être entièrement connu, et qui n’est donc accessible à la conscience qu’une fois qu’il s’impose à nouveau, de manière répétée, dans les cauchemars et les actions répétitives du survivant’. En d’autres termes, les flashes qui imprègnent le court-métrage ressemblent indéniablement à un retour du trauma.L’article analyse la manière dont le court-métrage d’Iñárritu tente de représenter la dimension irreprésentable du 11 septembre. S’appuyant sur l’utilisation que fait le film des images des ‘jumpers’ – qui furent largement censurées par les médias américains après les attentats – il examine la façon dont le réalisateur transcende la sphère de la représentation en déconstruisant l’expérience cinématographique habituelle. Explorant les limites du son et de l’image, Iñárritu produit une expérience extrêmement troublante pour son public qui doit adopter un type de perception qui s’approche de l’expérience traumatique et son film peut, dans une certaine

22 CFR 231.09 - No acceleration of Eligible Notes.

Science.gov (United States)

2010-04-01

... Section 231.09 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ARAB REPUBLIC OF EGYPT LOAN GUARANTEES ISSUED UNDER THE EMERGENCY WARTIME SUPPLEMENTAL APPROPRIATIONS ACT OF 2003, PUBLIC LAW 108-11... have the right to pay any amounts in respect of the Eligible Notes other than in accordance with the...

Characteristics of primary Sjögren's syndrome patients with IgG4 positive plasma cells infiltration in the labial salivary glands.

Science.gov (United States)

Liu, Chang; Zhang, Huayong; Yao, Genhong; Hu, Yunxia; Qi, Jingjing; Wang, Yan; Chen, Weiwei; Tang, Xiaojun; Li, Wenchao; Lu, Liwei; Gu, Luo; Sun, Lingyun

2017-01-01

The purpose of this study was to investigate the characteristics of primary Sjögren's syndrome (pSS) patients with IgG4 positive (IgG4 + ) plasma cell infiltration in labial salivary glands (LSGs). Paraffin sections of LSGs from 336 pSS patients were stained with IgG4 and IgG monoclonal antibodies. According to the infiltration of IgG4 + plasma cells, patients were divided and clinical and serological characteristics were analyzed and compared. Based on the infiltration of IgG4 + plasma cells in the LSGs, patients were divided into three subgroups, low IgG4, moderate IgG4, and high IgG4 groups. A negative association between the number of infiltrated IgG4 + plasma cells and the disease characteristics was observed. We found that the higher the IgG4 + expression in plasma cells, the lower the positive rates of serum anti-SSA antibodies, anti-SSB antibodies, antinuclear antibodies (ANA), and rheumatoid factor (RF). Besides, patients from the high IgG4 group had the highest frequency of interstitial lung disease (ILD, 30.6%) and tubulointerstitial nephritis (TIN, 13.9%), but the lowest frequency of leucopenia (13.9%), thrombocytopenia (11.1%), and abnormal thyroidal function (0%). PSS patients with different IgG4 + plasma cells infiltration in the LSGs had distinctive clinical and laboratory characteristics. It may help us to further understand the role of IgG4 + plasma cells in pSS.

Influenza sentinel surveillance network: a public health-primary care collaborative action to assess influenza A(H1N1)pmd09 in Catalonia, Spain.

Science.gov (United States)

Torner, Nuria; Baricot, Maretva; Martínez, Ana; Toledo, Diana; Godoy, Pere; Dominguez, Ángela

2013-03-01

The aim of this study was to evaluate the outcome of a collaborative action between Public Health services and Primary Care in the context of a case-control study on effectiveness of pharmaceutical and non-pharmaceutical measures to prevent hospitalization in a pandemic situation. To carry out this research the collaborative action of the primary care physicians members of the Influenza surveillance network was needed, they had to recall clinical information from influenza A(H1N1)pmd09 confirmed outpatient cases and negative outpatient controls matching their corresponding hospitalized confirmed case.   A survey questionnaire to assess involvement of Influenza Sentinel Surveillance Primary care physicians' Network of Catalonia (PIDIRAC) regarding the outpatient case and control outreach during the pandemic influenza season was performed. A total of 71,1% of completed surveys were received. Perception of pandemic activity was considered to be similar to seasonal influenza activity in 43.8% or higher but not unbearable in 37.5% of the replies. There was no nuisance reported from patients regarding neither the questions nor the surveyor. Collaborative research between Public Health services and Primary Care physicians enhances Public Health actions and research.

Thoracoscopic-assisted pulmonary surgery for partial and complete lung lobectomy in dogs and cats: 11 cases (2008-2013).

Science.gov (United States)

Wormser, Chloe; Singhal, Sunil; Holt, David E; Runge, Jeffrey J

2014-11-01

To describe the use of thoracoscopic-assisted pulmonary surgery (TAPS) for partial and complete lung lobectomy in small animal patients and to evaluate short-term outcome. Retrospective case series. 11 client-owned dogs and cats. Procedures-Medical records of dogs and cats that underwent a partial or complete TAPS lung lobectomy were reviewed. All patients underwent general anesthesia and were positioned in lateral recumbency with the affected hemithorax uppermost. One-lung ventilation was not implemented in any patient. For initial exploration, a 5- to 10-mm incision was made for insertion of a 30° telescope approximately 5 to 7 rib spaces away from the site of the pulmonary lesion in the dorsal third of the thorax. All subsequent incision placements were case dependent and determined by the location of the lesion to be resected. Following lesion localization, a 2- to 7-cm minithoracotomy incision was made with direct thoracoscopic visualization without the use of rigid rib retractors. In 10 of 11 patients, a 360° wound retraction device was placed at the minithoracotomy site prior to exteriorization and resection of the affected lung. Lymph nodes were inspected intraoperatively, but biopsies were not performed; incisions were closed routinely, and a thoracostomy tube was placed in all patients. 3 cats and 8 dogs underwent successful partial (5) or complete (6) TAPS lung lobectomy over a 5-year period (2008 through 2013). Median surgery time was 92.7 minutes (range, 77 to 150 minutes). Thoracostomy tubes were removed a median of 22.3 hours after surgery (range, 18 to 36 hours). The median time to discharge was 3.1 days (range, 1 to 6 days). No intraoperative complications were encountered. All patients were discharged from the hospital, with 9 of 11 patients alive 6 months after surgery. Results of this study suggested that lung lobectomy by means of TAPS can be successfully performed in dogs and cats. When compared with total thoracoscopic surgery, TAPS may

78 FR 71510 - Delegation of Authority to the States of Iowa; Kansas; Missouri; Nebraska; Lincoln-Lancaster...

Science.gov (United States)

2013-11-29

.... 10/24/12 11/05/10 12/30/12 12/22/12 S Primary Aluminum 06/28/11 07/01/08 6/30/11 07/01/09 Reduction.../30/12 12/22/12 09/28/10 04/02/12 Decorative Chromium Electroplating and Chromium Anodizing Tanks.../12 12/22/12 09/28/10 04/02/12 LL Primary Aluminum 9/19/11 07/01/10 6/30/11 07/01/11 07/01/09 07/01/11...

Partial pressure (or fugacity) of carbon dioxide, salinity and other variables collected from Surface underway observations using Carbon dioxide (CO2) gas analyzer, Shower head chamber equilibrator for autonomous carbon dioxide (CO2) measurement and other instruments from Marcus G. Langseth in the North Pacific Ocean from 2010-05-07 to 2010-09-30 (NCEI Accession 0144353)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0144353 includes Surface underway data collected from Marcus G. Langseth in the North Pacific Ocean from 2010-05-07 to 2010-09-30. These data include...

Selection of anthracnose resistant common beans using detached leaves in partially controlled environment

Directory of Open Access Journals (Sweden)

Alisson Campos Pereira

2014-08-01

Full Text Available The objectives of this study were to evaluate the possibility of selecting anthracnose resistant common bean plants using detached primary leaves in partially controlled environment of a greenhouse and identify differences in the reaction of genotypes to anthracnose. The common bean cultivars Ouro Negro, OuroVermelho, ManteigãoFosco 11, Rudá, Rudá-R, VP8, BRSMG Madrepérola, Pérola, MeiaNoite and BRSMG Talismãwere characterizedfor resistance to the races 65, 81 and 453 of Colletotrichum lindemuthianum and the method of detached primary leaves was compared to the method with the traditional inoculation of plants at the phenological stage V2. The lines Rudá, Rudá-R and Pérola were inoculated with the races 65 and 453 of C. lindemuthianum, aiming to assess the rate of coincidence of anthracnose severity by both inoculation methods. In general, the two methods presented similar results for the reaction of the cultivars. The use of detached primary leaves of common bean plants in the partially controlled environment was feasible for selection of plants resistant to anthracnose and has the advantages of low-needed infrastructure and reduction of resources, space and time.

A novel homozygous mutation IVS6+5G>T in CYP11B1 gene in a Vietnamese patient with 11β-hydroxylase deficiency.

Science.gov (United States)

Nguyen, Thi Phuong Mai; Nguyen, Thu Hien; Ngo, Diem Ngoc; Vu, Chi Dung; Nguyen, Thi Kim Lien; Nong, Van Hai; Nguyen, Huy Hoang

2015-07-10

Congenital adrenal hyperplasia (CAH) is an autosomal recessive disease which is characterized by a deficiency of one of the enzymes involved in the synthesis of cortisol from cholesterol by the adrenal cortex. CAH cases arising from impaired 11β-hydroxylase are the second most common form. Mutations in the CYP11B1 gene are the cause of 11β-hydroxylase deficiency. This study was performed on a patient with congenital adrenal hyperplasia and with premature development such as enlarged penis, muscle development, high blood pressure, and bone age equivalent of 5 years old at 2 years of chronological age. Biochemical tests for steroids confirmed the diagnosis of CAH. We used PCR and sequencing to screen for mutations in CYP11B1 gene. Results showed that the patient has a novel homozygous mutation of guanine (G) to thymine (T) in intron 6 (IVS6+5G>T). The analysis of this mutation by MaxEntScan boundary software indicated that this mutant could affect the gene splicing during transcription. Copyright © 2015 Elsevier B.V. All rights reserved.

11 CFR 9032.11 - State.

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false State. 9032.11 Section 9032.11 Federal Elections FEDERAL ELECTION COMMISSION PRESIDENTIAL ELECTION CAMPAIGN FUND: PRESIDENTIAL PRIMARY MATCHING FUND DEFINITIONS § 9032.11 State. State means each State of the United States, Puerto Rico, American...

40 CFR 50.11 - National primary and secondary ambient air quality standards for oxides of nitrogen (with...

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 2 2010-07-01 2010-07-01 false National primary and secondary ambient air quality standards for oxides of nitrogen (with nitrogen dioxide as the indicator). 50.11 Section 50.11 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS NATIONAL...

Oracle SOA BPEL PM 11g R1 a hands-on tutorial

CERN Document Server

Saraswathi, Ravi

2013-01-01

This hands-on, example-driven guide is a practical getting started tutorial with plenty of step-by-step instructions for beginner to intermediate level readers working with BPEL PM in Oracle SOA SuiteWritten for SOA developers, administrators, architects, and engineers who want to get started with Oracle BPEL PM 11g. No previous experience with BPEL PM is required, but an understanding of SOA and web services is assumed

76 FR 10761 - Delegation of Authority to the States of Iowa; Kansas; Missouri; Nebraska; Lincoln-Lancaster...

Science.gov (United States)

2011-02-28

.../20/09 07/01/08 12/31/08 07/01/06 11/11/09 11/05/10 05/30/10 07/21/10 S Primary Aluminum Reduction... Anodizing Tanks. O Ethylene Oxide 12/22/08 07/01/08 12/31/08 07/01/07 07/01/07 07/01/07 Emissions Standards... Publishing Industry. 11/11/09 11/05/10 05/30/10 07/21/10 09/28/10 04/13/10 LL Primary Aluminum 12/22/08 07/01...

Soil and Terrain Database for Cuba, primary data (version 1.0) - scale 1:1 million (SOTER_Cuba)

NARCIS (Netherlands)

Dijkshoorn, J.A.; Huting, J.R.M.

2014-01-01

The Soil and Terrain database for Cuba primary data (version 1.0), at scale 1:1 million (SOTER_Cuba), was compiled of enhanced soil informtion within the framework of the FAO's program Land Degradation Assessment in Drylands (LADA). Primary soil and terrain data for Cuba were obtained from the

11C-Choline PET/pathology image coregistration in primary localized prostate cancer

International Nuclear Information System (INIS)

Grosu, Anca-Ligia; Prokic, Vesna; Weirich, Gregor; Wendl, Christina; Geinitz, Hans; Molls, Michael; Kirste, Simon; Souvatzoglou, Michael; Schwaiger, Markus; Gschwend, Juergen E.; Treiber, Uwe; Weber, Wolfgang A.; Krause, Bernd Joachim

2014-01-01

The aim of this study was to develop a methodology for the comparison of pathology specimens after prostatectomy (post-S) with PET images obtained before surgery (pre-S). This method was used to evaluate the merit of 11 C-choline PET/CT for delineation of gross tumour volume (GTV) in prostate cancer (PC). In 28 PC patients, 11 C-choline PET/CT was performed before surgery. PET/CT data were coregistered with the pathology specimens. GTV on PET images (GTV-PET) was outlined automatically and corrected manually. Tumour volume in the prostate (TVP) was delineated manually on the pathology specimens. Based on the coregistered PET/pathology images, the following parameters were assessed: SUVmax and SUVmean in the tumoral and nontumoral prostate (NP), GTV-PET (millilitres) and TVP (millilitres). PET/pathology image coregistration was satisfactory. Mean SUVmax in the TVP was lower than in the NP: 5.0 and 5.5, respectively (p = 0.093). Considering the entire prostate, SUVmax was located in the TVP in two patients, in the TVP and NP in 12 patients and exclusively in NP in 14 patients. Partial overlap the TVP and GTV-PET was seen in 71 % of patients, and complete overlap in 4 %. PET/pathology image coregistration can be used for evaluation of different imaging modalities. 11 C-Choline PET failed to distinguish tumour from nontumour tissue. (orig.)

PheVI:09 (Phe6.44) as a sliding microswitch in seven-transmembrane (7TM) G protein-coupled receptor activation

DEFF Research Database (Denmark)

Valentin-Hansen, Louise; Holst, Birgitte; Frimurer, Thomas M

2012-01-01

In seven-transmembrane (7TM), G protein-coupled receptors, highly conserved residues function as microswitches, which alternate between different conformations and interaction partners in an extended allosteric interface between the transmembrane segments performing the large scale conformational......-V into a tight pocket generated by five hydrophobic residues protruding from TM-III and TM-V. Of these, the residue in position III:16 (3.40) (often an Ile or Val) appears to function as a barrier or gate for the transition between inactive and active conformation. Mutational analysis showed that PheVI:09...... an aromatic microswitch that stabilizes the active, outward tilted conformation of TM-VI relative to TM-III by sliding into a tight hydrophobic pocket between TM-III and TM-V and that the hydrophobic residue in position III:16 constitutes a gate for this transition....

Factors associated with blood oxygen partial pressure and carbon dioxide partial pressure regulation during respiratory extracorporeal membrane oxygenation support: data from a swine model.

Science.gov (United States)

Park, Marcelo; Mendes, Pedro Vitale; Costa, Eduardo Leite Vieira; Barbosa, Edzangela Vasconcelos Santos; Hirota, Adriana Sayuri; Azevedo, Luciano Cesar Pontes

2016-01-01

The aim of this study was to explore the factors associated with blood oxygen partial pressure and carbon dioxide partial pressure. The factors associated with oxygen - and carbon dioxide regulation were investigated in an apneic pig model under veno-venous extracorporeal membrane oxygenation support. A predefined sequence of blood and sweep flows was tested. Oxygenation was mainly associated with extracorporeal membrane oxygenation blood flow (beta coefficient = 0.036mmHg/mL/min), cardiac output (beta coefficient = -11.970mmHg/L/min) and pulmonary shunting (beta coefficient = -0.232mmHg/%). Furthermore, the initial oxygen partial pressure and carbon dioxide partial pressure measurements were also associated with oxygenation, with beta coefficients of 0.160 and 0.442mmHg/mmHg, respectively. Carbon dioxide partial pressure was associated with cardiac output (beta coefficient = 3.578mmHg/L/min), sweep gas flow (beta coefficient = -2.635mmHg/L/min), temperature (beta coefficient = 4.514mmHg/ºC), initial pH (beta coefficient = -66.065mmHg/0.01 unit) and hemoglobin (beta coefficient = 6.635mmHg/g/dL). In conclusion, elevations in blood and sweep gas flows in an apneic veno-venous extracorporeal membrane oxygenation model resulted in an increase in oxygen partial pressure and a reduction in carbon dioxide partial pressure 2, respectively. Furthermore, without the possibility of causal inference, oxygen partial pressure was negatively associated with pulmonary shunting and cardiac output, and carbon dioxide partial pressure was positively associated with cardiac output, core temperature and initial hemoglobin.

The Roles of Primary Cilia in Cardiovascular System

Science.gov (United States)

2015-10-01

vascular hypertension. Int J Vasc Med 2011; 2011: 376281. Received: December 10, 2014 Revised: June 09, 2015 Accepted: June 09, 2015 Graphical Abstract Current...Hypertension Reviews, 2015, Vol. 11, No. 1 i Graphical Abstract Current Hypertension Reviews, 2015, Vol. 11, No. 1 00 Vascular

Getting Started With Oracle SOA Suite 11g R1 - A Hands-On Tutorial

CERN Document Server

Buelow, Heidi; Palvankar, Prasen

2009-01-01

This fully illustrated step-by-step tutorial is based on proven training material that has been highly praised by hundreds of developers in product training courses given as part of the SOA Suite 11g rollout. You will learn how to build a services-oriente

Hemagglutinin 222D/G polymorphism facilitates fast intra-host evolution of pandemic (H1N1 2009 influenza A viruses.

Directory of Open Access Journals (Sweden)

Nora Seidel

Full Text Available The amino acid substitution of aspartic acid to glycine in hemagglutinin (HA in position 222 (HA-D222G as well as HA-222D/G polymorphism of pandemic (H1N1 2009 influenza viruses (A(H1N1pdm09 were frequently reported in severe influenza in humans and mice. Their impact on viral pathogenicity and the course of influenza has been discussed controversially and the underlying mechanism remained unclarified. In the present study, BALB/c mice, infected with the once mouse lung- and cell-passaged A(H1N1pdm09 isolate A/Jena/5258/09 (mpJena/5258, developed severe pneumonia. From day 2 to 3 or 4 post infection (p.i. symptoms (body weight loss and clinical score continuously worsened. After a short disease stagnation or even recovery phase in most mice, severity of disease further increased on days 6 and 7 p.i. Thereafter, surviving mice recovered. A 45 times higher virus titer maximum in the lung than in the trachea on day 2 p.i. and significantly higher tracheal virus titers compared to lung on day 6 p.i. indicated changes in the organ tropism during infection. Sequence analysis revealed an HA-222D/G polymorphism. HA-D222 and HA-G222 variants co-circulated in lung and trachea. Whereas, HA-D222 variant predominated in the lung, HA-G222 became the major variant in the trachea after day 4 p.i. This was accompanied by lower neutralizing antibody titers and broader receptor recognition including terminal sialic acid α-2,3-linked galactose, which is abundant on mouse trachea epithelial cells. Plaque-purified HA-G222-mpJena/5258 virus induced severe influenza with maximum symptom on day 6 p.i. These results demonstrated for the first time that HA-222D/G quasispecies of A(H1N1pdm09 caused severe biphasic influenza because of fast viral intra-host evolution, which enabled partial antibody escape and minor changes in receptor binding.

Effects of pH and seasonal temperature variation on simultaneous partial nitrification and anammox in free-water surface wetlands.

Science.gov (United States)

He, Yuling; Tao, Wendong; Wang, Ziyuan; Shayya, Walid

2012-11-15

Design considerations to enhance simultaneous partial nitrification and anammox in constructed wetlands are largely unknown. This study examined the effects of pH and seasonal temperature variation on simultaneous partial nitrification and anammox in two free-water surface wetlands. In order to enhance partial nitrification and inhibit nitrite oxidation, furnace slag was placed on the rooting substrate to maintain different pH levels in the wetland water. The wetlands were batch operated for dairy wastewater treatment under oxygen-limited conditions at a cycle time of 7 d. Fluorescence in situ hybridization analysis found that aerobic ammonium oxidizing bacteria and anammox bacteria accounted for 42-73% of the bacterial populations in the wetlands, which was the highest relative abundance of ammonium oxidizing and anammox bacteria in constructed wetlands enhancing simultaneous partial nitrification and anammox. The two wetlands removed total inorganic nitrogen efficiently, 3.36-3.38 g/m(2)/d in the warm season with water temperatures at 18.9-24.9 °C and 1.09-1.50 g/m(2)/d in the cool season at 13.8-18.9 °C. Plant uptake contributed 2-45% to the total inorganic nitrogen removal in the growing season. A seasonal temperature variation of more than 6 °C would affect simultaneous partial nitrification and anammox significantly. Significant pH effects were identified only when the temperatures were below 18.9 °C. Anammox was the limiting stage of simultaneous partial nitrification and anammox in the wetlands. Water pH should be controlled along with influent ammonium concentration and temperature to avoid toxicity of free ammonia to anammox bacteria. Copyright © 2012 Elsevier Ltd. All rights reserved.

Influence of the centrifuge time of primary plasma tubes on routine coagulation testing.

Science.gov (United States)

Lippi, Giuseppe; Salvagno, Gian Luca; Montagnana, Martina; Manzato, Franco; Guidi, Gian Cesare

2007-07-01

Preparation of blood specimens is a major bottleneck in the laboratory throughput. Reliable strategies for reducing the time required for specimen processing without affecting quality should be acknowledged, especially for laboratories performing stat analyses. The present investigation was planned to establish a minimal suitable centrifuge time for primary samples collected for routine coagulation testing. Five sequential primary vacuum tubes containing 0.109 mol/l buffered trisodium citrate were collected from 10 volunteers and were immediately centrifuged on a conventional centrifuge at 1500 x g, at room temperature for 1, 2, 5, 10 and 15 min, respectively. Hematological and routine coagulation testing, including prothrombin time, activated partial thromboplastin time and fibrinogen, were performed. The centrifugation time was inversely associated with residual blood cell elements in plasma, especially platelets. Statistically significant variations from the reference 15-min centrifuge specimens were observed for fibrinogen in samples centrifuged for 5 min at most and for the activated partial thromboplastin time in samples centrifuged for 2 min at most. Meaningful biases related to the desirable bias were observed for fibrinogen in samples centrifuged for 2 min at most, and for the activated partial thromboplastin time in samples centrifuged for 1 min at most. According to our experimental conditions, a 5-10 min centrifuge time at 1500 x g may be suitable for primary tubes collected for routine coagulation testing.

Magnetic properties of Nd-deficient manganites Nd0.9-xCaxMnOy

International Nuclear Information System (INIS)

Troyanchuk, I.O.; Khomchenko, V.A.; Pastushonok, S.N.; Novitsky, O.A.; Pavlov, V.I.; Szymczak, H.

2006-01-01

X-ray diffraction and magnetic studies of neodymium deficient Nd 0.9-x Ca x MnO y (0= 0.9 MnO y samples have been prepared in the 2.85= g -orbitals of manganese ions. Composition with y=2.85 is antiferromagnet with T N =85K, whereas for more oxidized Nd 0.9 MnO y samples a coexistence of antiferromagnetic and ferromagnetic phases is suggested. Low-temperature magnetic phase transition which is accompanied by a negative magnetization appearance has been found in the Nd 0.9 MnO 2.90 compound. Magnetic behavior of Nd 0.9-x Ca x MnO y (0.1= 1-x Ca x MnO 3 series. Properties of the Nd 0.9-x Ca x MnO y (0=< x=<0.4) solid solutions are in agreement with a hypothesis according to which a part of Nd ions can be substituted by Mn ions

Eesti keele õpik ja töövihik vene õppekeelega gümnaasiumi 11. klassile / Malle Rüütli, Ele Viilipus

Index Scriptorium Estoniae

Rüütli, Malle, 1952-

2008-01-01

Raamatutest: Rüütli, Malle; Viilipus, Ele. Eesti keele õpik vene õppekeelega gümnaasiumi 11. klassile. Rüütli, Malle; Viilipus, Ele. Eesti keele töövihik vene õppekeelega gümnaasiumi 11. klassile

40 CFR Table 11 to Subpart G of... - Wastewater-Inspection and Monitoring Requirements for Waste Management Units

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 9 2010-07-01 2010-07-01 false Wastewater-Inspection and Monitoring Requirements for Waste Management Units 11 Table 11 to Subpart G of Part 63 Protection of Environment... and Monitoring Requirements for Waste Management Units To comply with Inspection or monitoring...

Human Health Countermeasures - Partial-Gravity Analogs Workshop

Science.gov (United States)

Barr, Yael; Clement, Gilles; Norsk, Peter

2016-01-01

The experimental conditions that were deemed the most interesting by the HHC Element lead scientists are those permitting studies of the long-term effects of exposure to (a) chronic rotation when supine or in head down tilt (ground-based); and (b) long-radius centrifugation (space based). It is interesting to note that chronic ground based slow rotation room studies have not been performed since the 1960's, when the USA and USSR were investigating the potential use of AG for long-duration space missions. On the other hand, the other partial gravity analogs, i.e., parabolic flight, HUT, suspension, and short-radius centrifugation, have been regularly used in the last three decades (see review in Clément et al. 2015). Based on the workshop evaluations and the scores by the HHC scientific disciplines indicated in tables 3 and 4, simulation of partial G between 0 and 1 should be prioritized as follows: Priority 1. Chronic space-based partial-G analogs: a. Chronic space-based long-radius centrifugation. The ideal scenario would be chronic long-radius centrifugation of cells, animals and humans in a translational research approach - ideally beyond low earth orbit under deep space environmental effects and at various rotations - to obtain different G-effects. In this scenario, all physiological systems could be evaluated and the relationship between physiological response and G level established. This would be the most integrative way of defining, for the first time ever, G-thresholds for each physiological system. b. Chronic space-based centrifugation of animals. Chronic centrifugation of rodents at various G levels in space would allow for determination of AG thresholds of protection for each physiological system. In this case, all physiological systems will be of interest. Intermittent centrifugation will be of secondary interest. c. Chronic space-based centrifugation of cell cultures (RWV). Bioreactor studies of cells and cell cultures of various tissues at various G

Production, characterization, and immobilization of partially purified surfactant-detergent and alkali-thermostable protease from newly isolated Aeromonas caviae.

Science.gov (United States)

Datta, Sumitra; Menon, Gopalakrishnan; Varughese, Bincy

2017-04-21

Proteolytic Aeromonas caviae P-1-1 growing at wide-ranging pH (7.0-11.0) and moderate salinity (0-5% NaCl) was isolated from cattle shed of Thanjavur, India. It produced lipase, gelatinase, and polyhydroxybutyrate. Different culture conditions, incubation time, carbon and nitrogen sources, vitamins, amino acids, surfactants, and metal ions for optimal growth and protease production of P-1-1 were examined. Maximum protease (0.128 U/mL) production was achieved with 1% fructose, 1% yeast extract, 0.1% ammonium sulfate, 3% NaCl, 0.1% CaCl 2  · 2H 2 O, 1% glycine, 0.1% vitamin E, and 0.1% Tween-40 at pH 8.0 after 42 hr of incubation at 37°C. It was active over broad range of pH (7.0-12.0), temperature (15-100°C), and salinity (0-9% NaCl) with optima at pH 10.0, 55°C, and 3% NaCl. It retained 65 and 48% activities at pH 12.0 and 100°C, respectively. Partially purified protease was highly stable (100%) within pH range 7.0-12.0 and salinities of 0-5% NaCl for 48 hr. Cu 2+ , Mn 2+ , Co 2+ , and Ca 2+ did not inhibit its activity. Its stability at extreme pHs, temperatures, and in the presence of surfactants and commercial detergents suggests its possible application in laundry detergents. Partially purified protease was immobilized and reused. This is the first report of alkali-thermotolerant, surfactant-detergent-stable partially purified extracellular protease from A. caviae.

The CpG island methylator phenotype is concordant between primary colorectal carcinoma and matched distant metastases.

Science.gov (United States)

Cohen, Stacey A; Yu, Ming; Baker, Kelsey; Redman, Mary; Wu, Chen; Heinzerling, Tai J; Wirtz, Ralph M; Charalambous, Elpida; Pentheroudakis, George; Kotoula, Vassiliki; Kalogeras, Konstantine T; Fountzilas, George; Grady, William M

2017-01-01

The CpG island methylator phenotype (CIMP) in stage III colon cancer (CRC) has been associated with improved survival after treatment with adjuvant irinotecan-based chemotherapy. In this analysis, we determine whether CIMP status in the primary CRC is concordant with the CIMP status of matched metastases in order to determine if assessment of CIMP status in the primary tumor can be used to predict CIMP status of metastatic disease, which is relevant for patient management as well as for understanding the biology of CIMP CRCs. We assessed the CIMP status of 70 pairs of primary CRC and matched metastases using a CRC-specific panel of five markers ( CACNA1G , IGF2 , NEUROG1 , RUNX3 , and SOCS1 ) where CIMP positive was defined as 3/5 positive markers at a percent methylated reference threshold of ≥10%. Concordance was compared using the Fisher's exact test and P  CIMP status in the primary tumor and matched metastasis; five (7.0%) of the pairs were concordantly CIMP positive. Only one pair (1.4%) had divergent CIMP status, demonstrating CIMP positivity (4/5 markers positive) in the primary tumor, while the matched metastasis was CIMP negative (0 markers positive). CIMP status is generally concordant between primary CRCs and matched metastases. Thus, CIMP status in the primary tumor is maintained in matched metastases and can be used to inform CIMP-based therapy options for the metastases.

Transverse sphericity of primary charged particles in minimum bias proton-proton collisions at $\\sqrt{s}$=0.9, 2.76 and 7 TeV

CERN Document Server

Abelev, Betty; Adamova, Dagmar; Adare, Andrew Marshall; Aggarwal, Madan; Aglieri Rinella, Gianluca; Agocs, Andras Gabor; Agostinelli, Andrea; Aguilar Salazar, Saul; Ahammed, Zubayer; Ahmad, Arshad; Ahmad, Nazeer; Ahn, Sul-Ah; Ahn, Sang Un; Akindinov, Alexander; Aleksandrov, Dmitry; Alessandro, Bruno; Alfaro Molina, Jose Ruben; Alici, Andrea; Alkin, Anton; Almaraz Avina, Erick Jonathan; Alme, Johan; Alt, Torsten; Altini, Valerio; Altinpinar, Sedat; Altsybeev, Igor; Andrei, Cristian; Andronic, Anton; Anguelov, Venelin; Anielski, Jonas; Anson, Christopher Daniel; Anticic, Tome; Antinori, Federico; Antonioli, Pietro; Aphecetche, Laurent Bernard; Appelshauser, Harald; Arbor, Nicolas; Arcelli, Silvia; Arend, Andreas; Armesto, Nestor; Arnaldi, Roberta; Aronsson, Tomas Robert; Arsene, Ionut Cristian; Arslandok, Mesut; Asryan, Andzhey; Augustinus, Andre; Averbeck, Ralf Peter; Awes, Terry; Aysto, Juha Heikki; Azmi, Mohd Danish; Bach, Matthias Jakob; Badala, Angela; Baek, Yong Wook; Bailhache, Raphaelle Marie; Bala, Renu; Baldini Ferroli, Rinaldo; Baldisseri, Alberto; Baldit, Alain; Baltasar Dos Santos Pedrosa, Fernando; Ban, Jaroslav; Baral, Rama Chandra; Barbera, Roberto; Barile, Francesco; Barnafoldi, Gergely Gabor; Barnby, Lee Stuart; Barret, Valerie; Bartke, Jerzy Gustaw; Basile, Maurizio; Bastid, Nicole; Basu, Sumit; Bathen, Bastian; Batigne, Guillaume; Batyunya, Boris; Baumann, Christoph Heinrich; Bearden, Ian Gardner; Beck, Hans; Behera, Nirbhay Kumar; Belikov, Iouri; Bellini, Francesca; Bellwied, Rene; Belmont-Moreno, Ernesto; Bencedi, Gyula; Beole, Stefania; Berceanu, Ionela; Bercuci, Alexandru; Berdnikov, Yaroslav; Berenyi, Daniel; Bergognon, Anais Annick Erica; Berzano, Dario; Betev, Latchezar; Bhasin, Anju; Bhati, Ashok Kumar; Bhom, Jihyun; Bianchi, Livio; Bianchi, Nicola; Bianchin, Chiara; Bielcik, Jaroslav; Bielcikova, Jana; Bilandzic, Ante; Bjelogrlic, Sandro; Blanco, F; Blanco, Francesco; Blau, Dmitry; Blume, Christoph; Boccioli, Marco; Bock, Nicolas; Boettger, Stefan; Bogdanov, Alexey; Boggild, Hans; Bogolyubsky, Mikhail; Boldizsar, Laszlo; Bombara, Marek; Book, Julian; Borel, Herve; Borissov, Alexander; Bose, Suvendu Nath; Bossu, Francesco; Botje, Michiel; Boyer, Bruno Alexandre; Braidot, Ermes; Braun-Munzinger, Peter; Bregant, Marco; Breitner, Timo Gunther; Browning, Tyler Allen; Broz, Michal; Brun, Rene; Bruna, Elena; Bruno, Giuseppe Eugenio; Budnikov, Dmitry; Buesching, Henner; Bufalino, Stefania; Bugaiev, Kyrylo; Busch, Oliver; Buthelezi, Edith Zinhle; Caballero Orduna, Diego; Caffarri, Davide; Cai, Xu; Caines, Helen Louise; Calvo Villar, Ernesto; Camerini, Paolo; Canoa Roman, Veronica; Cara Romeo, Giovanni; Carena, Francesco; Carena, Wisla; Carlin Filho, Nelson; Carminati, Federico; Carrillo Montoya, Camilo Andres; Casanova Diaz, Amaya Ofelia; Castillo Castellanos, Javier Ernesto; Castillo Hernandez, Juan Francisco; Casula, Ester Anna Rita; Catanescu, Vasile; Cavicchioli, Costanza; Ceballos Sanchez, Cesar; Cepila, Jan; Cerello, Piergiorgio; Chang, Beomsu; Chapeland, Sylvain; Charvet, Jean-Luc Fernand; Chattopadhyay, Subhasis; Chattopadhyay, Sukalyan; Chawla, Isha; Cherney, Michael Gerard; Cheshkov, Cvetan; Cheynis, Brigitte; Chibante Barroso, Vasco Miguel; Chinellato, David; Chochula, Peter; Chojnacki, Marek; Choudhury, Subikash; Christakoglou, Panagiotis; Christensen, Christian Holm; Christiansen, Peter; Chujo, Tatsuya; Chung, Suh-Urk; Cicalo, Corrado; Cifarelli, Luisa; Cindolo, Federico; Cleymans, Jean Willy Andre; Coccetti, Fabrizio; Colamaria, Fabio; Colella, Domenico; Conesa Balbastre, Gustavo; Conesa del Valle, Zaida; Constantin, Paul; Contin, Giacomo; Contreras, Jesus Guillermo; Cormier, Thomas Michael; Corrales Morales, Yasser; Cortese, Pietro; Cortes Maldonado, Ismael; Cosentino, Mauro Rogerio; Costa, Filippo; Cotallo, Manuel Enrique; Crescio, Elisabetta; Crochet, Philippe; Cruz Alaniz, Emilia; Cuautle, Eleazar; Cunqueiro, Leticia; Dainese, Andrea; Dalsgaard, Hans Hjersing; Danu, Andrea; Das, Debasish; Das, Indranil; Das, Kushal; Dash, Sadhana; Dash, Ajay Kumar; De, Sudipan; de Barros, Gabriel; De Caro, Annalisa; de Cataldo, Giacinto; de Cuveland, Jan; De Falco, Alessandro; De Gruttola, Daniele; Delagrange, Hugues; Deloff, Andrzej; Demanov, Vyacheslav; De Marco, Nora; Denes, Ervin; De Pasquale, Salvatore; Deppman, Airton; D'Erasmo, Ginevra; de Rooij, Raoul Stefan; Diaz Corchero, Miguel Angel; Di Bari, Domenico; Dietel, Thomas; Di Giglio, Carmelo; Di Liberto, Sergio; Di Mauro, Antonio; Di Nezza, Pasquale; Divia, Roberto; Djuvsland, Oeystein; Dobrin, Alexandru Florin; Dobrowolski, Tadeusz Antoni; Dominguez, Isabel; Donigus, Benjamin; Dordic, Olja; Driga, Olga; Dubey, Anand Kumar; Ducroux, Laurent; Dupieux, Pascal; Dutta Majumdar, Mihir Ranjan; Dutta Majumdar, AK; Elia, Domenico; Emschermann, David Philip; Engel, Heiko; Erdal, Hege Austrheim; Espagnon, Bruno; Estienne, Magali Danielle; Esumi, Shinichi; Evans, David; Eyyubova, Gyulnara; Fabris, Daniela; Faivre, Julien; Falchieri, Davide; Fantoni, Alessandra; Fasel, Markus; Fearick, Roger Worsley; Fedunov, Anatoly; Fehlker, Dominik; Feldkamp, Linus; Felea, Daniel; Fenton-Olsen, Bo; Feofilov, Grigory; Fernandez Tellez, Arturo; Ferretti, Alessandro; Ferretti, Roberta; Figiel, Jan; Figueredo, Marcel; Filchagin, Sergey; Finogeev, Dmitry; Fionda, Fiorella; Fiore, Enrichetta Maria; Floris, Michele; Foertsch, Siegfried Valentin; Foka, Panagiota; Fokin, Sergey; Fragiacomo, Enrico; Frankenfeld, Ulrich Michael; Fuchs, Ulrich; Furget, Christophe; Fusco Girard, Mario; Gaardhoje, Jens Joergen; Gagliardi, Martino; Gago, Alberto; Gallio, Mauro; Gangadharan, Dhevan Raja; Ganoti, Paraskevi; Garabatos, Jose; Garcia-Solis, Edmundo; Garishvili, Irakli; Gerhard, Jochen; Germain, Marie; Geuna, Claudio; Gheata, Andrei George; Gheata, Mihaela; Ghidini, Bruno; Ghosh, Premomoy; Gianotti, Paola; Girard, Martin Robert; Giubellino, Paolo; Gladysz-Dziadus, Ewa; Glassel, Peter; Gomez, Ramon; Gonschior, Alexey; Gonzalez Ferreiro, Elena; Gonzalez-Trueba, Laura Helena; Gonzalez-Zamora, Pedro; Gorbunov, Sergey; Goswami, Ankita; Gotovac, Sven; Grabski, Varlen; Graczykowski, Lukasz Kamil; Grajcarek, Robert; Grelli, Alessandro; Grigoras, Costin; Grigoras, Alina Gabriela; Grigoriev, Vladislav; Grigoryan, Ara; Grigoryan, Smbat; Grinyov, Boris; Grion, Nevio; Gros, Philippe; Grosse-Oetringhaus, Jan Fiete; Grossiord, Jean-Yves; Grosso, Raffaele; Guber, Fedor; Guernane, Rachid; Guerra Gutierrez, Cesar; Guerzoni, Barbara; Guilbaud, Maxime Rene Joseph; Gulbrandsen, Kristjan Herlache; Gunji, Taku; Gupta, Anik; Gupta, Ramni; Gutbrod, Hans; Haaland, Oystein Senneset; Hadjidakis, Cynthia Marie; Haiduc, Maria; Hamagaki, Hideki; Hamar, Gergoe; Han, Byounghee; Hanratty, Luke David; Hansen, Alexander; Harmanova, Zuzana; Harris, John William; Hartig, Matthias; Hasegan, Dumitru; Hatzifotiadou, Despoina; Hayrapetyan, Arsen; Heckel, Stefan Thomas; Heide, Markus Ansgar; Helstrup, Haavard; Herghelegiu, Andrei Ionut; Herrera Corral, Gerardo Antonio; Herrmann, Norbert; Hess, Benjamin Andreas; Hetland, Kristin Fanebust; Hicks, Bernard; Hille, Per Thomas; Hippolyte, Boris; Horaguchi, Takuma; Hori, Yasuto; Hristov, Peter Zahariev; Hrivnacova, Ivana; Huang, Meidana; Humanic, Thomas; Hwang, Dae Sung; Ichou, Raphaelle; Ilkaev, Radiy; Ilkiv, Iryna; Inaba, Motoi; Incani, Elisa; Innocenti, Gian Michele; Innocenti, Pier Giorgio; Ippolitov, Mikhail; Irfan, Muhammad; Ivan, Cristian George; Ivanov, Vladimir; Ivanov, Marian; Ivanov, Andrey; Ivanytskyi, Oleksii; Jacholkowski, Adam Wlodzimierz; Jacobs, Peter; Jang, Haeng Jin; Jangal, Swensy Gwladys; Janik, Malgorzata Anna; Janik, Rudolf; Jayarathna, Sandun; Jena, Satyajit; Jha, Deeptanshu Manu; Jimenez Bustamante, Raul Tonatiuh; Jirden, Lennart; Jones, Peter Graham; Jung, Hyung Taik; Jusko, Anton; Kaidalov, Alexei; Kakoyan, Vanik; Kalcher, Sebastian; Kalinak, Peter; Kalliokoski, Tuomo Esa Aukusti; Kalweit, Alexander Philipp; Kanaki, Kalliopi; Kang, Ju Hwan; Kaplin, Vladimir; Karasu Uysal, Ayben; Karavichev, Oleg; Karavicheva, Tatiana; Karpechev, Evgeny; Kazantsev, Andrey; Kebschull, Udo Wolfgang; Keidel, Ralf; Khan, Palash; Khan, Mohisin Mohammed; Khan, Shuaib Ahmad; Khanzadeev, Alexei; Kharlov, Yury; Kileng, Bjarte; Kim, Do Won; Kim, Mimae; Kim, Minwoo; Kim, Seon Hee; Kim, Dong Jo; Kim, Se Yong; Kim, Jonghyun; Kim, Jin Sook; Kim, Beomkyu; Kim, Taesoo; Kirsch, Stefan; Kisel, Ivan; Kiselev, Sergey; Kisiel, Adam Ryszard; Klay, Jennifer Lynn; Klein, Jochen; Klein-Bosing, Christian; Kliemant, Michael; Kluge, Alexander; Knichel, Michael Linus; Knospe, Anders Garritt; Koch, Kathrin; Kohler, Markus; Kolojvari, Anatoly; Kondratiev, Valery; Kondratyeva, Natalia; Konevskih, Artem; Korneev, Andrey; Kour, Ravjeet; Kowalski, Marek; Kox, Serge; Koyithatta Meethaleveedu, Greeshma; Kral, Jiri; Kralik, Ivan; Kramer, Frederick; Kraus, Ingrid Christine; Krawutschke, Tobias; Krelina, Michal; Kretz, Matthias; Krivda, Marian; Krizek, Filip; Krus, Miroslav; Kryshen, Evgeny; Krzewicki, Mikolaj; Kucheriaev, Yury; Kuhn, Christian Claude; Kuijer, Paul; Kulakov, Igor; Kumar, Jitendra; Kurashvili, Podist; Kurepin, AB; Kurepin, A; Kuryakin, Alexey; Kushpil, Vasily; Kushpil, Svetlana; Kvaerno, Henning; Kweon, Min Jung; Kwon, Youngil; Ladron de Guevara, Pedro; Lakomov, Igor; Langoy, Rune; La Pointe, Sarah Louise; Lara, Camilo Ernesto; Lardeux, Antoine Xavier; La Rocca, Paola; Lazzeroni, Cristina; Lea, Ramona; Le Bornec, Yves; Lechman, Mateusz; Lee, Sung Chul; Lee, Ki Sang; Lee, Graham Richard; Lefevre, Frederic; Lehnert, Joerg Walter; Leistam, Lars; Lenhardt, Matthieu Laurent; Lenti, Vito; Leon, Hermes; Leoncino, Marco; Leon Monzon, Ildefonso; Leon Vargas, Hermes; Levai, Peter; Lien, Jorgen; Lietava, Roman; Lindal, Svein; Lindenstruth, Volker; Lippmann, Christian; Lisa, Michael Annan; Liu, Lijiao; Loenne, Per-Ivar; Loggins, Vera; Loginov, Vitaly; Lohn, Stefan Bernhard; Lohner, Daniel; Loizides, Constantinos; Loo, Kai Krister; Lopez, Xavier Bernard; Lopez Torres, Ernesto; Lovhoiden, Gunnar; Lu, Xianguo; Luettig, Philipp; Lunardon, Marcello; Luo, Jiebin; Luparello, Grazia; Luquin, Lionel; Luzzi, Cinzia; Ma, Rongrong; Ma, Ke; Madagodahettige-Don, Dilan Minthaka; Maevskaya, Alla; Mager, Magnus; Mahapatra, Durga Prasad; Maire, Antonin; Malaev, Mikhail; Maldonado Cervantes, Ivonne Alicia; Malinina, Ludmila; Mal'Kevich, Dmitry; Malzacher, Peter; Mamonov, Alexander; Manceau, Loic Henri Antoine; Mangotra, Lalit Kumar; Manko, Vladislav; Manso, Franck; Manzari, Vito; Mao, Yaxian; Marchisone, Massimiliano; Mares, Jiri; Margagliotti, Giacomo Vito; Margotti, Anselmo; Marin, Ana Maria; Marin Tobon, Cesar Augusto; Markert, Christina; Martashvili, Irakli; Martinengo, Paolo; Martinez, Mario Ivan; Martinez Davalos, Arnulfo; Martinez Garcia, Gines; Martynov, Yevgen; Mas, Alexis Jean-Michel; Masciocchi, Silvia; Masera, Massimo; Masoni, Alberto; Massacrier, Laure Marie; Mastromarco, Mario; Mastroserio, Annalisa; Matthews, Zoe Louise; Matyja, Adam Tomasz; Mayani, Daniel; Mayer, Christoph; Mazer, Joel; Mazzoni, Alessandra Maria; Meddi, Franco; Menchaca-Rocha, Arturo Alejandro; Mercado Perez, Jorge; Meres, Michal; Miake, Yasuo; Milano, Leonardo; Milosevic, Jovan; Mischke, Andre; Mishra, Aditya Nath; Miskowiec, Dariusz; Mitu, Ciprian Mihai; Mlynarz, Jocelyn; Mohanty, Bedangadas; Mohanty, Ajit Kumar; Molnar, Levente; Montano Zetina, Luis Manuel; Monteno, Marco; Montes, Esther; Moon, Taebong; Morando, Maurizio; Moreira De Godoy, Denise Aparecida; Moretto, Sandra; Morsch, Andreas; Muccifora, Valeria; Mudnic, Eugen; Muhuri, Sanjib; Mukherjee, Maitreyee; Muller, Hans; Munhoz, Marcelo; Musa, Luciano; Musso, Alfredo; Nandi, Basanta Kumar; Nania, Rosario; Nappi, Eugenio; Nattrass, Christine; Naumov, Nikolay; Navin, Sparsh; Nayak, Tapan Kumar; Nazarenko, Sergey; Nazarov, Gleb; Nedosekin, Alexander; Nicassio, Maria; Niculescu, Mihai; Nielsen, Borge Svane; Niida, Takafumi; Nikolaev, Sergey; Nikolic, Vedran; Nikulin, Sergey; Nikulin, Vladimir; Nilsen, Bjorn Steven; Nilsson, Mads Stormo; Noferini, Francesco; Nomokonov, Petr; Nooren, Gerardus; Novitzky, Norbert; Nyanin, Alexandre; Nyatha, Anitha; Nygaard, Casper; Nystrand, Joakim Ingemar; Ochirov, Alexander; Oeschler, Helmut Oskar; Oh, Saehanseul; Oh, Sun Kun; Oleniacz, Janusz; Oppedisano, Chiara; Ortiz Velasquez, Antonio; Ortona, Giacomo; Oskarsson, Anders Nils Erik; Ostrowski, Piotr Krystian; Otwinowski, Jacek Tomasz; Oyama, Ken; Ozawa, Kyoichiro; Pachmayer, Yvonne Chiara; Pachr, Milos; Padilla, Fatima; Pagano, Paola; Paic, Guy; Painke, Florian; Pajares, Carlos; Pal, S; Pal, Susanta Kumar; Palaha, Arvinder Singh; Palmeri, Armando; Papikyan, Vardanush; Pappalardo, Giuseppe; Park, Woo Jin; Passfeld, Annika; Pastircak, Blahoslav; Patalakha, Dmitri Ivanovich; Paticchio, Vincenzo; Pavlinov, Alexei; Pawlak, Tomasz Jan; Peitzmann, Thomas; Pereira Da Costa, Hugo Denis Antonio; Pereira De Oliveira Filho, Elienos; Peresunko, Dmitri; Perez Lara, Carlos Eugenio; Perez Lezama, Edgar; Perini, Diego; Perrino, Davide; Peryt, Wiktor Stanislaw; Pesci, Alessandro; Peskov, Vladimir; Pestov, Yury; Petracek, Vojtech; Petran, Michal; Petris, Mariana; Petrov, Plamen Rumenov; Petrovici, Mihai; Petta, Catia; Piano, Stefano; Piccotti, Anna; Pikna, Miroslav; Pillot, Philippe; Pinazza, Ombretta; Pinsky, Lawrence; Pitz, Nora; Piyarathna, Danthasinghe; Ploskon, Mateusz Andrzej; Pluta, Jan Marian; Pocheptsov, Timur; Pochybova, Sona; Podesta Lerma, Pedro Luis Manuel; Poghosyan, Martin; Polak, Karel; Polichtchouk, Boris; Pop, Amalia; Porteboeuf-Houssais, Sarah; Pospisil, Vladimir; Potukuchi, Baba; Prasad, Sidharth Kumar; Preghenella, Roberto; Prino, Francesco; Pruneau, Claude Andre; Pshenichnov, Igor; Puchagin, Sergey; Puddu, Giovanna; Pujol Teixido, Jordi; Pulvirenti, Alberto; Punin, Valery; Putis, Marian; Putschke, Jorn Henning; Quercigh, Emanuele; Qvigstad, Henrik; Rachevski, Alexandre; Rademakers, Alphonse; Radomski, Sylwester; Raiha, Tomi Samuli; Rak, Jan; Rakotozafindrabe, Andry Malala; Ramello, Luciano; Ramirez Reyes, Abdiel; Raniwala, Sudhir; Raniwala, Rashmi; Rasanen, Sami Sakari; Rascanu, Bogdan Theodor; Rathee, Deepika; Read, Kenneth Francis; Real, Jean-Sebastien; Redlich, Krzysztof; Reichelt, Patrick; Reicher, Martijn; Renfordt, Rainer Arno Ernst; Reolon, Anna Rita; Reshetin, Andrey; Rettig, Felix Vincenz; Revol, Jean-Pierre; Reygers, Klaus Johannes; Riccati, Lodovico; Ricci, Renato Angelo; Richert, Tuva; Richter, Matthias Rudolph; Riedler, Petra; Riegler, Werner; Riggi, Francesco; Rodrigues Fernandes Rabacal, Bartolomeu; Rodriguez Cahuantzi, Mario; Rodriguez Manso, Alis; Roed, Ketil; Rohr, David; Rohrich, Dieter; Romita, Rosa; Ronchetti, Federico; Rosnet, Philippe; Rossegger, Stefan; Rossi, Andrea; Roy, Christelle Sophie; Roy, Pradip Kumar; Rubio Montero, Antonio Juan; Rui, Rinaldo; Ryabinkin, Evgeny; Rybicki, Andrzej; Sadovsky, Sergey; Safarik, Karel; Sahoo, Raghunath; Sahu, Pradip Kumar; Saini, Jogender; Sakaguchi, Hiroaki; Sakai, Shingo; Sakata, Dosatsu; Salgado, Carlos Albert; Salzwedel, Jai; Sambyal, Sanjeev Singh; Samsonov, Vladimir; Sanchez Castro, Xitzel; Sandor, Ladislav; Sandoval, Andres; Sano, Satoshi; Sano, Masato; Santo, Rainer; Santoro, Romualdo; Sarkamo, Juho Jaako; Scapparone, Eugenio; Scarlassara, Fernando; Scharenberg, Rolf Paul; Schiaua, Claudiu Cornel; Schicker, Rainer Martin; Schmidt, Christian Joachim; Schmidt, Hans Rudolf; Schreiner, Steffen; Schuchmann, Simone; Schukraft, Jurgen; Schutz, Yves Roland; Schwarz, Kilian Eberhard; Schweda, Kai Oliver; Scioli, Gilda; Scomparin, Enrico; Scott, Rebecca; Scott, Patrick Aaron; Segato, Gianfranco; Selyuzhenkov, Ilya; Senyukov, Serhiy; Seo, Jeewon; Serci, Sergio; Serradilla, Eulogio; Sevcenco, Adrian; Shabetai, Alexandre; Shabratova, Galina; Shahoyan, Ruben; Sharma, Natasha; Sharma, Satish; Sharma, Rohini; Shigaki, Kenta; Shimomura, Maya; Shtejer, Katherin; Sibiriak, Yury; Siciliano, Melinda; Sicking, Eva; Siddhanta, Sabyasachi; Siemiarczuk, Teodor; Silvermyr, David Olle Rickard; Silvestre, catherine; Simatovic, Goran; Simonetti, Giuseppe; Singaraju, Rama Narayana; Singh, Ranbir; Singha, Subhash; Singhal, Vikas; Sinha, Tinku; Sinha, Bikash; Sitar, Branislav; Sitta, Mario; Skaali, Bernhard; Skjerdal, Kyrre; Smakal, Radek; Smirnov, Nikolai; Snellings, Raimond; Sogaard, Carsten; Soltz, Ron Ariel; Son, Hyungsuk; Song, Myunggeun; Song, Jihye; Soos, Csaba; Soramel, Francesca; Sputowska, Iwona; Spyropoulou-Stassinaki, Martha; Srivastava, Brijesh Kumar; Stachel, Johanna; Stan, Ionel; Stan, Ionel; Stefanek, Grzegorz; Steinbeck, Timm Morten; Steinpreis, Matthew; Stenlund, Evert Anders; Steyn, Gideon Francois; Stiller, Johannes Hendrik; Stocco, Diego; Stolpovskiy, Mikhail; Strabykin, Kirill; Strmen, Peter; Suaide, Alexandre Alarcon do Passo; Subieta Vasquez, Martin Alfonso; Sugitate, Toru; Suire, Christophe Pierre; Sukhorukov, Mikhail; Sultanov, Rishat; Sumbera, Michal; Susa, Tatjana; Szanto de Toledo, Alejandro; Szarka, Imrich; Szczepankiewicz, Adam; Szostak, Artur Krzysztof; Szymanski, Maciej; Takahashi, Jun; Tapia Takaki, Daniel Jesus; Tauro, Arturo; Tejeda Munoz, Guillermo; Telesca, Adriana; Terrevoli, Cristina; Thader, Jochen Mathias; Thomas, Deepa; Tieulent, Raphael Noel; Timmins, Anthony; Tlusty, David; Toia, Alberica; Torii, Hisayuki; Toscano, Luca; Truesdale, David Christopher; Trzaska, Wladyslaw Henryk; Tsuji, Tomoya; Tumkin, Alexandr; Turrisi, Rosario; Tveter, Trine Spedstad; Ulery, Jason Glyndwr; Ullaland, Kjetil; Ulrich, Jochen; Uras, Antonio; Urban, Jozef; Urciuoli, Guido Marie; Usai, Gianluca; Vajzer, Michal; Vala, Martin; Valencia Palomo, Lizardo; Vallero, Sara; van der Kolk, Naomi; Vande Vyvre, Pierre; van Leeuwen, Marco; Vannucci, Luigi; Vargas, Aurora Diozcora; Varma, Raghava; Vasileiou, Maria; Vasiliev, Andrey; Vechernin, Vladimir; Veldhoen, Misha; Venaruzzo, Massimo; Vercellin, Ermanno; Vergara, Sergio; Vernet, Renaud; Verweij, Marta; Vickovic, Linda; Viesti, Giuseppe; Vikhlyantsev, Oleg; Vilakazi, Zabulon; Villalobos Baillie, Orlando; Vinogradov, Alexander; Vinogradov, Leonid; Vinogradov, Yury; Virgili, Tiziano; Viyogi, Yogendra; Vodopianov, Alexander; Voloshin, Kirill; Voloshin, Sergey; Volpe, Giacomo; von Haller, Barthelemy; Vranic, Danilo; Øvrebekk, Gaute; Vrlakova, Janka; Vulpescu, Bogdan; Vyushin, Alexey; Wagner, Vladimir; Wagner, Boris; Wan, Renzhuo; Wang, Mengliang; Wang, Dong; Wang, Yifei; Wang, Yaping; Watanabe, Kengo; Weber, Michael; Wessels, Johannes; Westerhoff, Uwe; Wiechula, Jens; Wikne, Jon; Wilde, Martin Rudolf; Wilk, Grzegorz Andrzej; Wilk, Alexander; Williams, Crispin; Windelband, Bernd Stefan; Xaplanteris Karampatsos, Leonidas; Yaldo, Chris G; Yamaguchi, Yorito; Yang, Hongyan; Yang, Shiming; Yasnopolsky, Stanislav; Yi, JunGyu; Yin, Zhongbao; Yoo, In-Kwon; Yoon, Jongik; Yu, Weilin; Yuan, Xianbao; Yushmanov, Igor; Zach, Cenek; Zampolli, Chiara; Zaporozhets, Sergey; Zarochentsev, Andrey; Zavada, Petr; Zaviyalov, Nikolai; Zbroszczyk, Hanna Paulina; Zelnicek, Pierre; Zgura, Sorin Ion; Zhalov, Mikhail; Zhang, Xiaoming; Zhang, Haitao; Zhou, Fengchu; Zhou, Daicui; Zhou, You; Zhu, Jianhui; Zhu, Jianlin; Zhu, Xiangrong; Zichichi, Antonino; Zimmermann, Alice; Zinovjev, Gennady; Zoccarato, Yannick Denis; Zynovyev, Mykhaylo; Zyzak, Maksym

2012-09-18

Measurements of the sphericity of primary charged particles in minimum bias proton--proton collisions at $\\sqrt{s}$=0.9, 2.76 and 7 TeV with the ALICE detector at the LHC are presented. The observable is linearized to be collinear safe and is measured in the plane perpendicular to the beam direction using primary charged tracks with $p_{\\rm T}\\geq0.5$ GeV/c in $|\\eta|\\leq0.8$. The mean sphericity as a function of the charged particle multiplicity at mid-rapidity ($N_{\\rm ch}$) is reported for events with different $p_{\\rm T}$ scales ("soft" and "hard") defined by the transverse momentum of the leading particle. In addition, the mean charged particle transverse momentum versus multiplicity is presented for the different event classes, and the sphericity distributions in bins of multiplicity are presented. The data are compared with calculations of standard Monte Carlo event generators. The transverse sphericity is found to grow with multiplicity at all collision energies, with a steeper rise at low $N_{\\rm ch}...

Personality characteristics and their connection with learning efficiency of deaf and partially deaf pupils in mainstream primary and secondary school

OpenAIRE

Kastelic, Helena

2012-01-01

This thesis deals with personality characteristics and their connection with learning efficiency of deaf and partially deaf pupils and students in mainstream primary and secondary school. The theoretical part defines learning efficiency and focuses on the most significant factors of learning efficiency, including also personality characteristics of an individual. This thesis represents the idea of inclusion and its advantages and disadvantages and suggests to what extent it is present in our ...

Food source provisioning and susceptibility of immature and adult Tribolium castaneum on concrete partially treated with chlorfenapyr (Phantom®)

Science.gov (United States)

A series of experiments were conducted in which adults, pupae, and 4-week-old larvae of Tribolium castaneum (Herbst), the red flour beetle, were exposed separately on concrete arenas partially treated (14.4 % of the total area) with the insecticide chlorfenapyr (Phantom®) at 1.1 g active ingredient/...

NCBI nr-aa BLAST: CBRC-PABE-09-0018 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PABE-09-0018 ref|NP_005276.2| G protein-coupled receptor 7 [Homo sapiens] gb|AAH69117.1| Neuropeptides... B/W receptor 1 [Homo sapiens] gb|AAI07102.1| Neuropeptides B/W receptor 1 [Homo sap...iens] gb|EAW86722.1| neuropeptides B/W receptor 1 [Homo sapiens] NP_005276.2 0.0 100% ...

Stability of penicillin G sodium diluted with 0.9% sodium chloride injection or 5% dextrose injection and stored in polyvinyl chloride bag containers and elastomeric pump containers.

Science.gov (United States)

Hossain, Mirza Akram; Friciu, Mihaela; Aubin, Sebastien; Leclair, Grégoire

2014-04-15

The stability of penicillin G sodium solutions stored in polyvinyl chloride (PVC) bags or elastomeric pump containers was studied. Test samples were prepared by diluting powdered penicillin G sodium (10 million units/10-mL vial) to solutions of 2,500 or 50,000 units/mL with 0.9% sodium chloride injection or 5% dextrose injection. The preparations were transferred to 250-mL PVC bags and elastomeric pump containers. All samples were prepared in triplicate and stored at 5°C. Chemical stability was measured by a stability-indicating high-performance liquid chromatographic (HPLC) assay and by pH evaluation. Particulate matter was evaluated according to compendial standards using a light-obscuration particle count test. Preparations were visually examined throughout the study. After 21 days of storage, all test samples remained chemically stable, with an HPLC assay recovery value of more than 90% of the initial value. After 28 days, all samples prepared with either diluent and stored in PVC bags, as well as the samples diluted to 2,500 units/mL with sodium chloride injection and stored in elastomeric pump containers, did not meet the recovery acceptance limit. For all test samples, the mean pH consistently decreased during storage, from about 6.4 to about 5.5. Particle counts remained acceptable throughout the study, and no change in appearance was observed. Penicillin G for injection (2,500 and 50,000 units/mL) diluted in 0.9% sodium chloride injection or 5% dextrose injection and stored at 5°C in PVC containers or elastomeric pump containers was physically and chemically stable for a period of at least 21 days.

Acute normovolemic hemodilution is not beneficial in patients undergoing primary elective valve surgery

Directory of Open Access Journals (Sweden)

Virmani Sanjula

2010-01-01

Full Text Available The objective of this study was to evaluate the effectiveness of acute normovolemic hemodilution (ANH as a sole method of reducing allogenic blood requirement in patients undergoing primary elective valve surgery. One hundred eighty eight patients undergoing primary elective valve surgery were prospectively randomized into two groups: Group I (n=100 acted as control and in Group II (n=88 autologous blood was removed (10% of estimated blood volume in patients with hemoglobin (Hb > 12g% and 7% when the Hb was < 12g% in the pre-cardiopulmonary bypass (CPB period for subsequent re-transfusion after protamine administration. The autologous blood withdrawn was replaced simultaneously with an equal volume of hydroxyl-ethyl starch solution. Banked blood was transfused in both the groups when Hb was ≤6g % on CPB and ≤8g% after CPB. Platelets were transfused when the count fell to < 100´10 9 /L and fresh frozen plasma (FFP was transfused whenever there was diffuse bleeding with laboratory evidence of coagulopathy. The two groups were comparable as regards demographic data, type of surgical procedures performed, duration of CPB and ischemia, duration of elective ventilation and re-exploration for excessive bleeding. The autologous blood withdrawn in patients with Hb≥12g% was 288.3±69.4 mL and 244.4±41.3 mL with Hb < 12g% (P=NS. The Hb concentration (g % was comparable pre-operatively (Group I= 12.1±1.6, Group II= 12.4±1.4, on postoperative day 1 (Group I =10.3±1.1, Group II= 10.6±1.2 and day 7 (Group I = 10.9±1.5, Group II=10.4±1.5. However, the lowest Hb recorded on CPB was significantly lower in Group II (Group I =7.7±1.2, Group II=6.7±0.9, P < 0.05. There was no difference in the chest tube drainage (Group I =747.2±276.5 mL, Group II=527.6±399.5 mL, blood transfusion (Group I=1.1±1.0 units vs. Group II=1.3±1.0 units intra-operatively and Group I=1.7±1.2 units vs. Group II=1.7±1.4 units post-operatively and FFP transfusion (Group I

Areva: 1. quarter 2015 revenue down, at euros 1.762 bn: -1.1% vs. March 2014 (-0.9% like for like)

International Nuclear Information System (INIS)

Repaire, Philippine du

2015-01-01

In the 1. quarter of 2015, AREVA generated consolidated revenue of 1.762 billion euros, representing a decrease of 1.1% (-0.9% like for like) compared with the same period in 2014. Foreign exchange had a positive impact of 36 million euros over the period, while consolidation scope had a negative impact of 39 million euros. At March 31, 2015, the group had 47.520 billion euros in backlog, a 1.4% increase in relation to December 31, 2014 (46.866 billion euros) reflecting a favorable foreign exchange impact. It should be noted that the backlog does not include the amount from agreements signed with EDF in October 2013 for the EPR reactors project at Hinkley Point in the United Kingdom or for the related fuel. The order intake totaled 881 million euros in the 1. quarter of 2015, an increase compared with the 1. quarter of 2014 (668 million euros)

Species and Sex Differences in the Morphogenic Response of Primary Rodent Neurons to 3,3'-Dichlorobiphenyl (PCB 11).

Science.gov (United States)

Sethi, Sunjay; Keil, Kimberly P; Lein, Pamela J

2017-12-23

PCB 11 is an emerging global pollutant that we recently showed promotes axonal and dendritic growth in primary rat neuronal cell cultures. Here, we address the influence of sex and species on neuronal responses to PCB 11. Neuronal morphology was quantified in sex-specific primary hippocampal and cortical neuron-glia co-cultures derived from neonatal C57BL/6J mice and Sprague Dawley rats exposed for 48 h to vehicle (0.1% DMSO) or PCB 11 at concentrations ranging from 1 fM to 1 nM. Total axonal length was quantified in tau-1 immunoreactive neurons at day in vitro (DIV) 2; dendritic arborization was assessed by Sholl analysis at DIV 9 in neurons transfected with MAP2B-FusRed. In mouse cultures, PCB 11 enhanced dendritic arborization in female, but not male, hippocampal neurons and male, but not female, cortical neurons. In rat cultures, PCB 11 promoted dendritic arborization in male and female hippocampal and cortical neurons. PCB 11 also increased axonal growth in mouse and rat neurons of both sexes and neuronal cell types. These data demonstrate that PCB 11 exerts sex-specific effects on neuronal morphogenesis that vary depending on species, neurite type, and neuronal cell type. These findings have significant implications for risk assessment of this emerging developmental neurotoxicant.

Microbiological analysis after complete or partial removal of carious dentin using two different techniques in primary teeth: A randomized clinical trial

Science.gov (United States)

Singhal, Deepak Kumar; Acharya, Shashidhar; Thakur, Arun Singh

2016-01-01

Background: The management of deep carious lesions can be done by various techniques but residual caries dilemma still persists and bacterial reduction in cavities treated by either partial or complete caries removal techniques is debatable. So the objective of the present randomized clinical trial was to compare microbial counts in cavities submitted to complete caries removal and partial caries removal using either hand instruments or burs before and after 3 weeks of restoration. Materials and Methods: Primary molars with acute carious lesions in inner half of dentine and vital pulp were randomly divided into three groups of 14 each: Group A: Partial caries removal using hand instruments atraumatic restorative treatment (ART) only; Group B: Partial caries removal using bur; Group C: Complete caries removal using bur and caries detector dye. Dentine sample obtained after caries removal and 3 weeks after restoration, were subjected to microbial culture and counting (colony-forming units [CFU]/mg of dentine) for total viable bacterial count, Streptococcus spp., mutans streptococci, Lactobacillus spp. Results: Three techniques of caries removal showed significant (P < 0.05) reduction in all microorganisms studied after 3 weeks of evaluation, but there was no statistically significant difference in percentage reduction of microbial count among three groups. Conclusion: Results suggest the use of partial caries removal in a single session as compared to complete caries removal as a part of treatment of deep lesions in deciduous teeth in order to reduce the risk of pulp exposure. Partial caries removal using ART can be preferred for community settings as public health procedure for caries management. PMID:26962313

[Association of physical activities, sedentary behaviors with overweight/obesity in 9-11 year-old Chinese primary school students].

Science.gov (United States)

Chen, L; Li, Q; Song, Y; Ma, J; Wang, H J

2016-06-18

To explore the association of physical activities, sedentary behaviors with overweight/obesity in Chinese children aged 9-11 years, analyze the gender difference and heterogeneity of the association across different provinces, and provide evidence for prevention and control of overweight and obesity. Using the data of 40 692 children aged 9-11 years from Chinese National Survey on Students' Constitution and Health in 2010, the height and weight were measured and the time spent in physical activities, screen behaviors and homework were collected. We analyzed the associations among physical activities, sedentary behaviors and overweight/obesity in boys and girls separately, and assessed the heterogeneity of associations across different provinces with Meta-analysis. The prevalence of overweight/obesity of the boys (27.1%) was higher than that of the girls (12.9%), compared with the rural students (15.6%), the situation of overweight/obesity of the urban students (23.8%) was more serious, the prevalences of overweight/obesity were separately 22.6%, 19.2% and 17.5% among developed, middle-developed and undeveloped social economic status subgroups. The boys with physical activities no more than 1 hour per day were more likely to be overweight/obese, with the OR of 1.09 (95%CI: 1.02, 1.17). The girls with screen time more than 1 hour per day or homework time more than 2 hours per day were more likely to be overweight/obese, with the ORs of 1.13 (95%CI: 1.02, 1.26) and 1.18 (95%CI: 1.03, 1.35) respectively. The high level of sedentary behaviors (more than 135 min per day) was associated with overweight/obese in the girls, and the OR was 1.19 (95%CI: 1.08, 1.33). There was no significant heterogeneity of effect values between physical activities and overweight/obesity in the boys and between sedentary behaviors and overweight/obesity in the girls across the different provinces (P> 0.05). The associations among physical activities, sedentary behaviors and overweight

Performance Comparison of 112-Gb/s DMT, Nyquist PAM4, and Partial-Response PAM4 for Future 5G Ethernet-Based Fronthaul Architecture

Science.gov (United States)

Eiselt, Nicklas; Muench, Daniel; Dochhan, Annika; Griesser, Helmut; Eiselt, Michael; Olmos, Juan Jose Vegas; Monroy, Idelfonso Tafur; Elbers, Joerg-Peter

2018-05-01

For a future 5G Ethernet-based fronthaul architecture, 100G trunk lines of a transmission distance up to 10 km standard single mode fiber (SSMF) in combination with cheap grey optics to daisy chain cell site network interfaces are a promising cost- and power-efficient solution. For such a scenario, different intensity modulation and direct detect (IMDD) Formats at a data rate of 112 Gb/s, namely Nyquist four-level pulse amplitude modulation (PAM4), discrete multi-tone Transmission (DMT) and partial-response (PR) PAM4 are experimentally investigated, using a low-cost electro-absorption modulated laser (EML), a 25G driver and current state-of-the-art high Speed 84 GS/s CMOS digital-to-analog converter (DAC) and analog-to-digital converter (ADC) test chips. Each modulation Format is optimized independently for the desired scenario and their digital signal processing (DSP) requirements are investigated. The performance of Nyquist PAM4 and PR PAM4 depend very much on the efficiency of pre- and post-equalization. We show the necessity for at least 11 FFE-taps for pre-emphasis and up to 41 FFE coefficients at the receiver side. In addition, PR PAM4 requires an MLSE with four states to decode the signal back to a PAM4 signal. On the contrary, bit- and power-loading (BL, PL) is crucial for DMT and an FFT length of at least 512 is necessary. With optimized parameters, all Modulation formats result in a very similar performances, demonstrating a transmission distance of up to 10 km over SSMF with bit error rates (BERs) below a FEC threshold of 4.4E-3, allowing error free transmission.

Treatment of extremely severe acute hemopoietic radiation sickness beagles with RhG-CSF and RhIL-11

International Nuclear Information System (INIS)

Zhao Jianzhi; Zhang Ri; Li Ming; Xing Shuang; Luo Qingliang; Zhang Xueguang; Miao Jingcheng; Zhu Nankang

2010-01-01

Objective: To evaluate the effects of treatment combined recombinant human G-CSF (rhG-CSF) and recombinant human interleukin-11 (rhIL-11) on severe acute hemopoietic radiation sickness (ARS) beagles. Methods: Beagles were irradiated with 4.5 Gy 60 Co γ-ray to establish ARS models, and animals were divided into the irradiated control group and the supportive care and combined cytokines treatment cohort. After irradiation the irradiated control beagles was given no treatment, the supportive care beagles received purely symptomatic treatment including blood transfusion and anti-infection while the combined cytokines treatment beagles received rhG-CSF and rhIL-11 subcutaneously for three weeks besides symptomatic treatment.Results After irradiation, all kinds of cells' population declined sharply, but rebounded to normal basically in the combined cytokines treatment rate in the cohort. The mean blood transfusion volume of cytokines in the cohort and the period of blood transfusion all were less than those in the supportive care cohort (P<0.01). The period of administrated antibiotic of cytokines in the cohort was shorter than that in the supportive care cohort (P<0.05). In the observe period of 45 d, survival rate in the irradiated controls cohort was 0%, in the supportive care cohort was 80%, and in the combined cytokines treatment cohort was 100%(P<0.01). Conclusion: Administration of rhG-CSF and rhIL-11 early after irradiation and continued daily, in combined with supportive care in severe acute hemopoietic radiation sickness beagles can improve hematopoietic function restoration, stimulate blood cells to restore to the normal level quickly, significantly decrease the reguired volume of blood transfusion, shorten the period of anti-infection and increase survival of irradiated canines. (authors)

Genetic characterization of human hydatid cysts shows coinfection by Echinococcus canadensis G7 and Echinococcus granulosus sensu stricto G1 in Argentina.

Science.gov (United States)

Debiaggi, María Florencia; Soriano, Silvia Viviana; Pierangeli, Nora Beatriz; Lazzarini, Lorena Evelina; Pianciola, Luis Alfredo; Mazzeo, Melina Leonor; Moguillansky, Sergio; Farjat, Juan Angel Basualdo

2017-09-01

Human cystic echinococcosis caused by the larval stage of Echinococcus granulosus sensu lato (s.l.) is a highly endemic disease in the province of Neuquén, Patagonia, Argentina. Human infections with E. granulosus sensu stricto (s.s.) G1 and Echinococcus canadensis G6 were reported in Neuquén in previous studies, whereas four genotypes were identified in livestock: G1, G3, G6, and G7. The aim of this study was to identify the genotypes of E. granulosus s.l. isolates from humans of Neuquén province, Patagonia, Argentina, through the 2005-2014 period. Twenty six hydatid cysts were obtained from 21 patients. The most frequent locations were the liver and lungs. Single cysts were observed in 81.0% of patients, and combined infection of liver and lungs was detected in 9.5% of cases. Partial sequencing of mitochondrial cytochrome c oxidase subunit 1 (cox1) and NADH dehydrogenase subunit 1 (nad1) genes identified the presence of E. granulosus s.s. G1 (n = 11; 42.3%) including three different partial sequences; E. canadensis G6 (n = 14; 53.8%) and E. canadensis G7 (n = 1; 3.9%). Coinfection with G1 and G7 genotypes was detected in one patient who harbored three liver cysts. Most of the liver cysts corresponded to G1 and G6 genotypes. This study presents the first report in the Americas of a human infection with E. canadensis G7 and the second worldwide report of a coinfection with two different species and genotypes of E. granulosus s.l in humans. The molecular diversity of this parasite should be considered to redesign or improve the control program strategies in endemic regions.

Prospective study of robotic partial nephrectomy for renal cancer in Japan: Comparison with a historical control undergoing laparoscopic partial nephrectomy.

Science.gov (United States)

Tanaka, Kazushi; Teishima, Jun; Takenaka, Atsushi; Shiroki, Ryoichi; Kobayashi, Yasuyuki; Hattori, Kazunori; Kanayama, Hiro-Omi; Horie, Shigeo; Yoshino, Yasushi; Fujisawa, Masato

2018-05-01

To evaluate the outcomes of robotic partial nephrectomy compared with those of laparoscopic partial nephrectomy for T1 renal tumors in Japanese centers. Patients with a T1 renal tumor who underwent robotic partial nephrectomy were eligible for inclusion in the present study. The primary end-point consisted of three components: a negative surgical margin, no conversion to open or laparoscopic surgery and a warm ischemia time ≤25 min. We compared data from these patients with the data from a retrospective study of laparoscopic partial nephrectomy carried out in Japan. A total of 108 patients were registered in the present study; 105 underwent robotic partial nephrectomy. The proportion of patients who met the primary end-point was 91.3% (95% confidence interval 84.1-95.9%), which was significantly higher than 23.3% in the historical data. Major complications were seen in 19 patients (18.1%). The mean change in the estimated glomerular filtration rate in the operated kidney, 180 days postoperatively, was -10.8 mL/min/1.73 m 2 (95% confidence interval -12.3-9.4%). Robotic partial nephrectomy for patients with a T1 renal tumor is a safe, feasible and more effective operative method compared with laparoscopic partial nephrectomy. It can be anticipated that robotic partial nephrectomy will become more widely used in Japan in the future. © 2018 The Japanese Urological Association.

OCA Oracle Database 11g database administration I : a real-world certification guide

CERN Document Server

Ries, Steve

2013-01-01

Developed as a practical book, ""Oracle Database 11g Administration I Certification Guide"" will show you all you need to know to effectively excel at being an Oracle DBA, for both examinations and the real world. This book is for anyone who needs the essential skills to become an Oracle DBA, pass the Oracle Database Administration I exam, and use those skills in the real world to manage secure, high performance, and highly available Oracle databases.

PAI-1 4G/5G polymorphism contributes to cancer susceptibility: evidence from meta-analysis.

Science.gov (United States)

Wang, Shangqian; Cao, Qiang; Wang, Xiaoxiang; Li, Bingjie; Tang, Min; Yuan, Wanqing; Fang, Jianzheng; Qian, Jian; Qin, Chao; Zhang, Wei

2013-01-01

The plasminogen activator inhibitor-1 (PAI-1) is expressed in many cancer cell types and allows the modulation of cancer growth, invasion and angiogenesis. To date, studies investigated the association between a functional polymorphism in PAI-1 (4G/5G) and risk of cancer have shown inclusive results. A meta-analysis based on 25 case-control studies was performed to address this issue. Odds ratios (OR) with corresponding 95% confidence intervals (CIs) were used to assess the association. The statistical heterogeneity across studies was examined with I(2) test. Overall, a significant increased risk of cancer was associated with the PAI-1 4G/4G polymorphism for the allele contrast (4G vs. 5G: OR = 1.10, CI = 1.03-1.18, I(2) = 49.5%), the additive genetic model (4G/4G vs. 5G/5G: OR = 1.21, CI = 1.06-1.39, I(2) = 51.9%), the recessive genetic model (4G/4G vs. 4G/5G+5G/5G: OR = 1.11, CI = 1.04-1.18, I(2) = 20.8%). In the subgroup analysis by ethnicity, the results indicated that individuals with 4G/4G genotype had a significantly higher cancer risk among Caucasians (4G/4G vs. 5G/5G: OR = 1.31, 95%CI = 1.09-1.59, I(2) = 59.6%; 4G/4G vs. 4G/5G: OR = 1.12, 95%CI = 1.04-1.21, I(2) = 3.6%; recessive model: OR = 1.12, 95%CI = 1.05-1.21, I(2) = 25.3%). The results of the present meta-analysis support an association between the PAI-1 4G/5G polymorphism and increasing cancer risk, especially among Caucasians, and those with 4G allele have a high risk to develop colorectal cancer and endometrial cancer.

The role of robotic partial cystectomy in a patient with metastatic primary adenocarcinoma of the bladder

Directory of Open Access Journals (Sweden)

Katherine James

2015-03-01

Full Text Available Treatment of urachal adenocarcinoma (UA of the urinary bladder has typically been with radical cystectomy (RC but more conservative approaches are gaining popularity. Here we present the case of a female patient with metastatic primary bladder UA who was treated with robotic partial cystectomy (RPC and adjuvant chemotherapy; she is alive with no evidence of disease recurrence or metastatic disease at 5 years. This case provides some of the longest follow-up after RPC to date thereby demonstrating that RPC is a safe and oncologically viable treatment for selected patients even several years after definitive treatment. Patients undergoing RPC benefit from the reduced morbidity associated with this less radical treatment whilst enjoying similarly successful oncological outcomes to RC.   

Assessment of Body Mass Index (BMI in 6-11 Years Old Primary School Children in Tabriz City, Iran

Directory of Open Access Journals (Sweden)

Nazila Farrin

2016-06-01

Full Text Available Background and Objectives: The prevalence of childhood overweight and obesity has been increasingly growing in many societies. The present study aimed to determine body mass index (BMI in primary school boys and girls in Tabriz city. Methods: This descriptive cross-sectional study was conducted on 857 primary school students of Tabriz city in 2012-2013. First, BMI of each person was calculated, and according to the NCHS standard curves, the values below the 5th percentile were considered as malnutrition and underweight, between the 85th-95th percentiles as overweight, and equal to or above the 95th percentile as obesity. Data were analyzed by one-sample t-test and t-test. The significance level was considered to be p<0.05. Results: According to the BMI data, the frequency of underweight, overweight, and obesity in the male students, were 20.9, 5.5, and 3.1%, and in female students were 18.8, 9.7, 0.9%, and in the total number of students were 20.1, 7.4, and 2.1%, respectively. Compared to the 50th percentile, the mean BMI in male students in the age group of 9 years was higher (p<0.01 and in the age group of 6 years was lower (p<0.05. This comparison in the female students indicated higher mean BMI in the age groups of 7, 9, 10, and 11 years compared to the 50th percentile (p<0.05. The frequency of overweight among female students (9.7% was higher than male students (5.5%. However, the frequency of obesity in the male students was approximately 3.5 times higher than female students (p<0.05. Conclusion: Given the existence of both malnutrition states of underweight and obesity in the students and also the significant effect of childhood body weight on chronic disorders in adulthood, proper nutrition planning is necessary at the school level.

Multiple nuclear dots and rim-like/membranous IgG isotypes in primary biliary cirrhosis.

Science.gov (United States)

Muratori, Paolo; Granito, Alessandro; Ferri, Silvia; Pappas, Georgios; Volta, Umberto; Menichella, Rita; Bianchi, Francesco B; Lenzi, Marco; Muratori, Luigi

2009-03-01

Anti nuclear (ANA) immunomorphological patterns such as multiple nuclear dots (MND) and rim-like/membranous (RL/M) are considered highly specific but little sensitive for primary biliary cirrhosis (PBC) diagnosis. To evaluate frequency and clinical significance of MND and RL/M in PBC patients when investigated at the level of immunoglobulin G isotypes. MND and RL/M pattern have been tested in 141 PBC sera and 230 pathological controls using HEp-2 cells as substrate and anti- total IgG and individual IgG subclasses (IgG1, IgG2, IgG3, IgG4) as specific antisera. One hundred and fourteen of 141 (80%) PBC patients had RL/M or MND pattern when IgG subclasses were used as revealing reagents (vs. 34% when anti total IgG were used, p < 0.0001). The prevalent isotype was IgG1 for RL/M, and IgG2 for MND pattern. None of controls was positive. No clinical differences in terms of severity and outcome of disease have been observed in PBC patients positive for MND and RL/M when investigated with IgG isotypes. The research for RL/M and MND pattern at level of IgG isotype determines a wide gain in terms of sensitivity without a loss of specificity. In Italian PBC patients MND and RL/M pattern did not seem to characterize any subgroup of patients with a poorer prognosis.

47 CFR 11.31 - EAS protocol.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 1 2010-10-01 2010-10-01 false EAS protocol. 11.31 Section 11.31... characters. FM or TV call signs must use a slash ASCII character number 47 (/) in lieu of a dash. (c) The EAS... the State EAS Mapbook. FIPS# State: AL 01 AK 02 AZ 04 AR 05 CA 06 CO 08 CT 09 DE 10 DC 11 FL 12 GA 13...

8.64-11.62 GHz CMOS VCO and divider in a zero-IF 802.11a/b/g WLAN and Bluetooth application

International Nuclear Information System (INIS)

Sun Yu; Mei Niansong; Lu Bo; Huang Yumei; Hong Zhiliang

2010-01-01

A fully integrated VCO and divider implemented in SMIC 0.13-μm RFCMOS 1P8M technology with a 1.2 V supply voltage is presented. The frequency of the VCO is tuning from 8.64 to 11.62 GHz while the quadrature LO signals for 802.11a WLAN in 5.8 GHz band or for 802.11b/g WLAN and Bluetooth in 2.4 GHz band can be obtained by a frequency division by 2 or 4, respectively. A 6 bit switched capacitor array is applied for precise tuning of all necessary frequency bands. The testing results show that the VCO has a phase noise of-113 dBc - 1 MHz offset from the carrier of 5.5 GHz by dividing VCO output by two and the VCO core consumes 3.72 mW. The figure-of-merit for the tuning-range (FOM T ) of the VCO is -192.6 dBc/Hz. (semiconductor integrated circuits)

8.64-11.62 GHz CMOS VCO and divider in a zero-IF 802.11a/b/g WLAN and Bluetooth application

Energy Technology Data Exchange (ETDEWEB)

Sun Yu; Mei Niansong; Lu Bo; Huang Yumei; Hong Zhiliang, E-mail: yumeihuang@fudan.edu.c [ASIC and System State Key Laboratory, Fudan University, Shanghai 201203 (China)

2010-10-15

A fully integrated VCO and divider implemented in SMIC 0.13-{mu}m RFCMOS 1P8M technology with a 1.2 V supply voltage is presented. The frequency of the VCO is tuning from 8.64 to 11.62 GHz while the quadrature LO signals for 802.11a WLAN in 5.8 GHz band or for 802.11b/g WLAN and Bluetooth in 2.4 GHz band can be obtained by a frequency division by 2 or 4, respectively. A 6 bit switched capacitor array is applied for precise tuning of all necessary frequency bands. The testing results show that the VCO has a phase noise of-113 dBc - 1 MHz offset from the carrier of 5.5 GHz by dividing VCO output by two and the VCO core consumes 3.72 mW. The figure-of-merit for the tuning-range (FOM{sub T}) of the VCO is -192.6 dBc/Hz. (semiconductor integrated circuits)

Removable partial overdentures for the irradiated patient

International Nuclear Information System (INIS)

Rosenberg, S.W.

1990-01-01

Patients who have received radiotherapy to the head and neck area must avoid dental extractions and seek simplicity in treatment and home care follow-up. For partially edentulous patients, removable partial overdenture therapy can fulfill these goals while maintaining the high level of function and aesthetics desired by patients.11 references

Advanced Power Batteries for Renewable Energy Applications 3.09

Energy Technology Data Exchange (ETDEWEB)

Shane, Rodney [East Penn Manufacturing Company, Inc., Lyon Station, PA (United States)

2011-12-01

This report describes the research that was completed under project title Advanced Power Batteries for Renewable Energy Applications 3.09, Award Number DE-EE0001112. The report details all tasks described in the Statement of Project Objectives (SOPO). The SOPO includes purchasing of test equipment, designing tooling, building cells and batteries, testing all variables and final evaluation of results. The SOPO is included. There were various types of tests performed during the project, such as; gas collection, float current monitoring, initial capacity, high rate partial state of charge (HRPSoC), hybrid pulse power characterization (HPPC), high rate capacity, corrosion, software modeling and solar life cycle tests. The grant covered a period of two years starting October 1, 2009 and ending September 30, 2011.

A study of 11C-acetate production using 11C-choline commercial module

International Nuclear Information System (INIS)

Zhang Jinming; Tian Jiahe; Yao Shulin; Chen Yan

2008-01-01

Objective: 11 C-acetate is a useful PET tracer in evaluating myocardial metabolism but more interest has been focused on its application in tumor detection in recent years, especially hepatocellular carcinoma (HCC). This study was designed to evaluate the laboratory, preparation of 11 C-acetate with a modified 11 C-choline commercial module and to investigate its biodistribution in tumor (lung adenocarcinoma)-bearing mice as well as its potential as a tumor imaging agent. Methods: 11 C-acetate was synthesized with a modified 11 C choline module: Methyl magnesium bromide Grignard (0.1 ml of 1.5 mol/L) was load- ed to a Teflon loop before 11 CO 2 was recovered from the target. Cartier acetate solution (2 ml of 1 mmol/L) was pushed through the loop, SPE cartridges (mixed AG50 and IC-Ag) and then the QMA. The loop and cartridges were then rinsed with water. The product 11 C-acetate was then washed out from QMA with 0.9% NaCl solution into a collection vial containing diluted HCl. 11 C-carbonate was removed by nitrogen bubbling for 2 min. After neutralization with trisodium citrate, the injectable 11 C-acetate solution was obtained. The tumor-bearing mice were sacrificed. The percentage activity of injected dose per gram of tissue (% ID/g) for tumor and other tissues were calculated. One patient with known diagnosis of moderately differentiated HCC was injected with 11 C-acetate and imaged by PET/CT, followed by 18 F-fluorodeoxyglucose (FDG). Results: The synthesis yield of 11 C-acetate was (60.5 ± 8.7)% (decay conected, n=10); the radio-chemistry purity was > 98% and the synthesis time was 10 min from 11 CO 2 to 11 C-acetate. The radioactivity ratio for tumor/muscle was 1.76 at 30 min. A patient with known HCC showed positive 11 C-acetate accumulation in the tumor but was negative in 18 F-FDG. Conclusion: The synthesis of 11 C-acetate by modification of an 11 C-choline commercial module was feasible and it could be achieved with high yield, high radiochemical purity

Primary care physicians' use of the proposed classification of common mental disorders for ICD-11

DEFF Research Database (Denmark)

Goldberg, David P.; Lam, Tai-Pong; Minhas, Fareed

2017-01-01

Background. The World Health Organization is revising the classification of common mental disorders in primary care for ICD-11. Major changes from the ICD-10 primary care version have been proposed for: (i) mood and anxiety disorders; and (ii) presentations of multiple somatic symptoms (bodily...... stress syndrome). This three-part field study explored the implementation of the revised classification by primary care physicians (PCPs) in five countries. Methods. Participating PCPs in Brazil, China, Mexico, Pakistan and Spain were asked to use the revised classification, first in patients...... that they suspected might be psychologically distressed (Part 1), and second in patients with multiple somatic symptoms causing distress or disability not wholly attributable to a known physical pathology, or with high levels of health anxiety (Part 2). Patients referred to Part 1 or Part 2 underwent a structured...

22q11.2 deletion syndrome: behaviour problems of children and adolescents and parental stress.

Science.gov (United States)

Briegel, W; Schneider, M; Schwab, K Otfried

2008-11-01

22q11.2 deletion syndrome can be associated with a variety of somatic symptoms, developmental delays and psychiatric disorders. At present, there is little information on behaviour problems, parental stress and possible relations between these factors. Therefore, this study investigates behaviour problems of children and adolescents with 22q11.2DS, and their primary caregivers' stress. Parents of 4-17 year old subjects known to the German 22q11.2 deletion syndrome foundation were anonymously asked to fill out several questionnaires, e.g. the Child Behavior Checklist 4-18 (CBCL/4-18). The primary caregivers of 77/126 children [43 males, 34 females, mean age: 8;0 (4;0-16;11) years] sent back filled-out questionnaires. Forty-six of 76 subjects were rated as clinical on at least one of the CBCL-scales. Males had significantly higher scores on the total problems scale and the internalizing problems scale than females. The patients' age correlated with several CBCL-scales. Eleven of 49 subjects were suspicious of an autism spectrum disorder. Compared with the general population, but not with other parents of mentally and/or physically handicapped children, the primary caregivers experienced higher levels of stress, but showed normal life satisfaction. In spite of high rates of clinical behaviour problems among children and adolescents with 22q11.2DS and despite increased parental stress, most primary caregivers seem to have effective coping strategies, e.g. partnership support, to sustain normal levels of life satisfaction.

Effect of fluoxetine and adenosine receptor NECA agonist on G alpha q/11 protein of C6 glioma cells

Czech Academy of Sciences Publication Activity Database

Kovářů, H.; Kovářů, F.; Lisá, Věra

2012-01-01

Roč. 33, č. 6 (2012), s. 614-618 ISSN 0172-780X Institutional support: RVO:67985823 Keywords : C6 glioma cells * SSRI antidepressant * G alpha q/11 signalling * G protein coupled receptor Subject RIV: ED - Physiology Impact factor: 0.932, year: 2012

Simultaneous determination of penicillin G salts by infrared spectroscopy: Evaluation of combining orthogonal signal correction with radial basis function-partial least squares regression

Science.gov (United States)

Talebpour, Zahra; Tavallaie, Roya; Ahmadi, Seyyed Hamid; Abdollahpour, Assem

2010-09-01

In this study, a new method for the simultaneous determination of penicillin G salts in pharmaceutical mixture via FT-IR spectroscopy combined with chemometrics was investigated. The mixture of penicillin G salts is a complex system due to similar analytical characteristics of components. Partial least squares (PLS) and radial basis function-partial least squares (RBF-PLS) were used to develop the linear and nonlinear relation between spectra and components, respectively. The orthogonal signal correction (OSC) preprocessing method was used to correct unexpected information, such as spectral overlapping and scattering effects. In order to compare the influence of OSC on PLS and RBF-PLS models, the optimal linear (PLS) and nonlinear (RBF-PLS) models based on conventional and OSC preprocessed spectra were established and compared. The obtained results demonstrated that OSC clearly enhanced the performance of both RBF-PLS and PLS calibration models. Also in the case of some nonlinear relation between spectra and component, OSC-RBF-PLS gave satisfactory results than OSC-PLS model which indicated that the OSC was helpful to remove extrinsic deviations from linearity without elimination of nonlinear information related to component. The chemometric models were tested on an external dataset and finally applied to the analysis commercialized injection product of penicillin G salts.

Effect of electrolyte additives in improving the cycle and calendar life of graphite/Li{sub 1.1}[Ni{sub 1/3}Co{sub 1/3}Mn{sub 1/3}]{sub 0.9}O{sub 2} Li-ion cells

Energy Technology Data Exchange (ETDEWEB)

Liu, Jun; Chen, Zonghai; Busking, Sara; Belharouak, Ilias; Amine, Khalil [Chemical Engineering Division, Argonne National Laboratory, 9700 S. Cass Avenue, IL 60439 (United States)

2007-12-06

Lithium-rich layered metal oxide Li{sub 1.1}[Ni{sub 1/3}Co{sub 1/3}Mn{sub 1/3}]{sub 0.9}O{sub 2} was investigated as a potential positive electrode material for high-power batteries for hybrid electric vehicle (HEV) applications. In order to evaluate the power and life characteristics of the graphite/Li{sub 1.1}[Ni{sub 1/3}Co{sub 1/3}Mn{sub 1/3}]{sub 0.9}O{sub 2} cell chemistry, hybrid pulse power characterization (HPPC) and accelerated calendar life tests were conducted on several pouch cells containing electrolytes with and without additives. The data show that the cells containing 0.5 wt% lithium bis(oxalate)borate (LiBOB) or vinyl ethyl carbonate (VEC) additives, or the novel lithium difluoro(oxalato)borate (LiDFOB) additive, have much improved cycle and calendar life performance. (author)

Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from TYRO in the North Atlantic Ocean from 1989-07-31 to 1989-09-11 (NODC Accession 0113604)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0113604 includes chemical, discrete sample, physical and profile data collected from TYRO in the North Atlantic Ocean from 1989-07-31 to 1989-09-11....

Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using Alkalinity titrator, CTD and other instruments from the FRANKLIN in the Indian Ocean from 2000-09-26 to 2000-11-12 (NODC Accession 0108074)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0108074 includes chemical, discrete sample, physical and profile data collected from FRANKLIN in the Indian Ocean from 2000-09-26 to 2000-11-12 and...

Reduction of hexavalent chromium by Pannonibacter phragmitetus LSSE-09 stimulated with external electron donors under alkaline conditions

International Nuclear Information System (INIS)

Xu Lin; Luo Mingfang; Li Wangliang; Wei Xuetuan; Xie Keng; Liu Lijun; Jiang Chengying; Liu Huizhou

2011-01-01

Research highlights: → Growing cells have high Cr (VI) resistant and reducing ability aerobically. → Resting cells show strong anaerobic-reduction potential. → Acetate can highly stimulate both aerobic and anaerobic reduction process. - Abstract: A novel Cr (VI) resistant bacterial strain LSSE-09, identified as Pannonibacter phragmitetus, was isolated from industrial sludge. It has strong aerobic and anaerobic Cr (VI)-reduction potential under alkaline conditions. At 37 o C and pH 9.0, growing cells of strain LSSE-09 could completely reduce 100 and 1000 mg L -1 Cr (VI)-Cr (III) within 9 and 24 h, respectively under aerobic condition. Resting cells showed higher anaerobic reduction potential with the rate of 1.46 mg g -1 (dryweight) min -1 , comparing with their aerobic reduction rate, 0.21 mg g -1 min -1 . External electron donors, such as lactate, acetate, formate, pyruvate, citrate and glucose could highly increase the reduction rate, especially for aerobic reduction. The presence of 3000 mg L -1 acetate enhanced anaerobic and aerobic Cr (VI)-reduction rates up to 9.47 mg g -1 min -1 and 4.42 mg g -1 min -1 , respectively, which were 5 and 20 times faster than those without it. Strain LSSE-09 retained high activities over six batch cycles and NO 3 - and SO 4 2- had slightly negative effects on Cr (VI)-reduction rates. The results suggest that strain LSSE-09 has potential application for Cr (VI) detoxification in alkaline wastewater.

The Effects of Oxygen Partial Pressure on Liquidus Temperature of a High-Level Waste Glass with Spinel as the Primary Phase

International Nuclear Information System (INIS)

Izak, Pavel; Hrma, Pavel R.; Wilson, Benjamin K.; Vienna, John D.

2000-01-01

The redox state of iron affects spinal crystallization in vitrified high-level waste (HLW) glass. Simulated HLW glass with spinel as the primary crystalline phase field was heat treated at constant temperatures within the interval from 850 C to 1300 C under varying atmospheres with oxygen partial pressure, Po2, ranging from 1x10-16 kPa (pure CO) to 101 kPa (pure O2). Liquidus temperature (TL) of glass increased with decreasing Po2 up to Po2 > 3 x 10-9 kPa. At Po2 < 3 x 10-9 kPa, Ni-Fe alloy precipitated from the glass, and TL decreased. Samples were analyzed with optical microscope and scanning electron microscope. The mass fraction of spinel in glass was determined using quantitative X-ray diffraction. Spinel composition was investigated with energy disperse spectroscopy. Ferrous-ferric equilibrium at TL was calculated in a HLW glass as a function of temperature and Po2, based on the previous studies by Schreiber. TL/FeO over the interval 0.0063 < gFeO < 0.051 (1x10-2 kPa < Po2 < 3x10-9 kPa) was estimated from calculated ferrous-ferric equilibrium at TL as 1835 C

Proteolytic degradation of regulator of G protein signaling 2 facilitates temporal regulation of Gq/11 signaling and vascular contraction.

Science.gov (United States)

Kanai, Stanley M; Edwards, Alethia J; Rurik, Joel G; Osei-Owusu, Patrick; Blumer, Kendall J

2017-11-24

Regulator of G protein signaling 2 (RGS2) controls signaling by receptors coupled to the G q/11 class heterotrimeric G proteins. RGS2 deficiency causes several phenotypes in mice and occurs in several diseases, including hypertension in which a proteolytically unstable RGS2 mutant has been reported. However, the mechanisms and functions of RGS2 proteolysis remain poorly understood. Here we addressed these questions by identifying degradation signals in RGS2, and studying dynamic regulation of G q/11 -evoked Ca 2+ signaling and vascular contraction. We identified a novel bipartite degradation signal in the N-terminal domain of RGS2. Mutations disrupting this signal blunted proteolytic degradation downstream of E3 ubiquitin ligase binding to RGS2. Analysis of RGS2 mutants proteolyzed at various rates and the effects of proteasome inhibition indicated that proteolytic degradation controls agonist efficacy by setting RGS2 protein expression levels, and affecting the rate at which cells regain agonist responsiveness as synthesis of RGS2 stops. Analyzing contraction of mesenteric resistance arteries supported the biological relevance of this mechanism. Because RGS2 mRNA expression often is strikingly and transiently up-regulated and then down-regulated upon cell stimulation, our findings indicate that proteolytic degradation tightly couples RGS2 transcription, protein levels, and function. Together these mechanisms provide tight temporal control of G q/11 -coupled receptor signaling in the cardiovascular, immune, and nervous systems. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

ROLE OF PREEXISTING VIRUS-SPECIFIC IgG IN PRIMARY DISEASE AND IN REINFECTION WITH RESPIRATORY SYNCYTIAL VIRUS

Directory of Open Access Journals (Sweden)

V. Z. Krivitskaya

2012-01-01

Full Text Available Abstract. The aim of the study is evaluation of links between presence in blood of specific pre-existing IgG to respiratory-syncytial virus (RSV, clinical course of RSV infection and character specific to RSV humoral immune response in patients of different ages. The antibodies were detected by ELISA using whole RS virus or synthetic peptides corresponded to the selected determinants of the envelope RSV proteins. It was shown that RS specific maternal IgG antibodies passively transferred to babies in utero can circulate in the blood up to 10 months of life. The analysis of paired sera of 45 babies in the age of 1–10 months revealed firstly that presence of maternal IgG specific antibodies to the conservative B-cell immunogenic determinants of the F-protein (amino acids 221–232 and/or the G-protein (amino acids 152–164 and 184–198 is coupled with more high morbidity of primary RSV infection (89% versus 56%, p = 0.023, and also with more high frequency of complicated by bronchus obstruction course of the disease (81% versus 20%, р = 0.001 in compare with babies who were serologically negative to the maternal determinants specific antibodies. The correlation analysis has shown that the high presence of maternal determinant-specific IgG in the blood in babies till 10 months of life is associated in the case of primary infection with disbalance of humoral anti-viral immune response: intensive synthesis of serum RSV IgA. This is evidence of complicated course of infection with simultaneous suppression of response to RSV specific IgG. As opposed to the primary RSV infection in patients older than 3 years (n = 121 it was not detected links between anamnestic determinant-specific IgG synthesized by own immune system as the results of previous disease episodes and synthesis of anti-RSV IgG, IgM, IgE and IgA in RSV re-infections. In the contrast to babies in more older patients the feedback connection between level of pre-existing determinant

Stem Cell Mobilization with G-CSF versus Cyclophosphamide plus G-CSF in Mexican Children

Directory of Open Access Journals (Sweden)

José Eugenio Vázquez Meraz

2016-01-01

Full Text Available Fifty-six aphaereses were performed in 23 pediatric patients with malignant hematological and solid tumors, following three different protocols for PBPC mobilization and distributed as follows: A: seventeen mobilized with 4 g/m2 of cyclophosphamide (CFA and 10 μg/kg/day of granulocyte colony stimulating factor (G-CSF, B: nineteen with CFA + G-CSF, and C: twenty only with G-CSF when the WBC count exceeded 10 × 109/L. The average number of MNC/kg body weight (BW/aphaeresis was 0.4 × 108 (0.1–1.4, 2.25 × 108 (0.56–6.28, and 1.02 × 108 (0.34–2.5 whereas the average number of CD34+ cells/kg BW/aphaeresis was 0.18 × 106/kg (0.09–0.34, 1.04 × 106 (0.19–9.3, and 0.59 × 106 (0.17–0.87 and the count of CFU/kg BW/aphaeresis was 1.11 × 105 (0.31–2.12, 1.16 × 105 (0.64–2.97, and 1.12 × 105 (0.3–6.63 in groups A, B, and C, respectively. The collection was better in group B versus group A (p=0.007 and p=0.05, resp. and in group C versus group A (p=0.08 and p=0.05, resp.. The collection of PBPCs was more effective in the group mobilized with CFM + G-CSF when the WBC exceeded 10 × 103/μL in terms of MNC and CD34+ cells and there was no toxicity of the chemotherapy.

Stem Cell Mobilization with G-CSF versus Cyclophosphamide plus G-CSF in Mexican Children.

Science.gov (United States)

Meraz, José Eugenio Vázquez; Arellano-Galindo, José; Avalos, Armando Martínez; Mendoza-García, Emma; Jiménez-Hernández, Elva

2016-01-01

Fifty-six aphaereses were performed in 23 pediatric patients with malignant hematological and solid tumors, following three different protocols for PBPC mobilization and distributed as follows: A: seventeen mobilized with 4 g/m(2) of cyclophosphamide (CFA) and 10 μg/kg/day of granulocyte colony stimulating factor (G-CSF), B: nineteen with CFA + G-CSF, and C: twenty only with G-CSF when the WBC count exceeded 10 × 10(9)/L. The average number of MNC/kg body weight (BW)/aphaeresis was 0.4 × 10(8) (0.1-1.4), 2.25 × 10(8) (0.56-6.28), and 1.02 × 10(8) (0.34-2.5) whereas the average number of CD34+ cells/kg BW/aphaeresis was 0.18 × 10(6)/kg (0.09-0.34), 1.04 × 10(6) (0.19-9.3), and 0.59 × 10(6) (0.17-0.87) and the count of CFU/kg BW/aphaeresis was 1.11 × 10(5) (0.31-2.12), 1.16 × 10(5) (0.64-2.97), and 1.12 × 10(5) (0.3-6.63) in groups A, B, and C, respectively. The collection was better in group B versus group A (p = 0.007 and p = 0.05, resp.) and in group C versus group A (p = 0.08 and p = 0.05, resp.). The collection of PBPCs was more effective in the group mobilized with CFM + G-CSF when the WBC exceeded 10 × 10(3)/μL in terms of MNC and CD34+ cells and there was no toxicity of the chemotherapy.

Studies on herd-immunity and primary versus secondary infection of VHSV in challenge and vaccination trials with rainbow trout

DEFF Research Database (Denmark)

Lorenzen, Ellen; Kjær, Torben Egil; Lorenzen, Niels

as well as selective breeding, i.e. the more non-susceptible individuals in a population, the lower the risk of disease among susceptible individuals. Thus as part of a recent field trial with a VHS-DNA-vaccine vaccinated as well as naïve fish from a Danish fish farm were brought to the laboratory......Abstract for Scofda meeting 4-5.11.09 Studies on herd-immunity effect and primary versus secondary infection of VHSV by Ellen Lorenzen, Torben Eigil Kjær & Niels Lorenzen, National Veterinary Laboratory, Århus The phenomenon of “herd-immunity” is one of the basal principles behind vaccination...... at a size of 24g to be subjected to an experimental challenge with VHSV. The setup included 7 aquaria with 100 fish in each: 2 aquaria with 100 vaccinated fish (+VHS-challenge), 2 aquaria with 100 naïve fish (+ VHS-challenge), 2 aquaria with 50 vaccinated + 50 naïve fish (+VHS-challenge), and 1 aquarium...

The c.IVS1+1G>A mutation inthe GJB2 gene is prevalent and large ...

Indian Academy of Sciences (India)

IVS1+1G>A mutation inthe GJB2 gene is prevalent and large deletions involving the GJB6 gene are not present in the Turkish population. ASLI SIRMACI, DUYGU AKCAYOZ-DUMAN and MUSTAFA TEKIN∗. Division of Pediatric Molecular Genetics, Ankara University School of Medicine, Ankara 06100, Turkey. Introduction.

Partial Actions, Paradoxicality and Topological full Groups

DEFF Research Database (Denmark)

Scarparo, Eduardo

uniform Roe algebra is finite. In Article C, we analyze the C*-algebra generated by the Koopman representation of a topological full group, showing, in particular, that it is not AF andhas real rank zero. We also prove that if G is a finitely generated, elementary amenable group, and C*(G) has real rank......We study how paradoxicality properties affect the way groups partially acton topological spaces and C*-algebras. We also investigate the real rank zero and AF properties for certain classes of group C*-algebras. Specifically, in article A, we characterize supramenable groups in terms of existence...... of invariant probability measures for partial actions on compact Hausdorff spaces and existence of tracial states on partial crossed products. These characterizations show that, in general, one cannot decompose a partial crossed product of a C*-algebra by a semidirect product of groups as two iterated...

Reduction of Direct Health Costs Associated with Pertussis Vaccination with Acellular Vaccines in Children Aged 0-9 Years with Pertussis in Catalonia (Spain).

Science.gov (United States)

Plans-Rubió, Pedro; Navas, Encarna; Godoy, Pere; Carmona, Gloria; Domínguez, Angela; Jané, Mireia; Muñoz-Almagro, Carmen; Brotons, Pedro

2018-05-14

The aim of this study was to assess direct health costs in children with pertussis aged 0-9 years who were vaccinated, partially vaccinated, and unvaccinated during childhood, and to assess the association between pertussis costs and pertussis vaccination in Catalonia (Spain) in 2012-2013. Direct healthcare costs included pertussis treatment, pertussis detection, and preventive chemotherapy of contacts. Pertussis patients were considered vaccinated when they had received 4-5 doses, and unvaccinated or partially vaccinated when they had received 0-3 doses of vaccine. The Chi square test and the odds ratios were used to compare percentages and the t test was used to compare mean pertussis costs in different groups, considering a p case after taking into account the effect of other study variables, and €200 per case after taking into account pertussis severity. Direct healthcare costs were lower in children with pertussis aged 0-9 years vaccinated with 4-5 doses of acellular vaccines than in unvaccinated or partially vaccinated children with pertussis of the same age.

Temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from THOMAS G. THOMPSON in the North Pacific Ocean from 1985-08-04 to 1985-09-07 (NCEI Accession 0143394)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0143394 includes discrete sample and profile data collected from THOMAS G. THOMPSON in the North Pacific Ocean from 1985-08-04 to 1985-09-07 and...

Mouse Clr-g, a ligand for NK cell activation receptor NKR-P1F: crystal structure and biophysical properties

Czech Academy of Sciences Publication Activity Database

Skálová, Tereza; Kotýnková, Kristýna; Dušková, Jarmila; Hašek, Jindřich; Koval, Tomáš; Kolenko, Petr; Novák, P.; Man, Petr; Hanč, Pavel; Vaněk, Ondřej; Bezouška, K.; Dohnálek, Jan

2012-01-01

Roč. 189, č. 10 (2012), s. 4881-4889 ISSN 0022-1767 R&D Projects: GA AV ČR KJB101120805; GA ČR GAP302/11/0855; GA ČR GD305/09/H008; GA ČR GA305/07/1073; GA ČR(CZ) GAP207/10/1040; GA MŠk EE2.3.30.0029; GA ČR GA303/09/0477 EU Projects: European Commission(XE) 31220 - SPINE2-COMPLEXES Institutional research plan: CEZ:AV0Z40500505; CEZ:AV0Z50200510 Institutional support: RVO:61389013 ; RVO:61388971 Keywords : Clr-g * C-type lectin like fold * NK receptor Subject RIV: CE - Biochemistry; EC - Immunology (MBU-M) Impact factor: 5.520, year: 2012

Complications Following Primary and Revision Transsphenoidal Surgeries for Pituitary Tumors

Science.gov (United States)

Krings, James G.; Kallogjeri, Dorina; Wineland, Andre; Nepple, Kenneth G.; Piccirillo, Jay F.; Getz, Anne E.

2014-01-01

Objective This study aimed to determine the incidence of major complications following both primary and revision transsphenoidal pituitary surgery. Major complications included endocrinopathic, skull base, orbital, hemorrhagic and thromboembolic complications, respiratory failure, and death. Secondarily, this study aimed to examine factors associated with the occurrence of complications. Study Design Retrospective cohort analysis of California and Florida all-payer databases from 2005-2008. Methods The major complication rate following both primary and revision transsphenoidal pituitary surgery was calculated. Bivariate analyses were performed to investigate the relationship of patient characteristics with complication occurrence, and a multivariate model was constructed to determine risk factors associated with these complications. Results 5,277 primary cases and 192 revision cases met inclusion criteria. There was a non-significant absolute difference of 3.09% (95% CI −11.00 to 16.14) between the rate of complications following primary (n=443; 8.39%) and revision (n=22; 11.46%) surgeries. Multivariate analyses showed that patients with Medicare (OR=1.74; 95% CI 1.17 to 2.61), Medicaid (OR=2.13; 95% CI 1.59 to 2.86), or a malignant neoplasm (OR=3.10; 95% CI 1.62 to 5.93) were more likely to have complications. Conclusions The rate of major complications following transsphenoidal pituitary surgery is lower than earlier retrospective reports. The overall complication rate following revision surgery was not significantly different from primary surgery. Insurance status and a diagnosis of a malignant neoplasm were associated with a higher rate of complications. PMID:25263939

New approach to breast cancer CAD using partial least squares and kernel-partial least squares

Science.gov (United States)

Land, Walker H., Jr.; Heine, John; Embrechts, Mark; Smith, Tom; Choma, Robert; Wong, Lut

2005-04-01

Breast cancer is second only to lung cancer as a tumor-related cause of death in women. Currently, the method of choice for the early detection of breast cancer is mammography. While sensitive to the detection of breast cancer, its positive predictive value (PPV) is low, resulting in biopsies that are only 15-34% likely to reveal malignancy. This paper explores the use of two novel approaches called Partial Least Squares (PLS) and Kernel-PLS (K-PLS) to the diagnosis of breast cancer. The approach is based on optimization for the partial least squares (PLS) algorithm for linear regression and the K-PLS algorithm for non-linear regression. Preliminary results show that both the PLS and K-PLS paradigms achieved comparable results with three separate support vector learning machines (SVLMs), where these SVLMs were known to have been trained to a global minimum. That is, the average performance of the three separate SVLMs were Az = 0.9167927, with an average partial Az (Az90) = 0.5684283. These results compare favorably with the K-PLS paradigm, which obtained an Az = 0.907 and partial Az = 0.6123. The PLS paradigm provided comparable results. Secondly, both the K-PLS and PLS paradigms out performed the ANN in that the Az index improved by about 14% (Az ~ 0.907 compared to the ANN Az of ~ 0.8). The "Press R squared" value for the PLS and K-PLS machine learning algorithms were 0.89 and 0.9, respectively, which is in good agreement with the other MOP values.

16 CFR 0.9 - Organization structure.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Organization structure. 0.9 Section 0.9 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE ORGANIZATION § 0.9 Organization structure. The Federal Trade Commission comprises the following principal units...

Neuronal Activity in the Subthalamic Cerebrovasodilator Area under Partial-Gravity Conditions in Rats

Directory of Open Access Journals (Sweden)

Zeredo L Zeredo

2014-03-01

Full Text Available The reduced-gravity environment in space is known to cause an upward shift in body fluids and thus require cardiovascular adaptations in astronauts. In this study, we recorded in rats the neuronal activity in the subthalamic cerebrovasodilator area (SVA, a key area that controls cerebral blood flow (CBF, in response to partial gravity. “Partial gravity” is the term that defines the reduced-gravity levels between 1 g (the unit gravity acceleration on Earth and 0 g (complete weightlessness in space. Neuronal activity was recorded telemetrically through chronically implanted microelectrodes in freely moving rats. Graded levels of partial gravity from 0.4 g to 0.01 g were generated by customized parabolic-flight maneuvers. Electrophysiological signals in each partial-gravity phase were compared to those of the preceding 1 g level-flight. As a result, SVA neuronal activity was significantly inhibited by the partial-gravity levels of 0.15 g and lower, but not by 0.2 g and higher. Gravity levels between 0.2–0.15 g could represent a critical threshold for the inhibition of neurons in the rat SVA. The lunar gravity (0.16 g might thus trigger neurogenic mechanisms of CBF control. This is the first study to examine brain electrophysiology with partial gravity as an experimental parameter.

Predictivity of dog co-culture model, primary human hepatocytes and HepG2 cells for the detection of hepatotoxic drugs in humans

International Nuclear Information System (INIS)

Atienzar, Franck A.; Novik, Eric I.; Gerets, Helga H.; Parekh, Amit; Delatour, Claude; Cardenas, Alvaro; MacDonald, James; Yarmush, Martin L.; Dhalluin, Stéphane

2014-01-01

Drug Induced Liver Injury (DILI) is a major cause of attrition during early and late stage drug development. Consequently, there is a need to develop better in vitro primary hepatocyte models from different species for predicting hepatotoxicity in both animals and humans early in drug development. Dog is often chosen as the non-rodent species for toxicology studies. Unfortunately, dog in vitro models allowing long term cultures are not available. The objective of the present manuscript is to describe the development of a co-culture dog model for predicting hepatotoxic drugs in humans and to compare the predictivity of the canine model along with primary human hepatocytes and HepG2 cells. After rigorous optimization, the dog co-culture model displayed metabolic capacities that were maintained up to 2 weeks which indicates that such model could be also used for long term metabolism studies. Most of the human hepatotoxic drugs were detected with a sensitivity of approximately 80% (n = 40) for the three cellular models. Nevertheless, the specificity was low approximately 40% for the HepG2 cells and hepatocytes compared to 72.7% for the canine model (n = 11). Furthermore, the dog co-culture model showed a higher superiority for the classification of 5 pairs of close structural analogs with different DILI concerns in comparison to both human cellular models. Finally, the reproducibility of the canine system was also satisfactory with a coefficient of correlation of 75.2% (n = 14). Overall, the present manuscript indicates that the dog co-culture model may represent a relevant tool to perform chronic hepatotoxicity and metabolism studies. - Highlights: • Importance of species differences in drug development. • Relevance of dog co-culture model for metabolism and toxicology studies. • Hepatotoxicity: higher predictivity of dog co-culture vs HepG2 and human hepatocytes

Predictivity of dog co-culture model, primary human hepatocytes and HepG2 cells for the detection of hepatotoxic drugs in humans

Energy Technology Data Exchange (ETDEWEB)

Atienzar, Franck A., E-mail: franck.atienzar@ucb.com [UCB Pharma SA, Non-Clinical Development, Chemin du Foriest, 1420 Braine-l' Alleud (Belgium); Novik, Eric I. [H mu rel Corporation, 675 U.S. Highway 1, North Brunswick, NJ 08902 (United States); Gerets, Helga H. [UCB Pharma SA, Non-Clinical Development, Chemin du Foriest, 1420 Braine-l' Alleud (Belgium); Parekh, Amit [H mu rel Corporation, 675 U.S. Highway 1, North Brunswick, NJ 08902 (United States); Delatour, Claude; Cardenas, Alvaro [UCB Pharma SA, Non-Clinical Development, Chemin du Foriest, 1420 Braine-l' Alleud (Belgium); MacDonald, James [Chrysalis Pharma Consulting, LLC, 385 Route 24, Suite 1G, Chester, NJ 07930 (United States); Yarmush, Martin L. [Department of Biomedical Engineering, Rutgers University, Piscataway, NJ 08854 (United States); Dhalluin, Stéphane [UCB Pharma SA, Non-Clinical Development, Chemin du Foriest, 1420 Braine-l' Alleud (Belgium)

2014-02-15

Drug Induced Liver Injury (DILI) is a major cause of attrition during early and late stage drug development. Consequently, there is a need to develop better in vitro primary hepatocyte models from different species for predicting hepatotoxicity in both animals and humans early in drug development. Dog is often chosen as the non-rodent species for toxicology studies. Unfortunately, dog in vitro models allowing long term cultures are not available. The objective of the present manuscript is to describe the development of a co-culture dog model for predicting hepatotoxic drugs in humans and to compare the predictivity of the canine model along with primary human hepatocytes and HepG2 cells. After rigorous optimization, the dog co-culture model displayed metabolic capacities that were maintained up to 2 weeks which indicates that such model could be also used for long term metabolism studies. Most of the human hepatotoxic drugs were detected with a sensitivity of approximately 80% (n = 40) for the three cellular models. Nevertheless, the specificity was low approximately 40% for the HepG2 cells and hepatocytes compared to 72.7% for the canine model (n = 11). Furthermore, the dog co-culture model showed a higher superiority for the classification of 5 pairs of close structural analogs with different DILI concerns in comparison to both human cellular models. Finally, the reproducibility of the canine system was also satisfactory with a coefficient of correlation of 75.2% (n = 14). Overall, the present manuscript indicates that the dog co-culture model may represent a relevant tool to perform chronic hepatotoxicity and metabolism studies. - Highlights: • Importance of species differences in drug development. • Relevance of dog co-culture model for metabolism and toxicology studies. • Hepatotoxicity: higher predictivity of dog co-culture vs HepG2 and human hepatocytes.

Adiabatic Fixed-Bed Gasification of Colombian Coffee Husk Using Air-Steam Blends for Partial Oxidation

Directory of Open Access Journals (Sweden)

Javier Bonilla

2017-01-01

Full Text Available The increasing energy consumption, mostly supplied by fossil fuels, has motivated the research and development of alternative fuel technologies to decrease the humanity’s dependence on fossil fuels, which leads to pollution of natural sources. Small-scale biomass gasification, using air-steam blends for partial oxidation, is a good alternative since biomass is a neutral carbon feedstock for sustainable energy generation. This research presents results obtained from an experimental study on coffee husk (CH gasification, using air-steam blends for partial oxidation in a 10 kW fixed-bed gasifier. Parametric studies on equivalence ratio (ER (1.53 < ER < 6.11 and steam-fuel (SF ratio (0.23 < SF < 0.89 were carried out. The results show that increasing both SF and ER results in a syngas rich in CH4 and H2 but poor in CO. Also, decreased SF and ER decrease the peak temperature (Tpeak at the gasifier combustion zone. The syngas high heating value (HHV ranged from 3112 kJ/SATPm3 to 5085 kJ/SATPm3 and its maximum value was obtained at SF = 0.87 and ER = 4.09. The dry basis molar concentrations of the species, produced under those operating conditions (1.53 < ER < 6.11 and 0.23 < SF < 0.89, were between 1.12 and 4.1% for CH4, between 7.77 and 13.49% for CO, and between 7.54 and 19.07% for H2. Other species were in trace amount.

Clinical significations of G2-M stage partial synchronization on radiation therapies of uterine cervical carcinomas

International Nuclear Information System (INIS)

Sasaki, Hiroshi

1981-01-01

The present study revealed that irradiation-induced changes of repopulation and redistribution played an important role in radiosensitivity and cure process of human uterine cervical carcinoma. DNA measurements by a microspectrophotometer were made on Feulgen stained biopsy specimens obtained from 20 patients. On the other hand, flow-microfluorometric measurements with Fried's computed cell cycle analysis were made on transplanted human cervical carcinomas. The mean nuclear DNA amount of human cervical carcinoma cells increased according as the irradiation doses increase until 2,000 rad. Moreover, as regards with the mean nuclear diameter of cancer cells the same phenomenon was recognized, and there was an interrelation between the increase of mean nuclear DNA amount and that of mean nuclear diameter. This phenomenon was proved in nuclear DNA analysis by flow-microfluorometric measurements on transplanted human cervical carcinoma in nude mice. Computed cell cycle analysis of F.M.F. data demonstrated that this phenomenon was due to irradiation-induced changes of repopulation and redistribution. That is to say, irradiation induces the increase of cycling cells and then partial synchronization to G2-M stage. Examination of the interrelation between this phenomenon at 500 rad and 5 years survival rate demonstrated that there was more increase of nuclear DNA amount in the good prognosis group than in the poor prognosis group. Estimation of residual cells near the G1 stage at 2,000 rad demonstrated that there were more residual cells near the G1 stage in the poor prognosis group than in the good prognosis group. (author)

Strikingly different penetrance of LHON in two Chinese families with primary mutation G11778A is independent of mtDNA haplogroup background and secondary mutation G13708A

International Nuclear Information System (INIS)

Wang Huawei; Jia Xiaoyun; Ji Yanli; Kong Qingpeng; Zhang Qingjiong; Yao Yonggang; Zhang Yaping

2008-01-01

The penetrance of Leber's hereditary optic neuropathy (LHON) in families with primary mitochondrial DNA (mtDNA) mutations is very complex. Matrilineal and nuclear genetic background, as well as environmental factors, have been reported to be involved in different affected pedigrees. Here we describe two large Chinese families that show a striking difference in the penetrance of LHON, in which 53.3% and 15.0% of members were affected (P < 0.02), respectively. Analysis of the complete mtDNA genome of the two families revealed the presence of the primary mutation G11778A and several other variants suggesting the same haplogroup status G2a. The family with higher penetrance contained a previously described secondary mutation G13708A, which presents a polymorphism in normal Chinese samples and does not affect in vivo mitochondrial oxidative metabolism as described in a previous study. Evolutionary analysis failed to indicate any putatively pathogenic mutation that cosegregated with G11778A in these two pedigrees. Our results suggest that the variable penetrance of LHON in the two Chinese families is independent of both their mtDNA haplotype background and a secondary mutation G13708A. As a result, it is likely that unknown nuclear gene involvement and/or other factors contribute to the strikingly different penetrance of LHON

Crystal growth and piezoelectric properties of Ca3Ta(Ga0.9Sc0.1)3Si2O14 bulk single crystal

Science.gov (United States)

Igarashi, Yu; Yokota, Yuui; Ohashi, Yuji; Inoue, Kenji; Yamaji, Akihiro; Shoji, Yasuhiro; Kamada, Kei; Kurosawa, Shunsuke; Yoshikawa, Akira

2018-03-01

Ca3Ta(Ga0.9Sc0.1)3Si2O14 langasite-type single crystal with a diameter of 1 in. was grown by Czochralski (Cz) method. Obtained crystal had good crystallinity and its lattice constants exceeded those of Ca3TaGa3Si2O14 (CTGS) according to the X-ray analysis. A crack-free specimen cut from the grown crystal was used for the measurements of dielectric constant ε11T/ε0, electromechanical coupling factor k12, and piezoelectric constant d11. The accuracies of these measurements were better than those for the crystal grown by micro-pulling-down (μ-PD) method. Substitution of Ga with Sc resulted modification of these constants in the directions opposite to those observed after partial substitution of Ga (of CTGS) with Al. This suggests that increase of |d14| was most probably associated with enlargement of average size of the Ga sites. The crystal reported here had greater dimensions as compared to analogous crystals grown by the μ-PD method. As a result, accuracy of determination of acoustic constants of this material may be improved.

CD11c controls herpes simplex virus 1 responses to limit virus replication during primary infection.

Science.gov (United States)

Allen, Sariah J; Mott, Kevin R; Chentoufi, Aziz A; BenMohamed, Lbachir; Wechsler, Steven L; Ballantyne, Christie M; Ghiasi, Homayon

2011-10-01

CD11c is expressed on the surface of dendritic cells (DCs) and is one of the main markers for identification of DCs. DCs are the effectors of central innate immune responses, but they also affect acquired immune responses to infection. However, how DCs influence the efficacy of adaptive immunity is poorly understood. Here, we show that CD11c(+) DCs negatively orchestrate both adaptive and innate immunity against herpes simplex virus type 1 (HSV-1) ocular infection. The effectiveness and quantity of virus-specific CD8(+) T cell responses are increased in CD11c-deficient animals. In addition, the levels of CD83, CD11b, alpha interferon (IFN-α), and IFN-β, but not IFN-γ, were significantly increased in CD11c-deficient animals. Higher levels of IFN-α, IFN-β, and CD8(+) T cells in the CD11c-deficient mice may have contributed to lower virus replication in the eye and trigeminal ganglia (TG) during the early period of infection than in wild-type mice. However, the absence of CD11c did not influence survival, severity of eye disease, or latency. Our studies provide for the first time evidence that CD11c expression may abrogate the ability to reduce primary virus replication in the eye and TG via higher activities of type 1 interferon and CD8(+) T cell responses.

In vitro Cytotoxicity, Pharmacokinetics, Tissue Distribution, and Metabolism of Small-Molecule Protein Kinase D Inhibitors, kb-NB142-70 and kb-NB165-09, in Mice bearing Human Cancer Xenografts

Science.gov (United States)

Guo, Jianxia; Clausen, Dana M.; Beumer, Jan H.; Parise, Robert A.; Egorin, Merrill J.; Bravo-Altamirano, Karla; Wipf, Peter; Sharlow, Elizabeth R.; Wang, Qiming Jane; Eiseman, Julie L.

2012-01-01

Purpose Protein kinase D (PKD) mediates diverse biological responses including cell growth and survival. Therefore, PKD inhibitors may have therapeutic potential. We evaluated the in vitro cytotoxicity of two PKD inhibitors, kb-NB142-70 and its methoxy analog, kb-NB165-09, and examined their in vivo efficacy and pharmacokinetics. Methods The in vitro cytotoxicities of kb-NB142-70 and kb-NB165-09 were evaluated by MTT assay against PC-3, androgen independent prostate cancer cells, and CFPAC-1 and PANC-1, pancreatic cancer cells. Efficacy studies were conducted in mice bearing either PC-3 or CPFAC-1 xenografts. Tumor-bearing mice were euthanized between 5 and 1440 min after iv dosing, and plasma and tissue concentrations were measured by HPLC-UV. Metabolites were characterized by LC-MS/MS. Results kb-NB142-70 and kb-NB165-09 inhibited cellular growth in the low-mid μM range. The compounds were inactive when administered to tumor-bearing mice. In mice treated with kb-NB142-70, the plasma Cmax was 36.9 nmol/mL and the PC-3 tumor Cmax was 11.8 nmol/g. In mice dosed with kb-NB165-09, the plasma Cmax was 61.9 nmol/mL while the PANC-1 tumor Cmax was 8.0 nmol/g. The plasma half-lives of kb-NB142-70 and kb-NB165-09 were 6 and 14 min, respectively. Both compounds underwent oxidation and glucuronidation. Conclusions kb-NB142-70 and kb-NB165-09 were rapidly metabolized, and concentrations in tumor were lower than those required for in vitro cytotoxicity. Replacement of the phenolic hydroxyl group with a methoxy group increased the plasma half-life of kb-NB165-09 2.3-fold over that of kb-NB142-70. Rapid metabolism in mice suggests that next-generation compounds will require further structural modifications to increase potency and/or metabolic stability. PMID:23108699

Age-Related Hearing Impairment (ARHI) associated with GJB2 single mutation IVS1+1G>A in the Yakut population isolate in Eastern Siberia.

Science.gov (United States)

Barashkov, Nikolay A; Teryutin, Fedor M; Pshennikova, Vera G; Solovyev, Aisen V; Klarov, Leonid A; Solovyeva, Natalya A; Kozhevnikov, Andrei A; Vasilyeva, Lena M; Fedotova, Elvira E; Pak, Maria V; Lekhanova, Sargylana N; Zakharova, Elena V; Savvinova, Kyunney E; Gotovtsev, Nyurgun N; Rafailo, Adyum M; Luginov, Nikolay V; Alexeev, Anatoliy N; Posukh, Olga L; Dzhemileva, Lilya U; Khusnutdinova, Elza K; Fedorova, Sardana A

2014-01-01

Age-Related Hearing Impairment (ARHI) is one of the frequent sensory disorders registered in 50% of individuals over 80 years. ARHI is a multifactorial disorder due to environmental and poor-known genetic components. In this study, we present the data on age-related hearing impairment of 48 heterozygous carriers of mutation IVS1+1G>A (GJB2 gene) and 97 subjects with GJB2 genotype wt/wt in the Republic of Sakha/Yakutia (Eastern Siberia, Russia). This subarctic territory was found as the region with the most extensive accumulation of mutation IVS1+1G>A in the world as a result of founder effect in the unique Yakut population isolate. The GJB2 gene resequencing and detailed audiological analysis in the frequency range 0.25, 0.5, 1.0, 2.0, 4.0, 8.0 kHz were performed in all examined subjects that allowed to investigate genotype-phenotype correlations between the presence of single mutation IVS1+1G>A and hearing of subjects from examined groups. We revealed the linear correlation between increase of average hearing thresholds at speech frequencies (PTA0.5,1.0,2.0,4.0 kHz) and age of individuals with GJB2 genotype IVS1+1G>A/wt (rs = 0.499, p = 0.006860 for males and rs = 0.427, p = 0.000277 for females). Moreover, the average hearing thresholds on high frequency (8.0 kHz) in individuals with genotype IVS1+1G>A/wt (both sexes) were significantly worse than in individuals with genotype wt/wt (pA/wt was estimated to be ∼40 years (rs = 0.504, p = 0.003). These findings demonstrate that the single IVS1+1G>A mutation (GJB2) is associated with age-related hearing impairment (ARHI) of the IVS1+1G>A carriers in the Yakuts.

Age-Related Hearing Impairment (ARHI associated with GJB2 single mutation IVS1+1G>A in the Yakut population isolate in Eastern Siberia.

Directory of Open Access Journals (Sweden)

Nikolay A Barashkov

Full Text Available Age-Related Hearing Impairment (ARHI is one of the frequent sensory disorders registered in 50% of individuals over 80 years. ARHI is a multifactorial disorder due to environmental and poor-known genetic components. In this study, we present the data on age-related hearing impairment of 48 heterozygous carriers of mutation IVS1+1G>A (GJB2 gene and 97 subjects with GJB2 genotype wt/wt in the Republic of Sakha/Yakutia (Eastern Siberia, Russia. This subarctic territory was found as the region with the most extensive accumulation of mutation IVS1+1G>A in the world as a result of founder effect in the unique Yakut population isolate. The GJB2 gene resequencing and detailed audiological analysis in the frequency range 0.25, 0.5, 1.0, 2.0, 4.0, 8.0 kHz were performed in all examined subjects that allowed to investigate genotype-phenotype correlations between the presence of single mutation IVS1+1G>A and hearing of subjects from examined groups. We revealed the linear correlation between increase of average hearing thresholds at speech frequencies (PTA0.5,1.0,2.0,4.0 kHz and age of individuals with GJB2 genotype IVS1+1G>A/wt (rs = 0.499, p = 0.006860 for males and rs = 0.427, p = 0.000277 for females. Moreover, the average hearing thresholds on high frequency (8.0 kHz in individuals with genotype IVS1+1G>A/wt (both sexes were significantly worse than in individuals with genotype wt/wt (pA/wt was estimated to be ∼40 years (rs = 0.504, p = 0.003. These findings demonstrate that the single IVS1+1G>A mutation (GJB2 is associated with age-related hearing impairment (ARHI of the IVS1+1G>A carriers in the Yakuts.

Charged-particle multiplicities in proton–proton collisions at $\\sqrt{s} = 0.9$ to 8 TeV

OpenAIRE

Adam, Jaroslav; Adamova, Dagmar; Akindinov, Alexander; Bjelogrlic, Sandro; Blair, Justin Thomas; Blau, Dmitry; Blume, Christoph; Bock, Friederike; Bogdanov, Alexey; Boggild, Hans; Boldizsar, Laszlo; Bombara, Marek; Book, Julian Heinz; Alam, Sk Noor; Borel, Herve

2017-01-01

A detailed study of pseudorapidity densities and multiplicity distributions of primary charged particles produced in proton–proton collisions, at $\\sqrt{s} =$ 0.9, 2.36, 2.76, 7 and 8 TeV, in the pseudorapidity range $|\\eta |

Possible association of 3' UTR +357 A>G, IVS11-nt 93 T>C, c.1311 C>T polymorphism with G6PD deficiency.

Science.gov (United States)

Sirdah, Mahmoud M; Shubair, Mohammad E; Al-Kahlout, Mustafa S; Al-Tayeb, Jamal M; Prchal, Josef T; Reading, N Scott

2017-07-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked inherited enzymopathic disorder affecting more than 500 million people worldwide. It has so far been linked to 217 distinct genetic variants in the exons and exon-intron boundaries of the G6PD gene, giving rise to a wide range of biochemical heterogeneity and clinical manifestations. Reports from different settings suggested the association of intronic and other mutations outside the reading frame of the G6PD gene with reduced enzyme activity and presenting clinical symptoms. The present study aimed to investigate any association of other variations apart of the exonic or exonic intronic boundaries in the development of G6PD deficiency. Sixty-seven unrelated Palestinian children admitted to the pediatric hospital with hemolytic crises due to G6PD deficiency were studied. In our Palestinian cohort of 67 [59 males (M) and 8 females (F)] G6PD-deficient children, previously hospitalized for acute hemolytic anemia due to favism, molecular sequencing of the G6PD gene revealed four cases (3M and 1F) that did not have any of the variants known to cause G6PD deficiency, but the 3' UTR c.*+357A>G (rs1050757) polymorphism in association with IVS 11 (c.1365-13T>C; rs2071429), and c.1311C>T (rs2230037). We now provide an additional evidence form Palestinian G6PD-deficient subjects for a possible role of 3' UTR c.*+357 A>G, c.1365-13T>C, and/or c.1311C>T polymorphism for G6PD deficiency, suggesting that not only a single variation in the exonic or exonic intronic boundaries, but also a haplotype of G6PD should considered as a cause for G6PD deficiency.

Partial peritoneal alimentation in an infant.

Science.gov (United States)

Merritt, R J; Atkinson, J B; Whalen, T V; Thomas, D W; Sinatra, F R; Roloson, G J

1988-01-01

We provided partial peritoneal alimentation to a 1.69-kg 11-month-old premature infant who had no available central venous access, depleted peripheral venous access, and gastrointestinal dysfunction. A cuffed silastic catheter was surgically inserted into the suprahepatic space. An alimentation solution was continuously infused into the peritoneum for 28 days to supplement peripheral venous and nasogastric alimentation and contributed 42 +/- 15% of total calories daily. Weight gain was achieved, but complications included hypoglycemia, hypophosphatemia, intravascular dehydration, catheter site leakage, ascites, and hydrocele. At autopsy 11 months later, lipid accumulation was present in the upper peritoneum and the hilar regions of the lungs secondary to preexisting lymphatic obstruction. Partial peritoneal alimentation may be feasible when other access routes are inadequate, but lymphatic obstruction is a contraindication to the peritoneal administration of lipid emulsions.

Investigation of primary cooling water chemistry following the partial meltdown of Pu-Be neutron source in Tehran Research Reactor Core (TRR)

Energy Technology Data Exchange (ETDEWEB)

Aghoyeh, Reza Gholizadeh [School of Research and Development of Nuclear Reactors and Accelerators, Nuclear Science and Technology Research Institute (NSTRI), Atomic Energy Organization of Iran (AEOI), P.O. Box: 14155-1339, Tehran (Iran, Islamic Republic of); Khalafi, Hossein, E-mail: hkhalafi@aeoi.org.i [School of Research and Development of Nuclear Reactors and Accelerators, Nuclear Science and Technology Research Institute (NSTRI), Atomic Energy Organization of Iran (AEOI), P.O. Box: 14155-1339, Tehran (Iran, Islamic Republic of)

2011-03-15

Research highlights: Effect of Pu-Be neutron source meltdown in core on reactor water chemistry. Water chemistry of primary cooling before, during and after of above incident was compared. Training importance. Management of nuclear incident and accident. - Abstract: Effect of Pu-Be neutron source meltdown in core on reactor water chemistry was main aim of this study. Leaving the neutron source in the core after reactor power exceeds a few hundred Watts was the main reason for its partial meltdown. Water chemistry of primary cooling before, during and after of above incident was compared. Activity of some radio-nuclides such as Ba-140, La-140, I-131, I-132, Te-132 and Xe-135 increased. Other radio-nuclides such as Nd-147, Xe-133, Sr-91, I-133 and I-135 are also detected which were not existed before this incident.

Double-stranded RNA promotes CTL-independent tumor cytolysis mediated by CD11b+Ly6G+ intratumor myeloid cells through the TICAM-1 signaling pathway

Science.gov (United States)

Shime, Hiroaki; Matsumoto, Misako; Seya, Tsukasa

2017-01-01

PolyI:C, a synthetic double-stranded RNA analog, acts as an immune-enhancing adjuvant that regresses tumors in cytotoxic T lymphocyte (CTL)-dependent and CTL-independent manner, the latter of which remains largely unknown. Tumors contain CD11b+Ly6G+ cells, known as granulocytic myeloid-derived suppressor cells (G-MDSCs) or tumor-associated neutrophils (TANs) that play a critical role in tumor progression and development. Here, we demonstrate that CD11b+Ly6G+ cells respond to polyI:C and exhibit tumoricidal activity in an EL4 tumor implant model. PolyI:C-induced inhibition of tumor growth was attributed to caspase-8/3 cascade activation in tumor cells that occurred independently of CD8α+/CD103+ dendritic cells (DCs) and CTLs. CD11b+Ly6G+ cells was essential for the antitumor effect because depletion of CD11b+Ly6G+ cells totally abrogated tumor regression and caspase activation after polyI:C treatment. CD11b+Ly6G+ cells that had been activated with polyI:C showed cytotoxicity and inhibited tumor growth through the production of reactive oxygen species (ROS)/reactive nitrogen species (RNS). These responses were abolished in either Toll/interleukin-1 receptor domain-containing adaptor molecule-1 (TICAM-1)−/− or interferon (IFN)-αβ receptor 1 (IFNAR1)−/− mice. Thus, our results suggest that polyI:C activates the TLR3/TICAM-1 and IFNAR signaling pathways in CD11b+Ly6G+ cells in tumors, thereby eliciting their antitumor activity, independent of those in CD8α+/CD103+ DCs that prime CTLs. PMID:27834952

Primary and secondary kinetic isotope effects in the acid-catalyzed dehydration of 1,1'-diadamantylmethylcarbinol in aqueous acetic acid

International Nuclear Information System (INIS)

Lomas, J.S.

1981-01-01

The sulfuric acid catalyzed dehydration of 1,1'-diadamantyl-methylcarbinol in anhydrous acetic acid proceeds exclusively to 1,1'-bis(1-adamantyl)ethylene. The secondary deuterium isotope effect of 1.32 found for this reaction shows that carbonium ion formation from the protonated alcohol is rate determining. In the presence of water, however, capture of the carbonium ion competes with deprotonation, introducing a primary isotope effect. Consequently, the overall KIE rises, reaching 3.18 for 80% aqueous acetic acid. Analysis of the KIE for 80 to 100% aqueous acetic acid is consistent with a simple classical mechanism involving reversible formation of the intermediate carbonium ion. The primary isotope effect upon deprotonation is at the most 2.98, indicative of an asymmetric transition state close to the carbonium ion

Assay of partially purified glutamate dehydrogenase isolated from ...

African Journals Online (AJOL)

Glutamate dehydrogenase (E C 1.4.1.1) isolated from the seeds of asparagus beans was partially purified to a factor of 22 by dialysis after fractional precipitation with solid ammonium sulphate at 40 and 60% saturation. A specific activity of 11.78μmol min-1 mg-1 protein was calculated for the partially purified enzyme when ...

Summer Student Programme

CERN Multimedia

2006-01-01

Date Time Title Speaker 31/07/2006 09:15 - 10:00 Beyond the Standard Model (1/5) E. KIRITSIS 10:15 - 11:00 Root R. BRUN 11:15 - 12:00 Introduction to Statistics (1/5) G. COWAN 12:00 Discussion Session Date Time Title Speaker 01/08/2006 09:15 - 10:00 Beyond the Standard Model (2/5) E. KIRITSIS 10:15 - 11:00 Physics at Hadronic Colliders (1/4) K. JAKOBS 11:15 - 12:00 Introduction to Statistics (2/5) G. COWAN 12:00 Discussion Session 02/08/2006 09:15 - 10:00 Beyond the Standard Model (3/5) E. KIRITSIS 10:15 - 11:00 Introduction to Statistics (3/5) G. COWAN 11:15 - 12:00 Physics at Hadronic Colliders (2/4) K. JAKOBS 12:00 Discussion Session 03/08/2006 09:15 - 10:00 Beyond the Standard Model (4/4) E. KIRITSIS 10:15 - 11:00 Physics at Hadronic Colliders (3/4) K. JAKOBS 11:15 - 12:00 Introduction to Statistics (4/4) G. COWAN 12:00 Discussion Session 04/08/2006 09:15 - 11:00 Data Acquisition Systems (1-2/2) P. SPHICAS 11:15 - 12:00 Physics at Hadro...

The theory and measurement of partial discharge transients

DEFF Research Database (Denmark)

Pedersen, Aage; Crichton, George C; McAllister, Iain Wilson

1991-01-01

A theoretical approach to partial discharge transients is presented. This approach is based on the relationship between the charge induced on the measurement electrode by those created in the interelectrode volume during partial discharge activity. The primary sources for these induced charges ar...... electrode systems of practical interest is illustrated. A discussion of the salient features and practical aspects of the theory is included...

In vivo evaluation of [11C]-3-[2-[(3-methoxyphenylamino)carbonyl]ethenyl]-4,6-dichloroindole- 2-carboxylic acid ([11C]3MPICA) as a PET radiotracer for the glycine site of the NMDA ion channel

International Nuclear Information System (INIS)

Waterhouse, Rikki N.; Sultana, Abida; Laruelle, M.

2002-01-01

Alterations in normal NMDA receptor composition, densities and function have been implicated in the pathophysiology of certain neurological and neuropsychiatric disorders such as Parkinson's Disease, Huntington's Chorea, schizophrenia, alcoholism and stroke. In our first effort to provide PET ligands for the NMDA/glycine site, we reported the synthesis of a novel high affinity glycine site ligand, 3-[2-[(3-methoxyphenylamino)carbonyl]ethenyl]-4,6-dichloroindole-2 -carboxylic acid ((3MPICA), Ki=4.8±0.9 nM) and the corresponding carbon-11 labeled PET ligand, [ 11 C]3MPICA. We report here the in vivo evaluation of [ 11 C]3MPICA in rats. Biodistribution analysis revealed that [ 11 C]3MPICA exhibited low degree of brain penetration and high blood concentration. The average uptake at two minutes was highest in the cerebellum (0.19±0.04 %ID/g) and thalamus (0.18±0.05 %ID/g) and lower in the hippocampus (0.13±0.03) and frontal cortex (0.11±0.04 %ID/g). The radioactivity cleared quickly from all brain regions examined. Administration of unlabeled 3MPICA (1 mg/kg, i.v.) revealed at 60 minutes a small general reduction in regional brain radioactivity concentrations in treated animals versus controls, however, the blood radioactivity concentration was also lowered, confounding the assessment of the degree of saturable binding. Warfarin co-administration (100 mg/kg, i.v.) significantly lowered blood activity at 5 minutes post-injection (-27%, P 11 C]3MPICA does not appear to be a promising PET radiotracer for in vivo use

Dicty_cDB: FC-BS09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BS09 (Link to dictyBase) - - - Contig-U16215-1 FC-BS09Z (Li...nk to Original site) - - FC-BS09Z 626 - - - - Show FC-BS09 Library FC (Link to library) Clone ID FC-BS09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS09Q.Seq.d/ Representative seq. ID FC-BS...09Z (Link to Original site) Representative DNA sequence >FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS09Q.Seq....ignments: (bits) Value SSF360 (SSF360Q) /CSM/SS/SSF3-C/SSF360Q.Seq.d/ 854 0.0 FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS

Human GLTP and mutant forms of ACD11 suppress cell death in the Arabidopsis acd11 mutant

DEFF Research Database (Denmark)

Petersen, Nikolaj H T; McKinney, Lea V; Pike, Helen

2008-01-01

The Arabidopsis acd11 mutant exhibits runaway, programmed cell death due to the loss of a putative sphingosine transfer protein (ACD11) with homology to mammalian GLTP. We demonstrate that transgenic expression in Arabidopsis thaliana of human GLTP partially suppressed the phenotype of the acd11...

33 CFR 151.09 - Applicability.

Science.gov (United States)

2010-07-01

....09 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION... Pertains to Pollution from Ships Oil Pollution § 151.09 Applicability. (a) Except as provided in paragraph... the United States and is certificated for ocean service; (3) Is operated under the authority of the...

Strikingly different penetrance of LHON in two Chinese families with primary mutation G11778A is independent of mtDNA haplogroup background and secondary mutation G13708A

Energy Technology Data Exchange (ETDEWEB)

Wang Huawei [Key Laboratory of Animal Models and Human Disease Mechanisms, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming 650223 (China)]|[Laboratory for Conservation and Utilization of Bio-resource, Yunnan University, Kunming 650091 (China); Jia Xiaoyun; Ji Yanli [State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou 510060 (China); Kong Qingpeng [State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Zhang Qingjiong [State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou 510060 (China)], E-mail: qingjiongzhang@yahoo.com; Yao Yonggang [Key Laboratory of Animal Models and Human Disease Mechanisms, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming 650223 (China)]|[State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China)], E-mail: ygyaozh@yahoo.com; Zhang Yaping [Laboratory for Conservation and Utilization of Bio-resource, Yunnan University, Kunming 650091 (China)]|[State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China)

2008-08-25

The penetrance of Leber's hereditary optic neuropathy (LHON) in families with primary mitochondrial DNA (mtDNA) mutations is very complex. Matrilineal and nuclear genetic background, as well as environmental factors, have been reported to be involved in different affected pedigrees. Here we describe two large Chinese families that show a striking difference in the penetrance of LHON, in which 53.3% and 15.0% of members were affected (P < 0.02), respectively. Analysis of the complete mtDNA genome of the two families revealed the presence of the primary mutation G11778A and several other variants suggesting the same haplogroup status G2a. The family with higher penetrance contained a previously described secondary mutation G13708A, which presents a polymorphism in normal Chinese samples and does not affect in vivo mitochondrial oxidative metabolism as described in a previous study. Evolutionary analysis failed to indicate any putatively pathogenic mutation that cosegregated with G11778A in these two pedigrees. Our results suggest that the variable penetrance of LHON in the two Chinese families is independent of both their mtDNA haplotype background and a secondary mutation G13708A. As a result, it is likely that unknown nuclear gene involvement and/or other factors contribute to the strikingly different penetrance of LHON.

Dicty_cDB: FC-AI09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-AI09 (Link to dictyBase) - - - Contig-U16149-1 FC-AI09Z (Li...nk to Original site) - - FC-AI09Z 591 - - - - Show FC-AI09 Library FC (Link to library) Clone ID FC-AI09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AI/FC-AI09Q.Seq.d/ Representative seq. ID FC-AI...09Z (Link to Original site) Representative DNA sequence >FC-AI09 (FC-AI09Q) /CSM/FC/FC-AI/FC-AI09Q.Seq....*tkl ik*ilifykiknnkkkkkk Frame B: ---gt*kvpeflailfkrmasrsvlwy*rcltkakkglkapqtltik

[Outdoor activity and myopia among 681 primary students in urban and rural regions of Beijing].

Science.gov (United States)

Guo, Yin; Liu, Lijuan; Xu, Liang; Lü, Yanyun; Tang, Ping; Feng, Yi

2014-01-21

To explore the association between outdoor activity and myopia among 681 primary students from Beijing. School-based, cross-sectional investigation. Eye examination includes the visual acuity test, auto-refractor, slit lamp, ocular biometry and non-mydriatic fundus camera. Questionnaire includes regular items, near work, outdoor activity and social-economic status. The mean time spent outdoors was 1.6 ± 0.8 hours daily. Time spent on outdoor sports and outdoor leisure were 0.7 ± 0.1 hours daily, 1.0 ± 0.8 hours daily, respectively. Mean time of outdoor activity in urban was 1.1 ± 0.4 hours daily, compared with 2.2 ± 0.8 hours daily in rural (P = 0.000). In grade-1, total time spent outdoors is significantly different between myopia and non-myopia (1.4 ± 0.6 vs 1.8 ± 0.8 hours daily, P = 0.000), similar to outdoor leisure (0.8 ± 0.6 vs 1.1 ± 0.9 hours daily, P = 0.000). The same trend was also found in grade-4. The mean time spent outdoors was 1.6 ± 0.8 hours daily. Myopia spent a lower outdoor activity compared with non-myopia. More outdoor activity, e.g., in schools, may potentially be helpful to reduce the high prevalence of myopia in the young generation.

Partial and apparent molar volumes of aqueous solutions of the 1:1 type electrolytes

International Nuclear Information System (INIS)

Klugman, I.Yu.

2002-01-01

Formulas for calculating partial and apparent molar volumes of MX (M=Li-Cs; X = Cl-I) electrolyte aqueous solutions in a wide range of concentrations from 0 to 4 mol/kg with error not in excess of 0.05% are suggested. It is shown that the previously employed formulas for calculating partial molar volumes of electrolytes give false indications of mutual effect of ions and actually they are fit solely for very small concentrations [ru

Performance of RC columns with partial length corrosion

International Nuclear Information System (INIS)

Wang Xiaohui; Liang Fayun

2008-01-01

Experimental and analytical studies on the load capacity of reinforced concrete (RC) columns with partial length corrosion are presented, where only a fraction of the column length was corroded. Twelve simply supported columns were eccentrically loaded. The primary variables were partial length corrosion in tensile or compressive zone and the corrosion level within this length. The failure of the corroded column occurs in the partial length, mainly developed from or located nearby or merged with the longitudinal corrosion cracks. For RC column with large eccentricity, load capacity of the column is mainly influenced by the partial length corrosion in tensile zone; while for RC column with small eccentricity, load capacity of the column greatly decreases due to the partial length corrosion in compressive zone. The destruction of the longitudinally mechanical integrality of the column in the partial length leads to this great reduction of the load capacity of the RC column

Windshear Case Study: Denver, Colorado, July 11, 1988

Science.gov (United States)

1989-11-01

04/03/88 JR) GTF 1850 120 SC.T 250 -OVC: 45 032/83/40/n7/973/TC -.W 04COAS NE-E AND SW-NW GTF 1750 200 -SCT 250 -OVC 45 041/81/48/1306/?76/ ACCAS NE...2104/96) P: WND ; 000 /WSHFT 04 ACCAS S+W RS 1848 ----------------- ENROLITE TERMINAL FORECASTS:----------------- OMA FT11 111717 80 SCT 250 -BKN...Llvina TZz:i - 17 2 I / WPOMI 07/11/10 )ffZ=: 22:09:0@ @ ffM : 22: 09: 0 me! up or:p or -0 SA MR a I,92 - - , . va://94 7t2 18i1:S OA~tR 07/1/m w MInqu

A comparison of five partial volume correction methods for Tau and Amyloid PET imaging with [18F]THK5351 and [11C]PIB.

Science.gov (United States)

Shidahara, Miho; Thomas, Benjamin A; Okamura, Nobuyuki; Ibaraki, Masanobu; Matsubara, Keisuke; Oyama, Senri; Ishikawa, Yoichi; Watanuki, Shoichi; Iwata, Ren; Furumoto, Shozo; Tashiro, Manabu; Yanai, Kazuhiko; Gonda, Kohsuke; Watabe, Hiroshi

2017-08-01

To suppress partial volume effect (PVE) in brain PET, there have been many algorithms proposed. However, each methodology has different property due to its assumption and algorithms. Our aim of this study was to investigate the difference among partial volume correction (PVC) method for tau and amyloid PET study. We investigated two of the most commonly used PVC methods, Müller-Gärtner (MG) and geometric transfer matrix (GTM) and also other three methods for clinical tau and amyloid PET imaging. One healthy control (HC) and one Alzheimer's disease (AD) PET studies of both [ 18 F]THK5351 and [ 11 C]PIB were performed using a Eminence STARGATE scanner (Shimadzu Inc., Kyoto, Japan). All PET images were corrected for PVE by MG, GTM, Labbé (LABBE), Regional voxel-based (RBV), and Iterative Yang (IY) methods, with segmented or parcellated anatomical information processed by FreeSurfer, derived from individual MR images. PVC results of 5 algorithms were compared with the uncorrected data. In regions of high uptake of [ 18 F]THK5351 and [ 11 C]PIB, different PVCs demonstrated different SUVRs. The degree of difference between PVE uncorrected and corrected depends on not only PVC algorithm but also type of tracer and subject condition. Presented PVC methods are straight-forward to implement but the corrected images require careful interpretation as different methods result in different levels of recovery.

Radiative muon capture on Al, Si, Ca, Mo, Sn, and Pb

International Nuclear Information System (INIS)

Armstrong, D.S.; Serna-Angel, A.; Ahamad, S.

1992-08-01

The branching ratio for radiative muon capture relative to the non-radiative process, is sensitive to g p , the induced pseudoscalar coupling constant of the weak hadronic current. The photon energy spectra from RMC on 27 Al, 28 Si, 40 Ca, nat Mo, nat Sn, and nat Pb have been measured using a high-acceptance pair spectrometer. The measured partial branching ratios, R γ , for photons of E γ > 57 MeV are 1.43 ± 0.13, 1.93 ± 0.18, 2.09 ± 0.19, 1.11 ± 0.11, 0.98 ± 0.09 and 0.60 ± 0.07 respectively, in units of 10 -5 . The results confirm the previously observed suppression of R γ with increasing Z for Z > 20. For 40 Ca the present result is in good agreement with previous measurements. For the heavier nuclei, the results are compared with two recent calculations performed in the Fermi-gas model. In one case the data indicate a complete quenching of g p , but the more recent calculation does not reproduce the data for any value of g p . 50 refs., 9 figs., 8 tabs

Radiative muon capture on Al, Si, Ca, Mo, Sn, and Pb

International Nuclear Information System (INIS)

Armstrong, D.S.; Serna-Angel, A.; Ahmad, S.; Azuelos, G.; Bertl, W.; Blecher, M.; Chen, C.Q.; Depommier, P.; von Egidy, T.; Gorringe, T.P.; Hasinoff, M.D.; Henderson, R.S.; Larabee, A.J.; Macdonald, J.A.; McDonald, S.C.; Poutissou, J.; Poutissou, R.; Robertson, B.C.; Sample, D.G.; Taylor, G.N.; Wright, D.H.; Zhang, N.S.

1992-01-01

The branching ratio for radiative muon capture (RMC), relative to the nonradiative process, is sensitive to g p , the induced pseudoscalar coupling constant of the weak hadronic current. The photon energy spectra from RMC on 27 Al, 28 Si, 40 Ca, nat Mo, nat Sn, and nat Pb have been measured using a high-acceptance pair spectrometer. The measured partial branching ratios, R γ , for photons of E γ >57 MeV are 1.43±0.13, 1.93±0.18, 2.09±0.19, 1.11±0.11, 0.98±0.09, and 0.60±0.07 respectively, in units of 10 -5 . The results confirm the previously observed suppression of R γ with increasing Z for Z>20. For 40 Ca the present result is in good agreement with previous measurements. For the heavier nuclei, the results are compared with two recent calculations performed in the Fermi-gas model. In one case the data indicate a complete quenching of g p , but the more recent calculation does not reproduce the data for any value of g p

Neuronal RING finger protein 11 (RNF11 regulates canonical NF-κB signaling

Directory of Open Access Journals (Sweden)

Pranski Elaine L

2012-04-01

Full Text Available Abstract Background The RING domain-containing protein RING finger protein 11 (RNF11 is a member of the A20 ubiquitin-editing protein complex and modulates peripheral NF-κB signaling. RNF11 is robustly expressed in neurons and colocalizes with a population of α-synuclein-positive Lewy bodies and neurites in Parkinson disease patients. The NF-κB pathway has an important role in the vertebrate nervous system, where the absence of NF-κB activity during development can result in learning and memory deficits, whereas chronic NF-κB activation is associated with persistent neuroinflammation. We examined the functional role of RNF11 with respect to canonical NF-κB signaling in neurons to gain understanding of the tight association of inflammatory pathways, including NF-κB, with the pathogenesis of neurodegenerative diseases. Methods and results Luciferase assays were employed to assess NF-κB activity under targeted short hairpin RNA (shRNA knockdown of RNF11 in human neuroblastoma cells and murine primary neurons, which suggested that RNF11 acts as a negative regulator of canonical neuronal NF-κB signaling. These results were further supported by analyses of p65 translocation to the nucleus following depletion of RNF11. Coimmunoprecipitation experiments indicated that RNF11 associates with members of the A20 ubiquitin-editing protein complex in neurons. Site-directed mutagenesis of the myristoylation domain, which is necessary for endosomal targeting of RNF11, altered the impact of RNF11 on NF-κB signaling and abrogated RNF11’s association with the A20 ubiquitin-editing protein complex. A partial effect on canonical NF-κB signaling and an association with the A20 ubiquitin-editing protein complex was observed with mutagenesis of the PPxY motif, a proline-rich region involved in Nedd4-like protein interactions. Last, shRNA-mediated reduction of RNF11 in neurons and neuronal cell lines elevated levels of monocyte chemoattractant protein 1 and

Summer Students

CERN Multimedia

2005-01-01

SUMMER STUDENT LECTURE PROGRAMME Main Auditorium, bldg. 500 DATE TIME LECTURER TITLE Monday 1 August 09:15 - 10:00 P. WELLS The Higgs Saga at LEP 10:15 - 11:00 E. KIRITSIS Beyond the Standard Model (1/4) 11:15 - 12:00 G. COWAN Introduction to Statistics (1/3) 12:00 Discussion Session Tuesday 2 August 09:15 - 11:00 E. KIRITSIS Beyond the Standard Model (2-3/4) 11:15 - 12:00 G. COWAN Introduction to Statistics (2/3) 12:00 Discussion Session Wednesday 3 August 09:15 - 10:00 G. COWAN Introduction to Statistics (3/3) 10:15 - 11:00 E. KIRITSIS Beyond the Standard Model (4/4) 11:15 - 12:00 K. JAKOBS Physics at Hadronic Colliders (1/4) 12:00 Discussion Session Thursday 4 August 09:15 - 11:00 K. JAKOBS Physics at Hadronic Colliders (2-3/4) 11:15 - 12:00 A. WEINSTEIN Gravitation Waves 12:00 Discussion Session 16:30 - 18:00 Poster Session Friday 5 August 09:15 - 11:00 A. Höcker CP Violation (1-2/4) 11:15 - 12:00 K. JA...

Evaluation of brain and whole-body pharmacokinetics of 11C-labeled diphenylhydantoin in rats by means of planar positron imaging system

International Nuclear Information System (INIS)

Hasegawa, Yukinori; Kanai, Yasukazu; Hasegawa, Shinji; Shimosegawa, Eku; Kurachi, Yoshihisa; Hatazawa, Jun; Okamoto, Takashi; Matsui, Tamiko

2008-01-01

A planar positron imaging system (PPIS) enables whole-body dynamic imaging of radiopharmaceuticals labeled with positron-emitting nuclides. We evaluated the difference in the brain and whole-body pharmacokinetics of 11 C-diphenylhydantoin ( 11 C-DPH) between intravenous and duodenal administration in rats. Male Wistar rats (8 weeks old, mean body weight 250 g) were examined under anesthesia. A tracer amount of 11 C-DPH (2 μg or less; about 5 MBq) was injected into the tail vein (n=3) or duodenum (n=3). Immediately following the administration, PPIS scans were obtained for 20 min. Regions of interest (ROIs) were set on the brain, heart, liver, intestinal field, and urinary bladder, identified on the integrated images. The relative uptake value (RUV, %) was calculated as the regional count divided by the whole-body count multiplied by 100. Sequential changes in the RUV for each ROI were analyzed for the brain and other organs. Following intravenous injection of 11 C-DPH, the RUV in the brain was 1.59±0.07%, 1.53±0.09%, 1.40±0.09%, and 1.38±0.08% at 5 min, 10 min, 15 min, and 20 min after the injection, respectively. After duodenal administration, the corresponding values were 0.54±0.16%, 1.01±0.12%, 1.43±0.24%, and 1.52±0.06%, respectively. The 11 C-DPH distribution was significantly lower at 5 min and 10 min following duodenal administration than after intravenous injection (P 11 C-DPH between intravenous and duodenal administration in rats. Use of the PPIS is feasible for the evaluation of the pharmacokinetics in both the target organ and the whole body in small animals. (author)

Plasminogen activator inhibitor-1 5G/5G genotype is associated with early spontaneous recanalization of the infarct-related artery in patients presenting with acute ST-elevation myocardial infarction.

Science.gov (United States)

Cagliyan, Caglar E; Yuregir, Ozge O; Balli, Mehmet; Tekin, Kamuran; Akilli, Rabia E; Bozdogan, Sevcan T; Turkmen, Serdar; Deniz, Ali; Baykan, Oytun A; Aslan, Huseyin; Cayli, Murat

2013-05-01

We aimed to examine the association between plasminogen activator inhibitor-1 (PAI-1) genetic polymorphism and early spontaneous recanalization in patients presenting with acute ST-elevation myocardial infarction. Patients admitted to our emergency department with ST-elevation myocardial infarction in the first 6 h of symptom onset were included. An immediate primary percutaneous coronary intervention was performed. Patients were grouped according to the initial patency of the infarct-related artery (IRA) as follows: total occlusion (TO) group [Thrombolysis in Myocardial Infarction (TIMI) 0-1 flow in the IRA], partial recanalization group (TIMI 2 flow in the IRA), and complete recanalization (CR) group (TIMI 3 flow in the IRA). PAI-1 4G/5G polymorphism was detected using the real-time PCR method. There were 107 patients in the TO group, 30 patients in the partial recanalization group, and 45 patients in the CR group. When we evaluated degrees of patency according to the PAI-1 genotype, TO of the IRA was the highest in patients with the PAI 4G/4G genotype (PAI-1 4G/4G: 66.7%, PAI-1 4G/5G: 65.9%, PAI-1 5G/5G: 40.4%) and CR of the IRA was the highest in patients with the PAI 5G/5G genotype (PAI-1 5G/5G: 38.5%, PAI-1 4G/5G: 19.8%, PAI-1 4G/4G: 17.9%). The distribution of genotypes in different degrees of patency of IRA was statistically significant (P=0.029). In logistic regression analysis, the PAI-1 5G/5G genotype was associated independently with the spontaneous CR of the IRA (odds ratio: 2.875, 95% confidence interval [1.059-7.086], P=0.038). Patients with the PAI-1 5G/5G genotype seem to be luckier than others in terms of early spontaneous recanalization of the IRA. Further prospective studies with large patient populations are required for more precise results.

Multimodal Robots As Educational Tools In Primary And Lower Secondary Education

DEFF Research Database (Denmark)

Majgaard, Gunver

2015-01-01

Multimodal humanoid robots have been used as educational tools in primary and lower secondary schools. The pupils involved were between 11 and 16 years old. The learning goals included: programming, language learning, ethics, technology and mathematics, e.g. practised by 7th grade pupils who...

11 CFR 105.1 - Place of filing; House candidates and their authorized committees (2 U.S.C. 432(g)(1)).

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Place of filing; House candidates and their authorized committees (2 U.S.C. 432(g)(1)). 105.1 Section 105.1 Federal Elections FEDERAL ELECTION COMMISSION GENERAL DOCUMENT FILING (2 U.S.C. 432(g)) § 105.1 Place of filing; House candidates and their authorized...

An immunocapture/scintillation proximity analysis of G alpha q/11 activation by native serotonin (5-HT)2A receptors in rat cortex: blockade by clozapine and mirtazapine.

Science.gov (United States)

Mannoury La Cour, C; Chaput, C; Touzard, M; Millan, M J

2009-02-01

Though transduction mechanisms recruited by heterologously expressed 5-HT(2A) receptors have been extensively studied, their interaction with specific subtypes of G-protein remains to be directly evaluated in cerebral tissue. Herein, as shown by an immunocapture/scintillation proximity analysis, 5-HT, the prototypical 5-HT(2A) agonist, DOI, and Ro60,0175 all enhanced [(35)S]GTPgammaS binding to G alpha q/11 in rat cortex with pEC(50) values of 6.22, 7.24 and 6.35, respectively. No activation of G o or G s/olf was seen at equivalent concentrations of DOI. Stimulation of G alpha q/11 by 5-HT (30 microM) and DOI (30 microM) was abolished by the selective 5-HT(2A) vs. 5-HT(2C)/5-HT(2B) antagonists, ketanserin (pK(B) values of 9.11 and 8.88, respectively) and MDL100,907 (9.82 and 9.68). By contrast, 5-HT-induced [(35)S]GTPgammaS binding to G alpha q/11 was only weakly inhibited by the preferential 5-HT(2C) receptor antagonists, RS102,221 (6.94) and SB242,084 (7.39), and the preferential 5-HT(2B) receptor antagonist, LY266,097 (6.66). The antipsychotic, clozapine, which had marked affinity for 5-HT(2A) receptors, blocked the recruitment of G alpha q/11 by 5-HT and DOI with pK(B) values of 8.54 and 8.14, respectively. Its actions were mimicked by the "atypical" antidepressant and 5-HT(2A) receptor antagonist, mirtazapine, which likewise blocked 5-HT and DOI-induced G alpha q/11 protein activation with pK(B) values of 7.90 and 7.76, respectively. In conclusion, by use of an immunocapture/scintillation proximity strategy, this study shows that native 5-HT(2A) receptors in rat frontal cortex specifically recruit G alpha q/11 and that this action is blocked by clozapine and mirtazapine. Quantification of 5-HT(2A) receptor-mediated G alpha q/11 activation in frontal cortex should prove instructive in characterizing the actions of diverse classes of psychotropic agent. 2008 Wiley-Liss, Inc.

Summer Student Programme

CERN Multimedia

2006-01-01

Date Time Title Speaker 17/07/2006 09:15 - 11:00 Fundamental concepts in Particle Physics (1-2/6) G. ROSS 11:15 - 12:00 Astroparticle Physics (1/3) N. PALANQUE-DELABROUILLE 12:00 Discussion Session 18/07/2006 09:15 - 10:00 Fundamental concepts in Particle Physics (3/6) G. ROSS 10:15 - 12:00 Astroparticle Physics (2-3/3) N. PALANQUE-DELABROUILLE 12:00 Discussion Session 19/07/2006 09:15 - 10:00 Fundamental concepts in Particle Physics (4/6) G. ROSS 10:15 - 11:00 Neutrino Physics (1/4) J-J. GOMEZ-CADENAS 11:15 - 12:00 Seminar on LHC upgrade A. DE ROECK 12:00 Discussion Session 20/07/2006 09:15 - 10:00 Fundamental concepts in Particle Physics (5/6) G. ROSS 10:15 - 12:00 Neutrino Physics (2-3/4) J-J. GOMEZ-CADENAS 12:00 Discussion Session 21/07/2006 09:15 - 10:00 Fundamental concepts in Particle Physics (6/6) G. ROSS 10:15 - 11:00 The Standard Model (1/8) A. PICH 11:15 - 12:00 Neutrino Physics (4/4) J-J. GOMEZ-CADENAS 12:00 Discussion Session Date T...

Imaging primary prostate cancer with 11C-Choline PET/CT: relation to tumour stage, Gleason score and biomarkers of biologic aggressiveness

International Nuclear Information System (INIS)

Chen, Ji; Zhao, Yong; Li, Xin; Sun, Peng; Wang, Muwen; Wang, Ridong; Jin, Xunbo

2012-01-01

As a significant overlap of 11C-Choline standardized uptake value (SUV) between prostate cancer and benign prostate hyperplasia (BPH) tissue, controversy exists regarding the clinical value of 11C-Choline PET/CT scan in primary prostate cancer. In this study, the SUVmax of the prostate lesions and the pelvic muscles were measured and their ratios (SUVmax-P/M ratio) were calculated. Then we evaluated whether the tracer 11C-Choline uptake, quantified as SUVmax-P/M ratio, correlated with tumour stage, Gleason score, and expression levels of several biomarkers of aggressiveness. Twenty-six patients with primary prostate cancer underwent 11C-Choline PET/CT. Tumour specimens from these patients were graded histopathologically, and immunnohistochemistry for Ki-67, CD31, androgen receptor (AR), Her-2/neu, Bcl-2, and PTEN were performed. Both SUVmax and SUVmax-P/M ratio showed no significant difference between patients with tumour stage II and III, but significantly elevated in patients with tumour stage IV. SUVmax-P/M ratio was also significantly higher in lesions with Gleason score of 4+3 or higher versus less than or equal to 3+4. SUVmax-P/M ratio was found significantly correlated with expression levels of Ki-67 and CD31. In addition, a higher SUVmax-P/M ratio was demonstrated in Her-2/neu positive subgroup than negative subgroup. At the same time, Gleason score and expression levels of these biomarkers showed no significant association with SUVmax. Using the parameter SUVmax-P/M ratio, 11C-Choline PET/CT may be a valuable non-invasive imaging technology in the diagnosis of primary prostate cancer

SEMICONDUCTOR INTEGRATED CIRCUITS 8.64-11.62 GHz CMOS VCO and divider in a zero-IF 802.11a/b/g WLAN and Bluetooth application

Science.gov (United States)

Yu, Sun; Niansong, Mei; Bo, Lu; Yumei, Huang; Zhiliang, Hong

2010-10-01

A fully integrated VCO and divider implemented in SMIC 0.13-μm RFCMOS 1P8M technology with a 1.2 V supply voltage is presented. The frequency of the VCO is tuning from 8.64 to 11.62 GHz while the quadrature LO signals for 802.11a WLAN in 5.8 GHz band or for 802.11b/g WLAN and Bluetooth in 2.4 GHz band can be obtained by a frequency division by 2 or 4, respectively. A 6 bit switched capacitor array is applied for precise tuning of all necessary frequency bands. The testing results show that the VCO has a phase noise of—113 dBc @ 1 MHz offset from the carrier of 5.5 GHz by dividing VCO output by two and the VCO core consumes 3.72 mW. The figure-of-merit for the tuning-range (FOMT) of the VCO is -192.6 dBc/Hz.

Selective attenuation of norepinephrine release and stress-induced heart rate increase by partial adenosine A1 agonism.

Directory of Open Access Journals (Sweden)

Lorenz Bott-Flügel

Full Text Available The release of the neurotransmitter norepinephrine (NE is modulated by presynaptic adenosine receptors. In the present study we investigated the effect of a partial activation of this feedback mechanism. We hypothesized that partial agonism would have differential effects on NE release in isolated hearts as well as on heart rate in vivo depending on the genetic background and baseline sympathetic activity. In isolated perfused hearts of Wistar and Spontaneously Hypertensive Rats (SHR, NE release was induced by electrical stimulation under control conditions (S1, and with capadenoson 6 · 10(-8 M (30 µg/l, 6 · 10(-7 M (300 µg/l or 2-chloro-N(6-cyclopentyladenosine (CCPA 10(-6 M (S2. Under control conditions (S1, NE release was significantly higher in SHR hearts compared to Wistar (766+/-87 pmol/g vs. 173+/-18 pmol/g, p<0.01. Capadenoson led to a concentration-dependent decrease of the stimulation-induced NE release in SHR (S2/S1  =  0.90 ± 0.08 with capadenoson 6 · 10(-8 M, 0.54 ± 0.02 with 6 · 10(-7 M, but not in Wistar hearts (S2/S1  =  1.05 ± 0.12 with 6 · 10(-8 M, 1.03 ± 0.09 with 6 · 10(-7 M. CCPA reduced NE release to a similar degree in hearts from both strains. In vivo capadenoson did not alter resting heart rate in Wistar rats or SHR. Restraint stress induced a significantly greater increase of heart rate in SHR than in Wistar rats. Capadenoson blunted this stress-induced tachycardia by 45% in SHR, but not in Wistar rats. Using a [(35S]GTPγS assay we demonstrated that capadenoson is a partial agonist compared to the full agonist CCPA (74+/-2% A(1-receptor stimulation. These results suggest that partial adenosine A(1-agonism dampens stress-induced tachycardia selectively in rats susceptible to strong increases in sympathetic activity, most likely due to a presynaptic attenuation of NE release.

Pandemic vaccination strategies and influenza severe outcomes during the influenza A(H1N1)pdm09 pandemic and the post-pandemic influenza season

DEFF Research Database (Denmark)

Gil Cuesta, Julita; Aavitsland, Preben; Englund, Hélène

2016-01-01

During the 2009/10 influenza A(H1N1)pdm09 pandemic, the five Nordic countries adopted different approaches to pandemic vaccination. We compared pandemic vaccination strategies and severe influenza outcomes, in seasons 2009/10 and 2010/11 in these countries with similar influenza surveillance...... systems. We calculated the cumulative pandemic vaccination coverage in 2009/10 and cumulative incidence rates of laboratory confirmed A(H1N1)pdm09 infections, intensive care unit (ICU) admissions and deaths in 2009/10 and 2010/11. We estimated incidence risk ratios (IRR) in a Poisson regression model...... with the other countries. In 2010/11 Denmark had a significantly higher cumulative incidence of A(H1N1)pdm09 ICU admissions (IRR: 2.4; 95% confidence interval (CI): 1.9-3.0) and deaths (IRR: 8.3; 95% CI: 5.1-13.5). Compared with Denmark, the other countries had higher pandemic vaccination coverage...

ENVIRONMENTAL TECHNOLOGY VERIFICATION REPORT. STORMWATER SOURCE AREA TREATMENT DEVICE. THE TERRE HILL CONCRETE PRODUCTS TERRE KLEEN™ 09

Science.gov (United States)

Verification testing of the Terre Hill Concrete Products Terre Kleen™ 09 was conducted on a 1.27 acre portion of the City of Harrisburg, Pennsylvania Department of Public Works facility. The Terre Kleen™ devices combines primary and secondary chambers, baffles, a screen, and incl...

Current meter components and other data from FIXED PLATFORMS from 1977-11-09 to 1990-02-20 (NODC Accession 9300129)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Current meter components data were collected from FIXED PLATFORMS from 09 November 1977 to 20 February 1990. Data were collected by the Maritime Safety Agency;...

Altered response to A(H1N1)pnd09 vaccination in pregnant women

DEFF Research Database (Denmark)

Bischoff, Anne Louise; Følsgaard, Nilofar Vahman; Carson, Charlotte Giwercman

2013-01-01

BACKGROUND: Pregnant women were suspected to be at particular risk when H1N1pnd09 influenza became pandemic in 2009. Our primary objective was to compare the immune responses conferred by MF59®-adjuvanted vaccine (Focetria®) in H1N1pnd09-naïve pregnant and non-pregnant women. The secondary aims...... were to compare influences of dose and adjuvant on the immune response. METHODS: The study was nested in the Copenhagen Prospective Studies on Asthma in Childhood (COPSAC2010) pregnancy cohort in 2009-2010 and conducted as a single-blinded block-randomised [1∶1∶1] controlled clinical trial in pregnant...... women after gestational week 20: (1) 7.5 µg H1N1pnd09 antigen with MF59-adjuvant (Pa7.5 µg); (2) 3.75 µg antigen half MF59-adjuvanted (Pa3.75 µg); (3) 15 µg antigen unadjuvanted (P15 µg); and in non-pregnant women receiving (4) 7.5 µg antigen full adjuvanted (NPa7.5 µg). Blood samples were collected...

Retinal genes are differentially expressed in areas of primary versus secondary degeneration following partial optic nerve injury.

Directory of Open Access Journals (Sweden)

Wissam Chiha

Full Text Available Partial transection (PT of the optic nerve is an established experimental model of secondary degeneration in the central nervous system. After a dorsal transection, retinal ganglion cells (RGCs with axons in ventral optic nerve are intact but vulnerable to secondary degeneration, whereas RGCs in dorsal retina with dorsal axons are affected by primary and secondary injuries. Using microarray, we quantified gene expression changes in dorsal and ventral retina at 1 and 7 days post PT, to characterize pathogenic pathways linked to primary and secondary degeneration.In comparison to uninjured retina Cryba1, Cryba2 and Crygs, were significantly downregulated in injured dorsal retina at days 1 and 7. While Ecel1, Timp1, Mt2A and CD74, which are associated with reducing excitotoxicity, oxidative stress and inflammation, were significantly upregulated. Genes associated with oxygen binding pathways, immune responses, cytokine receptor activity and apoptosis were enriched in dorsal retina at day 1 after PT. Oxygen binding and apoptosis remained enriched at day 7, as were pathways involved in extracellular matrix modification. Fewer changes were observed in ventral retina at day 1 after PT, most associated with the regulation of protein homodimerization activity. By day 7, apoptosis, matrix organization and signal transduction pathways were enriched. Discriminant analysis was also performed for specific functional gene groups to compare expression intensities at each time point. Altered expression of selected genes (ATF3, GFAP, Ecel1, TIMP1, Tp53 and proteins (GFAP, ECEL1 and ATF3 were semi-quantitatively assessed by qRT-PCR and immunohistochemistry respectively.There was an acute and complex primary injury response in dorsal retina indicative of a dynamic interaction between neuroprotective and neurodegenerative events; ventral retina vulnerable to secondary degeneration showed a delayed injury response. Both primary and secondary injury resulted in the

COMMUNITY MEDICINE & PRIMARY HEALTH CARE

African Journals Online (AJOL)

ajiboro

... Experience in a primary health care facility in Rivers State, South-South Nigeria. ... health center increased by 3.09% (p-value > 0.05); the patients that had their babies in the facility were ... 100, 000 live births, based on historical studies and.

Absolute partial photoionization cross sections of ethylene

Science.gov (United States)

Grimm, F. A.; Whitley, T. A.; Keller, P. R.; Taylor, J. W.

1991-07-01

Absolute partial photoionization cross sections for ionization out of the first four valence orbitals to the X 2B 3u, A 2B 3g, B 2A g and C 2B 2u states of the C 2H 4+ ion are presented as a function of photon energy over the energy range from 12 to 26 eV. The experimental results have been compared to previously published relative partial cross sections for the first two bands at 18, 21 and 24 eV. Comparison of the experimental data with continuum multiple scattering Xα calculations provides evidence for extensive autoionization to the X 2B 3u state and confirms the predicted shape resonances in ionization to the A 2B 3g and B 2A g states. Identification of possible transitions for the autoionizing resonances have been made using multiple scattering transition state calculations on Rydberg excited states.

Dopamine D2 receptor radiotracers [11C](+)-PHNO and [3H]raclopride are indistinguishably inhibited by D2 agonists and antagonists ex vivo

International Nuclear Information System (INIS)

McCormick, Patrick N.; Kapur, Shitij; Seeman, Philip; Wilson, Alan A.

2008-01-01

Introduction: In vitro, the dopamine D2 receptor exists in two states, with high and low affinity for agonists. The high-affinity state is the physiologically active state thought to be involved in dopaminergic illnesses such as schizophrenia. The positron emission tomography radiotracer [ 11 C](+)-PHNO ([ 11 C](+)-4-propyl-3,4,4a,5,6,10b-hexahydro-2H-naphtho[1,2-b][1,4] oxazin-9-o l), being a D2 agonist, should selectively label the high-affinity state at tracer dose and therefore be more susceptible to competition by agonist as compared to the antagonist [ 3 H]raclopride, which binds to both affinity states. Methods: We tested this prediction using ex vivo dual-radiotracer experiments in conscious rats. D2 antagonists (haloperidol or clozapine), a partial agonist (aripiprazole), a full agonist [(-)-NPA] or the dopamine-releasing drug amphetamine (AMPH) were administered to rats prior to an intravenous coinjection of [ 11 C](+)-PHNO and [ 3 H]raclopride. Rats were sacrificed 60 min after radiotracer injection. Striatum, cerebellum and plasma samples were counted for 11 C and 3 H. The specific binding ratio {SBR, i.e., [%ID/g (striatum)-%ID/g (cerebellum)]/(%ID/g (cerebellum)} was used as the outcome measure. Results: In response to D2 antagonists, partial agonist or full agonist, [ 11 C](+)-PHNO and [ 3 H]raclopride SBRs responded indistinguishably in terms of both ED 50 and Hill slope (e.g., (-)-NPA ED 50 values are 0.027 and 0.023 mg/kg for [ 11 C](+)-PHNO and [ 3 H]raclopride, respectively). In response to AMPH challenge, [ 11 C](+)-PHNO and [ 3 H]raclopride SBRs were inhibited to the same degree. Conclusions: We have shown that the SBRs of [ 11 C](+)-PHNO- and [ 3 H]raclopride do not differ in their response to agonist challenge. These results do not support predictions of the in vivo binding behavior of a D2 agonist radiotracer and cast some doubt on the in vivo applicability of the D2 two-state model, as described by in vitro binding experiments

Physical, chemical, nutrient, and other data from the Gulf of California from the THOMAS G. THOMPSON as part of the International Decade of Ocean Exploration / Coastal Upwelling Ecosystems Analysis (IDOE/CUEA) from 05 March 1972 to 09 April 1972 (NODC Accession 7400405)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Physical, chemical, nutrient, and other data were collected from the Gulf of California from the THOMAS G. THOMPSON from 05 March 1972 to 09 April 1972. Data were...

Digital amateur observations of Venus at 0.9μm

Science.gov (United States)

Kardasis, E.

2017-09-01

Venus atmosphere is extremely dynamic, though it is very difficult to observe any features on it in the visible and even in the near-IR range. Digital observations with planetary cameras in recent years routinely produce high-quality images, especially in the near-infrared (0.7-1μm), since IR wavelengths are less influenced by Earth's atmosphere and Venus's atmosphere is partially transparent in this spectral region. Continuous observations over a few hours may track dark atmospheric features in the dayside and determine their motion. In this work we will present such observations and some dark-feature motion measurements at 0.9μm. Ground-based observations at this wavelength are rare and are complementary to in situ observations by JAXA's Akatsuki orbiter, that studies the atmospheric dynamics of Venus also in this band with the IR1 camera.

Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, Coulometer for DIC measurement and other instruments from the MIRAI in the Arctic Ocean and Beaufort Sea from 1999-09-11 to 1999-10-05 (NODC Accession 0112350)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0112350 includes chemical, discrete sample, physical and profile data collected from MIRAI in the Arctic Ocean and Beaufort Sea from 1999-09-11 to...

Cross-Layer Measurement on an IEEE 802.11g Wireless Network Supporting MPEG-2 Video Streaming Applications in the Presence of Interference

Directory of Open Access Journals (Sweden)

Alessandro Sona

2010-01-01

Full Text Available The performance of wireless local area networks supporting video streaming applications, based on MPEG-2 video codec, in the presence of interference is here dealt with. IEEE 802.11g standard wireless networks, that do not support QoS in according with IEEE 802.11e standard, are, in particular, accounted for and Bluetooth signals, additive white Gaussian noise, and competitive data traffic are considered as sources of interference. The goal is twofold: from one side, experimentally assessing and correlating the values that some performance metrics assume at the same time at different layers of an IEEE 802.11g WLAN delivering video streaming in the presence of in-channel interference; from the other side, deducing helpful and practical hints for designers and technicians, in order to efficiently assess and enhance the performance of an IEEE 802.11g WLAN supporting video streaming in some suitable setup conditions and in the presence of interference. To this purpose, an experimental analysis is planned following a cross-layer measurement approach, and a proper testbed within a semianechoic chamber is used. Valuable results are obtained in terms of signal-to-interference ratio, packet loss ratio, jitter, video quality, and interference data rate; helpful hints for designers and technicians are finally gained.

Photogenic partial seizures.

Science.gov (United States)

Hennessy, M J; Binnie, C D

2000-01-01

To establish the incidence and symptoms of partial seizures in a cohort of patients investigated on account of known sensitivity to intermittent photic stimulation and/or precipitation of seizures by environmental visual stimuli such as television (TV) screens or computer monitors. We report 43 consecutive patients with epilepsy, who had exhibited a significant EEG photoparoxysmal response or who had seizures precipitated by environmental visual stimuli and underwent detailed assessment of their photosensitivity in the EEG laboratory, during which all were questioned concerning their ictal symptoms. All patients were considered on clinical grounds to have an idiopathic epilepsy syndrome. Twenty-eight (65%) patients reported visually precipitated attacks occurring initially with maintained consciousness, in some instances evolving to a period of confusion or to a secondarily generalized seizure. Visual symptoms were most commonly reported and included positive symptoms such as coloured circles or spots, but also blindness and subjective symptoms such as "eyes going funny." Other symptoms described included nonspecific cephalic sensations, deja-vu, auditory hallucinations, nausea, and vomiting. No patient reported any clear spontaneous partial seizures, and there were no grounds for supposing that any had partial epilepsy excepting the ictal phenomenology of some or all of the visually induced attacks. These findings provide clinical support for the physiological studies that indicate that the trigger mechanism for human photosensitivity involves binocularly innervated cells located in the visual cortex. Thus the visual cortex is the seat of the primary epileptogenic process, and the photically triggered discharges and seizures may be regarded as partial with secondary generalization.

XRD and HRTEM characterization of mechanosynthesized Ti{sub 0.9}W{sub 0.1}C cermet

Energy Technology Data Exchange (ETDEWEB)

Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan 713103, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India)

2013-12-25

Highlights: •Cubic Ti{sub 0.9}W{sub 0.1}C is formed after 50 min of milling of α-Ti, W and graphite powders. •Nanocrystalline Ti{sub 0.9}W{sub 0.1}C with particle size ∼11 nm is obtained after 8 h milling. •Average particle size of Ti{sub 0.9}W{sub 0.1}C from XRD analysis and HRTEM is very close. •Formation of Ti{sub 0.9}W{sub 0.1}C is hindered as compared with TiC. -- Abstract: Elemental powder mixture of titanium, tungsten and graphite is milled by high energy planetary ball mill at a fixed ball to powder mass ratio (BPMR) for different duration to produce nanosized particles of Ti{sub 0.9}W{sub 0.1}C hard metal. Microstructure characterization in terms of lattice imperfections and phase quantification of ball-milled samples has been done primarily by analyzing the XRD pattern and employing Rietveld method of structure and microstructure refinement. After 8 h of ball-milling full formation of Ti{sub 0.9}W{sub 0.1}C is noticed without any contamination of other phase or milling media. TEM study of 8 h ball-milled sample gives direct supportive evidence of structural and microstructural evaluation by XRD pattern analysis. A comparative study of microstructural changes between TiC and Ti{sub 0.9}W{sub 0.1}C helps to understand the effect of addition of W as solute in Ti–C metal matrix.

Role of genetic polymorphisms in NFKB-mediated inflammatory pathways in response to primary chemoradiation therapy for rectal cancer.

Science.gov (United States)

Dzhugashvili, Maia; Luengo-Gil, Ginés; García, Teresa; González-Conejero, Rocío; Conesa-Zamora, Pablo; Escolar, Pedro Pablo; Calvo, Felipe; Vicente, Vicente; Ayala de la Peña, Francisco

2014-11-01

To investigate whether polymorphisms of genes related to inflammation are associated with pathologic response (primary endpoint) in patients with rectal cancer treated with primary chemoradiation therapy (PCRT). Genomic DNA of 159 patients with locally advanced rectal cancer treated with PCRT was genotyped for polymorphisms rs28362491 (NFKB1), rs1213266/rs5789 (PTGS1), rs5275 (PTGS2), and rs16944/rs1143627 (IL1B) using TaqMan single nucleotide polymorphism genotyping assays. The association between each genotype and pathologic response (poor response vs complete or partial response) was analyzed using logistic regression models. The NFKB1 DEL/DEL genotype was associated with pathologic response (odds ratio [OR], 6.39; 95% confidence interval [CI], 0.78-52.65; P=.03) after PCRT. No statistically significant associations between other polymorphisms and response to PCRT were observed. Patients with the NFKB1 DEL/DEL genotype showed a trend for longer disease-free survival (log-rank test, P=.096) and overall survival (P=.049), which was not significant in a multivariate analysis that included pathologic response. Analysis for 6 polymorphisms showed that patients carrying the haplotype rs28362491-DEL/rs1143627-A/rs1213266-G/rs5789-C/rs5275-A/rs16944-G (13.7% of cases) had a higher response rate to PCRT (OR, 8.86; 95% CI, 1.21-64.98; P=.034) than the reference group (rs28362491-INS/rs1143627-A/rs1213266-G/rs5789-C/rs5275-A/rs16944-G). Clinically significant (grade ≥2) acute organ toxicity was also more frequent in patients with that same haplotype (OR, 4.12; 95% CI, 1.11-15.36; P=.037). Our results suggest that genetic variation in NFKB-related inflammatory pathways might influence sensitivity to primary chemoradiation for rectal cancer. If confirmed, an inflammation-related radiogenetic profile might be used to select patients with rectal cancer for preoperative combined-modality treatment. Copyright © 2014 Elsevier Inc. All rights reserved.

Role of Genetic Polymorphisms in NFKB-Mediated Inflammatory Pathways in Response to Primary Chemoradiation Therapy for Rectal Cancer

International Nuclear Information System (INIS)

Dzhugashvili, Maia; Luengo-Gil, Ginés; García, Teresa; González-Conejero, Rocío; Conesa-Zamora, Pablo; Escolar, Pedro Pablo; Calvo, Felipe; Vicente, Vicente; Ayala de la Peña, Francisco

2014-01-01

Purpose: To investigate whether polymorphisms of genes related to inflammation are associated with pathologic response (primary endpoint) in patients with rectal cancer treated with primary chemoradiation therapy (PCRT). Methods and Materials: Genomic DNA of 159 patients with locally advanced rectal cancer treated with PCRT was genotyped for polymorphisms rs28362491 (NFKB1), rs1213266/rs5789 (PTGS1), rs5275 (PTGS2), and rs16944/rs1143627 (IL1B) using TaqMan single nucleotide polymorphism genotyping assays. The association between each genotype and pathologic response (poor response vs complete or partial response) was analyzed using logistic regression models. Results: The NFKB1 DEL/DEL genotype was associated with pathologic response (odds ratio [OR], 6.39; 95% confidence interval [CI], 0.78-52.65; P=.03) after PCRT. No statistically significant associations between other polymorphisms and response to PCRT were observed. Patients with the NFKB1 DEL/DEL genotype showed a trend for longer disease-free survival (log-rank test, P=.096) and overall survival (P=.049), which was not significant in a multivariate analysis that included pathologic response. Analysis for 6 polymorphisms showed that patients carrying the haplotype rs28362491-DEL/rs1143627-A/rs1213266-G/rs5789-C/rs5275-A/rs16944-G (13.7% of cases) had a higher response rate to PCRT (OR, 8.86; 95% CI, 1.21-64.98; P=.034) than the reference group (rs28362491-INS/rs1143627-A/rs1213266-G/rs5789-C/rs5275-A/rs16944-G). Clinically significant (grade ≥2) acute organ toxicity was also more frequent in patients with that same haplotype (OR, 4.12; 95% CI, 1.11-15.36; P=.037). Conclusions: Our results suggest that genetic variation in NFKB-related inflammatory pathways might influence sensitivity to primary chemoradiation for rectal cancer. If confirmed, an inflammation-related radiogenetic profile might be used to select patients with rectal cancer for preoperative combined-modality treatment

Charged-particle multiplicities in proton–proton collisions at √s=0.9 to 8 TeV

NARCIS (Netherlands)

Adam, J.; Adamová, D.; Aggarwal, M. M.; Rinella, G. Aglieri; Agnello, M.; Agrawal, N.; Ahammed, Z.; Ahmed, I.A.M.; Ahn, S. U.; Aiola, S.; Akindinov, A.; Alam, S. N.; Aleksandrov, D.; Alessandro, B.; Alexandre, D.; Molina, R. Alfaro; Alici, A.; Alkin, A.; Almaraz, J. R. M.; Alme, J.; Alt, T.; Altinpinar, S.; Altsybeev, I.; Prado, C. Alves Garcia; Andrei, C.; Andronic, A.; Anguelov, V.; Anielski, J.; Antičić, T.; Antinori, F.; Antonioli, P.; Aphecetche, L.; Appelshäuser, H.; Arcelli, S.; Arnaldi, R.; Arnold, O. W.; Arsene, I. C.; Arslandok, M.; Audurier, B.; Augustinus, A.; Averbeck, R.; Azmi, M. D.; Badalà, A.; Baek, Y. W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Baral, R. C.; Barbano, A. M.; Barbera, R.; Barile, F.; Barnaföldi, G. G.; Barnby, L. S.; Barret, V.; Bartalini, P.; Barth, K.; Bartke, J.; Bartsch, E.; Basile, M.; Bastid, N.; Basu, S.; Bathen, B.; Batigne, G.; Camejo, A. Batista; Batyunya, B.; Batzing, P. C.; Bearden, I. G.; Beck, H.; Bedda, C.; Behera, N. K.; Belikov, I.; Bellini, F.; Martinez, H. Bello; Bellwied, R.; Belmont, R.; Belmont-Moreno, E.; Belyaev, V.; Bencedi, G.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bertens, R. A.; Berzano, D.; Betev, L.; Bhasin, A.; Bhat, I. R.; Bhati, A. K.; Bhattacharjee, B.; Bhom, J.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielčík, J.; Bielčíková, J.; Bilandzic, A.; Biswas, R.; Biswas, S.; Bjelogrlic, S.; Blair, J. T.; Blau, D.; Blume, C.; Bock, F.; Bogdanov, A.; Bøggild, H.; Boldizsár, L.; Bombara, M.; Book, J.; Borel, H.; Borissov, A.; Borri, M.; Bossú, F.; Botta, E.; Böttger, S.; Bourjau, C.; Braun-Munzinger, P.; Bregant, M.; Breitner, T.; Broker, T. A.; Browning, T. A.; Broz, M.; Brucken, E. J.; Bruna, E.; Bruno, G. E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Buncic, P.; Busch, O.; Buthelezi, Z.; Butt, J. B.; Buxton, J. T.; Caffarri, D.; Cai, X.; Caines, H.; Diaz, L. Calero; Caliva, A.; Villar, E. Calvo; Camerini, P.; Carena, F.; Carena, W.; Carnesecchi, F.; Castellanos, J. Castillo; Castro, A. J.; Casula, E. A R; Sanchez, C. Ceballos; Cepila, J.; Cerello, P.; Cerkala, J.; Chang, B.; Chapeland, S.; Chartier, M.; Charvet, J. L.; Chattopadhyay, S.; Chattopadhyay, S.; Chelnokov, V.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Barroso, V. Chibante; Chinellato, D. D.; Cho, Sukhee; Chochula, P.; Choi, K.; Chojnacki, M.; Choudhury, S.; Christakoglou, P.; Christensen, C. H.; Christiansen, P.; Chujo, T.; Chung, S. U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Colamaria, F.; Colella, D.; Collu, A.; Colocci, M.; Balbastre, G. Conesa; Del Valle, Z. Conesa; Connors, M. E.; Contreras, J. G.; Cormier, T. M.; Morales, Y. Corrales; Maldonado, I. Cortés; Cortese, P.; Cosentino, M. R.; Costa, F.; Crochet, P.; Albino, R. Cruz; Cuautle, E.; Cunqueiro, L.; Dahms, T.; Dainese, A.; Danu, A.; Das, D.; Das, I.; Das, S.; Dash, A.; Dash, S.; Dasgupta, S. S.; De Caro, A.; De Cataldo, G.; De Conti, C.; De Cuveland, J.; De Falco, A.; De Gruttola, D.; De Marco, N.; De Pasquale, S.; Deisting, A.; Deloff, A.; Dénes, E.; Deplano, C.; Dhankher, P.; Di Bari, D.; Di Mauro, A.; Di Nezza, P.; Corchero, M. A Diaz; Dietel, T.; Dillenseger, P.; Divià, R.; Djuvsland, O.; Dobrin, A.; Gimenez, D. Domenicis; Dönigus, B.; Dordic, O.; Drozhzhova, T.; Dubey, A. K.; Dubla, A.; Ducroux, L.; Dupieux, P.; Ehlers, R. J.; Elia, D.; Engel, H.; Epple, E.; Erazmus, B.; Erdemir, I.; Erhardt, F.; Espagnon, B.; Estienne, M.; Esumi, S.; Eum, J.; Evans, D.; Evdokimov, S.; Eyyubova, G.; Fabbietti, L.; Fabris, D.; Faivre, J.; Fantoni, A.; Fasel, M.; Feldkamp, L.; Feliciello, A.; Feofilov, G.; Ferencei, J.; Téllez, A. Fernández; Ferreiro, E. G.; Ferretti, A.; Festanti, A.; Feuillard, V. J. G.; Figiel, J.; Figueredo, M. A S; Filchagin, S.; Finogeev, D.; Fionda, F. M.; Fiore, E. M.; Fleck, M. G.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Francescon, A.; Frankenfeld, U.; Fuchs, U.; Furget, C.; Furs, A.; Girard, M. Fusco; Gaardhøje, J. J.; Gagliardi, M.; Gago, A. M.; Gallio, M.; Gangadharan, D. R.; Ganoti, P.; Gao, C.; Garabatos, C.; Garcia-Solis, E.; Gargiulo, C.; Gasik, P.; Gauger, E. F.; Germain, M.; Gheata, A.; Gheata, M.; Ghosh, P.; Ghosh, S. K.; Gianotti, P.; Giubellino, P.; Giubilato, P.; Gladysz-Dziadus, E.; Glässel, P.; Coral, D. M.Goméz; Ramirez, A. Gomez; Gonzalez, V; González-Zamora, P.; Gorbunov, S.; Görlich, L.; Gotovac, S.; Grabski, V.; Grachov, O. A.; Graczykowski, L. K.; Graham, K. L.; Grelli, A.; Grigoras, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Gronefeld, J. M.; Grosse-Oetringhaus, J. F.; Grossiord, J. Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gunji, T.; Gupta, A.; Gupta, R.; Haake, R.; Haaland, O.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Harris, J. W.; Harton, A.; Hatzifotiadou, D.; Hayashi, S.; Heckel, S. T.; Heide, M.; Helstrup, H.; Herghelegiu, A.; Corral, G. Herrera; Hess, B. A.; Hetland, K. F.; Hillemanns, H.; Hippolyte, B.; Hosokawa, R.; Hristov, P.; Huang, M.; Humanic, T. J.; Hussain, N.; Hussain, T.; Hutter, D.; Hwang, D. S.; Ilkaev, R.; Inaba, M.; Ippolitov, M.; Irfan, M.; Ivanov, M.; Ivanov, V.; Izucheev, V.; Jachołkowski, A.; Jacobs, P. M.; Jadhav, M. B.; Jadlovska, S.; Jadlovsky, J.; Jahnke, C.; Jakubowska, M. J.; Jang, H. J.; Janik, M. A.; Jayarathna, P. H S Y; Jena, C.; Jena, S.; Bustamante, R. T Jimenez; Jones, P. G.; Jung, H.; Jusko, A.; Kalinak, P.; Kalweit, A.; Kamin, J.; Kang, J. H.; Kaplin, V.; Kar, S.; Uysal, A. Karasu; Karavichev, O.; Karavicheva, T.; Karayan, L.; Karpechev, E.; Kebschull, U.; Keidel, R.; Keijdener, D. L.D.; Keil, M.; Khan, M. Mohisin; Khan, P.M.; Khan, Shfaqat A.; Khanzadeev, A.; Kharlov, Y.; Kileng, B.; Kim, B.; Kim, D. W.; Kim, D. J.; Kim, D.-S.; Kim, H.; Kim, J. S.; Kim, M.; Kim, M.; Kim, S.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Kiss, G.; Klay, J. L.; Klein, C; Klein, J.; Klein-Bösing, C.; Klewin, S.; Kluge, A.; Knichel, M. L.; Knospe, A. G.; Kobayashi, T.; Kobdaj, C.; Kofarago, M.; Kollegger, T.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Kondratyuk, E.; Konevskikh, A.; Kopcik, M.; Kour, M.; Kouzinopoulos, C.; Kovalenko, O.; Kovalenko, V.; Kowalski, M.L.; Meethaleveedu, G. Koyithatta; Králik, I.; Kravčáková, A.; Kretz, M.; Krivda, M.; Krizek, F.; Kryshen, E.; Krzewicki, M.; Kubera, A. M.; Kučera, V.; Kuhn, C.; Kuijer, P. G.; Kumar, A.; Kumar, J.; Kumar, L.; Kumar, S.; Kurashvili, P.; Kurepin, A.; Kurepin, A. B.; Kuryakin, A.; Kweon, M. J.; Kwon, Y.; La Pointe, S. L.; La Rocca, P.; De Guevara, P. Ladron; Fernandes, C. Lagana; Lakomov, I.; Langoy, R.; Lara, C.; Lardeux, A.; Lattuca, A.; Laudi, E.; Lea, R.; Leardini, L.; Lee, G. R.; Lee, S.; Lehas, F.; Lemmon, R. C.; Lenti, V.; Leogrande, E.; Monzón, I. León; Vargas, H. León; Leoncino, M.; Lévai, P.; Li, S.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M. A.; Ljunggren, H. M.; Lodato, D. F.; Loenne, P. I.; Loginov, V.; Loizides, C.; Lopez, X.; Torres, E. López; Lowe, A.; Luettig, P.; Lunardon, M.; Luparello, G.; Maevskaya, A.; Mager, M.; Mahajan, S.; Mahmood, S. M.; Maire, A.; Majka, R. D.; Malaev, M.; Cervantes, I. Maldonado; Malinina, L.; Mal’Kevich, D.; Malzacher, P.; Mamonov, A.; Manko, V.; Manso, F.; Manzari, V.; Marchisone, M.; Mareš, J.; Margagliotti, G. V.; Margotti, A.; Margutti, J.; Marín, Alicia; Markert, C.; Marquard, M.; Martin, N. A.; Blanco, J. Martin; Martinengo, P.; Martínez-Cabrera, H.I.; García, G. Martínez; Pedreira, M. Martinez; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Massacrier, L.; Mastroserio, A.; Matyja, A.; mayer, C.; Mazer, J.; Mazzoni, M. A.; McDonald, D.; Meddi, F.; Melikyan, Y.; Menchaca-Rocha, A.; Meninno, E.; Pérez, J. Mercado; Meres, M.; Miake, Y.; Mieskolainen, M. M.; Mikhaylov, K.; Milano, L.; Milosevic, J.; Minervini, L. M.; Mischke, A.; Mishra, A. N.; Miśkowiec, D.; Mitra, J.; Mitu, C. M.; Mohammadi, N.; Mohanty, B.; Molnar, L.; Zetina, L. Montaño; Montes, E.; De Godoy, D. A Moreira; Moreno, L. A. P.; Moretto, S.; Morreale, A.; Morsch, A.; Muccifora, V.; Mudnic, E.; Mühlheim, D.; Muhuri, S.; Mukherjee, M.; Mulligan, J. D.; Munhoz, M. G.; Munzer, R. H.; Murray, S.; Musa, L.; Musinsky, J.; Naik, B.; Nair, Rajiv; Nandi, B. K.; Nania, R.; Nappi, E.; Naru, M. U.; da Luz, H. Natal; Nattrass, C.; Nayak, K.; Nayak, T. K.; Nazarenko, S.; Nedosekin, A.; Nellen, L.; Ng, F.; Nicassio, M.; Niculescu, M.; Niedziela, J.; Nielsen, B. S.; Nikolaev, S.; Nikulin, S.; Nikulin, V.; Noferini, F.; Nomokonov, P.; Nooren, G.; Noris, J. C. C.; Norman, J.; Nyanin, A.; Nystrand, J.; Oeschler, H.; Oh, S.; Oh, S. K.; Ohlson, A.; Okatan, A.; Okubo, T.; Olah, L.; Oleniacz, J.; Da Silva, A. C.Oliveira; Oliver, M. H.; Onderwaater, J.; Oppedisano, C.; Orava, R.; Velasquez, A. Ortiz; Oskarsson, A.; Otwinowski, J.; Oyama, K.; Ozdemir, M.; Pachmayer, Y.; Pagano, P.; Paić, G.; Pal, S. K.; Pan, J.; Pandey, A. K.; Papcun, P.; Papikyan, V.; Pappalardo, G. S.; Pareek, P.; Park, J.-W.; Parmar, S.; Passfeld, A.; Paticchio, V.; Patra, R. N.; Paul, B.; Peitzmann, T.; Da Costa, H. Pereira; Filho, E. Pereira De Oliveira; Peresunko, D.; Lara, C. E Pérez; Lezama, E. Perez; Peskov, V.; Pestov, Y.; Petráček, V.; Petrov, V.; Petrovici, M.; Petta, C.; Piano, S.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Piyarathna, D. B.; oskoń, M. P.; Planinic, M.; Pluta, J.; Pochybova, S.; Podesta-Lerma, P. L M; Poghosyan, M. G.; Polichtchouk, B.; Poljak, N.; Poonsawat, W.; Pop, A.; Porteboeuf-Houssais, S.; Porter, J.; Pospisil, J.; Prasad, S. K.; Preghenella, R.; Prino, F.; Pruneau, C. A.; Pshenichnov, I.; Puccio, M.; Puddu, G.; Pujahari, P.; Punin, V.; Putschke, J.; Qvigstad, H.; Rachevski, A.; Raha, S.; Rajput, S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Rami, F.; Raniwala, R.; Raniwala, S.; Räsänen, S.; Rascanu, B. T.; Rathee, D.; Read, K. F.; Redlich, K.; Reed, R. J.; Rehman, A.; Reichelt, P.; Reidt, F.; Ren, X.; Renfordt, R.; Reolon, A. R.; Reshetin, A.; Revol, J. P.; Reygers, K.; Riabov, V.; Ricci, R. A.; Richert, T.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Ristea, C.; Rocco, E.; Cahuantzi, M. Rodríguez; Manso, A. Rodriguez; Røed, K.; Rogochaya, E.; Rohr, D.; Röhrich, D.; Romita, R.; Ronchetti, F.; Ronflette, L.; Rosnet, P.; Rossi, A.; Roukoutakis, F.; Roy, A.; Roy, C.; Roy, P.; Montero, A. J Rubio; Rui, R.; Russo, R.; Ryabinkin, E.; Ryabov, Y.; Rybicki, A.; Sadovsky, S.; Šafařík, K.; Sahlmuller, B.; Sahoo, P.; Sahoo, R.; Sahoo, S.; Sahu, P. K.; Saini, J.; Sakai, S.; Saleh, M. A.; Salzwedel, J.; Sambyal, S.; Samsonov, V.; Šándor, L.; Sandoval, A.; Sano, M.; Sarkar, D.; Scapparone, E.; Scarlassara, F.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H. R.; Schuchmann, S.; Schukraft, J.; Schulc, M.; Schuster, T.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Šefčík, M.; Seger, J. E.; Sekiguchi, Y.; Sekihata, D.; Selyuzhenkov, I.; Senosi, K.; Senyukov, S.; Serradilla, E.; Sevcenco, A.; Shabanov, A.; Shabetai, A.; Shadura, O.; Shahoyan, R.; Shangaraev, A.; Sharma, A.; Sharma, M.; Sharma, M.; Sharma, N.; Shigaki, K.; Shtejer, K.; Sibiriak, Y.; Siddhanta, S.; Sielewicz, K. M.; Siemiarczuk, T.; Silvermyr, D.; Silvestre, C.; Simatovic, G.; Simonetti, G.; Singaraju, R.; Singh, R; Singha, S.; Singhal, V.; Sinha, B. C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T. B.; Slupecki, M.; Smirnov, N.; Snellings, R. J.M.; Snellman, T. W.; Søgaard, C.; Song, J.; Song, M.; Song, Z.; Soramel, F.; Sorensen, S.; Sozzi, F.; Spacek, M.; Spiriti, E.; Sputowska, I.; Spyropoulou-Stassinaki, M.; Stachel, J.; Stan, I.; Stefanek, G.; Stenlund, E.; Steyn, G.; Stiller, J. H.; Stocco, D.; Strmen, P.; Suaide, A. A P; Sugitate, T.; Suire, C.; Suleymanov, M.; Suljic, M.; Sultanov, R.; Šumbera, M.; Szabo, A.; De Toledo, A. Szanto; Szarka, I.; Szczepankiewicz, A.; Szymanski, M.; Tabassam, U.; Takahashi, J.; Tambave, G. J.; Tanaka, N.; Tangaro, M. A.; Tarhini, M.; Tariq, M.; Tarzila, M. G.; Tauro, A.; Muñoz, G. Tejeda; Telesca, A.; Terasaki, K.; Terrevoli, C.; Teyssier, B.; Thäder, J.; Thomas, D.; Tieulent, R.; Timmins, A. R.; Toia, A.; Trogolo, S.; Trombetta, G.; Trubnikov, V.; Trzaska, W. H.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T. S.; Ullaland, K.; Uras, A.; Usai, G. L.; Utrobicic, A.; Vajzer, M.; Vala, M.; Palomo, L. Valencia; Vallero, S.; Van Der Maarel, J.; Van Hoorne, J. W.; van Leeuwen, M.; Vanat, T.; Vyvre, P. Vande; Varga, D.; Vargas, A.; Vargyas, M.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vauthier, A.; Vechernin, V.; Veen, A. M.; Veldhoen, M.; Velure, A.; Venaruzzo, M.; Vercellin, E.; Limón, S. Vergara; Vernet, R.; Verweij, M.; Vickovic, L.; Viesti, G.; Viinikainen, J.; Vilakazi, Z.; Baillie, O. Villalobos; Tello, A. Villatoro; Vinogradov, A.; Vinogradov, L.; Vinogradov, Y.; Virgili, T.; Vislavicius, V.; Viyogi, Y. P.; Vodopyanov, A.; Völkl, M. A.; Voloshin, K.; Voloshin, S. A.; Volpe, G.; Haller, B.; Vorobyev, I.; Vranic, D.; Vrláková, J.; Vulpescu, B.; Vyushin, A.; Wagner, B.; Wagner, J.; Wang, H.; Wang, M.; Watanabe, D.; Watanabe, Y.; Weber, M.; Weber, S. G.; Weiser, D. F.; Wessels, J. P.; Westerhoff, U.; Whitehead, A. M.; Wiechula, J.; Wikne, J.; Wilde, M.; Wilk, G.; Wilkinson, J.; Williams, M. C S; Windelband, B.; Winn, M.; Yaldo, C. G.; Yang, H.; Yang, P.; Yano, S.; Yasar, C.; Yin, Z.; Yokoyama, H.; Yoo, I. K.; Yoon, J. H.; Yurchenko, V.; Yushmanov, I.; Zaborowska, A.; Zaccolo, V.; Zaman, A.; Zampolli, C.; Zanoli, H. J. C.; Zaporozhets, S.; Zardoshti, N.; Zarochentsev, A.; Závada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zgura, I. S.; Zhalov, M.; Zhang, H.; Zhang, X.; Zhang, Y.; Zhang, C.; Zhang, Z.; Zhao, C.; Zhigareva, N.; Zhou, D.; Zhou, Y.; Zhou, Z.; Zhu, H.; Zhu, J.; Zichichi, A.; Zimmermann, A.; Zimmermann, M. B.; Zinovjev, G.; Zyzak, M.

2017-01-01

A detailed study of pseudorapidity densities and multiplicity distributions of primary charged particles produced in proton–proton collisions, at s= 0.9, 2.36, 2.76, 7 and 8 TeV, in the pseudorapidity range | η| < 2 , was carried out using the ALICE detector. Measurements were obtained for three

Development of a scoring system for differentiating IgG4-related sclerosing cholangitis from primary sclerosing cholangitis.

Science.gov (United States)

Moon, Sung-Hoon; Kim, Myung-Hwan; Lee, Jong Kyun; Baek, Seunghee; Woo, Young Sik; Cho, Dong Hui; Oh, Dongwook; Song, Tae Jun; Park, Do Hyun; Lee, Sang Soo; Seo, Dong Wan; Lee, Sung Koo

2017-04-01

Recent research has shown that a substantial number of patients with primary sclerosing cholangitis (PSC) can also have elevated serum/tissue IgG4. The aim of our study was to develop a simple scoring system for the discrimination of IgG4-related sclerosing cholangits (IgG4-SC) from PSC. Patients with IgG4-SC (n = 39) and PSC (n = 76) who had intrahepatic/hilar strictures were included. Candidate-differentiating variables included patient age, other organ involvement (OOI), inflammatory bowel disease, serum IgG4, and cholangiographic features. A scoring system was developed on the basis of these variables, and its performance was internally validated using a bootstrapping-based method. The scoring system in the final model included age (IgG4-SC. The discrimination between IgG4-SC and PSC using the scoring system was excellent (area under the receiver operating characteristic curve, 0.986). A reliable differentiation of IgG4-SC from PSC can be made using the scoring system presented here. We suggest the diagnosis of IgG4-SC at a cutoff of 7 points or higher and the indication of diagnostic steroid trial at 5 or 6 points. External validation of our scoring system is warranted.

[Primary hyperparathyroidism in the dog. Diagnosis, therapy and postoperative management in 19 dogs].

Science.gov (United States)

Jores, K; Kessler, M

2011-01-01

Retrospective evaluation of diagnosis and outcome in 20 dogs with primary hyperparathyroidism. In 20 dogs primary hyperparathyroidism was diagnosed and 19 patients were treated via parathyroidectomy, 10 additionally with partial thyroidectomy. Medical records of the dogs were reviewed for signalment, clinical features, laboratory findings and results of histopathologic examination. In some cases postsurgical rehabilitation of calcium metabolism required substitution with calcium and vitamin D preparations. Mean age of the dogs was 11.5 years. The most common clinical signs comprised polydipsia, polyuria, reduced activity, and stiff gait. Laboratory findings were moderate to extensive hypercalcaemia, low or low-normal serum phosphorus concentrations and normal or increased serum parathyroid hormone concentrations. None of the dogs had an elevated parathyroid hormone-related polypeptide level. Histological examination revealed 11 adenomas, six carcinomas and two glandular hyperplasias. Postsurgical management of calcium homeostasis was challenging in some cases. Tumours of the parathyroid gland can be easily treated by parathyroidectomy and usually have a good prognosis. With careful interpretation of laboratory findings of a patient presenting with hypercalcaemia and ruling out other causes of hypercalcaemia diagnosis of primary hyperparathyroidism can be easily achieved and successfully treated byparathyroidectomy.

Superlattice Structures, Electronic Properties, and Spin Dynamics of the Partially Cu-Extracted Phase for the Composite Crystal System CuxV4O11

Science.gov (United States)

Onoda, Masashige; Tamura, Asato

2017-02-01

The crystal structures, electronic properties, and spin dynamics of CuxV4O11 with 1.2 ≤ x electron paramagnetic resonance. This system has superlattice structures mainly ascribed to the partial ordering of Cu ions. Cu1.78V4O11 is triclinic with space group Pbar{1} and the double supercell of the V4O11 substructure of the composite crystal. The significantly Cu-extracted crystal Cu1.40V4O11 has a quadruple supercell with space group P1. The electron transport for V ions is nonmetallic owing to the polaronic nature and/or phonon softening and to the random potential of Cu ions. The Curie-Weiss-type paramagnetism basically originates from the Cu2+ chain coordinated octahedrally, and the EPR relaxation at low temperatures is understood through the exchange mechanism for the dipole-dipole and anisotropic exchange interactions. The near absence of paramagnetic behaviors of V4+ ions might be due to the spin-singlet ladder model or alternating-exchange chain model depending on the superlattice structure and valence distribution. The electrochemical performance of Li rechargeable batteries using this superlattice system is about 300 A h kg-1 at voltages above 2 V.

Structural Study of the Partially Disordered Full-Length delta Subunit of RNA Polymerase from Bacillus subtilis

Czech Academy of Sciences Publication Activity Database

Papoušková, V.; Kadeřávek, P.; Otrusinová, O.; Rabatinová, Alžběta; Šanderová, Hana; Nováček, J.; Krásný, Libor; Sklenář, V.; Žídek, L.

2013-01-01

Roč. 14, č. 14 (2013), s. 1772-1779 ISSN 1439-4227 R&D Projects: GA ČR GA204/09/0583; GA ČR GA13-16842S Institutional support: RVO:61388971 Keywords : NMR spectroscopy * partially disordered proteins * protein structures Subject RIV: CE - Biochemistry Impact factor: 3.060, year: 2013

Effectiveness of early lens extraction for the treatment of primary angle-closure glaucoma (EAGLE): a randomised controlled trial

OpenAIRE

Azuara-Blanco, Augusto; Burr, Jennifer; Ramsay, Craig; Cooper, David; Foster, Paul J.; Friedman, David S.; Scotland, Graham; Javanbakht, Mehdi; Cochrane, Claire; Norrie, John; For the EAGLE study group

2016-01-01

PJF is supported by salary funding from the National Institute for Health Research (NIHR) through a grant to the Biomedical Research Centre at Moorfields Eye Hospital and UCL Institute of Ophthalmology. This work is supported by the Medical Research Council (MRC G0701604) and funding is managed by the NIHR (NIHR-EME 09-800-26) on behalf of the MRC–NIHR partnership. Background . Primary angle-closure glaucoma is a leading cause of irreversible blindness worldwide. In early-stage disease, in...

"LIFT11" lõpetab installatsioon "Rada metsas" / Margit Aule

Index Scriptorium Estoniae

Aule, Margit

2011-01-01

Kadrioru pargis 24.09.-22.10.2011 avatud jaapani arhitekti Tetsuo Kondo installatsioonist "Rada metsas", linnainstallatsioonide festivali LIFT11 viimasest ja suurimast teosest. Installatsiooni on rahastanud Jaapani Fond. Arhitektist

A primary standard for low-g shock calibration by laser interferometry

Science.gov (United States)

Sun, Qiao; Wang, Jian-lin; Hu, Hong-bo

2014-07-01

This paper presents a novel implementation of a primary standard for low-g shock acceleration calibration by laser interferometry based on rigid body collision at National Institute of Metrology, China. The mechanical structure of the standard device and working principles involved in the shock acceleration exciter, laser interferometers and virtual instruments are described. The novel combination of an electromagnetic exciter and a pneumatic exciter as the mechanical power supply of the standard device can deliver a wide range of shock acceleration levels. In addition to polyurethane rubber, two other types of material are investigated to ensure a wide selection of cushioning pads for shock pulse generation, with pulse shapes and data displayed. A heterodyne He-Ne laser interferometer is preferred for its precise and reliable measurement of shock acceleration while a homodyne one serves as a check standard. Some calibration results of a standard acceleration measuring chain are shown in company with the uncertainty evaluation budget. The expanded calibration uncertainty of shock sensitivity of the acceleration measuring chain is 0.8%, k = 2, with the peak acceleration range from 20 to 10 000 m s-2 and pulse duration from 0.5 to 10 ms. This primary shock standard can meet the traceability requirements of shock acceleration from various applications of industries from automobile to civil engineering and therefore is used for piloting the ongoing shock comparison of Technical Committee of Acoustics, Ultrasound and Vibration (TCAUV) of Asia Pacific Metrology Program (APMP), coded as APMP.AUV.V-P1.

A primary standard for low-g shock calibration by laser interferometry

International Nuclear Information System (INIS)

Sun, Qiao; Wang, Jian-lin; Hu, Hong-bo

2014-01-01

This paper presents a novel implementation of a primary standard for low-g shock acceleration calibration by laser interferometry based on rigid body collision at National Institute of Metrology, China. The mechanical structure of the standard device and working principles involved in the shock acceleration exciter, laser interferometers and virtual instruments are described. The novel combination of an electromagnetic exciter and a pneumatic exciter as the mechanical power supply of the standard device can deliver a wide range of shock acceleration levels. In addition to polyurethane rubber, two other types of material are investigated to ensure a wide selection of cushioning pads for shock pulse generation, with pulse shapes and data displayed. A heterodyne He–Ne laser interferometer is preferred for its precise and reliable measurement of shock acceleration while a homodyne one serves as a check standard. Some calibration results of a standard acceleration measuring chain are shown in company with the uncertainty evaluation budget. The expanded calibration uncertainty of shock sensitivity of the acceleration measuring chain is 0.8%, k = 2, with the peak acceleration range from 20 to 10 000 m s −2  and pulse duration from 0.5 to 10 ms. This primary shock standard can meet the traceability requirements of shock acceleration from various applications of industries from automobile to civil engineering and therefore is used for piloting the ongoing shock comparison of Technical Committee of Acoustics, Ultrasound and Vibration (TCAUV) of Asia Pacific Metrology Program (APMP), coded as APMP.AUV.V-P1. (paper)

Synthesis procedure for routine production of [carbonyl-{sup 11}C]desmethyl-WAY-100635

Energy Technology Data Exchange (ETDEWEB)

Maiti, Dilip K. [Department of Pediatrics, School of Medicine, PET Center, Children' s Hospital of Michigan, Wayne State University, 3901 Beaubien Blvd., Detroit, MI 48201 (United States); Chakraborty, Pulak K. [Department of Radiology, School of Medicine, PET Center, Children' s Hospital of Michigan, Wayne State University, 3901 Beaubien Blvd., Detroit, MI 48201 (United States)]. E-mail: pulak@pet.wayne.edu; Chugani, Diane C. [Department of Pediatrics, School of Medicine, PET Center, Children' s Hospital of Michigan, Wayne State University, 3901 Beaubien Blvd., Detroit, MI 48201 (United States); Department of Radiology, School of Medicine, PET Center, Children' s Hospital of Michigan, Wayne State University, 3901 Beaubien Blvd., Detroit, MI 48201 (United States); Muzik, Otto [Department of Pediatrics, School of Medicine, PET Center, Children' s Hospital of Michigan, Wayne State University, 3901 Beaubien Blvd., Detroit, MI 48201 (United States); Department of Radiology, School of Medicine, PET Center, Children' s Hospital of Michigan, Wayne State University, 3901 Beaubien Blvd., Detroit, MI 48201 (United States); Mangner, Thomas J. [Department of Radiology, School of Medicine, PET Center, Children' s Hospital of Michigan, Wayne State University, 3901 Beaubien Blvd., Detroit, MI 48201 (United States); Chugani, Harry T. [Department of Pediatrics, School of Medicine, PET Center, Children' s Hospital of Michigan, Wayne State University, 3901 Beaubien Blvd., Detroit, MI 48201 (United States); Department of Radiology, School of Medicine, PET Center, Children' s Hospital of Michigan, Wayne State University, 3901 Beaubien Blvd., Detroit, MI 48201 (United States); Department of Neurology, School of Medicine, PET Center, Children' s Hospital of Michigan, Wayne State University, 3901 Beaubien Blvd., Detroit, MI 48201 (United States)

2005-05-01

An improved one-pot synthesis procedure for routine production of [carbonyl-{sup 11}C]desmethyl-WAY-100635 ([{sup 11}C]DWAY) is described. An efficient purification of the crude product has also been developed and was accomplished by C-18 reversed-phase semi-preparative HPLC using 55/45 EtOH-NaH{sub 2}PO{sub 4} buffer (20mM, pH=6.5) as the eluent. The desired product fraction was collected in a 2.0-2.5mL volume and formulated with 11mL of 0.9% saline. The radioligand was ready for human use in 45min (EOB). The product was obtained with a radiochemical yield of 11.1+/-1.8% (EOB, n=15) with a radiochemical purity of >99%. Specific activity was 133.2-185.0GBq/{mu}mol (3.6-5.0Ci/{mu}mol, EOS, n=2) when ca. 37.0GBq (ca. 1.0Ci) of starting [{sup 11}C]CO{sub 2} was used. Unlabeled mass of [{sup 11}C]DWAY was found to be 0.15-0.24{mu}g/mL and the precursor was present in less than 50ng/mL in final production solution.

Method of nuclear power plant transition to partial loa

International Nuclear Information System (INIS)

Ilyunin, V.G.; Kuznetsov, I.A.; Murogov, V.M.; Shmelev, A.N.

1977-01-01

Five variants are proposed of a nuclear power plant with two reactors, of which one a breeder reactor, suitable for work under partial electrical load. Both reactors have a common secondary coolant circuit with a turbine, the breeder reactor operates at a lower coolant temperature in the primary coolant circuit than the other. In the transition of the power plant to the partial electrical load mode, the coolants of both reactors mix at a certain ratio. Heating of the turbine working medium is controlled so that the breeder reactor output increases rather than decreases. The breeding ratio is thereby also increased. Excess heat in the breeder reactor primary circuit is removed via a separate coolant circuit provided with a heat consumer. (Z.M.)

Re-irradiation of recurrent esophageal cancer after primary definitive radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Kim, Young Suk; Lee, Chang Geol; Kim, Kyung Hwan; Kim, Tae Hyung [Dept. of Radiation Oncology, Yonsei University Health System, Yonsei University College of Medicine, Seoul (Korea, Republic of)

2012-12-15

For recurrent esophageal cancer after primary definitive radiotherapy, no general treatment guidelines are available. We evaluated the toxicities and clinical outcomes of re-irradiation (re-RT) for recurrent esophageal cancer. We analyzed 10 patients with recurrent esophageal cancer treated with re-RT after primary definitive radiotherapy. The median time interval between primary radiotherapy and re-RT was 15.6 months (range, 4.8 to 36.4 months). The total dose of primary radiotherapy was a median of 50.4 Gy (range, 50.4 to 63.0 Gy). The total dose of re-RT was a median of 46.5 Gy (range, 44.0 to 50.4 Gy). The median follow-up period was 4.9 months (range, 2.6 to 11.4 months). The tumor response at 3 months after the end of re-RT was complete response (n = 2), partial response (n = 1), stable disease (n = 2), and progressive disease (n = 5). Grade 5 tracheoesophageal fistula developed in three patients. The time interval between primary radiotherapy and re-RT was less than 12 months in two of these three patients. Late toxicities included grade 1 dysphagia (n = 1). Re-RT of recurrent esophageal cancer after primary radiotherapy can cause severe toxicity.

Re-irradiation of recurrent esophageal cancer after primary definitive radiotherapy

International Nuclear Information System (INIS)

Kim, Young Suk; Lee, Chang Geol; Kim, Kyung Hwan; Kim, Tae Hyung

2012-01-01

For recurrent esophageal cancer after primary definitive radiotherapy, no general treatment guidelines are available. We evaluated the toxicities and clinical outcomes of re-irradiation (re-RT) for recurrent esophageal cancer. We analyzed 10 patients with recurrent esophageal cancer treated with re-RT after primary definitive radiotherapy. The median time interval between primary radiotherapy and re-RT was 15.6 months (range, 4.8 to 36.4 months). The total dose of primary radiotherapy was a median of 50.4 Gy (range, 50.4 to 63.0 Gy). The total dose of re-RT was a median of 46.5 Gy (range, 44.0 to 50.4 Gy). The median follow-up period was 4.9 months (range, 2.6 to 11.4 months). The tumor response at 3 months after the end of re-RT was complete response (n = 2), partial response (n = 1), stable disease (n = 2), and progressive disease (n = 5). Grade 5 tracheoesophageal fistula developed in three patients. The time interval between primary radiotherapy and re-RT was less than 12 months in two of these three patients. Late toxicities included grade 1 dysphagia (n = 1). Re-RT of recurrent esophageal cancer after primary radiotherapy can cause severe toxicity.

Association of anaemia in primary care patients with chronic kidney disease: cross sectional study of quality improvement in chronic kidney disease (QICKD) trial data

Science.gov (United States)

2013-01-01

Background Anaemia is a known risk factor for cardiovascular disease and treating anaemia in chronic kidney disease (CKD) may improve outcomes. However, little is known about the scope to improve primary care management of anaemia in CKD. Methods An observational study (N = 1,099,292) with a nationally representative sample using anonymised routine primary care data from 127 Quality Improvement in CKD trial practices (ISRCTN5631023731). We explored variables associated with anaemia in CKD: eGFR, haemoglobin (Hb), mean corpuscular volume (MCV), iron status, cardiovascular comorbidities, and use of therapy which associated with gastrointestinal bleeding, oral iron and deprivation score. We developed a linear regression model to identify variables amenable to improved primary care management. Results The prevalence of Stage 3–5 CKD was 6.76%. Hb was lower in CKD (13.2 g/dl) than without (13.7 g/dl). 22.2% of people with CKD had World Health Organization defined anaemia; 8.6% had Hb ≤ 11 g/dl; 3% Hb ≤ 10 g/dl; and 1% Hb ≤ 9 g/dl. Normocytic anaemia was present in 80.5% with Hb ≤ 11; 72.7% with Hb ≤ 10 g/dl; and 67.6% with Hb ≤ 9 g/dl; microcytic anaemia in 13.4% with Hb ≤ 11 g/dl; 20.8% with Hb ≤ 10 g/dl; and 24.9% where Hb ≤ 9 g/dl. 82.7% of people with microcytic and 58.8% with normocytic anaemia (Hb ≤ 11 g/dl) had a low ferritin (stores may be depleted in over >60% of people with normocytic anaemia. Prescribing oral iron has not corrected anaemia. PMID:23351270

A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification

Science.gov (United States)

Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.

2016-01-01

The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544

Análisis de impacto y desarrollo de buenas práctica de auditoría en bases de datos Oracle 11G

OpenAIRE

Delgado Picazo, Mario

2009-01-01

Este proyecto consiste en realizar un análisis y un estudio de los diferentes tipos de auditoría en Oracle 11g, con el objetivo de estudiar las características de las herramientas disponibles, así como su viabilidad. Mediante experimentación, se estudiará el comportamiento y el rendimiento de las diferentes modalidades de auditoría que Oracle 11g ofrece como motor de la base de datos, obteniendo resultados y comparativas que se utilizarán para preparar un manual de buenas prácticas acerca de ...

Assessment of partial coalescence in whippable oil-in-water food emulsions.

Science.gov (United States)

Petrut, Raul Flaviu; Danthine, Sabine; Blecker, Christophe

2016-03-01

Partial coalescence influences to a great extent the properties of final food products such as ice cream and whipped toppings. In return, the partial coalescence occurrence and development are conditioned, in such systems, by the emulsion's intrinsic properties (e.g. solid fat content, fat crystal shape and size), formulation (e.g. protein content, surfactants presence) and extrinsic factors (e.g. cooling rate, shearing). A set of methods is available for partial coalescence investigation and quantification. These methods are critically reviewed in this paper, balancing the weaknesses of the methods in terms of structure alteration (for turbidity, dye dilution, etc.) and assumptions made for mathematical models (for particle size determination) with their advantages (good repeatability, high sensitivity, etc.). With the methods proposed in literature, the partial coalescence investigations can be conducted quantitatively and/or qualitatively. Good correlation were observed between some of the quantitative methods such as dye dilution, calorimetry, fat particle size; while a poor correlation was found in the case of solvent extraction method with other quantitative methods. The most suitable way for partial coalescence quantification was implied to be the fat particle size method, which would give results with a high degree of confidence if used in combination with a microscopic technique for the confirmation of partial coalescence as the main destabilization mechanism. Copyright © 2015 Elsevier B.V. All rights reserved.

Some observations on the synthesis and electrolytic properties of (Ba1-xCax (M0.9Y0.1O3, M = Ce, Zr-based samples modified with calcium

Directory of Open Access Journals (Sweden)

Dudek Magdalena

2016-03-01

Full Text Available In this paper, the impact of partial substitution of calcium for barium in (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr on physicochemical properties of the powders and sintered samples was investigated. The powders, with various contents of calcium (x = 0, 0.02, 0.05, 0.1, were prepared by means of thermal decomposition of organometallic precursors containing EDTA. All of the BaCeO3-based powders synthesised at 1100 °C were monophasic with a rhombohedral structure, however, completely cubic BaZrO3-based solid solutions were obtained at 1200 °C. A study of the sinterability of BaZr0.9Y0.1O3 and BaCe0.9Y0.1O3-based pellets was performed under non-isothermal conditions within a temperature range of 25 to 1200 °C. The partial substitution of barium for calcium in the (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr solid solution improved the sinterability of the samples in comparison to the initial BaCe0.9Y0.1O3 or BaZr0.9Y0.1O3. The relative density of calcium-modified BaCe0.9Y0.1O3-based samples reached approximately 95 to 97 % after sintering at 1500 °C for 2 h in air. The same level of relative density was achieved after sintering calcium-modified BaZr0.9Y0.1O3 at 1600 °C for 2 h. Analysis of the electrical conductivity from both series of investigated materials showed that the highest ionic conductivity, in air and wet 5 % H2 in Ar, was attained for the compositions of x = 0.02 to 0.05 (Ba1-xCax(M0.9Y0.1O3, M = Zr, Ce. The oxygen reduction reaction on the interface Pt│BaM0.9Y0.1O3, M = Ce, Zr was investigated using Pt microelectrodes. Selected samples of (Ba1-xCax (M0.9Y0.1O3, M = Zr, Ce were tested as ceramic electrolytes in hydrogen-oxygen solid oxide fuel cells operating at temperatures of 700 to 850 °C.

G-CSF/anti-G-CSF antibody complexes drive the potent recovery and expansion of CD11b+Gr-1+ myeloid cells without compromising CD8+ T cell immune responses

Science.gov (United States)

2013-01-01

Background Administration of recombinant G-CSF following cytoreductive therapy enhances the recovery of myeloid cells, minimizing the risk of opportunistic infection. Free G-CSF, however, is expensive, exhibits a short half-life, and has poor biological activity in vivo. Methods We evaluated whether the biological activity of G-CSF could be improved by pre-association with anti-G-CSF mAb prior to injection into mice. Results We find that the efficacy of G-CSF therapy can be enhanced more than 100-fold by pre-association of G-CSF with an anti-G-CSF monoclonal antibody (mAb). Compared with G-CSF alone, administration of G-CSF/anti-G-CSF mAb complexes induced the potent expansion of CD11b+Gr-1+ myeloid cells in mice with or without concomitant cytoreductive treatment including radiation or chemotherapy. Despite driving the dramatic expansion of myeloid cells, in vivo antigen-specific CD8+ T cell immune responses were not compromised. Furthermore, injection of G-CSF/anti-G-CSF mAb complexes heightened protective immunity to bacterial infection. As a measure of clinical value, we also found that antibody complexes improved G-CSF biological activity much more significantly than pegylation. Conclusions Our findings provide the first evidence that antibody cytokine complexes can effectively expand myeloid cells, and furthermore, that G-CSF/anti-G-CSF mAb complexes may provide an improved method for the administration of recombinant G-CSF. PMID:24279871

Registration of 'CP 09-2392' Sugarcane

Science.gov (United States)

CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...

Structural, magnetic and transport properties of Mn3.1Sn0.9 and Mn3.1Sn0.9N compounds

International Nuclear Information System (INIS)

Feng, W.J.; Li, D.; Ren, W.J.; Li, Y.B.; Li, W.F.; Li, J.; Zhang, Y.Q.; Zhang, Z.D.

2007-01-01

The cubic anti-perovskite Mn 3.1 Sn 0.9 N compound is prepared via nitrogenation of the hexagonal Mn 3.1 Sn 0.9 compound. A magnetic phase diagram of Mn 3.1 Sn 0.9 compound is constructed by analysis of data of its magnetic properties. For Mn 3.1 Sn 0.9 N compound, parasitic ferromagnetism exists in the temperature range of 5-370 K, besides a spin-reorientation at about 280 K. Mn 3.1 Sn 0.9 compound exhibits a metallic conducting behavior, while Mn 3.1 Sn 0.9 N displays a metal-nonmetal transition due to the electron localization caused by the static disorder. The differences of the physical properties between the both compounds, are discussed, in terms of the correlation of the hexagonal DO 19 and the cubic anti-perovskite structures, the reduction of the distances between Mn atoms, and the spin-pairing or charge transfer effect due to the electron donation by N 2p to Mn 3d states after introduction of N atoms into the interstitial sites of Mn 3.1 Sn 0.9 compound

75 FR 11403 - Certain New Chemicals; Receipt and Status Information

Science.gov (United States)

2010-03-10

... for (S) 2-propenoic acid, America, Ltd. semiconductor 2-methyl-, 2- packages oxiranylmethyl ester... ether derivative P-10-0182 01/19/10 04/18/10 CBI (G) Coated particles (G) Aromatic for support..., hexahydro-5,5- dimethyl- P-09-0048 10/28/09 10/06/09 (G) Surface modified ceramic particles P-09-0061 12/11...

Adaptive metabolic response to 4 weeks of sugar-sweetened beverage consumption in healthy, lightly active individuals and chronic high glucose availability in primary human myotubes.

Science.gov (United States)

Sartor, Francesco; Jackson, Matthew J; Squillace, Cesare; Shepherd, Anthony; Moore, Jonathan P; Ayer, Donald E; Kubis, Hans-Peter

2013-04-01

Chronic sugar-sweetened beverage (SSB) consumption is associated with obesity and type 2 diabetes mellitus (T2DM). Hyperglycaemia contributes to metabolic alterations observed in T2DM, such as reduced oxidative capacity and elevated glycolytic and lipogenic enzyme expressions in skeletal muscle tissue. We aimed to investigate the metabolic alterations induced by SSB supplementation in healthy individuals and to compare these with the effects of chronic hyperglycaemia on primary muscle cell cultures. Lightly active, healthy, lean subjects (n = 11) with sporadic soft drink consumption underwent a 4-week SSB supplementation (140 ± 15 g/day, ~2 g glucose/kg body weight/day, glucose syrup). Before and after the intervention, body composition, respiratory exchange ratio (RER), insulin sensitivity, muscle metabolic gene and protein expression were assessed. Adaptive responses to hyperglycaemia (7 days, 15 mM) were tested in primary human myotubes. SSB supplementation increased fat mass (+1.0 kg, P < 0.05), fasting RER (+0.12, P < 0.05), fasting glucose (+0.3 mmol/L, P < 0.05) and muscle GAPDH mRNA expressions (+0.94 AU, P < 0.05). PGC1α mRNA was reduced (-0.20 AU, P < 0.05). Trends were found for insulin resistance (+0.16 mU/L, P = 0.09), and MondoA protein levels (+1.58 AU, P = 0.08). Primary myotubes showed elevations in GAPDH, ACC, MondoA and TXNIP protein expressions (P < 0.05). Four weeks of SSB supplementation in healthy individuals shifted substrate metabolism towards carbohydrates, increasing glycolytic and lipogenic gene expression and reducing mitochondrial markers. Glucose-sensing protein MondoA might contribute to this shift, although further in vivo evidence is needed to corroborate this.

Partial diagenetic overprint of late jurassic belemnites from New Zealand

DEFF Research Database (Denmark)

Ullmann, Clemens Vinzenz; Campbell, Hamish J.; Frei, Robert

2013-01-01

δ7Li values become more positive with progressive alteration. The direction and magnitude of the trends in the geochemical record indicate that one main phase of alteration that occurred in the Late Cretaceous caused most of the diagenetic signature in the calcite. Despite relatively deep burial......The preservation potential and trends of alteration of many isotopic systems (e.g. Li, Mg, Ca) that are measured in fossil carbonates are little explored, yet extensive paleoenvironmental interpretations have been made on the basis of these records. Here we present a geochemical dataset for a Late...... Jurassic (~153 Ma) belemnite (Belemnopsis sp.) from New Zealand that has been partially overprinted by alteration. We report the physical pathways and settings of alteration, the resulting elemental and isotopic trends including δ7Li values and Li/Ca ratios, and assess whether remnants of the primary shell...

Summer Students

CERN Multimedia

2005-01-01

SUMMER STUDENT LECTURE PROGRAMME Main Auditorium, bldg. 500 DATE TIME LECTURER TITLE Monday 18 July 09:15 - 11:00 G. ROSS Fundamental concepts in Particle Physics (1-2/6) 11:15 - 12:00 N. PALANQUE-DELABROUILLE Astroparticle Physics (1/3) 12:00 Discussion Session Tuesday 19 July 09:15 - 10:00 G. ROSS Fundamental concepts in Particle Physics (3/6) 10:15 - 12:00 N. PALANQUE-DELABROUILLE Astroparticle Physics (2-3/3) 12:00 Discussion Session Wednesday 20 July 09:15 - 10:00 G. ROSS Fundamental concepts in Particle Physics (4/6) 10:15 - 11:00 F. RADEMAKERS ROOT 11:15 - 12:00 L. ROSSI Super-conducting magnet technology for particle accelerators and detectors 12:00 Discussion Session Thursday 21 July 09:15 - 10:00 G. ROSS Fundamental concepts in Particle Physics (5/6) 10:15 - 12:00 C. DE LA TAILLE Introduction to Electronics (1-2/3) 12:00 Discussion Session Friday 22 July 09:15 - 10:00 C. DE LA TAILLE Introduction to Electronics (3/3) 10:15 -...

Hierarchical partial order ranking

International Nuclear Information System (INIS)

Carlsen, Lars

2008-01-01

Assessing the potential impact on environmental and human health from the production and use of chemicals or from polluted sites involves a multi-criteria evaluation scheme. A priori several parameters are to address, e.g., production tonnage, specific release scenarios, geographical and site-specific factors in addition to various substance dependent parameters. Further socio-economic factors may be taken into consideration. The number of parameters to be included may well appear to be prohibitive for developing a sensible model. The study introduces hierarchical partial order ranking (HPOR) that remedies this problem. By HPOR the original parameters are initially grouped based on their mutual connection and a set of meta-descriptors is derived representing the ranking corresponding to the single groups of descriptors, respectively. A second partial order ranking is carried out based on the meta-descriptors, the final ranking being disclosed though average ranks. An illustrative example on the prioritisation of polluted sites is given. - Hierarchical partial order ranking of polluted sites has been developed for prioritization based on a large number of parameters

Basic fibroblast growth factor is pro-adipogenic in rat skeletal muscle progenitor clone, 2G11 cells.

Science.gov (United States)

Nakano, Shin-ichi; Nakamura, Katsuyuki; Teramoto, Naomi; Yamanouchi, Keitaro; Nishihara, Masugi

2016-01-01

Intramuscular adipose tissue (IMAT) formation is a hallmark of marbling in cattle. IMAT is considered to originate from skeletal muscle progenitor cells with adipogenic potential. However, the mechanism involved in IMAT formation from these progenitor cells in vivo remains unclear. In the present study, among the growth factors tested, which were known to be expressed in skeletal muscle, we found only basic fibroblast growth factor (bFGF) has a pro-adipogenic effect on skeletal muscle derived adipogenic progenitor clone, 2G11 cells. Pre-exposure of 2G11 cells to bFGF did not affect initial gene expressions of CCAAT/enhancer-binding protein (C/EBP)β and C/EBPδ, while resulting in an enhancement of subsequent expressions of C/EBPα and proliferator-activated receptor gamma (PPARγ) during adipogenesis, indicating that bFGF is acting on the transcriptional regulation of C/EBPα and PPARγ. In addition, the effect of bFGF is mediated via two types of FGF receptor (FGFR) isoforms: FGFR1 and FGFR2 IIIc, and both receptors are prerequisite for bFGF to express its pro-adipogenic effect. These results suggest that bFGF plays an important role as a key trigger of IMAT formation in vivo. © 2015 Japanese Society of Animal Science.

Effect of biotic and abiotic factors on soil microbial community diversity during primary succession on colliery spoil heaps

Czech Academy of Sciences Publication Activity Database

Elhottová, Dana; Frouz, Jan; Chroňáková, Alica; Malý, S.; Krištůfek, Václav; Kalčík, Jiří; Szili-Kovács, T.; Picek, T.

2004-01-01

Roč. 45, - (2004), s. 51 ISSN 0009-0646. [Kongres československé společnosti mikrobiologické /23./. 06.09.2004-09.09.2004, Brno] Keywords : soil microbial community * primary succession * colliery spoil heaps Subject RIV: EH - Ecology, Behaviour

Human Biomechanical and Cardiopulmonary Responses to Partial Gravity – A Systematic Review

Directory of Open Access Journals (Sweden)

Charlotte Richter

2017-08-01

Full Text Available The European Space Agency has recently announced to progress from low Earth orbit missions on the International Space Station to other mission scenarios such as exploration of the Moon or Mars. Therefore, the Moon is considered to be the next likely target for European human space explorations. Compared to microgravity (μg, only very little is known about the physiological effects of exposure to partial gravity (μg < partial gravity <1 g. However, previous research studies and experiences made during the Apollo missions comprise a valuable source of information that should be taken into account when planning human space explorations to reduced gravity environments. This systematic review summarizes the different effects of partial gravity (0.1–0.4 g on the human musculoskeletal, cardiovascular and respiratory systems using data collected during the Apollo missions as well as outcomes from terrestrial models of reduced gravity with either 1 g or microgravity as a control. The evidence-based findings seek to facilitate decision making concerning the best medical and exercise support to maintain astronauts' health during future missions in partial gravity. The initial search generated 1,323 publication hits. Out of these 1,323 publications, 43 studies were included into the present analysis and relevant data were extracted. None of the 43 included studies investigated long-term effects. Studies investigating the immediate effects of partial gravity exposure reveal that cardiopulmonary parameters such as heart rate, oxygen consumption, metabolic rate, and cost of transport are reduced compared to 1 g, whereas stroke volume seems to increase with decreasing gravity levels. Biomechanical studies reveal that ground reaction forces, mechanical work, stance phase duration, stride frequency, duty factor and preferred walk-to-run transition speed are reduced compared to 1 g. Partial gravity exposure below 0.4 g seems to be insufficient to maintain

THE STELLAR INITIAL MASS FUNCTION AT 0.9 < z < 1.5

Energy Technology Data Exchange (ETDEWEB)

Martín-Navarro, Ignacio; Trujillo, Ignacio; Vazdekis, Alexandre [Instituto de Astrofísica de Canarias, c/Vía Láctea s/n, E38205 - La Laguna, Tenerife (Spain); Pérez-González, Pablo G.; Esquej, Pilar; Sánchez, Helena Domínguez; Espino, Néstor [Departamento de Astrofísica, Facultad de CC. Físicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain); Barro, Guillermo [UCO/Lick Observatory, Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Bruzual, Gustavo [Centro de Radioastronomía y Astrofísica, UNAM, Campus Morelia, México (Mexico); Charlot, Stéphane [UPMC-CNRS, UMR7095, Institut d' Astrophysique de Paris, F-75014 Paris (France); Cava, Antonio [Observatoire de Genève, Université de Genève, 51 Ch. des Maillettes, 1290 Versoix (Switzerland); Ferreras, Ignacio [Mullard Space Science Laboratory, University College London, Holmbury St. Mary, Dorking, Surrey RH5 6NT (United Kingdom); Barbera, Francesco La [INAF-Osservatorio Astronomico di Capodimonte, Napoli (Italy); Koekemoer, Anton M. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Cenarro, A. Javier, E-mail: imartin@iac [Centro de Estudios de Física del Cosmos de Aragǿn, Plaza San Juan 1, E-44001 Teruel (Spain)

2015-01-01

We explore the stellar initial mass function (IMF) of a sample of 49 massive quiescent galaxies (MQGs) at 0.9 < z < 1.5. We base our analysis on intermediate resolution spectro-photometric data in the GOODS-N field taken in the near-infrared and optical with the Hubble Space Telescope Wide Field Camera 3 G141 grism and the Survey for High-z Absorption Red and Dead Sources. To constrain the slope of the IMF, we have measured the TiO{sub 2} spectral feature, whose strength depends strongly on the content of low-mass stars, as well as on stellar age. Using ultraviolet to near-infrared individual and stacked spectral energy distributions, we have independently estimated the stellar ages of our galaxies. Knowing the age of the stellar population, we interpret the strong differences in the TiO{sub 2} feature as an IMF variation. In particular, for the heaviest z ∼ 1 MQGs (M > 10{sup 11} M {sub ☉}), we find an average age of 1.7 ± 0.3 Gyr and a bottom-heavy IMF (Γ {sub b} = 3.2 ± 0.2). Lighter MQGs (2 × 10{sup 10} < M < 10{sup 11} M {sub ☉}) at the same redshift are younger on average (1.0 ± 0.2 Gyr) and present a shallower IMF slope (Γ{sub b}=2.7{sub −0.4}{sup +0.3}). Our results are in good agreement with the findings about the IMF slope in early-type galaxies of similar mass in the present-day universe. This suggests that the IMF, a key characteristic of the stellar populations in galaxies, is bottom-heavier for more massive galaxies and has remained unchanged in the last ∼8 Gyr.

Neonatal Caffeine Treatment and Respiratory Function at 11 Years in Children under 1,251 g at Birth.

Science.gov (United States)

Doyle, Lex W; Ranganathan, Sarath; Cheong, Jeanie L Y

2017-11-15

Caffeine in the newborn period shortens the duration of assisted ventilation and reduces the incidence of bronchopulmonary dysplasia, but its effects on respiratory function in later childhood are unknown. To determine if children born with birth weight less than 1,251 g who were treated with neonatal caffeine had improved respiratory function at 11 years of age compared with children treated with placebo. Children enrolled in the CAP (Caffeine for Apnea of Prematurity) randomized controlled trial and assessed at the Royal Women's Hospital in Melbourne at 11 years of age had expiratory flow rates measured according to the standards of the American Thoracic Society. Values were converted to z-scores predicted for age, height, ethnicity, and sex. Parents completed questionnaires related to their child's respiratory health. A total of 142 children had expiratory flows measured. Expiratory flows were better in the caffeine group, by approximately 0.5 SD for most variables (e.g., FEV 1 ; mean z-score, -1.00 vs. -1.53; mean difference, 0.54; 95% confidence interval, 0.14-0.94; P = 0.008). Fewer children in the caffeine group had values for FVC below the fifth centile (11% vs. 28%; odds ratio, 0.31; 95% confidence interval, 0.12-0.77; P = 0.012). When adjusted for bronchopulmonary dysplasia, the difference in flow rates between groups diminished. Caffeine treatment in the newborn period improves expiratory flow rates in midchildhood, which seems to be achieved by improving respiratory health in the newborn period. Follow-up lung function testing in adulthood is vital for these individuals. Future placebo-controlled randomized trials of neonatal caffeine are unlikely. Clinical trial registered with www.clinicaltrials.gov (NCT00182312).

Abstracts from Dietetic Research Event: June 09-11, 2016.

Science.gov (United States)

2016-09-01

Winnipeg, Manitoba was the host city of the 2016 Dietitians of Canada Annual Conference. Through the support of Dietitians of Canada and CFDR, the 2016 event was both an exciting and informative exchange of research and experience-sharing efforts that inspired attendees. The submissions for this year's Canadian Foundation for Dietetic Research (CFDR) event represented the diversity of dietetic research conducted within Canada. The topics highlighted from this year's abstracts include Community Based Nutritional Care, Wellness & Public Health, Determinants of Food Choice, Dietary Intake, Nutrition Health & Education, Dietetic Practice & Education, Clinical Research & Patient Service, and Nutrition Social Media & the Web. Each presenter provided an 11-minute oral presentation (8 minutes for presenting and 3 minutes for questions). This allowed for meaningful interaction between the presenters and those attending the sessions. This year there were professional and student oral research presentations on each day of the conference. These presentations offered the newest insights into important research findings that apply to dietetic practice. This research event would not be possible without the commitment and dedication of many people. On behalf of Dietitians of Canada and CFDR, I would like to extend a special thank you to the 2016 Abstract Review Committee who represented research, clinical nutrition, community nutrition, and education: Masha Jessri (Ph.D Candidate, University of Toronto), Joyce Slater (Associate Professor, University of Manitoba) and Miyoung Suh (Associate Professor, University of Manitoba). We would also like to thank all of our moderators who assisted during the conference to keep our research presentation sessions on time: Marcia Cooper, Miyoung Suh, Andrea Buchholz, Dawna Royall, Paul Fieldhouse, Joyce Slater, Isabelle Giroux, and Bethany Hopkins. Finally, a special thank you to Michelle Naraine and Greg Sarney at CFDR for their assistance and

iWork '09 pocket genius

CERN Document Server

Hart-Davis, Guy

2010-01-01

If you want to get the very most out of the suite of iWork '09 applications, put this savvy Portable Genius guide to work. Want to create professional-quality documents? Make your spreadsheets powerful and unique? Deliver a persuasive presentation in person, on paper, or via the Internet? You'll find cool and useful Genius tips, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy the iWork '09 applications to the max.

Partial and No Recovery from Delirium in Older Hospitalized Adults: Frequency and Baseline Risk Factors.

Science.gov (United States)

Cole, Martin G; Bailey, Robert; Bonnycastle, Michael; McCusker, Jane; Fung, Shek; Ciampi, Antonio; Belzile, Eric; Bai, Chun

2015-11-01

To determine the frequency and baseline risk factors for partial and no recovery from delirium in older hospitalized adults. Cohort study with assessment of recovery status approximately 1 and 3 months after enrollment. University-affiliated, primary, acute-care hospital. Medical or surgical inpatients aged 65 and older with delirium (N = 278). The Mini-Mental State Examination (MMSE), Confusion Assessment Method (CAM), Delirium Index (DI), and activities of daily living (ADLs) were completed at enrollment and each follow-up. Primary outcome categories were full recovery (absence of CAM core symptoms of delirium), partial recovery (presence of ≥1 CAM core symptoms but not meeting criteria for delirium), no recovery (met CAM criteria for delirium), or death. Secondary outcomes were changes in MMSE, DI, and ADL scores between the baseline and last assessment. Potential risk factors included many clinical and laboratory variables. In participants with dementia, frequencies of full, partial, and no recovery and death at first follow-up were 6.3%, 11.3%, 74.6%, and 7.7%, respectively; in participants without dementia, frequencies were 14.3%, 17%, 50.9%, and 17.9%, respectively. In participants with dementia, frequencies at the second follow-up were 7.9%, 15.1%, 57.6%, and 19.4%, respectively; in participants without dementia, frequencies were 19.2%, 20.2%, 31.7%, and 28.8%, respectively. Frequencies were similar in participants with prevalent and incident delirium and in medical and surgical participants. The DI, MMSE, and ADL scores of many participants with partial and no recovery improved. Independent baseline risk factors for delirium persistence were chart diagnosis of dementia (odds ratio (OR) = 2.51, 95% confidence interval (CI) =1.38, 4.56), presence of any malignancy (OR = 5.79, 95% CI = 1.51, 22.19), and greater severity of delirium (OR =9.39, 95% CI = 3.95, 22.35). Delirium in many older hospitalized adults appears to be much more protracted than previously

Effect of MCM09, an active site-directed inhibitor of factor Xa, on B16-BL6 melanoma lung colonies in mice.

Science.gov (United States)

Rossi, C; Hess, S; Eckl, R W; di Lena, A; Bruno, A; Thomas, O; Poggi, A

2006-03-01

Treatment with anticoagulant drugs has shown potential inhibitory effect on tumor invasion, although the relationship with clotting inhibition was not clear. The aim of our study was to evaluate the potential antitumor activity of MCM09, a newly developed, active site-directed, small molecule inhibitor of factor Xa (FXa) [WO0216312], and to relate the findings to anticlotting potency. MCM09 (0.1-10 mg kg(-1)) or heparin (H; 10 mg kg(-1)) was injected intravenously (i.v.), with 5 x 10(4) B16-BL6 melanoma cells, in C57BL/6 mice. Mice were killed after 18 days, to count lung colonies. Ex vivo anticoagulant activity was measured by activated partial thromboplastin time (APTT) on mouse plasma. MCM09, a selective inhibitor of FXa (IC-50 = 2.4 nm against human FXa), inhibited in a dose-dependent manner B16-BL6 melanoma lung colonies in mice. Mean lung metastasis number was 20.9 +/- 4.8 in controls (n = 10), 1.2 +/- 0.4 in mice treated with H, 10 mg kg(-1) i.v. (P < 0.01), 0.9 +/- 0.3, 9.2 +/- 2.2 and 15.5 +/- 2.6 in mice treated with MCM09, at 10 (P < 0.01), 1 (P < 0.05) and 0.1 mg kg(-1) i.v. (ns), respectively. MCM09 (10 mg kg(-1) i.v.) significantly prolonged APTT (57.1 +/- 10.2 s) 30 min after i.v. injection when compared with controls (25.3 +/- 1.6 s; P < 0.05). Lung colonies were 74.2-72.6% reduced by MCM09 (10 mg kg(-1)) given 60 or 120 min before cells, but not by MCM09 given 60 min thereafter, suggesting a direct cell interaction as a mechanism underlying antitumor activity.

Low-resistance magnetic tunnel junctions prepared by partial remote plasma oxidation of 0.9 nm Al barriers

International Nuclear Information System (INIS)

Ferreira, Ricardo; Freitas, Paulo P.; MacKenzie, Maureen; Chapman, John N.

2005-01-01

Current perpendicular to the plane read-head elements suitable for high-density magnetic storage require low resistance while maintaining a reasonable magnetoresistive (MR) signal (RxA 2 and MR>20% for areal densities >200 Gb/in 2 ). This letter shows that competitive low RxA junctions can be produced using underoxidized barriers starting from 0.9 nm thick Al layers. For as-deposited junctions, tunneling magnetoresistance (TMR) ∼20% for RxA∼2-15 Ω μm 2 is obtained, while in the RxA∼60-150 Ω μm 2 range, TMR values between 40% to 45% are achieved. A limited number of junctions exhibits considerably lower RxA values with respect to the average, while keeping a similar MR (down to 0.44 Ω μm 2 with TMR of 20% and down to 2.2 Ω μm 2 with TMR of 52%). Experimental data suggest that current confinement to small regions (barrier defects/hot spots) may explain these results

Clinical Characteristics, Management, and Outcome of 22 Cases of Primary Hypophysitis

Directory of Open Access Journals (Sweden)

Sun Mi Park

2014-12-01

Full Text Available BackgroundPrimary hypophysitis causes varying degrees of endocrine dysfunction and mass effect. The natural course and best treatment have not been well established.MethodsMedical records of 22 patients who had been diagnosed with primary hypophysitis between January 2001 and March 2013 were retrospectively reviewed. Based on the anatomical location, we classified the cases as adenohypophysitis (AH, infundibuloneurohypophysitis (INH, and panhypophysitis (PH. Clinical presentation, endocrine function, pathologic findings, magnetic resonance imaging findings, and treatment courses were reviewed.ResultsAmong 22 patients with primary hypophysitis, 81.8% (18/22 had involvement of the posterior pituitary lobe. Two patients of the AH (2/3, 66.6% and three patients of the PH (3/10, 30% groups initially underwent surgical mass reduction. Five patients, including three of the PH (3/10, 33.3% group and one from each of the AH (1/3, 33.3% and INH (1/9, 11.1% groups, initially received high-dose glucocorticoid treatment. Nearly all of the patients treated with surgery or high-dose steroid treatment (9/11, 82% required continuous hormone replacement during the follow-up period. Twelve patients received no treatment for mass reduction due to the absence of acute symptoms and signs related to a compressive mass effect. Most of them (11/12, 92% did not show disease progression, and three patients recovered partially from hormone deficiency.ConclusionDeficits of the posterior pituitary were the most common features in our cases of primary hypophysitis. Pituitary endocrine defects responded less favorably to glucocorticoid treatment and surgery. In the absence of symptoms related to mass effect and with the mild defect of endocrine function, it may not require treatment to reduce mass except hormone replacement.

Estimation of cis-9, trans-11 conjugated linoleic acid content in UK foods and assessment of dietary intake in a cohort of healthy adults.

Science.gov (United States)

Mushtaq, Sohail; Heather Mangiapane, E; Hunter, Kirsty A

2010-05-01

Dietary conjugated linoleic acid (CLA) from ruminant-derived foods may be potentially beneficial to health. The quantity of cis-9, trans-11 CLA and trans-10, cis-12 CLA in a range of UK foodstuffs (112 foods) was determined using triple-column silver ion HPLC. The cis-9, trans-11 CLA content ranged from 1.9 mg/g lipid (mild Cheddar) to 7.3 mg/g lipid (processed cheese) in cheeses, from 0.9 mg/g lipid (ice cream) to 3.7 mg/g lipid (double cream) in non-cheese dairy products, and from 2.9 mg/g lipid (Swedish meatballs) to 6.0 mg/g lipid (minced lamb) in meat products. cis-9, trans-11 CLA concentrations for chocolate and sweets ranged from 0.1 mg/g lipid (hot chocolate) to 4.8 mg/g lipid (buttermint). The trans-10, cis-12 CLA isomer was undetected or negligible in the food samples examined. To provide information about dietary cis-9, trans-11 CLA intakes in the UK, a study was performed to estimate the daily intake of CLA in a cohort of eighteen healthy volunteers (nine female and nine male; aged 21-60 years; mean BMI = 24.0 kg/m2 (sd 2.2)) with a 7-d weighed food record. This information combined with the CLA isomer contents of UK foodstuffs was used to estimate the daily intake of the cohort. The mean daily intake of cis-9, trans-11 CLA was estimated to be 97.5 (sd 73.3) mg/d. Due to its potential health benefits, it is important to determine the CLA content of food and dietary intake as these data will be useful in determining the role of CLA in health and disease.

Chemical, physical and profile oceanographic data collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069126)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the...

Chemical, physical and profile oceanographic data collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069113)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the...

Summer Student Lecture Programme

CERN Multimedia

2004-01-01

Main Auditorium, bldg. 500 DATE TIME LECTURER TITLE Monday 2 August 09:15 - 10:00 P. Wells (CERN) The Higgs Saga at LEP 10:15 - 11:00 G. Cowan (Univ. of London) Introduction to Statistics (2/3) 11:15 - 12:00 G. Cowan (Univ. of London) Introduction to Statistics (3/3) DATE TIME LECTURER TITLE Tuesday 3 August 09:15 - 10:00 P. Sphicas (CERN) Trigger and Data Acquisition Systems (1/2) 10:15 - 11:00 R. Jacobsen (LBLN) From Raw Data to Physics Results (1/2) 11:15 - 12:00 R. Jacobsen (LBLN) G. Cowan (University of London) Discussion Session DATE TIME LECTURER TITLE Wednesday 4 August 09:15 - 10:00 P. Sphicas (CERN) Trigger and Data Acquisition Systems (2/2) 10:15 - 11:00 R. Jacobsen (LBLN) From Raw Data to Physics Results (2/2) 11:15 - 12:00 N. Palanque-Delabrouille (CEA) Astroparticle Physics (1/3) DATE TIME LECTURER TITLE Thursday 5 August 09:15 - 10:00 N. Palanque-Delabrouille (CEA) Astroparticle Physics (2/3) 10:15 - 11:00 N. Palanque-Delabrouille (CEA) A...

G Prathap

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education. G Prathap. Articles written in Resonance – Journal of Science Education. Volume 1 Issue 11 November 1996 pp 2-3 Article-in-a-Box. Karl Popper · G Prathap · More Details Fulltext PDF ...

Group formalism of Lie transformations to time-fractional partial ...

Indian Academy of Sciences (India)

Lie symmetry analysis; Fractional partial differential equation; Riemann–Liouville fractional derivative ... science and engineering. It is known that while ... differential equations occurring in different areas of applied science [11,14]. The Lie ...

Dissolved inorganic carbon, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from the THOMAS G. THOMPSON in the North Pacific Ocean from 1997-11-01 to 1997-11-11 (NODC Accession 0115176)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0115176 includes chemical, discrete sample, physical and profile data collected from THOMAS G. THOMPSON in the North Pacific Ocean from 1997-11-01 to...

[Analysis of genomic copy number variations in two sisters with primary amenorrhea and hyperandrogenism].

Science.gov (United States)

Zhang, Yanliang; Xu, Qiuyue; Cai, Xuemei; Li, Yixun; Song, Guibo; Wang, Juan; Zhang, Rongchen; Dai, Yong; Duan, Yong

2015-12-01

To analyze genomic copy number variations (CNVs) in two sisters with primary amenorrhea and hyperandrogenism. G-banding was performed for karyotype analysis. The whole genome of the two sisters were scanned and analyzed by array-based comparative genomic hybridization (array-CGH). The results were confirmed with real-time quantitative PCR (RT-qPCR). No abnormality was found by conventional G-banded chromosome analysis. Array-CGH has identified 11 identical CNVs from the sisters which, however, overlapped with CNVs reported by the Database of Genomic Variants (http://projects.tcag.ca/variation/). Therefore, they are likely to be benign. In addition, a -8.44 Mb 9p11.1-p13.1 duplication (38,561,587-47,002,387 bp, hg18) and a -80.9 kb 4q13.2 deletion (70,183,990-70,264,889 bp, hg18) were also detected in the elder and younger sister, respectively. The relationship between such CNVs and primary amenorrhea and hyperandrogenism was however uncertain. RT-qPCR results were in accordance with array-CGH. Two CNVs were detected in two sisters by array-CGH, for which further studies are needed to clarify their correlation with primary amenorrhea and hyperandrogenism.

Infinite partial summations

International Nuclear Information System (INIS)

Sprung, D.W.L.

1975-01-01

This paper is a brief review of those aspects of the effective interaction problem that can be grouped under the heading of infinite partial summations of the perturbation series. After a brief mention of the classic examples of infinite summations, the author turns to the effective interaction problem for two extra core particles. Their direct interaction is summed to produce the G matrix, while their indirect interaction through the core is summed in a variety of ways under the heading of core polarization. (orig./WL) [de

G4CEP: A G4 theory modification by including pseudopotential for molecules containing first-, second- and third-row representative elements

Energy Technology Data Exchange (ETDEWEB)

Silva, Cleuton de Souza [Instituto de Química, Universidade Estadual de Campinas, Barão Geraldo, P.O. Box 6154, 13083-970 Campinas, São Paulo (Brazil); Instituto de Ciências Exatas e Tecnologia, Universidade Federal do Amazonas, Campus de Itacoatiara, 69100-021 Itacoatiara, Amazonas (Brazil); Pereira, Douglas Henrique [Departamento de Ciências Exatas e Biotecnológicas, Universidade Federal do Tocantins, Campus de Gurupi, 77410-530 Gurupi, Tocantins (Brazil); Custodio, Rogério, E-mail: roger@iqm.unicamp.br [Instituto de Química, Universidade Estadual de Campinas, Barão Geraldo, P.O. Box 6154, 13083-970 Campinas, São Paulo (Brazil)

2016-05-28

The G4CEP composite method was developed from the respective G4 all-electron version by considering the implementation of compact effective pseudopotential (CEP). The G3/05 test set was used as reference to benchmark the adaptation by treating in this work atoms and compounds from the first and second periods of the periodic table, as well as representative elements of the third period, comprising 440 thermochemical data. G4CEP has not reached a so high level of accuracy as the G4 all-electron theory. G4CEP presented a mean absolute error around 1.09 kcal mol{sup −1}, while the original method presents a deviation corresponding to 0.83 kcal mol{sup −1}. The similarity of the optimized molecular geometries between G4 and G4CEP indicates that the core-electron effects and basis set adjustments may be pointed out as a significant factor responsible for the large discrepancies between the pseudopotential results and the experimental data, or even that the all-electron calculations are more efficient either in its formulation or in the cancellation of errors. When the G4CEP mean absolute error (1.09 kcal mol{sup −1}) is compared to 1.29 kcal mol{sup −1} from G3CEP, it does not seem so efficient. However, while the G3CEP uncertainty is ±4.06 kcal mol{sup −1}, the G4CEP deviation is ±2.72 kcal mol{sup −1}. Therefore, the G4CEP theory is considerably more reliable than any previous combination of composite theory and pseudopotential, particularly for enthalpies of formation and electron affinities.

Pertussis toxin, an inhibitor of G(αi PCR, inhibits bile acid- and cytokine-induced apoptosis in primary rat hepatocytes.

Directory of Open Access Journals (Sweden)

Golnar Karimian

Full Text Available Excessive hepatocyte apoptosis is a common event in acute and chronic liver diseases leading to loss of functional liver tissue. Approaches to prevent apoptosis have therefore high potential for the treatment of liver disease. G-protein coupled receptors (GPCR play crucial roles in cell fate (proliferation, cell death and act through heterotrimeric G-proteins. G(αiPCRs have been shown to regulate lipoapoptosis in hepatocytes, but their role in inflammation- or bile acid-induced apoptosis is unknown. Here, we analyzed the effect of inhibiting G(αiPCR function, using pertussis toxin (PT, on bile acid- and cytokine-induced apoptosis in hepatocytes. Primary rat hepatocytes, HepG2-rNtcp cells (human hepatocellular carcinoma cells or H-4-II-E cells (rat hepatoma cells were exposed to glycochenodeoxycholic acid (GCDCA or tumor necrosis factor-α (TNFα/actinomycin D (ActD. PT (50-200 nmol/L was added 30 minutes prior to the apoptotic stimulus. Apoptosis (caspase-3 activity, acridine orange staining and necrosis (sytox green staining were assessed. PT significantly reduced GCDCA- and TNFα/ActD-induced apoptosis in rat hepatocytes (-60%, p<0.05 in a dose-dependent manner (with no shift to necrosis, but not in HepG2-rNtcp cells or rat H-4-II-E cells. The protective effect of pertussis toxin was independent of the activation of selected cell survival signal transduction pathways, including ERK, p38 MAPK, PI3K and PKC pathways, as specific protein kinase inhibitors did not reverse the protective effects of pertussis toxin in GCDCA-exposed hepatocytes.Pertussis toxin, an inhibitor of G(αiPCRs, protects hepatocytes, but not hepatocellular carcinoma cells, against bile acid- and cytokine-induced apoptosis and has therapeutic potential as primary hepatoprotective drug, as well as adjuvant in anti-cancer therapy.

Academic Training: Summer Student Lecture Programme

CERN Multimedia

2004-01-01

Main Auditorium, bldg. 500 DATE TIME LECTURER TITLE Monday 12 July 09:15 - 10:00 G. Ross (The Rudolf Peierls Centre for Theoretical Physics & CERN) Fundamental Concepts of Particle Physics (1/6) 10:15 - 11:00 O. Bruening (CERN) Accelerators (1/5) 11:15 - 12:00 L. Di Lella (CERN) Introduction to Particle Physics (4/4) DATE TIME LECTURER TITLE Tuesday 13 July 09:15 - 10:00 G. Ross (The Rudolf Peierls Centre for Theoretical Physics & CERN) Fundamental Concepts of Particle Physics (2/6) 10:15 - 11:00 O. Bruening (CERN) Accelerators (2/5) 11:15 - 12:00 O. Bruening (CERN) G. Ross (The Rudolf Peierls Centre for Theoretical Physics & CERN) Discussion Session DATE TIME LECTURER TITLE Wednesday 14 July 09:15 - 10:00 G. Ross (The Rudolf Peierls Centre for Theoretical Physics & CERN) Fundamental Concepts of Particle Physics (3/6) 10:15 - 11:00 O. Bruening (CERN) Accelerators (3/5) 11:15 - 12:00 O. Bruening (CERN) Accelerators (4/5) 14:00 - ...

A Precision Measurement of the Spin Structure Functions f^p_1 and g^g_1

Energy Technology Data Exchange (ETDEWEB)

Toole, T.

2004-12-13

In Experiment E155 at the Stanford Linear Accelerator Center, the spin dependent structure function g{sub 1}(x,Q{sup 2}) was measured for both the proton and deuteron. This was accomplished by scattering 48.3 GeV highly polarized electrons (0.813 {+-} 0.020) off polarized {sup 15}NH{sub 3} (proton) and {sup 6}LiD (deuteron) targets. Data were collected in March and April of 1997 using three fixed angle, momentum analyzing spectrometers centered at 2.75{sup o}, 5.5{sup o}, and 10.5{sup o}. This enabled a kinematic coverage of 0.01 < x < 0.9 and 1 GeV{sup 2} < Q{sup 2} < 40 GeV{sup 2}. At an average Q{sup 2} of 5 GeV{sup 2}, the integrals in the measured region were f{sub 0.014}{sup 0.9}g{sub 1}(x)dx = 0.119 {+-} 0.002(stat.) {+-} 0.009(syst.) for the proton and 0.043 {+-} 0.003(stat.) {+-} 0.003(syst.) for the deuteron. Using a perturbative QCD analysis which included a global data set, the results were found to be consistent with the Bjorken Sum Rule. Asymmetry measurements also were made using photoproduced hadrons. Data were collected concurrently with the g{sub 1} data. For the proton, the asymmetries were small and non-zero. The deuteron measurements were consistent with zero.

A −3 dBm RF transmitter front-end for 802.11g application

International Nuclear Information System (INIS)

Zhao Jinxin; Yan Jun; Shi Yin

2013-01-01

A 2.4 GHz, direct-conversion RF transmitter front-end with an up converter and PA driver is fabricated in a 0.13 μm CMOS process for the reliable transmission of 54 Mb/s OFDM signals. The front-end output power is −3 dBm while the corresponding EVM is −27 dB which is necessary for the 802.11g standard of EVM at −25 dB. With the adopted gain control strategy the output power changes from −14.3 to −3.7 dBm with every step 0.8 dB (20%) which covers the gain variation due to working temperature and process. A power detector indicates the output power and delivers a voltage to the baseband to control the output power. (semiconductor integrated circuits)

Turbidity, SOLAR RADIATION - ATMOSPHERIC and other data from NATHANIEL B. PALMER from 1994-11-09 to 1994-12-08 (NODC Accession 9700174)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Temperature, salinity, and other data were collected from bottle and CTD casts from the Nathaniel B. Palmer from 09 November 1994 to 08 December 1994. Data were...

Vinorelbine rescue therapy for dogs with primary urinary bladder carcinoma.

Science.gov (United States)

Kaye, M E; Thamm, D H; Weishaar, K; Lawrence, J A

2015-12-01

The goal of this study was to evaluate the anti-tumour activity and toxicoses of vinorelbine as a palliative rescue therapy for dogs with primary urinary bladder carcinoma. Thirteen dogs refractory to prior chemotherapeutics and one dog naïve to chemotherapeutic treatment were enrolled. Vinorelbine (15 mg m(-2) IV) was administered intravenously along with concurrent oral anti-inflammatory drugs, if tolerated. A median of six doses of vinorelbine (range: 1-16) was administered. Two dogs (14%) had partial responses, and eight (57%) experienced stable disease. Subjective improvement in clinical signs was noted in 11 dogs (78%). Adverse events were mild and primarily haematological in nature. Median time to progression was 93 days (range: 20-239 days). Median survival time for all dogs was 187 days; median survival for 13 pre-treated dogs was 207 days. Vinorelbine may have utility in the management of canine primary urinary bladder carcinoma and should be evaluated in a prospective study. © 2013 John Wiley & Sons Ltd.

Traveling wave solutions of a biological reaction-convection-diffusion equation model by using $(G'/G$ expansion method

Directory of Open Access Journals (Sweden)

Shahnam Javadi

2013-07-01

Full Text Available In this paper, the $(G'/G$-expansion method is applied to solve a biological reaction-convection-diffusion model arising in mathematical biology. Exact traveling wave solutions are obtained by this method. This scheme can be applied to a wide class of nonlinear partial differential equations.

Dopamine D2 receptor radiotracers [{sup 11}C](+)-PHNO and [{sup 3}H]raclopride are indistinguishably inhibited by D2 agonists and antagonists ex vivo

Energy Technology Data Exchange (ETDEWEB)

McCormick, Patrick N. [Institute of Medical Science, University of Toronto, Toronto, Ontario, M5S 1A8 (Canada)], E-mail: patrick.mccormick@camhpet.ca; Kapur, Shitij [Department of Psychiatry, University of Toronto, Toronto, Ontario, M5S 1A8 (Canada); PET Center, Center for Addiction and Mental Health, Toronto, Ontario, M5T 1R8 (Canada); Seeman, Philip [Department of Psychiatry, University of Toronto, Toronto, Ontario, M5S 1A8 (Canada); Department of Pharmacology, University of Toronto, Toronto, Ontario, M5S 1A8 (Canada); Wilson, Alan A. [Department of Psychiatry, University of Toronto, Toronto, Ontario, M5S 1A8 (Canada); PET Center, Center for Addiction and Mental Health, Toronto, Ontario, M5T 1R8 (Canada)

2008-01-15

Introduction: In vitro, the dopamine D2 receptor exists in two states, with high and low affinity for agonists. The high-affinity state is the physiologically active state thought to be involved in dopaminergic illnesses such as schizophrenia. The positron emission tomography radiotracer [{sup 11}C](+)-PHNO ([{sup 11}C](+)-4-propyl-3,4,4a,5,6,10b-hexahydro-2H-naphtho[1,2-b][1,4] oxazin-9-o l), being a D2 agonist, should selectively label the high-affinity state at tracer dose and therefore be more susceptible to competition by agonist as compared to the antagonist [{sup 3}H]raclopride, which binds to both affinity states. Methods: We tested this prediction using ex vivo dual-radiotracer experiments in conscious rats. D2 antagonists (haloperidol or clozapine), a partial agonist (aripiprazole), a full agonist [(-)-NPA] or the dopamine-releasing drug amphetamine (AMPH) were administered to rats prior to an intravenous coinjection of [{sup 11}C](+)-PHNO and [{sup 3}H]raclopride. Rats were sacrificed 60 min after radiotracer injection. Striatum, cerebellum and plasma samples were counted for {sup 11}C and {sup 3}H. The specific binding ratio {l_brace}SBR, i.e., [%ID/g (striatum)-%ID/g (cerebellum)]/(%ID/g (cerebellum){r_brace} was used as the outcome measure. Results: In response to D2 antagonists, partial agonist or full agonist, [{sup 11}C](+)-PHNO and [{sup 3}H]raclopride SBRs responded indistinguishably in terms of both ED{sub 50} and Hill slope (e.g., (-)-NPA ED{sub 50} values are 0.027 and 0.023 mg/kg for [{sup 11}C](+)-PHNO and [{sup 3}H]raclopride, respectively). In response to AMPH challenge, [{sup 11}C](+)-PHNO and [{sup 3}H]raclopride SBRs were inhibited to the same degree. Conclusions: We have shown that the SBRs of [{sup 11}C](+)-PHNO- and [{sup 3}H]raclopride do not differ in their response to agonist challenge. These results do not support predictions of the in vivo binding behavior of a D2 agonist radiotracer and cast some doubt on the in vivo

The (2p, 2p) 11Δg state of 6Li2: Fourier transform spectrum of the 11Δg-B1IIu transition

International Nuclear Information System (INIS)

Linton, C.; Martin, F.; Crozet, P.; Ross, A.J.; Bacis, R.

1993-01-01

The 1 1 Δ g -B 1 II u transition of 6 Li 2 has been observed in collisionally induced fluorescence following single frequency optical-optical double resonance excitation of the F 1 Σ g + state using a ring dye laser with DCM dye. Spectra of the s and a symmetry levels were obtained separately, at high resolution, in the near-infrared region using a Fourier transform spectrometer. The molecular constants (Dunham coefficients) of the 1 1 Δ g state have been calculated. Comparison of the constants and dissociation energy with ab initio calculations has shown that the 1 1 Δ g state correlates with Li(2p) + Li(2p) and has a dissociation energy of 9,579 ± 1 cm -1 . The energy transfer process responsible for excitation of the 1 1 Δ g state is discussed

40 CFR 61.09 - Notification of startup.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Notification of startup. 61.09 Section...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS General Provisions § 61.09 Notification of startup. (a) The owner or operator of each stationary source which has an initial startup after the effective...

Synthesis and positron emission tomography studies of C-11-labeled isotopomers and metabolites of GTS-21, a partial α7 nicotinic cholinergic agonist drug

International Nuclear Information System (INIS)

Kim, Sung Won; Ding Yushin; Alexoff, David; Patel, Vinal; Logan, Jean; Lin, K.-S.; Shea, Colleen; Muench, Lisa; Xu Youwen; Carter, Pauline; King, Payton; Constanzo, Jasmine R.; Ciaccio, James A.; Fowler, Joanna S.

2007-01-01

Introduction: (3E)-3-[(2,4-dimethoxyphenyl)methylene]-3,4,5,6-tetrahydro-2,3'-bipyridine (GTS-21), a partial α7 nicotinic acetylcholine receptor agonist drug, has recently been shown to improve cognition in schizophrenia and Alzheimer's disease. One of its two major demethylated metabolites, 4-OH-GTS-21, has been suggested to contribute to its therapeutic effects. Methods: We labeled GTS-21 in two different positions with carbon-11 ([2-methoxy- 11 C]GTS-21 and [4- 11 C]GTS-21) along with two corresponding demethylated metabolites ([2-methoxy- 11 C]4-OH-GTS-21 and [4-methoxy- 11 C]2-OH-GTS-21) for pharmacokinetic studies in baboons and mice with positron emission tomography (PET). Results: Both [2- 11 C]GTS-21 and [4-methoxy- 11 C]GTS-21 showed similar initial high rapid uptake in baboon brain, peaking from 1 to 3.5 min (0.027-0.038%ID/cc) followed by rapid clearance (t 1/2 11 C]GTS-21 continued to clear while [4-methoxy- 11 C]GTS-21 plateaued, suggesting the entry of a labeled metabolite into the brain. Comparison of the pharmacokinetics of the two labeled metabolites confirmed expected higher brain uptake and retention of [4-methoxy- 11 C]2-OH-GTS-21 (the labeled metabolite of [4-methoxy- 11 C]GTS-21) relative to [2-methoxy- 11 C]4-OH-GTS-21 (the labeled metabolite of [2-methoxy- 11 C]GTS-21), which had negligible brain uptake. Ex vivo studies in mice showed that GTS-21 is the major chemical form in the mouse brain. Whole-body dynamic PET imaging in baboon and mouse showed that the major route of excretion of C-11 is through the gallbladder. Conclusions: The major findings are as follows: (a) extremely rapid uptake and clearance of [2-methoxy- 11 C]GTS-21 from the brain, which may need to be considered in developing optimal dosing of GTS-21 for patients, and (b) significant brain uptake of 2-OH-GTS-21, suggesting that it might contribute to the therapeutic effects of GTS-21. This study illustrates the value of comparing different label positions and labeled

Neuromuscular Exercise Post Partial Medial Meniscectomy

DEFF Research Database (Denmark)

Hall, Michelle; Hinman, Rana S; Wrigley, Tim V

2015-01-01

PURPOSE: To evaluate the effects of a 12-week, home-based, physiotherapist-guided neuromuscular exercise program on the knee adduction moment (an indicator of mediolateral knee load distribution) in people with a medial arthroscopic partial meniscectomy within the past 3-12 months. METHODS......: An assessor-blinded, randomised controlled trial including people aged 30-50 years with no to mild pain following medial arthroscopic partial meniscectomy was conducted. Participants were randomly allocated to either a 12-week neuromuscular exercise program that targeted neutral lower limb alignment...... or a control group with no exercise. The exercise program included eight individual sessions with one of seven physiotherapists in private clinics, together with home exercises. Primary outcomes were the peak external knee adduction moment during normal pace walking and during a one-leg sit-to-stand. Secondary...

Atomic-partial vibrational density of states of i-AlCuFe quasicrystals

International Nuclear Information System (INIS)

Parshin, P.P.; Zemlyanov, M.; Brand, R.A.; Dianoux, A.J.; Calvayrac, Y.

2002-01-01

We present new results on the separation of the atomic-partial vibrational density of states for the ternary quasicrystal i-Al 62 Cu 25.5 Fe 12.5 . The decomposition into three atomic-partial functions, Al-, Cu- and Fe-g(E), has been performed self-consistently with the calculation of the multi-phonon contributions. The results show the surprising result that both Cu- and Fe-g(E) are strongly peaked. The low-energy regions of Al- and Cu-g(E) show strong deviations from Debye behaviour due to the presence of non-propagating low-energy vibrational states. (orig.)

Summer Students

CERN Multimedia

2005-01-01

SUMMER STUDENT LECTURE PROGRAMME Main Auditorium, bldg. 500 Monday 8 August 09:15 - 10:00 A. Höcker CP Violation (3/4) 10:15 - 12:00 J-J. GOMEZ-CADENAS Neutrino Physics (1-2/4) 12:00 Discussion Session Tuesday 9 August 09:15 - 10:00 A. Höcker CP Violation (4/4) 10:15 - 11:00 J-J. GOMEZ-CADENAS Neutrino Physics (3/4) 11:15 - 12:00 F. GREY The GRID 12:00 Discussion Session 14:15 - 17:00 Student Sessions Wednesday 10 August 09:15 - 10:00 J-J. GOMEZ-CADENAS Neutrino Physics (4/4) 10:15 - 12:00 J. LESGOURGUES Introduction to Cosmology (1-2/5) 12:00 Discussion Session 14:15 - 17:00 Student Sessions Thursday 11 August 09:15 - 11:00 J. LESGOURGUES Introduction to Cosmology (3-4/5) 11:15 - 12:00 G. KALMUS The ILC Story 12:00 Discussion Session Friday 12 August 09:15 - 10:00 J. LESGOURGUES Introduction to Cosmology (5/5) 10:15 - 11:00 G. VENEZIANO String theory: has Einstein's dream come true? 11:00  Discussion...

Primary care closed claims experience of Massachusetts malpractice insurers.

Science.gov (United States)

Schiff, Gordon D; Puopolo, Ann Louise; Huben-Kearney, Anne; Yu, Winnie; Keohane, Carol; McDonough, Peggy; Ellis, Bonnie R; Bates, David W; Biondolillo, Madeleine

Despite prior focus on high-impact inpatient cases, there are increasing data and awareness that malpractice in the outpatient setting, particularly in primary care, is a leading contributor to malpractice risk and claims. To study patterns of primary care malpractice types, causes, and outcomes as part of a Massachusetts ambulatory malpractice risk and safety improvement project. Retrospective review of pooled closed claims data of 2 malpractice carriers covering most Massachusetts physicians during a 5-year period (January 1, 2005, through December 31, 2009). Data were harmonized between the 2 insurers using a standardized taxonomy. Primary care practices in Massachusetts. All malpractice claims that involved primary care practices insured by the 2 largest insurers in the state were screened. A total of 551 claims from primary care practices were identified for the analysis. Numbers and types of claims, including whether claims involved primary care physicians or practices; classification of alleged malpractice (eg, misdiagnosis or medication error); patient diagnosis; breakdown in care process; and claim outcome (dismissed, settled, verdict for plaintiff, or verdict for defendant). During a 5-year period there were 7224 malpractice claims of which 551 (7.7%) were from primary care practices. Allegations were related to diagnosis in 397 (72.1%), medications in 68 (12.3%), other medical treatment in 41 (7.4%), communication in 15 (2.7%), patient rights in 11 (2.0%), and patient safety or security in 8 (1.5%). Leading diagnoses were cancer (n = 190), heart diseases (n = 43), blood vessel diseases (n = 27), infections (n = 22), and stroke (n = 16). Primary care cases were significantly more likely to be settled (35.2% vs 20.5%) or result in a verdict for the plaintiff (1.6% vs 0.9%) compared with non-general medical malpractice claims (P < .001). In Massachusetts, most primary care claims filed are related to alleged misdiagnosis. Compared with malpractice

Immunoglobulin G responses to Malassezia pachydermatis in healthy dogs and dogs with Malassezia dermatitis.

Science.gov (United States)

Bond, R; Lloyd, D H

2002-04-20

Serum immunoglobulin G (IgG) responses of healthy dogs and dogs with Malasseziapachydermatis dermatitis were compared by Western immunoblotting. M pachydermatis CBS 1879 was disrupted mechanically and its proteins were separated and blotted on to nitrocellulose membranes before being incubated with sera from eight healthy beagles, eight Irish setters with gluten-sensitive enteropathy, 15 healthy basset hounds, and 30 dogs with Mpachydermatis-associated dermatitis, 20 of which were basset hounds. The mean (se) numbers of bands of immunoreactivity observed in the seborrhoeic basset hounds (10.7 [0.4]) and affected mixed-breed dogs (9.4 [0.9]) were significantly greater than in the beagles (3-0 [1.0]), Irish setters (5.5 [1.1]) and healthy basset hounds (5.6 [0.7]). The number of bands identified was correlated (r(s) = 0.76, P dogs were immunoreactive towards the 132, 66 and 50 to 54 kDa proteins and the affected dogs were also usually reactive towards the 219, 110, 71 and 42 kDa proteins.

Spontaneous Retroperitoneal Hemorrhage (Wunderlich Syndrome due to Large Upper Pole Renal Angiomyolipoma: Does Robotic-Assisted Laparoscopic Partial Nephrectomy Have a Role in Primary Treatment?

Directory of Open Access Journals (Sweden)

Achilles Ploumidis

2013-01-01

Full Text Available Spontaneous rapture with consequent retroperitoneal hemorrhage (Wunderlich’s syndrome is the complication mostly feared from large renal angiomyolipomas (RAMLs. In hemodynamic stable patients, minimal invasive therapies have superseded open surgery as the mainstay of treatment, with contemporary cases mostly treated by selective arterial embolization. Robotic-assisted laparoscopic partial nephrectomy (RALPN is an established minimal access treatment that has been used in the past for benign and malignant lesions of the kidney in the elective setting, but rarely in urgent situations as primary treatment. We present a case of a ruptured RAML in a young female treated effectively by RALPN.

WE-EF-BRA-11: Precision Partial-Tumor Irradiation of Dorsal Rodent Mammary Tumors

Energy Technology Data Exchange (ETDEWEB)

Malcolm, J [Duke Medical Physics Graduate Program, Durham, NC (United States); Boss, K [Department of Comparative Biomedical Sciences, North Carolina State University (United States); Dewhirst, M [Dpt of Radiation and Cancer Biology, Duke University, Durham, North Carolina (United States); Oldham, M [Dpt of Radiation Oncology, Duke University Medical Center, Durham, NC (United States)

2015-06-15

Purpose: To introduce a pre-clinical treatment technique on a micro-irradiator to treat specific volumes of dorsal mammary tumors in BALB/c mice while sparing lungs and spine. This technique facilitates pre-clinical investigation of tumor response to sub-optimal radiation treatments in which a portion of the tumor is unirradiated, known as a “marginal miss”. In-vitro data suggests that partial tumor radiations trigger a more aggressive phenotype in non-irradiated, regional tumor cells via bystander effects. As the lung tissue is spared, the impact of marginal miss on the development of pulmonary metastasis may be assessed. Methods: End to end test was performed on three BALB/c mice as proof of concept for larger studies. 1Gy was delivered on the micro-irradiator employing previously unexplored lateral parallel-opposed diamond and/or triangle-shaped beams. The margins of the treatment beam were defined using a combination of tumor palpation, barium fiducial markers, and real-time fluoroscopic images. The dose distribution was independently verified with kilovoltage beam Monte Carlo dose calculations with 7% statistical uncertainty and double exposure images. As a final step, the technique was used in a larger pre-clinical study (15Gy, 36 BALB/c mice) and lung metastasis in response to tumor irradiation of 100%, 50% and 0% was quantified. Results: For the Monte-Carlo dose calculations, the dose volume histograms established a maximum dose within the un-irradiated and radiated portions of the mammary tumor of 0.3Gy and 1.5Gy respectively, with a sharp gradient at the boundary. 100% of the lung volume received less than 0.5Gy. This technique proved suitable for a pre-clinical marginal miss study with 50% more lung metastases in partially-radiated mouse models compared to completely. Conclusion: We have developed a novel treatment technique for partial or full irradiation of dorsal mammary tumors incorporating lung sparing.The technique will be useful for exploring

Chemical and physical oceanographic profile data collected from CTD casts aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater Horizon oil spill event (NODC Accession 0068955)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater...

Exon: CBRC-MMUS-09-0206 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0206 gttcaataccaccaccaccaccaccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccactaccaccaccaccacca...ccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccatcaccactaccaccaccaccaccaccaccaccaccaccaccaccaccaccagggagaacaagcattcaa ...

Health physics during work on the G. 2 and G. 3 reactor exchanges; La radioprotection des travaux sur les echangeurs des piles G. 2 et G. 3

Energy Technology Data Exchange (ETDEWEB)

Rodier, J; Chassany, J; Guillermin, P [Commissariat a l' Energie Atomique, Centre de Production de Plutonium, Marcoule (France). Centre d' Etudes Nucleaires

1965-07-01

During this work and its preparation, which took place first at G. 2 and then at G. 3 over a period of 11 months, 15000 measurement results were obtained. Their analysis, together with a consideration of the organisation on the site and of the conclusions drawn from the experiment, shows the various factors which determine the importance of the radio-active dangers. (authors) [French] Au cours de ces travaux et de leur preparation, qui ont eu lieu successivement a G. 3 puis a G. 2, pendant 11 mois, 15 000 resultats de mesures ont ete obtenus. Leur etude, mise en parallele avec l'organisation du chantier et les enseignements tires de l'experience, met en evidence les divers facteurs conditionnant les niveaux de risques radioactifs. (auteurs)

Childhood lead exposure in France: benefit estimation and partial cost-benefit analysis of lead hazard control

Directory of Open Access Journals (Sweden)

Zmirou-Navier Denis

2011-05-01

Full Text Available Abstract Background Lead exposure remains a public health concern due to its serious adverse effects, such as cognitive and behavioral impairment: children younger than six years of age being the most vulnerable population. In Europe, the lead-related economic impacts have not been examined in detail. We estimate the annual costs in France due to childhood exposure and, through a cost benefit analysis (CBA, aim to assess the expected social and economic benefits of exposure abatement. Methods Monetary benefits were assessed in terms of avoided national costs. We used results from a 2008 survey on blood-lead (B-Pb concentrations in French children aged one to six years old. Given the absence of a threshold concentration being established, we performed a sensitivity analysis assuming different hypothetical threshold values for toxicity above 15 μg/L, 24 μg/L and 100 μg/L. Adverse health outcomes of lead exposure were translated into social burden and economic costs based on literature data from literature. Direct health benefits, social benefits and intangible avoided costs were included. Costs of pollutant exposure control were partially estimated in regard to homes lead-based paint decontamination, investments aiming at reducing industrial lead emissions and removal of all lead drinking water pipes. Results The following overall annual benefits for the three hypothetical thresholds values in 2008 are: €22.72 billion, €10.72 billion and €0.44 billion, respectively. Costs from abatement ranged from €0.9 billion to 2.95 billion/year. Finally, from a partial CBA of lead control in soils and dust the estimates of total net benefits were € 3.78 billion, € 1.88 billion and €0.25 billion respectively for the three hypothesized B-Pb effect values. Conclusions Prevention of childhood lead exposure has a high social benefit, due to reduction of B-Pb concentrations to levels below 15 μg/L or 24 μg/L, respectively. Reducing only exposures

Broad antibody mediated cross-neutralization and preclinical immunogenicity of new codon-optimized HIV-1 clade CRF02_AG and G primary isolates.

Directory of Open Access Journals (Sweden)

Simon M Agwale

Full Text Available Creation of an effective vaccine for HIV has been an elusive goal of the scientific community for almost 30 years. Neutralizing antibodies are assumed to be pivotal to the success of a prophylactic vaccine but previous attempts to make an immunogen capable of generating neutralizing antibodies to primary "street strain" isolates have resulted in responses of very limited breadth and potency. The objective of the study was to determine the breadth and strength of neutralizing antibodies against autologous and heterologous primary isolates in a cohort of HIV-1 infected Nigerians and to characterize envelopes from subjects with particularly broad or strong immune responses for possible use as vaccine candidates in regions predominated by HIV-1 CRF02_AG and G subtypes. Envelope vectors from a panel of primary Nigerian isolates were constructed and tested with plasma/sera from the same cohort using the PhenoSense HIV neutralizing antibody assay (Monogram Biosciences Inc, USA to assess the breadth and potency of neutralizing antibodies. The immediate goal of this study was realized by the recognition of three broadly cross-neutralizing sera: (NG2-clade CRF02_AG, NG3-clade CRF02_AG and NG9- clade G. Based on these findings, envelope gp140 sequences from NG2 and NG9, complemented with a gag sequence (Clade G and consensus tat (CRF02_AG and G antigens have been codon-optimized, synthesized, cloned and evaluated in BALB/c mice. The intramuscular administration of these plasmid DNA constructs, followed by two booster DNA immunizations, induced substantial specific humoral response against all constructs and strong cellular responses against the gag and tat constructs. These preclinical findings provide a framework for the design of candidate vaccine for use in regions where the HIV-1 epidemic is driven by clades CRF02_AG and G.

Broad antibody mediated cross-neutralization and preclinical immunogenicity of new codon-optimized HIV-1 clade CRF02_AG and G primary isolates.

Science.gov (United States)

Agwale, Simon M; Forbi, Joseph C; Notka, Frank; Wrin, Terri; Wild, Jens; Wagner, Ralf; Wolf, Hans

2011-01-01

Creation of an effective vaccine for HIV has been an elusive goal of the scientific community for almost 30 years. Neutralizing antibodies are assumed to be pivotal to the success of a prophylactic vaccine but previous attempts to make an immunogen capable of generating neutralizing antibodies to primary "street strain" isolates have resulted in responses of very limited breadth and potency. The objective of the study was to determine the breadth and strength of neutralizing antibodies against autologous and heterologous primary isolates in a cohort of HIV-1 infected Nigerians and to characterize envelopes from subjects with particularly broad or strong immune responses for possible use as vaccine candidates in regions predominated by HIV-1 CRF02_AG and G subtypes. Envelope vectors from a panel of primary Nigerian isolates were constructed and tested with plasma/sera from the same cohort using the PhenoSense HIV neutralizing antibody assay (Monogram Biosciences Inc, USA) to assess the breadth and potency of neutralizing antibodies. The immediate goal of this study was realized by the recognition of three broadly cross-neutralizing sera: (NG2-clade CRF02_AG, NG3-clade CRF02_AG and NG9- clade G). Based on these findings, envelope gp140 sequences from NG2 and NG9, complemented with a gag sequence (Clade G) and consensus tat (CRF02_AG and G) antigens have been codon-optimized, synthesized, cloned and evaluated in BALB/c mice. The intramuscular administration of these plasmid DNA constructs, followed by two booster DNA immunizations, induced substantial specific humoral response against all constructs and strong cellular responses against the gag and tat constructs. These preclinical findings provide a framework for the design of candidate vaccine for use in regions where the HIV-1 epidemic is driven by clades CRF02_AG and G.

PARTIAL PURIFICATION AND IMMUNE-BIOCHEMICAL CHARACTERIZATION OF DOG SERUM IMMUNOGLOBULIN G

Directory of Open Access Journals (Sweden)

Manoj Kumar

2013-06-01

Full Text Available In the present study Immunoglobulin G was purified from serum of dog by gel filtration chromatography on Sephacryl S-200. SDS- PAGE analysis of purified dog IgG showed major polypeptides of 66 kDa, 52.40 kDa and 20.72 kDa. The purified Immunoglobulin has been found to be immune-reactive by DID test and Western Blot analysis when treated against hyperimmune sera which was raised in rabbit.

Comparison of the Hemagglutination Inhibition Test and IgG ELISA in Categorizing Primary and Secondary Dengue Infections Based on the Plaque Reduction Neutralization Test

Directory of Open Access Journals (Sweden)

Nurhayati Lukman

2016-01-01

Full Text Available Secondary dengue infection by heterotypic serotypes is associated with severe manifestations of disease, that is, dengue hemorrhagic fever (DHF and dengue shock syndrome (DSS. The World Health Organization (WHO has recommended criteria based on the hemagglutination inhibition (HI test to distinguish between primary and secondary dengue infections. Since the HI test has practical limitations and disadvantages, we evaluated the accuracy of WHO HI criteria and compared it with criteria based on an IgG enzyme-linked immunosorbent assay (ELISA using a plaque reduction neutralization test (PRNT as the gold standard. Both WHO HI criteria and IgG ELISA criteria performed strongly (16/16 in determining primary infection. However, to determine secondary infection, the IgG ELISA criteria performed better (72/73 compared to the WHO HI criteria (23/73.

OsPEX11, a peroxisomal biogenesis factor 11, contributes to salt stress tolerance in Oryza sativa

Directory of Open Access Journals (Sweden)

Cui Peng

2016-09-01

Full Text Available Peroxisomes are single membrane-bound organelles, whose basic enzymatic constituents are catalase and H2O2-producing flavin oxidases. Previous reports showed that peroxisome is involved in numerous processes including primary and secondary metabolism, plant development and abiotic stress responses. However, knowledge on the function of different peroxisome genes from rice and its regulatory roles in salt and other abiotic stresses is limited. Here, a novel prey protein, OsPEX11 (Os03g0302000, was screened and identified by yeast two-hybrid and GST pull down assays. Phenotypic analysis of OsPEX11 overexpression seedlings demonstrated that they had better tolerance to salt stress than wild type and OsPEX11-RNAi seedlings. Compared with wild type and OsPEX11-RNAi seedlings, overexpression of OsPEX11 had lower level of lipid peroxidation, Na+/K+ ratio, higher activities of antioxidant enzymes (SOD, POD and CAT and proline accumulation. Furthermore, qPCR data suggested that OsPEX11 acted as a positive regulator of salt tolerance by reinforcing the expression of several well-known rice transporters (OsHKT2;1, OsHKT1;5, OsLti6a, OsLti6b, OsSOS1, OsNHX1 and OsAKT1 involved in Na+/K+ homeostasis in transgenic plants under salinity. Ultrastructural observations of OsPEX11-RNAi seedlings showed that they were less sensitive to salt stress than wild type and overexpression lines. These results provide experimental evidence that OsPEX11 is an important gene implicated in Na+ and K+ regulation, and plays a critical role in salt stress tolerance by modulating the expression of cation transporters and antioxidant defense. Thus, OsPEX11 could be considered in transgenic breeding for improvement of salt stress tolerance in rice crop.

OsPEX11, a Peroxisomal Biogenesis Factor 11, Contributes to Salt Stress Tolerance in Oryza sativa.

Science.gov (United States)

Cui, Peng; Liu, Hongbo; Islam, Faisal; Li, Lan; Farooq, Muhammad A; Ruan, Songlin; Zhou, Weijun

2016-01-01

Peroxisomes are single membrane-bound organelles, whose basic enzymatic constituents are catalase and H 2 O 2 -producing flavin oxidases. Previous reports showed that peroxisome is involved in numerous processes including primary and secondary metabolism, plant development and abiotic stress responses. However, knowledge on the function of different peroxisome genes from rice and its regulatory roles in salt and other abiotic stresses is limited. Here, a novel prey protein, OsPEX11 (Os03g0302000), was screened and identified by yeast two-hybrid and GST pull-down assays. Phenotypic analysis of OsPEX11 overexpression seedlings demonstrated that they had better tolerance to salt stress than wild type (WT) and OsPEX11-RNAi seedlings. Compared with WT and OsPEX11-RNAi seedlings, overexpression of OsPEX11 had lower level of lipid peroxidation, Na + /K + ratio, higher activities of antioxidant enzymes (SOD, POD, and CAT) and proline accumulation. Furthermore, qPCR data suggested that OsPEX11 acted as a positive regulator of salt tolerance by reinforcing the expression of several well-known rice transporters ( OsHKT2;1, OsHKT1;5, OsLti6a, OsLti6b, OsSOS1, OsNHX1 , and OsAKT1 ) involved in Na + /K + homeostasis in transgenic plants under salinity. Ultrastructural observations of OsPEX11-RNAi seedlings showed that they were less sensitive to salt stress than WT and overexpression lines. These results provide experimental evidence that OsPEX11 is an important gene implicated in Na + and K + regulation, and plays a critical role in salt stress tolerance by modulating the expression of cation transporters and antioxidant defense. Thus, OsPEX11 could be considered in transgenic breeding for improvement of salt stress tolerance in rice crop.

Comparison of Gross Primary Productivity Derived from GIMMS NDVI3g, GIMMS, and MODIS in Southeast Asia

Directory of Open Access Journals (Sweden)

Junbang Wang

2014-03-01

Full Text Available Gross primary production (GPP plays an important role in the net ecosystem exchange of CO2 between the atmosphere and terrestrial ecosystems. It is particularly important to monitor GPP in Southeast Asia because of increasing rates of tropical forest degradation and deforestation in the region in recent decades. The newly available, improved, third generation Normalized Difference Vegetation Index (NDVI3g from the Global Inventory Modelling and Mapping Studies (GIMMS group provides a long temporal dataset, from July 1981 to December 2011, for terrestrial carbon cycle and climate response research. However, GIMMS NDVI3g-based GPP estimates are not yet available. We applied the GLOPEM-CEVSA model, which integrates an ecosystem process model and a production efficiency model, to estimate GPP in Southeast Asia based on three independent results of the fraction of photosynthetically active radiation absorbed by vegetation (FPAR from GIMMS NDVI3g (GPPNDVI3g, GIMMS NDVI1g (GPPNDVI1g, and the Moderate Resolution Imaging Spectroradiometer (MODIS MOD15A2 FPAR product (GPPMOD15. The GPP results were validated using ground data from eddy flux towers located in different forest biomes, and comparisons were made among the three GPPs as well as the MOD17A2 GPP products (GPPMOD17. Based on validation with flux tower derived GPP estimates the results show that GPPNDVI3g is more accurate than GPPNDVI1g and is comparable in accuracy with GPPMOD15. In addition, GPPNDVI3g and GPPMOD15 have good spatial-temporal consistency. Our results indicate that GIMMS NDVI3g is an effective dataset for regional GPP simulation in Southeast Asia, capable of accurately tracking the variation and trends in long-term terrestrial ecosystem GPP dynamics.

Body-focused repetitive behavior disorders in ICD-11

Directory of Open Access Journals (Sweden)

Jon E. Grant

2014-01-01

Full Text Available This article addresses the question of how body-focused repetitive behavior disorders (e.g., trichotillomania and skin-picking disorder should be characterized in ICD-11. The article reviews the historical nosology of the two disorders and the current approaches in DSM-5 and ICD-10. Although data are limited and mixed regarding the optimal relationship between body-focused repetitive behavior disorders and nosological categories, these conditions should be included within the obsessive-compulsive and related disorders category, as this is how most clinicians see these behaviors, and as this may optimize clinical utility. The descriptions of these disorders should largely mirror those in DSM-5, given the evidence from recent field surveys. The recommendations regarding ICD-11 and body-focused repetitive behavior disorders should promote the global identification and treatment of these conditions in primary care settings.

Secular changes in intakes of foods among New Zealand adults from 1997 to 2008/09.

Science.gov (United States)

Smith, Claire; Gray, Andrew R; Mainvil, Louise A; Fleming, Elizabeth A; Parnell, Winsome R

2015-12-01

To examine changes in the food choices of New Zealand (NZ) adults, between the 1997 National Nutrition Survey (NNS97) and the 2008/09 NZ Adult Nutrition Survey (2008/09 NZANS). The 2008/09 NZANS and the NNS97 were cross-sectional surveys of NZ adults (aged 15 years and over). Dietary intake data were collected using a computer-based 24 h diet recall. Logistic regression models were used to examine changes over time in the percentage reporting each food group, with survey year, sex and age group (19-30 years, 31-50 years, 51-70 years, ≥71 years) as the variables. NZ households. Adults aged 19 years and over (NNS97, n 4339; 2008/09 NZANS, n 3995). In the 2008/09 NZANS compared with NNS97, males and females were less likely to report consuming bread, potatoes, beef, vegetables, breakfast cereal, milk, cheese, butter, pies, biscuits, cakes and puddings, and sugar/confectionery (all Psnacks and snack bars (e.g., crisps, extruded snacks, muesli bars; P=0.007) and pasta and pasta dishes (P=0.017). Although food choices were associated with sex and age group, there were few differential changes between the surveys by sex or age group. For all age groups there was a shift in the percentage who reported consuming the traditional NZ foods, namely bread, beef, potatoes and vegetables, towards more rice and rice dishes. Declines in the consumption of butter, pies, biscuits, cakes and puddings are congruent with current dietary guidelines.

Open-source implementation of an ad-hoc IEEE802.11a/g/p software-defined radio on low-power and low-cost general purpose processors

Directory of Open Access Journals (Sweden)

S. Ciccia

2017-12-01

Full Text Available This work proposes a low-cost and low-power software-defined radio open-source platform with IEEE 802.11 a/g/p wireless communication capability. A state-of-the-art version of the IEEE 802.11 a/g/p software for GNU Radio (a free and open-source software development framework is available online, but we show here that its computational complexity prevents operations in low-power general purpose processors, even at throughputs below the standard. We therefore propose an evolution of this software that achieves a faster and lighter IEEE 802.11 a/g/p transmitter and receiver, suitable for low-power general purpose processors, for which GNU Radio provides very limited support; we discuss and describe the software radio processing structuring that is necessary to achieve the goal, providing a review of signal processing techniques. In particular, we emphasize the advanced reduced-instruction set (RISC machine (ARM study case, for which we also optimize some of the processing libraries. The presented software will remain open-source.

Testing the generalized partial credit model

NARCIS (Netherlands)

Glas, Cornelis A.W.

1996-01-01

The partial credit model (PCM) (G.N. Masters, 1982) can be viewed as a generalization of the Rasch model for dichotomous items to the case of polytomous items. In many cases, the PCM is too restrictive to fit the data. Several generalizations of the PCM have been proposed. In this paper, a

Hypochondriasis: considerations for ICD-11

Directory of Open Access Journals (Sweden)

Odile A. van den Heuvel

2014-01-01

Full Text Available The World Health Organization (WHO is currently revisiting the ICD. In the 10th version of the ICD, approved in 1990, hypochondriacal symptoms are described in the context of both the primary condition hypochondriacal disorder and as secondary symptoms within a range of other mental disorders. Expansion of the research base since 1990 makes a critical evaluation and revision of both the definition and classification of hypochondriacal disorder timely. This article addresses the considerations reviewed by members of the WHO ICD-11 Working Group on the Classification of Obsessive-Compulsive and Related Disorders in their proposal for the description and classification of hypochondriasis. The proposed revision emphasizes the phenomenological overlap with both anxiety disorders (e.g., fear, hypervigilance to bodily symptoms, and avoidance and obsessive-compulsive and related disorders (e.g., preoccupation and repetitive behaviors and the distinction from the somatoform disorders (presence of somatic symptom is not a critical characteristic. This revision aims to improve clinical utility by enabling better recognition and treatment of patients with hypochondriasis within the broad range of global health care settings.

Partial splenic embolization combined with vincristine infusion for the treatment of refractory idiopathic thrombocytopenic purpura and Evans syndrome: observation of its long-term efficacy

International Nuclear Information System (INIS)

Chen Shibing

2011-01-01

Objective: To observe the long-term efficacy of partial spleen embolization combined with vincristine infusion in treating refractory idiopathic thrombocytopenic purpura (ITP) and Evans syndrome. Methods: During the period of 2000-2007, partial spleen embolization together with vincristine infusion was carried out in 30 patients with refractory idiopathic thrombocytopenic purpura (n=24) or Evans syndrome (n=6). Vincristine infusion (2 mg) via splenic artery was performed before partial spleen embolization procedure. The long-term effectiveness was observed and analyzed. Results: One week after the treatment, the platelet count was increased from preoperative (10.23±8.28) × 10 9 /L to (140.28±85.45) × 10 9 /L in patients with ITP, while the platelet count was increased from preoperative (12±8) × 10 9 /L to (210±60) × 10 9 /L in patients with Evans syndrome. Meanwhile, the hemoglobin level showed an increase in different degrees, from preoperative (63.00±13.62) g/L to postoperative (123.00±13.14) g/L. The therapeutic effectiveness was 100%. During the follow-up time lasting for 3-5 years, recurrence was seen in 11 patients (36.7%) and the overall efficacy rate was 63.3%. Conclusion: For the treatment of refractory idiopathic thrombocytopenic purpura and Evans syndrome, partial spleen embolization combined with vincristine infusion carries reliable long-term efficacy. (author)

Helicobacter pylori and primary gastric lymphoma. A histopathologic and immunohistochemical analysis of 237 patients.

Science.gov (United States)

Nakamura, S; Yao, T; Aoyagi, K; Iida, M; Fujishima, M; Tsuneyoshi, M

1997-01-01

Few previous articles have analyzed the relation between infection with Helicobacter pylori (H. pylori) and primary gastric lymphoma in a large number of patients. Resected and biopsied specimens from 237 patients with primary gastric lymphoma were investigated for H. pylori using hematoxylin and eosin stain, modified Giemsa stain, and immunohistochemistry. These specimens were compared with specimens from 29 patients with chronic active gastritis, 33 with peptic ulcers, and 41 with gastric carcinoma. H. pylori was detected in 145 of 237 patients (61%) with gastric lymphoma. The frequency of H. pylori positivity was higher in patients with lymphoma restricted to the mucosa and submucosa (76%) than in those with lymphoma invading beyond the submucosa (48%) (P gastritis (100%) (P gastritis and peptic ulcer. The H. pylori grading score for patients with lymphoma (0.9 +/- 1.0) was lower than for those with chronic active gastritis (1.9 +/- 0.8) (P < 0.001), peptic ulcers (2.2 +/- 1.0) (P < 0.001), or gastric carcinoma (1.2 +/- 1.1) (P < 0.05). These results suggest that H. pylori is more likely to be associated with early states of primary gastric lymphoma than with advanced states. Thus, H. pylori may disappear during the progression of primary gastric lymphoma.

Partial dynamical symmetries in quantal many-body systems

International Nuclear Information System (INIS)

Van Isacker, P.

2001-01-01

Partial dynamical symmetries are associated with Hamiltonians that are partially solvable. The determination of the properties of a quantal system of N interacting particles moving in an external potential requires the solution of the eigenvalue equation associated with a second-quantised Hamiltonian. In many situations of interest the Hamiltonian commutes with transformations that constitute a symmetry algebra G sym . This characteristic opens a way to find all analytically solvable Hamiltonians. The author gives a brief review of some recent developments

Laparoscopic partial nephrectomy for endophytic hilar tumors: feasibility and outcomes.

Science.gov (United States)

Di Pierro, G B; Tartaglia, N; Aresu, L; Polara, A; Cielo, A; Cristini, C; Grande, P; Gentile, V; Grosso, G

2014-06-01

To analyze feasibility and outcomes of laparoscopic partial nephrectomy (LPN) for endophytic hilar tumors in low-intermediate (ASA I-II) risk patients. This is a single centre retrospective study. From May 2009 to September 2011, 208 LPNs were performed at our institution. Overall 11 (5.2%) elective LPNs were for hilar tumors not visible on kidney surface. Hilar tumor was defined as a mass located in the renal hilum and in contact with a major renal vessel on preoperative imaging. Procedures were carried out by a single experienced surgeon (G.G.) via retroperitoneal approach by clamping the only main renal artery. Mean (range) age of patients was 45.3 years (38.2-64.1), tumor size 1.6 cm (1.2-2.0), warm ischemia time 24 min (19-32), operative time 140 min (110-200) and estimated blood loss 270 ml (100-750). Two collecting system injuries were observed and repaired intraoperatively. No conversion to open surgery was required. Final pathological examination revealed 10 renal cell carcinomas and 1 oncocytoma. A negative surgical margin was obtained in 10/11 (91%) patients. Renal function and serum hemoglobin were nearly unaltered pre and post-surgery. No tumor recurrence was observed at mean (range) follow-up of 34 months (15-43). In experienced hands, LPN represents a feasible, safe and effective treatment for selected patients diagnosed with endophytic hilar masses. A larger number of patients and longer follow-up are required to draw definitive conclusions. Copyright © 2013 Elsevier Ltd. All rights reserved.

Extended stability of intravenous 0.9% sodium chloride solution after prolonged heating or cooling.

Science.gov (United States)

Puertos, Enrique

2014-03-01

The primary objective of this study was to evaluate the stability and sterility of an intravenous 0.9% sodium chloride solution that had been cooled or heated for an extended period of time. Fifteen sterile 1 L bags of 0.9% sodium chloride solution were randomly selected for this experiment. Five bags were refrigerated at an average temperature of 5.2°C, 5 bags were heated at an average temperature of 39.2°C, and 5 bags were stored at an average room temperature of 21.8°C to serve as controls. All samples were protected from light and stored for a period of 199 days prior to being assayed and analyzed for microbial and fungal growth. There was no clinically significant difference in the mean sodium values between the refrigerated samples, the heated samples, and the control group. There were no signs of microbial or fungal growth for the duration of the study. A sterile intravenous solution of 0.9% sodium chloride that was heated or cooled remained stable and showed no signs of microbial or fungal growth for a period of 199 days. This finding will allow hospitals and emergency medical technicians to significantly extend the expiration date assigned to these fluids and therefore obviate the need to change out these fluids every 28 days as recommended by the manufacturer.

Implant support for removable partial overdentures: a case report.

Science.gov (United States)

Halterman, S M; Rivers, J A; Keith, J D; Nelson, D R

1999-01-01

Functional stability and the preservation of remaining alveolar bone are primary, and often elusive, goals when restoring the partially edentulous arch. The incorporation of dental implants for the partial support of removable prostheses offers a practical adjunct in the fulfillment of these objectives. Planning for complex courses of treatment that include dental implants requires close coordination between the surgeon and the restorative dentist. Decisions that deal with type, location, size, number of implant fixtures, and design of the prosthesis are critical. All of these areas must be discussed and established as acceptable to the patient and each clinician before the initiation of treatment. In this report, we present a course of patient treatment in which a removable partial denture is supported by natural remaining teeth in conjunction with osseointegrated implants.

30 CFR 840.11 - Inspections by State regulatory authority.

Science.gov (United States)

2010-07-01

... mining and reclamation operation under its jurisdiction, and shall conduct such partial inspections of each inactive surface coal mining and reclamation operation under its jurisdiction as are necessary to....11 Section 840.11 Mineral Resources OFFICE OF SURFACE MINING RECLAMATION AND ENFORCEMENT, DEPARTMENT...

Chemical and physical oceanographic profile data collected from CTD casts aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater Horizon oil spill event (NODC Accession 0069071)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater...

Reporting new cases of anaemia in primary care settings in Crete, Greece: a rural practice study

Directory of Open Access Journals (Sweden)

Lionis Christos

2012-04-01

Full Text Available Abstract Background Early diagnosis of anaemia represents an important task within primary care settings. This study reports on the frequency of new cases of anaemia among patients attending rural primary care settings in Crete (Greece and to offer an estimate of iron deficiency anaemia (IDA frequency in this study group. Methods All patients attending the rural primary health care units of twelve general practitioners (GPs on the island of Crete for ten consecutive working days were eligible to participate in this study. Hemoglobin (Hb levels were measured by portable analyzers. Laboratory tests to confirm new cases of anaemia were performed at the University General Hospital of Heraklion. Results One hundred and thirteen out of 541 recruited patients had a low value of Hb according to the initial measurement obtained by the use of the portable analyzer. Forty five (45.5% of the 99 subjects who underwent laboratory testing had confirmed anaemia. The mean value of the Hb levels in the group with confirmed anaemia, as detected by the portable analyzer was 11.1 g/dl (95% Confidence Interval (CI from 10.9 to 11.4 and the respective mean value of the Hb levels obtained from the full blood count was 11.4 g/dl (95% CI from 11.2 to 11.7 (P = 0.01. Sixteen out of those 45 patients with anaemia (35.6% had IDA, with ferritin levels lower than 30 ng/ml. Conclusion Keeping in mind that this paper does not deal with specificity or sensitivity figures, it is suggested that in rural and remote settings anaemia is still invisible and point of care testing may have a place to identify it.

Interrelation of transport properties, defect structure and spin state of Ni3+ in La1.2Sr0.8Ni0.9Fe0.1O4+δ

Science.gov (United States)

Gilev, A. R.; Kiselev, E. A.; Zakharov, D. M.; Cherepanov, V. A.

2017-10-01

The total conductivity, Seebeck coefficient and oxygen non-stoichiometry for La1.2Sr0.8Ni0.9Fe0.1O4+δ have been measured vs temperature and oxygen partial pressure P(O2). The measurements were carried out at 800, 850, 900 and 950 °C within the P(O2) range of 10-5-0.21 atm. La1.2Sr0.8Ni0.9Fe0.1O4+δ was shown to be oxygen deficient in all temperature and P(O2) ranges studied. The calculated values of the partial molar enthalpy of oxygen depend very slightly on oxygen content (δ), indicating that La1.2Sr0.8Ni0.9Fe0.1O4+δ with the oxygen deficiency can be considered an ideal solution. The model of point defect equilibria in La1.2Sr0.8Ni0.9Fe0.1O4+δ has been proposed and fitted to experimental dependencies. Subsequent joint analysis of the defect structure and transport properties revealed that electron holes can coexist in both localized and quasi-delocalized states in the oxide: the former corresponded to high-spin state Ni3+ and the latter - to low-spin state Ni3+. The mobilities of localized electron holes were shown to be significantly lower in comparison to quasi-delocalized ones. The behavior of localized electron holes was explained in terms of a small polaron conduction mechanism; in contrast, quasi-delocalized electron holes were described in terms of a band conduction approach. The small polaron conduction mechanism was shown to be predominant in the Sr- and Fe-co-doped lanthanum nickelate.

Single-port laparoscopic partial splenectomy: a case report.

Science.gov (United States)

Hong, Tae Ho; Lee, Sang Kuon; You, Young Kyoung; Kim, Jun Gi

2010-10-01

With the better understanding of the importance of the spleen as a primary organ of the human immune system, there has been an increased interest in performing the partial splenectomy for a number of indications such as nonparasitic cysts, benign tumors, staging of lymphomas, etc. Moreover, laparoscopic partial splenectomy has been gaining more interest as the recommended approach for benign splenic disorders to preserve the splenic function with very low recurrence rates. Meanwhile, many surgeons have attempted to reduce the number and size of the ports in laparoscopic surgery with the aim of inducing less parietal trauma and fewer scars. One of these efforts is single-port laparoscopic surgery, which is a rapidly evolving field all over the world. Here, we describe a feasible method of single-port laparoscopic partial splenectomy for treating a benign splenic cyst that was located in the upper medial aspect of the spleen.

Atomic-partial vibrational density of states of i-AlCuFe quasicrystals

CERN Document Server

Parshin, P P; Brand, R A; Dianoux, A J; Calvayrac, Y

2002-01-01

We present new results on the separation of the atomic-partial vibrational density of states for the ternary quasicrystal i-Al sub 6 sub 2 Cu sub 2 sub 5 sub . sub 5 Fe sub 1 sub 2 sub . sub 5. The decomposition into three atomic-partial functions, Al-, Cu- and Fe-g(E), has been performed self-consistently with the calculation of the multi-phonon contributions. The results show the surprising result that both Cu- and Fe-g(E) are strongly peaked. The low-energy regions of Al- and Cu-g(E) show strong deviations from Debye behaviour due to the presence of non-propagating low-energy vibrational states. (orig.)

Macro-IML manual for DEC PDP 11 computer with controller DEC CA 11-A/BORER type 1,533 A

International Nuclear Information System (INIS)

Kubitz, M.; Kind, R.

1975-03-01

The IML-implementations follow the Macro-Syntax as given in Appendix A of the document 'CAMAC. The Definitior of IML (A Language For Use in CAMAC Systems)'. This document has been adopted as a description by ESONE and AEC NIM in August/September 74 and has been published in October 74. They have been designed for the DEC PDP 11 computer with the branch controller DEC CA 11-A and the Single Crate Controller BORER Type 1,533 A. For both DEC operating systems, DOS V08/09 and RSX-11D/M a full set of macros has been implemented except the block transfer on special LAM, X-error control statements and the subscript mode. Transfer modes not implemented by the hardware of the CA 11-A are simulated by software. (orig.) [de

Biochemical, sensory and microbiological attributes of bream (Megalobrama amblycephala) during partial freezing and chilled storage.

Science.gov (United States)

Song, Yongling; Luo, Yongkang; You, Juan; Shen, Huixing; Hu, Sumei

2012-01-15

Bream is one of the main farmed freshwater fish species in China. This study aimed to examine the nucleotide degradation of bream during partial freezing and chilled storage and to assess the possible usefulness of nucleotide ratios (K, Ki, H, P, Fr and G values) as freshness indices in comparison with sensory assessment and total viable counts. Total viable counts were 5.74 and 4.66 log(colony-forming units g(-1)) on the day of sensory rejection under chilled storage and partial freezing storage respectively. The inosine 5-monophosphate decrease and inosine increase were faster in chilled storage than in partial freezing storage. Hypoxanthine levels increased continuously with time under both storage regimes. Among the nucleotide ratios, the K, Ki, P, G and Fr values were superior to the H value and provided useful freshness indicators for both storage conditions. Bream in chilled storage were sensorially acceptable only up to 10 days, compared with 33 days for bream in partial freezing storage. Partial freezing delayed the nucleotide degradation of bream. Copyright © 2011 Society of Chemical Industry.

Hydrogen or Soot?: Partial Oxidation of High-boiling Hydrocarbon Wastes

Czech Academy of Sciences Publication Activity Database

Lederer, J.; Hanika, Jiří; Nečesaný, F.; Poslední, W.; Tukač, V.; Veselý, Václav

2015-01-01

Roč. 29, č. 1 (2015), s. 5-11 ISSN 0352-9568 Institutional support: RVO:67985858 Keywords : partial oxidation * waste * hydrocarbon Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 0.675, year: 2015

Gender-dependent association of HSD11B1 single nucleotide polymorphisms with glucose and HDL-C levels

Directory of Open Access Journals (Sweden)

Luciane Viater Turek

2014-09-01

Full Text Available In this study, we investigated the influence of two SNPs (rs846910 and rs12086634 of the HSD11B1 gene that encodes 11β-hydroxysteroid dehydrogenase type 1(11β-HSD1, the enzyme that catalyzes the conversion of cortisol to cortisone, on variables associated with obesity and metabolic syndrome in 215 individuals of both sexes from southern Brazil. The HSD11B1 gene variants were genotyped using the TaqMan SNP genotyping assay. Glucose, triglycerides, total cholesterol, HDL-cholesterol and LDL-cholesterol were measured by standard automated methods. Significant results were found in women, with carriers of the G allele of SNP rs12086634 having higher glucose levels than non-carriers. Carriers of the A allele of SNP rs846910 had higher levels of HDL-cholesterol. The involvement of both polymorphisms as independent factors in determining the levels of glucose and HDL-cholesterol was confirmed by multiple regression analysis (β = 0.19 ± 0.09, p = 0.03 and β = 0.22 ± 0.10, p = 0.03, respectively. Our findings suggest that the HSD11B1SNPs studied may indirectly influence glucose and HDL-cholesterol metabolism in women, possibly through down-regulation of the HSD11B1 gene by estrogen.

Association between CTLA-4 60G/A and -1661A/G polymorphisms and the risk of cancers: a meta-analysis.

Directory of Open Access Journals (Sweden)

Qing Yan

Full Text Available CTLA-4 is one of the most fundamental immunosuppressive cotykines which belongs to the immunoglobulin super-family, and is expressed mainly on activated T cells. Previous studies have reported the existence of CTLA4 60G/A and CTLA4 -1661A/G polymorphism in cancers. However, the effects remain conflicting. Hence, we performed a meta-analysis to investigate the association between these polymorphisms and cancer risk.We searched the Pubmed and Web of Science databases until October 24, 2013 to obtain relevant published studies. Pooled odds ratios (ORs and corresponding 95% confidence intervals (CIs for the relationship between CTLA4 gene polymorphisms and cancer susceptibility were calculated by stata 11 software. Heterogeneity tests, sensitivity analyses and publication bias assessments were also performed in our meta-analysis.A total of 22 articles comprising 31 case-control studies concerning the CTLA-4 60G/A and CTLA-4 -1661A/G polymorphisms were included in the meta-analysis. The pooled results suggested the CTLA-4 60G/A polymorphism was significantly associated with an increased skin cancer risk (AA vs. GG: OR = 1.32, 95%CI = 1.09-1.59; AA vs. GA+GG: OR = 1.26, 95%CI = 1.07-1.48. For CTLA-4 -1661 A/G polymorphism, the results showed that the CTLA-4 -1661A/G polymorphism was significantly associated with an increased cancer risk (GA vs. AA: OR = 1.44, 95%CI = 1.13-1.82; GA+GG vs. AA: OR = 1.35, 95%CI = 1.07-1.69; G vs. A: OR = 1.21, 95%CI = 1.01-1.47, especially in gastric cancer, breast cancer, other cancers and in Asians population subgroups.Our meta-analysis suggests that the CTLA-4 -1661A/G polymorphism is a potential factor for the susceptibility of cancer, especially in gastric cancer, breast cancer and other cancers, and the CTLA-4 60G/A polymorphism is significantly associated with increased skin cancer risk. The effect of the CTLA-4 -1661A/G polymorphism on cancer susceptibility especially

Risk Factors for Blood Transfusion With Primary Posterior Lumbar Fusion.

Science.gov (United States)

Basques, Bryce A; Anandasivam, Nidharshan S; Webb, Matthew L; Samuel, Andre M; Lukasiewicz, Adam M; Bohl, Daniel D; Grauer, Jonathan N

2015-11-01

Retrospective cohort study. To identify factors associated with blood transfusion for primary posterior lumbar fusion surgery, and to identify associations between blood transfusion and other postoperative complications. Blood transfusion is a relatively common occurrence for patients undergoing primary posterior lumbar fusion. There is limited information available describing which patients are at increased risk for blood transfusion, and the relationship between blood transfusion and short-term postoperative outcomes is poorly characterized. The American College of Surgeons National Surgical Quality Improvement Program (ACS-NSQIP) database was used to identify patients undergoing primary posterior lumbar fusion from 2011 to 2013. Multivariate analysis was used to find associations between patient characteristics and blood transfusion, along with associations between blood transfusion and postoperative outcomes. Out of 4223 patients, 704 (16.7%) had a blood transfusion. Age 60 to 69 (relative risk [RR] 1.6), age greater than equal to 70 (RR 1.7), American Society of Anesthesiologists class greater than equal to 3 (RR 1.1), female sex (RR 1.1), pulmonary disease (RR 1.2), preoperative hematocrit less than 36.0 (RR 2.0), operative time greater than equal to 310 minutes (RR 2.9), 2 levels (RR 1.6), and 3 or more levels (RR 2.1) were independently associated with blood transfusion. Interbody fusion (RR 0.9) was associated with decreased rates of blood transfusion. Receiving a blood transfusion was significantly associated with any complication (RR 1.7), sepsis (RR 2.6), return to the operating room (RR 1.7), deep surgical site infection (RR 2.6), and pulmonary embolism (RR 5.1). Blood transfusion was also associated with an increase in postoperative length of stay of 1.4 days (P risk factors for these occurrences were characterized. Strategies to minimize blood loss might be considered in these patients to avoid the associated complications. 3.

Synthesis and positron emission tomography studies of C-11-labeled isotopomers and metabolites of GTS-21, a partial {alpha}7 nicotinic cholinergic agonist drug

Energy Technology Data Exchange (ETDEWEB)

Kim, Sung Won [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States) and Department of Chemistry, State University of New York at Stony Brook, Stony Brook, NY 11794-3400 (United States)]. E-mail: swkim@bnl.gov; Ding Yushin [Department of Chemistry, State University of New York at Stony Brook, Stony Brook, NY 11794-3400 (United States); Department of Radiology, Yale University School of Medicine, New Haven, CT 06520-8048 (United States); Alexoff, David [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Patel, Vinal [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Logan, Jean [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Lin, K.-S. [Department of Radiology, University of Pittsburgh, Pittsburgh, PA 15213 (United States); Shea, Colleen [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Muench, Lisa [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Xu Youwen [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Carter, Pauline [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); King, Payton [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Constanzo, Jasmine R. [Department of Chemistry, Fordham University, Bronx, NY 10458 (United States); Ciaccio, James A. [Department of Chemistry, Fordham University, Bronx, NY 10458 (United States); Fowler, Joanna S. [Medical Department, Brookhaven National Laboratory, Upton, NY 11973 (United States); Department of Chemistry, State University of New York at Stony Brook, Stony Brook, NY 11794-3400 (United States); Department of Psychiatry, Mount Sinai School of Medicine, New York, NY 10029 (United States)

2007-07-15

Introduction: (3E)-3-[(2,4-dimethoxyphenyl)methylene]-3,4,5,6-tetrahydro-2,3'-bipyridine (GTS-21), a partial {alpha}7 nicotinic acetylcholine receptor agonist drug, has recently been shown to improve cognition in schizophrenia and Alzheimer's disease. One of its two major demethylated metabolites, 4-OH-GTS-21, has been suggested to contribute to its therapeutic effects. Methods: We labeled GTS-21 in two different positions with carbon-11 ([2-methoxy-{sup 11}C]GTS-21 and [4-{sup 11}C]GTS-21) along with two corresponding demethylated metabolites ([2-methoxy-{sup 11}C]4-OH-GTS-21 and [4-methoxy-{sup 11}C]2-OH-GTS-21) for pharmacokinetic studies in baboons and mice with positron emission tomography (PET). Results: Both [2-{sup 11}C]GTS-21 and [4-methoxy-{sup 11}C]GTS-21 showed similar initial high rapid uptake in baboon brain, peaking from 1 to 3.5 min (0.027-0.038%ID/cc) followed by rapid clearance (t {sub 1/2}<15 min), resulting in low brain retention by 30 min. However, after 30 min, [2-methoxy-{sup 11}C]GTS-21 continued to clear while [4-methoxy-{sup 11}C]GTS-21 plateaued, suggesting the entry of a labeled metabolite into the brain. Comparison of the pharmacokinetics of the two labeled metabolites confirmed expected higher brain uptake and retention of [4-methoxy-{sup 11}C]2-OH-GTS-21 (the labeled metabolite of [4-methoxy-{sup 11}C]GTS-21) relative to [2-methoxy-{sup 11}C]4-OH-GTS-21 (the labeled metabolite of [2-methoxy-{sup 11}C]GTS-21), which had negligible brain uptake. Ex vivo studies in mice showed that GTS-21 is the major chemical form in the mouse brain. Whole-body dynamic PET imaging in baboon and mouse showed that the major route of excretion of C-11 is through the gallbladder. Conclusions: The major findings are as follows: (a) extremely rapid uptake and clearance of [2-methoxy-{sup 11}C]GTS-21 from the brain, which may need to be considered in developing optimal dosing of GTS-21 for patients, and (b) significant brain uptake of 2-OH-GTS-21

Application of transmission infrared spectroscopy and partial least squares regression to predict immunoglobulin G concentration in dairy and beef cow colostrum.

Science.gov (United States)

Elsohaby, Ibrahim; Windeyer, M Claire; Haines, Deborah M; Homerosky, Elizabeth R; Pearson, Jennifer M; McClure, J Trenton; Keefe, Greg P

2018-03-06

The objective of this study was to explore the potential of transmission infrared (TIR) spectroscopy in combination with partial least squares regression (PLSR) for quantification of dairy and beef cow colostral immunoglobulin G (IgG) concentration and assessment of colostrum quality. A total of 430 colostrum samples were collected from dairy (n = 235) and beef (n = 195) cows and tested by a radial immunodiffusion (RID) assay and TIR spectroscopy. Colostral IgG concentrations obtained by the RID assay were linked to the preprocessed spectra and divided into combined and prediction data sets. Three PLSR calibration models were built: one for the dairy cow colostrum only, the second for beef cow colostrum only, and the third for the merged dairy and beef cow colostrum. The predictive performance of each model was evaluated separately using the independent prediction data set. The Pearson correlation coefficients between IgG concentrations as determined by the TIR-based assay and the RID assay were 0.84 for dairy cow colostrum, 0.88 for beef cow colostrum, and 0.92 for the merged set of dairy and beef cow colostrum. The average of the differences between colostral IgG concentrations obtained by the RID- and TIR-based assays were -3.5, 2.7, and 1.4 g/L for dairy, beef, and merged colostrum samples, respectively. Further, the average relative error of the colostral IgG predicted by the TIR spectroscopy from the RID assay was 5% for dairy cow, 1.2% for beef cow, and 0.8% for the merged data set. The average intra-assay CV% of the IgG concentration predicted by the TIR-based method were 3.2%, 2.5%, and 6.9% for dairy cow, beef cow, and merged data set, respectively.The utility of TIR method for assessment of colostrum quality was evaluated using the entire data set and showed that TIR spectroscopy accurately identified the quality status of 91% of dairy cow colostrum, 95% of beef cow colostrum, and 89% and 93% of the merged dairy and beef cow colostrum samples

samaru-main-vol 11 2011

African Journals Online (AJOL)

Library _info_Sc_ 1

2004-07-11

Jul 11, 2004 ... Samaru Journal of Information Studies Vol. 11 (1 & 2)2011 ... It is therefore paramount that the library ... source of primary and up to date information, both students and ... entertainment, arts, fashion, law, economy, medicine,.

Summer Students

CERN Multimedia

2005-01-01

SUMMER STUDENT LECTURE PROGRAMME Main Auditorium, bldg. 500 DATE TIME LECTURER TITLE Monday 11 July 09:15 - 10:00 L. Di Lella (CERN) Introduction to Particle Physics (4/4) 10:15 - 11:00 P. Chomaz (GANIL / CERN) Introduction to Nuclear Physics (3/3) 11:15 - 12:00 G. ROLANDI (CERN) How an experiment is designed (2/2) 12:00 Discussion Session Tuesday 12 July  09:15 - 11:00 O. BrÜning (CERN) Accelerators (1-2/5) 11:15 - 12:00 O. ULLALAND (CERN) Detectors (1/5) 12:00 Discussion Session Wednesday 13 July 09:15 - 10:00 O. BrÜning (CERN) Accelerators (3/5) 10:15 - 11:00 R. LANDUA (CERN) Antimatter in the Lab (1/2) 11:15 - 12:00 O. ULLALAND (CERN) Detectors (2/5) 12:00 Discussion Session Thursday 14 July 09:15 - 10:00 O. ULLALAND (CERN) Detectors (3/5) 10:15 - 11:00 G. ROLANDI (CERN) Antimatter in the Lab (2/2) 11:15 - 12:00 O. BrÜning (CERN) Accelerators (4/5) 12:00 Discussion Session Friday 1...

Familial primary hyperparathyroidism

International Nuclear Information System (INIS)

Iqbal, P.; Javed, R.

2007-01-01

A case of primary hyperparathyroidism in a 17 years old female is described. Patient presented with severe abdominal and pelvic pains associate with discomfort. Diagnostic testing revealed multiple upper and lower limb fractures and renal stones. Case was self limiting. Patient's condition resolved on parathyroidectomy for adenoma and partial thyroidectomy. Follow-up showed familial links. (author)

The antagonistic regulation of abscisic acid-inhibited root growth by brassinosteroids is partially mediated via direct suppression of ABSCISIC ACID INSENSITIVE 5 expression by BRASSINAZOLE RESISTANT 1.

Science.gov (United States)

Yang, Xiaorui; Bai, Yang; Shang, Jianxiu; Xin, Ruijiao; Tang, Wenqiang

2016-09-01

Brassinosteroids (BRs) and abscisic acid (ABA) are plant hormones that antagonistically regulate many aspects of plant growth and development; however, the mechanisms that regulate the crosstalk of these two hormones are still not well understood. BRs regulate plant growth and development by activating BRASSINAZOLE RESISTANT 1 (BZR1) family transcription factors. Here we show that the crosstalk between BRs and ABA signalling is partially mediated by BZR1 regulated gene expression. bzr1-1D is a dominant mutant with enhanced BR signalling; our results showed that bzr1-1D mutant is less sensitive to ABA-inhibited primary root growth. By RNA sequencing, a subset of BZR1 regulated ABA-responsive root genes were identified. Of these genes, the expression of a major ABA signalling component ABA INSENSITIVE 5 (ABI5) was found to be suppressed by BR and by BZR1. Additional evidences showed that BZR1 could bind strongly with several G-box cis-elements in the promoter of ABI5, suppress the expression of ABI5 and make plants less sensitive to ABA. Our study demonstrated that ABI5 is a direct target gene of BZR1, and modulating the expression of ABI5 by BZR1 plays important roles in regulating the crosstalk between the BR and ABA signalling pathways. © 2016 John Wiley & Sons Ltd.

[Partial splenectomy in sickle cell disease].

Science.gov (United States)

Gutiérrez Díaz, A I; Svarch, E; Arencibia Núñez, A; Sabournin Ferrier, V; Machín García, S; Menendez Veitía, A; Ramón Rodriguez, L; Serrano Mirabal, J; García Peralta, T; López Martin, L G

2015-04-01

Total splenectomy in sickle cell disease is related to a high risk of fulminant sepsis and increased incidence of other events, which have not been reported in patients with partial splenectomy. In this study we examined the patients with sickle cell disease and partial splenectomy and compared the clinical and laboratory results with non-splenectomized patients. We studied 54 patients with sickle cell disease who underwent partial splenectomy in childhood from 1986 until 2011 at the Institute of Hematology and Immunology. They were compared with 54 non-splenectomized patients selected by random sampling with similar characteristics. Partial splenectomy was performed at a mean age of 4.1 years, with a higher frequency in homozygous hemoglobin S (70.4%), and the most common cause was recurrent splenic sequestration crisis. The most common postoperative complications were fever of unknown origin (14.8%) and acute chest syndrome (11.1%). After splenectomy there was a significant increase in leukocytes, neutrophils, and platelets, the latter two parameters remained significantly elevated when compared with non-splenectomized patients. There was no difference in the incidence of clinical events, except hepatic sequestration, which was more common in splenectomized patients. Partial splenectomy was a safe procedure in patients with sickle cell disease. There were no differences in the clinical picture in children splenectomized and non-splenectomized except the greater frequency of hepatic sequestration crisis in the first group. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier España, S.L.U. All rights reserved.

Radiation effect on partially synchronized Yoshida sarcoma cells

International Nuclear Information System (INIS)

Bippus, P.H.; Heitz, J.; Ruehl, U.; Averdunk, R.

1982-01-01

Yoshida sarcoma cells, which have the same growth characteristics as ascites cells in the mouse and in cell suspension, were partially synchronized in vitro by means of excess thymidine (0.1 mM thymidine for 18 h). The growth of non-synchronized cultures was inhibited by irradiation, the degree depending on the dose of radiation. At the same time, a 50% inhibition in vivo (380 rad) and in vitro (480 rad) was determined. The incorporation of 3 H-thymidine into the DNA is inhibited by 10-32%, depending on the radiation dose. The mitotic index decreases 2 h after irradiation by a dose-dependent amount. A mitotic maximum develops later; the delay is dose-dependent. Partially synchronized cells were irradiated in the G 1 /S-, S-, G 2 -, and G 1 -phase. As compared to the 3 H-thymidine incorporation and the mitotic index there were no significant differences between the cultures which were irradiated in the individual phases of the non-synchronized control cultures. The cultures which were irradiated in the G 2 -phase, however, showed a significantly reduced growth in vivo after 48 h. If the cells were cultured for more than 72 h after irradiation, the differences between the cultures irradiated in the G 2 -phase and the other phases were reduced. (orig.)

Five year prognosis in patients with angina identified in primary care: incident cohort study.

LENUS (Irish Health Repository)

Buckley, Brian S

2009-01-01

OBJECTIVE: To ascertain the risk of acute myocardial infarction, invasive cardiac procedures, and mortality among patients with newly diagnosed angina over five years. DESIGN: Incident cohort study of patients with primary care data linked to secondary care and mortality data. SETTING: 40 primary care practices in Scotland. PARTICIPANTS: 1785 patients with a diagnosis of angina as their first manifestation of ischaemic heart disease, 1 January 1998 to 31 December 2001. MAIN OUTCOME MEASURES: Adjusted hazard ratios for acute myocardial infarction, coronary artery bypass grafting, percutaneous transluminal coronary angioplasty, death from ischaemic heart disease, and all cause mortality, adjusted for demographics, lifestyle risk factors, and comorbidity at cohort entry. RESULTS: Mean age was 62.3 (SD 11.3). Male sex was associated with an increased risk of acute myocardial infarction (hazard ratio 2.01, 95% confidence interval 1.35 to 2.97), death from ischaemic heart disease (2.80, 1.73 to 4.53), and all cause mortality (1.82, 1.33 to 2.49). Increasing age was associated with acute myocardial infarction (1.04, 1.02 to 1.06, per year of age increase), death from ischaemic heart disease (1.09, 1.06 to 1.11, per year of age increase), and all cause mortality (1.09, 1.07 to 1.11, per year of age increase). Smoking was associated with subsequent acute myocardial infarction (1.94, 1.31 to 2.89), death from ischaemic heart disease (2.12, 1.32 to 3.39), and all cause mortality (2.11, 1.52 to 2.95). Obesity was associated with death from ischaemic heart disease (2.01, 1.17 to 3.45) and all cause mortality (2.20, 1.52 to 3.19). Previous stroke was associated with all cause mortality (1.78, 1.13 to 2.80) and chronic kidney disease with death from ischaemic heart disease (5.72, 1.74 to 18.79). Men were more likely than women to have coronary artery bypass grafting or percutaneous transluminal coronary angioplasty after a diagnosis of angina; older people were less likely to

PARTIAL PURIFICATION AND CHARACTERIZATION OF ALKALOPHILIC PROTEASE FROM PSEUDOMONAS AERUGINOSA

Directory of Open Access Journals (Sweden)

R. Satheeskumar

2013-10-01

Full Text Available Partial purification and characterization of alkalophilic protease production from Pseudomonas aeruginosa was isolated from the gut of marine and coastal waters shrimp Penaeus monodon. The protease production was assayed in submerged fermentation to produce maximum protease activity (423 ± 0.09 U/ml. The enzyme was precipitated with ammonium sulphate and partially purified by ion exchange chromatography through DEAE Sephadex A-50 column. In 10th fraction showed maximum protease activity (734 ± 0.18 U/ml with increase in purification fold. The molecular weight of protease from Pseudomonas aeruginosa was recorded as 60 kDa. The stability of protease was tested at various pH and temperature; it showed maximum protease activity at pH-9 and temperature 50ºC. Among the various surfactants tested for enzyme stability, maximum activity was retained in poly ethylene glycol. The compatibility of protease enzyme with various commercial detergents; the enzyme retained maximum protease activity in tide. The results are indicated that all these properties make the bacterial proteases are most suitable for wide industrial applications.

Synthesis of [{sup 11}C]-S21007 a novel 5HT{sub 3} partial agonist as a potential tracer for PET studies

Energy Technology Data Exchange (ETDEWEB)

Guillouet, S.; Barre, L.; Gourand, F. [CEA Centre de Cyceron, 14 -Caen (France); Lasne, M.C. [Centre National de la Recherche Scientifique, 14 - Caen (France); Rault, S. [Caen Univ., 14 (France). Faculte de Pharmacie

1996-04-01

5HT{sub 3} receptors have been the focus of much research during the last decade. The presence of these receptors has been demonstrated in many neuronal tissues, both in periphery and in the CNS. The identification of selective agonists and antagonists for this receptor subtype has allowed the discovery of several important new therapeutic applications as the inhibition of pain, migraine, cytotoxic and radiation-induced emesis and treatment of psychoses and anxiety. The first 5HT{sub 3} antagonist labelled with a {beta}+ emitter atom was [{sup 11}C]MDL72222. The PET studies which have been performed with it in the brain of baboon (distribution, kinetics and binding) have established that it was not a good radioligand to detect a specific binding, due to its high lipophilicity. Other radioligands have been developed since, but their affinities for 5HT{sub 3} receptors PET studies have not been demonstrated. Among a series of of tricyclic piperazine derivatives synthesized, S21007 has been described as a novel selective and partial agonist which possesses a good affinity for 5HT{sub 3} receptors (IC{sub 50} = 1nM) versus other 5HT subtypes studied where IC{sub 50} > 1{mu}M. We report here the radiosynthesis of [{sup 11}C]S21007. (author).

Distribution of the Discretization and Algebraic Error in Numerical Solution of Partial Differential Equations

Czech Academy of Sciences Publication Activity Database

Papež, Jan; Liesen, J.; Strakoš, Z.

2014-01-01

Roč. 449, 15 May (2014), s. 89-114 ISSN 0024-3795 R&D Projects: GA AV ČR IAA100300802; GA ČR GA201/09/0917 Grant - others:GA MŠk(CZ) LL1202; GA UK(CZ) 695612 Institutional support: RVO:67985807 Keywords : numerical solution of partial differential equations * finite element method * adaptivity * a posteriori error analysis * discretization error * algebra ic error * spatial distribution of the error Subject RIV: BA - General Mathematics Impact factor: 0.939, year: 2014

Structural analysis, optical and dielectric function of [Ba{sub 0.9}Ca{sub 0.1}](Ti{sub 0.9}Zr{sub 0.1})O{sub 3} nanocrystals

Energy Technology Data Exchange (ETDEWEB)

Herrera-Pérez, G., E-mail: guillermo.herrera@cimav.edu.mx, E-mail: damasio.morales@cimav.edu.mx [Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Physics of Materials Department, Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Morales, D., E-mail: guillermo.herrera@cimav.edu.mx, E-mail: damasio.morales@cimav.edu.mx; Paraguay-Delgado, F.; Reyes-Rojas, A.; Fuentes-Cobas, L. E. [Physics of Materials Department, Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Borja-Urby, R. [Centro de Nanociencias Micro y Nanotecnologías, Instituto Politécnico Nacional, 07300 México City (Mexico)

2016-09-07

This work presents the identification of inter-band transitions in the imaginary part of the dielectric function (ε{sub 2}) derived from the Kramers–Kronig analysis for [Ba{sub 0.9}Ca{sub 0.1}](Ti{sub 0.9}Zr{sub 0.1})O{sub 3} (BCZT) nanocrystals synthesized by the modified Pechini method. The analysis started with the chemical identification of the atoms that conform BCZT in the valence loss energy region of a high energy-resolution of electron energy loss spectroscopy. The indirect band energy (E{sub g}) was determined in the dielectric response function. This result is in agreement with the UV-Vis technique, and it obtained an optical band gap of 3.16 eV. The surface and volume plasmon peaks were observed at 13.1 eV and 26.2 eV, respectively. The X-ray diffraction pattern and the Rietveld refinement data of powders heat treated at 700 °C for 1 h suggest a tetragonal structure with a space group (P4 mm) with the average crystal size of 35 nm. The average particle size was determined by transmission electron microscopy.

Five-year trends of second-hand smoke exposure in Greece: a comparison between complete, partial, and prelegislation levels.

Science.gov (United States)

Vardavas, Constantine I; Anagnostopoulos, Nektarios; Patelarou, Evridiki; Minas, Markos; Nakou, Chrysanthi; Dramba, Vassiliki; Giourgouli, Gianna; Bagkeris, Emmanouil; Gourgoulianis, Konstantinos; Pattaka, Paraskevi; Antoniadis, Antonis; Lionis, Christos; Bertic, Monique; Dockery, Douglas; Connolly, Gregory N; Behrakis, Panagiotis K

2012-12-01

Our aim was to assess second-hand smoke (SHS) exposure in hospitality venues after the smoke-free legislation implemented in September 2010 in Greece and to compare with when a partial ban was in place and in 2006 when no ban was in place. Hospitality venues were prospectively assessed for their indoor concentrations of particulate matter (PM(2.5)) during the partial ban phase (n=149) and the complete ban phase (n=120, 80% followed up), while overall and matched by venue comparisons were also performed (no ban vs. partial ban vs. complete ban). Comparisons with previously collected data in 2006 when no ban was in place also was performed. Indoor air levels of PM(2.5) attributable to SHS dropped following the transition from a partial to a complete ban by 34% (137 μg/m(3) vs. 90 μg/m(3), p=0.003). This drop was larger in bars (from 195 μg/m(3) to 121 μg/m(3)), than in cafes (124 μg/m(3) vs. 87 μg/m(3)) or restaurants (42 μg/m(3) vs. 39 μg/m(3)). PM(2.5) concentrations between 2006 (no ban) and the partial ban of 2010 were also found to decrease by 94 μg/m(3); however, among matched venues, the levels of indoor air pollution were not found to change significantly (218 μg/m(3) vs. 178 μg/m(3), p=0.58). Comparing the 2010 complete ban results (n=120) with previously collected data from 2006 when no ban was in place (n=43), overall PM(2.5) concentrations were found to fall from 268 μg/m(3) to 89 μg/m(3), while a matched analysis found a significant reduction in PM(2.5) concentrations (249 μg/m(3) vs. 46 μg/m(3), p=0.011). The complete ban of smoking in hospitality venues in Greece led to a reduction in SHS exposure, in comparison to when the partial ban or no ban was in place; however, exposure to SHS was not eliminated indicating the need for stronger enforcement.

Application of Modified G'/G-Expansion Method to Traveling Wave Solutions for Whitham-Broer-Kaup-Like Equations

International Nuclear Information System (INIS)

Zhou Yubin; Li Chao

2009-01-01

A modified G'/G-expansion method is presented to derive traveling wave solutions for a class of nonlinear partial differential equations called Whitham-Broer-Kaup-Like equations. As a result, the hyperbolic function solutions, trigonometric function solutions, and rational solutions with parameters to the equations are obtained. When the parameters are taken as special values the solitary wave solutions can be obtained. (general)

Impact of media health campaign for primary health care among mothers in karachi

International Nuclear Information System (INIS)

Habibullah, S.

2008-01-01

To evaluate the knowledge, attitude and practice of media-based primary health care (i.e. Expanded Programme of Immunization, National Polio Day, oral rehydration therapy, breast feeding, contraceptive practices, modes of spread of hepatitis B, C, and HIV) among mothers with children under five years of age in an urban and a rural area of Karachi and changes in the same after community-based health education The study was conducted in two phases. In the first phase 600 mothers with children under five years of age were selected at random (300 urban and 300 rural) for the evaluation of knowledge, attitude and practice of media-based primary health care i.e. Expanded Programme of Immunization, National Polio Day, oral rehydration therapy, breast feeding, contraceptive practices and modes of spread of Hepatitis B, C and HIV. In the second phase, health education on the same components of primary health care was given by lady health workers of the area to the same community for one month. Data of 200 mothers (100 urban and 100 rural) was re-evaluated after three months, to find out if there was any change, in the same. All the three areas were given scores and grade. In this study, 58% were Sindhi speaking. The mean age of mothers was 29 years. Majority (91% urban and 45% rural mothers) had access to one or more media channels. The knowledge of media-based primary health care was poor (score=10.09) among all mothers but attitude (score=8.07) and practice (score=11.09) was good for the same in more than 70% mothers in both communities. In the second phase of the study, it was found that the knowledge of primary health care had not improved but attitude and practice was good as observed earlier in both communities. Despite the national media based health education of Primary Health Care for decades, knowledge of primary health care was poor among mothers (urban and rural) but attitude and practice was good. Age and exposure to one or more media channels was found

Chrodrimanins K-N and Related Meroterpenoids from the Fungus Penicillium sp. SCS-KFD09 Isolated from a Marine Worm, Sipunculus nudus.

Science.gov (United States)

Kong, Fan-Dong; Ma, Qing-Yun; Huang, Sheng-Zhuo; Wang, Pei; Wang, Jun-Feng; Zhou, Li-Man; Yuan, Jing-Zhe; Dai, Hao-Fu; Zhao, You-Xing

2017-04-28

Six new meroterpenoids, chrodrimanins K-N (1-4), including two uncommon chlorinated ones (1 and 2), and verruculides B2 (5) and B3 (6), as well as seven known ones (7-13), were isolated from the fermentation broth of Penicillium sp. SCS-KFD09 isolated from a marine worm, Sipunculus nudus, from Haikou Bay, China. The structures including the absolute configurations of the new compounds were unambiguously elucidated by spectroscopic data, X-ray diffraction analysis, and ECD spectra analysis along with quantum ECD calculations. In addition, the X-ray crystal structures and absolute configurations of two previously reported meroterpenoids, chrodrimanins F (9) and A (11), are described for the first time. Compounds 1, 4, and 7 displayed anti-H1N1 activity with IC 50 values of 74, 58, and 34 μM, respectively, while compound 5 showed weak inhibitory activity against Staphylococcus aureus with an MIC of 32 μg/mL.

[Fertility after treatment with Eazi-breedTM CIDR G for 6 or 12 days outside the breeding season in Lacaune dairy sheep].

Science.gov (United States)

Fleisch, A; Piechotta, M; Bollwein, H; Janett, F

2013-07-01

This study compares the fertility after short- and long-term synchronization using a progesterone intravaginal device in Lacaune dairy sheep outside the breeding season. For the experiment 108 Lacaune sheep were treated with Eazi-breed™ CIDR® G intravaginal devices (Pfizer Animal Health, Zürich) for 12 days (Group L, n = 60) or 6 days (Group K, n = 48) in combination with eCG (Group L) or with eCG and 125 μg Cloprostenol (Group K) at device removal. Thereafter the ewes were kept together with rams for 60 days, ewes in estrus were recorded and the fertility was assessed after lambing. Blood progesterone concentration was measured at device application, withdrawal and 14 days later. Results show that neither treatment nor parity had an influence on estrus rate (Group L 91.7 %, Group K 93.8 %, nulli- and pluriparous animals 96.9 % and 90.8 %, respectively). Group L showed a tendency towards a better first cycle lambing rate and a significantly (P sheep of Group K (71.7 % vs. 60.4 % and 83.3 % vs. 72.9 %). Pluriparous ewes had higher (P synchronized ewe than nulliparous sheep for the first cycle (75.0 % vs. 46.9 % and 1.4 ± 1.0 vs. 0.9 ± 1.1) as well as for the overall service period (92.1 % vs. 46.9 % and 1.7 ± 0.8 vs. 0.9 ± 1.1). Fourteen days after insert withdrawal progesterone concentrations were higher (P progesterone treatment and nulliparous ewes were less suitable for estrus induction outside the breeding season.

The Holocene Sedimentation in Sandstone Rockshelters of Northern Bohemia

Czech Academy of Sciences Publication Activity Database

Cílek, Václav

2000-01-01

Roč. 11, - (2000), s. 66-69 ISSN 1210-9606. [International Conference on Past Global Changes Upper Pleistocene and Holocene Climatic Variations. Prague, 06.09.2000-09.09.2000] Grant - others:US(XC) National Geographic Society 6330-98 "The last foragers of the Northern Europe" Institutional research plan: CEZ:AV0Z3013912 Subject RIV: DB - Geology ; Mineralogy http://geolines.gli.cas.cz/fileadmin/volumes/volume11/G11-066.pdf

Effect of partial weight bearing program on functional ability and ...

African Journals Online (AJOL)

Lilian A. Zaky

2013-03-17

Mar 17, 2013 ... essence of the importance of partial weight bearing program in rehabilitation of lower limb condi ... and long term physical and psychosocial impairments [11,12]. .... gram for their functional walking using the 6-min walking test,.

Early Primary Endoscopic Realignment of Posterior Urethral Injury- Evaluation and Follow-Up

Directory of Open Access Journals (Sweden)

Prasad Mylarappa

2013-07-01

Full Text Available Background: The management of complete orpartial posterior urethral disruption is contro-versial and much debate continues regarding theimmediate, early and delayed definitive therapy.Objective: We report our institutional experi-ence and long term result of early endoscopicrealignment of traumatic posterior urethral in-jury. Method and Materials: Between Septem-ber 1996 and March 2012, ninety six men witheither complete (84 or partial (12 posteriorurethral injury secondary to blunt trauma (11or pelvic fractures (85, presented to our insti-tution and these patients underwent immediatesuprapubic cystostomy followed by early pri-mary endoscopic realignment done 3-8 daysafter injury. Result: Seventy four patients(92.5% were continent after catheter removal.Urethral stricture was seen in seventy two pa-tients (90% of which fifty patients (69.4%had simple urethral stricture who were managedby urethral dilatation on outpatient basis. Four-teen patients (19.4% developed short stric-tures which were successfully treated with vi-sual internal urethrotomy. Eight patients(11.1% required anastomotic urethroplasty fordense stricture. Potency was retained in sev-enty five patients (93.75%. Urinary flow mea-surements at follow-up evaluation were satis-factory.Conclusion:Early primary endoscopic realign-ment in our experience reduces time to spon-taneous voiding, decrease the need for majorreconstructive surgery and long term supra pub-lic urinary diversion.

Acute adrenal failure as the presenting feature of primary antiphospholipid syndrome in a child

Directory of Open Access Journals (Sweden)

Improda Nicola

2012-09-01

Full Text Available Abstract Introduction Antiphospholipid syndrome (APS is characterized by recurrent arterial and venous thrombosis and detection of antiphospholipid antibodies (aPLs. This syndrome may be associated with connective tissue disorders, or with malignancies, but it may also appear in isolated form (primary APS. We report on a pediatric patient presenting with acute adrenal failure as the first manifestation of primary APS. Case report A previously healthy 11-year-old boy developed fever, abdominal pain, and vomiting. An abdominal computed tomography scan showed nodular lesions in the adrenal glands. He was referred to our Department and a diagnosis of APS and acute adrenal failure was considered, based on positive aPLs (IgG and IgM, elevated ACTH levels and low cortisol levels. Other features were anemia, thrombocytopenia, elevated inflammatory parameters, hypergammaglobulinemia, prolonged partial thromboplastin time, positive antinuclear, anticardiolipin, anti-platelet antibodies, with negative double-stranded DNA antibodies. Lupus anticoagulant and Coomb’s tests were positive. MRI revealed a bilateral adrenal hemorrhage. A treatment with intravenous metylprednisolone, followed by oral prednisone and anticoagulant, was started, resulting in a progressive improvement. After 2 months he also showed hyponatremia and elevated renine levels, indicating a mineralcocorticoid deficiency, requiring fludrocortisones therapy. Conclusion The development of acute adrenal failure from bilateral adrenal haemorrhage in the context of APS is a rare but life-threatening event that should be promptly recognized and treated. Moreover, this case emphasizes the importance of the assessment of aPLs in patients with acute adrenal failure in the context of an autoreaction.

PARTIAL AGONISTS, FULL AGONISTS, ANTAGONISTS - DILEMMAS OF DEFINITION

NARCIS (Netherlands)

HOYER, D; BODDEKE, HWGM

The absence of selective antagonists makes receptor characterization difficult, and largely dependent on the use of agonists. However, there has been considerable debate as to whether certain drugs acting at G protein-coupled receptors are better described as agonists, partial agonists or

Comparison of the predictive performance of the BIG, TRISS, and PS09 score in an adult trauma population derived from multiple international trauma registries.

Science.gov (United States)

Brockamp, Thomas; Maegele, Marc; Gaarder, Christine; Goslings, J Carel; Cohen, Mitchell J; Lefering, Rolf; Joosse, Pieter; Naess, Paal A; Skaga, Nils O; Groat, Tahnee; Eaglestone, Simon; Borgman, Matthew A; Spinella, Philip C; Schreiber, Martin A; Brohi, Karim

2013-07-11

The BIG score (Admission base deficit (B), International normalized ratio (I), and Glasgow Coma Scale (G)) has been shown to predict mortality on admission in pediatric trauma patients. The objective of this study was to assess its performance in predicting mortality in an adult trauma population, and to compare it with the existing Trauma and Injury Severity Score (TRISS) and probability of survival (PS09) score. A retrospective analysis using data collected between 2005 and 2010 from seven trauma centers and registries in Europe and the United States of America was performed. We compared the BIG score with TRISS and PS09 scores in a population of blunt and penetrating trauma patients. We then assessed the discrimination ability of all scores via receiver operating characteristic (ROC) curves and compared the expected mortality rate (precision) of all scores with the observed mortality rate. In total, 12,206 datasets were retrieved to validate the BIG score. The mean ISS was 15 ± 11, and the mean 30-day mortality rate was 4.8%. With an AUROC of 0.892 (95% confidence interval (CI): 0.879 to 0.906), the BIG score performed well in an adult population. TRISS had an area under ROC (AUROC) of 0.922 (0.913 to 0.932) and the PS09 score of 0.825 (0.915 to 0.934). On a penetrating-trauma population, the BIG score had an AUROC result of 0.920 (0.898 to 0.942) compared with the PS09 score (AUROC of 0.921; 0.902 to 0.939) and TRISS (0.929; 0.912 to 0.947). The BIG score is a good predictor of mortality in the adult trauma population. It performed well compared with TRISS and the PS09 score, although it has significantly less discriminative ability. In a penetrating-trauma population, the BIG score performed better than in a population with blunt trauma. The BIG score has the advantage of being available shortly after admission and may be used to predict clinical prognosis or as a research tool to risk stratify trauma patients into clinical trials.

Omega-3 Fatty Acid Supplementation Improves Endothelial Function in Primary Antiphospholipid Syndrome: A Small-Scale Randomized Double-Blind Placebo-Controlled Trial.

Science.gov (United States)

Felau, Sheylla M; Sales, Lucas P; Solis, Marina Y; Hayashi, Ana Paula; Roschel, Hamilton; Sá-Pinto, Ana Lúcia; Andrade, Danieli Castro Oliveira De; Katayama, Keyla Y; Irigoyen, Maria Claudia; Consolim-Colombo, Fernanda; Bonfa, Eloisa; Gualano, Bruno; Benatti, Fabiana B

2018-01-01

Endothelial cells are thought to play a central role in the pathogenesis of antiphospholipid syndrome (APS). Omega-3 polyunsaturated fatty acid (n-3 PUFA) supplementation has been shown to improve endothelial function in a number of diseases; thus, it could be of high clinical relevance in APS. The aim of this study was to evaluate the efficacy of n-3 PUFA supplementation on endothelial function (primary outcome) of patients with primary APS (PAPS). A 16-week randomized clinical trial was conducted with 22 adult women with PAPS. Patients were randomly assigned (1:1) to receive placebo (PL, n  = 11) or n-3 PUFA (ω-3, n  = 11) supplementation. Before (pre) and after (post) 16 weeks of the intervention, patients were assessed for endothelial function (peripheral artery tonometry) (primary outcome). Patients were also assessed for systemic markers of endothelial cell activation, inflammatory markers, dietary intake, international normalized ratio (INR), and adverse effects. At post, ω-3 group presented significant increases in endothelial function estimates reactive hyperemia index (RHI) and logarithmic transformation of RHI (LnRHI) when compared with PL (+13 vs. -12%, p  = 0.06, ES = 0.9; and +23 vs. -22%, p  = 0.02, ES = 1.0). No changes were observed for e-selectin, vascular adhesion molecule-1, and fibrinogen levels ( p  > 0.05). In addition, ω-3 group showed decreased circulating levels of interleukin-10 (-4 vs. +45%, p  = 0.04, ES = -0.9) and tumor necrosis factor (-13 vs. +0.3%, p  = 0.04, ES = -0.95) and a tendency toward a lower intercellular adhesion molecule-1 response (+3 vs. +48%, p  = 0.1, ES = -0.7) at post when compared with PL. No changes in dietary intake, INR, or self-reported adverse effects were observed. In conclusion, 16 weeks of n-3 PUFA supplementation improved endothelial function in patients with well-controlled PAPS. These results support a role of n-3 PUFA supplementation as an

Omega-3 Fatty Acid Supplementation Improves Endothelial Function in Primary Antiphospholipid Syndrome: A Small-Scale Randomized Double-Blind Placebo-Controlled Trial

Science.gov (United States)

Felau, Sheylla M.; Sales, Lucas P.; Solis, Marina Y.; Hayashi, Ana Paula; Roschel, Hamilton; Sá-Pinto, Ana Lúcia; Andrade, Danieli Castro Oliveira De; Katayama, Keyla Y.; Irigoyen, Maria Claudia; Consolim-Colombo, Fernanda; Bonfa, Eloisa; Gualano, Bruno; Benatti, Fabiana B.

2018-01-01

Endothelial cells are thought to play a central role in the pathogenesis of antiphospholipid syndrome (APS). Omega-3 polyunsaturated fatty acid (n-3 PUFA) supplementation has been shown to improve endothelial function in a number of diseases; thus, it could be of high clinical relevance in APS. The aim of this study was to evaluate the efficacy of n-3 PUFA supplementation on endothelial function (primary outcome) of patients with primary APS (PAPS). A 16-week randomized clinical trial was conducted with 22 adult women with PAPS. Patients were randomly assigned (1:1) to receive placebo (PL, n = 11) or n-3 PUFA (ω-3, n = 11) supplementation. Before (pre) and after (post) 16 weeks of the intervention, patients were assessed for endothelial function (peripheral artery tonometry) (primary outcome). Patients were also assessed for systemic markers of endothelial cell activation, inflammatory markers, dietary intake, international normalized ratio (INR), and adverse effects. At post, ω-3 group presented significant increases in endothelial function estimates reactive hyperemia index (RHI) and logarithmic transformation of RHI (LnRHI) when compared with PL (+13 vs. −12%, p = 0.06, ES = 0.9; and +23 vs. −22%, p = 0.02, ES = 1.0). No changes were observed for e-selectin, vascular adhesion molecule-1, and fibrinogen levels (p > 0.05). In addition, ω-3 group showed decreased circulating levels of interleukin-10 (−4 vs. +45%, p = 0.04, ES = −0.9) and tumor necrosis factor (−13 vs. +0.3%, p = 0.04, ES = −0.95) and a tendency toward a lower intercellular adhesion molecule-1 response (+3 vs. +48%, p = 0.1, ES = −0.7) at post when compared with PL. No changes in dietary intake, INR, or self-reported adverse effects were observed. In conclusion, 16 weeks of n-3 PUFA supplementation improved endothelial function in patients with well-controlled PAPS. These results support a role of n-3 PUFA supplementation as an

Determination of Fatty Acid Metabolism with Dynamic [11C]Palmitate Positron Emission Tomography of Mouse Heart In Vivo

Directory of Open Access Journals (Sweden)

Yinlin Li

2015-09-01

Full Text Available The goal of this study was to establish a quantitative method for measuring fatty acid (FA metabolism with partial volume (PV and spill-over (SP corrections using dynamic [11C]palmitate positron emission tomographic (PET images of mouse heart in vivo. Twenty-minute dynamic [11C]palmitate PET scans of four 18- to 20-week-old male C57BL/6 mice under isoflurane anesthesia were performed using a Focus F-120 PET scanner. A model-corrected blood input function, by which the input function with SP and PV corrections and the metabolic rate constants (k1–k5 are simultaneously estimated from the dynamic [11C]palmitate PET images of mouse hearts in a four-compartment tracer kinetic model, was used to determine rates of myocardial fatty acid oxidation (MFAO, myocardial FA esterification, myocardial FA use, and myocardial FA uptake. The MFAO thus measured in C57BL/6 mice was 375.03 ± 43.83 nmol/min/g. This compares well to the MFAO measured in perfused working C57BL/6 mouse hearts ex vivo of about 350 nmol/g/min and 400 nmol/min/g. FA metabolism was measured for the first time in mouse heart in vivo using dynamic [11C]palmitate PET in a four-compartment tracer kinetic model. MFAO obtained with this model was validated by results previously obtained with mouse hearts ex vivo.

The Impact of Trauma Exposure and Post-Traumatic Stress Disorder on Healthcare Utilization Among Primary Care Patients

Science.gov (United States)

Kartha, Anand; Brower, Victoria; Saitz, Richard; Samet, Jeffrey H.; Keane, Terence M.; Liebschutz, Jane

2009-01-01

Background Trauma exposure and post-traumatic stress disorder (PTSD) increase healthcare utilization in veterans, but their impact on utilization in other populations is uncertain. Objectives To examine the association of trauma exposure and PTSD with healthcare utilization, in civilian primary care patients. Research Design Cross-sectional study. Subjects English speaking patients at an academic, urban primary care clinic. Measures Trauma exposure and current PTSD diagnoses were obtained from the Composite International Diagnostic Interview. Outcomes were nonmental health outpatient and emergency department visits, hospitalizations, and mental health outpatient visits in the prior year from an electronic medical record. Analyses included bivariate unadjusted and multivariable Poisson regressions adjusted for age, gender, income, substance dependence, depression, and comorbidities. Results Among 592 subjects, 80% had ≥1 trauma exposure and 22% had current PTSD. In adjusted regressions, subjects with trauma exposure had more mental health visits [incidence rate ratio (IRR), 3.9; 95% confidence interval (CI), 1.1–14.1] but no other increased utilization. After adjusting for PTSD, this effect of trauma exposure was attenuated (IRR, 3.2; 95% CI, 0.9–11.7). Subjects with PTSD had more hospitalizations (IRR, 2.2; 95% CI, 1.4–3.7), more hospital nights (IRR, 2.6; 95% CI, 1.4–5.0), and more mental health visits (IRR, 2.2; 95% CI, 1.1–4.1) but no increase in outpatient and emergency department visits. Conclusions PTSD is associated with more hospitalizations, longer hospitalizations, and greater mental healthcare utilization in urban primary care patients. Although trauma exposure is independently associated with greater mental healthcare utilization, PTSD mediates a portion of this association. PMID:18362818

OSTEOPLASTY BY G.A. ILIZAROV IN ORTHOPEDIC REHABILITATION OF PATIENTS WITH PRIMARY TUMORS OF LEG BONES

Directory of Open Access Journals (Sweden)

P. I. Balaev

2013-01-01

Full Text Available The analysis of orthopedic rehabilitation of 49 patients with primary tumors of leg bones using ostheosynthesis technique was presented. Patients with bone sarcoma underwent non-free osteoplasty by G.A. Ilizarov after combined treatment including radical tumor resection and neoadjuvant chemotherapy. In the group of patients with benign tumors the rehabilitation measures for anatomic-and-functional recovery of the limb operated were made in a single-stage fashion. The use of the transosseous osteosynthesis technologies according to Ilizarov allowed replacement of post-resection bone defects and optimal limb reconstruction not only in adults, but also in children with incomplete skeletal formation.

Coinfection with influenza A(H1N1)pdm09 and dengue virus in fatal cases.

Science.gov (United States)

Perdigão, Anne Carolinne Bezerra; Ramalho, Izabel Letícia Cavalcante; Guedes, Maria Izabel Florindo; Braga, Deborah Nunes Melo; Cavalcanti, Luciano Pamplona Góes; Melo, Maria Elisabeth Lisboa de; Araújo, Rafael Montenegro de Carvalho; Lima, Elza Gadelha; Silva, Luciene Alexandre Bié da; Araújo, Lia de Carvalho; Araújo, Fernanda Montenegro de Carvalho

2016-09-01

We report on four patients with fatal influenza A(H1N1)pdm09 and dengue virus coinfections. Clinical, necropsy and histopathologic findings presented in all cases were characteristic of influenza-dengue coinfections, and all were laboratory-confirmed for both infections. The possibility of influenza and dengue coinfection should be considered in locations where these two viruses' epidemic periods coincide to avoid fatal outcomes. Dengue is a mosquito-borne viral infection caused by one of the four dengue viruses (DENV-1 to 4). Each of these viruses is capable of causing nonspecific febrile illnesses, classic dengue fever and dengue haemorrhagic fever (Gubler 1998). As a result, dengue is often difficult to diagnose clinically, especially because peak dengue season often coincides with that of other common febrile illnesses in tropical regions (Chacon et al. 2015). In April 2009, a new virus, influenza A/H1N1/pandemic (FluA/H1N1/09pdm), caused a severe outbreak in Mexico. The virus quickly spread throughout the world, and in June 2009, the World Health Organization declared a pandemic (WHO 2010). In Brazil, the first laboratory confirmed case of FluA/H1N1/09pdm was in July 2009 (Pires Neto et al. 2013). The state of Ceará, in Northeast Brazil, is a dengue endemic area. In this state, the virus influenza A(H1N1)pdm09 has circulated since 2009, and through the first half of 2012, 11 deaths caused by the virus were confirmed (Pires Neto et al. 2013). The influenza and dengue seasons in Ceará overlap, which led to diagnostic difficulties. We report four cases of laboratory-confirmed coinfection of deadly influenza A(H1N1)pdm09 with DENV, which occurred during the dengue and influenza season in 2012 and 2013 in Ceará.

Coinfection with influenza A(H1N1pdm09 and dengue virus in fatal cases

Directory of Open Access Journals (Sweden)

Anne Carolinne Bezerra Perdigão

2016-01-01

Full Text Available Abstract We report on four patients with fatal influenza A(H1N1pdm09 and dengue virus coinfections. Clinical, necropsy and histopathologic findings presented in all cases were characteristic of influenza-dengue coinfections, and all were laboratory-confirmed for both infections. The possibility of influenza and dengue coinfection should be considered in locations where these two viruses’ epidemic periods coincide to avoid fatal outcomes. Dengue is a mosquito-borne viral infection caused by one of the four dengue viruses (DENV-1 to 4. Each of these viruses is capable of causing nonspecific febrile illnesses, classic dengue fever and dengue haemorrhagic fever (Gubler 1998. As a result, dengue is often difficult to diagnose clinically, especially because peak dengue season often coincides with that of other common febrile illnesses in tropical regions (Chacon et al. 2015. In April 2009, a new virus, influenza A/H1N1/pandemic (FluA/H1N1/09pdm, caused a severe outbreak in Mexico. The virus quickly spread throughout the world, and in June 2009, the World Health Organization declared a pandemic (WHO 2010. In Brazil, the first laboratory confirmed case of FluA/H1N1/09pdm was in July 2009 (Pires Neto et al. 2013. The state of Ceará, in Northeast Brazil, is a dengue endemic area. In this state, the virus influenza A(H1N1pdm09 has circulated since 2009, and through the first half of 2012, 11 deaths caused by the virus were confirmed (Pires Neto et al. 2013. The influenza and dengue seasons in Ceará overlap, which led to diagnostic difficulties. We report four cases of laboratory-confirmed coinfection of deadly influenza A(H1N1pdm09 with DENV, which occurred during the dengue and influenza season in 2012 and 2013 in Ceará.

Synthesis and electrochemical properties of xLiMn0.9Fe0.1PO4·yLi3V2(PO4)3/C composite cathode materials for lithium–ion batteries

International Nuclear Information System (INIS)

Wu, Ling; Lu, JiaJia; Wei, Gui; Wang, Pengfei; Ding, Hao; Zheng, Junwei; Li, Xiaowei; Zhong, Shengkui

2014-01-01

Highlights: • xLiMn 0.9 Fe 0.1 PO4·yLi 3 V 2 (PO 4 ) 3 /C composites are prepared by a solid-state method. • The addition of Li 3 V 2 (PO 4 ) 3 can improve the properties of LiMn 0.9 Fe 0.1 PO 4 . • Mutual doping occurrs between the LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases. • 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical properties. - Abstract: The xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x:y=1:0, 9:1 5:1, 3:1, 1:1 and 0:1) cathode materials are synthesized by a ball–milling and post–calcination method. XRD results reveal that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites are composed of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases, and no impurities are detected. In LiMn 0.9 Fe 0.1 PO 4 –Li 3 V 2 (PO 4 ) 3 system, most of the manganese, iron and vanadium elements in the raw materials tend to form the two major phases, and only small amounts of V, Mn and Fe as dopants enter into the lattice of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 . Electrochemical tests show that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites exhibit much better performance than the single LiMn 0.9 Fe 0.1 PO 4 /C. Among the samples, 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical performance. The sample delivers the specific capacities of 158.1, 140.7 and 100.2 mAh g −1 at 0.05, 1 and 4 C rates in the potential range of 2.5–4.5 V, and exhibits very long and flat discharge plateau around 4.0 V up to 1 C rate. The sample also shows good cycling performance at various C–rates

Multi-scale diffuse interface modeling of multi-component two-phase flow with partial miscibility

KAUST Repository

Kou, Jisheng; Sun, Shuyu

2016-01-01

In this paper, we introduce a diffuse interface model to simulate multi-component two-phase flow with partial miscibility based on a realistic equation of state (e.g. Peng-Robinson equation of state). Because of partial miscibility, thermodynamic

Enhanced Personal Contact With HIV Patients Improves Retention in Primary Care: A Randomized Trial in 6 US HIV Clinics

Science.gov (United States)

Gardner, Lytt I.; Giordano, Thomas P.; Marks, Gary; Wilson, Tracey E.; Craw, Jason A.; Drainoni, Mari-Lynn; Keruly, Jeanne C.; Rodriguez, Allan E.; Malitz, Faye; Moore, Richard D.; Bradley-Springer, Lucy A.; Holman, Susan; Rose, Charles E.; Girde, Sonali; Sullivan, Meg; Metsch, Lisa R.; Saag, Michael; Mugavero, Michael J.; Drainoni, Mari-Lynn; Ferreira, Cintia; Koppelman, Lisa; McDoom, Maya; Naisteter, Michal; Osella, Karina; Ruiz, Glory; Skolnik, Paul; Sullivan, Meg; Gibbs-Cohen, Sophia; Desrivieres, Elana; Frederick, Mayange; Gravesande, Kevin; Holman, Susan; Johnson, Harry; Taylor, Tonya; Wilson, Tracey; Cheever, Laura; Malitz, Faye; Mills, Robert; Craw, Jason; Gardner, Lytt; Girde, Sonali; Marks, Gary; Batey, Scott; Gaskin, Stephanie; Mugavero, Michael; Murphree, Jill; Raper, Jim; Saag, Michael; Thogaripally, Suneetha; Willig, James; Zinski, Anne; Arya, Monisha; Bartholomew, David; Biggs, Tawanna; Budhwani, Hina; Davila, Jessica; Giordano, Tom; Miertschin, Nancy; Payne, Shapelle; Slaughter, William; Jenckes, Mollie; Keruly, Jeanne; McCray, Angie; McGann, Mary; Moore, Richard; Otterbein, Melissa; Zhou, Liming; Garzon, Carolyn; Jean-Simon, Jesline; Mercogliano, Kathy; Metsch, Lisa; Rodriguez, Allan; Saint-Jean, Gilbert; Shika, Marvin; Bradley-Springer, Lucy; Corwin, Marla

2014-01-01

Background. The aim of the study was to determine whether enhanced personal contact with human immunodeficiency virus (HIV)–infected patients across time improves retention in care compared with existing standard of care (SOC) practices, and whether brief skills training improves retention beyond enhanced contact. Methods. The study, conducted at 6 HIV clinics in the United States, included 1838 patients with a recent history of inconsistent clinic attendance, and new patients. Each clinic randomized participants to 1 of 3 arms and continued to provide SOC practices to all enrollees: enhanced contact with interventionist (EC) (brief face-to-face meeting upon returning for care visit, interim visit call, appointment reminder calls, missed visit call); EC + skills (organization, problem solving, and communication skills); or SOC only. The intervention was delivered by project staff for 12 months following randomization. The outcomes during that 12-month period were (1) percentage of participants attending at least 1 primary care visit in 3 consecutive 4-month intervals (visit constancy), and (2) proportion of kept/scheduled primary care visits (visit adherence). Results. Log-binomial risk ratios comparing intervention arms against the SOC arm demonstrated better outcomes in both the EC and EC + skills arms (visit constancy: risk ratio [RR], 1.22 [95% confidence interval {CI}, 1.09–1.36] and 1.22 [95% CI, 1.09–1.36], respectively; visit adherence: RR, 1.08 [95% CI, 1.05–1.11] and 1.06 [95% CI, 1.02–1.09], respectively; all Ps < .01). Intervention effects were observed in numerous patient subgroups, although they were lower in patients reporting unmet needs or illicit drug use. Conclusions. Enhanced contact with patients improved retention in HIV primary care compared with existing SOC practices. A brief patient skill-building component did not improve retention further. Additional intervention elements may be needed for patients reporting illicit

Enhanced personal contact with HIV patients improves retention in primary care: a randomized trial in 6 US HIV clinics.

Science.gov (United States)

Gardner, Lytt I; Giordano, Thomas P; Marks, Gary; Wilson, Tracey E; Craw, Jason A; Drainoni, Mari-Lynn; Keruly, Jeanne C; Rodriguez, Allan E; Malitz, Faye; Moore, Richard D; Bradley-Springer, Lucy A; Holman, Susan; Rose, Charles E; Girde, Sonali; Sullivan, Meg; Metsch, Lisa R; Saag, Michael; Mugavero, Michael J

2014-09-01

The aim of the study was to determine whether enhanced personal contact with human immunodeficiency virus (HIV)-infected patients across time improves retention in care compared with existing standard of care (SOC) practices, and whether brief skills training improves retention beyond enhanced contact. The study, conducted at 6 HIV clinics in the United States, included 1838 patients with a recent history of inconsistent clinic attendance, and new patients. Each clinic randomized participants to 1 of 3 arms and continued to provide SOC practices to all enrollees: enhanced contact with interventionist (EC) (brief face-to-face meeting upon returning for care visit, interim visit call, appointment reminder calls, missed visit call); EC + skills (organization, problem solving, and communication skills); or SOC only. The intervention was delivered by project staff for 12 months following randomization. The outcomes during that 12-month period were (1) percentage of participants attending at least 1 primary care visit in 3 consecutive 4-month intervals (visit constancy), and (2) proportion of kept/scheduled primary care visits (visit adherence). Log-binomial risk ratios comparing intervention arms against the SOC arm demonstrated better outcomes in both the EC and EC + skills arms (visit constancy: risk ratio [RR], 1.22 [95% confidence interval {CI}, 1.09-1.36] and 1.22 [95% CI, 1.09-1.36], respectively; visit adherence: RR, 1.08 [95% CI, 1.05-1.11] and 1.06 [95% CI, 1.02-1.09], respectively; all Ps effects were observed in numerous patient subgroups, although they were lower in patients reporting unmet needs or illicit drug use. Enhanced contact with patients improved retention in HIV primary care compared with existing SOC practices. A brief patient skill-building component did not improve retention further. Additional intervention elements may be needed for patients reporting illicit drug use or who have unmet needs. CDCHRSA9272007. Published by Oxford University

Genetic analysis of Kruppel-like zinc finger 11 variants in 5864 Danish individuals: potential effect on insulin resistance and modified signal transducer and activator of transcription-3 binding by promoter variant -1659G>C

DEFF Research Database (Denmark)

Gutiérrez-Aguilar, Ruth; Froguel, Philippe; Hamid, Yasmin H

2008-01-01

CONTEXT: The transcription factor Krüppel-like zinc finger 11 (KLF11) has been suggested to contribute to genetic risk of type 2 diabetes (T2D). Our previous results showed that four KLF11 variants, in strong linkage disequilibrium (LD block including +185 A>G/Gln62Arg and -1659 G>C) were...

Effects of hydroxychloroquine on symptomatic improvement in primary Sjögren syndrome: the JOQUER randomized clinical trial.

Science.gov (United States)

Gottenberg, Jacques-Eric; Ravaud, Philippe; Puéchal, Xavier; Le Guern, Véronique; Sibilia, Jean; Goeb, Vincent; Larroche, Claire; Dubost, Jean-Jacques; Rist, Stéphanie; Saraux, Alain; Devauchelle-Pensec, Valérie; Morel, Jacques; Hayem, Gilles; Hatron, Pierre; Perdriger, Aleth; Sene, Damien; Zarnitsky, Charles; Batouche, Djilali; Furlan, Valérie; Benessiano, Joelle; Perrodeau, Elodie; Seror, Raphaele; Mariette, Xavier

2014-07-16

Primary Sjögren syndrome is a systemic autoimmune disease characterized by mouth and eye dryness, pain, and fatigue. Hydroxychloroquine is the most frequently prescribed immunosuppressant for the syndrome. However, evidence regarding its efficacy is limited. To evaluate the efficacy of hydroxychloroquine for the main symptoms of primary Sjögren syndrome: dryness, pain, and fatigue. From April 2008 to May 2011, 120 patients with primary Sjögren syndrome according to American-European Consensus Group Criteria from 15 university hospitals in France were randomized in a double-blind, parallel-group, placebo-controlled trial. Participants were assessed at baseline, week 12, week 24 (primary outcome), and week 48. The last follow-up date for the last patient was May 15, 2012. Patients were randomized (1:1) to receive hydroxychloroquine (400 mg/d) or placebo until week 24. All patients were prescribed hydroxychloroquine between weeks 24 and 48. The primary end point was the proportion of patients with a 30% or greater reduction between weeks 0 and 24 in scores on 2 of 3 numeric analog scales (from 0 [best] to 10 [worst]) evaluating dryness, pain, and fatigue. At 24 weeks, the proportion of patients meeting the primary end point was 17.9% (10/56) in the hydroxychloroquine group and 17.2% (11/64) in the placebo group (odds ratio, 1.01; 95% CI, 0.37-2.78; P = .98). Between weeks 0 and 24, the mean (SD) numeric analog scale score for dryness changed from 6.38 (2.14) to 5.85 (2.57) in the placebo group and 6.53 (1.97) to 6.22 (1.87) in the hydroxychloroquine group. The mean (SD) numeric analog scale score for pain changed from 4.92 (2.94) to 5.08 (2.48) in the placebo group and 5.09 (3.06) to 4.59 (2.90) in the hydroxychloroquine group. The mean (SD) numeric analog scale for fatigue changed from 6.26 (2.27) to 5.72 (2.38) in the placebo group and 6.00 (2.52) to 5.94 (2.40) in the hydroxychloroquine group. All but 1 patient in the hydroxychloroquine group had detectable

Radioprotective effects of Sipunculus nudus L. polysaccharide combined with WR-2721, rhIL-11 and rhG-CSF on radiation-injured mice

International Nuclear Information System (INIS)

Jiang Shuqi; Shen Xianrong; Liu Yuming; He Ying; Jiang Dingwen; Chen Wei

2015-01-01

This study investigated the radioprotective effect of Sipunculus nudus L. polysaccharide (SNP) in combination with WR-2721, rhIL-11 and rhG-CSF on irradiated mice. A total of 70 Imprinting Control Region (ICR) mice were divided into seven groups: the control group, the model group and five administration groups. All groups, except the control group, were exposed to a 5 Gy 60 Co γ-ray beam. Blood parameters [including white blood cell (WBC), red blood cell (RBC) and platelet counts and hemoglobin level] were assessed three days before irradiation, and the on the 3rd, 7th and 14th days after irradiation. Spleen, thymus and testicular indices, DNA contents of bone marrow cells, bone marrow nucleated cells, sperm counts, superoxide dismutase (SOD), malondialdehyde (MDA), testosterone and estradiol levels in the serum were assessed on the 14th day after irradiation. The combined administration of SNP, WR-2721, rhIL-11 and rhG-CSF exerted synergistic recovery effects on peripheral blood WBC, RBC and platelet counts and hemoglobin levels in irradiated mice, and synergistic promotion effects on spleen, thymus, testicle, bone marrow nucleated cells and sperm counts in irradiated mice. The synergistic administration increased the serum SOD activities and serum testosterone content of irradiated mice, but synergy decreased the content of serum MDA and estradiol in irradiated mice. These results suggest that the combined administration of SNP, WR-2721, rhIL-11 and rhG-CSF should increase the efficacy of these drugs for acute radiation sickness, protect immunity, hematopoiesis and the reproductive organs of irradiated-damaged mice, and improve oxidation resistance in the body. (author)

Polymorphism of HLA class I and class II alleles in influenza A(H1N1)pdm09 virus infected population of Assam, Northeast India.

Science.gov (United States)

Dutta, Mousumi; Dutta, Prafulla; Medhi, Subhash; Borkakoty, Biswajyoti; Biswas, Dipankar

2018-05-01

Human leucocyte antigen (HLA) represents one of the most highly polymorphic systems which plays a central role in the immune response. Genetic polymorphism of HLA in influenza A(H1N1)pdm09 infected population may be an important factor in disease progression and severity that needs further probing. In this study, a total of 110 Influenza like illness patients were recruited from the population of Assam, Northeast India, from which 35 cases infected by A(H1N1)pdm09 viruses and 35 controls were typed for HLA-A, B and DRB1 locus by PCR-SSP method. A total of seven alleles of HLA-A, 16 alleles of HLA-B, and 11 alleles of HLA-DRB1 locus were identified. The most common alleles within each locus in cases were HLA-A*11 (85.71%, P = 0.046), HLA-B*35 (25%, P = 0.0001), and HLA-DRB1*15 (49.35%,  P = 0.133) as compared to the controls, HLA-A*11 (40.82%), HLA-B*35 (0.00%), and HLA-DRB1*15 (67.53%). The frequency of HLA-A*11 and HLA-B*35 were significantly higher in cases as compared to the controls. In DRB1 locus, HLA-DRB1*10 was significantly higher in cases (20.78%, P = 0.005) than that of controls (0.00%). Whereas, HLA-DRB1*15 showed a higher frequency in controls than in cases. In addition, HLA-DRB3*01 (P = 0.053), DRB4*01 (P = 1.000), and DRB5*01(P = 0.591) were also identified along with HLA-DRB1 haplotype. From this preliminary study, it is suspected that there may be a role of HLA-A*11, HLA-B*35 and HLA-DRB1*10 in conferring susceptibility to influenza A(H1N1)pdm09 infection in the study population. A larger extended study on HLA polymorphism may explain the association between HLA and influenza A(H1N1)pdm09 infection and provide insights for HLA restricted peptide based vaccines. © 2018 Wiley Periodicals, Inc.

Experimental evidence for partial spatial coherence in imaging Mueller polarimetry.

Science.gov (United States)

Ossikovski, Razvigor; Arteaga, Oriol; Yoo, Sang Hyuk; Garcia-Caurel, Enric; Hingerl, Kurt

2017-11-15

We demonstrate experimentally the validity of the partial spatial coherence formalism in Mueller polarimetry and show that, in a finite spatial resolution experiment, the measured response is obtained through convolving the theoretical one with the instrument function. The reported results are of primary importance for Mueller imaging systems.

Eslicarbazepine acetate add-on for drug-resistant partial epilepsy.

Science.gov (United States)

Chang, Xian-Chao; Yuan, Hai; Wang, Yi; Xu, Hui-Qin; Hong, Wen-Ke; Zheng, Rong-Yuan

2017-10-25

This is an updated version of the Cochrane Review published in the Cochrane Library 2011, Issue 12.The majority of people with epilepsy have a good prognosis, but up to 30% of people continue to have seizures despite several regimens of antiepileptic drugs. In this review, we summarized the current evidence regarding eslicarbazepine acetate (ESL) when used as an add-on treatment for drug-resistant partial epilepsy. To evaluate the efficacy and tolerability of ESL when used as an add-on treatment for people with drug-resistant partial epilepsy. The searches for the original review were run in November 2011. Subsequently, we searched the Cochrane Epilepsy Group Specialized Register (6 December 2016), the Cochrane Central Register of Controlled Trials (CENTRAL 2016, Issue 11) and MEDLINE (1946 to 6 December 2016). There were no language restrictions. We reviewed the reference lists of retrieved studies to search for additional reports of relevant studies. We also contacted the manufacturers of ESL and experts in the field for information about any unpublished or ongoing studies. Randomized placebo controlled double-blind add-on trials of ESL in people with drug-resistant partial epilepsy. Two review authors independently selected trials for inclusion and extracted data. Outcomes investigated included 50% or greater reduction in seizure frequency, seizure freedom, treatment withdrawal, adverse effects, and drug interactions. Primary analyses were by intention to treat (ITT). The dose-response relationship was evaluated in regression models. We included five trials (1799 participants) rated at low risk of bias; all studies were funded by BIAL. The overall risk ratio (RR) with 95% confidence interval (CI) for 50% or greater reduction in seizure frequency was 1.71 (95% CI 1.42 to 2.05). Dose regression analysis showed evidence that ESL reduced seizure frequency with an increase in efficacy with increasing doses of ESL. ESL was significantly associated with seizure freedom

Preliminary results following the use of a fixed combination of timolol–brimonidine in patients with ocular hypertension and primary open-angle glaucoma

Directory of Open Access Journals (Sweden)

Dimitris Papaconstantinou

2009-03-01

Full Text Available Dimitris Papaconstantinou1, Ilias Georgalas2, Nikolaos Kourtis1, Christos Pitsas1, Efthimios Karmiris1, Chrysanthi Koutsandrea1, Ioannis Ladas1, Gerasimos Georgopoulos11Department of Ophthalmology, “G Gennimatas” Hospital of Athens, University of Athens, Athens, Greece; 2Department of Ophthalmology, “G Gennimatas” Hospital of Athens, NHS, Athens, Greece Purpose: The purpose of this prospective study was to evaluate the efficacy in intraocular pressure (IOP control and the tolerance of a topically administered fixed combination of timolol–brimonidine in 50 patients with ocular hypertension and primary open-angle glaucoma.Methods: After determining a baseline IOP, the fixed combination timolol–brimonidine was used twice daily for two months, while IOP, ophthalmic signs, and/or symptoms were monitored.Results: The mean IOP value was decreased from 23.09 mm Hg (±1.98 SD to 17.46 mm Hg (±1.47 SD during the 1st month (paired Student’s t test = 9.88 και p < 0.001, and to 17.51 mm Hg (±1.43 SD in the 2nd month. Between the 1st and 2nd month, no statistical difference was observed (paired Student’s t test = 0.02 και p < 0.1. In 8% of the patients during the 1st month and 10% of patients in the 2nd month, some ophthalmic signs were observed, while only mild ophthalmic symptoms were reported in 6% and 8% of the patients, respectively.Conclusions: In conclusion, the fixed combination of timolol–brimonidine has a satisfactory IOP-lowering effect without any serious side effects due to the topical use. Keywords: fixed combination 0.2% brimonidine–0.5% timolol, ocular hypertension, primary open-angle glaucoma

Apoptosis inhibitor 5 (API-5; AAC-11; FIF) is upregulated in human carcinomas in vivo

Czech Academy of Sciences Publication Activity Database

Kočí, Lenka; Chlebová, K.; Hýžďalová, Martina; Hofmanová, Jiřina; Jíra, M.; Kysela, P.; Kozubík, Alois; Kala, Z.; Krejčí, Pavel

2012-01-01

Roč. 3, č. 4 (2012), s. 913-916 ISSN 1792-1074 R&D Projects: GA ČR(CZ) GA305/09/1526; GA ČR(CZ) GD303/09/H048; GA ČR(CZ) GAP301/11/1730 Institutional research plan: CEZ:AV0Z50040702 Keywords : apoptosis inhibitor 5 * apoptosis * human carcinoma Subject RIV: BO - Biophysics Impact factor: 0.237, year: 2012

Induction of CD8+ T-cell responses against subunit antigens by the novel cationic liposomal CAF09 adjuvant

DEFF Research Database (Denmark)

Korsholm, Karen Smith; Hansen, Jon; Karlsen, Kasper

2014-01-01

previously described CTL-inducing adjuvants, CAF05 (DDA/trehalose dibehenate (TDB)/Poly(I:C)), Aluminium/monophosphoryl lipid-A (MPL) and Montanide/CpG/IL-2. The optimal effect was obtained when the CAF09-adjuvanted vaccine was administered by the i.p. route, whereas s.c. administration primed limited CD8+ T...

Partial anomalous pulmonary venous return in Turner syndrome.

Science.gov (United States)

van den Hoven, Allard T; Chelu, Raluca G; Duijnhouwer, Anthonie L; Demulier, Laurent; Devos, Daniel; Nieman, Koen; Witsenburg, Maarten; van den Bosch, Annemien E; Loeys, Bart L; van Hagen, Iris M; Roos-Hesselink, Jolien W

2017-10-01

The aim of this study is to describe the prevalence, anatomy, associations and clinical impact of partial anomalous pulmonary venous return in patients with Turner syndrome. All Turner patients who presented at our Turner clinic, between January 2007 and October 2015 were included in this study and underwent ECG, echocardiography and advanced imaging such as cardiac magnetic resonance or computed tomography as part of their regular clinical workup. All imaging was re-evaluated and detailed anatomy was described. Partial anomalous pulmonary venous return was diagnosed in 24 (25%) out of 96 Turner patients included and 14 (58%) of these 24 partial anomalous pulmonary venous return had not been reported previously. Right atrial or ventricular dilatation was present in 11 (46%) of 24 partial anomalous pulmonary venous return patients. When studied with advanced imaging modalities and looked for with specific attention, PAPVR is found in 1 out of 4 Turner patients. Half of these patients had right atrial and/or ventricular dilatation. Evaluation of pulmonary venous return should be included in the standard protocol in all Turner patients. Copyright © 2017. Published by Elsevier B.V.

Effect of Free Ammonia, Free Nitrous Acid, and Alkalinity on the Partial Nitrification of Pretreated Pig Slurry, Using an Alternating Oxic/Anoxic SBR

Directory of Open Access Journals (Sweden)

Marisol Belmonte

2017-01-01

Full Text Available The effect of free ammonia (NH3 or FA, free nitrous acid (HNO2 or FNA, and total alkalinity (TA on the performance of a partial nitrification (PN sequencing batch reactor (SBR treating anaerobically pretreated pig slurry was studied. The SBR was operated under alternating oxic/anoxic (O/A conditions and was fed during anoxic phases. This strategy allowed using organic matter to partially remove nitrite (NO2- and nitrate (NO3- generated during oxic phases. The desired NH4+ to NO2- ratio of 1.3 g N/g N was obtained when an Ammonium Loading Rate (ALR of 0.09 g NH4+-N/L·d was applied. The system was operated at a solid retention time (SRT of 15–20 d and dissolved oxygen (DO levels higher than 3 mg O2/L during the whole operational period. PN mainly occurred caused by the inhibitory effect of FNA on nitrite oxidizing bacteria (NOB. Once HNO2 concentration was negligible, NH4+ was fully oxidized to NO3- in spite of the presence of FA. The use of biomass acclimated to ammonium as inoculum avoided a possible effect of FA on NOB activity.

Atypical IgG4+ Plasmacytic Proliferations and Lymphomas: Characterization of 11 Cases.

Science.gov (United States)

Bledsoe, Jacob R; Wallace, Zachary S; Deshpande, Vikram; Richter, Joshua R; Klapman, Jason; Cowan, Andrew; Stone, John H; Ferry, Judith A

2017-09-01

To report the clinicopathologic features of monotypic immunoglobulin G4+ (IgG4+) lymphoid and plasmacytic proliferations. Cases were identified from the pathology files. Pathology and clinical materials were reviewed. Eleven cases of monotypic IgG4+ proliferations were identified at nodal, orbital, or salivary sites. Six cases (three men, three women; age, 57-94 years) met criteria for lymphoma or plasma cell neoplasia. Most contained frequent Mott cells. Five cases (three men, two women; age, 40-80 years) had restricted proliferations of atypical/monotypic IgG4+ plasma cells in a background of reactive lymphoid hyperplasia or inflammation. Monotypic IgG4+ proliferations include lymphomas, plasmacytic neoplasms, and a previously uncharacterized group of proliferations not meeting criteria for conventional hematolymphoid neoplasia. Distinct features included prominent Mott cells and/or monotypic plasma cells within follicles. The proliferations were infrequently associated with IgG4-related disease (IgG4-RD). Our findings raise questions regarding the relationship between clonal IgG4+ proliferations, reactive/inflammatory processes, and IgG4-RD. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Tolerance of a standard intact protein formula versus a partially hydrolyzed formula in healthy, term infants

Directory of Open Access Journals (Sweden)

Marunycz John D

2009-06-01

Full Text Available Abstract Background Parents who perceive common infant behaviors as formula intolerance-related often switch formulas without consulting a health professional. Up to one-half of formula-fed infants experience a formula change during the first six months of life. Methods The objective of this study was to assess discontinuance due to study physician-assessed formula intolerance in healthy, term infants. Infants (335 were randomized to receive either a standard intact cow milk protein formula (INTACT or a partially hydrolyzed cow milk protein formula (PH in a 60 day non-inferiority trial. Discontinuance due to study physician-assessed formula intolerance was the primary outcome. Secondary outcomes included number of infants who discontinued for any reason, including parent-assessed. Results Formula intolerance between groups (INTACT, 12.3% vs. PH, 13.7% was similar for infants who completed the study or discontinued due to study physician-assessed formula intolerance. Overall study discontinuance based on parent- vs. study physician-assessed intolerance for all infants (14.4 vs.11.1% was significantly different (P = 0.001. Conclusion This study demonstrated no difference in infant tolerance of intact vs. partially hydrolyzed cow milk protein formulas for healthy, term infants over a 60-day feeding trial, suggesting nonstandard partially hydrolyzed formulas are not necessary as a first-choice for healthy infants. Parents frequently perceived infant behavior as formula intolerance, paralleling previous reports of unnecessary formula changes. Trial Registration clinicaltrials.gov: NCT00666120

Primary hepatic neuroendocrine tumor after 4 years tumor-free follow-up.

Science.gov (United States)

Lambrescu, Ioana Maria; Martin, Sorina; Cima, Luminita; Herlea, Vlad; Badiu, Corin; Fica, Simona

2015-06-01

A primary hepatic neuroendocrine tumour (PHNET) is a very rare disease. The liver represents the preferential site for neuroendocrine tumors' metastases. A 45-year old Caucasian female who presented with nausea, vomiting, diarrhea, accompanied by diffuse abdominal pain was found to have on contrast-enhanced computer tomography an encapsulated, partially cystic liver mass. The patient underwent an uneventful left atypical hepatic resection. Histopatological and immunohistochemical examination revealed a slowly growing (G1) hepatic neuroendocrine tumour. Post surgery, the specific neuroendocrine markers (serum Chromogranin A and 24h urinary 5 hydroxy-indolacetic acid) were within normal range. Further functional imaging investigations were performed. No other lesions were found making probable the diagnosis of PHNET. The patient is presently after 4 years of follow-up with no local recurrence or distant metastases. The diagnosis of PHNET is a medical challenge that requires a thorough long term follow-up in order to exclude an occult primary neuroendocrine tumour.

Charged particle multiplicities in pp interactions at sqrt(s) = 0.9, 2.36, and 7 TeV

Energy Technology Data Exchange (ETDEWEB)

Khachatryan, V. [Yerevan Physics Institute (Aremenia); et al.,

2011-01-01

Measurements of primary charged hadron multiplicity distributions are presented for non-single-diffractive events in proton-proton collisions at centre-of-mass energies of sqrt(s) = 0.9, 2.36, and 7 TeV, in five pseudorapidity ranges from |eta|<0.5 to |eta|<2.4. The data were collected with the minimum-bias trigger of the CMS experiment during the LHC commissioning runs in 2009 and the 7 TeV run in 2010. The multiplicity distribution at sqrt(s) = 0.9 TeV is in agreement with previous measurements. At higher energies the increase of the mean multiplicity with sqrt(s) is underestimated by most event generators. The average transverse momentum as a function of the multiplicity is also presented. The measurement of higher-order moments of the multiplicity distribution confirms the violation of Koba-Nielsen-Olesen scaling that has been observed at lower energies.

Charged particle multiplicities in pp interactions at $\\sqrt{s}$ = 0.9, 2.36, and 7 TeV

CERN Document Server

Khachatryan, Vardan; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Erö, Janos; Fabjan, Christian; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hammer, Josef; Haensel, Stephan; Hartl, Christian; Hoch, Michael; Hörmann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kasieczka, Gregor; Kiesenhofer, Wolfgang; Krammer, Manfred; Liko, Dietrich; Mikulec, Ivan; Pernicka, Manfred; Rohringer, Herbert; Schöfbeck, Robert; Strauss, Josef; Taurok, Anton; Teischinger, Florian; Waltenberger, Wolfgang; Walzel, Gerhard; Widl, Edmund; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Benucci, Leonardo; Ceard, Ludivine; Cerny, Karel; De Wolf, Eddi A.; Janssen, Xavier; Maes, Thomas; Mucibello, Luca; Ochesanu, Silvia; Roland, Benoit; Rougny, Romain; Selvaggi, Michele; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Adler, Volker; Beauceron, Stephanie; Blekman, Freya; Blyweert, Stijn; D'Hondt, Jorgen; Devroede, Olivier; Kalogeropoulos, Alexis; Maes, Joris; Maes, Michael; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Onsem, Gerrit Patrick; Villella, Ilaria; Charaf, Otman; Clerbaux, Barbara; De Lentdecker, Gilles; Dero, Vincent; Gay, Arnaud; Hammad, Gregory Habib; Hreus, Tomas; Marage, Pierre Edouard; Thomas, Laurent; Vander Velde, Catherine; Vanlaer, Pascal; Wickens, John; Costantini, Silvia; Grunewald, Martin; Klein, Benjamin; Marinov, Andrey; Ryckbosch, Dirk; Thyssen, Filip; Tytgat, Michael; Vanelderen, Lukas; Verwilligen, Piet; Walsh, Sinead; Zaganidis, Nicolas; Basegmez, Suzan; Bruno, Giacomo; Caudron, Julien; De Favereau De Jeneret, Jerome; Delaere, Christophe; Demin, Pavel; Favart, Denis; Giammanco, Andrea; Grégoire, Ghislain; Hollar, Jonathan; Lemaitre, Vincent; Liao, Junhui; Militaru, Otilia; Ovyn, Severine; Pagano, Davide; Pin, Arnaud; Piotrzkowski, Krzysztof; Quertenmont, Loic; Schul, Nicolas; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Alves, Gilvan; De Jesus Damiao, Dilson; Pol, Maria Elena; Henrique Gomes E Souza, Moacyr; Carvalho, Wagner; Da Costa, Eliza Melo; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Mundim, Luiz; Nogima, Helio; Oguri, Vitor; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Silva Do Amaral, Sheila Mara; Sznajder, Andre; Torres Da Silva De Araujo, Felipe; De Almeida Dias, Flavia; Ferreira Dias, Marco Andre; Tomei, Thiago; De Moraes Gregores, Eduardo; Da Cunha Marinho, Franciole; Novaes, Sergio F.; Padula, Sandra; Darmenov, Nikolay; Dimitrov, Lubomir; Genchev, Vladimir; Iaydjiev, Plamen; Piperov, Stefan; Rodozov, Mircho; Stoykova, Stefka; Sultanov, Georgi; Tcholakov, Vanio; Trayanov, Rumen; Vankov, Ivan; Dyulendarova, Milena; Hadjiiska, Roumyana; Kozhuharov, Venelin; Litov, Leander; Marinova, Evelina; Mateev, Matey; Pavlov, Borislav; Petkov, Peicho; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Jiang, Chun-Hua; Liang, Dong; Liang, Song; Wang, Jian; Wang, Jian; Wang, Xianyou; Wang, Zheng; Yang, Min; Zang, Jingjing; Zhang, Zhen; Ban, Yong; Guo, Shuang; Li, Wenbo; Mao, Yajun; Qian, Si-Jin; Teng, Haiyun; Zhu, Bo; Cabrera, Andrés; Gomez Moreno, Bernardo; Ocampo Rios, Alberto Andres; Osorio Oliveros, Andres Felipe; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Lelas, Karlo; Plestina, Roko; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Dzelalija, Mile; Brigljevic, Vuko; Duric, Senka; Kadija, Kreso; Morovic, Srecko; Attikis, Alexandros; Fereos, Reginos; Galanti, Mario; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A.; Rykaczewski, Hans; Assran, Yasser; Mahmoud, Mohammed; Hektor, Andi; Kadastik, Mario; Kannike, Kristjan; Müntel, Mait; Raidal, Martti; Rebane, Liis; Azzolini, Virginia; Eerola, Paula; Czellar, Sandor; Härkönen, Jaakko; Heikkinen, Mika Aatos; Karimäki, Veikko; Kinnunen, Ritva; Klem, Jukka; Kortelainen, Matti J.; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Mäenpää, Teppo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Ungaro, Donatella; Wendland, Lauri; Banzuzi, Kukka; Korpela, Arja; Tuuva, Tuure; Sillou, Daniel; Besancon, Marc; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Gentit, François-Xavier; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Marionneau, Matthieu; Millischer, Laurent; Rander, John; Rosowsky, André; Shreyber, Irina; Titov, Maksym; Verrecchia, Patrice; Baffioni, Stephanie; Beaudette, Florian; Bianchini, Lorenzo; Bluj, Michal; Broutin, Clementine; Busson, Philippe; Charlot, Claude; Dobrzynski, Ludwik; Granier de Cassagnac, Raphael; Haguenauer, Maurice; Miné, Philippe; Mironov, Camelia; Ochando, Christophe; Paganini, Pascal; Porteboeuf, Sarah; Sabes, David; Salerno, Roberto; Sirois, Yves; Thiebaux, Christophe; Wyslouch, Bolek; Zabi, Alexandre; Agram, Jean-Laurent; Andrea, Jeremy; Besson, Auguste; Bloch, Daniel; Bodin, David; Brom, Jean-Marie; Cardaci, Marco; Chabert, Eric Christian; Collard, Caroline; Conte, Eric; Drouhin, Frédéric; Ferro, Cristina; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Greder, Sebastien; Juillot, Pierre; Karim, Mehdi; Le Bihan, Anne-Catherine; Mikami, Yoshinari; Van Hove, Pierre; Fassi, Farida; Mercier, Damien; Baty, Clement; Beaupere, Nicolas; Bedjidian, Marc; Bondu, Olivier; Boudoul, Gaelle; Boumediene, Djamel; Brun, Hugues; Chanon, Nicolas; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Falkiewicz, Anna; Fay, Jean; Gascon, Susan; Ille, Bernard; Kurca, Tibor; Le Grand, Thomas; Lethuillier, Morgan; Mirabito, Laurent; Perries, Stephane; Sordini, Viola; Tosi, Silvano; Tschudi, Yohann; Verdier, Patrice; Xiao, Hong; Roinishvili, Vladimir; Anagnostou, Georgios; Edelhoff, Matthias; Feld, Lutz; Heracleous, Natalie; Hindrichs, Otto; Jussen, Ruediger; Klein, Katja; Merz, Jennifer; Mohr, Niklas; Ostapchuk, Andrey; Perieanu, Adrian; Raupach, Frank; Sammet, Jan; Schael, Stefan; Sprenger, Daniel; Weber, Hendrik; Weber, Martin; Wittmer, Bruno; Ata, Metin; Bender, Walter; Erdmann, Martin; Frangenheim, Jens; Hebbeker, Thomas; Hinzmann, Andreas; Hoepfner, Kerstin; Hof, Carsten; Klimkovich, Tatsiana; Klingebiel, Dennis; Kreuzer, Peter; Lanske, Dankfried; Magass, Carsten; Masetti, Gianni; Merschmeyer, Markus; Meyer, Arnd; Papacz, Paul; Pieta, Holger; Reithler, Hans; Schmitz, Stefan Antonius; Sonnenschein, Lars; Steggemann, Jan; Teyssier, Daniel; Bontenackels, Michael; Davids, Martina; Duda, Markus; Flügge, Günter; Geenen, Heiko; Giffels, Manuel; Haj Ahmad, Wael; Heydhausen, Dirk; Kress, Thomas; Kuessel, Yvonne; Linn, Alexander; Nowack, Andreas; Perchalla, Lars; Pooth, Oliver; Rennefeld, Jörg; Sauerland, Philip; Stahl, Achim; Thomas, Maarten; Tornier, Daiske; Zoeller, Marc Henning; Aldaya Martin, Maria; Behrenhoff, Wolf; Behrens, Ulf; Bergholz, Matthias; Borras, Kerstin; Cakir, Altan; Campbell, Alan; Castro, Elena; Dammann, Dirk; Eckerlin, Guenter; Eckstein, Doris; Flossdorf, Alexander; Flucke, Gero; Geiser, Achim; Glushkov, Ivan; Hauk, Johannes; Jung, Hannes; Kasemann, Matthias; Katkov, Igor; Katsas, Panagiotis; Kleinwort, Claus; Kluge, Hannelies; Knutsson, Albert; Krücker, Dirk; Kuznetsova, Ekaterina; Lange, Wolfgang; Lohmann, Wolfgang; Mankel, Rainer; Marienfeld, Markus; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mnich, Joachim; Mussgiller, Andreas; Olzem, Jan; Parenti, Andrea; Raspereza, Alexei; Raval, Amita; Schmidt, Ringo; Schoerner-Sadenius, Thomas; Sen, Niladri; Stein, Matthias; Tomaszewska, Justyna; Volyanskyy, Dmytro; Walsh, Roberval; Wissing, Christoph; Autermann, Christian; Bobrovskyi, Sergei; Draeger, Jula; Enderle, Holger; Gebbert, Ulla; Kaschube, Kolja; Kaussen, Gordon; Klanner, Robert; Mura, Benedikt; Naumann-Emme, Sebastian; Nowak, Friederike; Pietsch, Niklas; Sander, Christian; Schettler, Hannes; Schleper, Peter; Schröder, Matthias; Schum, Torben; Schwandt, Joern; Srivastava, Ajay Kumar; Stadie, Hartmut; Steinbrück, Georg; Thomsen, Jan; Wolf, Roger; Bauer, Julia; Buege, Volker; Chwalek, Thorsten; De Boer, Wim; Dierlamm, Alexander; Dirkes, Guido; Feindt, Michael; Gruschke, Jasmin; Hackstein, Christoph; Hartmann, Frank; Heindl, Stefan Michael; Heinrich, Michael; Held, Hauke; Hoffmann, Karl-Heinz; Honc, Simon; Kuhr, Thomas; Martschei, Daniel; Mueller, Steffen; Müller, Thomas; Niegel, Martin; Oberst, Oliver; Oehler, Andreas; Ott, Jochen; Peiffer, Thomas; Piparo, Danilo; Quast, Gunter; Rabbertz, Klaus; Ratnikov, Fedor; Renz, Manuel; Saout, Christophe; Scheurer, Armin; Schieferdecker, Philipp; Schilling, Frank-Peter; Schott, Gregory; Simonis, Hans-Jürgen; Stober, Fred-Markus Helmut; Troendle, Daniel; Wagner-Kuhr, Jeannine; Zeise, Manuel; Zhukov, Valery; Ziebarth, Eva Barbara; Daskalakis, Georgios; Geralis, Theodoros; Kesisoglou, Stilianos; Kyriakis, Aristotelis; Loukas, Demetrios; Manolakos, Ioannis; Markou, Athanasios; Markou, Christos; Mavrommatis, Charalampos; Petrakou, Eleni; Gouskos, Loukas; Mertzimekis, Theodoros; Panagiotou, Apostolos; Evangelou, Ioannis; Foudas, Costas; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Patras, Vaios; Triantis, Frixos A.; Aranyi, Attila; Bencze, Gyorgy; Boldizsar, Laszlo; Debreczeni, Gergely; Hajdu, Csaba; Horvath, Dezso; Kapusi, Anita; Krajczar, Krisztian; Laszlo, Andras; Sikler, Ferenc; Vesztergombi, Gyorgy; Beni, Noemi; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Veszpremi, Viktor; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Bansal, Sunil; Beri, Suman Bala; Bhatnagar, Vipin; Dhingra, Nitish; Jindal, Monika; Kaur, Manjit; Kohli, Jatinder Mohan; Mehta, Manuk Zubin; Nishu, Nishu; Saini, Lovedeep Kaur; Sharma, Archana; Singh, Anil; Singh, Jas Bir; Singh, Supreet Pal; Ahuja, Sudha; Bhattacharya, Satyaki; Choudhary, Brajesh C.; Gupta, Pooja; Jain, Sandhya; Jain, Shilpi; Kumar, Ashok; Shivpuri, Ram Krishen; Choudhury, Rajani Kant; Dutta, Dipanwita; Kailas, Swaminathan; Kataria, Sushil Kumar; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Suggisetti, Praveenkumar; Aziz, Tariq; Guchait, Monoranjan; Gurtu, Atul; Maity, Manas; Majumder, Devdatta; Majumder, Gobinda; Mazumdar, Kajari; Mohanty, Gagan Bihari; Saha, Anirban; Sudhakar, Katta; Wickramage, Nadeesha; Banerjee, Sudeshna; Dugad, Shashikant; Mondal, Naba Kumar; Arfaei, Hessamaddin; Bakhshiansohi, Hamed; Etesami, Seyed Mohsen; Fahim, Ali; Hashemi, Majid; Jafari, Abideh; Khakzad, Mohsen; Mohammadi, Abdollah; Mohammadi Najafabadi, Mojtaba; Paktinat Mehdiabadi, Saeid; Safarzadeh, Batool; Zeinali, Maryam; Abbrescia, Marcello; Barbone, Lucia; Calabria, Cesare; Colaleo, Anna; Creanza, Donato; De Filippis, Nicola; De Palma, Mauro; Dimitrov, Anton; Fedele, Francesca; Fiore, Luigi; Iaselli, Giuseppe; Lusito, Letizia; Maggi, Giorgio; Maggi, Marcello; Manna, Norman; Marangelli, Bartolomeo; My, Salvatore; Nuzzo, Salvatore; Pacifico, Nicola; Pierro, Giuseppe Antonio; Pompili, Alexis; Pugliese, Gabriella; Romano, Francesco; Roselli, Giuseppe; Selvaggi, Giovanna; Silvestris, Lucia; Trentadue, Raffaello; Tupputi, Salvatore; Zito, Giuseppe; Abbiendi, Giovanni; Benvenuti, Alberto; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Giunta, Marina; Grandi, Claudio; Marcellini, Stefano; Meneghelli, Marco; Montanari, Alessandro; Navarria, Francesco; Odorici, Fabrizio; Perrotta, Andrea; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gianni; Travaglini, Riccardo; Albergo, Sebastiano; Cappello, Gigi; Chiorboli, Massimiliano; Costa, Salvatore; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Frosali, Simone; Gallo, Elisabetta; Genta, Chiara; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Benussi, Luigi; Bianco, Stefano; Colafranceschi, Stefano; Fabbri, Franco; Piccolo, Davide; Fabbricatore, Pasquale; Musenich, Riccardo; Benaglia, Andrea; Cerati, Giuseppe Benedetto; De Guio, Federico; Di Matteo, Leonardo; Ghezzi, Alessio; Malberti, Martina; Malvezzi, Sandra; Martelli, Arabella; Massironi, Andrea; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Ragazzi, Stefano; Redaelli, Nicola; Sala, Silvano; Tabarelli de Fatis, Tommaso; Tancini, Valentina; Buontempo, Salvatore; Carrillo Montoya, Camilo Andres; Cimmino, Anna; De Cosa, Annapaola; De Gruttola, Michele; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Merola, Mario; Noli, Pasquale; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Bellan, Paolo; Biasotto, Massimo; Bisello, Dario; Branca, Antonio; Carlin, Roberto; Checchia, Paolo; Conti, Enrico; De Mattia, Marco; Dorigo, Tommaso; Fanzago, Federica; Gasparini, Fabrizio; Giubilato, Piero; Gresele, Ambra; Lacaprara, Stefano; Lazzizzera, Ignazio; Margoni, Martino; Meneguzzo, Anna Teresa; Nespolo, Massimo; Perrozzi, Luca; Pozzobon, Nicola; Ronchese, Paolo; Simonetto, Franco; Torassa, Ezio; Tosi, Mia; Vanini, Sara; Ventura, Sandro; Zotto, Pierluigi; Zumerle, Gianni; Baesso, Paolo; Berzano, Umberto; Riccardi, Cristina; Torre, Paola; Vitulo, Paolo; Viviani, Claudio; Biasini, Maurizio; Bilei, Gian Mario; Caponeri, Benedetta; Fanò, Livio; Lariccia, Paolo; Lucaroni, Andrea; Mantovani, Giancarlo; Menichelli, Mauro; Nappi, Aniello; Santocchia, Attilio; Servoli, Leonello; Taroni, Silvia; Valdata, Marisa; Volpe, Roberta; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Broccolo, Giuseppe; Castaldi, Rino; D'Agnolo, Raffaele Tito; Dell'Orso, Roberto; Fiori, Francesco; Foà, Lorenzo; Giassi, Alessandro; Kraan, Aafke; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Palla, Fabrizio; Palmonari, Francesco; Sarkar, Subir; Segneri, Gabriele; Serban, Alin Titus; Spagnolo, Paolo; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; Del Re, Daniele; Di Marco, Emanuele; Diemoz, Marcella; Franci, Daniele; Grassi, Marco; Longo, Egidio; Organtini, Giovanni; Palma, Alessandro; Pandolfi, Francesco; Paramatti, Riccardo; Rahatlou, Shahram; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Biino, Cristina; Botta, Cristina; Cartiglia, Nicolo; Castello, Roberto; Costa, Marco; Demaria, Natale; Graziano, Alberto; Mariotti, Chiara; Marone, Matteo; Maselli, Silvia; Migliore, Ernesto; Mila, Giorgia; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Pastrone, Nadia; Pelliccioni, Mario; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Sola, Valentina; Solano, Ada; Staiano, Amedeo; Trocino, Daniele; Vilela Pereira, Antonio; Ambroglini, Filippo; Belforte, Stefano; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; Montanino, Damiana; Penzo, Aldo; Heo, Seong Gu; Chang, Sunghyun; Chung, Jin Hyuk; Kim, Dong Hee; Kim, Gui Nyun; Kim, Ji Eun; Kong, Dae Jung; Park, Hyangkyu; Son, Dohhee; Son, Dong-Chul; Kim, Jaeho; Kim, Jae Yool; Song, Sanghyeon; Choi, Suyong; Hong, Byung-Sik; Jo, Mihee; Kim, Hyunchul; Kim, Ji Hyun; Kim, Tae Jeong; Lee, Kyong Sei; Moon, Dong Ho; Park, Sung Keun; Rhee, Han-Bum; Seo, Eunsung; Shin, Seungsu; Sim, Kwang Souk; Choi, Minkyoo; Kang, Seokon; Kim, Hyunyong; Park, Chawon; Park, Inkyu; Park, Sangnam; Ryu, Geonmo; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Lee, Jongseok; Lee, Sungeun; Seo, Hyunkwan; Yu, Intae; Bilinskas, Mykolas Jurgis; Grigelionis, Ignas; Janulis, Mindaugas; Martisiute, Dalia; Petrov, Pavel; Sabonis, Tomas; Castilla Valdez, Heriberto; De La Cruz Burelo, Eduard; Lopez-Fernandez, Ricardo; Sánchez Hernández, Alberto; Villasenor-Cendejas, Luis Manuel; Carrillo Moreno, Salvador; Vazquez Valencia, Fabiola; Salazar Ibarguen, Humberto Antonio; Casimiro Linares, Edgar; Morelos Pineda, Antonio; Reyes-Santos, Marco A.; Allfrey, Philip; Krofcheck, David; Tam, Jason; Butler, Philip H.; Doesburg, Robert; Silverwood, Hamish; Ahmad, Muhammad; Ahmed, Ijaz; Asghar, Muhammad Irfan; Hoorani, Hafeez R.; Khan, Wajid Ali; Khurshid, Taimoor; Qazi, Shamona; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Frueboes, Tomasz; Gokieli, Ryszard; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Wrochna, Grzegorz; Zalewski, Piotr; Almeida, Nuno; David Tinoco Mendes, Andre; Faccioli, Pietro; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Sá Martins, Pedro; Musella, Pasquale; Nayak, Aruna; Ribeiro, Pedro Quinaz; Seixas, Joao; Silva, Pedro; Varela, Joao; Wöhri, Hermine Katharina; Belotelov, Ivan; Bunin, Pavel; Finger, Miroslav; Finger Jr., Michael; Golutvin, Igor; Kamenev, Alexey; Karjavin, Vladimir; Kozlov, Guennady; Lanev, Alexander; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Smirnov, Vitaly; Volodko, Anton; Zarubin, Anatoli; Bondar, Nikolai; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Levchenko, Petr; Murzin, Victor; Oreshkin, Vadim; Smirnov, Igor; Sulimov, Valentin; Uvarov, Lev; Vavilov, Sergey; Vorobyev, Alexey; Andreev, Yuri; Gninenko, Sergei; Golubev, Nikolai; Kirsanov, Mikhail; Krasnikov, Nikolai; Matveev, Viktor; Pashenkov, Anatoli; Toropin, Alexander; Troitsky, Sergey; Epshteyn, Vladimir; Gavrilov, Vladimir; Kaftanov, Vitali; Kossov, Mikhail; Krokhotin, Andrey; Lychkovskaya, Natalia; Safronov, Grigory; Semenov, Sergey; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Boos, Edouard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Kodolova, Olga; Lokhtin, Igor; Obraztsov, Stepan; Petrushanko, Sergey; Sarycheva, Ludmila; Savrin, Viktor; Snigirev, Alexander; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Rusakov, Sergey V.; Vinogradov, Alexey; Azhgirey, Igor; Bitioukov, Sergei; Grishin, Viatcheslav; Kachanov, Vassili; Konstantinov, Dmitri; Korablev, Andrey; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Slabospitsky, Sergey; Sobol, Andrei; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Djordjevic, Milos; Krpic, Dragomir; Milosevic, Jovan; Aguilar-Benitez, Manuel; Alcaraz Maestre, Juan; Arce, Pedro; Battilana, Carlo; Calvo, Enrique; Cepeda, Maria; Cerrada, Marcos; Colino, Nicanor; De La Cruz, Begona; Diez Pardos, Carmen; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Ferrando, Antonio; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M.; Josa, Maria Isabel; Merino, Gonzalo; Puerta Pelayo, Jesus; Redondo, Ignacio; Romero, Luciano; Santaolalla, Javier; Willmott, Carlos; Albajar, Carmen; Codispoti, Giuseppe; de Trocóniz, Jorge F; Cuevas, Javier; Fernandez Menendez, Javier; Folgueras, Santiago; Gonzalez Caballero, Isidro; Lloret Iglesias, Lara; Vizan Garcia, Jesus Manuel; Brochero Cifuentes, Javier Andres; Cabrillo, Iban Jose; Calderon, Alicia; Chamizo Llatas, Maria; Chuang, Shan-Huei; Duarte Campderros, Jordi; Felcini, Marta; Fernandez, Marcos; Gomez, Gervasio; Gonzalez Sanchez, Javier; Gonzalez Suarez, Rebeca; Jorda, Clara; Lobelle Pardo, Patricia; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Matorras, Francisco; Munoz Sanchez, Francisca Javiela; Piedra Gomez, Jonatan; Rodrigo, Teresa; Ruiz Jimeno, Alberto; Scodellaro, Luca; Sobron Sanudo, Mar; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Baillon, Paul; Ball, Austin; Barney, David; Bell, Alan James; Benedetti, Daniele; Bernet, Colin; Bialas, Wojciech; Bloch, Philippe; Bocci, Andrea; Bolognesi, Sara; Breuker, Horst; Brona, Grzegorz; Bunkowski, Karol; Camporesi, Tiziano; Cano, Eric; Cerminara, Gianluca; Christiansen, Tim; Coarasa Perez, Jose Antonio; Covarelli, Roberto; Curé, Benoît; D'Enterria, David; Dahms, Torsten; De Roeck, Albert; Duarte Ramos, Fernando; Elliott-Peisert, Anna; Funk, Wolfgang; Gaddi, Andrea; Gennai, Simone; Georgiou, Georgios; Gerwig, Hubert; Gigi, Dominique; Gill, Karl; Giordano, Domenico; Glege, Frank; Gomez-Reino Garrido, Robert; Gouzevitch, Maxime; Govoni, Pietro; Gowdy, Stephen; Guiducci, Luigi; Hansen, Magnus; Harvey, John; Hegeman, Jeroen; Hegner, Benedikt; Henderson, Conor; Hoffmann, Hans Falk; Honma, Alan; Innocente, Vincenzo; Janot, Patrick; Karavakis, Edward; Lecoq, Paul; Leonidopoulos, Christos; Lourenco, Carlos; Macpherson, Alick; Maki, Tuula; Malgeri, Luca; Mannelli, Marcello; Masetti, Lorenzo; Meijers, Frans; Mersi, Stefano; Meschi, Emilio; Moser, Roland; Mozer, Matthias Ulrich; Mulders, Martijn; Nesvold, Erik; Nguyen, Matthew; Orimoto, Toyoko; Orsini, Luciano; Perez, Emmanuelle; Petrilli, Achille; Pfeiffer, Andreas; Pierini, Maurizio; Pimiä, Martti; Polese, Giovanni; Racz, Attila; Rolandi, Gigi; Rommerskirchen, Tanja; Rovelli, Chiara; Rovere, Marco; Sakulin, Hannes; Schäfer, Christoph; Schwick, Christoph; Segoni, Ilaria; Sharma, Archana; Siegrist, Patrice; Simon, Michal; Sphicas, Paraskevas; Spiga, Daniele; Spiropulu, Maria; Stöckli, Fabian; Stoye, Markus; Tropea, Paola; Tsirou, Andromachi; Tsyganov, Andrey; Veres, Gabor Istvan; Vichoudis, Paschalis; Voutilainen, Mikko; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Gabathuler, Kurt; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; König, Stefan; Kotlinski, Danek; Langenegger, Urs; Meier, Frank; Renker, Dieter; Rohe, Tilman; Sibille, Jennifer; Starodumov, Andrei; Bortignon, Pierluigi; Caminada, Lea; Chen, Zhiling; Cittolin, Sergio; Dissertori, Günther; Dittmar, Michael; Eugster, Jürg; Freudenreich, Klaus; Grab, Christoph; Hervé, Alain; Hintz, Wieland; Lecomte, Pierre; Lustermann, Werner; Marchica, Carmelo; Martinez Ruiz del Arbol, Pablo; Meridiani, Paolo; Milenovic, Predrag; Moortgat, Filip; Nef, Pascal; Nessi-Tedaldi, Francesca; Pape, Luc; Pauss, Felicitas; Punz, Thomas; Rizzi, Andrea; Ronga, Frederic Jean; Sala, Leonardo; Sanchez, Ann - Karin; Sawley, Marie-Christine; Stieger, Benjamin; Tauscher, Ludwig; Thea, Alessandro; Theofilatos, Konstantinos; Treille, Daniel; Urscheler, Christina; Wallny, Rainer; Weber, Matthias; Wehrli, Lukas; Weng, Joanna; Aguiló, Ernest; Amsler, Claude; Chiochia, Vincenzo; De Visscher, Simon; Favaro, Carlotta; Ivova Rikova, Mirena; Millan Mejias, Barbara; Regenfus, Christian; Robmann, Peter; Schmidt, Alexander; Snoek, Hella; Wilke, Lotte; Chang, Yuan-Hann; Chen, Kuan-Hsin; Chen, Wan-Ting; Dutta, Suchandra; Go, Apollo; Kuo, Chia-Ming; Li, Syue-Wei; Lin, Willis; Liu, Ming-Hsiung; Liu, Zong-kai; Lu, Yun-Ju; Wu, Jing-Han; Yu, Shin-Shan; Bartalini, Paolo; Chang, Paoti; Chang, You-Hao; Chang, Yu-Wei; Chao, Yuan; Chen, Kai-Feng; Hou, George Wei-Shu; Hsiung, Yee; Kao, Kai-Yi; Lei, Yeong-Jyi; Lu, Rong-Shyang; Shiu, Jing-Ge; Tzeng, Yeng-Ming; Wang, Minzu; Adiguzel, Aytul; Bakirci, Mustafa Numan; Cerci, Salim; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gökbulut, Gül; Güler, Yalcin; Gurpinar, Emine; Hos, Ilknur; Kangal, Evrim Ersin; Karaman, Turker; Kayis Topaksu, Aysel; Nart, Alisah; Önengüt, Gülsen; Ozdemir, Kadri; Ozturk, Sertac; Polatöz, Ayse; Sogut, Kenan; Tali, Bayram; Topakli, Huseyin; Uzun, Dilber; Vergili, Latife Nukhet; Vergili, Mehmet; Zorbilmez, Caglar; Akin, Ilina Vasileva; Aliev, Takhmasib; Bilmis, Selcuk; Deniz, Muhammed; Gamsizkan, Halil; Guler, Ali Murat; Ocalan, Kadir; Ozpineci, Altug; Serin, Meltem; Sever, Ramazan; Surat, Ugur Emrah; Yildirim, Eda; Zeyrek, Mehmet; Deliomeroglu, Mehmet; Demir, Durmus; Gülmez, Erhan; Halu, Arda; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Özbek, Melih; Ozkorucuklu, Suat; Sonmez, Nasuf; Levchuk, Leonid; Bell, Peter; Bostock, Francis; Brooke, James John; Cheng, Teh Lee; Clement, Emyr; Cussans, David; Frazier, Robert; Goldstein, Joel; Grimes, Mark; Hansen, Maria; Hartley, Dominic; Heath, Greg P.; Heath, Helen F.; Huckvale, Benedickt; Jackson, James; Kreczko, Lukasz; Metson, Simon; Newbold, Dave M.; Nirunpong, Kachanon; Poll, Anthony; Senkin, Sergey; Smith, Vincent J.; Ward, Simon; Basso, Lorenzo; Bell, Ken W.; Belyaev, Alexander; Brew, Christopher; Brown, Robert M.; Camanzi, Barbara; Cockerill, David J.A.; Coughlan, John A.; Harder, Kristian; Harper, Sam; Kennedy, Bruce W.; Olaiya, Emmanuel; Petyt, David; Radburn-Smith, Benjamin Charles; Shepherd-Themistocleous, Claire; Tomalin, Ian R.; Womersley, William John; Worm, Steven; Bainbridge, Robert; Ball, Gordon; Ballin, Jamie; Beuselinck, Raymond; Buchmuller, Oliver; Colling, David; Cripps, Nicholas; Cutajar, Michael; Davies, Gavin; Della Negra, Michel; Fulcher, Jonathan; Futyan, David; Guneratne Bryer, Arlo; Hall, Geoffrey; Hatherell, Zoe; Hays, Jonathan; Iles, Gregory; Karapostoli, Georgia; Lyons, Louis; Magnan, Anne-Marie; Marrouche, Jad; Nandi, Robin; Nash, Jordan; Nikitenko, Alexander; Papageorgiou, Anastasios; Pesaresi, Mark; Petridis, Konstantinos; Pioppi, Michele; Raymond, David Mark; Rompotis, Nikolaos; Rose, Andrew; Ryan, Matthew John; Seez, Christopher; Sharp, Peter; Sparrow, Alex; Tapper, Alexander; Tourneur, Stephane; Vazquez Acosta, Monica; Virdee, Tejinder; Wakefield, Stuart; Wardrope, David; Whyntie, Tom; Barrett, Matthew; Chadwick, Matthew; Cole, Joanne; Hobson, Peter R.; Khan, Akram; Kyberd, Paul; Leslie, Dawn; Martin, William; Reid, Ivan; Teodorescu, Liliana; Hatakeyama, Kenichi; Bose, Tulika; Carrera Jarrin, Edgar; Clough, Andrew; Fantasia, Cory; Heister, Arno; St. John, Jason; Lawson, Philip; Lazic, Dragoslav; Rohlf, James; Sperka, David; Sulak, Lawrence; Avetisyan, Aram; Bhattacharya, Saptaparna; Chou, John Paul; Cutts, David; Esen, Selda; Ferapontov, Alexey; Heintz, Ulrich; Jabeen, Shabnam; Kukartsev, Gennadiy; Landsberg, Greg; Narain, Meenakshi; Nguyen, Duong; Segala, Michael; Speer, Thomas; Tsang, Ka Vang; Borgia, Maria Assunta; Breedon, Richard; Calderon De La Barca Sanchez, Manuel; Cebra, Daniel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Cox, Peter Timothy; Dolen, James; Erbacher, Robin; Friis, Evan; Ko, Winston; Kopecky, Alexandra; Lander, Richard; Liu, Haidong; Maruyama, Sho; Miceli, Tia; Nikolic, Milan; Pellett, Dave; Robles, Jorge; Schwarz, Thomas; Searle, Matthew; Smith, John; Squires, Michael; Tripathi, Mani; Vasquez Sierra, Ricardo; Veelken, Christian; Andreev, Valeri; Arisaka, Katsushi; Cline, David; Cousins, Robert; Deisher, Amanda; Duris, Joseph; Erhan, Samim; Farrell, Chris; Hauser, Jay; Ignatenko, Mikhail; Jarvis, Chad; Plager, Charles; Rakness, Gregory; Schlein, Peter; Tucker, Jordan; Valuev, Vyacheslav; Babb, John; Clare, Robert; Ellison, John Anthony; Gary, J William; Giordano, Ferdinando; Hanson, Gail; Jeng, Geng-Yuan; Kao, Shih-Chuan; Liu, Feng; Liu, Hongliang; Luthra, Arun; Nguyen, Harold; Pasztor, Gabriella; Satpathy, Asish; Shen, Benjamin C.; Stringer, Robert; Sturdy, Jared; Sumowidagdo, Suharyo; Wilken, Rachel; Wimpenny, Stephen; Andrews, Warren; Branson, James G.; Dusinberre, Elizabeth; Evans, David; Golf, Frank; Holzner, André; Kelley, Ryan; Lebourgeois, Matthew; Letts, James; Mangano, Boris; Muelmenstaedt, Johannes; Padhi, Sanjay; Palmer, Christopher; Petrucciani, Giovanni; Pi, Haifeng; Pieri, Marco; Ranieri, Riccardo; Sani, Matteo; Sharma, Vivek; Simon, Sean; Tu, Yanjun; Vartak, Adish; Würthwein, Frank; Yagil, Avraham; Barge, Derek; Bellan, Riccardo; Campagnari, Claudio; D'Alfonso, Mariarosaria; Danielson, Thomas; Geffert, Paul; Incandela, Joe; Justus, Christopher; Kalavase, Puneeth; Koay, Sue Ann; Kovalskyi, Dmytro; Krutelyov, Vyacheslav; Lowette, Steven; Mccoll, Nickolas; Pavlunin, Viktor; Rebassoo, Finn; Ribnik, Jacob; Richman, Jeffrey; Rossin, Roberto; Stuart, David; To, Wing; Vlimant, Jean-Roch; Bornheim, Adolf; Bunn, Julian; Chen, Yi; Gataullin, Marat; Kcira, Dorian; Litvine, Vladimir; Ma, Yousi; Mott, Alexander; Newman, Harvey B.; Rogan, Christopher; Timciuc, Vladlen; Traczyk, Piotr; Veverka, Jan; Wilkinson, Richard; Yang, Yong; Zhu, Ren-Yuan; Akgun, Bora; Carroll, Ryan; Ferguson, Thomas; Iiyama, Yutaro; Jang, Dong Wook; Jun, Soon Yung; Liu, Yueh-Feng; Paulini, Manfred; Russ, James; Terentyev, Nikolay; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Dinardo, Mauro Emanuele; Drell, Brian Robert; Edelmaier, Christopher; Ford, William T.; Heyburn, Bernadette; Luiggi Lopez, Eduardo; Nauenberg, Uriel; Smith, James; Stenson, Kevin; Ulmer, Keith; Wagner, Stephen Robert; Zang, Shi-Lei; Agostino, Lorenzo; Alexander, James; Chatterjee, Avishek; Das, Souvik; Eggert, Nicholas; Fields, Laura Johanna; Gibbons, Lawrence Kent; Heltsley, Brian; Hopkins, Walter; Khukhunaishvili, Aleko; Kreis, Benjamin; Kuznetsov, Valentin; Nicolas Kaufman, Gala; Patterson, Juliet Ritchie; Puigh, Darren; Riley, Daniel; Ryd, Anders; Shi, Xin; Sun, Werner; Teo, Wee Don; Thom, Julia; Thompson, Joshua; Vaughan, Jennifer; Weng, Yao; Winstrom, Lucas; Wittich, Peter; Biselli, Angela; Cirino, Guy; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Anderson, Jacob; Apollinari, Giorgio; Atac, Muzaffer; Bakken, Jon Alan; Banerjee, Sunanda; Bauerdick, Lothar A.T.; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C.; Bloch, Ingo; Borcherding, Frederick; Burkett, Kevin; Butler, Joel Nathan; Chetluru, Vasundhara; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Demarteau, Marcel; Eartly, David P.; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gao, Yanyan; Gottschalk, Erik; Green, Dan; Gunthoti, Kranti; Gutsche, Oliver; Hahn, Alan; Hanlon, Jim; Harris, Robert M.; Hirschauer, James; Hooberman, Benjamin; James, Eric; Jensen, Hans; Johnson, Marvin; Joshi, Umesh; Khatiwada, Rakshya; Kilminster, Benjamin; Klima, Boaz; Kousouris, Konstantinos; Kunori, Shuichi; Kwan, Simon; Limon, Peter; Lipton, Ron; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Mason, David; McBride, Patricia; McCauley, Thomas; Miao, Ting; Mishra, Kalanand; Mrenna, Stephen; Musienko, Yuri; Newman-Holmes, Catherine; O'Dell, Vivian; Popescu, Sorina; Pordes, Ruth; Prokofyev, Oleg; Saoulidou, Niki; Sexton-Kennedy, Elizabeth; Sharma, Seema; Soha, Aron; Spalding, William J.; Spiegel, Leonard; Tan, Ping; Taylor, Lucas; Tkaczyk, Slawek; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitmore, Juliana; Wu, Weimin; Yang, Fan; Yumiceva, Francisco; Yun, Jae Chul; Acosta, Darin; Avery, Paul; Bourilkov, Dimitri; Chen, Mingshui; Di Giovanni, Gian Piero; Dobur, Didar; Drozdetskiy, Alexey; Field, Richard D.; Fisher, Matthew; Fu, Yu; Furic, Ivan-Kresimir; Gartner, Joseph; Goldberg, Sean; Kim, Bockjoo; Klimenko, Sergey; Konigsberg, Jacobo; Korytov, Andrey; Kropivnitskaya, Anna; Kypreos, Theodore; Matchev, Konstantin; Mitselmakher, Guenakh; Muniz, Lana; Pakhotin, Yuriy; Prescott, Craig; Remington, Ronald; Schmitt, Michael; Scurlock, Bobby; Sellers, Paul; Skhirtladze, Nikoloz; Wang, Dayong; Yelton, John; Zakaria, Mohammed; Ceron, Cristobal; Gaultney, Vanessa; Kramer, Laird; Lebolo, Luis Miguel; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Adams, Todd; Askew, Andrew; Bandurin, Dmitry; Bochenek, Joseph; Chen, Jie; Diamond, Brendan; Gleyzer, Sergei V; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Jenkins, Merrill; Johnson, Kurtis F.; Prosper, Harrison; Sekmen, Sezen; Veeraraghavan, Venkatesh; Baarmand, Marc M.; Dorney, Brian; Guragain, Samir; Hohlmann, Marcus; Kalakhety, Himali; Ralich, Robert; Vodopiyanov, Igor; Adams, Mark Raymond; Anghel, Ioana Maria; Apanasevich, Leonard; Bai, Yuting; Bazterra, Victor Eduardo; Betts, Russell Richard; Callner, Jeremy; Cavanaugh, Richard; Dragoiu, Cosmin; Garcia-Solis, Edmundo Javier; Gerber, Cecilia Elena; Hofman, David Jonathan; Khalatyan, Samvel; Lacroix, Florent; O'Brien, Christine; Silvestre, Catherine; Smoron, Agata; Strom, Derek; Varelas, Nikos; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Cankocak, Kerem; Clarida, Warren; Duru, Firdevs; Lae, Chung Khim; McCliment, Edward; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Newsom, Charles Ray; Norbeck, Edwin; Olson, Jonathan; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Wetzel, James; Yetkin, Taylan; Yi, Kai; Barnett, Bruce Arnold; Blumenfeld, Barry; Bonato, Alessio; Eskew, Christopher; Fehling, David; Giurgiu, Gavril; Gritsan, Andrei; Guo, Zijin; Hu, Guofan; Maksimovic, Petar; Rappoccio, Salvatore; Swartz, Morris; Tran, Nhan Viet; Whitbeck, Andrew; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Grachov, Oleg; Murray, Michael; Noonan, Daniel; Radicci, Valeria; Sanders, Stephen; Wood, Jeffrey Scott; Zhukova, Victoria; Bolton, Tim; Chakaberia, Irakli; Ivanov, Andrew; Makouski, Mikhail; Maravin, Yurii; Shrestha, Shruti; Svintradze, Irakli; Wan, Zongru; Gronberg, Jeffrey; Lange, David; Wright, Douglas; Baden, Drew; Boutemeur, Madjid; Eno, Sarah Catherine; Ferencek, Dinko; Gomez, Jaime; Hadley, Nicholas John; Kellogg, Richard G.; Kirn, Malina; Lu, Ying; Mignerey, Alice; Rossato, Kenneth; Rumerio, Paolo; Santanastasio, Francesco; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite; Tonwar, Suresh C.; Twedt, Elizabeth; Alver, Burak; Bauer, Gerry; Bendavid, Joshua; Busza, Wit; Butz, Erik; Cali, Ivan Amos; Chan, Matthew; Dutta, Valentina; Everaerts, Pieter; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Hahn, Kristan Allan; Harris, Philip; Kim, Yongsun; Klute, Markus; Lee, Yen-Jie; Li, Wei; Loizides, Constantinos; Luckey, Paul David; Ma, Teng; Nahn, Steve; Paus, Christoph; Roland, Christof; Roland, Gunther; Rudolph, Matthew; Stephans, George; Sumorok, Konstanty; Sung, Kevin; Wenger, Edward Allen; Xie, Si; Yang, Mingming; Yilmaz, Yetkin; Yoon, Sungho; Zanetti, Marco; Cole, Perrie; Cooper, Seth; Cushman, Priscilla; Dahmes, Bryan; De Benedetti, Abraham; Dudero, Phillip Russell; Franzoni, Giovanni; Haupt, Jason; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Rekovic, Vladimir; Rusack, Roger; Sasseville, Michael; Singovsky, Alexander; Cremaldi, Lucien Marcus; Godang, Romulus; Kroeger, Rob; Perera, Lalith; Rahmat, Rahmat; Sanders, David A; Summers, Don; Bloom, Kenneth; Bose, Suvadeep; Butt, Jamila; Claes, Daniel R.; Dominguez, Aaron; Eads, Michael; Keller, Jason; Kelly, Tony; Kravchenko, Ilya; Lazo-Flores, Jose; Lundstedt, Carl; Malbouisson, Helena; Malik, Sudhir; Snow, Gregory R.; Baur, Ulrich; Godshalk, Andrew; Iashvili, Ia; Kharchilava, Avto; Kumar, Ashish; Smith, Kenneth; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Boeriu, Oana; Chasco, Matthew; Kaadze, Ketino; Reucroft, Steve; Swain, John; Wood, Darien; Zhang, Jinzhong; Anastassov, Anton; Kubik, Andrew; Odell, Nathaniel; Ofierzynski, Radoslaw Adrian; Pollack, Brian; Pozdnyakov, Andrey; Schmitt, Michael; Stoynev, Stoyan; Velasco, Mayda; Won, Steven; Antonelli, Louis; Berry, Douglas; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kolb, Jeff; Kolberg, Ted; Lannon, Kevin; Luo, Wuming; Lynch, Sean; Marinelli, Nancy; Morse, David Michael; Pearson, Tessa; Ruchti, Randy; Slaunwhite, Jason; Valls, Nil; Warchol, Jadwiga; Wayne, Mitchell; Ziegler, Jill; Bylsma, Ben; Durkin, Lloyd Stanley; Gu, Jianhui; Hill, Christopher; Killewald, Phillip; Kotov, Khristian; Ling, Ta-Yung; Rodenburg, Marissa; Williams, Grayson; Adam, Nadia; Berry, Edmund; Elmer, Peter; Gerbaudo, Davide; Halyo, Valerie; Hebda, Philip; Hunt, Adam; Jones, John; Laird, Edward; Lopes Pegna, David; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroué, Pierre; Quan, Xiaohang; Saka, Halil; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zuranski, Andrzej; Acosta, Jhon Gabriel; Huang, Xing Tao; Lopez, Angel; Mendez, Hector; Oliveros, Sandra; Ramirez Vargas, Juan Eduardo; Zatserklyaniy, Andriy; Alagoz, Enver; Barnes, Virgil E.; Bolla, Gino; Borrello, Laura; Bortoletto, Daniela; Everett, Adam; Garfinkel, Arthur F.; Gecse, Zoltan; Gutay, Laszlo; Jones, Matthew; Koybasi, Ozhan; Laasanen, Alvin T.; Leonardo, Nuno; Liu, Chang; Maroussov, Vassili; Merkel, Petra; Miller, David Harry; Neumeister, Norbert; Potamianos, Karolos; Shipsey, Ian; Silvers, David; Svyatkovskiy, Alexey; Yoo, Hwi Dong; Zablocki, Jakub; Zheng, Yu; Jindal, Pratima; Parashar, Neeti; Boulahouache, Chaouki; Cuplov, Vesna; Ecklund, Karl Matthew; Geurts, Frank J.M.; Liu, Jinghua H.; Morales, Jafet; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Zabel, James; Betchart, Burton; Bodek, Arie; Chung, Yeon Sei; de Barbaro, Pawel; Demina, Regina; Eshaq, Yossof; Flacher, Henning; Garcia-Bellido, Aran; Goldenzweig, Pablo; Gotra, Yury; Han, Jiyeon; Harel, Amnon; Miner, Daniel Carl; Orbaker, Douglas; Petrillo, Gianluca; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Demortier, Luc; Goulianos, Konstantin; Lungu, Gheorghe; Mesropian, Christina; Yan, Ming; Atramentov, Oleksiy; Barker, Anthony; Duggan, Daniel; Gershtein, Yuri; Gray, Richard; Halkiadakis, Eva; Hidas, Dean; Hits, Dmitry; Lath, Amitabh; Panwalkar, Shruti; Patel, Rishi; Richards, Alan; Rose, Keith; Schnetzer, Steve; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Cerizza, Giordano; Hollingsworth, Matthew; Spanier, Stefan; Yang, Zong-Chang; York, Andrew; Asaadi, Jonathan; Eusebi, Ricardo; Gilmore, Jason; Gurrola, Alfredo; Kamon, Teruki; Khotilovich, Vadim; Montalvo, Roy; Nguyen, Chi Nhan; Pivarski, James; Safonov, Alexei; Sengupta, Sinjini; Tatarinov, Aysen; Toback, David; Weinberger, Michael; Akchurin, Nural; Bardak, Cemile; Damgov, Jordan; Jeong, Chiyoung; Kovitanggoon, Kittikul; Lee, Sung Won; Mane, Poonam; Roh, Youn; Sill, Alan; Volobouev, Igor; Wigmans, Richard; Yazgan, Efe; Appelt, Eric; Brownson, Eric; Engh, Daniel; Florez, Carlos; Gabella, William; Johns, Willard; Kurt, Pelin; Maguire, Charles; Melo, Andrew; Sheldon, Paul; Velkovska, Julia; Arenton, Michael Wayne; Balazs, Michael; Boutle, Sarah; Buehler, Marc; Conetti, Sergio; Cox, Bradley; Francis, Brian; Hirosky, Robert; Ledovskoy, Alexander; Lin, Chuanzhe; Neu, Christopher; Yohay, Rachel; Gollapinni, Sowjanya; Harr, Robert; Karchin, Paul Edmund; Mattson, Mark; Milstène, Caroline; Sakharov, Alexandre; Anderson, Michael; Bachtis, Michail; Bellinger, James Nugent; Carlsmith, Duncan; Dasu, Sridhara; Efron, Jonathan; Gray, Lindsey; Grogg, Kira Suzanne; Grothe, Monika; Hall-Wilton, Richard; Herndon, Matthew; Klabbers, Pamela; Klukas, Jeffrey; Lanaro, Armando; Lazaridis, Christos; Leonard, Jessica; Lomidze, David; Loveless, Richard; Mohapatra, Ajit; Parker, William; Reeder, Don; Ross, Ian; Savin, Alexander; Smith, Wesley H.; Swanson, Joshua; Weinberg, Marc

2011-01-01

Measurements of primary charged hadron multiplicity distributions are presented for non-single-diffractive events in proton-proton collisions at centre-of-mass energies of sqrt(s) = 0.9, 2.36, and 7 TeV, in five pseudorapidity ranges from |eta|<0.5 to |eta|<2.4. The data were collected with the minimum-bias trigger of the CMS experiment during the LHC commissioning runs in 2009 and the 7 TeV run in 2010. The multiplicity distribution at sqrt(s) = 0.9 TeV is in agreement with previous measurements. At higher energies the increase of the mean multiplicity with sqrt(s) is underestimated by most event generators. The average transverse momentum as a function of the multiplicity is also presented. The measurement of higher-order moments of the multiplicity distribution confirms the violation of Koba-Nielsen-Olesen scaling that has been observed at lower energies.

46 CFR 42.09-5 - All vessels-division into types.

Science.gov (United States)

2010-10-01

... 46 Shipping 2 2010-10-01 2010-10-01 false All vessels-division into types. 42.09-5 Section 42.09-5... BY SEA Load Line Assignments and Surveys-General Requirements § 42.09-5 All vessels—division into types. (a) For the purposes of this part, each vessel to which this part applies is either a Type “A” or...

Air National Guard Women’s Sleep Health Study

Science.gov (United States)

2017-04-23

your rec;earcll or t 11ohnloal dooumen1G wlll BOt be l~d to the &02 1aG.1.JAC leg -al omoe for..., etht- re𔃻’lew. To 11~sls1 )󈧅! h rn 11 .-:::r.9...PUBUSHED OR F’"’EBIENTEO: "Afr Nari.ol!l!l Gt:iard Wo- Dti !11.15 S.eey Healdll Smdy" 7. FUNDING RECEIVED FOR THIS STUOY"? £8l "E3 C No FUNDtNG SOURCE: l’ri...18.18% 18.18% 27.27% LONG PAUSES BETWEEN BREATHS 72.73% 9.09% 9.09% 9.09% LEGS TWITCHING 63.64% 0.00% 18.18% 18.18% DISORIENTATION 100.00% 0.00

Measurement of the Proton and Deuteron Spin Structure Functions G1 and G2

Energy Technology Data Exchange (ETDEWEB)

Tobias, Al

2003-04-02

The SLAC experiment E155 was a deep-inelastic scattering experiment that scattered polarized electrons off polarized proton and deuteron targets in the effort to measure precisely the proton and deuteron spin structure functions. The nucleon structure functions g{sub 1} and g{sub 2} are important quantities that help test our present models of nucleon structure. Such information can help quantify the constituent contributions to the nucleon spin. The structure functions g{sub 1}{sup p} and G{sub 1}{sup d} have been measured over the kinematic range 0.01 {le} x {le} 0.9 and 1 {le} Q{sup 2} {le} 40 GeV{sup 2} by scattering 48.4 GeV longitudinally polarized electrons off longitudinally polarized protons and deuterons. In addition, the structure functions g{sub 2}{sup p} and g{sub 2}{sup d} have been measured over the kinematic range 0.01 {le} x {le} 0.7 and 1 {le} Q{sup 2} {le} 17 GeV{sup 2} by scattering 38.8 GeV longitudinally polarized electrons off transversely polarized protons and deuterons. The measurements of g{sub 1} confirm the Bjorken sum rule and find the net quark polarization to be {Delta}{Sigma} = 0.23 {+-} 0.04 {+-} 0.6 while g{sub 2} is found to be consistent with the g{sub 2}{sup WW} model.

One-step partial or complete caries removal and bonding with antibacterial or traditional self-etch adhesives: study protocol for a randomized controlled trial.

Science.gov (United States)

Villat, Cyril; Attal, Jean-Pierre; Brulat, Nathalie; Decup, Franck; Doméjean, Sophie; Dursun, Elisabeth; Fron-Chabouis, Hélène; Jacquot, Bruno; Muller Bolla, Michèle; Plasse-Pradelle, Nelly; Roche, Laurent; Maucort-Boulch, Delphine; Nony, Patrice; Gritsch, Kerstin; Millet, Pierre; Gueyffier, François; Grosgogeat, Brigitte

2016-08-15

Current concepts in conservative dentistry advocate minimally invasive dentistry and pulp vitality preservation. Moreover, complete removal of carious dentin in deep carious lesions often leads to pulp exposure and root canal treatment, despite the absence of irreversible pulp inflammation. For years, partial caries removal has been performed on primary teeth, but little evidence supports its effectiveness for permanent teeth. Furthermore, the recent development of new antibacterial adhesive systems could be interesting in the treatment of such lesions. The objectives of this study are to compare the effectiveness of partial versus complete carious dentin removal in deep lesions (primary objective) and the use of an antibacterial versus a traditional two-step self-etch adhesive system (main secondary objective). The DEep CAries Treatment (DECAT) study protocol is a multicenter, randomized, controlled superiority trial comparing partial versus complete caries removal followed by adhesive restoration. The minimum sample size required is 464 patients. Two successive randomizations will be performed (allocation ratio 1:1): the first for the type of excavation (partial versus complete) and the second (if no root canal treatment is required) for the type of adhesive (antibacterial versus traditional). For the two objectives, the outcome is the success of the treatment after 1 year, measured according to a composite outcome of five FDI criteria: material fracture and retention, marginal adaptation, radiographic examination (including apical pathologies), postoperative sensitivity and tooth vitality, and carious lesion recurrence. The study will investigate the interest of a conservative approach for the management of deep carious lesions in terms of dentin excavation and bioactive adhesive systems. The results may help practitioners achieve the most efficient restorative procedure to maintain pulp vitality and increase the restoration longevity. Clinical

IEA-R1 renewed primary coolant piping system stress analysis

International Nuclear Information System (INIS)

Fainer, Gerson; Faloppa, Altair A.; Oliveira, Carlos A. de; Mattar Neto, Miguel

2015-01-01

A partial replacement of the IEA-R1 piping system was conducted in 2014. The aim of this work is to perform the stress analysis of the renewed primary piping system of the IEA-R1, taking into account the as built conditions and the pipe modifications. The nuclear research reactor IEA-R1 is a pool type reactor designed by Babcox-Willcox, which is operated by IPEN since 1957. The primary coolant system is responsible for removing the residual heat of the Reactor core. As a part of the life management, a regular inspection detected some degradation in the primary piping system. In consequence, part of the piping system was replaced. The partial renewing of the primary piping system did not imply in major piping layout modifications. However, the stress condition of the piping systems had to be reanalyzed. The structural stress analysis of the primary piping systems is now presented and the final results are discussed. (author)

Estudo histopatológico do efeito do tenoxicam com água bidestilada ou com cloreto de sódio a 0,9% no endotélio venoso de coelhos Estudio histopatológico del efecto del tenoxican con agua bidestilada o con cloreto de sodio a 0,9% en el endotélio venoso de conejos Histopathologic study on the effects of tenoxicam with bidistilled water or with 0.9% sodium chloride in rabbits venous endothelium

Directory of Open Access Journals (Sweden)

Taylor Brandão Schnaider

2002-04-01

Full Text Available JUSTIFICATIVA E OBJETIVOS: Em estudo com células endoteliais de veias umbilicais humanas expostas à indometacina, foi observado aumento da atividade pró-coagulante. Estudo em coelhos comprovou a presença de trombose nas veias auriculares após administração de tenoxicam com seu diluente ou de seu diluente isolado. Não foram encontrados estudos na literatura consultada que tenham avaliado o endotélio venoso após a administração do tenoxicam, em seres humanos. O objetivo desta pesquisa foi avaliar se o tenoxicam com cloreto de sódio a 0,9% (NaCl a 0,9% provoca alterações no endotélio venoso de coelhos, como as observadas quando associado ao seu diluente (água bidestilada. MÉTODO: Noventa coelhos (2.000 - 3.500 g foram distribuídos aleatoriamente em dois grupos: Controle, com administração de NaCl a 0,9%; Experimento, com tenoxicam (20 mg associado à água bidestilada ou ao NaCl a 0,9%. O volume injetado nos dois grupos foi constante de 2 ml. A anestesia foi induzida com maleato de acepromazina, cloridrato de cetamina e cloridrato de xilazina, sendo a punção das veias auriculares caudais direita e esquerda realizada com agulha tipo borboleta 27G. Os animais foram mantidos no biotério por 6 h, 12 h e 24 h, novamente anestesiados e submetidos à eutanásia, sendo então realizada exérese das aurículas em sua base e posterior avaliação microscópica das veias. RESULTADOS: Observou-se trombose no grupo Experimento, numa porcentagem de 19,4% após administração do tenoxicam com água bidestilada e 22,2% após administração do tenoxicam com NaCl a 0,9%. No grupo Controle, em que foi injetado somente NaCl a 0,9%, nenhuma das veias apresentou trombose. CONCLUSÕES: Os resultados encontrados permitem concluir que o tenoxicam, com água bidestilada ou com solução de cloreto de sódio a 0,9%, produziu trombose nas veias em que foi injetado.JUSTIFICATIVA Y OBJETIVOS: En estudio con células endoteliales de venas umbilicales

Potential Application of Ganoderma lucidum in Solid State Fermentation of Primary Sludge and Wheat Straw

Directory of Open Access Journals (Sweden)

João Paulo Furlan de Jesus

2015-04-01

Full Text Available This study was conducted to investigate the production of lignocellulolytic enzymes and sugars by the fungus Ganoderma lucidum during solid state fermentation (SSF using primary sludge (PS and wheat straw (WS as substrates at different concentration ratios. For fungal growth on SSF, 20 g of each blended substrate was added to Erlenmeyer flasks, which were autoclaved and maintained at room temperature prior to inoculation, whereas for submerged fermentation (SF, flasks containing 25 mL of potato dextrose broth (PDB were used as standard to check the differences between both methods of growth, and then all flasks were incubated at 25 °C in the dark, during 8 and 16 days. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis from the protein extract obtained from solid state fermentation strongly suggested that G. lucidum could produce lignocellulolytic enzymes to degrade primary sludge and wheat straw. Among the sugars, the production of xylose and mannose was disturbed by adding primary sludge. With the addition of primary sludge, high glucuronic acid content was observed. The results suggest that the combination of primary sludge and wheat straw, at concentration ratios of 1:1 to 1:3, respectively, can be used as a raw material in the production of lignocellulolytic enzymes and the bioconversion of other types of biomass by G. lucidum.

Identification of G Protein-Coupled Receptors (GPCRs in Primary Cilia and Their Possible Involvement in Body Weight Control.

Directory of Open Access Journals (Sweden)

Yoshihiro Omori

Full Text Available Primary cilia are sensory organelles that harbor various receptors such as G protein-coupled receptors (GPCRs. We analyzed subcellular localization of 138 non-odorant GPCRs. We transfected GPCR expression vectors into NIH3T3 cells, induced ciliogenesis by serum starvation, and observed subcellular localization of GPCRs by immunofluorescent staining. We found that several GPCRs whose ligands are involved in feeding behavior, including prolactin-releasing hormone receptor (PRLHR, neuropeptide FF receptor 1 (NPFFR1, and neuromedin U receptor 1 (NMUR1, localized to the primary cilia. In addition, we found that a short form of dopamine receptor D2 (DRD2S is efficiently transported to the primary cilia, while a long form of dopamine receptor D2 (DRD2L is rarely transported to the primary cilia. Using an anti-Prlhr antibody, we found that Prlhr localized to the cilia on the surface of the third ventricle in the vicinity of the hypothalamic periventricular nucleus. We generated the Npy2r-Cre transgenic mouse line in which Cre-recombinase is expressed under the control of the promoter of Npy2r encoding a ciliary GPCR. By mating Npy2r-Cre mice with Ift80 flox mice, we generated Ift80 conditional knockout (CKO mice in which Npy2r-positive cilia were diminished in number. We found that Ift80 CKO mice exhibited a body weight increase. Our results suggest that Npy2r-positive cilia are important for body weight control.

Identification of G Protein-Coupled Receptors (GPCRs) in Primary Cilia and Their Possible Involvement in Body Weight Control.

Science.gov (United States)

Omori, Yoshihiro; Chaya, Taro; Yoshida, Satoyo; Irie, Shoichi; Tsujii, Toshinori; Furukawa, Takahisa

2015-01-01

Primary cilia are sensory organelles that harbor various receptors such as G protein-coupled receptors (GPCRs). We analyzed subcellular localization of 138 non-odorant GPCRs. We transfected GPCR expression vectors into NIH3T3 cells, induced ciliogenesis by serum starvation, and observed subcellular localization of GPCRs by immunofluorescent staining. We found that several GPCRs whose ligands are involved in feeding behavior, including prolactin-releasing hormone receptor (PRLHR), neuropeptide FF receptor 1 (NPFFR1), and neuromedin U receptor 1 (NMUR1), localized to the primary cilia. In addition, we found that a short form of dopamine receptor D2 (DRD2S) is efficiently transported to the primary cilia, while a long form of dopamine receptor D2 (DRD2L) is rarely transported to the primary cilia. Using an anti-Prlhr antibody, we found that Prlhr localized to the cilia on the surface of the third ventricle in the vicinity of the hypothalamic periventricular nucleus. We generated the Npy2r-Cre transgenic mouse line in which Cre-recombinase is expressed under the control of the promoter of Npy2r encoding a ciliary GPCR. By mating Npy2r-Cre mice with Ift80 flox mice, we generated Ift80 conditional knockout (CKO) mice in which Npy2r-positive cilia were diminished in number. We found that Ift80 CKO mice exhibited a body weight increase. Our results suggest that Npy2r-positive cilia are important for body weight control.

The influence of international medical electives on career preference for primary care and rural practice.

Science.gov (United States)

Law, Iain R; Walters, Lucie

2015-11-11

Previous studies have demonstrated a correlation between medical students who undertake international medical electives (IMEs) in resource poor settings and their reported career preference for primary care in underserved areas such as rural practice. This study examines whether a similar correlation exists in the Australian medical school context. Data was extracted from the Medical Schools Outcomes Database (MSOD) of Australian medical students that completed commencing student and exit questionnaires between 2006 and 2011. Student responses were categorized according to preferred training program and preferred region of practice at commencement. The reported preferences at exit of students completing IMEs in low and middle income countries (LMIC) were compared to those completing electives in high income countries (HIC). The effect of elective experience for students expressing a preference for primary care at commencement was non-significant, with 40.32 % of LMIC and 42.11 % of HIC students maintaining a preference for primary care. Similarly there were no significant changes following LMIC electives for students expressing a preference for specialist training at commencement with 11.81 % of LMIC and 10.23 % of HIC students preferring primary care at exit. The effect of elective experience for students expressing a preference for rural practice at commencement was non-significant, with 41.51 % of LMIC and 49.09 % of HIC students preferring rural practice at exit. Similarly there were no significant changes following LMIC electives for students expressing a preference for urban practice at commencement, with 7.84 % of LMIC and 6.70 % of HIC students preferring rural practice at exit. This study did not demonstrate an association between elective experience in resource poor settings and a preference for primary care or rural practice. This suggests that the previously observed correlation between LMIC electives and interest in primary care in

Prevalence of chromosomal abnormalities in Sri Lankan women with primary amenorrhea.

Science.gov (United States)

Samarakoon, Lasitha; Sirisena, Nirmala D; Wettasinghe, Kalum T; Kariyawasam, Kariyawasam Warnakulathanthrige Jayani C; Jayasekara, Rohan W; Dissanayake, Vajira H W

2013-05-01

Chromosomal abnormalities are implicated in the etiology of primary amenorrhea. The underlying chromosomal aberrations are varied and regional differences have been reported. The objective of this study is to describe the prevalence of various types of chromosomal abnormalities in Sri Lankan women with primary amenorrhea. Medical records of all patients diagnosed with primary amenorrhea referred for cytogenetic analysis to two genetic centers in Sri Lanka from January 2005 to December 2011 were reviewed. Chromosome culture and karyotyping was performed on peripheral blood samples obtained from each patient. Data were analyzed using standard descriptive statistics. Altogether 338 patients with primary amenorrhea were karyotyped and mean age at testing was 20.5 years. Numerical and structural chromosomal abnormalities were noted in 115 (34.0%) patients which included 45,X Turner syndrome (10.7%), Turner syndrome variants (13.9%), XY females (6.5%), 45,X/46,XY (0.9%), 46,XX/46,XY (0.6%), 47,XXX (0.3%), 47,XX,+ mar (0.3%), 46,X,i(X)(p10) (0.3%), 46,XX with SRY gene translocation on X chromosome (0.3%) and 46,XX,inv(7)(p10;q11.2) (0.3%). Short stature, absent secondary sexual characteristics, neck webbing, cubitus valgus and broad chest with widely spaced nipples were commonly seen in patients with Turner syndrome and variant forms. Neck webbing and absent secondary sexual characteristics were significantly associated with classical Turner syndrome than variant forms. A considerable proportion of women with primary amenorrhea had chromosomal abnormalities. Mean age at testing was late suggesting delay in referral for karyotyping. Early referral for cytogenetic evaluation is recommended for the identification of underlying chromosomal aberrations in women with primary amenorrhea. © 2012 The Authors. Journal of Obstetrics and Gynaecology Research © 2012 Japan Society of Obstetrics and Gynecology.

Overview of Future of Probabilistic Methods and RMSL Technology and the Probabilistic Methods Education Initiative for the US Army at the SAE G-11 Meeting

Science.gov (United States)

Singhal, Surendra N.

2003-01-01

The SAE G-11 RMSL Division and Probabilistic Methods Committee meeting sponsored by the Picatinny Arsenal during March 1-3, 2004 at Westin Morristown, will report progress on projects for probabilistic assessment of Army system and launch an initiative for probabilistic education. The meeting features several Army and industry Senior executives and Ivy League Professor to provide an industry/government/academia forum to review RMSL technology; reliability and probabilistic technology; reliability-based design methods; software reliability; and maintainability standards. With over 100 members including members with national/international standing, the mission of the G-11s Probabilistic Methods Committee is to enable/facilitate rapid deployment of probabilistic technology to enhance the competitiveness of our industries by better, faster, greener, smarter, affordable and reliable product development.

Cast Partial Denture versus Acrylic Partial Denture for Replacement of Missing Teeth in Partially Edentulous Patients

Directory of Open Access Journals (Sweden)

Pramita Suwal

2017-03-01

Full Text Available Aim: To compare the effects of cast partial denture with conventional all acrylic denture in respect to retention, stability, masticatory efficiency, comfort and periodontal health of abutments. Methods: 50 adult partially edentulous patient seeking for replacement of missing teeth having Kennedy class I and II arches with or without modification areas were selected for the study. Group-A was treated with cast partial denture and Group-B with acrylic partial denture. Data collected during follow-up visit of 3 months, 6 months, and 1 year by evaluating retention, stability, masticatory efficiency, comfort, periodontal health of abutment. Results: Chi-square test was applied to find out differences between the groups at 95% confidence interval where p = 0.05. One year comparison shows that cast partial denture maintained retention and stability better than acrylic partial denture (p< 0.05. The masticatory efficiency was significantly compromising from 3rd month to 1 year in all acrylic partial denture groups (p< 0.05. The comfort of patient with cast partial denture was maintained better during the observation period (p< 0.05. Periodontal health of abutment was gradually deteriorated in all acrylic denture group (p

Annual report 2008-09

International Nuclear Information System (INIS)

2009-01-01

The Pakistan Atomic Energy Commission (PAEC) annual report for the year 2008-09 has been compiled. The salient features of the activities of various Centers, Power Plants and different project have been explained. The activities are described under the topics as: highlights of various projects, nuclear power, engineering, physical sciences, biological sciences, nuclear materials, safety, human resource development, PAEC health services projects and publications. (A.B).

Lignans from Opuntia ficus-indica seeds protect rat primary hepatocytes and HepG2 cells against ethanol-induced oxidative stress.

Science.gov (United States)

Kim, Jung Wha; Yang, Heejung; Kim, Hyeon Woo; Kim, Hong Pyo; Sung, Sang Hyun

2017-01-01

Bioactivity-guided isolation of Opuntia ficus-indica (Cactaceae) seeds against ethanol-treated primary rat hepatocytes yielded six lignan compounds. Among the isolates, furofuran lignans 4-6, significantly protected rat hepatocytes against ethanol-induced oxidative stress by reducing intracellular reactive oxygen species levels, preserving antioxidative defense enzyme activities, and maintaining the glutathione content. Moreover, 4 dose-dependently induced the heme oxygenase-1 expression in HepG2 cells.

Prothrombin G20210A mutation, hypogonadotropic hypogonadism, and generalized vitiligo-related ischemic stroke in a young adult.

Science.gov (United States)

Varoglu, Asuman Orhan; Kocatürk, Idris; Tatar, Abdulgani

2010-06-01

Cerebral infarction is a rare neurological situation in young adults, usually caused by genetic factors. We report here a case of multiple cerebral infarctions with prothrombin G20210A mutation, hypogonadotropic hypogonadism, and generalized vitiligo as a first case report. A 17-year-old female adolescent was admitted to our clinic due to a change in mental status. The patient's neurological examination revealed loss of consciousness and the presence of tetraparesia. Generalized vitiligo was also detected. Magnetic resonance imaging (MRI) and diffusion-weighted investigations (DWIs) showed acute ischemic stroke in the bilateral cerebellum, pons and left occipital regions. Heterozygote prothrombin G20210A mutation was found upon genetic examination. She had never had a menstrual cycle. Laboratory data revealed that the level of luteinizing hormone (LH) was 0.5 mIU/mL (1.1-11.6) and follicle-stimulating hormone (FSH) was 1.7 mIU/mL (2.8-11.3). Therefore, she was diagnosed with hypogonadotropic hypogonadism. The causes of ischemic stroke are heterozygote prothrombin G20210A mutation, generalized vitiligo, and hypogonadotropic hypogonadism. After treatment, the patient's neurological deficit partially improved and she was discharged. In order to identify the etiology of ischemic stroke, we suggest physicians take into account heterozygote prothrombin G20210A mutation and endocrine abnormalities, especially hypogonadotropic hypogonadism and generalized vitiligo.

Documenting Horror: The Use of Sound in Non-Fiction 9/11 Films

Directory of Open Access Journals (Sweden)

Jesse Schlotterbeck

2011-09-01

Full Text Available While conventional 9/11 documentaries focus on the most known and visible images of the attack, three films that work against this tendency, 9/11 (2002, 11'09''01 - September 11 (2002 and Fahrenheit 9/11 (2004, avoid the television news coverage of the towers and portray the attacks primarily through sound. These films avoid or scantly interject the too familiar footage, working instead with the audio track’s ability to convey the horrors of the event.  By emphasizing sound, these films address a challenge familiar to documentary studies: how to appropriately represent a historical event whose tragic scale makes aesthetic representation questionable.

Total prohibition of smoking but not partial restriction effectively reduced exposure to tobacco smoke among restaurant workers in Finland.

Science.gov (United States)

Reijula, Jere; Johnsson, Tom; Kaleva, Simo; Tuomi, Tapani; Reijula, Kari

2013-10-01

To assess work-related exposure to tobacco smoke in Finnish restaurants, a series of nationwide questionnaire surveys were conducted among restaurant workers and the levels of indoor air nicotine concentrations were measured in restaurants. The survey aimed to evaluate the impact of the smoke-free legislation in general and in particular after the total smoking ban launched in 2007. In 2003-2010, four national questionnaire surveys were conducted among restaurant workers and the concentration of nicotine in indoor air was measured in different types of restaurants, bars and nightclubs. Between 2003 and 2010, the proportion of restaurant workers reporting occupational exposure to tobacco smoke dropped from 59% to 11%. Among pub workers, the decrease was from 97% to 18% and in workers of dining restaurants from 49% to 10%, respectively. The median concentration of nicotine in indoor air of all restaurants decreased from 11.7 μg/m(3) to 0.1 μg/m(3). The most significant decrease was detected in pubs where the decrease was from 16.1 μg/m(3) to 0.1 μg/m(3). Among all restaurant workers, in 2003-2010 the prevalence of daily smokers was reduced from 39% to 31% in men and from 35% to 25% in women. Total prohibition of smoking but not partial restriction in restaurants was effective in reducing work-related exposure to tobacco smoke. Strict tobacco legislation may partly be associated with the significant decrease of daily smoking prevalence among restaurant workers.

No negative impact of serum IgG4 levels on clinical outcome in 435 patients with primary sclerosing cholangitis from Japan.

Science.gov (United States)

Tanaka, Atsushi; Tazuma, Susumu; Nakazawa, Takahiro; Isayama, Hiroyuki; Tsuyuguchi, Toshio; Inui, Kazuo; Takikawa, Hajime

2017-04-01

Several studies have demonstrated that elevated serum IgG4 levels are associated with poor outcomes of primary sclerosing cholangitis (PSC), but the impact of serum IgG4 levels on PSC remains controversial. In this study, we aimed to determine prognostic factors of patients with PSC and to investigate the association between serum IgG4 levels and the clinical features and prognosis of PSC in a Japanese cohort. We retrospectively analyzed follow-up data for 435 patients with PSC (UMIN000018438). Patients with distinct etiologies of sclerosing cholangitis including IgG4-related sclerosing cholangitis (IgG4-SC) were excluded from this study. Serum IgG4 levels were tested at the time of diagnosis in 216 of 435 patients with PSC, and were elevated in 27 patients (>134 mg/dl, 12.5%). Clinical features at diagnosis were comparable between patients with normal and elevated serum IgG4 levels, with the exception of serum albumin. The overall and liver-transplantation free survival rate was comparable between the groups. Multivariate analysis indicated that age, albumin, and bilirubin, but not IgG4, at the time of diagnosis affected PSC prognosis. The current study showed that serum IgG4 levels at diagnosis do not affect PSC prognosis in a Japanese cohort that excluded patients with IgG4-SC. © 2017 Japanese Society of Hepato-Biliary-Pancreatic Surgery.