Triply heavy tetraquark states with the QQ anti Q anti q configuration
Energy Technology Data Exchange (ETDEWEB)
Chen, Kan; Liu, Xiang [Lanzhou University, School of Physical Science and Technology, Lanzhou (China); Lanzhou University and Institute of Modern Physics of CAS, Research Center for Hadron and CSR Physics, Lanzhou (China); Liu, Yan-Rui; Wu, Jing [Shandong University, School of Physics and Key Laboratory of Particle Physics and Particle Irradiation (MOE), Jinan (China); Zhu, Shi-Lin [Peking University, School of Physics and State Key Laboratory of Nuclear Physics and Technology, Beijing (China); Collaborative Innovation Center of Quantum Matter, Beijing (China); Peking University, Center of High Energy Physics, Beijing (China)
2017-01-15
In the framework of the color-magnetic interaction, we systematically investigate the mass splittings of the QQ anti Q anti q tetraquark states and estimate their rough masses in this work. These systems include the explicitly exotic states cc anti b anti q and bb anti c anti q and the hidden exotic states cc anti c anti q, cb anti b anti q, bc anti c anti q, and bb anti b anti q. If a state around the estimated mass region can be observed, its nature as a genuine tetraquark is favored. The strong decay patterns shown here will be helpful to the experimental search for these exotic states. (orig.)
Exotic tetraquark states with the qq anti Q anti Q configuration
Energy Technology Data Exchange (ETDEWEB)
Luo, Si-Qiang; Chen, Kan; Liu, Xiang [Lanzhou University, School of Physical Science and Technology, Lanzhou (China); Lanzhou University and Institute of Modern Physics, CAS, Research Center for Hadron and CSR Physics, Lanzhou (China); Liu, Yan-Rui [Shandong University, School of Physics and Key Laboratory of Particle Physics and Particle Irradiation (MOE), Jinan (China); Zhu, Shi-Lin [Peking University, School of Physics and State Key Laboratory of Nuclear Physics and Technology, Beijing (China); Collaborative Innovation Center of Quantum Matter, Beijing (China); Peking University, Center for High Energy Physics, Beijing (China)
2017-10-15
In this work, we study systematically the mass splittings of the qq anti Q anti Q (q = u, d, s and Q = c, b) tetraquark states with the color-magnetic interaction by considering color mixing effects and estimate roughly their masses. We find that the color mixing effect is relatively important for the J{sup P} = 0{sup +} states and possible stable tetraquarks exist in the nn anti Q anti Q (n = u, d) and ns anti Q anti Q systems either with J = 0 or with J = 1. Possible decay patterns of the tetraquarks are briefly discussed. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Chao, K T [Oxford Univ. (UK). Dept. of Theoretical Physics; Science Research Council, Chilton (UK). Rutherford and Appleton Labs.)
1980-07-01
Taking account of the colour magnetic and electric forces, we discuss the spectroscopy of various types of c anti c q anti q states. Their decay, hadronic production, production in e/sup +/e/sup -/ annihilation as well as photoproduction are also studied.
Comparison of q anti qg and q anti qγ events in e+e- annihilation at PEP
International Nuclear Information System (INIS)
Hofmann, W.
1986-07-01
In comparing the particle flow in the event plane of three-jet (q anti qg) events and of radiative annihilation events (q anti qγ) for similar kinematic configurations, two PEP experiments find a significant decrease in particle density in the angular region opposite to the gluon jet in q anti qg events, relative to the particle density in the region opposite to the photon in q anti qγ events. The effect is predicted both by QCD and by phenomenological string models. 5 refs., 5 figs
Hybrid mesons (Q anti Qg) in N anti N annihilation
International Nuclear Information System (INIS)
Dover, C.B.; Gutsche, T.; Faessler, A.
1993-09-01
N anti N annihilation reactions provide exciting possibilities to study mesonic resonances beyond the usual Q anti Q spectrum. Particularly the search for Q anti Qg mesons containing an explicit dynamical excitation of the gluon field is not promising, since hybrids are predicted to display unique features: exotic quantum numbers (J πC ) and dynamical selection rules for their decay modes. The authors have investigated the possibility of producing hybrids from p anti p atomic states in reactions of the type N anti N(L= 0,1) → π + Q anti Qg. Production rates for hybrid mesons are found to display a strong dependence on the quantum numbers and kinematical factors associated with the transition. The dependence on the orbital angular momentum L of the p anti p atomic state, accessible in p anti p annihilation at rest, would provide a striking signature for the production of hybrids. In estimating branching ratios for the formation of Q anti Qg hybrid mesons in N anti N annihilation reactions at rest, the authors have employed a microscopic model with constituent quarks and gluons in analogy to the annihilation model for the production of Q anti Q mesons
Analysis of the QQ anti Q anti Q tetraquark states with QCD sum rules
Energy Technology Data Exchange (ETDEWEB)
Wang, Zhi-Gang [North China Electric Power University, Department of Physics, Baoding (China)
2017-07-15
In this article, we study the J{sup PC} = 0{sup ++} and 2{sup ++} QQ anti Q anti Q tetraquark states with the QCD sum rules, and we obtain the predictions M{sub X(cc} {sub anti} {sub c} {sub anti} {sub c,0}{sup {sub +}{sub +)}} =5.99 ± 0.08 GeV, M{sub X(cc} {sub anti} {sub c} {sub anti} {sub c,2}{sup {sub +}{sub +)}} = 6.09 ± 0.08 GeV, M{sub X(bb} {sub anti} {sub b} {sub anti} {sub b,0}{sup {sub +}{sub +)}} = 18.84 ± 0.09 GeV and M{sub X(bb} {sub anti} {sub b} {sub anti} {sub b,2}{sup {sub +}{sub +)}} = 18.85 ± 0.09 GeV, which can be confronted to the experimental data in the future. Furthermore, we illustrate that the diquark-antidiquark type tetraquark state can be taken as a special superposition of a series of meson-meson pairs and that it embodies the net effects. (orig.)
Directory of Open Access Journals (Sweden)
Potrich D.P.
2001-01-01
Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.
Anti-C1q antibodies in systemic lupus erythematosus
DEFF Research Database (Denmark)
Orbai, A-M; Truedsson, L; Sturfelt, G
2015-01-01
OBJECTIVE: Anti-C1q has been associated with systemic lupus erythematosus (SLE) and lupus nephritis in previous studies. We studied anti-C1q specificity for SLE (vs rheumatic disease controls) and the association with SLE manifestations in an international multicenter study. METHODS: Information...... in combination with anti-dsDNA and low complement was the strongest serological association with renal involvement. These data support the usefulness of anti-C1q in SLE, especially in lupus nephritis....
Metazoan operons accelerate recovery from growth arrested states
Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.
2011-01-01
Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799
Q2 anti Q2 states with relatively narrow widths
International Nuclear Information System (INIS)
Ono, Seiji.
1978-09-01
Using the mass formulas which correctly predict the mass of mesons and baryons the mass of diquark states is computed. From this mass spectrum the existance of the observed narrow baryonia and wide baryonia can be naturally understood. Other relatively narrow Q 2 anti Q 2 states are predicted to exist. (orig.) [de
Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.
Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale
2015-05-25
Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.
Anti-C1q autoantibodies in patients with neuromyelitis optica spectrum disorders.
Yoshikura, Nobuaki; Kimura, Akio; Hayashi, Yuichi; Inuzuka, Takashi
2017-09-15
We examined anti-complement C1q (C1q) autoantibody levels in serum and cerebrospinal fluid (CSF) samples of patients with neuromyelitis optica spectrum disorders (NMOSD). We analyzed the correlations between anti-C1q autoantibody levels and the clinical and other CSF characteristics of NMOSD. Serum and CSF anti-C1q autoantibody levels increased during the acute phase of NMOSD, reverting to the same levels as controls during remission. CSF anti-C1q autoantibody levels during the acute phase correlated with several markers reflecting disease severity, Expanded Disability Status Scale worsening, spinal cord lesion length in cases with myelitis, CSF protein and interleukin-6 levels, and CSF/serum albumin ratios. Copyright © 2017 Elsevier B.V. All rights reserved.
Prevalence and clinical significance of anti-C1q antibodies in ...
African Journals Online (AJOL)
Asmaa Hegazy
2012-04-21
Apr 21, 2012 ... sists of 20 patients with musculoskeletal manifestations, mainly arthritis ... C1q have been found in many different autoimmune diseases, ... improve our diagnostic potential, from these, anti-C1q anti- ... Subjects and methods.
Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.
Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong
2012-01-01
During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.
2005-11-18
Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.
2007-03-15
Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.
International Nuclear Information System (INIS)
Riaz, M.O.; Ahmed, T.A.
2016-01-01
Objective: To study the correlation of anti C1q antibodies with disease activity in patients with systemic lupus erythematosus (SLE). Study Design: Cross sectional, observational study. Place and Duration of study: The Department of Immunology, Armed Forces Institute of Pathology, Rawalpindi in collaboration with Military Hospital, Rawalpindi, Pakistan Institute of Medical Sciences, Islamabad and Benazir Bhutto Hospital, Rawalpindi, from Jan 2012 to Dec 2013. Material and Methods: Patients with a clinical diagnosis of SLE were included in the study on fulfilling revised American College of Rheumatology (ACR) criteria (1997). Main outcome measures were SLE disease activity index (SLEDAI) score and anti C1q antibody levels in serum. SLEDAI scores were calculated for each patient on the basis of physical examination, patient interviews and previous clinical records. Anti C1q antibody levels in the serum were determined by enzyme-linked immunosorbent assay (ELISA) and correlated with the SLEDAI scores by calculating Pearson's correlation coefficient 'r'. The cutoff value for anti C1q antibody positivity in the serum was determined by evaluating the serum levels of anti C1q antibodies in 25 healthy subjects and was 12 U/ml. Results: Six male and forty nine female SLE patients with an age range of 16-47 years (mean 34.5 years) and 8-70 years (mean 31.7 years) respectively were studied. The correlation between anti C1q levels and SLEDAI scores in all patients was demonstrated by calculating the correlation coefficient and was not significant (r=0.19, p=0.14). However, there was an inverse correlation between anti C1q levels and SLEDAI scores in patients with severe disease and this was statistically significant (r=-0.448, p=0.037). The difference in anti C1q antibody positivity between patients with and without nephritis was not significant. The anti C1q antibody levels correlated poorly with anti double stranded deoxyribonucleic acid (dsDNA) antibody positivity. A
Detecting uber-operons in prokaryotic genomes.
Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying
2006-01-01
We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.
Evidence against the selfish operon theory.
Pál, Csaba; Hurst, Laurence D
2004-06-01
According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.
A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.
Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo
2014-01-01
The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.
Directory of Open Access Journals (Sweden)
Zara Sohail
2018-02-01
Full Text Available Background: Lupus nephritis (LN is the most common and serious complication associated with SLE and it results in significant morbidity and mortality. It is known by several studies that patients of LN have higher levels of anti-dsDNA and anti-C1q compared with SLE patients without renal involvement. The current study was designed to determine and compare the level of anti-dsDNA and anti-C1q in patients of SLE with and without lupus nephritis in the Pakistani population. This current study was also aimed at providing proof that anti-C1q levels are more prominent in LN/non-LN SLE as compared to anti-dsDNA. This project may help in the determination of results in Pakistan and contribute to the further confirmation of the sensitivity of anti-C1q. Method: The patient samples were collected from Sheikh Zayed hospital, Lahore. These patients were clinically diagnosed by the Rheumatologists as SLE and LN positive on the basis of ACR and SLEDAI scoring criteria. This study was performed and samples were analyzed in the Department of Medical and Laboratory Sciences, Imperial College of Business Study, Lahore on the patient’s serum by ELISA technique. Result: About 38% (12 patients with LN were positive for anti-dsDNA and 31% (9 SLE patients without LN were positive whereas about 38.7% (12 were anti-dsDNA negative in LN cases and 58.6% (17 in SLE without LN. In case of anti-C1q 100% (31 of these LN patients were positive and 93.1% (27 patients SLE without LN showed positive anti C1q results. Only 6.9% (2 patients showed negative results for anti-C1q in LN negative patients Conclusion: The higher levels of anti-C1q suggest that it may be a better diagnostic marker for LN than that of anti-dsDNA and that it can be helpful in the prognosis of SLE patients.
REMap: Operon Map of M. tuberculosis
Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu
2016-01-01
A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008
ProOpDB: Prokaryotic Operon DataBase.
Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique
2012-01-01
The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.
The relative value of operon predictions
Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.
For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,
Transcriptome dynamics-based operon prediction in prokaryotes.
Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario
2014-05-16
Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.
International Nuclear Information System (INIS)
Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.
1993-01-01
Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid
Directory of Open Access Journals (Sweden)
Vandana Pradhan
2010-01-01
Full Text Available To identify Fc RIIA genotypes in Systemic Lupus Erythematosus (SLE patients and their association with anti-C1q antibodies. Methods. Fc RIIA genotyping was done in eighty Indian SLE patients and eighty healthy controls using allele-specific PCR. Anti-C1q antibodies were measured by ELISA. Results. LN patients showed higher SLEDAI (6–32 as compared to SLE patients without renal manifestations and had SLEDAI between 6–23. Fc RIIA polymorphic frequency in SLE patients was R131/H131 (67.5%, R131/R131 (20% and H131/ H131 (12.5% as against that of normal population (62.5%, 10%, and 27.5%, respectively. Sixty two patients (77.5% showed positivity for anti-C1q antibodies. LN patients showed elevated levels of anti-C1q antibodies (258.2u/ml±38.5U/mL as compared to SLE patients without nephritis (134.6±24.6 U/mL. Among anti-C1q positive patients, 71% had R131/H131 genotype, 22.6% had R131/R131 and remaining 6.4%, patients had H131/H131 genotype. All anti-C1q positive patients with R131/R131 genotype had elevated levels of anti-C1q antibodies (>100 U/ml, whereas among anti-C1q negative patients, none had R131/R131 genotype. Conclusion. This first report on Indian SLE patients supports the hypothesis that Fc RIIA R131 variant over expression may constitute a susceptibility factor for development of severe SLE manifestations in LN patients.
Problem-Solving Test: Tryptophan Operon Mutants
Szeberenyi, Jozsef
2010-01-01
This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…
Narang, Atul; Oehler, Stefan
2017-05-01
The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.
Stochastic simulations of the tetracycline operon
2011-01-01
Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular
Stochastic simulations of the tetracycline operon
Directory of Open Access Journals (Sweden)
Kaznessis Yiannis N
2011-01-01
Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the
Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon
2014-01-01
Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.
Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy
2015-01-01
Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851
Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh
2016-04-01
Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.
Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio
2016-01-01
The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.
Energy Technology Data Exchange (ETDEWEB)
Barik, N; Barik, B K [Utkal Univ., Bhubaneswar (India). Dept. of Physics
1981-12-01
It is shown that a non-relativistic power-law potential model for the heavy quarks in the form V(r) = Arsup(..nu..) + V/sub 0/, (A,..nu..>0) acquires relativistic consistency in generating Dirac bound states of Q anti Q-system in agreement with the Schroedinger spectroscopy if the interaction is modelled by equally mixed scalar and vector parts as suggested by the phenomenology of fine-hyperfine splittings of heavy quarkonium systems in a non-relativistic perturbative approach.
Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul
2015-08-18
Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Final state polarization effectsin e-e+ → γ, Z → q anti qg
International Nuclear Information System (INIS)
Koller, K.; Schiller, D.H.; Waehner, D.
1980-10-01
We discuss the polarization of the quark and/or antiquark in e - e + → γ, Z → q anti qg, and of the hadrons (baryons or vector mesons) belonging to the most energetic jet initiated either by the quark or the antiquark. (orig.)
Teaching the Big Ideas of Biology with Operon Models
Cooper, Robert A.
2015-01-01
This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…
Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.
2005-04-12
Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.
Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.
Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan
2017-01-01
Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.
Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A
2011-11-01
HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.
Sequence and features of the tryptophan operon of Vibrio parahemolyticus.
Crawford, I P; Han, C Y; Silverman, M
1991-01-01
The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.
Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.
Lawrence, J
1999-12-01
The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.
Evolution and Biophysics of the Escherichia coli lac Operon
Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor
2011-03-01
To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.
Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius
Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena
2013-01-01
Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange
Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.
Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L
2014-07-08
We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are
International Nuclear Information System (INIS)
Hambrock, Christian
2011-04-01
In my thesis I present our work on the bottom-baryon light-cone distribution amplitudes (LCDAs) and on the [bq][ anti b anti q]-tetraquarks. For the former we extended the known LCDAs for the ground state baryon Λ b to the entire b-baryon ground state multiplets and included s-quark mass-breaking effects. The LCDAs form crucial input for the calculations of characteristic properties of b-baryon decays. In this context they can for example be used in the calculation of form factors for semileptonic flavor-changing neutral-current (FCNC) decays. For the [bq][ anti b anti q]-tetraquarks, we calculated the tetraquark mass spectrum for all quarks q=u,d,s,c in a constituent Hamiltonian quark model. We estimated the electronic width by introducing a generalized Van Royen-Weisskopf formula for the tetraquarks, and evaluated the partial hadronic two-body and total decay widths for the tetraquarks with quantum numbers J PC =1 -- . With this input, we performed a Breit-Wigner fit, including the tetraquark contributions, to the inclusive R b -spectrum measured by BaBar. The obtained χ 2 /d.o.f. of the BaBar R b -scan data is fairly good. The resulting fits are suggestive of tetraquark states but not conclusive. We developed a model to describe the transitions e + e - →Y b →Υ(nS)(π + π - ,K + K - ,ηπ 0 ), in which Y b is a 1 -- tetraquark state. The model includes the exchange of light tetraquark and meson states. We used this model to fit the invariant-mass and helicity spectra for the dipionic final state measured by Belle and used the results to estimate the spectra of the channels e + e - →Y b →Υ(nS)(K + K - ,ηπ 0 ). The spectra are enigmatic in shape and magnitude and defy an interpretation in the framework of the standard bottomonia, requesting either an interpretation in terms of exotic states, such as tetraquarks, or a radical alteration of the, otherwise successful, QCD-based bottomonium-model. The tetraquark hypothesis describes the current data well
Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales
Directory of Open Access Journals (Sweden)
Gogarten J Peter
2008-01-01
Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to
Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.
Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti
2017-01-01
The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.
REMap: Operon map of M. tuberculosis based on RNA sequence data.
Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu
2016-07-01
A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.
Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization
Ray, J. Christian J; Igoshin, Oleg A.
2012-01-01
Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903
The Genomic Pattern of tDNA Operon Expression in E. coli.
Directory of Open Access Journals (Sweden)
2005-06-01
Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.
Solving a discrete model of the lac operon using Z3
Gutierrez, Natalia A.
2014-05-01
A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.
Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†
Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.
2003-01-01
The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting
Ancient origin of the tryptophan operon and the dynamics of evolutionary change.
Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A
2003-09-01
The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting
Energy Technology Data Exchange (ETDEWEB)
Hambrock, Christian
2011-04-15
In my thesis I present our work on the bottom-baryon light-cone distribution amplitudes (LCDAs) and on the [bq][ anti b anti q]-tetraquarks. For the former we extended the known LCDAs for the ground state baryon {lambda}{sub b} to the entire b-baryon ground state multiplets and included s-quark mass-breaking effects. The LCDAs form crucial input for the calculations of characteristic properties of b-baryon decays. In this context they can for example be used in the calculation of form factors for semileptonic flavor-changing neutral-current (FCNC) decays. For the [bq][ anti b anti q]-tetraquarks, we calculated the tetraquark mass spectrum for all quarks q=u,d,s,c in a constituent Hamiltonian quark model. We estimated the electronic width by introducing a generalized Van Royen-Weisskopf formula for the tetraquarks, and evaluated the partial hadronic two-body and total decay widths for the tetraquarks with quantum numbers J{sup PC}=1{sup --}. With this input, we performed a Breit-Wigner fit, including the tetraquark contributions, to the inclusive R{sub b}-spectrum measured by BaBar. The obtained {chi}{sup 2}/d.o.f. of the BaBar R{sub b}-scan data is fairly good. The resulting fits are suggestive of tetraquark states but not conclusive. We developed a model to describe the transitions e{sup +}e{sup -}{yields}Y{sub b}{yields}{upsilon}(nS)({pi}{sup +}{pi}{sup -},K{sup +}K{sup -},{eta}{pi}{sup 0}), in which Y{sub b} is a 1{sup --} tetraquark state. The model includes the exchange of light tetraquark and meson states. We used this model to fit the invariant-mass and helicity spectra for the dipionic final state measured by Belle and used the results to estimate the spectra of the channels e{sup +}e{sup -}{yields}Y{sub b}{yields}{upsilon}(nS)(K{sup +}K{sup -},{eta}{pi}{sup 0}). The spectra are enigmatic in shape and magnitude and defy an interpretation in the framework of the standard bottomonia, requesting either an interpretation in terms of exotic states, such as
International Nuclear Information System (INIS)
Jones, G.T.; Jones, R.W.L.; Allport, P.; Borner, H.P.; Myatt, G.; Radojicic, D.; Bullock, F.W.; Burke, S.
1990-01-01
Using data on νp and anti νp charged current interactions from a bubble chamber experiment with BEBC at CERN, the average multiplicities of charged hadrons and pions are determined as functions of W 2 and Q 2 . The analysis is based on ∝20000 events with incident ν and ∝10000 events with incident anti ν. In addition to the known dependence of the average multiplicity on W 2 a weak dependence on Q 2 for fixed intervals of W is observed. For W>2 Gev and Q 2 >0.1 GeV 2 the average multiplicity of charged hadrons is well described by =a 1 +a 2 ln(W 2 /GeV 2 )+a 3 ln(Q 2 /GeV 2 ) with a 1 =0.465±0.053, a 2 =1.211±0.021, a 3 =0.103±0.014 for the νp and a 1 =-0.372±0.073, a 2 =1.245±0.028, a=30.093±0.015 for the anti νp reaction. (orig.)
Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.
García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L
2017-09-01
Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization
Igoshin, Oleg
2011-03-01
Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.
Rapid customised operon assembly by yeast recombinational cloning.
Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R
2017-06-01
We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.
Lu, P.; Asseri, A.H.O.; Kremer, Martijn; Maaskant, Janneke; Ummels, Roy; Lill, H.; Bald, D.
2018-01-01
Mycobacterial energy metabolism currently attracts strong attention as new target space for development of anti-tuberculosis drugs. The imidazopyridine Q203 targets the cytochrome bcc complex of the respiratory chain, a key component in energy metabolism. Q203 blocks growth of Mycobacterium
Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.
Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P
2015-01-01
In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Carolina Serena
Full Text Available The clinical use of purified SOD enzymes has strong limitations due to their large molecular size, high production cost and immunogenicity. These limitations could be compensated by using instead synthetic SOD mimetic compounds of low molecular weight.We have recently reported that two SOD mimetic compounds, the Mn(II complexes of the polyamines Pytren2Q and Pytren4Q, displayed high antioxidant activity in bacteria and yeast. Since frequently molecules with antioxidant properties or free-radical scavengers also have anti-inflammatory properties we have assessed the anti-inflammatory potential of Pytren2Q and Pytren4Q Mn(II complexes, in cultured macrophages and in a murine model of inflammation, by measuring the degree of protection they could provide against the cellular injury produced by lipopolisacharide, a bacterial endotoxin.In this report we show that the Mn(II complex of Pytren4Q but not that of Pytren2Q effectively protected human cultured THP-1 macrophages and whole mice from the inflammatory effects produced by LPS. These results obtained with two molecules that are isomers highlight the importance of gathering experimental data from animal models of disease in assessing the potential of candidate molecules.The effective anti-inflammatory activity of the Mn(II complex of Pytren4Q in addition to its low toxicity, water solubility and ease of production would suggest it is worth taking into consideration for future pharmacological studies.
An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.
Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula
2013-07-01
The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Anirban Chatterjee
2012-01-01
Full Text Available Background: Deficiency of Co-Q10 has been found to be responsible for periodontal destruction; therefore, this study was undertaken to evaluate the anti-gingivitis effect of Co-Q10 on plaque induced gingivitis. Materials and Methods: Thirty subjects with plaque induced gingivitis were enrolled in a split mouth randomized controlled trial. For each subject, scaling was randomly performed for any two quadrants, followed by the topical application of Co-Q10 randomly in a previously scaled and as an unscaled quadrant for a period of 28 days. Four treatment options were planned: option A: scaling only; option B: Co-Q10 along with scaling; option C: Co-Q10. Results: Marked reduction in gingival, bleeding, and plaque scores were recorded at the sites where C0-Q10 was applied. Mean±S.D of aforementioned periodontal parameters at 28th day showed significant reduction for option A, B, and C when compared with baseline. Conclusion: Promising results were obtained after the solitary application of Co-Q10 as well as when it was used as an adjunct to scaling and root planing for treatment of plaque induced gingivitis.
Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.
Marincola, Gabriella; Wolz, Christiane
2017-06-02
In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
CONDOP: an R package for CONdition-Dependent Operon Predictions.
Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario
2016-10-15
The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.
Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio
2012-01-01
Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.
The pyrimidine operon pyrRPB-carA from Lactococcus lactis
DEFF Research Database (Denmark)
Martinussen, Jan; Schallert, J.; Andersen, Birgit
2001-01-01
The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...
DEFF Research Database (Denmark)
Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten
1994-01-01
Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...
Gauge vector boson pair production at p antiP colliders
International Nuclear Information System (INIS)
Ranft, G.
1981-01-01
Boson pair production in q anti q processes: q anti q → W - W + , q anti q → Z 0 Z 0 , q anti q → Z 0 #betta#, d anti u → Z 0 W - (#betta#W - ) n u anti d →#betta#W + (Z 0 W - ) are studied. The polarization amplitudes qsub(L) anti qsub(R) → Vsub(1lambdasub(1))+Vsub(2lamdasub(2)), qsub(R) anti qsub(L) → Vsub(1lamdasub(1))+Vsub(2lambdasub(2)) of the all channels for fixed quark (antiquark) helicity (L or R) and fixed polarizations of the final vector bosons lambda 1 and lambda 2 are investigated. Angular distributions in the q anti q c. m. s. for d anti u → #betta##betta# - reaction are given. The peculiarities of cross sections of the processes are considered
N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae
Directory of Open Access Journals (Sweden)
Muhammad Afzal
2016-09-01
Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.
Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.
Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L
2016-01-01
Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.
Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae
Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P
2015-01-01
In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase
Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R; Aro, Eva-Mari
2012-09-28
The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (C(i)), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the Q(B) site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by C(i) limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in C(i) conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon.
The post-transcriptional operon
DEFF Research Database (Denmark)
Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik
2011-01-01
model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....
Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.
Stewart, V; Yanofsky, C
1986-01-01
We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.
Directory of Open Access Journals (Sweden)
Juliana Teixeira de Magalhães
2005-06-01
Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.
Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha
2014-11-01
Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.
Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm
Directory of Open Access Journals (Sweden)
Dharmesh Harwani
2014-12-01
Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.
Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.
Harwani, Dharmesh
2014-01-01
Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.
Operon Gene Order Is Optimized for Ordered Protein Complex Assembly
Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.
2016-01-01
Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901
Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.
Directory of Open Access Journals (Sweden)
Catherine E Dana
Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.
HELICOBACTER PYLORI AND t(11;18(q21;q21 TRANSLOCATION IN GASTRIC MALT LYMPHOMA
Directory of Open Access Journals (Sweden)
Karine Sampaio LIMA
2014-04-01
Full Text Available Context Gastric mucosa-associated lymphoid tissue (MALT lymphoma is clearly associated with Helicobacter pylori gastritis and can be cured with anti- H pylori therapy alone. The presence of t(11;18(q21;q21 translocation is thought to predict a lower response rate to anti- H pylori treatment. Objectives To study the presence of t(11;18(q21;q21 genetic translocation and its clinical impact in low-grade gastric MALT lymphoma Brazilian patients. Methods A consecutive series of eight patients with gastric MALT lymphoma were submitted to gastroscopy, endoscopic ultrasound, histopathological examination, H pylori search and RT-PCR-based methodology. All patients received anti-H pylori treatment. Eradicated patients were followed-up every 3-6 months for 2 years. Results Eight patients were studied. All patients had tumor involvement restricted to the mucosa or submucosa and seven patients had low-grade gastric MALT lymphoma. All infected patients achieved H pylori eradication. Histological tumor regression was observed in 5/7 (71% of the low-grade gastric MALT lymphoma patients. The presence of t(11;18(q21;q21 translocation was found in 4 (57% of these patients; among them only two had histological tumor regression following H pylori eradication. Conclusions RT-PCR is a feasible and efficient method to detect t(11;18(q21;q21 translocation, being carried out in routine molecular biology laboratories. The early detection of such translocation can be very helpful for better targeting the therapy to be applied to gastric MALT lymphoma patients.
Structural organization of the transfer RNA operon I of Vibrio cholerae
Indian Academy of Sciences (India)
Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...
q-deformed conformal superalgebra and its Hopf subalgebras
International Nuclear Information System (INIS)
Dobrev, V.K.; Lukierski, J.; Sobczyk, J.; Tolstoy, V.N.
1992-07-01
We present in detail a Hopf superalgebra U q (su(2,2/2)) which is a q-deformation of the conformal superalgebra su(2,2/1). The superalgebra U q (su(2,2/1)) contains as a subalgebra a q-deformed super-Poincare algebra and as Hopf subalgebras two conjugate 16-generator q-deformed super-Weyl algebras, which are q-deformation of parabolic subalgebras of su(2,2/1). We use several (anti-) involutions, including the standard Cartan involution and a *-antiinvolution under which the super-Weyl algebras are *-subalgebras of U q (su(2,2/1)). The q-deformed Lorentz algebra is Hopf subalgebra of both Weyl algebras and is preserved by all (anti-) involutions considered. (author). 26 refs
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.
Directory of Open Access Journals (Sweden)
Jeffrey R Johansen
Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.
International Nuclear Information System (INIS)
Lipatov, A.V.; Zotov, N.P.
2015-01-01
We investigate the possibility to detect the scalar Higgs boson decay H → b anti b in the associated Z and b anti b production at the LHC using the k T -factorization QCD approach. Our consideration is based on the off-shell (i.e. depending on the transverse momenta of initial quarks and gluons) production amplitudes of q* anti q* → ZH → Zq' anti q', q* anti q* → Zq' anti q', and g*g* → Zq' anti q' partonic subprocesses supplemented with the Catani.Ciafoloni.Fiorani. Marchesini (CCFM) dynamics of parton densities in a proton. We argue that the H → b anti b signal could be observed at large transverse momenta near the Higgs boson peak despite the overwhelming QCD background, and we point out the important role of angular correlations between the produced Z boson and b-quarks. (orig.)
UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD
International Nuclear Information System (INIS)
Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.
1994-01-01
UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent
Cop-like operon: Structure and organization in species of the Lactobacillale order
Directory of Open Access Journals (Sweden)
ANGÉLICA REYES
2006-01-01
Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.
Elucidation of Operon Structures across Closely Related Bacterial Genomes
Li, Guojun
2014-01-01
About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722
Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin
2015-03-17
Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal
Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M
2001-04-01
We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.
Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia
2011-10-01
Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.
Dielectric spectroscopy of the SmQ* phase
Perkowski, P.; Bubnov, A.; Piecek, W.; Ogrodnik, K.; Hamplová, V.; Kašpar, M.
2011-11-01
Liquid crystal possessing two biphenyl moieties in the molecular core and lateral chlorine substitution far from the chiral chain has been studied by dielectric spectroscopy. On cooling from the isotropic phase, the material possesses the frustrated smectic Q* (SmQ*) and SmCA* phases. It has been confirmed by dielectric spectroscopy that the SmQ* phase can be related to the SmCA* anti-ferroelectric phase. However, only one relaxation process has been observed in the SmQ* phase, while in the SmCA*, two relaxations are clearly detectable. It seems that the mode found in the SmQ* can be connected with high-frequency anti-phase mode observed in the SmCA* phase. Its relaxation frequency is similar to PH relaxation frequency, but is weaker. The same relaxation has been observed even a few degrees above the SmQ*-Iso phase transition. Another explanation for the mode detected in SmQ* and isotropic phases can be molecular motions around short molecular axis.
Autoantibodies against C1q in systemic lupus erythematosus are antigen-driven
DEFF Research Database (Denmark)
Schaller, Monica; Bigler, Cornelia; Danner, Doris
2009-01-01
response against C1q at the molecular level, we screened a bone marrow-derived IgGkappa/IgGlambda Fab phage display library from a SLE patient with high anti-C1q Ab titer against purified human C1q. Six Fabs that exhibited strong binding to C1q in ELISA were isolated. The anti-C1q Fabs recognized...... neoepitopes that were only exposed on bound C1q and not present on soluble C1q mapping to different regions of the collagen-like region of C1q. Analysis of the genes encoding the variable H and L chains of the IgG-derived anti-C1q Fab revealed that all the variable H and L chain regions were highly mutated......, with nucleotide and amino acid homologies to the closest germline in the range of 71-97% (average 85 +/- 4) and 72-92% (average 88 +/- 6), respectively. In addition, the variable region of the Fabs exhibited high replacement to silent ratios. The six anti-C1q Fabs were shown to be of high affinity, with a K...
Dynamic model of gene regulation for the lac operon
International Nuclear Information System (INIS)
Angelova, Maia; Ben-Halim, Asma
2011-01-01
Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.
Dynamic model of gene regulation for the lac operon
Energy Technology Data Exchange (ETDEWEB)
Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)
2011-03-01
Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.
Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.
Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan
2017-10-01
One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple
Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.
Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula
2016-09-01
The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.
Prevalence of transcription promoters within archaeal operons and coding sequences.
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.
clpC operon regulates cell architecture and sporulation in Bacillus anthracis.
Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra
2015-03-01
The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.
2016-01-01
The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073
CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum
Directory of Open Access Journals (Sweden)
Marasco Rosangela
2006-11-01
Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro
Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.
Cortes, Teresa; Cox, Robert Ashley
2015-04-01
Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.
DEFF Research Database (Denmark)
Danielsen, S; Kilstrup, M; Barilla, K
1992-01-01
. A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...
Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao
2013-10-01
The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates
DEFF Research Database (Denmark)
Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria
2014-01-01
We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....
Energy Technology Data Exchange (ETDEWEB)
Chofor, Ndimofor; Harder, Dietrich; Selbach, Hans-Joachim; Poppe, Bjoern [University of Oldenburg and Pius-Hospital Oldenburg (Germany). Medical Radiation Physics Group
2016-11-01
The application of various radiation detectors for brachytherapy dosimetry has motivated this study of the energy dependence of radiation quality correction factor k{sub Q,M}, the quotient of the detector responses under calibration conditions at a {sup 60}Co unit and under the given non-reference conditions at the point of measurement, M, occurring in photon brachytherapy. The investigated detectors comprise TLD, radiochromic film, ESR, Si diode, plastic scintillator and diamond crystal detectors as well as ionization chambers of various sizes, whose measured response-energy relationships, taken from the literature, served as input data. Brachytherapy photon fields were Monte-Carlo simulated for an ideal isotropic {sup 192}Ir point source, a model spherical {sup 192}Ir source with steel encapsulation and a commercial HDR GammaMed Plus source. The radial source distance was varied within cylindrical water phantoms with outer radii ranging from 10 to 30 cm and heights from 20 to 60 cm. By application of this semiempirical method - originally developed for teletherapy dosimetry - it has been shown that factor k{sub Q,M} is closely correlated with a single variable, the fluence-weighted mean photon energy anti E{sub F} at the point of measurement. The radial profiles of anti E{sub F} obtained with either the commercial {sup 192}Ir source or the two simplified source variants show little variation. The observed correlations between parameters k{sub Q,M} and anti E{sub F} are represented by fitting formulae for all investigated detectors, and further variation of the detector type is foreseen. The herewith established close correlation of radiation quality correction factor k{sub Q,M} with local mean photon energy anti E{sub F} can be regarded as a simple regularity, facilitating the practical application of correction factor k{sub Q,M} for in-phantom dosimetry around {sup 192}Ir brachytherapy sources. anti E{sub F} values can be assessed by Monte Carlo simulation or
Structural characterization of the Salmonella typhimurium LT2 umu operon
International Nuclear Information System (INIS)
Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.
1990-01-01
The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity
Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes
Directory of Open Access Journals (Sweden)
Jan Ewald
2015-04-01
Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.
Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli
Directory of Open Access Journals (Sweden)
Sun Yuan
2006-02-01
Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.
Walshe-Roussel, Brendan; Choueiri, Christine; Saleem, Ammar; Asim, Muhammd; Caal, Federico; Cal, Victor; Rojas, Marco Otarola; Pesek, Todd; Durst, Tony; Arnason, John Thor
2013-08-01
The widespread use of Neurolaena lobata (L.) R. Br. ex Cass. by Q'eqchi' Maya and indigenous healers throughout the Caribbean for inflammatory conditions prompted the study of the anti-inflammatory activity of this traditional medicine. The objectives of this study were to conduct a detailed ethnobotanical investigation of the uses of N. lobata by the Q'eqchi' Maya of Belize for a variety of inflammatory symptoms and to evaluate the in vitro anti-inflammatory activity of leaf extract and isolated sesquiterpene lactones. The crude 80% EtOH extract of N. lobata leaves administered at 100 μg/mL reduced LPS-stimulated TNF-α production in THP-1 monocytes by 72% relative to the stimulated vehicle control. Isolated sesquiterpene lactones, neurolenins B, C+D, lobatin B and 9α-hydroxy-8β-isovalerianyloxy-calyculatolide were more active (IC50=0.17-2.32 μM) than the positive control parthenolide (IC50=4.79 μM). The results provide a pharmacological and phytochemical basis for the traditional use of this leaf for inflammatory conditions. Copyright © 2013 Elsevier Ltd. All rights reserved.
Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P
2015-01-01
In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.
Decreases in average bacterial community rRNA operon copy number during succession.
Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R
2016-05-01
Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.
Riyanti, Eny Ida; Rogers, Peter L
2009-01-01
Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...
Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh
2014-10-01
Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.
DEFF Research Database (Denmark)
Givskov, M; Eberl, L; Christiansen, Gunna
1995-01-01
. Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...
Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M
2014-12-01
Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.
Eucaryotic operon genes can define highly conserved syntenies
Czech Academy of Sciences Publication Activity Database
Trachtulec, Zdeněk
2004-01-01
Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004
Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús
2013-02-01
Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.
Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.
Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef
2016-10-15
Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is
Involvement of the Acr3 and DctA anti-porters in arsenite oxidation in Agrobacterium tumefaciens 5A.
Kang, Yoon-Suk; Shi, Zunji; Bothner, Brian; Wang, Gejiao; McDermott, Timothy R
2015-06-01
Microbial arsenite (AsIII) oxidation forms a critical piece of the arsenic cycle in nature, though our understanding of how and why microorganisms oxidize AsIII remains rudimentary. Our model organism Agrobacterium tumefaciens 5A contains two distinct ars operons (ars1 and ars2) that are similar in their coding region content. The ars1 operon is located nearby the aio operon that is essential for AsIII oxidation. The AsIII/H(+) anti-porters encoded by acr3-1 and acr3-2 are required for maximal AsIII and antimonite (SbIII) resistance, but acr3-1 (negatively regulated by ArsR-1) appears more active in this regard and also required for AsIII oxidation and expression of aioBA. A malate-phosphate anti-porter DctA is regulated by RpoN and AsIII, and is required for normal growth with malate as a sole carbon source. Qualitatively, a ΔdctA mutant was normal for AsIII oxidation and AsIII/SbIII resistance at metalloid concentrations inhibitory to the Δacr3-1 mutant; however, aioBA induction kinetics was significantly phase-shift delayed. Acr3 involvement in AsIII/SbIII resistance is reasonably well understood, but the role of Acr3 and DctA anti-porters in AsIII oxidation and its regulation is unexpected, and suggests that controlled AsIII trafficking across the cytoplasmic membrane is important to a process understood to occur in the periplasm. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O
2015-02-01
Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Qinna Cui
Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.
Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P
In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased
Lee, Myoung-Jae; Jung, Young-Dae
2018-05-01
The dispersion properties of surface dust ion-acoustic waves in a self-gravitating magnetized dusty plasma layer with the (r, q) distribution are investigated. The result shows that the wave frequency of the symmetric mode in the plasma layer decreases with an increase in the wave number. It is also shown that the wave frequency of the symmetric mode decreases with an increase in the spectral index r. However, the wave frequency of the anti-symmetric mode increases with an increase in the wave number. It is also found that the anti-symmetric mode wave frequency increases with an increase in the spectral index r. In addition, it is found that the influence of the self-gravitation on the symmetric mode wave frequency decreases with increasing scaled Jeans frequency. Moreover, it is found that the wave frequency of the symmetric mode increases with an increase in the dust charge; however, the anti-symmetric mode shows opposite behavior.
Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C
2015-07-07
Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.
HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.
Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong
2016-01-01
Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.
Kim, Moonjeong; Kim, Kwang-Sun
2017-07-06
The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Chung, T; Resnik, E; Stueland, C; LaPorte, D C
1993-01-01
Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...
Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria
2016-01-01
The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the
KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G
Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It
Goh, Yong Jun; Klaenhammer, Todd R
2013-01-01
Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira
2013-07-01
Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Boyd, D A; Mulvey, M R
2013-02-01
To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.
Sequence analysis of the Legionella micdadei groELS operon
DEFF Research Database (Denmark)
Hindersson, P; Høiby, N; Bangsborg, Jette Marie
1991-01-01
shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...
Sahukhal, Gyan S; Elasri, Mohamed O
2014-06-11
Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.
Structural organization of the transfer RNA operon I of Vibrio cholerae
Indian Academy of Sciences (India)
Unknown
[Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.
Characterization of the Leptospira interrogans S10-spc-alpha operon
Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.
2000-01-01
A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an
Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan
2014-01-01
Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory
Buyon, Jill; Furie, Richard; Putterman, Chaim; Ramsey-Goldman, Rosalind; Kalunian, Kenneth; Barken, Derren; Conklin, John; Dervieux, Thierry
2016-01-01
The relationship between cell-bound complement activation products (CB-CAPs: EC4d, EC3d), anti-C1q, soluble complement C3/C4 and disease activity in systemic lupus erythematosus (SLE) was evaluated. Per protocol, at baseline all SLE subjects enrolled in this longitudinal study presented with active disease and elevated CB-CAPs. At each monthly visit, the non-serological (ns) Safety of Estrogens in Lupus Erythematosus: National Assessment (SELENA-SLEDAI) and the British Isles Lupus Assessment Group (BILAG)-2004 index scores were determined as was a random urinary protein to creatinine ratio (uPCR). Short-form 36 (SF-36) questionnaires were also collected. All soluble markers were determined using immunoassays, while EC4d and EC3d were determined using flow cytometry. Statistical analysis consisted of linear mixed models with random intercept and fixed slopes. A total of 36 SLE subjects (mean age 34 years; 94% female) were enrolled and evaluated monthly for an average 11 visits per subject. Clinical improvements were observed during the study, with significant decreases in ns-SELENA-SLEDAI scores, BILAG-2004 index scores and uPCR, and increases in all domains of SF-36 (pimprovements in at least six out of the eight domains of SF-36 and outperformed C3/C4. Anti-dsDNA titres did not correlate with changes in disease activity. These data indicate that CB-CAPs and anti-C1q are helpful in monitoring patients with SLE.
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843
Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong
2017-01-01
The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.
Directory of Open Access Journals (Sweden)
Arkin Adam P
2006-01-01
Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.
Directory of Open Access Journals (Sweden)
Xiaoping Zhang
2013-12-01
Full Text Available Bacterial blight, caused by Xanthomonas oryzae pv. oryzae (Xoo, is one of the most destructive diseases of rice (Oryza sativa L. worldwide. The type III secretion system (T3SS of Xoo, encoded by the hrp (hypersensitive response and pathogenicity genes, plays critical roles in conferring pathogenicity in host rice and triggering a hypersensitive response (HR in non-host plants. To investigate the major genes conferring the pathogenicity and avirulence of Xoo, we previously constructed a random Tn5-insertion mutant library of Xoo strain PXO99A. We report here the isolation and characterization of a Tn5-insertion mutant PXM69. Tn5-insertion mutants were screened on indica rice JG30, which is highly susceptible to PXO99A, by leaf-cutting inoculation. Four mutants with reduced virulence were obtained after two rounds of screening. Among them, the mutant PXM69 had completely lost virulence to the rice host and ability to elicit HR in non-host tobacco. Southern blotting analysis showed a single copy of a Tn5-insertion in the genome of PXM69. PCR walking and sequencing analysis revealed that the Tn5 transposon was inserted at nucleotide position 70,192–70,201 in the genome of PXO99A, disrupting the type III hrc (hrp-conserved gene hrcQ, the first gene in the D operon of the hrp cluster in Xoo. To confirm the relationship between the Tn5-insertion and the avirulence phenotype of PXM69, we used the marker exchange mutagenesis to create a PXO99A mutant, ΔhrcQ::KAN, in which the hrcQ was disrupted by a kanamycin-encoding gene cassette at the same site as that of the Tn5-insertion. ΔhrcQ::KAN showed the same phenotype as mutant PXM69. Reintroduction of the wild-type hrcQ gene partially complemented the pathogenic function of PXM69. RT-PCR and cellulase secretion assays showed that the Tn5-disruption of hrcQ did not affect transcription of downstream genes in the D operon and function of the type II secretion system. Our results provide new insights into
Institute of Scientific and Technical Information of China (English)
Xiaoping; Zhang; Chunlian; Wang; Chongke; Zheng; Jinying; Che; Yanqiang; Li; Kaijun; Zhao
2013-01-01
Bacterial blight, caused by Xanthomonas oryzae pv. oryzae(Xoo), is one of the most destructive diseases of rice(Oryza sativa L.) worldwide. The type III secretion system(T3SS) of Xoo, encoded by the hrp(hypersensitive response and pathogenicity) genes, plays critical roles in conferring pathogenicity in host rice and triggering a hypersensitive response(HR) in non-host plants. To investigate the major genes conferring the pathogenicity and avirulence of Xoo, we previously constructed a random Tn5-insertion mutant library of Xoo strain PXO99A. We report here the isolation and characterization of a Tn5-insertion mutant PXM69. Tn5-insertion mutants were screened on indica rice JG30, which is highly susceptible to PXO99A, by leaf-cutting inoculation.Four mutants with reduced virulence were obtained after two rounds of screening. Among them, the mutant PXM69 had completely lost virulence to the rice host and ability to elicit HR in non-host tobacco. Southern blotting analysis showed a single copy of a Tn5-insertion in the genome of PXM69. PCR walking and sequencing analysis revealed that the Tn5 transposon was inserted at nucleotide position 70,192–70,201 in the genome of PXO99A, disrupting the type III hrc(hrp-conserved) gene hrcQ, the first gene in the D operon of the hrp cluster in Xoo. To confirm the relationship between the Tn5-insertion and the avirulence phenotype of PXM69, we used the marker exchange mutagenesis to create a PXO99Amutant, ΔhrcQ::KAN, in which the hrcQ was disrupted by a kanamycin-encoding gene cassette at the same site as that of the Tn5-insertion. ΔhrcQ::KAN showed the same phenotype as mutant PXM69. Reintroduction of the wild-type hrcQ gene partially complemented the pathogenic function of PXM69. RT-PCR and cellulase secretion assays showed that the Tn5-disruption of hrcQ did not affect transcription of downstream genes in the D operon and function of the type II secretion system. Our results provide new insights into the pathogenic
Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.
Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki
2015-11-17
rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.
Dixit, R; Trivedi, P K; Nath, P; Sane, P V
1999-09-01
Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.
Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E
2016-01-01
An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.
Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.
2014-01-01
Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527
Ray, Sujay; Banerjee, Arundhati
2015-10-01
Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.
Open-flavor charm and bottom s q q ¯ Q ¯ and q q q ¯ Q ¯ tetraquark states
Chen, Wei; Chen, Hua-Xing; Liu, Xiang; Steele, T. G.; Zhu, Shi-Lin
2017-06-01
We provide comprehensive investigations for the mass spectrum of exotic open-flavor charmed/bottom s q q ¯ c ¯ , q q q ¯ c ¯ , s q q ¯ b ¯ , q q q ¯ b ¯ tetraquark states with various spin-parity assignments JP=0+,1+,2+ and 0- , 1- in the framework of QCD sum rules. In the diquark configuration, we construct the diquark-antidiquark interpolating tetraquark currents using the color-antisymmetric scalar and axial-vector diquark fields. The stable mass sum rules are established in reasonable parameter working ranges, which are used to give reliable mass predictions for these tetraquark states. We obtain the mass spectra for the open-flavor charmed/bottom s q q ¯c ¯, q q q ¯c ¯, s q q ¯b ¯, q q q ¯b ¯ tetraquark states with various spin-parity quantum numbers. In addition, we suggest searching for exotic doubly-charged tetraquarks, such as [s d ][u ¯ c ¯ ]→Ds(*)-π- in future experiments at facilities such as BESIII, BelleII, PANDA, LHCb, and CMS, etc.
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter
2008-01-01
Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of
RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.
Pérez-Oseguera, Angeles; Cevallos, Miguel A
2013-11-01
Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Terezinha Knöbl
2006-06-01
Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.
Kang, Dong-Min; Michon, Christophe; Morinaga, Tetsuro; Tanaka, Kosei; Takenaka, Shinji; Ishikawa, Shu; Yoshida, Ken-Ichi
2017-07-11
Bacillus subtilis is able to utilize at least three inositol stereoisomers as carbon sources, myo-, scyllo-, and D-chiro-inositol (MI, SI, and DCI, respectively). NAD + -dependent SI dehydrogenase responsible for SI catabolism is encoded by iolX. Even in the absence of functional iolX, the presence of SI or MI in the growth medium was found to induce the transcription of iolX through an unknown mechanism. Immediately upstream of iolX, there is an operon that encodes two genes, yisR and iolQ (formerly known as degA), each of which could encode a transcriptional regulator. Here we performed an inactivation analysis of yisR and iolQ and found that iolQ encodes a repressor of the iolX transcription. The coding sequence of iolQ was expressed in Escherichia coli and the gene product was purified as a His-tagged fusion protein, which bound to two sites within the iolX promoter region in vitro. IolQ is a transcriptional repressor of iolX. Genetic evidences allowed us to speculate that SI and MI might possibly be the intracellular inducers, however they failed to antagonize DNA binding of IolQ in in vitro experiments.
International Nuclear Information System (INIS)
Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.
1988-01-01
The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis
A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport
Chopra, Paras; Bender, Andreas
The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].
Directory of Open Access Journals (Sweden)
Tahtouh Muriel
2012-02-01
Full Text Available Abstract Background In invertebrates, the medicinal leech is considered to be an interesting and appropriate model to study neuroimmune mechanisms. Indeed, this non-vertebrate animal can restore normal function of its central nervous system (CNS after injury. Microglia accumulation at the damage site has been shown to be required for axon sprouting and for efficient regeneration. We characterized HmC1q as a novel chemotactic factor for leech microglial cell recruitment. In mammals, a C1q-binding protein (C1qBP alias gC1qR, which interacts with the globular head of C1q, has been reported to participate in C1q-mediated chemotaxis of blood immune cells. In this study, we evaluated the chemotactic activities of a recombinant form of HmC1q and its interaction with a newly characterized leech C1qBP that acts as its potential ligand. Methods Recombinant HmC1q (rHmC1q was produced in the yeast Pichia pastoris. Chemotaxis assays were performed to investigate rHmC1q-dependent microglia migration. The involvement of a C1qBP-related molecule in this chemotaxis mechanism was assessed by flow cytometry and with affinity purification experiments. The cellular localization of C1qBP mRNA and protein in leech was investigated using immunohistochemistry and in situ hybridization techniques. Results rHmC1q-stimulated microglia migrate in a dose-dependent manner. This rHmC1q-induced chemotaxis was reduced when cells were preincubated with either anti-HmC1q or anti-human C1qBP antibodies. A C1qBP-related molecule was characterized in leech microglia. Conclusions A previous study showed that recruitment of microglia is observed after HmC1q release at the cut end of axons. Here, we demonstrate that rHmC1q-dependent chemotaxis might be driven via a HmC1q-binding protein located on the microglial cell surface. Taken together, these results highlight the importance of the interaction between C1q and C1qBP in microglial activation leading to nerve repair in the medicinal
Tahtouh, Muriel; Garçon-Bocquet, Annelise; Croq, Françoise; Vizioli, Jacopo; Sautière, Pierre-Eric; Van Camp, Christelle; Salzet, Michel; Nagnan-le Meillour, Patricia; Pestel, Joël; Lefebvre, Christophe
2012-02-22
In invertebrates, the medicinal leech is considered to be an interesting and appropriate model to study neuroimmune mechanisms. Indeed, this non-vertebrate animal can restore normal function of its central nervous system (CNS) after injury. Microglia accumulation at the damage site has been shown to be required for axon sprouting and for efficient regeneration. We characterized HmC1q as a novel chemotactic factor for leech microglial cell recruitment. In mammals, a C1q-binding protein (C1qBP alias gC1qR), which interacts with the globular head of C1q, has been reported to participate in C1q-mediated chemotaxis of blood immune cells. In this study, we evaluated the chemotactic activities of a recombinant form of HmC1q and its interaction with a newly characterized leech C1qBP that acts as its potential ligand. Recombinant HmC1q (rHmC1q) was produced in the yeast Pichia pastoris. Chemotaxis assays were performed to investigate rHmC1q-dependent microglia migration. The involvement of a C1qBP-related molecule in this chemotaxis mechanism was assessed by flow cytometry and with affinity purification experiments. The cellular localization of C1qBP mRNA and protein in leech was investigated using immunohistochemistry and in situ hybridization techniques. rHmC1q-stimulated microglia migrate in a dose-dependent manner. This rHmC1q-induced chemotaxis was reduced when cells were preincubated with either anti-HmC1q or anti-human C1qBP antibodies. A C1qBP-related molecule was characterized in leech microglia. A previous study showed that recruitment of microglia is observed after HmC1q release at the cut end of axons. Here, we demonstrate that rHmC1q-dependent chemotaxis might be driven via a HmC1q-binding protein located on the microglial cell surface. Taken together, these results highlight the importance of the interaction between C1q and C1qBP in microglial activation leading to nerve repair in the medicinal leech.
Córica, María Emilia
2012-01-01
: Las concentraciones de anticuerpo anti-C1q están elevadas en los pacientes afectados de LES. Según algunos estudios la presencia de este anticuerpo está asociada a la nefropatía lúpica, sin embargo en otros estudios esta relación no se comprobó. En nuestro trabajo relacionamos la positividad del anticuerpo anti-C1q con las manifestaciones clínicas, hematológicas e inmunológicas de la enfermedad. A diferencia de estudios previos sólo pudimos establecer una relación estadísticamente significa...
DEFF Research Database (Denmark)
Eberl, L; Winson, MK; Sternberg, C
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....
Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.
Chowdhury, Nilkanta; Bagchi, Angshuman
2017-07-01
Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.
Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato
2018-01-01
Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.
Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo
2014-12-01
The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.
Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko
2012-07-15
Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.
Dynamics and bistability in a reduced model of the lac operon
Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.
2004-06-01
It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.
Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito
2014-09-01
Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Preformed β-amyloid fibrils are destabilized by coenzyme Q10 in vitro
International Nuclear Information System (INIS)
Ono, Kenjiro; Hasegawa, Kazuhiro; Naiki, Hironobu; Yamada, Masahito
2005-01-01
Inhibition of the formation of β-amyloid fibrils (fAβ), as well as the destabilization of preformed fAβ in the CNS, would be attractive therapeutic targets for the treatment of Alzheimer's disease (AD). We reported previously that nordihydroguaiaretic acid (NDGA) and wine-related polyphenol, myricetin (Myr), inhibit fAβ formation from Aβ and destabilize preformed fAβ in vitro. Using fluorescence spectroscopic analysis with thioflavin T and electron microscopic studies, we examined the effects of coenzyme Q 10 (CoQ 10 ) on the formation, extension, and destabilization of fAβ at pH 7.5 at 37 deg C in vitro. We next compared the anti-amyloidogenic activities of CoQ 10 with NDGA and Myr. CoQ 10 dose-dependently inhibited fAβ formation from amyloid β-peptide (Aβ), as well as their extension. Moreover, it destabilized preformed fAβs. The anti-amyloidogenic effects of CoQ 10 were slightly weaker than those of NDGA and Myr. CoQ 10 could be a key molecule for the development of therapeutics for AD
Free radical scavenging activity of coenzyme Q measured by a chemiluminescent assay
International Nuclear Information System (INIS)
Battino, Maurizio; Ferri, Elida; Girotti, Stefano; Lenaz, Giorgio
1991-01-01
Involvement of coenzyme Q (CoQ) in anti-oxydant activities, in addition to its major redox role, has frequently been suggested in recent years. In order to elucidate if CoQ could really be engaged in scavenging free radicals produced endogenously in a biological system, an experimental system was developed in which beef heart mitochondria in the presence of a saturating NADH concentration and of rotenone produce free radicals. The presence of oxygen-reactive forms was easily detected by a luminol-dependent chemiluminescence process. The chemi-luminescence assay showed that short-chain CoQ homologues can act as pro-oxidants, enhancing free radical effects, while exogenous coenzyme Q 10 could scavenge free radicals, especially at very low concentration. In this system, exogenous CoQ 10 was more effective than α-tocopherol at the same concentration in scavenging free radicals. The molecular mechanism that leads to this activity is still unclear, but these results are of biochemical importance because they indicate that CoQ may act as an anti=oxidant in situations mimicking physiopathological conditions. This direct chemiluminescent method is promising for studies of biochemical processes which involve active oxygen species. (author). 24 refs.; 4 figs
DEFF Research Database (Denmark)
Brøndsted, Lone; Atlung, Tove
1996-01-01
The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...
Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert
2015-05-01
Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.
2015-01-01
encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....
Roy, Ajit; Ranjan, Akash
2016-02-23
Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.
International Nuclear Information System (INIS)
Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.
2007-01-01
The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit
Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120
Directory of Open Access Journals (Sweden)
Lindblad Peter
2008-04-01
Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the
Predictions for the anti B0 → anti K*0 X(YZ) and anti Bs0 → φ X(YZ) with X(4160), Y(3940), Z(3930)
International Nuclear Information System (INIS)
Liang, Wei-Hong; Molina, R.; Doering, M.; Xie, Ju-Jun; Oset, E.
2015-01-01
We investigate the decay of anti B 0 → anti K *0 R and anti B s 0 → φR with R being the X(4160), Y(3940), Z(3930) resonances. Under the assumption that these states are dynamically generated from the vector-vector interaction, as has been concluded from several theoretical studies, we use a reaction mechanism of quark production at the elementary level, followed by hadronization of one final q anti q pair into two vectors and posterior final state interaction of this pair of vector mesons to produce the resonances. With this procedure we are able to predict five ratios for these decays, which are closely linked to the dynamical nature of these states, and also predict the order of magnitude of the branching ratios which we find of the order of 10 -4 , well within the present measurable range. In order to further test the dynamical nature of these resonances we study the anti B s 0 → φ D* anti D* and anti B s 0 → φ D s * anti D s * decays close to the D* anti D* and D s * anti D s * thresholds and make predictions for the ratio of the mass distributions in these decays and the anti B s 0 → φR decay widths. The measurement of these decays rates can help unravel the nature of these resonances. (orig.)
Feasibility studies of the anti pp→π circle e+e- electromagnetic channel at anti PANDA
International Nuclear Information System (INIS)
Boucher, Jerome
2011-01-01
Among all possible realizations of quark and antiquark assembly, the nucleon (the proton and the neutron) is the most stable of all hadrons and consequently has been the subject of intensive studies. Mass, shape, radius and more complex representations of its internal structure are measured since several decades using different probes. The proton (spin 1/2) is described by the electric G E and magnetic G M form factors which characterise its internal structure. The simplest way to measure the proton form factors consists in measuring the angular distribution of the electron-proton elastic scattering accessing the so-called Space-Like region where q 2 ≤0. Using the crossed channel anti pp e + e - , one accesses another kinematical region, the so-called Time-Like region where q 2 >0. However, due to the anti pp e + e - threshold q 2 th , only the kinematical domain q 2 >q 2 th > 0 is available. To access the unphysical region, one may use the anti pp→π circle e + e - reaction where the π circle takes away a part of the system energy allowing q 2 to be varied between q 2 th and almost 0. This thesis aims to show the feasibility of such measurements with the anti PANDA detector which will be installed on the new high intensity antiproton ring at the FAIR facility at Darmstadt. To describe the anti pp → π circle e + e - reaction, a Lagrangian based approach is developed. The 5-fold differential cross section is determined and related to linear combinations of hadronic tensors. Under the assumption of one nucleon exchange, the hadronic tensors are expressed in terms of the 2 complex proton electromagnetic form factors. An extraction method which provides an access to the proton electromagnetic form factor ratio R= vertical stroke G E vertical stroke / vertical stroke G M vertical stroke and for the first time in an unpolarized experiment to the cosine of the phase difference is developed. Such measurements have never been performed in the unphysical region up to
Wang, Y. P.; Dai, T. Y.; Wu, J.; Ju, Y. L.; Yao, B. Q.
2018-06-01
We report the acousto-optically Q-switched Ho:YAG laser with double anti-misalignment corner cubes pumped by a diode-pumped Tm:YLF laser. In the continuous-wave operation of Ho:YAG laser, the maximum s-polarized output power of 3.2 W at 2090.3 nm was obtained under the absorbed pump power of 12.9 W by rotating the fast axis of quarter-wave plate to change the output transmission of laser cavity. The corresponding optical-to-optical conversion efficiency was 24.8% and the slope efficiency was 55.7%. When one of the corner cubes was rotated to 11.8° around vertical direction or 6.7° around horizontal direction, the laser could still operate stably. For the Q-switched operation, the pulse energy of Ho:YAG laser was 9.9 mJ with a pulse width of 53 ns at the repetition rate of 100 Hz, resulting in a peak power of 186.8 kW. The beam quality factor M2 of Ho:YAG laser was 1.3.
Seroprevalence of Q fever in Goats in the Sudan
Directory of Open Access Journals (Sweden)
Diaeldin A Salih
Full Text Available Aim: The survey was carried out to detect anti- C. burnetii antibodies in goat's sera samples in eight States in the Sudan during September 2010 – July 2011. Materials and Methods: In a preliminary study, four hundred and sixty caprine sera samples collected from eight States in the Sudan were screened for anti- Coxiella burnetii (the causative agent of Q fever antibodies using a commercial indirect ELISA (iELISA kit. Results: The results showed an overall prevalence rate 24.22% of Q fever antibodies. The prevalence rate of antibodies ranged from 6.7% in Kassala to 40% in South Darfur. The prevalence rates were highest in South Darfur (40% and South Kordofan (34.7%, moderate in El Gazira (29.7%, Khartoum (29.1%, the Northern (24% and the River Nile (20.2% States. It was lowest in the White Nile (7.5% and Kassala (6.7% States. Conclusion: It could be concluded that Q fever is prevalent in goats in the Sudan. Therefore, further epizootiological investigations on Q fever in other farm animals and man at the country level is important to monitor and determine the magnitude of Q fever infection in order to estimate its economic impact on animal industry and its public health hazard in the Sudan. In addition, the impact of Q fever among shepherds should be studied. [Vet. World 2012; 5(7.000: 394-397
Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel
2015-01-01
The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539
Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent
2015-09-01
The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
The effect of stochasticity on the lac operon: an evolutionary perspective.
Directory of Open Access Journals (Sweden)
Milan van Hoek
2007-06-01
Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel
Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.
Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W
1993-01-01
CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...
Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong
2015-10-23
The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.
Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J
2017-05-01
Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
DEFF Research Database (Denmark)
Eberl, L; Winson, MK; Sternberg, C
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....
Kim, Dae Hun; Ko, Kwan Soo
2015-07-01
To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Hiraku Takada
Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons
DEFF Research Database (Denmark)
Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal
2008-01-01
The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...
Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.
Directory of Open Access Journals (Sweden)
T Sabari Sankar
2009-03-01
Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.
DEFF Research Database (Denmark)
Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin
1996-01-01
Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...
Directory of Open Access Journals (Sweden)
Mohd eKhubaib
2016-05-01
Full Text Available PE/PPE genes, present in cluster with ESAT-6 like genes, are suspected to have a role in antigenic variation and virulence of Mycobacterium tuberculosis. Their roles in immune evasion and immune modulation of host are also well documented. We present evidence that PE32/PPE65 present within the RD8 region are co-operonic, co-transcribed and co-translated, and play role in modulating host immune responses. Experiments with macrophage cell lines revealed that this protein complex suppresses pro-inflammatory cytokines such as TNF-α and IL-6 whereas also inducing high expression of anti-inflammatory IL-10. Immunization of mice with these recombinant proteins dampens an effective Th1 response as evident from reduced frequency of IFN-g and IL-2 producing CD4+ and CD8+ T cells. IgG sub-typing from serum of immunized mice revealed high levels of IgG1 when compared with IgG2a and IgG2b. Further IgG1/IgG2a ratio clearly demonstrated that the protein complex manipulates the host immune response favourable to the pathogen. Our results demonstrate that the co-transcribed and co-translated PE32 and PPE65 antigens are involved specifically in modulating anti-mycobacterial host immune response by hampering Th1 response.
Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W
2015-11-01
Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
DEFF Research Database (Denmark)
Eberl, L; Christiansen, Gunna; Molin, S
1996-01-01
The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...
Nanno, Satoru; Hagihara, Kiyoyuki; Sakabe, Manami; Okamura, Hiroshi; Inaba, Akiko; Nagata, Yuki; Nishimoto, Mitsutaka; Koh, Hideo; Nakao, Yoshitaka; Nakane, Takahiko; Nakamae, Hirohisa; Shimono, Taro; Hino, Masayuki
2013-04-01
A 20-year-old female presented with thirst, polyposia, and polyuria and was referred to our hospital because of leukocytosis and anemia. Bone marrow aspiration revealed 66.8% myeloperoxidase-positive blasts and trilineage myelodysplasia. The karyotype was 45, XX, inv(3)(q21q26.2), -7[19]. Therefore, a diagnosis of AML with inv(3)(q21q26.2) complicated by -7 was made. Moreover, hyposthenuria and a low anti-diuretic hormone (ADH) level were observed. Although cerebrospinal fluid analysis was normal, magnetic resonance imaging (MRI) revealed the absence of hyperintensity in the neurohypophysis in T1-weighted images. Therefore, she was also diagnosed with diabetes insipidus. After she was administered a desmopressin nasal spray, the volume of urine produced decreased. Following treatment with second induction therapy containing high-dose cytarabine for AML, she achieved complete remission in the bone marrow. Moreover, when the abnormality on MRI and the volume of urine were normalized, she discontinued desmopressin. Although diabetes insipidus is a rare complication of AML, the majority of AML patients who have diabetes insipidus have the abnormal karyotypes with inv(3)(q21q26.2)/t(3;3)(q21;q26.2) and monosomy 7. Further study is required to clarify the pathogenesis and develop a strategy for the treatment of this category of AML.
Deaner, Matthew; Holzman, Allison; Alper, Hal S
2018-04-16
Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis
Czech Academy of Sciences Publication Activity Database
Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav
2007-01-01
Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007
Osipiuk, J; Joachimiak, A
1997-09-12
We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.
Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.
de Oliveira, Rafael R; Nicholson, Wayne L
2016-01-01
To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.
Stefanski, Katherine M.
A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.
Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia
2016-08-01
To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)
Czech Academy of Sciences Publication Activity Database
Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.
2017-01-01
Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016
Iwatani, Shun; Ishibashi, Naoki; Flores, Floirendo P; Zendo, Takeshi; Nakayama, Jiro; Sonomoto, Kenji
2016-09-01
Lacticin Q is an unmodified leaderless bacteriocin produced by Lactococcus lactis QU 5. It has been revealed that the production and self-immunity of lacticin Q are facilitated by a gene cluster lnqQBCDEF The gene for a putative TetR-family transcriptional regulator, termed lnqR, was found nearby the lnqQBCDEF cluster, but its involvement in lacticin Q biosynthesis remained unknown. In this study, we created an LnqR-overexpressing QU 5 recombinant by using lactococcal constitutive promoter P32 The recombinant QU 5 showed enhanced production of and self-immunity to lacticin Q. RT-PCR analysis has revealed that an overexpression of LnqR increases the amounts of lnqQBCDEF transcripts, and these six genes are transcribed as an operon in a single transcriptional unit. Interestingly, LnqR expression and thus lacticin Q production by L. lactis QU 5 was found temperature dependent, while LnzR, an LnqR-homologue, in L. lactis QU 14 was expressed in a similar but not identical manner to LnqR, resulting in dissimilar bacteriocin productivities by these strains. This report demonstrates LnqR as the first TetR-family transcriptional regulator involved in LAB bacteriocin biosynthesis and that, as an exceptional case of TetR-family regulators, LnqR positively regulates the transcription of these biosynthetic genes. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Energy Technology Data Exchange (ETDEWEB)
Albaladejo, M.; Fernandez-Soler, P.; Nieves, J.; Ortega, P.G. [Centro Mixto CSIC-Universidad de Valencia, Instituto de Fisica Corpuscular (IFIC), Institutos de Investigacion de Paterna, Aptd. 22085, Valencia (Spain)
2017-03-15
The discovery of the D{sup *}{sub s0}(2317) and D{sub s1}(2460) resonances in the charmed-strange meson spectra revealed that formerly successful constituent quark models lose predictability in the vicinity of two-meson thresholds. The emergence of non-negligible effects due to meson loops requires an explicit evaluation of the interplay between Q anti q and (Q anti q)(q anti q) Fock components. In contrast to the c anti s sector, there is no experimental evidence of J{sup P} = 0{sup +}, 1{sup +} bottom-strange states yet. Motivated by recent lattice studies, in this work the heavy-quark partners of the D{sub s0}{sup *}(2317) and D{sub s1}(2460) states are analyzed within a heavy meson chiral unitary scheme. As a novelty, the coupling between the constituent quark-model P-wave anti B{sub s} scalar and axial mesons and the anti B{sup (*)}K channels is incorporated employing an effective interaction, consistent with heavy-quark spin symmetry, constrained by the lattice energy levels. (orig.)
Coenzyme Q10 protects hair cells against aminoglycoside.
Directory of Open Access Journals (Sweden)
Kazuma Sugahara
Full Text Available It is well known that the production of free radicals is associated with sensory cell death induced by an aminoglycoside. Many researchers have reported that antioxidant reagents protect sensory cells in the inner ear, and coenzyme Q10 (CoQ10 is an antioxidant that is consumed as a health food in many countries. The purpose of this study was to investigate the role of CoQ10 in mammalian vestibular hair cell death induced by aminoglycoside. Cultured utricles of CBA/CaN mice were divided into three groups (control group, neomycin group, and neomycin + CoQ10 group. In the neomycin group, utricles were cultured with neomycin (1 mM to induce hair cell death. In the neomycin + CoQ10 group, utricles were cultured with neomycin and water-soluble CoQ10 (30-0.3 µM. Twenty-four hours after exposure to neomycin, the cultured tissues were fixed, and vestibular hair cells were labeled using an anti-calmodulin antibody. Significantly more hair cells survived in the neomycin + CoQ10 group than in the neomycin group. These data indicate that CoQ10 protects sensory hair cells against neomycin-induced death in the mammalian vestibular epithelium; therefore, CoQ10 may be useful as a protective drug in the inner ear.
Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.
2013-11-01
Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.
Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R
2001-01-01
Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).
Frías, José E; Flores, Enrique
2015-07-01
Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria
Tadmor, Arbel
2009-03-01
In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.
Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando
2015-02-27
It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.
The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus
Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.
2006-01-01
The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and
Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine
2014-10-01
The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Energy Technology Data Exchange (ETDEWEB)
Liang, Wei-Hong [Guangxi Normal University, Department of Physics, Guilin (China); Chinese Academy of Sciences, Institute of Modern Physics, Lanzhou (China); Molina, R.; Doering, M. [The George Washington University, Washington, DC (United States); Xie, Ju-Jun [Chinese Academy of Sciences, Institute of Modern Physics, Lanzhou (China); Institute of Modern Physics of CAS and Lanzhou University, Research Center for Hadron and CSR Physics, Lanzhou (China); Institute of Theoretical Physics, Chinese Academy of Sciences, State Key Laboratory of Theoretical Physics, Beijing (China); Oset, E. [Chinese Academy of Sciences, Institute of Modern Physics, Lanzhou (China); Centro Mixto Universidad de Valencia-CSIC Institutos de Investigacion de Paterna, Departamento de Fisica Teorica y IFIC, Valencia (Spain)
2015-05-15
We investigate the decay of anti B{sup 0} → anti K{sup *0}R and anti B{sub s}{sup 0} → φR with R being the X(4160), Y(3940), Z(3930) resonances. Under the assumption that these states are dynamically generated from the vector-vector interaction, as has been concluded from several theoretical studies, we use a reaction mechanism of quark production at the elementary level, followed by hadronization of one final q anti q pair into two vectors and posterior final state interaction of this pair of vector mesons to produce the resonances. With this procedure we are able to predict five ratios for these decays, which are closely linked to the dynamical nature of these states, and also predict the order of magnitude of the branching ratios which we find of the order of 10{sup -4}, well within the present measurable range. In order to further test the dynamical nature of these resonances we study the anti B{sub s}{sup 0} → φ D* anti D* and anti B{sub s}{sup 0} → φ D{sub s}{sup *} anti D{sub s}{sup *} decays close to the D* anti D* and D{sub s}{sup *} anti D{sub s}{sup *} thresholds and make predictions for the ratio of the mass distributions in these decays and the anti B{sub s}{sup 0} → φR decay widths. The measurement of these decays rates can help unravel the nature of these resonances. (orig.)
Ghosh, Semanti; Bagchi, Angshuman
2015-12-01
Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio
Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T
2017-11-01
Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.
Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L
2017-01-01
Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.
Directory of Open Access Journals (Sweden)
Kathleen Jwanoswki
Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.
Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.
Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D
2015-01-01
Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage
Yang, C Y; Chou, C W; Chen, S Y; Cheng, H M
2001-04-01
Hypopituitarism is the clinical syndrome that results from failure of the anterior pituitary gland to produce its hormones. Hypopituitarism can result from: (1) intrinsic or primary pituitary disease; (2) intrinsic hypothalamic or secondary pituitary disease; or (3) extrinsic extrasellar or parasellar disease. The etiologies of primary hypopituitarism are miscellaneous. The dominant clinical picture of hypopituitarism in the adult is that of hypogonadism. Reports have associated hypopituitarism with anti-pituitary-antibodies, hereditary syndrome and chromosome defects, but hypopituitarism has rarely been associated with balanced chromosome translocation (11;22)(q24;q13). Here, we describe a case of anterior pituitary failure with balanced chromosome translocation. A 19-year-old Chinese teenager presented with failure of pubertal development and sexual infantilism. On examination, the patient had the classic appearance of hypogonadism. Endocrine studies and three combined pituitary function tests revealed panhypopituitarism. A chromosomal study revealed 46,XY,t(11;22)(q24;q13), a balanced translocation between 11q24 and 22q13. Chest films showed delayed fusion of bilateral humeral head epiphyses and bilateral acromions. Scrotal sonography revealed testes were small bilaterally. Magnetic resonance imaging (MRI) of the sella revealed pituitary dwarfism. The patient received 19 months replacement therapy, including steroids (prednisolone 5 mg each day), L-thyroxine (Eltroxin 100 ug each day), and testosterone enanthate 250 mg every two weeks. His height increased 4 cm with secondary sexual characteristics developed, and muscle power increased.
Evidence for a novel chemotactic C1q domain-containing factor in the leech nerve cord.
Tahtouh, Muriel; Croq, Françoise; Vizioli, Jacopo; Sautiere, Pierre-Eric; Van Camp, Christelle; Salzet, Michel; Daha, Mohamed R; Pestel, Joël; Lefebvre, Christophe
2009-02-01
In vertebrates, central nervous system (CNS) protection is dependent on many immune cells including microglial cells. Indeed, activated microglial cells are involved in neuroinflammation mechanisms by interacting with numerous immune factors. Unlike vertebrates, some lophotrochozoan invertebrates can fully repair their CNS following injury. In the medicinal leech Hirudo medicinalis, the recruitment of microglial cells at the lesion site is essential for sprouting of injured axons. Interestingly, a new molecule homologous to vertebrate C1q was characterized in leech, named HmC1q (for H. medicinalis) and detected in neurons and glial cells. In chemotaxis assays, leech microglial cells were demonstrated to respond to human C1q. The chemotactic activity was reduced when microglia was preincubated with signaling pathway inhibitors (Pertussis Toxin or wortmannin) or anti-human gC1qR antibody suggesting the involvement of gC1qR in C1q-mediated migration in leech. Assays using cells preincubated with NO chelator (cPTIO) showed that C1q-mediated migration was associated to NO production. Of interest, by using anti-HmC1q antibodies, HmC1q released in the culture medium was shown to exhibit a similar chemotactic effect on microglial cells as human C1q. In summary, we have identified, for the first time, a molecule homologous to mammalian C1q in leech CNS. Its chemoattractant activity on microglia highlights a new investigation field leading to better understand leech CNS repair mechanisms.
Nishida, Tatsuro; Kaino, Tomohiro; Ikarashi, Ryo; Nakata, Daisuke; Terao, Keiji; Ando, Masahiro; Hamaguchi, Hiro-o.; Kawamukai, Makoto; Yamamoto, Tatsuyuki
2013-09-01
The inclusion complex of coenzyme Q10 (CoQ10) by γ-cyclodextrin (γ-CD), CoQ10-CD complex, was recently developed. The addition of the CoQ10-CD complex recovered the growth of a fission yeast mutant strain, Δdps1, which otherwise cannot grow well due to the lack of coenzyme Q producing ability. However, the oxygen consumption rate of this strain was not restored by the addition of the CoQ10-CD complex. The addition of two other anti-oxidative reagents, glutathione and ascorbic acid, also recovered the growth of the Δdps1 strain as well. These results indicated that the recovery of the growth of Δdps1 was brought about by the anti-oxidative property of CoQ10. The intensity of Raman spectra of Δdps1 at 1602 cm-1, which is prominently observed for the wild type of the fission yeast, was compared between before and after addition of the CoQ10-CD complex. The signal was very weakly observed for Δdps1 and did not increase in intensity by the addition of the CoQ10-CD complex. These results suggested the recovery of the growth of Δdps1 was brought about not by the restoration of respiration function of Δdps1 but by the anti-oxidative property of CoQ10 to result in the decrease in the oxidative stress.
Possible Heavy Tetraquarks qQ(-q-Q), qq(-Q-Q) and qQ(-Q-Q)%可能的qQ(-q-Q),qq(-Q-Q)和qQ(-Q-Q)重四夸克态
Institute of Scientific and Technical Information of China (English)
崔莹; 陈晓林; 邓卫真; 朱世琳
2007-01-01
Assuming X(3872) is a qc-q-c tetraquark and using its mass as input, we perform a schematic study of the masses of possible heavy tetraquarks using the color-magnetic interaction with the flavor symmetry breaking corrections.%假设X(3872)是一个qc(-q-c)四夸克态,并用它的质量作为输入,用具有味对称性破坏的色磁相互作用系统研究了可能的重四夸克态的质量谱.
Scale dependence of open c anti c and b anti b production in the low x region
Energy Technology Data Exchange (ETDEWEB)
Oliveira, E.G. de [Universidade Federal de Santa Catarina, Departamento de Fisica, CFM, C.P. 476, Florianopolis, SC (Brazil); University of Durham, Institute for Particle Physics Phenomenology, Durham (United Kingdom); Martin, A.D. [University of Durham, Institute for Particle Physics Phenomenology, Durham (United Kingdom); Ryskin, M.G. [University of Durham, Institute for Particle Physics Phenomenology, Durham (United Kingdom); NRC Kurchatov Institute, Petersburg Nuclear Physics Institute, St. Petersburg (Russian Federation)
2017-03-15
The 'optimal' factorization scale μ{sub 0} is calculated for open heavy quark production. We find that the optimal value is μ{sub F} = μ{sub 0} ≅ 0.85√(p{sup 2}{sub T}+m{sub Q}{sup 2}); a choice which allows us to resum the double-logarithmic, (α{sub s} ln μ{sup 2}{sub F} ln (1/x)){sup n} corrections (enhanced at LHC energies by large values of ln(1/x)) and to move them into the incoming parton distributions, PDF (x, μ{sub 0}{sup 2}). Besides this result for the single inclusive cross section (corresponding to an observed heavy quark of transverse momentum p{sub T}), we also determined the scale for processes where the acoplanarity can be measured; that is, events where the azimuthal angle between the quark and the antiquark may be determined experimentally. Moreover, we discuss the important role played by the 2 → 2 subprocesses, gg → Q anti Q at NLO and higher orders. In summary, we achieve a better stability of the QCD calculations, so that the data on c anti c and b anti b production can be used to further constrain the gluons in the small x, relatively low scale, domain, where the uncertainties of the global analyses are large at present. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Boucher, Jerome
2011-07-01
Among all possible realizations of quark and antiquark assembly, the nucleon (the proton and the neutron) is the most stable of all hadrons and consequently has been the subject of intensive studies. Mass, shape, radius and more complex representations of its internal structure are measured since several decades using different probes. The proton (spin 1/2) is described by the electric G{sub E} and magnetic G{sub M} form factors which characterise its internal structure. The simplest way to measure the proton form factors consists in measuring the angular distribution of the electron-proton elastic scattering accessing the so-called Space-Like region where q{sup 2}{<=}0. Using the crossed channel anti pp<->e{sup +}e{sup -}, one accesses another kinematical region, the so-called Time-Like region where q{sup 2}>0. However, due to the anti pp <->e{sup +}e{sup -} threshold q{sup 2}{sub th}, only the kinematical domain q{sup 2}>q{sup 2}{sub th}> 0 is available. To access the unphysical region, one may use the anti pp{yields}{pi} {sup circle} e{sup +}e{sup -} reaction where the {pi} {sup circle} takes away a part of the system energy allowing q{sup 2} to be varied between q{sup 2}{sub th} and almost 0. This thesis aims to show the feasibility of such measurements with the anti PANDA detector which will be installed on the new high intensity antiproton ring at the FAIR facility at Darmstadt. To describe the anti pp {yields} {pi} {sup circle} e{sup +}e{sup -} reaction, a Lagrangian based approach is developed. The 5-fold differential cross section is determined and related to linear combinations of hadronic tensors. Under the assumption of one nucleon exchange, the hadronic tensors are expressed in terms of the 2 complex proton electromagnetic form factors. An extraction method which provides an access to the proton electromagnetic form factor ratio R= vertical stroke G{sub E} vertical stroke / vertical stroke G{sub M} vertical stroke and for the first time in an
Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.
da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A
2017-07-01
One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions
Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon
Nouwen, N; Driessen, AJM
2005-01-01
Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.
International Nuclear Information System (INIS)
Becker, R.L.
1987-01-01
Electron transfer between a neutral target and a projectile ion is one of the more interesting and difficult processes to calculate. Experimentally, there is no simple, yet clean, way to measure transfer from a given shell to a given shell. For the case of K to anti K transfer (the bar designating the projectile) an indirect method is common. One measures K-vacancy cross sections for projectiles with ionic charges q=Z, Z-1, and ≤(Z-2). Then with the assumption that the initial anti K electrons are inert, one infers the K 1 to anti K 1 and K 2 to anti K 2 cross sections from linear combinations of the measured cross sections. The postulate that anti K-electrons are inert is brought into doubt by noting that the probability of inverse (anti K to K) transfer is equal by time-reversal invariance to that for K to anti K transfer. An extensive set of such measurements has been reported recently by Hall et al. for the nearly symmetric, strongly interacting systems 17 Cl q+ + 22 Ti. We have performed coupled-channels calculations for these systems and have compared results of various forms of the independent Fermi particle model (IFPM) with and without the assumption that any initially present anti K electron is passive. The passive anti K-electron models provide only a fair approximation to the results of the full IFPM. (orig.)
Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann
2015-01-01
The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.
Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.
Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard
2010-07-01
Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.
2012-01-01
Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433
Abuelezz, Sally A; Hendawy, Nevien; Magdy, Yosra
2017-06-01
Depression is a major health problem in which oxidative stress and inflammation are inextricably connected in its pathophysiology. Coenzyme Q10 (CoQ10) is an important anti-oxidant compound with anti-inflammatory and neuro-protective properties. This study was designed to investigate the hypothesis that CoQ10 by its anti-oxidant and anti-inflammatory potentials can alleviate depressive- like behavior by restoring the balance of the tryptophan catabolites kynurenine/serotonin toward the serotonin pathway by down-regulation of hippocampal indoleamine 2,3-dioxygenase 1 (IDO-1). Depressive-like behavior was induced by chronic unpredictable mild stress (CUMS) protocol including food or water deprivation, cage tilting, reversed light cycle etc. Male Wistar rats were randomly divided into five groups; Control, CUMS, CUMS and CoQ10 (50,100 and 200 mg/kg/day i.p. respectively) groups. CoQ10 effects on different behavioral and biochemical tests were analyzed. CoQ10 showed significant antidepressant efficacy, as evidenced by significantly decreased stress induced changes to forced swimming challenge and open field test, as well as attenuating raised corticosterone level and adrenal glands weight. The anti-oxidant effect of CoQ10 was exhibited by its ability to significantly reduce hippocampal elevated malondialdehyde and 4-hydroxynonenal levels and elevate the reduced glutathione and catalase levels. CoQ10 significantly reduced different pro-inflammatory cytokines levels including interleukin (IL)-1β, IL-2, IL-6 and tumor necrosis factor-α. It suppressed hippocampal IDO-1 and subsequent production of kynurenine and enhanced the hippocampal contents of tryptophan and serotonin. Immunohistochemical analysis revealed that CoQ10 was able to attenuate the elevated microglial CD68 and elevate the astrocyte glial fibrillary acidic protein compared to CUMS group. CoQ10 exhibited antidepressant-like effects on rats exposed to CUMS. This could be attributed to its ability to reduce
Withaferin A Suppresses Anti-apoptotic BCL2, Bcl-xL, XIAP and ...
African Journals Online (AJOL)
apoptotic ... Quantitative real-time polymerase chain reaction (qPCR) was performed using Taq PCR Master ... Keywords: Anti-apoptotic genes, Cervical cancer, Apoptosis, Cell viability, BCL2, .... polyclonal anti-rabbit immunoglobulin HRP-linked.
Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.
The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises
Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M
2015-12-29
Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.
Cen, Xu-Feng; Wang, Jing-Zhi; Zhao, Guo-Ping; Wang, Ying; Wang, Jin
2016-03-18
In the agl3EFGXYZ operon (SCO7167-SCO7162, abbreviated as agl3 operon) of Streptomyces coelicolor M145, agl3EFG genes encode a putative ABC-type carbohydrate transporter. The transcription of this operon has been proved to be repressed by Agl3R (SCO7168), a neighboring GntR-family regulator, and this repression can be released by growth on poor carbon sources. Here in this study, we prove that the transcription of agl3 operon is also directly repressed by GlnR, a central regulator governing the nitrogen metabolism in S. coelicolor. The electrophoretic mobility shift assay (EMSA) employing the agl3 promoter and mixtures of purified recombinant GlnR and Agl3R indicates that GlnR and Agl3R bind to different DNA sequences within the promoter region of agl3 operon, which is further confirmed by the DNase I footprinting assay. As Agl3R and GlnR have been demonstrated to sense the extracellular carbon and nitrogen supplies, respectively, it is hypothesized that the transcription of agl3 operon is stringently governed by the availabilities of extracellular carbon and nitrogen sources. Consistent with the hypothesis, the agl3 operon is further found to be derepressed only under the condition of poor carbon and rich nitrogen supplies, when both regulators are inactivated. It is believed that activation of the expression of agl3 operon may facilitate the absorption of extracellular carbohydrates to balance the ratio of intracellular carbon to nitrogen. Copyright © 2016 Elsevier Inc. All rights reserved.
Jeong, Daun; Yang, Jeongmo; Lee, Soojin; Kim, Borim; Um, Youngsoon; Kim, Youngrok; Ha, Kyoung-Su; Lee, Jinwon
2016-05-18
Klebsiella pneumoniae is known to produce 2,3-butanediol (2,3-BDO), a valuable chemical. In K. pneumoniae, the 2,3-BDO operon (budBAC) is involved in the production of 2,3-BDO. To observe the physiological role of the 2,3-BDO operon in a mixed acid fermentation, we constructed a budBAC-deleted strain (SGSB109). The production of extracellular metabolites, CO2 emission, carbon distribution, and NADH/NAD(+) balance of SGSB109 were compared with the parent strain (SGSB100). When comparing the carbon distribution at 15 hr, four significant differences were observed: in 2,3-BDO biosynthesis, lactate and acetate production (lactate and acetate production increased 2.3-fold and 4.1-fold in SGSB109 compared to SGSB100), CO2 emission (higher in SGSB100), and carbon substrate uptake (higher in SGSB100). Previous studies on the inactivation of the 2,3-BDO operon were focused on the increase of 1,3-propanediol production. Few studies have been done observing the role of 2,3-BDO biosynthesis. This study provides a prime insight into the role of 2,3-BDO biosynthesis of K. pneumoniae.
Evidence of mesoniums in anti pn annihilations and γγ reactions
International Nuclear Information System (INIS)
Liu, K.F.; Li, B.A.
1987-01-01
A new resonance at 1480 MeV with a width of 110 MeV is found in anti pn annihilations in the channel anti pn → π - X 0 (1480) → π - ρ 0 ρ 0 . Its mass, width and spin-parity are shown to be consistent with the ρ 0 ρ 0 enhancement observed in γγ reactions. Together with the suppression in the γγ → ρ + ρ - data which requires the admixture of an isotensor structure, this ρ 0 ρ 0 resonance in anti pn annihilation and γγ reactions and their small ππ branching ratios represent the best evidence yet for the Q 2 Q-bar 2 nature of the mesoniums. A ρ - ρ - resonance in anti pn annihilations which would betray the exotic isotensor nature of the resonance is predicted. (author)
Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander
2015-02-01
Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène
2018-01-22
Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.
Directory of Open Access Journals (Sweden)
Johanna Rintahaka
Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we
Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar
2014-01-01
A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)
Czech Academy of Sciences Publication Activity Database
Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš
2017-01-01
Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016
Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.
2005-01-01
Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons
Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M
2017-01-15
The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize
Study of b anti b production in e+e- annihilation at √s = 29 GeV with the aid of neural networks
International Nuclear Information System (INIS)
Lambert, D.J.; Lawrence Berkeley Lab., CA
1994-11-01
The author presents a measurement of σ(b anti b)/σ(q anti q) in the annihilation process e + e - → q anti q → hadrons at √s = 29 GeV. The analysis is based on 66 pb -1 of data collected between 1984 and 1986 with the TPC/2γ detector at PEP. To identify bottom events, he uses a neural network with inputs that are computed from the 3-momenta of all of the observed charged hadrons in each event. He also presents a study of bias in techniques for measuring inclusive π ± , K ± , and p/anti p production in the annihilation process e + e - → b anti b → hadrons at √s = 29 GeV, using a neural network to identify bottom-quark jets. In this study, charged particles are identified by a simultaneous measurement of momentum and ionization energy loss (dE/dx)
Zhang, Lihong; Liu, Xiaomeng; Li, Xinxin; Chen, Sanfeng
2015-10-01
To investigate the transcription and translation and nitrogenase activity of the nine N2-fixing-gene (nif) operon (nifBHDKENXhesAnifX) of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21 under different conditions. The Paenibacillus nif operon under the control of the T7 promoter is significantly transcribed and effectively translated in E. coli BL21 when grown in medium containing organic N compounds (yeast extract and Tryptone) or NH4+ by using RT-PCR and Western blot analysis. Transcription and translation of foreign nif genes in E. coli are not inhibited by environmental organic or inorganic N compounds or O2. However, contrary to transcription and translation, nitrogenase activity is 4% lower in the recombinant E. coli 78-32 compared to the native Paenibacillus sp. WLY78. The Paenibacillus nif operon under the control of T7 promoter enables E. coli BL21 to synthesize active nitrogenase. This study shows how the nif gene operon can be transferred to non-N2-fixing bacteria or to eukaryotic organelles.
RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.
Lei, Mei G; Lee, Chia Y
2015-12-01
Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation
Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds
Directory of Open Access Journals (Sweden)
Cataldi Angel A
2011-07-01
Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are
Directory of Open Access Journals (Sweden)
Enrico eMuhr
2016-01-01
Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.
Skew cyclic codes over F_q+uF_q+vF_q+uvF_q
Directory of Open Access Journals (Sweden)
Ting Yao
2015-09-01
Full Text Available In this paper, we study skew cyclic codes over the ring $R=F_q+uF_q+vF_q+uvF_q$, where $u^{2}=u,v^{2}=v,uv=vu$, $q=p^{m}$ and $p$ is an odd prime. We investigate the structural properties of skew cyclic codes over $R$ through a decomposition theorem. Furthermore, we give a formula for the number of skew cyclic codes of length $n$ over $R.$
Real forms of complex quantum anti-de-Sitter algebra Uq(Sp(4;C)) and their contraction schemes
International Nuclear Information System (INIS)
Lukierski, J.; Nowicki, A.; Ruegg, H.
1991-01-01
We describe four types of inner involutions of the Cartan-Weyl basis providing (for vertical strokeqvertical stroke=1 and q real) three types of real quantum Lie algebras: U q (O(3, 2)) (quantum D=4 anti-de-Sitter), U q (O(4, 1)) (quantum D=4 de-Sitter) and U q (O(5)). We give also two types of inner involutions of the Cartan-Chevalley basis of U q (Sp(4; C)) which cannot be extended to inner involutions of the Cartan-Weyl basis. We outline twelve contraction schemes for quantum D=4 anti-de-Sitter algebra. All these contractions provide four commuting translation generators, but only two (one for vertical strokeqvertical stroke=1, the second for q real) lead to the quantum Poincare algebra with an undeformed space rotation O(3) subalgebra. (orig.)
Directory of Open Access Journals (Sweden)
Alexander William Eastman
2015-01-01
Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing
Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban
2017-07-17
Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway
Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M
2016-11-08
Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10
2011-01-01
Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to
Hormonal Influence on Coenzyme Q10 Levels in Blood Plasma
Directory of Open Access Journals (Sweden)
Alfredo Pontecorvi
2011-12-01
Full Text Available Coenzyme Q10 (CoQ10, also known as ubiquinone for its presence in all body cells, is an essential part of the cell energy-producing system. However, it is also a powerful lipophilic antioxidant protecting lipoproteins and cell membranes. Due to these two actions, CoQ10 is commonly used in clinical practice in chronic heart failure, male infertility, and neurodegenerative disease. However, it is also taken as an anti-aging substance by healthy people aiming for long-term neuroprotection and by sportsmen to improve endurance. Many hormones are known to be involved in body energy regulation, in terms of production, consumption and dissipation, and their influence on CoQ10 body content or blood values may represent an important pathophysiological mechanism. We summarize the main findings of the literature about the link between hormonal systems and circulating CoQ10 levels. In particular the role of thyroid hormones, directly involved in the regulation of energy homeostasis, is discussed. There is also a link with gonadal and adrenal hormones, partially due to the common biosynthetic pathway with CoQ10, but also to the increased oxidative stress found in hypogonadism and hypoadrenalism.
Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana
2018-04-16
Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for
Q fever outbreak in the terraced vineyards of Lavaux, Switzerland
Directory of Open Access Journals (Sweden)
C. Bellini
2014-07-01
Full Text Available Coxiella burnetii infection (Q fever is a widespread zoonosis with low endemicity in Switzerland, therefore no mandatory public report was required. A cluster of initially ten human cases of acute Q fever infections characterized by prolonged fever, asthenia and mild hepatitis occurred in 2012 in the terraced vineyard of Lavaux. Epidemiological investigations based on patients’ interviews and veterinary investigations included environmental sampling as well as Coxiella-specific serological assay and molecular examinations (real-time PCR in vaginal secretions of suspected sheep. These investigations demonstrated that 43% of sheep carried the bacteria whereas 30% exhibited anti-Coxiella antibodies. Mitigation measures, including limiting human contacts with the flock, hygiene measures, flock vaccination and a public official alert, have permitted the detection of four additional human cases and the avoidance of a much larger outbreak. Since November 2012, mandatory reporting of Q fever to Swiss public health authorities has been reintroduced. A close follow up of human cases will be necessary to identify chronic Q fever.
Directory of Open Access Journals (Sweden)
Astha Agarwal
2013-01-01
Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.
Auranen, M; Nieminen, T; Majuri, S; Vanhala, R; Peltonen, L; Järvelä, I
2000-05-01
The role of genetic factors in the etiology of the autistic spectrum of disorders has clearly been demonstrated. Ten chromosomal regions, on chromosomes 1p, 4p, 6q, 7q, 13q, 15q, 16p, 17q, 19q and 22q have potentially been linked to autism.1-8 We have analyzed these chromosomal regions in a total of 17 multiplex families with autism originating from the isolated Finnish population by pairwise linkage analysis and sib-pair analysis. Mild evidence for putative contribution was found only with the 1p chromosomal region in the susceptibility to autism. Our data suggest that additional gene loci exist for autism which will be detectable in and even restricted to the isolated Finnish population.
Lescat, Mathilde; Reibel, Florence; Pintard, Coralie; Dion, Sara; Glodt, Jérémy; Gateau, Cecile; Launay, Adrien; Ledda, Alice; Cruveiller, Stephane; Cruvellier, Stephane; Tourret, Jérôme; Tenaillon, Olivier
2014-01-01
The Escherichia coli species is divided in phylogenetic groups that differ in their virulence and commensal distribution. Strains belonging to the B2 group are involved in extra-intestinal pathologies but also appear to be more prevalent as commensals among human occidental populations. To investigate the genetic specificities of B2 sub-group, we used 128 sequenced genomes and identified genes of the core genome that showed marked difference between B2 and non-B2 genomes. We focused on the gene and its surrounding region with the strongest divergence between B2 and non-B2, the antiporter gene nhaA. This gene is part of the nhaAR operon, which is in the core genome but flanked by mobile regions, and is involved in growth at high pH and high sodium concentrations. Consistently, we found that a panel of non-B2 strains grew faster than B2 at high pH and high sodium concentrations. However, we could not identify differences in expression of the nhaAR operon using fluorescence reporter plasmids. Furthermore, the operon deletion had no differential impact between B2 and non-B2 strains, and did not result in a fitness modification in a murine model of gut colonization. Nevertheless, sequence analysis and experiments in a murine model of septicemia revealed that recombination in nhaA among B2 strains was observed in strains with low virulence. Finally, nhaA and nhaAR operon deletions drastically decreased virulence in one B2 strain. This effect of nhaAR deletion appeared to be stronger than deletion of all pathogenicity islands. Thus, a population genetic approach allowed us to identify an operon in the core genome without strong effect in commensalism but with an important role in extra-intestinal virulence, a landmark of the B2 strains.
Directory of Open Access Journals (Sweden)
Seung-June Oh
2012-06-01
Full Text Available Purpose Psychometric properties of the overactive bladder questionnaire (OAB-q were recently examined. However, since the cross-cultural adaptation of a non-English version of the OAB-q has never been demonstrated, we evaluated the psychometric properties of a Korean version of the OAB-q in a Korean population with OAB. Methods A prospective cohort study involving 116 women with 58 OAB and 58 control subjects was performed and convergent validity was assessed. Total and subscale OAB-q scores of the control and OAB groups were compared to their sensitivity to score changes before and after administering anti-cholinergic medication for 12 weeks. Short form 36 and King's health questionnaire (KHQ were also used for comparison or correlation. Results Assessment of face validity showed that the Korean version of the OAB-q was reasonable with OAB-q subscale scores being significantly different between the control and patient groups. Significant correlation (range, -0.29 to -0.81 was found between the OAB-q scores and KHQ results for the OAB patients. Cronbach's alpha coefficients (range, 0.77 to 0.95 indicated excellent internal consistency and test-retest analysis involving 35 OAB patients showed that each questions as well as subscale scores were reproducible. Each score of OAB-q also showed statistically significant sensitivity to changes following anti-muscarinic treatment for OAB (n=27, P<0.001 except for social, P=0.059. Conclusions The Korean version of the OAB-q is a valid and reliable instrument to measure outcomes in Korean patients with OAB.
Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari
2012-01-01
The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963
Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin
2013-01-01
The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.
Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S
2012-05-01
The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.
Fetoni, Anna Rita; Piacentini, Roberto; Fiorita, Antonella; Paludetti, Gaetano; Troiani, Diana
2009-02-27
The mitochondrial respiratory chain is a powerful source of reactive oxygen species (ROS) also in noise induced hearing loss (NIHL) and anti-oxidants and free-radicals scavengers have been shown to attenuate the damage. Coenzyme Q(10) (CoQ(10)) or ubiquinone has a bioenergetic role as a component of the mithocondrial respiratory chain, it inhibits mitochondrial lipid peroxidation, inducing ATP production and it is involved in ROS removal and prevention of oxidative stress-induced apoptosis. However the therapeutic application of CoQ(10) is limited by the lack of solubility and poor bio- availability, therefore it is a challenge to improve its water solubility in order to ameliorate the efficacy in tissues and fluids. This study was conducted in a model of acoustic trauma in the guinea pig where the effectiveness of CoQ(10) was compared with a soluble formulation of CoQ(10) (multicomposite CoQ(10) Terclatrate, Q-ter) given intraperitoneally 1 h before and once daily for 3 days after pure tone noise exposure (6 kHz for 1 h at 120 dB SPL). Functional and morphological studies were carried out by measuring auditory brainstem responses, scanning electron microscopy for hair cell loss count, active caspase 3 staining and terminal deoxynucleotidyl transferase-mediated dUTP labelling assay in order to identify initial signs of apoptosis. Treatments decreased active caspase 3 expression and the number of apoptotic cells, but animals injected with Q-ter showed a greater degree of activity in preventing apoptosis and thus in improving hearing. These data confirm that solubility of Coenzyme Q(10) improves the ability of CoQ(10) in preventing oxidative injuries that result from mitochondrial dysfunction.
Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich
2016-05-01
Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.
2016-01-01
The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted
q-bosons and the q-analogue quantized field
International Nuclear Information System (INIS)
Nelson, C.A.
1994-01-01
The q-analogue coherent states |z > q are used to identify physical signatures for the presence of a q-analogue quantized radiation field in the | > q classical limit where |z| is large. In this quantum-optics-like limit, the fractional uncertainties of most physical quantities (momentum, position, amplitude, phase) which characterize the quantum field are O(1). They only vanish as O(1/|z|) when q = 1. However, for the number operator, N, and the N-Hamiltonian for a free q-boson gas, H N = ℎω(N + 1/2), the fractional uncertainties do still approach zero. A signature for q-boson counting statistics is that (ΔN) 2 / → 0 as |z| → ∞. Except for its O(1) fractional uncertainty, the q-generalization of the Hermitian phase operator of Pegg and Barnett, φ q , still exhibits normal classical behavior. The standard number-phase uncertainty-relation, ΔN Δφ q = 1/2, and the approximate commutation relation, [N,φ q ] = i, still hold for the single-mode q-analogue quantized field. So, N and φ q are almost canonically conjugate operators in the |z > q classical limit. The |z > q CS's minimize this uncertainty relation for moderate |z| 2
Exclusive production of pion pairs in γ*γ collisions at Large Q2
International Nuclear Information System (INIS)
Diehl, M.
2000-01-01
The authors perform a QCD analysis of the exclusive production of two mesons in γ*γ collisions in the kinematical domain of large photon virtuality Q and small hadronic invariant mass W. This reaction is dominated by a scale invariant mechanism which factorizes into a perturbative subprocess, γ*γ -> q anti q or γ*γ -> gg, and a generalized two-meson distribution amplitude. The authors develop in detail the phenomenology of this process at e + e - colliders. Using a simple model for the two-pion distribution amplitude, based on its general properties, the authors estimate the cross section for the kinematics accessible at BABAR, BELLE, CLEO and LEP
DEFF Research Database (Denmark)
Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence
2005-01-01
Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...
Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent
2000-01-01
In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...
Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade
Czech Academy of Sciences Publication Activity Database
Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav
2015-01-01
Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015
Purification and crystallization of Phd, the antitoxin of the phd/doc operon
International Nuclear Information System (INIS)
Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy
2010-01-01
The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein
fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.
Khun, H H; Deved, V; Wong, H; Lee, B C
2000-12-01
The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.
Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA
DEFF Research Database (Denmark)
Poulsen, Peter; Jensen, Kaj Frank
1992-01-01
We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...
On the q-exponential of matrix q-Lie algebras
Directory of Open Access Journals (Sweden)
Ernst Thomas
2017-01-01
Full Text Available In this paper, we define several new concepts in the borderline between linear algebra, Lie groups and q-calculus.We first introduce the ring epimorphism r, the set of all inversions of the basis q, and then the important q-determinant and corresponding q-scalar products from an earlier paper. Then we discuss matrix q-Lie algebras with a modified q-addition, and compute the matrix q-exponential to form the corresponding n × n matrix, a so-called q-Lie group, or manifold, usually with q-determinant 1. The corresponding matrix multiplication is twisted under τ, which makes it possible to draw diagrams similar to Lie group theory for the q-exponential, or the so-called q-morphism. There is no definition of letter multiplication in a general alphabet, but in this article we introduce new q-number systems, the biring of q-integers, and the extended q-rational numbers. Furthermore, we provide examples of matrices in suq(4, and its corresponding q-Lie group. We conclude with an example of system of equations with Ward number coeficients.
Directory of Open Access Journals (Sweden)
Mariana Noelia Viale
2014-01-01
Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.
Directory of Open Access Journals (Sweden)
Siyu Wang
2018-04-01
Full Text Available Hydroxycinnamic acid amides (HCAA are the secondary metabolites ubiquitously exist in flowering plants, formed by condensation between hydroxycinnamates and mono or polyamines. HCAA species not only serve multiple functions in plant growth and development, but also exert significant positive effects on human health. In this study, we combined organic synthesis and UPHLC-TripleQ-MS/MS specifically targeting at HCAA species. The method was fully validated with respect to specificity, linearity, intra- and inter-day precision and accuracy, limit of detection (LOD, limit of quantification (LOQ, recovery, and reproducibility. We applied this method to identify and quantify HCAAs from the root barks and leaves of Lycium barbarum. HCAA species were reported in leaves for the first time, and 10 new HCAA species were further identified in root barks in addition to the ones reported in the literature. We also examine anti-inflammatory properties of identified HCAAs species. Seven HCAA compounds had a potent NO inhibitory effect with IC50 as low as 2.381 μM (trans-N-caffeoyl phenethylamine. Our developed method largely improved analytical sensitivity of HCAAs species that potentially contributes to plant metabolomics studies. Keywords: Hydroxycinnamic acid amide, Lycium barbarum, UHPLC-MS/MS, Quantification, Anti-inflammatory
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG
Directory of Open Access Journals (Sweden)
Orlando Díaz-Hernández
2010-07-01
Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.
Díaz-Hernández, Orlando; Santillán, Moisés
2010-01-01
In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.
Heavy-Quark Symmetry Implies Stable Heavy Tetraquark Mesons Q_{i}Q_{j}q[over ¯]_{k}q[over ¯]_{l}.
Eichten, Estia J; Quigg, Chris
2017-11-17
For very heavy quarks Q, relations derived from heavy-quark symmetry predict the existence of novel narrow doubly heavy tetraquark states of the form Q_{i}Q_{j}q[over ¯]_{k}q[over ¯]_{l} (subscripts label flavors), where q designates a light quark. By evaluating finite-mass corrections, we predict that double-beauty states composed of bbu[over ¯]d[over ¯], bbu[over ¯]s[over ¯], and bbd[over ¯]s[over ¯] will be stable against strong decays, whereas the double-charm states ccq[over ¯]_{k}q[over ¯]_{l}, mixed beauty+charm states bcq[over ¯]_{k}q[over ¯]_{l}, and heavier bbq[over ¯]_{k}q[over ¯]_{l} states will dissociate into pairs of heavy-light mesons. Observation of a new double-beauty state through its weak decays would establish the existence of tetraquarks and illuminate the role of heavy color-antitriplet diquarks as hadron constituents.
Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions
Burbank, Lindsey P.; Van Horn, Christopher R.
2017-01-01
The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...
Qin, Tian; Ken-Ichiro, Iida; Ren, Hong Yu; Zhou, Hai Jian; Yoshida, Shin-Ichi
2016-06-01
To understand the mechanism of invasion by Legionella dumoffii. The L. dumoffii strain Tex-KL was mutated using the Tn903 derivative, Tn903dIIlacZ. After screening 799 transposon insertion mutants, we isolated one defective mutant. We then constructed the gene-disrupted mutant, KL16, and studied its invasion of and intracellular growth in HeLa and A549 cells, and in A/J mice survival experiments. The structure of traC-traD operon was analyzed by RT-PCR. The transposon insertion was in a gene homologous to Salmonella typhi traC, which is required for the assembly of F pilin into the mature F pilus structure and for conjugal DNA transmission. Results from RT-PCR suggested that the traC-traD region formed an operon. We found that when the traC gene was disrupted, invasion and intracellular growth of L. dumoffii Tex-KL were impaired in human epithelial cells. When mice were infected by intranasal inoculation with a traC deficient mutant, their survival significantly increased when compared to mice infected with the wild-type strain.. Our results indicated that the traC-traD operon is required for the invasion and intracellular growth abilities of L. dumoffii Tex-KL in epithelial cells. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Study of charged-current ep interactions at Q2 > 200 GeV2 with the ZEUS detector at HERA
International Nuclear Information System (INIS)
Derrick, M.; Krakauer, D.; Magill, S.
1996-06-01
Deep inelastic charged-current reactions have been studied in e + p and e - p collisions at a center of mass energy of about 300 GeV in the kinematic region Q 2 >200 GeV 2 and x>0.006 using the ZEUS detector at HERA. The integrated cross sections for Q 2 >200 GeV 2 are found to be σ e + p→ anti νX =30.3 -4.2-2.6 +5.5+1.6 pb and σ e - p→νX =54.7 -9.8-3.4 +15.9+2.8 pb. Differential cross sections have been measured as functions of the variables x, y and Q 2 . From the measured differential cross sections dσ/dQ 2 , the W boson mass is determined to be M W =79 -7-4 +8+4 GeV. Measured jet rates and transverse energy profiles agree with model predictions. A search for charged-current interactions with a large rapidity gap yielded one candidate event, corresponding to a cross section σ e + p→ anti νX (Q 2 >200 GeV 2 ; η max -0.7 +1.8 ±0.1 pb. (orig.)
q-Virasoro algebra, q-conformal dimensions and free q-superstring
International Nuclear Information System (INIS)
Chaichian, M.
1996-01-01
The commutators of standard Virasoro generators and fields generate various representations of the centreless Virasoro algebra depending on a conformal dimension J of the field in question (J is related to the Bargmann index of SU(1,1) generated by L m , m=0,±1). We introduce the notion of q-conformal dimension for various oscillator realizations of q-deformed Virasoro (super)algebras proposed earlier. We use the field theoretical approach introduced recently in which the q-Virasoro currents L α (z) are expressed as Schwinger-like point-split normally ordered quadratic expressions in elementary fields. We extend this approach and probe the elementary fields A(z) (the q-superstring coordinate, momentum and fermionic field) and their powers by the q-Virasoro generators L α m (i.e. we calculate the commutators [L α m ,A(z)]) and show that to all of them can be assigned just the standard non-deformed conformal dimension. (orig.)
Directory of Open Access Journals (Sweden)
Florian Labarrade
2018-01-01
Full Text Available The significance of Coenzyme Q10 (CoQ10 as an anti-oxidant barrier of the skin, as well as a key component in anti-aging strategies for skin care products, has been firmly established. Biosynthesis of CoQ10 in the mitochondria is well known, but there is only limited information on the non-mitochondrial synthesis of CoQ10 in the skin. Recent findings in zebrafish identified that a tumor suppressor, Ubiad1, is also a key enzyme in the non-mitochondrial synthesis of CoQ10. The purpose of this study was to investigate expression of Ubiad1 in human skin, and its implication in the skin’s cutaneous response to oxidative stress. We observed Ubiad1 localization in the epidermis, particularly a subcellular localization in the Golgi apparatus. Ubiad1 modulation by a pentapeptide was associated with an observed reduction in ROS/RNS stresses (−44%/−19% respectively, lipid peroxidation (−25% and preservation of membrane fluidity under stress conditions. Electron microscopy of keratinocytes revealed a significant degree of stimulation of the Golgi complex, as well as significantly improved mitochondrial morphology. Given the importance of CoQ10 in mitigating the visible signs of skin aging, our findings identify Ubiad1 as an essential component of the defensive barriers of the epidermis.
Measurement of K{sup 0}{sub S}, {lambda} and anti {lambda} production at HERA
Energy Technology Data Exchange (ETDEWEB)
Chekanov, S.; Derrick, M.; Magill, S. [Argonne National Laboratory, Argonne, IL (US)] (and others)
2006-12-15
The production of the neutral strange hadrons K{sup 0}{sub S}, {lambda} and anti {lambda} has been measured in ep collisions at HERA using the ZEUS detector. Cross sections, baryon-to-meson ratios, relative yields of strange and charged light hadrons, {lambda} (anti {lambda}) asymmetry and polarization have been measured in three kinematic regions: Q{sup 2}>25 GeV{sup 2}; 5<Q{sup 2}<25 GeV{sup 2}; and in photoproduction (Q{sup 2} {approx_equal}0), in which the presence of two hadronic jets, each with at least 5 GeV transverse energy, was required. The measurements agree in general with Monte Carlo models and are consistent with measurements made at e{sup +}e{sup -} colliders, except for an enhancement of baryon relative to meson production in photoproduction. (orig.)
The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.
Rajagopalan, Ramya; Kroos, Lee
2017-05-15
Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent
Increased complement C1q level marks active disease in human tuberculosis.
Directory of Open Access Journals (Sweden)
Yi Cai
Full Text Available BACKGROUND: Complement functions as an important host defense system and complement C5 and C7 have been implicated in immunopathology of tuberculosis. However, little is known about the role of other complement components in tuberculosis. METHODS: Complement gene expression in peripheral blood mononuclear cells of tuberculosis patients and controls were determined using whole genome transcriptional microarray assays. The mRNA and protein levels of three C1q components, C1qA, C1qB, and C1qC, were further validated by qRT-PCR and enzyme-linked immunosorbent assay, respectively. The percentages of C1q expression in CD14 positive cells were determined by flow cytometry. Finally, C1qC protein level was quantified in the pleural fluid of tuberculosis and non-tuberculosis pleurisy. RESULTS: C1q expression increases significantly in the peripheral blood of patients with active tuberculosis compared to healthy controls and individuals with latent TB infection. The percentage of C1q-expressing CD14 positive cells is significantly increased in active TB patients. C1q expression in the peripheral blood correlates with sputum smear positivity in tuberculosis patients and is reduced after anti-tuberculosis chemotherapy. Notably, receiver operating characteristic analysis showed that C1qC mRNA levels in peripheral blood efficiently discriminate active from latent tuberculosis infection and healthy controls. Additionally, C1qC protein level in pleural effusion shows improved power in discriminating tuberculosis from non-tuberculosis pleurisy when compared to other inflammatory markers, such as IL-6 and TNF-α. CONCLUSIONS: C1q expression correlates with active disease in human tuberculosis. C1q could be a potential diagnostic marker to discriminate active tuberculosis from latent tuberculosis infection as well as tuberculosis pleurisy from non-tuberculosis pleurisy.
A study of b anti b production in e+e- collisions at √(s)=130 -207 GeV
International Nuclear Information System (INIS)
Abdallah, J.; Antilogus, P.; Augustin, J.E.; Baubillier, M.; Berggren, M.; Da Silva, W.; Kapusta, F.; Savoy-Navarro, A.; Abreu, P.; Andringa, S.; Anjos, N.; Castro, N.; Espirito Santo, M.C.; Goncalves, P.; Moreno, S.; Onofre, A.; Peralta, L.; Pimenta, M.; Tome, B.; Veloso, F.; Adam, W.; Buschbeck, B.; Leder, G.; Liko, D.; MacNaughton, J.; Mandl, F.; Mitaroff, W.; Strauss, J.; Adzic, P.; Fanourakis, G.; Kokkinias, P.; Loukas, D.; Markou, A.; Mastroyiannopoulos, N.; Nassiakou, M.; Tzamarias, S.; Zupan, M.; Albrecht, T.; Allmendinger, T.; Apel, W.D.; Boer, W. de; Feindt, M.; Haag, C.; Hauler, F.; Hennecke, M.; Jungermann, L.; Kerzel, U.; Moch, M.; Rehn, J.; Sander, C.; Stanitzki, M.; Weiser, C.; Alemany-Fernandez, R.; Ask, S.; Augustinus, A.; Baillon, P.; Battaglia, M.; Camporesi, T.; Carena, F.; Charpentier, P.; Chierici, R.; Chudoba, J.; Chung, S.U.; Collins, P.; Elsing, M.; Foeth, H.; Gavillet, P.; Holt, P.J.; Joram, C.; Kjaer, N.J.; Marin, J.C.; Mariotti, C.; Pape, L.; Parzefall, U.; Piotto, E.; Poireau, V.; Rebecchi, P.; Schwickerath, U.; Spassov, T.; Treille, D.; Van Eldik, J.; Van Vulpen, I.; Wicke, D.; Allport, P.P.; Booth, P.S.L.; Bowcock, T.J.V.; Houlden, M.A.; Jackson, J.N.; King, B.T.; Mc Nulty, R.; Palacios, J.P.; Tobin, M.; Washbrook, A.J.; Amaldi, U.; Bonesini, M.; Calvi, M.; Matteuzzi, C.; Paganoni, M.; Pullia, A.; Tabarelli, T.; Tonazzo, A.; Amapane, N.; De Maria, N.; Migliore, E.; Romero, A.; Amato, S.; Silva, T. da; Paula, L. de; Gandelman, M.; Lopes, J.H.; Marechal, B.; Moraes, D.; Anashkin, E.; Checchia, P.; De Min, A.; Margoni, M.; Mazzucato, F.; Mazzucato, M.; Ronchese, P.; Andreazza, A.; Meroni, C.; Troncon, C.; Vegni, G.; Arnoud, Y.; Berat, C.; Ledroit, F.; Asman, B.; Holmgren, S.O.; Johansson, E.K.; Leinonen, L.; Lipniacka, A.; Moa, T.; Ballestrero, A.; Bambade, P.; Ben-Haim, E.; Bouquet, B.; Cosme, G.; Fulda-Quenzer, F.; Grosdidier, G.; Lepeltier, V.; Richard, F.; Roudeau, P.; Stocchi, A.; Barbier, R.; Jonsson, P.; Katsanevas, S.; Smadja, G.; Verdier, P.; Bardin, D.; Boyko, I.; Kouznetsov, O.; Krumstein, Z.; Olshevski, A.; Pozdniakov, V.; Pukhaeva, N.; Sadovsky, A.; Sisakian, A.; Tkatchev, L.; Tyapkin, I.A.; Tyapkin, P.; Zhuravlov, V.; Zimin, N.I.; Zintchenko, A.; Barker, G.J.; Baroncelli, A.; Di Simone, A.; Graziani, E.; Passeri, A.; Pieri, L.; Becks, K.H.; Behrmann, A.; Buschmann, P.; Drees, J.; Flagmeyer, U.; Hamacher, K.; Liebig, W.; Malek, A.; Mueller, U.; Muenich, K.; Passon, O.; Reinhardt, R.; Siebel, M.; Wahlen, H.; Begalli, M.; Mundim, L.; Benekos, N.; Fokitis, E.; Gazis, E.; Katsoufis, E.; Maltezos, S.; Papadopoulou, T.D.; Benvenuti, A.; Cavallo, F.; Navarria, F.; Paiano, S.; Perrotta, A.; Rovelli, T.; Valenti, G.; Bertrand, D.; D'Hondt, J.; Clercq, C. de; Lemonne, J.; Wickens, J.; Besancon, M.; Besson, N.; Boonekamp, M.; Jarry, P.; Lutz, P.; Nicolaidou, R.; Ouraou, A.; Pierre, F.; Ruhlmann-Kleider, V.; Turluer, M.L.; Vilanova, D.; Bloch, D.; Winter, M.; Blom, M.; Kluit, P.; Montenegro, J.; Mulders, M.; Reid, D.; Timmermans, J.; Dam, P. van; Bluj, M.; Doroba, K.; Grzelak, K.; Hoffman, J.; Nawrocki, K.; Sosnowski, R.; Szczekowski, M.; Szeptycka, M.; Trochimczuk, M.; Zalewski, P.; Borisov, G.; Sopczak, A.; Botner, O.; Brenner, R.; Ekelof, T.; Ellert, M.; Hallgren, A.; Tegenfeldt, F.; Bracko, M.; Kernel, G.; Brodet, E.; Hamilton, K.; Jeans, D.; Lyons, L.; Myatt, G.; Radojicic, D.; Renton, P.; Wilkinson, G.; Bruckman, P.; Cieslik, K.; Kucharczyk, M.; Lesiak, T.; Palka, H.; Polok, G.; Witek, M.; Zalewska, A.; Brunet, J.M.; Tristram, G.; Canale, V.; Di Ciaccio, L.; Verzi, V.
2009-01-01
Measurements are presented of R b , the ratio of the b anti b cross-section to the q anti q cross-section in e + e - collisions, and the forward-backward asymmetry A FB b at twelve energy points in the range √(s)=130-07 GeV. These results are found to be consistent with the Standard Model expectations. The measurements are used to set limits on new physics scenarios involving contact interactions. (orig.) 2
Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.
2015-01-01
ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans
Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G
2015-08-01
In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop
DEFF Research Database (Denmark)
Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.
2011-01-01
Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...
q-Sumudu transforms of q-analogues of Bessel functions.
Uçar, Faruk
2014-01-01
The main purpose of this paper is to evaluate q-Sumudu transforms of a product of q-Bessel functions. Interesting special cases of theorems are also discussed. Further, the results proved in this paper may find certain applications of q-Sumudu transforms to the solutions of the q-integrodifferential equations involving q-Bessel functions. The results may help to extend the q-theory of orthogonal functions.
Michael, Victoria; Frank, Oliver; Bartling, Pascal; Scheuner, Carmen; Göker, Markus; Brinkmann, Henner; Petersen, Jörn
2016-10-01
Alphaproteobacteria of the metabolically versatile Roseobacter group (Rhodobacteraceae) are abundant in marine ecosystems and represent dominant primary colonizers of submerged surfaces. Motility and attachment are the prerequisite for the characteristic 'swim-or-stick' lifestyle of many representatives such as Phaeobacter inhibens DSM 17395. It has recently been shown that plasmid curing of its 65-kb RepA-I-type replicon with >20 genes for exopolysaccharide biosynthesis including a rhamnose operon results in nearly complete loss of motility and biofilm formation. The current study is based on the assumption that homologous biofilm plasmids are widely distributed. We analyzed 33 roseobacters that represent the phylogenetic diversity of this lineage and documented attachment as well as swimming motility for 60% of the strains. All strong biofilm formers were also motile, which is in agreement with the proposed mechanism of surface attachment. We established transposon mutants for the four genes of the rhamnose operon from P. inhibens and proved its crucial role in biofilm formation. In the Roseobacter group, two-thirds of the predicted biofilm plasmids represent the RepA-I type and their physiological role was experimentally validated via plasmid curing for four additional strains. Horizontal transfer of these replicons was documented by a comparison of the RepA-I phylogeny with the species tree. A gene content analysis of 35 RepA-I plasmids revealed a core set of genes, including the rhamnose operon and a specific ABC transporter for polysaccharide export. Taken together, our data show that RepA-I-type biofilm plasmids are essential for the sessile mode of life in the majority of cultivated roseobacters.
Exclusive production of pion pairs in {gamma}*{gamma} collisions at Large Q{sup 2}
Energy Technology Data Exchange (ETDEWEB)
Diehl, M.
2000-03-15
The authors perform a QCD analysis of the exclusive production of two mesons in {gamma}*{gamma} collisions in the kinematical domain of large photon virtuality Q and small hadronic invariant mass W. This reaction is dominated by a scale invariant mechanism which factorizes into a perturbative subprocess, {gamma}*{gamma} {r{underscore}arrow} q{anti q} or {gamma}*{gamma} {r{underscore}arrow} gg, and a generalized two-meson distribution amplitude. The authors develop in detail the phenomenology of this process at e{sup +}e{sup {minus}} colliders. Using a simple model for the two-pion distribution amplitude, based on its general properties, the authors estimate the cross section for the kinematics accessible at BABAR, BELLE, CLEO and LEP.
Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim
2014-01-01
The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432
Properties of ΣQ*, ΞQ* and ΩQ* heavy baryons in cold nuclear matter
Azizi, K.; Er, N.
2018-02-01
The in-medium properties of the heavy spin-3/2 ΣQ*, ΞQ* and ΩQ* baryons with Q being b or c quark are investigated. The shifts in some spectroscopic parameters of these particles due to the saturated cold nuclear matter are calculated. The variations of those parameters with respect to the changes in the density of the cold nuclear medium are studied, as well. It is observed that the parameters of ΣQ* baryons are considerably affected by the nuclear matter compared to the ΞQ* and ΩQ* particles that roughly do not see the medium. The results obtained may be used in analyses of the data to be provided by the in-medium experiments like PANDA.
New molecular settings to support in vivo anti-malarial assays.
Bahamontes-Rosa, Noemí; Alejandre, Ane Rodriguez; Gomez, Vanesa; Viera, Sara; Gomez-Lorenzo, María G; Sanz-Alonso, Laura María; Mendoza-Losana, Alfonso
2016-03-08
Quantitative real-time PCR (qPCR) is now commonly used as a method to confirm diagnosis of malaria and to differentiate recrudescence from re-infection, especially in clinical trials and in reference laboratories where precise quantification is critical. Although anti-malarial drug discovery is based on in vivo murine efficacy models, use of molecular analysis has been limited. The aim of this study was to develop qPCR as a valid methodology to support pre-clinical anti-malarial models by using filter papers to maintain material for qPCR and to compare this with traditional methods. FTA technology (Whatman) is a rapid and safe method for extracting nucleic acids from blood. Peripheral blood samples from mice infected with Plasmodium berghei, P. yoelii, or P. falciparum were kept as frozen samples or as spots on FTA cards. The extracted genetic material from both types of samples was assessed for quantification by qPCR using sets of specific primers specifically designed for Plasmodium 18S rRNA, LDH, and CytB genes. The optimal conditions for nucleic acid extraction from FTA cards and qPCR amplification were set up, and were confirmed to be suitable for parasite quantification using DNA as template after storage at room temperature for as long as 26 months in the case of P. berghei samples and 52 months for P. falciparum and P. yoelii. The quality of DNA extracted from the FTA cards for gene sequencing and microsatellite amplification was also assessed. This is the first study to report the suitability of FTA cards and qPCR assay to quantify parasite load in samples from in vivo efficacy models to support the drug discovery process.
Mitochondria-targeted antioxidant SkQ1 improves impaired dermal wound healing in old mice.
Demyanenko, Ilya A; Popova, Ekaterina N; Zakharova, Vlada V; Ilyinskaya, Olga P; Vasilieva, Tamara V; Romashchenko, Valeria P; Fedorov, Artem V; Manskikh, Vasily N; Skulachev, Maxim V; Zinovkin, Roman A; Pletjushkina, Olga Yu; Skulachev, Vladimir P; Chernyak, Boris V
2015-07-01
The process of skin wound healing is delayed or impaired in aging animals. To investigate the possible role of mitochondrial reactive oxygen species (mtROS) in cutaneous wound healing of aged mice, we have applied the mitochondria-targeted antioxidant SkQ1. The SkQ1 treatment resulted in accelerated resolution of the inflammatory phase, formation of granulation tissue, vascularization and epithelization of the wounds. The wounds of SkQ1-treated mice contained increased amount of myofibroblasts which produce extracellular matrix proteins and growth factors mediating granulation tissue formation. This effect resembled SkQ1-induced differentiation of fibroblasts to myofibroblast, observed earlierin vitro. The Transforming Growth Factor beta (TGFb) produced by SkQ1-treated fibroblasts was found to stimulated motility of endothelial cells in vitro, an effect which may underlie pro-angiogenic action of SkQ1 in the wounds. In vitro experiments showed that SkQ1 prevented decomposition of VE-cadherin containing contacts and following increase in permeability of endothelial cells monolayer, induced by pro-inflammatory cytokine TNF. Prevention of excessive reaction of endothelium to the pro-inflammatory cytokine(s) might account for anti-inflammatory effect of SkQ1. Our findings point to an important role of mtROS in pathogenesis of age-related chronic wounds.
The Possible Heavy Tetraquarks $qQ\\bar q \\bar Q$, $qq\\bar Q \\bar Q$ and $qQ\\bar Q \\bar Q$
Cui, Ying; Chen, Xiao-Lin; Deng, Wei-Zhen; Zhu, Shi-Lin
2006-01-01
Assuming X(3872) is a $qc \\bar q \\bar c$ tetraquark and using its mass as input, we perform a schematic study of the masses of possible heavy tetraquarks using the color-magnetic interaction with the flavor symmetry breaking corrections.
Directory of Open Access Journals (Sweden)
Ziqing eDeng
2013-07-01
Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.
Charged Q-ball dark matter from B and L direction
Energy Technology Data Exchange (ETDEWEB)
Hong, Jeong-Pyong; Kawasaki, Masahiro [Institute for Cosmic Ray Research, The University of Tokyo,5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8582 (Japan); Kavli IPMU (WPI), UTIAS, The University of Tokyo,5-1-5 Kashiwanoha, Kashiwa, 277-8583 (Japan); Yamada, Masaki [Institute for Cosmic Ray Research, The University of Tokyo,5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8582 (Japan); Kavli IPMU (WPI), UTIAS, The University of Tokyo,5-1-5 Kashiwanoha, Kashiwa, 277-8583 (Japan); Department of Physics, Tohoku University,Sendai, Miyagi 980-8578 (Japan)
2016-08-24
We consider nearly equal number of gauge mediation type charged (anti-) Q-balls with charge of ±α{sup −1}≃±137 well before the BBN epoch and discussed how they evolve in time. We found that ion-like objects with electric charges of +O(1) are likely to become relics in the present universe, which we expect to be the dark matter. These are constrained by MICA experiment, where the trail of heavy atom-like or ion-like object in 10{sup 9} years old ancient mica crystals is not observed. We found that the allowed region for gauge mediation model parameter and reheating temperature have to be smaller than the case of the neutral Q-ball dark matter.
Discrete q-derivatives and symmetries of q-difference equations
Energy Technology Data Exchange (ETDEWEB)
Levi, D [Dipartimento di Fisica, Universita Roma Tre and INFN-Sezione di Roma Tre, Via della Vasca Navale 84, 00146 Rome (Italy); Negro, J [Departamento de FIsica Teorica, Universidad de Valladolid, E-47011, Valladolid (Spain); Olmo, M A del [Departamento de FIsica Teorica, Universidad de Valladolid, E-47011, Valladolid (Spain)
2004-03-12
In this paper we extend the umbral calculus, developed to deal with difference equations on uniform lattices, to q-difference equations. We show that many properties considered for shift invariant difference operators satisfying the umbral calculus can be implemented to the case of the q-difference operators. This q-umbral calculus can be used to provide solutions to linear q-difference equations and q-differential delay equations. To illustrate the method, we will apply the obtained results to the construction of symmetry solutions for the q-heat equation.
DEFF Research Database (Denmark)
Eberl, Leo; Sternberg, Claus; Givskov, Michael Christian
1994-01-01
specific sites situated in the promoter region of the parCBA operon. The two ParA proteins that are produced as a result of independent translation initiation at two different start codons within the same open reading frame were overexpressed in Escherichia coli and partially purified. Both forms...
Functional differential equations for the q-Fourier transform of q-Gaussians
International Nuclear Information System (INIS)
Umarov, S; Queiros, S M Duarte
2010-01-01
In this paper the question 'is the q-Fourier transform of a q-Gaussian a q'-Gaussian (with some q') up to a constant factor?' is studied for the whole range of q in (- infty, 3). This question is connected with applicability of the q-Fourier transform in the study of limit processes in nonextensive statistical mechanics. Using the functional differential equation approach we prove that the answer is affirmative if and only if 1 ≤ q < 3, excluding two particular cases of q < 1, namely q=1/2 and q=2/3. Complementarily, we discuss some applications of the q-Fourier transform to nonlinear partial differential equations such as the porous medium equation.
Functional differential equations for the q-Fourier transform of q-Gaussians
Energy Technology Data Exchange (ETDEWEB)
Umarov, S [Department of Mathematics, Tufts University, Medford, MA (United States); Queiros, S M Duarte, E-mail: sdqueiro@gmail.co [Unilever R and D Port Sunlight, Quarry Road East, Wirral, CH63 3JW (United Kingdom)
2010-02-05
In this paper the question 'is the q-Fourier transform of a q-Gaussian a q'-Gaussian (with some q') up to a constant factor?' is studied for the whole range of q in (- infty, 3). This question is connected with applicability of the q-Fourier transform in the study of limit processes in nonextensive statistical mechanics. Using the functional differential equation approach we prove that the answer is affirmative if and only if 1 <= q < 3, excluding two particular cases of q < 1, namely q=1/2 and q=2/3. Complementarily, we discuss some applications of the q-Fourier transform to nonlinear partial differential equations such as the porous medium equation.
q-Deformed KP Hierarchy and q-Deformed Constrained KP Hierarchy
He, Jingsong; Li, Yinghua; Cheng, Yi
2006-01-01
Using the determinant representation of gauge transformation operator, we have shown that the general form of $au$ function of the $q$-KP hierarchy is a $q$-deformed generalized Wronskian, which includes the $q$-deformed Wronskian as a special case. On the basis of these, we study the $q$-deformed constrained KP ($q$-cKP) hierarchy, i.e. $l$-constraints of $q$-KP hierarchy. Similar to the ordinary constrained KP (cKP) hierarchy, a large class of solutions of $q$-cKP hierarchy can be represent...
Measurement of K0S, Λ and anti Λ production at HERA
International Nuclear Information System (INIS)
Chekanov, S.; Derrick, M.; Magill, S.
2006-12-01
The production of the neutral strange hadrons K 0 S , Λ and anti Λ has been measured in ep collisions at HERA using the ZEUS detector. Cross sections, baryon-to-meson ratios, relative yields of strange and charged light hadrons, Λ (anti Λ) asymmetry and polarization have been measured in three kinematic regions: Q 2 >25 GeV 2 ; 5 2 2 ; and in photoproduction (Q 2 ≅0), in which the presence of two hadronic jets, each with at least 5 GeV transverse energy, was required. The measurements agree in general with Monte Carlo models and are consistent with measurements made at e + e - colliders, except for an enhancement of baryon relative to meson production in photoproduction. (orig.)
Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model
Cao, Xin; Song, Yongli; Zhang, Tonghua
In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.
Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P
2000-10-01
Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.
An improved Q estimation approach: the weighted centroid frequency shift method
Li, Jingnan; Wang, Shangxu; Yang, Dengfeng; Dong, Chunhui; Tao, Yonghui; Zhou, Yatao
2016-06-01
Seismic wave propagation in subsurface media suffers from absorption, which can be quantified by the quality factor Q. Accurate estimation of the Q factor is of great importance for the resolution enhancement of seismic data, precise imaging and interpretation, and reservoir prediction and characterization. The centroid frequency shift method (CFS) is currently one of the most commonly used Q estimation methods. However, for seismic data that contain noise, the accuracy and stability of Q extracted using CFS depend on the choice of frequency band. In order to reduce the influence of frequency band choices and obtain Q with greater precision and robustness, we present an improved CFS Q measurement approach—the weighted CFS method (WCFS), which incorporates a Gaussian weighting coefficient into the calculation procedure of the conventional CFS. The basic idea is to enhance the proportion of advantageous frequencies in the amplitude spectrum and reduce the weight of disadvantageous frequencies. In this novel method, we first construct a Gauss function using the centroid frequency and variance of the reference wavelet. Then we employ it as the weighting coefficient for the amplitude spectrum of the original signal. Finally, the conventional CFS is adopted for the weighted amplitude spectrum to extract the Q factor. Numerical tests of noise-free synthetic data demonstrate that the WCFS is feasible and efficient, and produces more accurate results than the conventional CFS. Tests for noisy synthetic data indicate that the new method has better anti-noise capability than the CFS. The application to field vertical seismic profile (VSP) data further demonstrates its validity5.
Bose-Einstein correlation and Q-υKυ(Q) distribution
International Nuclear Information System (INIS)
Dai Qirun; Zhao Shusong
1995-01-01
Bose-Einstein correlation is one of the most useful means to study the source emitting hadrons. Based on the non-perturbative theory of quantum fields, we have proposed a kind of source distribution, i.e., the Q -υ K υ (Q) distribution, which is applied to calculate single inclusion distribution of P // , P perpecular , N, Y and the correlation with each other, i.e., Seagull effect. The results have a better approximation to the corresponding experimental data. The paper emphasizes the calculation of Bose-Einstein correlation for inclusive two particle based on the Q -υ K υ (Q) distribution. The fitted curves agree with experimental data, especially, in the small Q range. The Q -υ K υ (Q) distribution is a more advanced theory as compared with Gauss source and K-P source distribution
Vanderlinde, Elizabeth M.; Magnus, Samantha A.; Tambalo, Dinah D.; Koval, Susan F.; Yost, Christopher K.
2011-01-01
The bacterial cell envelope is of critical importance to the function and survival of the cell; it acts as a barrier against harmful toxins while allowing the flow of nutrients into the cell. It also serves as a point of physical contact between a bacterial cell and its host. Hence, the cell envelope of Rhizobium leguminosarum is critical to cell survival under both free-living and symbiotic conditions. Transposon mutagenesis of R. leguminosarum strain 3841 followed by a screen to isolate mutants with defective cell envelopes led to the identification of a novel conserved operon (RL3499-RL3502) consisting of a putative moxR-like AAA+ ATPase, a hypothetical protein with a domain of unknown function (designated domain of unknown function 58), and two hypothetical transmembrane proteins. Mutation of genes within this operon resulted in increased sensitivity to membrane-disruptive agents such as detergents, hydrophobic antibiotics, and alkaline pH. On minimal media, the mutants retain their rod shape but are roughly 3 times larger than the wild type. On media containing glycine or peptides such as yeast extract, the mutants form large, distorted spheres and are incapable of sustained growth under these culture conditions. Expression of the operon is maximal during the stationary phase of growth and is reduced in a chvG mutant, indicating a role for this sensor kinase in regulation of the operon. Our findings provide the first functional insight into these genes of unknown function, suggesting a possible role in cell envelope development in Rhizobium leguminosarum. Given the broad conservation of these genes among the Alphaproteobacteria, the results of this study may also provide insight into the physiological role of these genes in other Alphaproteobacteria, including the animal pathogen Brucella. PMID:21357485
Goh, Yong Jun; Klaenhammer, Todd R
2013-01-01
Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596
Coenzyme Q10 production in plants: current status and future prospects.
Parmar, Sanjay Singh; Jaiwal, Anjali; Dhankher, Om Parkash; Jaiwal, Pawan K
2015-06-01
Coenzyme Q10 (CoQ10) or Ubiquinone10 (UQ10), an isoprenylated benzoquinone, is well-known for its role as an electron carrier in aerobic respiration. It is a sole representative of lipid soluble antioxidant that is synthesized in our body. In recent years, it has been found to be associated with a range of patho-physiological conditions and its oral administration has also reported to be of therapeutic value in a wide spectrum of chronic diseases. Additionally, as an antioxidant, it has been widely used as an ingredient in dietary supplements, neutraceuticals, and functional foods as well as in anti-aging creams. Since its limited dietary uptake and decrease in its endogenous synthesis in the body with age and under various diseases states warrants its adequate supply from an external source. To meet its growing demand for pharmaceutical, cosmetic and food industries, there is a great interest in the commercial production of CoQ10. Various synthetic and fermentation of microbial natural producers and their mutated strains have been developed for its commercial production. Although, microbial production is the major industrial source of CoQ10 but due to low yield and high production cost, other cost-effective and alternative sources need to be explored. Plants, being photosynthetic, producing high biomass and the engineering of pathways for producing CoQ10 directly in food crops will eliminate the additional step for purification and thus could be used as an ideal and cost-effective alternative to chemical synthesis and microbial production of CoQ10. A better understanding of CoQ10 biosynthetic enzymes and their regulation in model systems like E. coli and yeast has led to the use of metabolic engineering to enhance CoQ10 production not only in microbes but also in plants. The plant-based CoQ10 production has emerged as a cost-effective and environment-friendly approach capable of supplying CoQ10 in ample amounts. The current strategies, progress and constraints of
UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon
International Nuclear Information System (INIS)
Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.
1988-01-01
Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs
q-conformally covariant q-Minkowski space-time and invariant equations
International Nuclear Information System (INIS)
Dobrev, V.K.
1997-09-01
We present explicitly the covariant action of the q-conformal algebra on the q-Minkowski space we proposed earlier. We also present some q-conformally invariant equations, namely a hierarchy of q-Maxwell equations, and also a q-d'Alembert equation, proposed earlier by us, in a form different from the original . (author). 19 refs
Nuryastuti, Titik; van der Mei, Henny C.; Busscher, Henk J.; Kuijer, Roel; Aman, Abu T.; Krom, Bastiaan P.
Phenotypic variation of Staphylococcus epidermidis involving the slime related ica operon results in heterogeneity in surface characteristics of individual bacteria in axenic cultures. Five clinical S. epidermidis isolates demonstrated phenotypic variation, i.e. both black and red colonies on Congo
Directory of Open Access Journals (Sweden)
Rhea U. Vallente-Samonte
2000-09-01
Full Text Available Homologies between chromosome banding patterns and DNA sequences in the great apes and humans suggest an apparent common origin for these two lineages. The availability of DNA probes for specific regions of human chromosomes (5q31, 10q22, 13q32-33 and 19q13.1 led us to cross-hybridize these to chimpanzee (Pan troglodytes, PTR, gorilla (Gorilla gorilla, GGO and orangutan (Pongo pygmaeus, PPY chromosomes in a search for equivalent regions in the great apes. Positive hybridization signals to the chromosome 5q31-specific DNA probe were observed at HSA 5q31, PTR 4q31, GGO 4q31 and PPY 4q31, while fluorescent signals using the chromosome 10q22-specific DNA probe were noted at HSA 10q22, PTR 8q22, GGO 8q22 and PPY 7q22. The chromosome arms showing hybridization signals to the Quint-EssentialTM 13-specific DNA probe were identified as HSA 13q32-33, PTR 14q32-33, GGO 14q32-33 and PPY 14q32-33, while those presenting hybridization signals to the chromosome 19q13.1-specific DNA probe were identified as HSA 19q13.1, PTR 20q13, GGO 20q13 and PPY 20q13. All four probes presumably hybridized to homologous chromosomal locations in the apes, which suggests a homology of certain unique DNA sequences among hominoid species.Homologias entre os padrões de bandamento de cromossomos e seqüências de DNA em grandes macacos e humanos sugerem uma aparente origem comum para estas duas linhagens. A disponibilidade de sondas de DNA para regiões específicas de cromossomos humanos (5q31, 10q22, 13q32-33 e 19q13.1 nos levou a realizar hibridação cruzada com cromossomos de chimpanzé (Pan troglodytes, PTR, gorila (Gorilla gorilla, GGO e orangotango (Pongo pygmaeus, PPY em um pesquisa de regiões equivalentes em grandes macacos. Sinais positivos de hibridação para a sonda de DNA específica para o cromossomo 5q31 foram observados em HSA 5q31, PTR 4q31, GGO 4q31 e PPY 4q31, enquanto que sinais fluorescentes usando a sonda de DNA específica para o cromossomo 10q22 foram
An anti-image interference quadrature IF architecture for satellite receivers
Directory of Open Access Journals (Sweden)
He Weidong
2014-08-01
Full Text Available Since Global Navigation Satellite System (GNSS signals span a wide range of frequency, wireless signals coming from other communication systems may be aliased and appear as image interference. In quadrature intermediate frequency (IF receivers, image aliasing due to in-phase and quadrature (I/Q channel mismatches is always a big problem. I/Q mismatches occur because of gain and phase imbalances between quadrature mixers and capacitor mismatches in analog-to-digital converters (ADC. As a result, the dynamic range and performance of a receiver are severely degraded. In this paper, several popular receiver architectures are summarized and the image aliasing problem is investigated in detail. Based on this analysis, a low-IF architecture is proposed for a single-chip solution and a novel and feasible anti-image algorithm is investigated. With this anti-image digital processing, the image reject ratio (IRR can reach approximately above 50 dB, which relaxes image rejection specific in front-end circuit designs and allows cheap and highly flexible analog front-end solutions. Simulation and experimental data show that the anti-image algorithm can work effectively, robustly, and steadily.
RAPD-PCR analysis of cultured type olives in Turkey | Sesli | African ...
African Journals Online (AJOL)
OP-A, OP-I, OP-Q). A total of 33 primers among 60 Operon random primers (Kit OP-A, OP-I, OP-Q) yielded clear and firm bands. The electrophoretic patterns of olive samples showed that 159 highly polymorphic loci. Averages of 4.81 scorable ...
Role of the Escherichia coli glnALG operon in regulation of ammonium transport
International Nuclear Information System (INIS)
Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.
1986-01-01
Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt
Lugthart, Sanne; Groschel, Stefan; Beverloo, H. Berna; Kayser, Sabine; Valk, Peter J. M.; van Zelderen-Bhola, Shama Lydia; Ossenkoppele, Gert Jan; Vellenga, Edo; van den Berg-de Ruiter, Eva; Schanz, Urs; Verhoef, Gregor; Vandenberghe, Peter; Ferrant, Augustin; Kohne, Claus-Henning; Pfreundschuh, Michael; Horst, Heinz A.; Koller, Elisabeth; von Lilienfeld-Toal, Marie; Bentz, Martin; Ganser, Arnold; Schlegelberger, Brigitte; Jotterand, Martine; Krauter, Jurgen; Pabst, Thomas; Theobald, Matthias; Schlenk, Richard F.; Delwel, Ruud; Dohner, Konstanze; Lowenberg, Bob; Doehner, Hartmut
2010-01-01
Purpose Acute myeloid leukemia (AML) with inv(3)(q21q26.2)/t(3; 3)(q21; q26.2) inv(3)/t(3; 3)] is recognized as a distinctive entity in the WHO classification. Risk assignment and clinical and genetic characterization of AML with chromosome 3q abnormalities other than inv(3)/t(3; 3) remain largely
Virulence and Stress Responses of Shigella flexneri Regulated by PhoP/PhoQ
Directory of Open Access Journals (Sweden)
Zhiwei Lin
2018-01-01
Full Text Available The two-component signal transduction system PhoP/PhoQ is an important regulator for stress responses and virulence in most Gram-negative bacteria, but characterization of PhoP/PhoQ in Shigella has not been thoroughly investigated. In the present study, we found that deletion of phoPQ (ΔphoPQ from Shigella flexneri 2a 301 (Sf301 resulted in a significant decline (reduced by more than 15-fold in invasion of HeLa cells and Caco-2 cells, and less inflammation (− or + compared to Sf301 (+++ in the guinea pig Sereny test. In low Mg2+ (10 μM medium or pH 5 medium, the ΔphoPQ strain exhibited a growth deficiency compared to Sf301. The ΔphoPQ strain was more sensitive than Sf301 to polymyxin B, an important antimicrobial agent for treating multi-resistant Gram-negative infections. By comparing the transcriptional profiles of ΔphoPQ and Sf301 using DNA microarrays, 117 differentially expressed genes (DEGs were identified, which were involved in Mg2+ transport, lipopolysaccharide modification, acid resistance, bacterial virulence, respiratory, and energy metabolism. Based on the reported PhoP box motif [(T/G GTTTA-5nt-(T/G GTTTA], we screened 38 suspected PhoP target operons in S. flexneri, and 11 of them (phoPQ, mgtA, slyB, yoaE, yrbL, icsA, yhiWX, rstA, hdeAB, pagP, and shf–rfbU-virK-msbB2 were demonstrated to be PhoP-regulated genes based on electrophoretic mobility shift assays and β-galactosidase assays. One of these PhoP-regulated genes, icsA, is a well-known virulence factor in S. flexneri. In conclusion, our data suggest that the PhoP/PhoQ system modulates S. flexneri virulence (in an icsA-dependent manner and stress responses of Mg2+, pH and antibacterial peptides.
Salmonella enterica, a bacterial, food-borne pathogen of humans, can contaminate raw fruits and vegetables. Causing much public concern, the bacteria can survive in water used to wash produce. The ability to survive the low-osmolarity of the wash waters is attributed to the OpgGH operon that leads...
Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan
2014-11-01
The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.
Archana, G.; Naresh Kumar, G.
2014-01-01
Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2) transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2) containing artificial oxalate operon (plac-FpOAR-oah) and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp) secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil. PMID:24705024
Directory of Open Access Journals (Sweden)
Kavita Yadav
Full Text Available Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah, Fomitopsis plaustris oxalate transporter (FpOAR and Vitreoscilla hemoglobin (vgb in various combinations. Pf (pKCN2 transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4 secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2 transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2 containing artificial oxalate operon (plac-FpOAR-oah and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil.
Directory of Open Access Journals (Sweden)
Lisa M Starr
Full Text Available Pentachlorophenol (PCP induced expression of the NalC repressor-regulated PA3720-armR operon and the MexR repressor-controlled mexAB-oprM multidrug efflux operon of Pseudomonas aeruginosa. PCP's induction of PA3720-armR resulted from its direct modulation of NalC, the repressor's binding to PA3720-armR promoter-containing DNA as seen in electromobility shift assays (EMSAs being obviated in the presence of this agent. The NalC binding site was localized to an inverted repeat (IR sequence upstream of PA3720-armR and overlapping a promoter region whose transcription start site was mapped. While modulation of MexR by the ArmR anti-repressor explains the upregulation of mexAB-oprM in nalC mutants hyperexpressing PA3720-armR, the induction of mexAB-oprM expression by PCP is not wholly explainable by PCP induction of PA3720-armR and subsequent ArmR modulation of MexR, inasmuch as armR deletion mutants still showed PCP-inducible mexAB-oprM expression. PCP failed, however, to induce mexAB-oprM in a mexR deletion strain, indicating that MexR was required for this, although PCP did not modulate MexR binding to mexAB-oprM promoter-containing DNA in vitro. One possibility is that MexR responds to PCP-generated in vivo effector molecules in controlling mexAB-oprM expression in response to PCP. PCP is an unlikely effector and substrate for NalC and MexAB-OprM--its impact on NalC binding to the PA3720-armR promoter DNA occurred only at high µM levels--suggesting that it mimics an intended phenolic effector/substrate(s. In this regard, plants are an abundant source of phenolic antimicrobial compounds and, so, MexAB-OprM may function to protect P. aeruginosa from plant antimicrobials that it encounters in nature.
International Nuclear Information System (INIS)
Ali, Ahmed; Hambrock, Christian; Ahmed, Ishtiaq; Aslam, M. Jamil
2009-11-01
We study the spectroscopy and dominant decays of the bottomonium-like tetraquarks (bound diquarks-antidiquarks), focusing on the lowest lying P-wave [bq][anti b anti q] states Y [bq] (with q=u,d), having J PC =1 -- . To search for them, we analyse the BABAR data obtained during an energy scan of the e + e - →b anti b cross section in the range of √(s)=10.54 to 11.20 GeV. We find that these data are consistent with the presence of an additional b anti b state Y [bq] with a mass of 10.90 GeV and a width of about 30 MeV apart from the Υ(5S) and Υ(6S) resonances. A closeup of the energy region around the Y [bq] -mass may resolve this state in terms of the two mass eigenstates, Y [b,l] and Y [b,h] , with a mass difference, estimated as about 6 MeV. We tentatively identify the state Y [bq] (10900) from the R b -scan with the state Y b (10890) observed by BELLE in the process e + e - →Y b (10890)→Υ(1S,2S)π + π - due to their proximity in masses and decay widths. (orig.)
Bersanini, Luca; Allahverdiyeva, Yagut; Battchikova, Natalia; Heinz, Steffen; Lespinasse, Maija; Ruohisto, Essi; Mustila, Henna; Nickelsen, Jörg; Vass, Imre; Aro, Eva-Mari
2017-03-01
In Synechocystis sp. PCC 6803, the flv4-2 operon encodes the flavodiiron proteins Flv2 and Flv4 together with a small protein, Sll0218, providing photoprotection for Photosystem II (PSII). Here, the distinct roles of Flv2/Flv4 and Sll0218 were addressed, using a number of flv4-2 operon mutants. In the ∆sll0218 mutant, the presence of Flv2/Flv4 rescued PSII functionality as compared with ∆sll0218-flv2, where neither Sll0218 nor the Flv2/Flv4 heterodimer are expressed. Nevertheless, both the ∆sll0218 and ∆sll0218-flv2 mutants demonstrated deficiency in accumulation of PSII proteins suggesting a role for Sll0218 in PSII stabilization, which was further supported by photoinhibition experiments. Moreover, the accumulation of PSII assembly intermediates occurred in Sll0218-lacking mutants. The YFP-tagged Sll0218 protein localized in a few spots per cell at the external side of the thylakoid membrane, and biochemical membrane fractionation revealed clear enrichment of Sll0218 in the PratA-defined membranes, where the early biogenesis steps of PSII occur. Further, the characteristic antenna uncoupling feature of the ∆flv4-2 operon mutants is shown to be related to PSII destabilization in the absence of Sll0218. It is concluded that the Flv2/Flv4 heterodimer supports PSII functionality, while the Sll0218 protein assists PSII assembly and stabilization, including optimization of light harvesting. © 2016 The Authors. Plant, Cell & Enviroment Published by John Wiley & Sons Ltd.
The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis
Ahn, Sang-Joon; Burne, Robert A.
2006-01-01
The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...
International Nuclear Information System (INIS)
Choi, Hoo-Kyun; Pokharel, Yuba Raj; Lim, Sung Chul; Han, Hyo-Kyung; Ryu, Chang Seon; Kim, Sang Kyum; Kwak, Mi Kyong; Kang, Keon Wook
2009-01-01
Coenzyme Q10 (CoQ10), an endogenous antioxidant, is important in oxidative phosphorylation in mitochondria. It has anti-diabetic and anti-cardiovascular disease effects, but its ability to protect against liver fibrosis has not been studied. Here, we assessed the ability of solubilized CoQ10 to improve dimethylnitrosamine (DMN)-induced liver fibrogenesis in mice. DMN treatments for 3 weeks produced a marked liver fibrosis as assessed by histopathological examination and tissue 4-hydroxyproline content. Solubilized CoQ10 (10 and 30 mg/kg) significantly inhibited both the increases in fibrosis score and 4-hydroxyproline content induced by DMN. Reverse transcription-polymerase chain reaction and Western blot analyses revealed that solubilized CoQ10 inhibited increases in the transforming growth factor-β1 (TGF-β1) mRNA and α-smooth muscle actin (α-SMA) protein by DMN. Interestingly, hepatic glutamate-cysteine ligase (GCL) and glutathione S-transferase A2 (GSTA2) were up-regulated in mice treated with CoQ10. Solubilized CoQ10 also up-regulated antioxidant enzymes such as catalytic subunits of GCL and GSTA2 via activating NF-E2 related factor2 (Nrf2)/antioxidant response element (ARE) in H4IIE hepatoma cells. Moreover, CoQ10's inhibition of α-SMA and TGF-β1 expressions disappeared in Nrf2-null MEF cells. In contrast, Nrf2 overexpression significantly decreased the basal expression levels of α-SMA and TGF-β1 in Nrf2-null MEF cells. These results demonstrated that solubilized CoQ10 inhibited DMN-induced liver fibrosis through suppression of TGF-β1 expression via Nrf2/ARE activation.
Hirooka, Kazutake; Kodoi, Yusuke; Satomura, Takenori; Fujita, Yasutaro
2015-12-28
The Bacillus subtilis rhaEWRBMA (formerly yuxG-yulBCDE) operon consists of four genes encoding enzymes for l-rhamnose catabolism and the rhaR gene encoding a DeoR-type transcriptional regulator. DNase I footprinting analysis showed that the RhaR protein specifically binds to the regulatory region upstream of the rhaEW gene, in which two imperfect direct repeats are included. Gel retardation analysis revealed that the direct repeat farther upstream is essential for the high-affinity binding of RhaR and that the DNA binding of RhaR was effectively inhibited by L-rhamnulose-1-phosphate, an intermediate of L-rhamnose catabolism. Moreover, it was demonstrated that the CcpA/P-Ser-HPr complex, primarily governing the carbon catabolite control in B. subtilis, binds to the catabolite-responsive element, which overlaps the RhaR binding site. In vivo analysis of the rhaEW promoter-lacZ fusion in the background of ccpA deletion showed that the L-rhamnose-responsive induction of the rhaEW promoter was negated by the disruption of rhaA or rhaB but not rhaEW or rhaM, whereas rhaR disruption resulted in constitutive rhaEW promoter activity. These in vitro and in vivo results clearly indicate that RhaR represses the operon by binding to the operator site, which is detached by L-rhamnulose-1-phosphate formed from L-rhamnose through a sequence of isomerization by RhaA and phosphorylation by RhaB, leading to the derepression of the operon. In addition, the lacZ reporter analysis using the strains with or without the ccpA deletion under the background of rhaR disruption supported the involvement of CcpA in the carbon catabolite repression of the operon. Since L-rhamnose is a component of various plant-derived compounds, it is a potential carbon source for plant-associating bacteria. Moreover, it is suggested that L-rhamnose catabolism plays a significant role in some bacteria-plant interactions, e.g., invasion of plant pathogens and nodulation of rhizobia. Despite the physiological
q-Bernoulli numbers and q-Bernoulli polynomials revisited
Directory of Open Access Journals (Sweden)
Kim Taekyun
2011-01-01
Full Text Available Abstract This paper performs a further investigation on the q-Bernoulli numbers and q-Bernoulli polynomials given by Acikgöz et al. (Adv Differ Equ, Article ID 951764, 9, 2010, some incorrect properties are revised. It is point out that the generating function for the q-Bernoulli numbers and polynomials is unreasonable. By using the theorem of Kim (Kyushu J Math 48, 73-86, 1994 (see Equation 9, some new generating functions for the q-Bernoulli numbers and polynomials are shown. Mathematics Subject Classification (2000 11B68, 11S40, 11S80
Directory of Open Access Journals (Sweden)
Silvia Dossena
2013-12-01
Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.
Directory of Open Access Journals (Sweden)
Altenbuchner Josef
2011-10-01
Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on
Yao, Yang; Yang, Xiushi; Shi, Zhenxing; Ren, Guixing
2014-05-01
Quinoa (Chenopodium quinoa Willd.) is a pseudocereal from South Americas that has received increased interest around the world because it is a good source of different nutrients and rich in saponins. However, the saponins in quinoa seeds planted in China were poorly known. We obtained 4 quinoa saponin fractions, Q30, Q50, Q70, and Q90, and 11 saponins were determined by HPLC-MS. Q50 possessed 8 individual saponins and had the highest content of saponins. We further evaluated the anti-inflammatory activity on RAW 264.7 murine macrophage cells of the 4 fractions. The 4 fractions not only dose-dependently decreased the production of inflammatory mediators NO but also inhibited the release of inflammatory cytokines including tumor necrosis factor-α and interleukin-6 in lipopolysaccharide-induced RAW264.7 cells. These results suggest that quinoa saponins may be used as functional food components for prevention and treatment of inflammation. Our findings demonstrate that saponins from the quinoa have the potential to anti-inflammation by suppressing the release of inflammatory cytokines. © 2014 Institute of Food Technologists®
International Nuclear Information System (INIS)
Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.
2011-01-01
Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein
International Nuclear Information System (INIS)
Rao, Pulivarthi H; Murty, Vundavalli VVS; Arias-Pulido, Hugo; Lu, Xin-Yan; Harris, Charles P; Vargas, Hernan; Zhang, Fang F; Narayan, Gopeshwar; Schneider, Achim; Terry, Mary Beth
2004-01-01
Carcinoma of uterine cervix is the second most common cancers among women worldwide. Combined radiation and chemotherapy is the choice of treatment for advanced stages of the disease. The prognosis is poor, with a five-year survival rate ranging from about 20–65%, depending on stage of the disease. Therefore, genetic characterization is essential for understanding the biology and clinical heterogeneity in cervical cancer (CC). We used a genome-wide screening method – comparative genomic hybridization (CGH) to identify DNA copy number changes in 77 patients with cervical cancer. We applied categorical and survival analyses to analyze whether chromosomal changes were related to clinico-pathologic characteristics and patients survival. The CGH analysis revealed a loss of 2q33-q37 (57.1%), gain of 3q (54.5%) and chromosomal amplifications (20.77%) as frequent genetic changes. A total of 15 amplified chromosomal sites were detected in 16 cases that include 1p31, 2q32, 7q22, 8q21.2-q24, 9p22, 10q21, 10q24, 11q13, 11q21, 12q15, 14q12, 17p11.2, 17q22, 18p11.2, and 19q13.1. Recurrent amplified sites were noted at 11q13, 11q21, and 19q13.1. The genomic alterations were further evaluated for prognostic significance in CC patients, and we did not find any correlation with a number of clinical or histological parameters. The tumors harboring HPV18 exhibited higher genomic instability compared to tumors with HPV 16. This study demonstrated that 2q33-q37 deletions, 3q gains and chromosomal amplifications as characteristic changes in invasive CC. These genetic alterations will aid in the identification of novel tumor suppressor gene(s) at 2q33-q37 and oncogenes at amplified chromosomal sites. Molecular characterization of these chromosomal changes utilizing the current genomic technologies will provide new insights into the biology and clinical behavior of CC
Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.
Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S
2006-03-01
Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.
Triply heavy tetraquark states with the $QQ\\bar{Q}\\bar{q}$ configuration
Chen, Kan; Liu, Xiang; Wu, Jing; Liu, Yan-Rui; Zhu, Shi-Lin
2016-01-01
In the framework of the color-magnetic interaction, we systematically investigate the mass splittings of the $QQ\\bar{Q}\\bar{q}$ tetraquark states and estimated their rough masses in this work. These systems include the explicitly exotic states $cc\\bar{b}\\bar{q}$ and $bb\\bar{c}\\bar{q}$ and the hidden exotic states $cc\\bar{c}\\bar{q}$, $cb\\bar{b}\\bar{q}$, $bc\\bar{c}\\bar{q}$, and $bb\\bar{b}\\bar{q}$. If a state around the estimated mass region could be observed, its nature as a genuine tetraquark ...
Li, Yong-Hui; Tan, Yin-Feng; Wei, Na; Zhang, Jun-Qing
2016-01-01
Alpinia oxyphylla fruit (AOF, Yizhi in Chinese) is a well-known traditional Chinese medicine as an anti-diuretic agent and composed of two parts i.e . seed and shell. These two parts have different components, but the bioactivity differences of the two parts are not clear. This study aims to evaluate the different anti-diuretic effects of the seed and shell of AOF. The potential bioactive components were analyzed by UPLC-Q-TOF-MS. The diuretic and anti-diuretic activity was determined with saline-loads rats. The results showed that the 200 mg/kg and 400mg/kg of SREAO displayed a short-time anti-diuretic activity 1h after administration and then a significant diuretic activity was being observed at 5-6 h in 400mg/kg group of SREAO. And the 400mg/kg doses of SREAO also showed a remarkable increase for electrolyte excretion of K + . Three sesquiterpene compounds, namely oxyphyllol A (1), oxyphyllol B (2), and nootkatone (3) were identified from the active SREAO fraction by UHPLC-ESI-Q-TOF/MS. The seed part of Alpinia oxyphylla possessed pronounced diuretic and anti-diuretic effect. The sesquiterpene components are the major constituents and possibly contributed the diuretic and anti-diuretic activity.
Sato, Takuya; Nonoyama, Shouta; Kimura, Akane; Nagata, Yuji; Ohtsubo, Yoshiyuki; Tsuda, Masataka
2017-08-15
Iron and heme play very important roles in various metabolic functions in bacteria, and their intracellular homeostasis is maintained because high concentrations of free forms of these molecules greatly facilitate the Fenton reaction-mediated production of large amounts of reactive oxygen species that severely damage various biomolecules. The ferric uptake regulator (Fur) from Burkholderia multivorans ATCC 17616 is an iron-responsive global transcriptional regulator, and its fur deletant exhibits pleiotropic phenotypes. In this study, we found that the phenotypes of the fur deletant were suppressed by an additional mutation in hemP The transcription of hemP was negatively regulated by Fur under iron-replete conditions and was constitutive in the fur deletant. Growth of a hemP deletant was severely impaired in a medium containing hemin as the sole iron source, demonstrating the important role of HemP in hemin utilization. HemP was required as a transcriptional activator that specifically binds the promoter-containing region upstream of a Fur-repressive hmuRSTUV operon, which encodes the proteins for hemin uptake. A hmuR deletant was still able to grow using hemin as the sole iron source, albeit at a rate clearly lower than that of the wild-type strain. These results strongly suggested (i) the involvement of HmuR in hemin uptake and (ii) the presence in ATCC 17616 of at least part of other unknown hemin uptake systems whose expression depends on the HemP function. Our in vitro analysis also indicated high-affinity binding of HemP to hemin, and such a property might modulate transcriptional activation of the hmu operon. IMPORTANCE Although the hmuRSTUV genes for the utilization of hemin as a sole iron source have been identified in a few Burkholderia strains, the regulatory expression of these genes has remained unknown. Our analysis in this study using B. multivorans ATCC 17616 showed that its HemP protein is required for expression of the hmuRSTUV operon, and the
Directory of Open Access Journals (Sweden)
Keyhani Nemat O
2004-06-01
Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered
Trichinella spiralis Calreticulin Binds Human Complement C1q As an Immune Evasion Strategy.
Zhao, Limei; Shao, Shuai; Chen, Yi; Sun, Ximeng; Sun, Ran; Huang, Jingjing; Zhan, Bin; Zhu, Xinping
2017-01-01
As a multicellular parasitic nematode, Trichinella spiralis regulates host immune responses by producing a variety of immunomodulatory molecules to escape from host immune attack, but the mechanisms underlying the immune evasion are not well understood. Here, we identified that T. spiralis calreticulin ( Ts -CRT), a Ca 2+ -binding protein, facilitated T. spiralis immune evasion by interacting with the first component of human classical complement pathway, C1q. In the present study, Ts -CRT was found to be expressed on the surface of different developmental stages of T. spiralis as well as in the secreted products of adult and muscle larval worms. Functional analysis identified that Ts -CRT was able to bind to human C1q, resulting in the inhibition of C1q-initiated complement classical activation pathway reflected by reduced C4/C3 generation and C1q-dependent lysis of antibody-sensitized sheep erythrocytes. Moreover, recombinant Ts -CRT (r Ts -CRT) binding to C1q suppressed C1q-induced THP-1-derived macrophages chemotaxis and reduced monocyte-macrophages release of reactive oxygen intermediates (ROIs). Blocking Ts -CRT on the surface of newborn larvae (NBL) of T. spiralis with anti- Ts -CRT antibody increased the C1q-mediated adherence of monocyte-macrophages to larvae and impaired larval infectivity. All of these results suggest that T. spiralis -expressed Ts -CRT plays crucial roles in T. spiralis immune evasion and survival in host mostly by directly binding to host complement C1q, which not only reduces C1q-mediated activation of classical complement pathway but also inhibits the C1q-induced non-complement activation of macrophages.
Partial monosomy 8q and partial trisomy 9q due to the maternal translocation t(8;9(q24.3;q34.1)
DEFF Research Database (Denmark)
Tos, T; Alp, M Y; Eker, H K
2014-01-01
Partial trisomy 9q34-qter and partial monosomy 8q24.3-qter are very rare chromosomal abnormalities. Characteristic features of partial trisomy 9q34-qter are hypotonia, developmental delay, mild intellectual disability, dolichocephaly, distinct facial phenotype, long and thin fingers, and cardiac...
Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.
2016-01-01
Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575
DEFF Research Database (Denmark)
Hansen, L. H.; Sørensen, S. J.; Jensen, Lars Bogø
1997-01-01
A 12-kb PstI fragment including the entire E. coli lactose operon (lacIPOZYA) was inserted in one copy into the chromosome of Pseudomonas putida, Pseudomonas fluorescens and an E. coli strain with lac(-) phenotype. This was made possible by improvements of an already existing mini-Tn5 transposon...... flanked by NotI sites needed in the mini-Tn5 delivery system; (b) the generation of E. coli nonlysogenic strains expressing the pi protein thus being capable of maintaining and delivering R6K-based mini-Tn5 vectors to other E. coli strains; (c) the successful insertion of the E. coli lactose operon...... into the P. fluorescens chromosome giving P. fluorescens the ability to grow on lactose; (d) evidence from Southern blotting that contradicts the assumption that the mini-Tn5 delivery system always creates one-copy inserts. These improvements allow insertion of large DNA fragments encoding highly expressed...
Q-phonons, Q-invariants, and company
International Nuclear Information System (INIS)
Brentano, P. von; Gade, A.; Pietralla, N.; Werner, V.
2002-01-01
The paper discusses the concept of Q-phonons and its connection to the concept of Q-invariants and the shape parameters of nuclei. It will also discuss some useful relations between Q-invariants and observables. These relations allow one to determine crucial nuclear observables such as the square of the quadrupole moment of the first 2+ state from lifetime data of the gamma- and ground band which may have applications, in future measurements with rare isotopes beams. These concepts are discussed for the Barium, Xenon and Cerium nuclei with mass numbers around A = 130, because some of these concepts were either introduced or at least heavily used in the discussion of the nuclear structure of these nuclei
q-Space Upsampling Using x-q Space Regularization.
Chen, Geng; Dong, Bin; Zhang, Yong; Shen, Dinggang; Yap, Pew-Thian
2017-09-01
Acquisition time in diffusion MRI increases with the number of diffusion-weighted images that need to be acquired. Particularly in clinical settings, scan time is limited and only a sparse coverage of the vast q -space is possible. In this paper, we show how non-local self-similar information in the x - q space of diffusion MRI data can be harnessed for q -space upsampling. More specifically, we establish the relationships between signal measurements in x - q space using a patch matching mechanism that caters to unstructured data. We then encode these relationships in a graph and use it to regularize an inverse problem associated with recovering a high q -space resolution dataset from its low-resolution counterpart. Experimental results indicate that the high-resolution datasets reconstructed using the proposed method exhibit greater quality, both quantitatively and qualitatively, than those obtained using conventional methods, such as interpolation using spherical radial basis functions (SRBFs).
International Nuclear Information System (INIS)
Ogievetsky, O.; Schmidke, W.B.; Wess, J.; Muenchen Univ.; Zumino, B.; Lawrence Berkeley Lab., CA
1992-01-01
The q-differential calculus for the q-Minkowski space is developed. The algebra of the q-derivatives with the q-Lorentz generators is found giving the q-deformation of the Poincare algebra. The reality structure of the q-Poincare algebra is given. The reality structure of the q-differentials is also found. The real Laplaacian is constructed. Finally the comultiplication, counit and antipode for the q-Poincare algebra are obtained making it a Hopf algebra. (orig.)
Directory of Open Access Journals (Sweden)
Bianca Schwartbeck
2016-11-01
Full Text Available Cystic fibrosis (CF is associated with chronic bacterial airway infections leading to lung insufficiency and decreased life expectancy. Staphylococcus aureus is one of the most prevalent pathogens isolated from the airways of CF patients. Mucoid colony morphology has been described for Pseudomonas aeruginosa, the most common pathogen in CF, but not for S. aureus. From the airways of 8 of 313 CF patients (2.5% mucoid S. aureus isolates (n = 115 were cultured with a mean persistence of 29 months (range 1 month, 126 months. In contrast to non-mucoid S. aureus, mucoid isolates were strong biofilm formers. The upstream region of the ica operon, which encodes the proteins responsible for the synthesis of the polysaccharide intercellular adhesin (PIA, of mucoid isolates was sequenced. Spa-types of mucoid and non-mucoid strains were identical, but differed between patients. Mucoid isolates carried a 5 bp deletion in the intergenic region between icaR and icaA. During long-term persistence, from two patients subsequent non-mucoid isolates (n = 12 with 5 bp deletions were cultured, which did not produce biofilm. Sequencing of the entire ica operon identified compensatory mutations in various ica-genes including icaA (n = 7, icaD (n = 3 and icaC (n = 2. Six sequential isolates of each of these two patients with non-mucoid and mucoid phenotypes were subjected to whole genome sequencing revealing a very close relationship of the individual patient's isolates. Transformation of strains with vectors expressing the respective wild-type genes restored mucoidy. In contrast to the non-mucoid phenotype, mucoid strains were protected against neutrophilic killing and survived better under starvation conditions. In conclusion, the special conditions present in CF airways seem to facilitate ongoing mutations in the ica operon during S. aureus persistence.
Fermi-Dirac correlation and Q-νKν(Q) distribution
International Nuclear Information System (INIS)
Dai Qirun; Li Jimei; Ma Zhanqing; Zhao Shusong
1996-01-01
The Fermi-Dirac correlation of identical protons is studied. Based on the non-perturbative theory of quantum fields, we put forward a kind of source distribution--the Q -ν K ν (Q) distribution. The Fermi-Dirac correlation of (p +- -p +- )-pairs is calculated from this distribution. The fitted curves agree with experimental data. The Q -ν K ν (Q) distribution has more advantages than the Gauss Source distribution. The radii of the source emitting hadrons and the anomalous dimensions of the Fermi field are calculated from the Fermi-Dirac correlation of identical protons
Positive regulation of plasmacytoid dendritic cell function via Ly49Q recognition of class I MHC
Tai, Lee-Hwa; Goulet, Marie-Line; Belanger, Simon; Toyama-Sorimachi, Noriko; Fodil-Cornu, Nassima; Vidal, Silvia M.; Troke, Angela D.; McVicar, Daniel W.; Makrigiannis, Andrew P.
2008-01-01
Plasmacytoid dendritic cells (pDCs) are an important source of type I interferon (IFN) during initial immune responses to viral infections. In mice, pDCs are uniquely characterized by high-level expression of Ly49Q, a C-type lectin-like receptor specific for class I major histocompatibility complex (MHC) molecules. Despite having a cytoplasmic immunoreceptor tyrosine-based inhibitory motif, Ly49Q was found to enhance pDC function in vitro, as pDC cytokine production in response to the Toll-like receptor (TLR) 9 agonist CpG-oligonucleotide (ODN) could be blocked using soluble monoclonal antibody (mAb) to Ly49Q or H-2Kb. Conversely, CpG-ODN–dependent IFN-α production by pDCs was greatly augmented upon receptor cross-linking using immobilized anti-Ly49Q mAb or recombinant H-2Kb ligand. Accordingly, Ly49Q-deficient pDCs displayed a severely reduced capacity to produce cytokines in response to TLR7 and TLR9 stimulation both in vitro and in vivo. Finally, TLR9-dependent antiviral responses were compromised in Ly49Q-null mice infected with mouse cytomegalovirus. Thus, class I MHC recognition by Ly49Q on pDCs is necessary for optimal activation of innate immune responses in vivo. PMID:19075287
Plastino, A.; Rocca, M. C.
2018-05-01
We generalize several well known quantum equations to a Tsallis’ q-scenario, and provide a quantum version of some classical fields associated with them in the recent literature. We refer to the q-Schródinger, q-Klein-Gordon, q-Dirac, and q-Proca equations advanced in, respectively, Phys. Rev. Lett. 106, 140601 (2011), EPL 118, 61004 (2017) and references therein. We also introduce here equations corresponding to q-Yang-Mills fields, both in the Abelian and non-Abelian instances. We show how to define the q-quantum field theories corresponding to the above equations, introduce the pertinent actions, and obtain equations of motion via the minimum action principle. These q-fields are meaningful at very high energies (TeV scale) for q = 1.15, high energies (GeV scale) for q = 1.001, and low energies (MeV scale) for q = 1.000001 [Nucl. Phys. A 955 (2016) 16 and references therein]. (See the ALICE experiment at the LHC). Surprisingly enough, these q-fields are simultaneously q-exponential functions of the usual linear fields’ logarithms.
Quantum groups, roots of unity and particles on quantized Anti-de Sitter space
International Nuclear Information System (INIS)
Steinacker, H.
1997-01-01
Quantum groups in general and the quantum Anti-de Sitter group U q (so(2,3)) in particular are studied from the point of view of quantum field theory. The author shows that if q is a suitable root of unity, there exist finite-dimensional, unitary representations corresponding to essentially all the classical one-particle representations with (half) integer spin, with the same structure at low energies as in the classical case. In the massless case for spin ≥ 1, open-quotes naiveclose quotes representations are unitarizable only after factoring out a subspace of open-quotes pure gaugesclose quotes, as classically. Unitary many-particle representations are defined, with the correct classical limit. Furthermore, the author identifies a remarkable element Q in the center of U q (g), which plays the role of a BRST operator in the case of U q (so(2,3)) at roots of unity, for any spin ≥ 1. The associated ghosts are an intrinsic part of the indecomposable representations. The author shows how to define an involution on algebras of creation and anihilation operators at roots of unity, in an example corresponding to non-identical particles. It is shown how nonabelian gauge fields appear naturally in this framework, without having to define connections on fiber bundles. Integration on Quantum Euclidean space and sphere and on Anti-de Sitter space is studied as well. The author gives a conjecture how Q can be used in general to analyze the structure of indecomposable representations, and to define a new, completely reducible associative (tensor) product of representations at roots of unity, which generalizes the standard open-quotes truncatedclose quotes tensor product as well as many-particle representations
Quantum groups, roots of unity and particles on quantized Anti-de Sitter space
Energy Technology Data Exchange (ETDEWEB)
Steinacker, Harold [Univ. of California, Berkeley, CA (United States). Dept. of Physics
1997-05-23
Quantum groups in general and the quantum Anti-de Sitter group Uq(so(2,3)) in particular are studied from the point of view of quantum field theory. The author shows that if q is a suitable root of unity, there exist finite-dimensional, unitary representations corresponding to essentially all the classical one-particle representations with (half) integer spin, with the same structure at low energies as in the classical case. In the massless case for spin ≥ 1, "naive" representations are unitarizable only after factoring out a subspace of "pure gauges", as classically. Unitary many-particle representations are defined, with the correct classical limit. Furthermore, the author identifies a remarkable element Q in the center of Uq(g), which plays the role of a BRST operator in the case of Uq(so(2,3)) at roots of unity, for any spin ≥ 1. The associated ghosts are an intrinsic part of the indecomposable representations. The author shows how to define an involution on algebras of creation and anihilation operators at roots of unity, in an example corresponding to non-identical particles. It is shown how nonabelian gauge fields appear naturally in this framework, without having to define connections on fiber bundles. Integration on Quantum Euclidean space and sphere and on Anti-de Sitter space is studied as well. The author gives a conjecture how Q can be used in general to analyze the structure of indecomposable representations, and to define a new, completely reducible associative (tensor) product of representations at roots of unity, which generalizes the standard "truncated" tensor product as well as many-particle representations.
Functional C1q is present in the skin mucus of Siberian sturgeon (Acipenser baerii).
Fan, Chunxin; Wang, Jian; Zhang, Xuguang; Song, Jiakun
2015-01-01
The skin mucus of fish acts as the first line of self-protection against pathogens in the aquatic environment and comprises a number of innate immune components. However, the presence of the critical classical complement component C1q, which links the innate and adaptive immune systems of mammalians, has not been explored in a primitive actinopterygian fish. In this study, we report that C1q is present in the skin mucus of the Siberian sturgeon (Acipenser baerii). The skin mucus was able to inhibit the growth of Escherichia coli. The bacteriostatic activity of the skin mucus was reduced by heating and by pre-incubation with EDTA or mouse anti-human C1q antibody. We also detected C1q protein in skin mucus using the western blot procedure and isolated a cDNA that encodes the Siberian sturgeon C1qC, which had 44.7-51.4% identity with C1qCs in teleosts and tetrapods. A phylogenetic analysis revealed that Siberian sturgeon C1qC lies at the root of the actinopterygian branch and is separate from the tetrapod branch. The C1qC transcript was expressed in many tissues as well as in skin. Our data indicate that C1q is present in the skin mucus of the Siberian sturgeon to protect against water-borne bacteria, and the C1qC found in the sturgeon may represent the primitive form of teleost and tetrapod C1qCs. © 2014 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and Wiley Publishing Asia Pty Ltd.
Analytic results for the one loop NMHV H anti qqgg amplitude
International Nuclear Information System (INIS)
Badger, Simon; Campbell, John M.; Williams, Ciaran
2009-01-01
We compute the one-loop amplitude for a Higgs boson, a quark-antiquark pair and a pair of gluons of negative helicity, i.e. for the next-to-maximally helicity violating (NMHV) case, A(H, 1 - anti q , 2 + q , 3 - g , 4 - g ). The calculation is performed using an effective Lagrangian which is valid in the limit of very large top quark mass. As a result of this paper all amplitudes for the transition of a Higgs boson into 4 partons are now known analytically at one-loop order. (orig.)
Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S
2000-01-01
A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln
Aims: To investigate the function of the master flagellar operon flhDC in the fish pathogen Yersinia ruckeri and compare the effect of flhD mutation to a naturally occurring mutation causing loss-of-motility in emergent biotype 2 (BT2) strains. Methods and Results: In this study isogenic Y. ruckeri ...
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. Q QIAO. Articles written in Bulletin of Materials Science. Volume 39 Issue 2 April 2016 pp 519-523. Effect of temperature on structure and corrosion resistance for electroless NiWP coating · M Q YU Q QIAO F YOU C L LI Y ZHAO Z Z XIAO H L LUO Z F XU KAZUHIRO MATSUGI ...
Directory of Open Access Journals (Sweden)
Giuseppe Dattoli
1996-05-01
Full Text Available q analog of bessel functions, symmetric under the interchange of q and q^ −1 are introduced. The definition is based on the generating function realized as product of symmetric q-exponential functions with appropriate arguments. Symmetric q-Bessel function are shown to satisfy various identities as well as second-order q-differential equations, which in the limit q → 1 reproduce those obeyed by the usual cylindrical Bessel functions. A brief discussion on the possible algebraic setting for symmetric q-Bessel functions is also provided.
Protective Effect of Coenzyme Q10 on Methamphetamine-Induced Apoptosis in Adult Male Rats
Directory of Open Access Journals (Sweden)
Fatemeh Gholipour
2017-06-01
Full Text Available Background: The negative consequence of methamphetamine abuse is due to neuropathologic changes in the brain, which reduces dopaminergic neurons and result in damage to different brain areas. Neurotoxicity induced by methamphetamine increases the oxidative stress and associated with neuronal apoptosis. The role of the antioxidant coenzyme Q10 probably produces its neuroprotective effects. Therefore, the purpose of the present study was to examine the protective effect of coenzyme Q10 on methamphetamine-induced apoptosis in adult male rats.Materials and Methods: Fifty Wistar eight-week adult rats randomly divided into 5 groups: Healthy control, methamphetamine injection (Meth, methamphetamine injection and CoQ10 5mg/kg treatment (Meth+Post CoQ10 5mg/kg, methamphetamine injection and CoQ10 10mg/kg treatment (Meth+Post CoQ10 10mg/kg, methamphetamine injection and CoQ10 20mg/kg treatment (Meth+Post CoQ10 20mg/kg. Methamphetamine with a purity of 96% with a dosage of 20 mg/kg was injected Intraperitoneal. Coenzyme Q10 for three treatment groups was injected intraperitoneally for 14 days in a dosage of 5, 10 and 20 mg/kg/day. The protein expressions of Baxand Bcl2 were evaluated by western blotting technique.Results: Bax protein expression was significantly lower in Meth+Post CoQ10 5mg/kg (p=0.010 and so Meth+Post CoQ10 10mg/kg (p=0.004 comparing to Meth group. In addition, Bcl2 protein expression was significantly higher in Meth+Post CoQ10 5mg/kg comparing to Meth group (p=0.018. However, there were no significant differences between control and CoQ10 treatment groups. Bax/Bcl2 ratio was significantly lower in Meth+Post CoQ10 5mg/kg (p=0.005, Meth+Post CoQ10 10mg/kg (p=0.008 and Meth+Post CoQ10 20mg/kg (p=0.044 comparing to Meth group.Conclusion: We suggest that CoQ10 reduces the methamphetamine-induced apoptosis in the striatum of the rats through the reduction of apoptotic factors and increase of anti-apoptotic pathways.
q-deformed Weinberg-Salam model and q-deformed Maxwell equations
International Nuclear Information System (INIS)
Alavi, S.A.; Sarbishaei, M.; Mokhtari, A.
2000-01-01
We study the q-deformation of the gauge part of the Weinberg-Salam model and show that the q-deformed theory involves new interactions. We then obtain q-deformed Maxwell equations from which magnetic monopoles appear naturally. (author)
International Nuclear Information System (INIS)
Lovett, C.M. Jr.; Love, P.E.; Yasbin, R.E.; Roberts, J.W.
1988-01-01
We quantitated the induction of the Bacillus subtilis Rec protein (the analog of Escherichia coli RecA protein) and the B. subtilis din-22 operon (representative of a set of DNA damage-inducible operons in B. subtilis) following DNA damage in Rec+ and DNA repair-deficient strains. After exposure to mitomycin C or UV irradiation, each of four distinct rec (recA1, recB2, recE4, and recM13) mutations reduced to the same extent the rates of both Rec protein induction (determined by densitometric scanning of immunoblot transfers) and din-22 operon induction (determined by assaying beta-galactosidase activity in din-22::Tn917-lacZ fusion strains). The induction deficiencies in recA1 and recE4 strains were partially complemented by the E. coli RecA protein, which was expressed on a plasmid in B. subtilis; the E. coli RecA protein had no effect on either induction event in Rec+, recB2, or recM13 strains. These results suggest that (i) the expression of both the B. subtilis Rec protein and the din-22 operon share a common regulatory component, (ii) the recA1 and recE4 mutations affect the regulation and/or activity of the B. subtilis Rec protein, and (iii) an SOS regulatory system like the E. coli system is highly conserved in B. subtilis. We also showed that the basal level of B. subtilis Rec protein is about 4,500 molecules per cell and that maximum induction by DNA damage causes an approximately fivefold increase in the rate of Rec protein accumulation
International Nuclear Information System (INIS)
Klepp, K.O.; Gurtner, D.
1996-01-01
The new compounds TlCuT IV Q 3 (T = Zr, Hf; Q = S, Se) were prepared by reacting intimate mixtures of Tl 2 S or TlSe with stoichiometric amounts of the corresponding Group IV metal, Cu and the corresponding chalcogen at 870 . The four compounds are isostructural and crystallize in Cmcm, Z = 4 with a 3.726(4) A, b = 13.987(9) A, c = 9.783(4) A for TlCuZrS 3 ; a = 3.847(1) A, b 14.381(6) A, c = 10.150(1) A for TlCuZrSe 3 ; a = 3.694(1) A, b = 14.030(3) A, c = 9.750(3) A for TlCuHfS 3 ; and a = 3.831(1) A, b = 14.409(9) A, c = 10.124(2) A for TlCuHfSe 3 . Their crystal structures were determined from single crystal diffractometer data (Mo Kα radiation, ambient temperature) and refined to conventional R values of 0.016, 0.040, 0.019 and 0.031 respectively. An outstanding feature of their crystal structures is the formation of infinite anionic layers, 2 ∞ -[CuT IV Q 3 ] - parallel to (010), which are separated by Tl + cations. These layers are built up by edge sharing TQ 6 octahedra and distorted CuQ 4 tetrahedra. Average T-Q distances are anti d(Zr-S) = 2.586(1) A, anti d(Zr-Se) = 2.707(1) A, anti d(Hf-S) = 2.569(2) A and anti d(Hf-Se) = 2.694(1) A. Cu-chalcogen distances are anti d(Cu-S) = 2.318(2) A and anti d(Cu-Se) = 2.432(3) A respectively. The thallium ions are in bicapped trigonal prismatic chalcogen coordinations. The atomic arrangement corresponds to that of KCuZrS 3 ; based on the thallium-chalcogen partial structure it can be regarded as a filled variant of an anti-Re 3 B structure type. (orig.)
q-Derivatives, quantization methods and q-algebras
International Nuclear Information System (INIS)
Twarock, Reidun
1998-01-01
Using the example of Borel quantization on S 1 , we discuss the relation between quantization methods and q-algebras. In particular, it is shown that a q-deformation of the Witt algebra with generators labeled by Z is realized by q-difference operators. This leads to a discrete quantum mechanics. Because of Z, the discretization is equidistant. As an approach to a non-equidistant discretization of quantum mechanics one can change the Witt algebra using not the number field Z as labels but a quadratic extension of Z characterized by an irrational number τ. This extension is denoted as quasi-crystal Lie algebra, because this is a relation to one-dimensional quasicrystals. The q-deformation of this quasicrystal Lie algebra is discussed. It is pointed out that quasicrystal Lie algebras can be considered also as a 'deformed' Witt algebra with a 'deformation' of the labeling number field. Their application to the theory is discussed
Energy Technology Data Exchange (ETDEWEB)
Takahashi, N; Miake, Y; Nojiri, Y; Minamisono, T; Mizobuchi, A; Sugimoto, K [Osaka Univ., Toyonaka (Japan). Lab. of Nuclear Studies; Ishihara, M [Institute of Physical and Chemical Research, Wako, Saitama (Japan)
1978-10-09
Spin polarization of /sup 12/B was measured for /sup 100/Mo(/sup 14/N,/sup 12/B) at Esub(i)(/sup 14/N) approximately 200 MeV as a function of Q value down to Q approximately - 150 MeV, and was found anti-parallel to ksub(f)xksub(i) in the deep-inelastic region. The data together with those at lower incident energies show a systematic trend in Q-value dependence of the polarization.
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Siblings with opposite chromosome constitutions, dup(2q)/del(7q) and del(2q)/dup(7q).
Shim, Sung Han; Shim, Jae Sun; Min, Kyunghoon; Lee, Hee Song; Park, Ji Eun; Park, Sang Hee; Hwang, Euna; Kim, Minyoung
2014-01-15
Chromosome 7q36 microdeletion syndrome is a rare genomic disorder characterized by underdevelopment of the brain, microcephaly, anomalies of the sex organs, and language problems. Developmental delay, intellectual disability, autistic spectrum disorders, BDMR syndrome, and unusual facial morphology are the key features of the chromosome 2q37 microdeletion syndrome. A genetic screening for two brothers with global developmental delay using high-resolution chromosomal analysis and subtelomeric multiplex ligation-dependent probe amplification revealed subtelomeric rearrangements on the same sites of 2q37.2 and 7q35, with reversed deletion and duplication. Both of them showed dysmorphic facial features, severe disability of physical and intellectual development, and abnormal genitalia with differential abnormalities in their phenotypes. The family did not have abnormal genetic phenotypes. According to the genetic analysis of their parents, adjacent-1 segregation from their mother's was suggested as a mechanism of their gene mutation. By comparing the phenotypes of our patients with previous reports on similar patients, we tried to obtain the information of related genes and their chromosomal locations. © 2013.
Some approximation properties of ( p , q $(p,q$ -Bernstein operators
Directory of Open Access Journals (Sweden)
Shin Min Kang
2016-06-01
Full Text Available Abstract This paper is concerned with the ( p , q $(p,q$ -analog of Bernstein operators. It is proved that, when the function is convex, the ( p , q $(p,q$ -Bernstein operators are monotonic decreasing, as in the classical case. Also, some numerical examples based on Maple algorithms that verify these properties are considered. A global approximation theorem by means of the Ditzian-Totik modulus of smoothness and a Voronovskaja type theorem are proved.
On alternative q-Weibull and q-extreme value distributions: Properties and applications
Zhang, Fode; Ng, Hon Keung Tony; Shi, Yimin
2018-01-01
Tsallis statistics and Tsallis distributions have been attracting a significant amount of research work in recent years. Importantly, the Tsallis statistics, q-distributions have been applied in different disciplines. Yet, a relationship between some existing q-Weibull distributions and q-extreme value distributions that is parallel to the well-established relationship between the conventional Weibull and extreme value distributions through a logarithmic transformation has not be established. In this paper, we proposed an alternative q-Weibull distribution that leads to a q-extreme value distribution via the q-logarithm transformation. Some important properties of the proposed q-Weibull and q-extreme value distributions are studied. Maximum likelihood and least squares estimation methods are used to estimate the parameters of q-Weibull distribution and their performances are investigated through a Monte Carlo simulation study. The methodologies and the usefulness of the proposed distributions are illustrated by fitting the 2014 traffic fatalities data from The National Highway Traffic Safety Administration.
Are brucellosis, Q fever and melioidosis potential causes of febrile illness in Madagascar?
Boone, Ides; Henning, Klaus; Hilbert, Angela; Neubauer, Heinrich; von Kalckreuth, Vera; Dekker, Denise Myriam; Schwarz, Norbert Georg; Pak, Gi Deok; Krüger, Andreas; Hagen, Ralf Matthias; Frickmann, Hagen; Heriniaina, Jean Noël; Rakotozandrindrainy, Raphael; Rakotondrainiarivelo, Jean Philibert; Razafindrabe, Tsiry; Hogan, Benedikt; May, Jürgen; Marks, Florian; Poppert, Sven; Al Dahouk, Sascha
2017-08-01
Brucellosis, Q fever and melioidosis are zoonoses, which can lead to pyrexia. These diseases are often under-ascertained and underreported because of their unspecific clinical signs and symptoms, insufficient awareness by physicians and public health officers and limited diagnostic capabilities, especially in low-resource countries. Therefore, the presence of Brucella spp., Coxiella burnetii and Burkholderia pseudomallei was investigated in Malagasy patients exhibiting febrile illness. In addition, we analyzed zebu cattle and their ticks as potential reservoirs for Brucella and C. burnetii, respectively. Specific quantitative real-time PCR assays (qPCRs) were performed on 1020 blood samples drawn from febrile patients. In total, 15 samples (1.5%) were Brucella-positive, mainly originating from patients without travel history, while DNA from C. burnetii and Bu. pseudomallei was not detected. Anti-C. burnetii antibodies were found in four out of 201 zebu serum samples (2%), whereas anti-Brucella antibodies could not be detected. Brucella DNA was detected in a single zebu sample. Three out of 330 ticks analyzed (1%) were positively tested for C. burnetii DNA but with high Ct values in the qPCR assay. Our data suggest that zebus as well as Amblyomma and Boophilus ticks have to be considered as a natural reservoir or vector for C. burnetii, but the risk of cattle-to-human transmission is low. Since bovine brucellosis does not seem to contribute to human infections in Madagascar, other transmission routes have to be assumed. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier
2017-07-01
Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.
Directory of Open Access Journals (Sweden)
Ugen Kenneth E
2004-06-01
Full Text Available Abstract Background In prior work we detected reduced anti-Aβ antibody titers in Aβ-vaccinated transgenic mice expressing the human amyloid precursor protein (APP compared to nontransgenic littermates. We investigated this observation further by vaccinating APP and nontransgenic mice with either the wild-type human Aβ peptide, an Aβ peptide containing the "Dutch Mutation", E22Q, or a wild-type Aβ peptide conjugated to papillomavirus virus-like particles (VLPs. Results Anti-Aβ antibody titers were lower in vaccinated APP than nontransgenic mice even when vaccinated with the highly immunogenic Aβ E22Q. One concern was that human Aβ derived from the APP transgene might mask anti-Aβ antibodies in APP mice. To test this possibility, we dissociated antigen-antibody complexes by incubation at low pH. The low pH incubation increased the anti-Aβ antibody titers 20–40 fold in APP mice but had no effect in sera from nontransgenic mice. However, even after dissociation, the anti-Aβ titers were still lower in transgenic mice vaccinated with wild-type Aβ or E22Q Aβ relative to non-transgenic mice. Importantly, the dissociated anti-Aβ titers were equivalent in nontransgenic and APP mice after VLP-based vaccination. Control experiments demonstrated that after acid-dissociation, the increased antibody titer did not cross react with bovine serum albumin nor alpha-synuclein, and addition of Aβ back to the dissociated serum blocked the increase in antibody titers. Conclusions Circulating human Aβ can interfere with ELISA assay measurements of anti-Aβ titers. The E22Q Aβ peptide vaccine is more immunogenic than the wild-type peptide. Unlike peptide vaccines, VLP-based vaccines against Aβ abrogate the effects of Aβ self-tolerance.
MEIJER, WG
1994-01-01
During autotrophic growth of Xanthobacter flavus, energy derived from the oxidation of hydrogen methanol or formate is used to drive the assimilation of CO2 via the Calvin cycle. The genes encoding the Calvin cycle enzymes are organized in the cbb operon, which is expressed only during autotrophic
2,4-diacetylphloroglucinol (2,4-DAPG)-producing Pseudomonas brassicacearum Q8r1-96 is a highly effective biocontrol agent of take-all disease of wheat. Strain Z30-97, a recombinant derivative of Q8r1-96 containing the phzABCDEFG operon from P. synxantha (formerly P. fluorescens) 2-79 inserted into ...
Replication the association of 2q32.2-q32.3 and 14q32.11 with hepatocellular carcinoma.
Chen, Wei; Wang, Mingquan; Zhang, Zhen; Tang, Huayang; Zuo, Xianbo; Meng, Xiangling; Xiong, Maoming; Zhou, Fusheng; Liang, Bo; Dai, Fen; Fang, Jun; Gao, Jinping; Zhu, Jun; Zhu, Yong; Wan, Hong; Wang, Miaofeng; Chan, Shixin; Sun, Liangdan
2015-04-25
Hepatocellular carcinoma (HCC) is a malignant tumor. The morbidity and mortality of HCC tend to ascend and become a serious threat to the population health. Genetic studies of HCC have identified several susceptibility loci of HCC. In this study, we aim to replicate the association of these loci in our samples from Chinese population and further investigate the genetic interaction. We selected 16 SNPs within 1p36.22, 2q32.2-q32.3, 3p21.33, 8p12, 14q32.11 and 21q21.3 and genotyped in 507 HCC patients and 3014 controls by using Sequenom MassARRAY system. Association analyses were performed by using PLINK 1.07. We observed that the STAT4 (2q32.2-q32.3) at rs7574865 (P=1.17×10(-3), OR=0.79) and EFCAB11 (14q32.11) at rs8013403 (P=1.54×10(-3), OR=0.80) were significantly associated with HCC in this study. In 3p21.33, genetic variant rs6795737 within GLB1 was also observed with suggestive evidence (P=9.98×10(-3), OR=0.84). In the interaction analysis, the pair of associated SNPs (rs7574865 within STAT4, rs8013403 within EFCAB11) generated evidence for interaction (P=4.10×10(-3)). In summary, our work first reported the association of 14q32.11 (EFCAB11) with HCC in Chinese Han population and revealed the genetic interaction between STAT4 (2q32.2-q32.3) and EFCAB11 (14q32.11) in HCC. Copyright © 2015 Elsevier B.V. All rights reserved.
Yi, Jia; Xiao, Shui Bing; Zeng, Zhi Xiong; Lu, Jin Fang; Liu, Lu Yi; Laghari, Zubair Ahmed; Nie, Pin; Yu, Hong Bing; Xie, Hai Xia
2016-08-01
Edwardsiella tarda is an important Gram-negative pathogen that employs a type III secretion system (T3SS) to deliver effectors into host cells to facilitate bacterial survival and replication. These effectors are translocated into host cells through a translocon complex composed of three secreted proteins, namely, EseB, EseC, and EseD. The secretion of EseB and EseD requires a chaperone protein called EscC, whereas the secretion of EseC requires the chaperone EscA. In this study, we identified a novel protein (EseE) that also regulates the secretion of EseC. An eseE deletion mutant secreted much less EseC into supernatants, accompanied by increased EseC levels within bacterial cells. We also demonstrated that EseE interacted directly with EseC in a pulldown assay. Interestingly, EseC, EseE, and EscA were able to form a ternary complex, as revealed by pulldown and gel filtration assays. Of particular importance, the deletion of eseE resulted in decreased levels of EseB and EseD proteins in both the bacterial pellet and supernatant fraction. Furthermore, real-time PCR assays showed that EseE positively regulated the transcription of the translocon operon escC-eseE, comprising escC, eseB, escA, eseC, eseD, and eseE These effects of EseE on the translocon components/operon appeared to have a functional consequence, since the ΔeseE strain was outcompeted by wild-type E. tarda in a mixed infection in blue gourami fish. Collectively, our results demonstrate that EseE not only functions as a chaperone for EseC but also acts as a positive regulator controlling the expression of the translocon operon escC-eseE, thus contributing to the pathogenesis of E. tarda in fish. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
DEFF Research Database (Denmark)
Larsen, Jesper; Kuhnert, Peter; Frey, Joachim
2007-01-01
subclades, thus reaffirming the hypothesis of vertical inheritance of the leukotoxin operon. The presence of individual 5' flanking regions in M. haemolytica + M. glucosida and M. granulomatis reflects later genome rearrangements within each subclade. The evolution of the novel 5' flanking region in M...
Shuel, Michelle L; Karlowsky, Kathleen E; Law, Dennis K S; Tsang, Raymond S W
2011-12-01
Population biology of Haemophilus influenzae can be studied by multilocus sequence typing (MLST), and isolates are assigned sequence types (STs) based on nucleotide sequence variations in seven housekeeping genes, including fucK. However, the ST cannot be assigned if one of the housekeeping genes is absent or cannot be detected by the current protocol. Occasionally, strains of H. influenzae have been reported to lack the fucK gene. In this study, we examined the prevalence of this mutation among our collection of H. influenzae isolates. Of the 704 isolates studied, including 282 encapsulated and 422 nonencapsulated isolates, nine were not typeable by MLST owing to failure to detect the fucK gene. All nine fucK-negative isolates were nonencapsulated and belonged to various biotypes. DNA sequencing of the fucose operon region confirmed complete deletion of genes in the operon in seven of the nine isolates, while in the remaining two isolates, some of the genes were found intact or in parts. The significance of these findings is discussed.
Anti-symmetric rank-two tensor matter field on superspace for NT=2
International Nuclear Information System (INIS)
Spalenza, Wesley; Ney, Wander G.; Helayel-Neto, J.A.
2004-01-01
In this work, we discuss the interaction between anti-symmetric rank-two tensor matter and topological Yang-Mills fields. The matter field considered here is the rank-2 Avdeev-Chizhov tensor matter field in a suitably extended N T =2 SUSY. We start off from the N T =2, D=4 superspace formulation and we go over to Riemannian manifolds. The matter field is coupled to the topological Yang-Mills field. We show that both actions are obtained as Q-exact forms, which allows us to express the energy-momentum tensor as Q-exact observables
Qq(Q-bar)(q-bar)' states in chiral SU(3) quark model
International Nuclear Information System (INIS)
Zhang Haixia; Zhang Min; Zhang Zongye
2007-01-01
We study the masses of Qq(Q-bar)(q-bar)' states with J PC =0 ++ , 1 ++ , 1 +- and 2 ++ in the chiral SU(3) quark model, where Q is the heavy quark (c or b) and q(q') is the light quark (u,d or s). According to our numerical results, it is improbable to make the interpretation of [cn(c-bar)(n-bar)] 1 ++ and [cn(c-bar)(n-bar)] 2 ++ (n=u,d) states as X(3872) and Y(3940), respectively. However, it is interesting to find the tetraquarks in the bq(b-bar)(q-bar)' system. (authors)
Energy Technology Data Exchange (ETDEWEB)
Ali, Ahmed; Hambrock, Christian [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Ahmed, Ishtiaq [Quaid-i-Azam Univ., Islamabad (Pakistan). National Centre for Physics; Aslam, M. Jamil [Quaid-i-Azam Univ., Islamabad (Pakistan). Physics Dept.
2009-11-15
We study the spectroscopy and dominant decays of the bottomonium-like tetraquarks (bound diquarks-antidiquarks), focusing on the lowest lying P-wave [bq][anti b anti q] states Y{sub [bq]} (with q=u,d), having J{sup PC}=1{sup --}. To search for them, we analyse the BABAR data obtained during an energy scan of the e{sup +}e{sup -}{yields}b anti b cross section in the range of {radical}(s)=10.54 to 11.20 GeV. We find that these data are consistent with the presence of an additional b anti b state Y{sub [bq]} with a mass of 10.90 GeV and a width of about 30 MeV apart from the {upsilon}(5S) and {upsilon}(6S) resonances. A closeup of the energy region around the Y{sub [bq]}-mass may resolve this state in terms of the two mass eigenstates, Y{sub [b,l]} and Y{sub [b,h]}, with a mass difference, estimated as about 6 MeV. We tentatively identify the state Y{sub [bq]}(10900) from the R{sub b}-scan with the state Y{sub b}(10890) observed by BELLE in the process e{sup +}e{sup -}{yields}Y{sub b}(10890){yields}{upsilon}(1S,2S){pi}{sup +}{pi}{sup -} due to their proximity in masses and decay widths. (orig.)
DEFF Research Database (Denmark)
Mygind, T; Birkelund, Svend; Christiansen, Gunna
1998-01-01
To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...
Energy Technology Data Exchange (ETDEWEB)
Althoff, M; Braunschweig, W; Gerhards, R; Kirschfink, F J; Martyn, H U; Rosskamp, P; Wallraff, W; Bock, B; Eisenmann, J; Fischer, H M
1986-08-01
We have measured the process e/sup +/e/sup -/->e/sup +/e/sup -/+hadrons, where one of the scattered electrons was detected at large angles, with Q/sup 2/ ranging from 7 to 70 (GeV/c)/sup 2/. The photon structure function F/sub 2/sup(..gamma..)(x, Q/sup 2/) was determined at an average Q/sup 2/ of 23 (GeV/c)/sup 2/. The measurements were compared to theoretical predictions of the Quark Parton Model and Quantum Chromodynamics. In both models a hadronic part was added. Within the errors the data are in agreement with the QPM using quark masses of 300 MeV/c/sup 2/ for the light quarks. The data also agree with a QCD calculation including higher order corrections. A fit yielded a ..lambda..sub(anti M)anti S) value of 140(+190-65) MeV, where the errors include statistical and systematic uncertainties.
Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.
Burbank, Lindsey P; Van Horn, Christopher R
2017-11-01
The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence
Analytic results for the one loop NMHV H anti qqgg amplitude
Energy Technology Data Exchange (ETDEWEB)
Badger, Simon [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Campbell, John M. [Glasgow Univ. (United Kingdom). Dept. of Physics and Astronomy; Ellis, R. Keith [Fermilab, Batavia, IL (United States); Williams, Ciaran [Durham Univ. (United Kingdom). Dept. of Physics
2009-10-23
We compute the one-loop amplitude for a Higgs boson, a quark-antiquark pair and a pair of gluons of negative helicity, i.e. for the next-to-maximally helicity violating (NMHV) case, A(H, 1{sup -} {sub anti} {sub q}, 2{sup +}{sub q}, 3{sup -}{sub g}, 4{sup -}{sub g}). The calculation is performed using an effective Lagrangian which is valid in the limit of very large top quark mass. As a result of this paper all amplitudes for the transition of a Higgs boson into 4 partons are now known analytically at one-loop order. (orig.)
Extended q -Gaussian and q -exponential distributions from gamma random variables
Budini, Adrián A.
2015-05-01
The family of q -Gaussian and q -exponential probability densities fit the statistical behavior of diverse complex self-similar nonequilibrium systems. These distributions, independently of the underlying dynamics, can rigorously be obtained by maximizing Tsallis "nonextensive" entropy under appropriate constraints, as well as from superstatistical models. In this paper we provide an alternative and complementary scheme for deriving these objects. We show that q -Gaussian and q -exponential random variables can always be expressed as a function of two statistically independent gamma random variables with the same scale parameter. Their shape index determines the complexity q parameter. This result also allows us to define an extended family of asymmetric q -Gaussian and modified q -exponential densities, which reduce to the standard ones when the shape parameters are the same. Furthermore, we demonstrate that a simple change of variables always allows relating any of these distributions with a beta stochastic variable. The extended distributions are applied in the statistical description of different complex dynamics such as log-return signals in financial markets and motion of point defects in a fluid flow.
Ibrahim, Alshaymaa Ahmed; El-Lebedy, Dalia; Ashmawy, Ingy; Hady, Maha Abdel
2017-06-01
Paraoxonase-1 (PON1) is involved in the oxidative stress process that cause tissue damage observed in systemic lupus erythematosus (SLE) and anti-phospholipid syndrome (APS). The aim of the present study was to investigate the association of PON1 Q192R and L55M polymorphisms with risk of SLE and associated APS among Egyptian sample. The study included 120 SLE patients (45 without APS and 75 with APS) and 120 healthy subjects. PON1 Q192R and L55M polymorphisms were genotyped by real-time PCR. No significant differences in Q192R genotypes or allele frequencies were found between patients and controls (p = 0.5 and 0.1, respectively). The frequency of the 55M allele was significantly higher in SLE patients than in controls (66.6 vs. 43.3%), while the 55L allele was more frequent in controls (56.6%) than in patients (33.3%) (p = 0.03). The LL genotype was more frequent in controls (21.6%) than in patients (10%) while M allele carrier genotypes (LM + MM) were more frequent among patients (90%) than controls (78.3%), p = 0.04. Also, the 55M allele was more frequent in APS patients (73.3%) than in patients without APS (55.6%), p = 0.004. M allele carrier genotypes (LM + MM) was significantly higher among APS patients (95.4%) than in non-APS patients (80%), p = 0.008. Our results indicated that the PON1 L55M polymorphism associated with SLE and associated APS in a population from Cairo of Egypt, while the Q192R polymorphism plays no role in disease susceptibility. A large scale study to assess PON1 polymorphisms, PON1 activity, and markers of oxidative stress interaction is needed to clarify the role of PON-1 polymorphisms in the pathogenesis of SLE and associated APS.
DEFF Research Database (Denmark)
Revelles, O.; Espinosa-Urgel, M.; Molin, Søren
2004-01-01
-aminovaleric acid and then further degraded to glutaric acid via the action of the davDT gene products. We show that the davDT genes form an operon transcribed from a single sigma(70)-dependent promoter. The relatively high level of basal expression from the davD promoter increased about fourfold in response...
Clinical delineation of a patient with trisomy 12q23q24
Bouman, Arjan; Schuitema, Anke; Pfundt, Rolph; van de Zande, Guillaume; Kleefstra, Tjitske
2013-01-01
Trisomies of 12q23q24 have been described rarely in literature. Only a few case-reports have been published so far almost exclusively reporting on neonates or young infants. We present a 16-year-old patient with a trisomy of 12q23.3q24.3. Full phenotypic evaluation at this age comprised: severe
Directory of Open Access Journals (Sweden)
Uzma Qaisar
Full Text Available The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators.
International Nuclear Information System (INIS)
Dobrev, V.K.; Doebner, H.D.; Mrugalla, C.
1995-12-01
We give a q-deformation S-perpendicular q of the centrally extended Schroedinger algebra. We construct the lowest weight representations of S-perpendicular q , starting from the Verma modules over S-perpendicular q , finding their singular vectors and factoring the Verma submodules built on the singular vectors. We also give a vector-field realization of S-perpendicular q which provides polynomial realization of the lowest weight representations and an infinite hierarchy of q-difference equations which may be called generalized q-deformed heat equations. We also apply our methods to the on-shell q-Schroedinger algebra proposed by Floreanini and Vinet. (author). 12 refs
Weyl q-coefficients for uq(3) and Racah q -coefficients for suq(2)
International Nuclear Information System (INIS)
Asherova, R.M.; Smirnov, Yu.F.; Tolstoy, V.N.
1996-01-01
With the aid of the projection-operator technique, the general analytic expression for the elements of the matrix that relates the U and T bases of an arbitrary finite-dimensional irreducible representation of the uq(3) quantum algebra (Weyl q-coefficients) is obtained for the case where the deformation parameter q is not equal to a square root of unity. The procedure for resummation of q-factorial expressions is used to prove that, modulo phase factors, these Weyl q-coefficients coincide with Racah q-coefficients for the suq(2) quantum algebra. It is also shown that, on the basis of one general formula, the q-analogs of all known general analytic expressions for the 6j symbols (and Racah coefficients) of the Lie algebras of the angular momentum can be obtained by using this resummation procedure. The symmetry properties of these q coefficients are discussed. The result is formulated in the following way: the general formulas for the q-6j symbols (Racah q-coefficients) of the suq(2) quantum algebra are obtained from the general formulas for the conventional 6j symbols (Racah coefficients) of the su(2) Lie algebra by replacing directly all factorials with q-factorials, the symmetry properties of the q-6j symbols being completely coincident with the symmetry properties of the conventional 6j symbols
DEFF Research Database (Denmark)
Becker, Kerstin; Di Donato, Nataliya; Holder-Espinasse, Muriel
2012-01-01
with broad nasal tip, anteverted nares, long philtrum, and thin upper lip. In this study we describe two patients with overlapping 6q14 deletions presenting with developmental delay and characteristic dysmorphism. Molecular karyotyping using array CGH analysis revealed a de novo 8.9 Mb deletion at 6q14.1-q14.......3 and a de novo 11.3 Mb deletion at 6q12.1-6q14.1, respectively. We provide a review of the clinical features of twelve other patients with 6q14 deletions detected by array CGH analysis. By assessing all reported data we could not identify a single common region of deletion. Possible candidate genes in 6q14...
Coenzyme Q10 Supplementation Modulates NFκB and Nrf2 Pathways in Exercise Training
Directory of Open Access Journals (Sweden)
Ragip Pala, Cemal Orhan, Mehmet Tuzcu, Nurhan Sahin, Shakir Ali, Vedat Cinar, Mustafa Atalay, Kazim Sahin
2016-03-01
Full Text Available This study reports the effects of Q10, coenzyme Q10 or ubiquinone, a component of the electron transport chain in mitochondria, on nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB, inhibitors of kappa B (IκB, nuclear factor (erythroid-derived 2-like 2 (Nrf2 and hemeoxygenase 1 (HO-1 in rats after chronic exercise training for 6 weeks. 8-week old male Wistar rats were assigned randomly to one of four treatments planned in a 2 x 2 factorial arrangement of two condition (sedentary vs. exercise training, and two coenzyme Q10 levels (0 and 300 mg/kg per day for 6 weeks. The expression levels of the target proteins were determined in the heart, liver and muscle, and biochemical parameters including creatinine, urea, glucose and lipid profile were investigated in plasma. When compared with sedentary group, significant decreases in heart, liver and muscle NFκB levels by 45%, 26% and 44% were observed in Q10 supplemented rats after exercise training, respectively, while the inhibitory protein IκB increased by 179%, 111% and 127% in heart, liver and muscle tissues. Q10 supplementation caused an increase in Nrf2 (167%, 165% and 90% and HO-1 (107%, 156% and 114% after exercise training in heart, liver and muscle tissues (p < 0.05. No significant change was observed in any of the parameters associated with protein, carbohydrate and lipid metabolism, except that exercise caused a decrease in plasma triglyceride, which was further decreased by Q10. In conclusion, these results suggest that Q10 modulates the expression of NFκB, IκB, Nrf2 and HO-1 in exercise training, indicating an anti-inflammatory effect of Q10 and emphasizes its role in antioxidant defense.
Belbachir, H.; Mirzavaziri, M.; Moslehian, M. S.
2005-01-01
Replacing the triangle inequality, in the definition of a norm, by $|x + y| ^{q}\\leq 2^{q-1}(|x| ^{q} + |y| ^{q}) $, we introduce the notion of a q-norm. We establish that every q-norm is a norm in the usual sense, and that the converse is true as well.
Q → qZ decays at Tevatron and SSC energies
International Nuclear Information System (INIS)
Agrawal, P.; Ellis, S.D.
1990-09-01
The possible existence of a new heavy quark Q that decays predominantly via the flavor changing neutral current transition Q → qZ is discussed. Candidates include a fourth generation charge -- 1/3 quark, or a more exotic vector-like quark. Such particles are interesting both as extensions of the Standard Model and due to their unique decay modes. The primary experimental indication of the pair production and subsequent decay of quarks is ZZ pair production at an essentially strong interaction rate. This mode can then constitute an unexpected background to the searches for other particles. In particular the channel Q bar Q → ZZ + X can generate a serious background to the search for the Higgs boson via the H 0 → ZZ mode at the SSC. Thus it is essential to search for such new heavy quarks at the Tevatron. Possible detection signatures for this purpose are discussed. 24 refs. , 1 fig., 3 tabs
18q- and 18q+ mosaicism in a mentally retarded boy
Ausems, M. G.; Bhola, S. L.; Post-Blok, C. A.; Hennekam, R. C.; de France, H. F.
1994-01-01
A mentally retarded boy was found to have an unusual chromosomal mosaicism [46,XY, del(18) (q22)/46,XY,iso psu dic(18)(q23)]. The clinical manifestations are compatible with the 18q- syndrome. The chromosome alteration was defined by high resolution banding and fluorescence in situ hybridization
Q and you: The application of Q methodology in recreation research
Whitney. Ward
2010-01-01
Researchers have used various qualitative and quantitative methods to deal with subjectivity in studying people's recreation experiences. Q methodology has been the most effective approach for analyzing both qualitative and quantitative aspects of experience, including attitudes or perceptions. The method is composed of two main components--Q sorting and Q factor...
A case of de novo duplication of 15q24-q26.3
Directory of Open Access Journals (Sweden)
Hye Ran Kim
2011-06-01
Full Text Available Distal duplication, or trisomy 15q, is an extremely rare chromosomal disorder characterized by prenatal and postnatal overgrowth, mental retardation, and craniofacial malformations. Additional abnormalities typically include an unusually short neck, malformations of the fingers and toes, scoliosis and skeletal malformations, genital abnormalities, particularly in affected males, and, in some cases, cardiac defects. The range and severity of symptoms and physical findings may vary from case to case, depending upon the length and location of the duplicated portion of chromosome 15q. Most reported cases of duplication of the long arm of chromosome 15 frequently have more than one segmental imbalance resulting from unbalanced translocations involving chromosome 15 and deletions in another chromosome, as well as other structural chromosomal abnormalities. We report a female newborn with a de novo duplication, 15q24- q26.3, showing intrauterine overgrowth, a narrow asymmetric face with down-slanting palpebral fissures, a large, prominent nose, and micrognathia, arachnodactyly, camptodactyly, congenital heart disease, hydronephrosis, and hydroureter. Chromosomal analysis showed a 46,XX,inv(9(p12q13,dup(15(q24q26.3. Array comparative genomic hybridization analysis revealed a gain of 42 clones on 15q24-q26.3. This case represents the only reported patient with a de novo 15q24-q26.3 duplication that did not result from an unbalanced translocation and did not have a concomitant monosomic component in Korea.
QSAR models for anti-malarial activity of 4-aminoquinolines.
Masand, Vijay H; Toropov, Andrey A; Toropova, Alla P; Mahajan, Devidas T
2014-03-01
In the present study, predictive quantitative structure - activity relationship (QSAR) models for anti-malarial activity of 4-aminoquinolines have been developed. CORAL, which is freely available on internet (http://www.insilico.eu/coral), has been used as a tool of QSAR analysis to establish statistically robust QSAR model of anti-malarial activity of 4-aminoquinolines. Six random splits into the visible sub-system of the training and invisible subsystem of validation were examined. Statistical qualities for these splits vary, but in all these cases, statistical quality of prediction for anti-malarial activity was quite good. The optimal SMILES-based descriptor was used to derive the single descriptor based QSAR model for a data set of 112 aminoquinolones. All the splits had r(2)> 0.85 and r(2)> 0.78 for subtraining and validation sets, respectively. The three parametric multilinear regression (MLR) QSAR model has Q(2) = 0.83, R(2) = 0.84 and F = 190.39. The anti-malarial activity has strong correlation with presence/absence of nitrogen and oxygen at a topological distance of six.
Dash, Hirak R; Basu, Subham; Das, Surajit
2017-04-01
Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.
Bergshoeff, E. A.; Hartong, J.; Ploegh, A.; Sorokin, D.
We construct the half-supersymmetric instanton solutions that are electric-magnetically dual to the recently discussed half-supersymmetric Q7-branes. We call these instantons "Q-instantons". Whereas the D-instanton is most conveniently described using the RR axion chi and the dilaton phi, the
Zhao, Ting; Wang, Yu-An; Zhao, Zong-Yan; Liu, Qiang; Liu, Qing-Ju
2018-01-01
In order to explore the similarity, difference, and tendency of binary copper-based chalcogenides, the crystal structure, electronic structure, and optical properties of eight compounds of Cu2Q and CuQ (Q = O, S, Se, and Te) have been calculated by density functional theory with HSE06 method. According to the calculated results, the electronic structure and optical properties of Cu2Q and CuQ present certain similarities and tendencies, with the increase of atomic number of Q elements: the interactions between Cu-Q, Cu-Cu, and Q-Q are gradually enhancing; the value of band gap is gradually decreasing, due to the down-shifting of Cu-4p states; the covalent feature of Cu atoms is gradually strengthening, while their ionic feature is gradually weakening; the absorption coefficient in the visible-light region is also increasing. On the other hand, some differences can be found, owing to the different crystal structure and component, for example: CuO presents the characteristics of multi-band gap, which is very favorable to absorb infrared-light; the electron transfer in CuQ is stronger than that in Cu2Q; the absorption peaks and intensity are very strong in the ultraviolet-light region and infrared-light region. The findings in the present work will help to understand the underlying physical mechanism of binary copper-based chalcogenides, and available to design novel copper-based chalcogenides photo-electronics materials and devices.
Konopleva, Maria N; Khrulnova, Svetlana A; Baranova, Ancha; Ekimov, Leonid V; Bazhenov, Sergey V; Goryanin, Ignatiy I; Manukhov, Ilya V
2016-05-13
Lux-operon of psychrophilic bacteria Aliivibrio logei contains two copies of luxR and is regulated by Type I quorum sensing (QS). Activation of lux-operon of psychrophilic bacteria A. logei by LuxR1 requires about 100 times higher concentrations of autoinducer (AI) than the activation by LuxR2. On the other hand, LuxR1 does not require GroEL/ES chaperonin for its folding and cannot be degraded by protease Lon, while LuxR2 sensitive to Lon and requires GroEL/ES. Here we show that at 10(-5) - 10(-4)М concentrations of AI a combination of luxR1 and luxR2 products is capable of activating the Pr-promoters of A. logei lux-operon in Escherichia coli independently of GroEL/ES and protease Lon. The presence of LuxR1 assists LuxR2 in gro(-) cells when AI was added at high concentration, while at low concentration of AI in a cell LuxR1 decreases the LuxR2 activity. These observations may be explained by the formation of LuxR1/LuxR2 heterodimers that act in complex with AI independently from GroEL/ES and protease Lon. This study expands current understanding of QS regulation in A. logei as it implies cooperative regulation of lux-operon by LuxR1 and LuxR2 proteins. Copyright © 2016 Elsevier Inc. All rights reserved.
Chemical failure modes of AlQ3-based OLEDs: AlQ3 hydrolysis.
Knox, John E; Halls, Mathew D; Hratchian, Hrant P; Schlegel, H Bernhard
2006-03-28
Tris(8-hydroxyquinoline)aluminum(III), AlQ3, is used in organic light-emitting diodes (OLEDs) as an electron-transport material and emitting layer. The reaction of AlQ3 with trace H2O has been implicated as a major failure pathway for AlQ3-based OLEDs. Hybrid density functional calculations have been carried out to characterize the hydrolysis of AlQ3. The thermochemical and atomistic details for this important reaction are reported for both the neutral and oxidized AlQ3/AlQ3+ systems. In support of experimental conclusions, the neutral hydrolysis reaction pathway is found to be a thermally activated process, having a classical barrier height of 24.2 kcal mol(-1). First-principles infrared and electronic absorption spectra are compared to further characterize AlQ3 and the hydrolysis pathway product, AlQ2OH. The activation energy for the cationic AlQ3 hydrolysis pathway is found to be 8.5 kcal mol(-1) lower than for the neutral reaction, which is significant since it suggests a role for charge imbalance in promoting chemical failure modes in OLED devices.
Various endocrine disorders in children with t(13;14(q10;q10 Robertsonian translocation
Directory of Open Access Journals (Sweden)
Byung Ho Choi
2013-09-01
Full Text Available Purpose45,XY,t(13;14(q10;q10 karyotype can suggest infertility associated with more or less severe oligospermia in male adults. In addition, 45,XX,t(13;14(q10;q10 karyotype carries reproductive risks such as miscarriage or infertility in female adults. However, reports on the phenotype of this karyotype in children are very rare. This study was done to observe various phenotypes of this karyotype in children.MethodsBetween January 2007 and December 2012, children diagnosed with 45,XY,t(13;14(q10;q10 or 45,XX,t(13;14(q10;q10 karyotype by chromosome analysis were analyzed retrospectively.ResultsEight children (5 boys and 3 girls were diagnosed with 45,XY,t(13;14(q10;q10 or 45,XX,t(13;14(q10;q10 karyotype. They ranged in age from 5 years and 6 months to 12 years and 4 months. The phenotypes of the study patients consisted of 1 hypogonadotrophic hypogonadism, 1 precocious puberty, 3 early puberty, 2 growth hormone deficiency (GHD (partial and 1 idiopathic short stature. As shown here t(13;14(q10;q10 Robertsonian translocation shows a wide range of phenotypes.ConclusionIt can be said that t(13;14(q10;q10 Robertsonian translocation shows various phenotypes from GHD to precocious puberty in children. Further large-scale studies are necessary.
Q2/Q3 2017 Solar Industry Update
Energy Technology Data Exchange (ETDEWEB)
Feldman, David J. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Hoskins, Jack [Dept. of Energy (DOE), Washington DC (United States); Margolis, Robert M. [National Renewable Energy Lab. (NREL), Golden, CO (United States)
2017-10-24
This technical presentation provides an update on the major trends that occurred in the solar industry in Q2 and Q3 of 2017. Major topics of focus include global and U.S. supply and demand, module and system price, investment trends and business models, and updates on U.S. government programs supporting the solar industry.
Q2/Q3 2016 Solar Industry Update
Energy Technology Data Exchange (ETDEWEB)
Feldman, David; Boff, Daniel; Margolis, Robert
2016-10-11
This technical presentation provides an update on the major trends that occurred in the solar industry in the Q2 and Q3 of 2016. Major topics of focus include global and U.S. supply and demand, module and system price, investment trends and business models, and updates on U.S. government programs supporting the solar industry.
Q3/Q4 2016 Solar Industry Update
Energy Technology Data Exchange (ETDEWEB)
Feldman, David; Boff, Daniel; Margolis, Robert
2016-12-21
This technical presentation provides an update on the major trends that occurred in the solar industry in the Q3 and Q4 of 2016. Major topics of focus include global and U.S. supply and demand, module and system price, investment trends and business models, and updates on U.S. government programs supporting the solar industry.
Q3/Q4 2017 Solar Industry Update
Energy Technology Data Exchange (ETDEWEB)
Feldman, David J. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Hoskins, Jack [Dept. of Energy (DOE), Washington DC (United States); Margolis, Robert M. [National Renewable Energy Lab. (NREL), Golden, CO (United States)
2018-02-15
This technical presentation provides an update on the major trends that occurred in the solar industry in the Q3 and Q4 of 2017. Major topics of focus include global and U.S. supply and demand, module and system price, investment trends and business models, and updates on U.S. government programs supporting the solar industry.
Coenzyme Q10 protects retinal cells from apoptosis induced by radiation in vitro and in vivo
International Nuclear Information System (INIS)
Lulli, M.; Witort, E.; Papucci, L.; Torre, E.; Schiavone, N.; Capaccioli, S.; Dal Monte, M.
2012-01-01
The key pathogenetic event of many retinopathies is apoptosis of retinal cells. Our previous studies have demonstrated that Coenzyme Q10 (CoQ10) prevents apoptosis of corneal keratocytes both in vitro and in vivo, by virtue of its ability to inhibit mitochondrial depolarization, independently of its free radical scavenger role. The aim of this study was to evaluate whether CoQ10 can protect cultured retinal cells and the retinas of rats from radiation-induced apoptosis, if instilled as eye drops in the cornea. In vitro experiments were carried out on cultured ARPE-19 or retinal ganglion cells (RGC)-5 cells pretreated with CoQ10 before eliciting apoptosis by ultraviolet (UV)- and γ-radiation, chemical hypoxia (Antimycin A) and serum starvation. Cell viability was evaluated by light microscopy and fluorescence activated cell sorting analysis. Apoptotic events were scored by time-lapse videomicroscopy. Mitochondrial permeability transition was evaluated by JC-1. The anti-apoptotic effectiveness of CoQ10 in retina was also evaluated by an in situ end-labeling assay in Wistar albino rats treated with CoQ10 eye drops prior to UV irradiation of the eye. CoQ10 substantially increased cell viability and lowered retinal cell apoptosis in response both to UV- and γ-radiation and to chemical hypoxia or serum starvation by inhibiting mitochondrion depolarization. In the rat, CoQ10, even when applied as eye drops on the cornea, protected all retina layers from ultraviolet radiation (UVR)-induced apoptosis. The ability of CoQ10 to protect retinal cells from radiation-induced apoptosis following its instillation on the cornea suggests the possibility for CoQ10 eye drops to become a future therapeutic countermeasure for radiation-induced retinal lesions. (author)
Exploring open-charm decay mode Λ_c anti Λ_c of charmonium-like state Y(4630)
International Nuclear Information System (INIS)
Liu, Xuewen; Li, Xue-Qian; Ke, Hong-Wei; Liu, Xiang
2016-01-01
The newly observed X, Y, Z exotic states are definitely not in the standard Q anti Q"' structures, thus their existence composes a challenge to our understanding on the fundamental principles of hadron physics. Therefore the studies on their decay patterns which are determined by the non-perturbative QCD will definitely shed light on the concerned physics. Generally the four-quark states might be in a molecular state or tetraquark or their mixture. In this work, we adopt the suggestion that Y(4630) is a charmonium-like tetraquark made of a diquark and an anti-diquark. If it is true, its favorable decay mode should be Y(4630) decaying into an open-charm baryon pair, since such a transition occurs via strong interaction and is super-OZI-allowed. In this work, we calculate the decay width of Y(4630) → Λ_c anti Λ_c in the framework of the quark pair creation model. Our numerical results on the partial width computed in the tetraquark configuration coincide with the Belle data within a certain error tolerance. (orig.)
Directory of Open Access Journals (Sweden)
Grabe Hans
2010-06-01
Full Text Available Abstract Background Obsessive-compulsive disorder (OCD is a clinically and etiologically heterogeneous syndrome. The high frequency of obsessive-compulsive symptoms reported in subjects with the 22q11.2 deletion syndrome (DiGeorge/velocardiofacial syndrome or Prader-Willi syndrome (15q11-13 deletion of the paternally derived chromosome, suggests that gene dosage effects in these chromosomal regions could increase risk for OCD. Therefore, the aim of this study was to search for microrearrangements in these two regions in OCD patients. Methods We screened the 15q11-13 and 22q11.2 chromosomal regions for genomic imbalances in 236 patients with OCD using multiplex ligation-dependent probe amplification (MLPA. Results No deletions or duplications involving 15q11-13 or 22q11.2 were identified in our patients. Conclusions Our results suggest that deletions/duplications of chromosomes 15q11-13 and 22q11.2 are rare in OCD. Despite the negative findings in these two regions, the search for copy number variants in OCD using genome-wide array-based methods is a highly promising approach to identify genes of etiologic importance in the development of OCD.
Directory of Open Access Journals (Sweden)
Álvarez-Morales Ariel
2011-05-01
Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.
The q-G method : A q-version of the Steepest Descent method for global optimization.
Soterroni, Aline C; Galski, Roberto L; Scarabello, Marluce C; Ramos, Fernando M
2015-01-01
In this work, the q-Gradient (q-G) method, a q-version of the Steepest Descent method, is presented. The main idea behind the q-G method is the use of the negative of the q-gradient vector of the objective function as the search direction. The q-gradient vector, or simply the q-gradient, is a generalization of the classical gradient vector based on the concept of Jackson's derivative from the q-calculus. Its use provides the algorithm an effective mechanism for escaping from local minima. The q-G method reduces to the Steepest Descent method when the parameter q tends to 1. The algorithm has three free parameters and it is implemented so that the search process gradually shifts from global exploration in the beginning to local exploitation in the end. We evaluated the q-G method on 34 test functions, and compared its performance with 34 optimization algorithms, including derivative-free algorithms and the Steepest Descent method. Our results show that the q-G method is competitive and has a great potential for solving multimodal optimization problems.
q-trace for quantum groups and q-deformed Yang-Mills theory
International Nuclear Information System (INIS)
Isaev, A.P.; Popowicz, Z.
1992-01-01
The definitions of orbits and q-trace for the quantum groups are introduced. Then the q-trace is used to construct the invariants for the quantum group orbits and to formulate the q-deformed Yang-Mills theory. The amusing formal relation of the Weinberg type mixing angle with the quantum group deformation parameter is discussed. (orig.)
The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.
Ahn, Sang-Joon; Burne, Robert A
2006-10-01
The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.
Magnetic barriers and their q95 dependence at DIII-D
Volpe, F. A.; Kessler, J.; Ali, H.; Evans, T. E.; Punjabi, A.
2012-05-01
It is well known that externally generated resonant magnetic perturbations (RMPs) can form islands in the plasma edge. In turn, large overlapping islands generate stochastic fields, which are believed to play a role in the avoidance and suppression of edge localized modes (ELMs) at DIII-D. However, large coalescing islands can also generate, in the middle of these stochastic regions, KAM surfaces effectively acting as ‘barriers’ against field-line dispersion and, indirectly, particle diffusion. It was predicted in Ali and Punjabi (2007 Plasma Phys. Control. Fusion 49 1565-82) that such magnetic barriers can form in piecewise analytic DIII-D plasma equilibria. In this work, the formation of magnetic barriers at DIII-D is corroborated by field-line tracing calculations using experimentally constrained EFIT (Lao et al 1985 Nucl. Fusion 25 1611) DIII-D equilibria perturbed to include the vacuum field from the internal coils utilized in the experiments. According to these calculations, the occurrence and location of magnetic barriers depend on the edge safety factor q95. It was thus suggested that magnetic barriers might contribute to narrowing the edge stochastic layer and play an indirect role in the RMPs failing to control ELMs for certain values of q95. The analysis of DIII-D discharges where q95 was varied, however, does not show anti-correlation between barrier formation and ELM suppression.
Magnetic barriers and their q95 dependence at DIII-D
International Nuclear Information System (INIS)
Volpe, F.A.; Kessler, J.; Ali, H.; Punjabi, A.; Evans, T.E.
2012-01-01
It is well known that externally generated resonant magnetic perturbations (RMPs) can form islands in the plasma edge. In turn, large overlapping islands generate stochastic fields, which are believed to play a role in the avoidance and suppression of edge localized modes (ELMs) at DIII-D. However, large coalescing islands can also generate, in the middle of these stochastic regions, KAM surfaces effectively acting as ‘barriers’ against field-line dispersion and, indirectly, particle diffusion. It was predicted in Ali and Punjabi (2007 Plasma Phys. Control. Fusion 49 1565–82) that such magnetic barriers can form in piecewise analytic DIII-D plasma equilibria. In this work, the formation of magnetic barriers at DIII-D is corroborated by field-line tracing calculations using experimentally constrained EFIT (Lao et al 1985 Nucl. Fusion 25 1611) DIII-D equilibria perturbed to include the vacuum field from the internal coils utilized in the experiments. According to these calculations, the occurrence and location of magnetic barriers depend on the edge safety factor q 95 . It was thus suggested that magnetic barriers might contribute to narrowing the edge stochastic layer and play an indirect role in the RMPs failing to control ELMs for certain values of q 95 . The analysis of DIII-D discharges where q 95 was varied, however, does not show anti-correlation between barrier formation and ELM suppression. (paper)
DEFF Research Database (Denmark)
Hahn, Thomas; Foldspang, Anders
1997-01-01
Quadriceps muscle contraction tends to straighten the Q angle. We expected that sports comprising a high amount of quadriceps training could be associated with low Q angles. The aim of the present study was to estimate the Q angle in athletes and to investigate its potential associations with par......Quadriceps muscle contraction tends to straighten the Q angle. We expected that sports comprising a high amount of quadriceps training could be associated with low Q angles. The aim of the present study was to estimate the Q angle in athletes and to investigate its potential associations...... with participation in sport. Three hundred and thirty-nine athletes had their Q angle measured. The mean of right-side Q angles was higher than left side, and the mean Q angle was higher in women than in men. The Q angle was positively associated with years of jogging, and negatively with years of soccer, swimming...... and sports participation at all. It is concluded that the use of Q angle measurements is questionable....
Energy Technology Data Exchange (ETDEWEB)
Brinkmann, Martin
2010-04-15
The inclusive production cross section of D{sup *{+-}}(2010) mesons in deep-inelastic e{sup {+-}}p scattering is measured in the kinematic region of photon virtuality 100<Q{sup 2}<1000 GeV{sup 2} and inelasticity 0.02
Panitz, J C; Zverlov, V V; Pham, V T T; Stürzl, S; Schieder, D; Schwarz, W H
2014-02-01
A new solventogenic bacterium, strain GT6, was isolated from standing water sediment. 16S-rRNA gene analysis revealed that GT6 belongs to the heterogeneous Clostridium tetanomorphum group of bacteria exhibiting 99% sequence identity with C. tetanomorphum 4474(T). GT6 can utilize a wide range of carbohydrate substrates including glucose, fructose, maltose, xylose and glycerol to produce mainly n-butanol without any acetone. Additional products of GT6 metabolism were ethanol, butyric acid, acetic acid, and trace amounts of 1,3-propanediol. Medium and substrate composition, and culture conditions such as pH and temperature influenced product formation. The major fermentation product from glycerol was n-butanol with a final concentration of up to 11.5 g/L. 3% (v/v) glycerol lead to a total solvent concentration of 14 g/L within 72 h. Growth was not inhibited by glycerol concentrations as high as 15% (v/v). The solventogenesis genes crt, bcd, etfA/B and hbd composing the bcs (butyryl-CoA synthesis) operon of C. tetanomorphum GT6 were sequenced. They occur in a genomic arrangement identical to those in other solventogenic clostridia. Furthermore, the sequence of a potential regulator gene highly similar to that of the NADH-sensing Rex family of regulatory genes was found upstream of the bcs operon. Potential binding sites for Rex have been identified in the promoter region of the bcs operon of solvent producing clostridia as well as upstream of other genes involved in NADH oxidation. This indicates a fundamental role of Rex in the regulation of fermentation products in anaerobic, and especially in solventogenic bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.
Best polynomial degree reduction on q-lattices with applications to q-orthogonal polynomials
Ait-Haddou, Rachid
2015-06-07
We show that a weighted least squares approximation of q-Bézier coefficients provides the best polynomial degree reduction in the q-L2-norm. We also provide a finite analogue of this result with respect to finite q-lattices and we present applications of these results to q-orthogonal polynomials. © 2015 Elsevier Inc. All rights reserved.
Best polynomial degree reduction on q-lattices with applications to q-orthogonal polynomials
Ait-Haddou, Rachid; Goldman, Ron
2015-01-01
We show that a weighted least squares approximation of q-Bézier coefficients provides the best polynomial degree reduction in the q-L2-norm. We also provide a finite analogue of this result with respect to finite q-lattices and we present applications of these results to q-orthogonal polynomials. © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jacob Sode
Full Text Available To determine whether genetic variation within genes related to the Toll-like receptor, inflammasome and interferon-γ pathways contributes to the differences in treatment response to tumour necrosis factor inhibitors (anti-TNF in patients with rheumatoid arthritis (RA.In a retrospective case-case study, we assessed 23 functional single nucleotide polymorphisms (SNPs in 15 genes. We included 538 anti-TNF naïve Danish RA patients from the nationwide DANBIO database. Multivariable logistic regression analyses were performed to detect associations (p-value<0.05 between genotypes and European League Against Rheumatism (EULAR treatment responses. False Discovery Rate corrections for multiple testing (q-value and stratified analyses were performed to investigate association with individual therapies and IgM-rheumatoid factor (RF status.Six of twenty successfully genotyped polymorphisms were nominally associated with EULAR treatment response. Three of these were in weak to moderate linkage disequilibrium with polymorphisms previously reported associated with anti-TNF treatment response. TLR5(rs5744174 variant allele carriers (odds ratio(OR = 1.7(1.1-2.5,p = 0.010,q = 0.46 and TLR1(rs4833095 homozygous variant carriers (OR = 2.8(1.1-7.4,p = 0.037,q = 0.46 had higher odds for a positive treatment response. NLRP3(rs10754558 variant allele carriers (odds ratio(OR = 0.6(0.4-1.0,p = 0.045,q = 0.46 were more likely to have a negative treatment response. The association in TLR5(rs5744174 remained significant after correction for multiple comparisons among patients negative for RF (OR = 6.2(2.4-16.3,p = 0.0002,q = 0.024. No other association withstood correction for multiple testing. Post hoc analyses showed that change in Patient Global score on a visual analogue scale (VAS and change in pain VAS were the main factors responsible for the association.We reproduced previously reported associations between genetic variation in the TLR10/1/6 gene cluster, TLR5
Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier
2017-01-01
The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.
q-analogue of summability of formal solutions of some linear q-difference-differential equations
Directory of Open Access Journals (Sweden)
Hidetoshi Tahara
2015-01-01
Full Text Available Let \\(q\\gt 1\\. The paper considers a linear \\(q\\-difference-differential equation: it is a \\(q\\-difference equation in the time variable \\(t\\, and a partial differential equation in the space variable \\(z\\. Under suitable conditions and by using \\(q\\-Borel and \\(q\\-Laplace transforms (introduced by J.-P. Ramis and C. Zhang, the authors show that if it has a formal power series solution \\(\\hat{X}(t,z\\ one can construct an actual holomorphic solution which admits \\(\\hat{X}(t,z\\ as a \\(q\\-Gevrey asymptotic expansion of order \\(1\\.
The q-Onsager algebra and multivariable q-special functions
Baseilhac, Pascal; Vinet, Luc; Zhedanov, Alexei
2017-09-01
Two sets of mutually commuting q-difference operators x i and y j , i,j=1,...,N such that x i and y i generate a homomorphic image of the q-Onsager algebra for each i are introduced. The common polynomial eigenfunctions of each set are found to be entangled product of elementary Pochhammer functions in N variables and N+3 parameters. Under certain conditions on the parameters, they form two ‘dual’ bases of polynomials in N variables. The action of each operator with respect to its dual basis is block tridiagonal. The overlap coefficients between the two dual bases are expressed as entangled products of q-Racah polynomials and satisfy an orthogonality relation. The overlap coefficients between either one of these bases and the multivariable monomial basis are also considered. One obtains in this case entangled products of dual q-Krawtchouk polynomials. Finally, the ‘split’ basis in which the two families of operators act as block bidiagonal matrices is also provided.
Zhu, Y; Lin, E C
1988-05-01
L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.
The adaptation study of the Q-sport-14 scale for the private sport establishments
Directory of Open Access Journals (Sweden)
Mehmet ÖZTÜRK
2016-03-01
Full Text Available Aim: The objective of this study is to adapt the “Q-SPORT 14” scale which is a tool to measure service quality for the private sport establishments. Material and Methods: The “Q-SPORT 10” scale, developed by Rial et al. (2010, reliability and validity study was conducted by Yıldız (2011 and adapted in Turkish, was used as data gathering tool. Total 585 scales were distributed to the participants and were withdrawn. The researcher ignored 103 of them due to incomplete marking. In the study, factor analysis, the rotated components matrix test, KMO and Barlet sphericity test, and the anti-image correlation test and reliability analaysis were used. The significance level was p<0.05 and the confidence interval was 95%. Results: KMO test was performed for the suitability of the sample size and it was 0.905. Bartlett sphericity test score was significant (p <0.01. The total variance description exposed 2 factors that Eigenvalues were higher than 1 and contributions to variance of these factors are 55%. After rotated components matrix analysis two sub-dimensions were identified (higher greater than 0.5; 9 items were related to "program and instructor quality" and the rest 5 items were related to “the physical environment and quality of equipment." The anti-image correlation presented that all items were higher than 0.5 All scores were more higher than 0.3 in the corrected item-total correlation and higher than 0.7 in Cronbach's alpha when item deleted. Conclusion: Q-SPORT 14 scale is highly reliable and usable measurement tool to test service quality in private sport establishments.
Strangeness production at low Q{sup 2} in deep-inelastic ep scattering at HERA
Energy Technology Data Exchange (ETDEWEB)
Aaron, F.D.; Alexa, C.; Preda, T.; Rotaru, M. [National Institute for Physics and Nuclear Engineering (NIPNE), Bucharest (Romania); Andreev, V.; Belousov, A.; Eliseev, A.; Fomenko, A.; Gogitidze, N.; Lebedev, A.; Loktionova, N.; Malinovski, E.; Rusakov, S.; Sheviakov, I.; Shtarkov, L.N.; Smirnov, P.; Soloviev, Y.; Vazdik, Y. [Lebedev Physical Institute, Moscow (Russian Federation); Antunovic, B.; Aplin, S.; Bacchetta, A.; Bartel, W.; Beckingham, M.; Brandt, G.; Brinkmann, M.; Campbell, A.J.; Cholewa, A.; Deak, M.; Boer, Y. de; Roeck, A. de; Eckerlin, G.; Elsen, E.; Felst, R.; Fleischer, M.; Gayler, J.; Glazov, A.; Grell, B.R.; Haidt, D.; Helebrant, C.; Janssen, M.E.; Jung, H.; Katzy, J.; Kleinwort, C.; Klimkovich, T.; Knutsson, A.; Korbel, V.; Kraemer, M.; Krastev, K.; Kutak, K.; Levonian, S.; List, J.; Lucaci-Timoce, A.I.; Marti, Ll.; Meyer, A.B.; Meyer, H.; Meyer, J.; Michels, V.; Niebuhr, C.; Nikiforov, A.; Nozicka, M.; Olsson, J.E.; Panagoulias, I.; Papadopoulou, T.; Peng, H.; Pitzl, D.; Placakyte, R.; Radescu, V.; Rurikova, Z.; Salvaire, F.; Schmidt, S.; Schmitt, S.; Sefkow, F.; Staykova, Z.; Steder, M.; Toll, T.; Vargas Trevino, A.; Vinokurova, S.; Wessels, M.; Wissing, C.; Wuensch, E.; Zhu, Y.C. [DESY, Hamburg (Germany); Asmone, A.; Stella, B. [Dipt. di Fisica Universita di Roma Tre (Italy); INFN Roma 3, Roma (Italy); Astvatsatourov, A.; Delvax, J.; Wolf, E.A. de; Favart, L.; Hreus, T.; Janssen, X.; Marage, P.; Mozer, M.U.; Roland, B.; Roosen, R.; Sunar, D.; Sykora, T.; Mechelen, P. van [Inter-University Inst. for High Energies ULB-VUB, Brussels (Belgium); Univ. Antwerpen, Antwerpen (Belgium); Backovic, S.; Dubak, A.; Lastovicka-Medin, G.; Picuric, I.; Raicevic, N. [Univ. of Montenegro, Faculty of Science, Podgorica (ME); Baghdasaryan, A.; Ghazaryan, S.; Hovhannisyan, A.; Volchinski, V.; Yeganov, V.; Zohrabyan, H. [Yerevan Physics Inst., Yerevan (Armenia); Barrelet, E. [Universites Paris VI et VII, IN2P3-CNRS, LPNHE, Paris (France)] [and others
2009-05-15
The production of neutral strange hadrons is investigated using deep-inelastic scattering events measured with the H1 detector at HERA. The measurements are made in the phase space defined by the negative four-momentum transfer squared of the photon 2<Q{sup 2}<100 GeV{sup 2} and the inelasticity 0.1
Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A
2017-11-01
The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and
Directory of Open Access Journals (Sweden)
Opsata Mona
2010-08-01
Full Text Available Abstract Background The class IIa bacteriocin, pediocin PA-1, has clear potential as food preservative and in the medical field to be used against Gram negative pathogen species as Enterococcus faecalis and Listeria monocytogenes. Resistance towards class IIa bacteriocins appear in laboratory and characterization of these phenotypes is important for their application. To gain insight into bacteriocin resistance we studied mutants of E. faecalis V583 resistant to pediocin PA-1 by use of transcriptomic analyses. Results Mutants of E. faecalis V583 resistant to pediocin PA-1 were isolated, and their gene expression profiles were analyzed and compared to the wild type using whole-genome microarray. Significantly altered transcription was detected from about 200 genes; most of them encoding proteins involved in energy metabolism and transport. Glycolytic genes were down-regulated in the mutants, but most of the genes showing differential expression were up-regulated. The data indicate that the mutants were relieved from glucose repression and putative catabolic responsive elements (cre could be identified in the upstream regions of 70% of the differentially expressed genes. Bacteriocin resistance was caused by reduced expression of the mpt operon encoding the mannose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS, and the same transcriptional changes were seen in a mptD-inactivated mutant. This mutant also had decreased transcription of the whole mpt operon, showing that the PTS is involved in its own transcriptional regulation. Conclusion Our data confirm the important role of mannose PTS in class IIa bacteriocin sensitivity and we demonstrate its importance involving global carbon catabolite control.
Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar
2011-06-10
The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.
Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon
DEFF Research Database (Denmark)
van Wezel, G P; Krab, I M; Douthwaite, S
1994-01-01
Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...
Quark-anti-quark potential in N=4 SYM
Energy Technology Data Exchange (ETDEWEB)
Gromov, Nikolay [Mathematics Department, King’s College London,The Strand, London WC2R 2LS (United Kingdom); St. Petersburg INP,Gatchina, 188 300, St.Petersburg (Russian Federation); Levkovich-Maslyuk, Fedor [Mathematics Department, King’s College London,The Strand, London WC2R 2LS (United Kingdom); Nordita, KTH Royal Institute of Technology and Stockholm University, Roslagstullsbacken 23, SE-106 91 Stockholm (Sweden)
2016-12-22
We construct a closed system of equations describing the quark-anti-quark potential at any coupling in planar N=4 supersymmetric Yang-Mills theory. It is based on the Quantum Spectral Curve method supplemented with a novel type of asymptotics. We present a high precision numerical solution reproducing the classical and one-loop string predictions very accurately. We also analytically compute the first 7 nontrivial orders of the weak coupling expansion. Moreover, we study analytically the generalized quark-anti-quark potential in the limit of large imaginary twist to all orders in perturbation theory. We demonstrate how the QSC reduces in this case to a one-dimensional Schrodinger equation. In the process we establish a link between the Q-functions and the solution of the Bethe-Salpeter equation.
Criado, Raquel; Gutiérrez, Jorge; Martín, María; Herranz, Carmen; Hernández, Pablo E; Cintas, Luis M
2006-12-01
Polyclonal antibodies with specificity for enterocin L50A (EntL50A), enterocin L50B (EntL50B), and enterocin Q (EntQ) produced by Enterococcus faecium L50 have been generated by immunization of rabbits with chemically synthesized peptides derived from the C terminus of EntL50A (LR1) and EntL50B (LR2) and from the complete enterocin Q (EntQ) conjugated to the carrier protein keyhole limpet hemocyanin (KLH). The sensitivity and specificity of these antibodies were evaluated by a noncompetitive indirect enzyme-linked immunosorbent assay (NCI-ELISA) and a competitive indirect ELISA (CI-ELISA). The NCI-ELISA was valuable for detecting anti-EntL50A-, anti-EntL50B-, and anti-EntQ-specific antibodies in the sera of the LR1-KLH-, LR2-KLH-, and EntQ-KLH-immunized animals, respectively. Moreover, these antibodies and those specific for enterocin P (EntP) obtained in a previous work (J. Gutiérrez, R. Criado, R. Citti, M. Martín, C. Herranz, M. F. Fernández, L. M. Cintas, and P. E. Hernández, J. Agric. Food Chem. 52:2247-2255, 2004) were used in an NCI-ELISA to detect and quantify the production of EntL50A, EntL50B, EntP, and EntQ by the multiple-bacteriocin producer E. faecium L50 grown at different temperatures (16 to 47 degrees C). Our results show that temperature has a strong influence on bacteriocin production by this strain. EntL50A and EntL50B are synthesized at 16 to 32 degrees C, but production becomes negligible when the growth temperature is above 37 degrees C, whereas EntP and EntQ are synthesized at temperatures ranging from 16 to 47 degrees C. Maximum EntL50A and EntL50B production was detected at 25 degrees C, while EntP and EntQ are maximally produced at 37 and 47 degrees C, respectively. The loss of plasmid pCIZ1 (50 kb) and/or pCIZ2 (7.4 kb), encoding EntL50A and EntL50B as well as EntQ, respectively, resulted in a significant increase in production and stability of the chromosomally encoded EntP.
Directory of Open Access Journals (Sweden)
April M Sapp
Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and
Huang, Teng; Liu, Youping; Li, Yanping; Liao, Yuqin; Shou, Qiong; Zheng, Minghuan; Liao, Xueyan; Li, Rongcheng
2018-03-07
This was an extension study of a randomized, double-blind, placebo-controlled immunogenicity and safety study of the quadrivalent human papillomavirus (qHPV) (HPV 6, 11, 16, and 18) vaccine conducted in Chinese female subjects aged 9-45 years and male subjects aged 9-15 years. To investigate the persistence of anti-HPV 6, -11, -16, and -18 responses among Chinese subjects, subjects enrolled in the base study were followed up at around month 42 (approximately 3.5 years after vaccination). Among 600 subjects enrolled in the base study, a total of 468 subjects consented for participation in the extension study. Anti-HPV 6, -11, -16, and -18 antibodies were detected by the competitive Luminex immunoassay (cLIA) and total IgG Luminex immunoassay (IgG LIA). Among the female subjects who received the qHPV vaccine, the proportions of subjects remained seropositive were high with both the cLIA and IgG LIA for HPV type 6, 11, and 16 through approximately 42 months following the first dose vaccination. For HPV 18, the seropositivity rate remained high as 82.0% with the IgG LIA, while it decreased to 53.6% with the cLIA, which was similar to the findings observed in other studies. The seropositivity rates remained high at month 42 for all qHPV types with both the cLIA and IgG LIA among the male subjects. Administration of a 3-dose regimen of qHPV vaccine induces durable anti-HPV 6, anti-HPV 11, anti-HPV 16, and anti-HPV 18 responses among Chinese subjects for at least 3.5 years after vaccination. ClinicalTrials.gov registry:NCT01427777. Copyright © 2018. Published by Elsevier Ltd.
Maths-type q-deformed coherent states for q>1
International Nuclear Information System (INIS)
Quesne, C.; Penson, K.A.; Tkachuk, V.M.
2003-01-01
Maths-type q-deformed coherent states with q>1 allow a resolution of unity in the form of an ordinary integral. They are sub-Poissonian and squeezed. They may be associated with a harmonic oscillator with minimal uncertainties in both position and momentum and are intelligent coherent states for the corresponding deformed Heisenberg algebra
Two girls with a de novo Xq rearrangement of paternal origin: t(X;9(q24;q12 or rea(Xdup q
Directory of Open Access Journals (Sweden)
Ana I. Vásquez-Velásquez
2016-04-01
Full Text Available Objective: We report on two rare Xq rearrangements, namely a t(X;9(q24;q12 found in a mildly-affected girl (Patient 1 and a rea(Xdup q concomitant with a rob(14;21mat in a Down syndrome girl (Patient 2. Case report: Both rearrangements were characterized by banding techniques [Giemsa (G, constitutive heterochromatin (C, and bromodeoxyuridine (BrdU pulse], fluorescence in situ hybridization (FISH assays, human androgen receptor (HUMAR assays, and microarray analyses. Patient 1 had a t(X;9(q24;q12dn. Patient 2 had a de novo rea(X(qter→q23 or q24::p11.2→qter concomitant with an unbalanced rob(14;21mat. X-Inactivation studies in metaphases and DNA revealed a fully skewed inactivation: the normal homolog was silenced in Patient 1 and the rea(X in Patient 2. Both rearranged X chromosomes were of paternal descent. Microarray analyses revealed no imbalances in Patient 1 whereas loss of Xp (∼52 Mb and duplication of Xq (∼44 Mb and 21q were confirmed in Patient 2. Conclusion: Our observations further document the cytogenetic heterogeneity and predominant paternal origin of certain de novo X-chromosome rearrangements.
High rates of de novo 15q11q13 inversions in human spermatozoa
Directory of Open Access Journals (Sweden)
Molina Òscar
2012-02-01
Full Text Available Abstract Low-Copy Repeats predispose the 15q11-q13 region to non-allelic homologous recombination. We have already demonstrated that a significant percentage of Prader-Willi syndrome (PWS fathers have an increased susceptibility to generate 15q11q13 deletions in spermatozoa, suggesting the participation of intrachromatid exchanges. This work has been focused on assessing the incidence of de novo 15q11q13 inversions in spermatozoa of control donors and PWS fathers in order to determine the basal rates of inversions and to confirm the intrachromatid mechanism as the main cause of 15q11q13 anomalies. Semen samples from 10 control donors and 16 PWS fathers were processed and analyzed by triple-color FISH. Three differentially labeled BAC-clones were used: one proximal and two distal of the 15q11-q13 region. Signal associations allowed the discrimination between normal and inverted haplotypes, which were confirmed by laser-scanning confocal microscopy. Two types of inversions were detected which correspond to the segments involved in Class I and II PWS deletions. No significant differences were observed in the mean frequencies of inversions between controls and PWS fathers (3.59% ± 0.46 and 9.51% ± 0.87 vs 3.06% ± 0.33 and 10.07% ± 0.74. Individual comparisons showed significant increases of inversions in four PWS fathers (P Results suggest that the incidence of heterozygous inversion carriers in the general population could reach significant values. This situation could have important implications, as they have been described as predisposing haplotypes for genomic disorders. As a whole, results confirm the high instability of the 15q11-q13 region, which is prone to different types of de novo reorganizations by intrachromatid NAHR.
Q4 2017/Q1 2018 Solar Industry Update
Energy Technology Data Exchange (ETDEWEB)
Feldman, David J [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Margolis, Robert M [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Hoskins, Jack [U.S. Department of Energy
2018-05-16
This technical presentation provides an update on the major trends that occurred in the solar industry in Q4 2017 and Q1 2018. Major topics of focus include global and U.S. supply and demand, module and system price, investment trends and business models, and updates on U.S. government programs supporting the solar industry.
Preparation of a tritium Q-value measurement in a double penning trap
Energy Technology Data Exchange (ETDEWEB)
Diehl, Christoph; Orth, Christoph; Blaum, Klaus [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Physikalisches Institut, Ruprecht-Karls-Universitaet, Heidelberg (Germany); Pinegar, David [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Van Dyck, Robert Jr. [Department of Physics, University of Washington, Seattle (United States)
2009-07-01
A precise determination of the Q-value of tritium ({sup 3}H) is of relevance for the determination of the electron anti-neutrino mass as aspired by the Karlsruhe Tritium Neutrino Experiment (KATRIN). In our double Penning trap mass spectrometer we aim to measure the mass ratio of {sup 3}H and its {beta}-decay product {sup 3}He to an accuracy of 10{sup -11}, which would determine the Q-value to an accuracy of 30 meV. The spectrometer we utilize is an enhanced version of the University of Washington Penning trap mass spectrometer (UW-PTMS) and was recently transfered from Seattle to Heidelberg, where it is set up at the moment as the MPIK/UW-PTMS. We present the necessary preparation work at the Max-Planck-Institut fuer Kernphysik. This includes major reconstructions of the building as well as studies and control of environmental parameters in the laboratory, like temperature and magnetic field.
High density low-q discharges with D-shaped plasmas in Doublet III
International Nuclear Information System (INIS)
Nagami, Masayuki; Yoshida, Hidetoshi; Shinya, Kichiro; Yokomizo, Hideaki; Shimada, Michiya; Ioki, Kimihiro; Izumi, Shigeru; Kitsunezaki, Masao; Jahns, G.
1981-07-01
The maximum plasma current in Doublet III is found to be limited by disruptions when the limiter safety factor is approximately 2. However, due to the strong toroidal and shaping field effect on rotational transform at the outer plasma edge associated with a D-shape formation having a vertical elongation of 1.5, the safety factor q sub(a) * estimated from simple geometric considerations for D-shaped plasmas corresponds to values as low as 1.5. These discharges operate stably with considerably higher plasma current than most reactor design studies assume. These low-q discharges show excellent plasma performance: very flat spatial electron temperature progiles, high density operation with anti n sub(e)R/B sub(T) up to 7.8, and good energy confinement producing a volume average β of up to 1% with ohmic heating only. This operational regime appears to be applicable to future high β tokamaks with D-shaped cross section. (author)
DEFF Research Database (Denmark)
Koch, Anders; Svendsen, Claus Bo; Christensen, Jens Jorgen
2010-01-01
We report a patient with Q fever endocarditis in a settlement in eastern Greenland (Isortoq, Ammassalik area). Likely animal sources include sled dogs and seals. Q fever may be underdiagnosed in Arctic areas but may also represent an emerging infection.......We report a patient with Q fever endocarditis in a settlement in eastern Greenland (Isortoq, Ammassalik area). Likely animal sources include sled dogs and seals. Q fever may be underdiagnosed in Arctic areas but may also represent an emerging infection....
Formation of q bar q resonances in the bar NN system
International Nuclear Information System (INIS)
Ivanov, N.Ya.
1995-01-01
The formation of q bar q resonances lying on the leading Regge trajectories in the bar NN system is studied in the quark-gluon string model. The model predicts strong suppression of the decays of q bar q states into bar NN pairs in relation to two-meson modes. The author's analysis shows that the contributions of the resonances f 4 (2050) (I G J PC = 0 + 4 ++ ), ρ 5 (2240) (I G J PC = 1 + 5 -- ), and f 6 (2510) (I G J PC = 0 + 6 ++ ) to the processes of two-meson bar NN annihilation (bar pp → ππ, bar KK, hor-ellipsis) are about 1% of the corresponding experimental integrated cross sections. 30 refs., 2 figs., 1 tab
Numerical and Experimental Study of the Q Factor of High-Q Micropillar Cavities
DEFF Research Database (Denmark)
Gregersen, Niels; Reitzenstein, S.; Kistner, C.
2010-01-01
Micropillar cavities are potential candidates for high-efficiency single-photon sources and are testbeds for cavity quantum electrodynamics experiments. In both applications a high quality (Q) factor is desired. It was recently shown that the Q of high-Q semiconductor micropillar cavities exhibit...
Chen, Wei; Chen, Hua-Xing; Liu, Xiang; Steele, T. G.; Zhu, Shi-Lin
2017-12-01
We have studied the mass spectra of the hidden-charm/bottom q c q ¯c ¯, s c s ¯c ¯ and q b q ¯b ¯, s b s ¯b ¯ tetraquark states with JP C=0++ and 2++ in the framework of QCD sum rules. We construct ten scalar and four tensor interpolating currents in a systematic way and calculate the mass spectra for these tetraquark states. The X*(3860 ) may be either an isoscalar tetraquark state or χc 0(2 P ). If the X*(3860 ) is a tetraquark candidate, our results prefer the 0++ option over the 2++ one. The X (4160 ) may be classified as either the scalar or tensor q c q ¯c ¯ tetraquark state, while the X (3915 ) favors a 0++ q c q ¯c ¯ or s c s ¯c ¯ tetraquark assignment over the tensor one. The X (4350 ) cannot be interpreted as a s c s ¯c ¯ tetraquark with either JP C=0++ or 2++.
Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel
2014-01-01
Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.
International Nuclear Information System (INIS)
Lima, A.F. de
2003-01-01
The q-deformed kink of the λφ 4 -model is obtained via the normalisable ground state eigenfunction of a fluctuation operator associated with the q-deformed hyperbolic functions. The kink mass, the bosonic zero-mode and the q-deformed potential in 1+1 dimensions are found. (author)
Probing lepton-flavour universality with K → πν anti ν decays
Energy Technology Data Exchange (ETDEWEB)
Bordone, Marzia; Buttazzo, Dario; Isidori, Gino; Monnard, Joachim [Universitaet Zuerich, Physik-Institut, Zurich (Germany)
2017-09-15
We analyse the rare processes K → πν anti ν in view of the recent hints of violations of lepton-flavour universality (LFU) observed in B meson decays. If, as suggested by present data, the new interactions responsible for LFU violations couple mainly to the third generation of left-handed fermions, K → πν anti ν decays turn out to be particularly interesting: these are the only kaon decays with third-generation leptons (the τ neutrinos) in the final state. In order to relate B-physics anomalies and K decays we adopt an effective field theory approach, assuming that the new interactions satisfy an approximate U(2){sub q} x U(2){sub l} flavour symmetry. In this framework we show that O(1) deviations from the Standard Model predictions in K → πν anti ν branching ratios, closely correlated to similar effects in B → K{sup (*)}ν anti ν, are naturally expected. The correlation of B(K → πν anti ν), B(B → K{sup (*)}ν anti ν), and the LFU violations in B decays would provide a very valuable tool to shed more light on this interesting phenomenon. (orig.)
Exploring open-charm decay mode Λ{sub c} anti Λ{sub c} of charmonium-like state Y(4630)
Energy Technology Data Exchange (ETDEWEB)
Liu, Xuewen; Li, Xue-Qian [Nankai University, School of Physics, Tianjin (China); Ke, Hong-Wei [Tianjin University, School of Science, Tianjin (China); Liu, Xiang [Lanzhou University, School of Physical Science and Technology, Lanzhou (China); Lanzhou University and Institute of Modern Physics of CAS, Research Center for Hadron and CSR Physics, Lanzhou (China)
2016-10-15
The newly observed X, Y, Z exotic states are definitely not in the standard Q anti Q{sup '} structures, thus their existence composes a challenge to our understanding on the fundamental principles of hadron physics. Therefore the studies on their decay patterns which are determined by the non-perturbative QCD will definitely shed light on the concerned physics. Generally the four-quark states might be in a molecular state or tetraquark or their mixture. In this work, we adopt the suggestion that Y(4630) is a charmonium-like tetraquark made of a diquark and an anti-diquark. If it is true, its favorable decay mode should be Y(4630) decaying into an open-charm baryon pair, since such a transition occurs via strong interaction and is super-OZI-allowed. In this work, we calculate the decay width of Y(4630) → Λ{sub c} anti Λ{sub c} in the framework of the quark pair creation model. Our numerical results on the partial width computed in the tetraquark configuration coincide with the Belle data within a certain error tolerance. (orig.)
q-fractional calculus and equations
Annaby, Mahmoud H
2012-01-01
This nine-chapter monograph introduces a rigorous investigation of q-difference operators in standard and fractional settings. It starts with elementary calculus of q-differences and integration of Jackson’s type before turning to q-difference equations. The existence and uniqueness theorems are derived using successive approximations, leading to systems of equations with retarded arguments. Regular q-Sturm–Liouville theory is also introduced; Green’s function is constructed and the eigenfunction expansion theorem is given. The monograph also discusses some integral equations of Volterra and Abel type, as introductory material for the study of fractional q-calculi. Hence fractional q-calculi of the types Riemann–Liouville; Grünwald–Letnikov; Caputo; Erdélyi–Kober and Weyl are defined analytically. Fractional q-Leibniz rules with applications in q-series are also obtained with rigorous proofs of the formal results of Al-Salam-Verma, which remained unproved for decades. In working ...
A characterization of the desarguesian planes of order q2 by SL(2,q
Directory of Open Access Journals (Sweden)
D. A. Foulser
1983-01-01
Full Text Available The main result is that if the translation complement of a translation plane of order q2 contains a group isomorphic to SL(2,q and if the subgroups of order q are elations (shears, then the plane is Desarguesian. This generalizes earlier work of Walker, who assumed that the kernel of the plane contained GF(q.
Directory of Open Access Journals (Sweden)
Kristen Dilzell
2015-01-01
Full Text Available This case report concerns a 16-year-old girl with a 9.92 Mb, heterozygous interstitial chromosome deletion at 7q33-q35, identified using array comparative genomic hybridization. The patient has dysmorphic facial features, intellectual disability, recurrent infections, self-injurious behavior, obesity, and recent onset of hemihypertrophy. This patient has overlapping features with previously reported individuals who have similar deletions spanning the 7q32-q36 region. It has been difficult to describe an interstitial 7q deletion syndrome due to variations in the sizes and regions in the few patients reported in the literature. This case contributes to the further characterization of an interstitial distal 7q deletion syndrome.
The Escherichia coli COG1738 Member YhhQ Is Involved in 7-Cyanodeazaguanine (preQ0 Transport
Directory of Open Access Journals (Sweden)
Rémi Zallot
2017-02-01
Full Text Available Queuosine (Q is a complex modification of the wobble base in tRNAs with GUN anticodons. The full Q biosynthesis pathway has been elucidated in Escherichia coli. FolE, QueD, QueE and QueC are involved in the conversion of guanosine triphosphate (GTP to 7-cyano-7-deazaguanine (preQ0, an intermediate of increasing interest for its central role in tRNA and DNA modification and secondary metabolism. QueF then reduces preQ0 to 7-aminomethyl-7-deazaguanine (preQ1. PreQ1 is inserted into tRNAs by tRNA guanine(34 transglycosylase (TGT. The inserted base preQ1 is finally matured to Q by two additional steps involving QueA and QueG or QueH. Most Eubacteria harbor the full set of Q synthesis genes and are predicted to synthesize Q de novo. However, some bacteria only encode enzymes involved in the second half of the pathway downstream of preQ0 synthesis, including the signature enzyme TGT. Different patterns of distribution of the queF, tgt, queA and queG or queH genes are observed, suggesting preQ0, preQ1 or even the queuine base being salvaged in specific organisms. Such salvage pathways require the existence of specific 7-deazapurine transporters that have yet to be identified. The COG1738 family was identified as a candidate for a missing preQ0/preQ1 transporter in prokaryotes, by comparative genomics analyses. The existence of Q precursor salvage was confirmed for the first time in bacteria, in vivo, through an indirect assay. The involvement of the COG1738 in salvage of a Q precursor was experimentally validated in Escherichia coli, where it was shown that the COG1738 family member YhhQ is essential for preQ0 transport.
Anti-symmetric rank-two tensor matter field on superspace for N{sub T}=2
Energy Technology Data Exchange (ETDEWEB)
Spalenza, Wesley; Ney, Wander G; Helayel-Neto, J A
2004-05-06
In this work, we discuss the interaction between anti-symmetric rank-two tensor matter and topological Yang-Mills fields. The matter field considered here is the rank-2 Avdeev-Chizhov tensor matter field in a suitably extended N{sub T}=2 SUSY. We start off from the N{sub T}=2, D=4 superspace formulation and we go over to Riemannian manifolds. The matter field is coupled to the topological Yang-Mills field. We show that both actions are obtained as Q-exact forms, which allows us to express the energy-momentum tensor as Q-exact observables.
BLV-CoCoMo-qPCR: a useful tool for evaluating bovine leukemia virus infection status
Directory of Open Access Journals (Sweden)
Jimba Mayuko
2012-09-01
Full Text Available Abstract Background Bovine leukemia virus (BLV is associated with enzootic bovine leukosis, which is the most common neoplastic disease of cattle. BLV infects cattle worldwide, imposing a severe economic impact on the dairy cattle industry. Recently, we developed a new quantitative real-time polymerase chain reaction (PCR method using Coordination of Common Motifs (CoCoMo primers to measure the proviral load of known and novel BLV variants in BLV-infected animals. Indeed, the assay was highly effective in detecting BLV in cattle from a range of international locations. This assay enabled us to demonstrate that proviral load correlates not only with BLV infection capacity as assessed by syncytium formation, but also with BLV disease progression. In this study, we compared the sensitivity of our BLV-CoCoMo-qPCR method for detecting BLV proviruses with the sensitivities of two real-time PCR systems, and also determined the differences of proviral load with serotests. Results BLV-CoCoMo-qPCR was found to be highly sensitive when compared with the real-time PCR-based TaqMan MGB assay developed by Lew et al. and the commercial TaKaRa cycleave PCR system. The BLV copy number determined by BLV-CoCoMo-qPCR was only partially correlated with the positive rate for anti-BLV antibody as determined by the enzyme-linked immunosorbent assay, passive hemagglutination reaction, or agar gel immunodiffusion. This result indicates that, although serotests are widely used for the diagnosis of BLV infection, it is difficult to detect BLV infection with confidence by using serological tests alone. Two cattle were experimentally infected with BLV. The kinetics of the provirus did not precisely correlate with the change in anti-BLV antibody production. Moreover, both reactions were different in cattle that carried different bovine leukocyte antigen (BoLA-DRB3 genotypes. Conclusions Our results suggest that the quantitative measurement of proviral load by BLV-CoCoMo-q
q-Power function over q-commuting variables and deformed XXX, XXZ chains
International Nuclear Information System (INIS)
Khoroshkin, S.M.; Stolin, A.A.; Tolstoy, V.N.
2001-01-01
Certain functional identifies for the Gauss q-power function of a sum of q-commuting variables are found. Then these identifies are used to obtain two-parameter twists of the quantum affine algebra U q (sl 2 ) and of the Yangian Y(sl 2 ). The corresponding deformed trigonometric and rational quantum R matrices, which then are used in the computation of deformed XXX and XXZ Hamiltonians [ru
Economic significance of Q for mirror reactors: combinations of Q and M which look promising
International Nuclear Information System (INIS)
Werner, R.W.
1978-01-01
This term Q is the ratio of the fusion powder produced to the power input. It is a driven device. Q is truly the success parameter for mirrors--widely discussed but not succinctly specified as to required value. The problem is that Q can be treated as a subjective parameter--there are many milestone Qs; for scientific demonstration, for breakeven power, etc. Yet for a successful reactor, there is only one Q and that is the Q which produces mirror fusion power at the busbar that is less than the cost of delivered power in mills/kwhr by other means. We call this Q/sub PRACTICAL/ and believe there is a convincing argument that says this Q/sub PRACTICAL/ can be about 5.0 even assuming modest efficiencies for system components. A direct convertor is necessary. If the direct convertor were deleted, a Q/sub PRACTICAL/ of approximately 7.5 would be required. If we wish to soften the value of Q further, then the technical logic for the fusion fission hybrid is very powerful. With the hybrid a Q/sub PRACTICAL/ of 1.5 to 2.0 appears to be a very reasonable value. The key in being able to specify values of Q/sub PRACTICAL/ lies in economically comparing the capital cost of fusion power to the sum of the capital cost and the present value of all the fuel costs for the competitive fuel intensive plants
International Nuclear Information System (INIS)
Gill, R.D.; Edwards, A.W.; Keegan, B.; Lazzaro, E.; O'Rourke, J.; Weller, A.; Zasche, D.
1989-01-01
Tokamak q-profiles play a central role in the determination of plasma stability and q(r) towards the plasma centre is particularly important for the sawtooth instability. On JET, q(r) has been determined from magnetic measurements and Faraday rotation. Further information about the position of the q=1 surface has been found from the sawtooth inversion radius, the position of the snake and the resonance effect observed on visible light and X-ray emission during pellet injection. In addition the shear at the q=1 surface has been measured from pellet ablation. This result is supported by the movement of the snake caused by a sawtooth crash. A summary of these data will be made after presenting the new results from pellet ablation. (author) 5 refs., 8 figs
Energy Technology Data Exchange (ETDEWEB)
Bazeia, D., E-mail: bazeia@fisica.ufpb.br [Departamento de Física, Universidade Federal da Paraíba, 58051-970 João Pessoa, PB (Brazil); Losano, L.; Marques, M.A. [Departamento de Física, Universidade Federal da Paraíba, 58051-970 João Pessoa, PB (Brazil); Menezes, R. [Departamento de Ciências Exatas, Universidade Federal da Paraíba, 58297-000 Rio Tinto, PB (Brazil); Departamento de Física, Universidade Federal de Campina Grande, 58109-970 Campina Grande, PB (Brazil); Rocha, R. da [Centro de Matemática, Computação e Cognição, Universidade Federal do ABC, 09210-580 Santo André (Brazil)
2016-07-10
In this work we deal with non-topological solutions of the Q-ball type in two space–time dimensions, in models described by a single complex scalar field that engenders global symmetry. The main novelty is the presence of stable Q-balls solutions that live in a compact interval of the real line and appear from a family of models controlled by two distinct parameters. We find analytical solutions and study their charge and energy, and show how to control the parameters to make the Q-balls classically and quantum mechanically stable.
Anti-wrinkle and anti-whitening effects of jucá (Libidibia ferrea Mart.) extracts.
Pedrosa, Tatiana do Nascimento; Barros, Aline Oliveira; Nogueira, Jéssica Rodrigues; Fruet, Andréa Costa; Rodrigues, Isis Costa; Calcagno, Danielle Queiroz; Smith, Marilia de Arruda Cardoso; de Souza, Tatiane Pereira; Barros, Silvia Berlanga de Moraes; de Vasconcellos, Marne Carvalho; Silva, Felipe Moura Araújo da; Koolen, Hector Henrique Ferreira; Maria-Engler, Silvya Stuchi; Lima, Emerson Silva
2016-11-01
Skin aging is a natural process of the human body that may be accelerated due to extrinsic causes. Libidibia ferrea, popularly known as jucá, is a small tree, which possesses an abundant phenolic composition with potential antioxidant and enzymatic inhibition activities. Thus, this work aimed to investigate the anti-wrinkle and anti-whitening potentials of jucá trunk bark (LFB) and pod (LFP) extracts. A comprehensive analysis of LFB and LFP phenolic composition was accomplished by means of liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS). Effects on skin degradation were assessed by inhibitory enzymatic activity against elastase, hyaluronidase and collagenase through colorimetric assays. Cellular viability in B16F10 and primary fibroblasts were determined by Trypan Blue exclusion assay. Anti-melanogenic effects on B16F10 cells were evaluated using cellular tyrosinase, melanin content, western blot, and RT-qPCR analyses. Inhibition of matrix metalloproteinase-2 and metalloproteinase-9 (MMP-2 and MMP-9) was determined by gelatin zymography and western blot methodologies. LC-MS/MS analyses of LFB and LFP extracts allowed the characterization of 18 compounds, among them, flavonoids, phenolic acids, and secoridoids. Additionally the pod and trunk bark compositions were compared. Hyaluronidase inhibitory activity for both extracts, LFB (IC 50 = 8.5 ± 0.8 µg/mL) and LFP (IC 50 = 16 ± 0.5 µg/mL), was stronger than standard rutin (IC 50 = 27.6 ± 0.06). Pro-MMP-2 was significantly inhibited by both extracts. LFB and LFP decreased the melanin content in B16F10 due to tyrosinase inhibitory activity. L. ferrea extracts has high potential as a cosmetic ingredient due to its anti-wrinkle and depigmentant effects.
International Nuclear Information System (INIS)
Maenaka, Katsumi; Fukushi, Kouji; Aramaki, Hironori; Shirakihara, Yasuo
2005-01-01
The P. putida cytochrome P450cam operon repressor CamR has been expressed in E. coli and crystallized in space group P2 1 2 1 2. The Pseudomonas putida cam repressor (CamR) is a homodimeric protein that binds to the camO DNA operator to inhibit the transcription of the cytochrome P450cam operon camDCAB. CamR has two functional domains: a regulatory domain and a DNA-binding domain. The binding of the inducer d-camphor to the regulatory domain renders the DNA-binding domain unable to bind camO. Native CamR and its selenomethionyl derivative have been overproduced in Escherichia coli and purified. Native CamR was crystallized under the following conditions: (i) 12–14% PEG 4000, 50 mM Na PIPES, 0.1 M KCl, 1% glycerol pH 7.3 at 288 K with and without camphor and (ii) 1.6 M P i , 50 mM Na PIPES, 2 mM camphor pH 6.7 at 278 K. The selenomethionyl derivative CamR did not crystallize under either of these conditions, but did crystallize using 12.5% PEG MME 550, 25 mM Na PIPES, 2.5 mM MgCl 2 pH 7.3 at 298 K. Preliminary X-ray diffraction studies revealed the space group to be orthorhombic (P2 1 2 1 2), with unit-cell parameters a = 48.0, b = 73.3, c = 105.7 Å. Native and selenomethionyl derivative data sets were collected to 3 Å resolution at SPring-8 and the Photon Factory
Die soeke na die betekenis van Q: Inleidende opmerkings oor die geskiedenis van Q-navorsing
Directory of Open Access Journals (Sweden)
Gerhard Nel
2003-10-01
According to the two source-theory, large parts of the material in Matthew and Luke which show conformity and which are not found in Mark, point to the existence of a source which comprises sayings of Jesus and reminds one of the typical wisdom material in the Old Testament. In this paper a few introductory remarks are made on the history of the research done in respect of this source, known as Q. The questions regarding the actual existence and origin of Q are briefly discussed in the first part of the paper. Four aspects of Q research are addressed: Q is a document which shows its own integrity; the distinction between tradition and redaction in Q; stratifications and phases in the development of Q; the wisdom character of the material in Q.
Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.
Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B
1995-01-01
Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.
Berendsen, Erwin M; Koning, Rosella A; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P; Wells-Bennik, Marjon H J
2016-01-01
Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA(2mob), present on a Tn1546
Mangotoxin production of Pseudomonas syringae pv. syringae is regulated by MgoA.
Carrión, Víctor J; van der Voort, Menno; Arrebola, Eva; Gutiérrez-Barranquero, José A; de Vicente, Antonio; Raaijmakers, Jos M; Cazorla, Francisco M
2014-02-21
The antimetabolite mangotoxin is a key factor in virulence of Pseudomonas syringae pv. syringae strains which cause apical necrosis of mango trees. Previous studies showed that mangotoxin biosynthesis is governed by the mbo operon. Random mutagenesis led to the identification of two other gene clusters that affect mangotoxin biosynthesis. These are the gacS/gacA genes and mgo operon which harbors the four genes mgoBCAD. The current study shows that disruption of the nonribosomal peptide synthetase (NRPS) gene mgoA resulted in loss of mangotoxin production and reduced virulence on tomato leaves. Transcriptional analyses by qPCR and promoter reporter fusions revealed that mbo expression is regulated by both gacS/gacA and mgo genes. Also, expression of the mgo operon was shown to be regulated by gacS/gacA. Heterologous expression under the native promoter of the mbo operon resulted in mangotoxin production in non-producing P. syringae strains, but not in other Pseudomonas species. Also introduction of the mbo and mgo operons in nonproducing P. protegens Pf-5 did not confer mangotoxin production but did enhance transcription of the mbo promoter. From the data obtained in this study, we conclude that both mbo and mgo operons are under the control of the gacS/gacA two-component system and that the MgoA product acts as a positive regulator of mangotoxin biosynthesis.
Mondal, Smarajit; Yakhnin, Alexander V; Babitzke, Paul
2017-07-15
The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism in which tryptophan-activated TRAP binds to the nascent transcript and blocks the formation of an antiterminator structure such that the formation of an overlapping intrinsic terminator causes termination in the 5' untranslated region (5' UTR). In the absence of bound TRAP, the antiterminator forms and transcription continues into the trp genes. RNA polymerase pauses at positions U107 and U144 in the 5' UTR. The general transcription elongation factors NusA and NusG stimulate pausing at both positions. NusG-stimulated pausing at U144 requires sequence-specific contacts with a T tract in the nontemplate DNA (ntDNA) strand within the paused transcription bubble. Pausing at U144 participates in a trpE translation repression mechanism. Since U107 just precedes the critical overlap between the antiterminator and terminator structures, pausing at this position is thought to participate in attenuation. Here we carried out in vitro pausing and termination experiments to identify components of the U107 pause signal and to determine whether pausing affects the termination efficiency in the 5' UTR. We determined that the U107 and U144 pause signals are organized in a modular fashion containing distinct RNA hairpin, U-tract, and T-tract components. NusA-stimulated pausing was affected by hairpin strength and the U-tract sequence, whereas NusG-stimulated pausing was affected by hairpin strength and the T-tract sequence. We also determined that pausing at U107 results in increased TRAP-dependent termination in the 5' UTR, implying that NusA- and NusG-stimulated pausing participates in the trp operon attenuation mechanism by providing additional time for TRAP binding. IMPORTANCE The expression of several bacterial operons is controlled by regulated termination in the 5' untranslated region (5' UTR). Transcription attenuation is defined as situations in which the binding of a regulatory
Scaled momentum distributions for K0S and Λ/ anti Λ in DIS at HERA
International Nuclear Information System (INIS)
Abramowicz, H.; Abt, I.; Adamczyk, L.
2011-11-01
Scaled momentum distributions for the strange hadrons K S 0 and Λ/ anti Λ were measured in deep inelastic ep scattering with the ZEUS detector at HERA using an integrated luminosity of 330 pb -1 . The evolution of these distributions with the photon virtuality, Q 2 , was studied in the kinematic region 10 2 2 and 0.001 + e - data alone, fail to describe the measurements. The calculations based on FFs extracted from a global analysis including e + e - , ep and pp data give an improved description. The measurements presented in this paper have the potential to further constrain the FFs of quarks, anti-quarks and gluons yielding K S 0 and Λ/ anti Λ strange hadrons. (orig.)
International Nuclear Information System (INIS)
Ogievetsky, O.; Pillin, M.; Schmidke, W.B.; Wess, J.; Zumino, B.
1993-01-01
In this lecture I discuss the algebraic structure of a q-deformed four-vector space. It serves as a good example of quantizing Minkowski space. To give a physical interpretation of such a quantized Minkowski space we construct the Hilbert space representation and find that the relevant time and space operators have a discrete spectrum. Thus the q-deformed Minkowski space has a lattice structure. Nevertheless this lattice structure is compatible with the operation of q-deformed Lorentz transformations. The generators of the q-deformed Lorentz group can be represented as linear operators in the same Hilbert space. (orig.)
Precise measurement of neutrino and anti-neutrino differential cross sections on iron
Energy Technology Data Exchange (ETDEWEB)
Tzanov, Martin Mihaylov [Pittsburgh U.
2005-11-01
This thesis will present a precise measurement of the differential cross section for charged current neutrino and anti-neutrino scattering from iron. The NuTeV experiment took data during 1996-97 and collected 8.6 10 º and 2.4 10 º charged-current (CC) interactions. The experiment combines sign-selected neutrino and antineutrino beams and the upgraded CCFR iron-scintillator neutrino detector. A precision continuous calibration beam was used to determine the muon and hadron energy scales to a precision of about a factor of two better than previous experiments. The structure functions F (x,Q2) and xF3(x,Q2) are extracted and compared with theory and previous measurements.
International Nuclear Information System (INIS)
Block, Martin M.; Durand, Loyal; McKay, Douglas W.
2008-01-01
We derive a second-order linear differential equation for the leading-order gluon distribution function G(x,Q 2 )=xg(x,Q 2 ) which determines G(x,Q 2 ) directly from the proton structure function F 2 p (x,Q 2 ). This equation is derived from the leading-order evolution equation for F 2 p (x,Q 2 ), and does not require knowledge of either the individual quark distributions or the gluon evolution equation. Given an analytic expression that successfully reproduces the known experimental data for F 2 p (x,Q 2 ) in a domain x min (Q 2 )≤x≤x max (Q 2 ), Q min 2 ≤Q 2 ≤Q max 2 of the Bjorken variable x and the virtuality Q 2 in deep inelastic scattering, G(x,Q 2 ) is uniquely determined in the same domain. We give the general solution and illustrate the method using the recently proposed Froissart-bound-type parametrization of F 2 p (x,Q 2 ) of E. L. Berger, M. M. Block and C.-I. Tan [Phys. Rev. Lett. 98, 242001 (2007)]. Existing leading-order gluon distributions based on power-law descriptions of individual parton distributions agree roughly with the new distributions for x > or approx. 10 -3 as they should, but are much larger for x -3 .
Directory of Open Access Journals (Sweden)
Seema Korgaonkar
2011-01-01
Full Text Available Primary amenorrhea (PA refers to the absence of menarche by the age of 16-18 years although secondary sexual characters are developed. PA occurs in 1-3% of women in the reproductive age group. Various factors such as anatomical, genetic and hormonal factors reported to influence PA. We report triple chromosomal abnormalities of rob(13;14(q10;q10,inv(9(p13q33, i(Xq(qter---q10::---qter in a case of PA and short stature. Though proband has multiple chromosome aberrations, genotypic effect of only i(Xq is evident as proband has PA and short stature. The rob(13;14 and inv(9, which are paternally derived may have role in later reproductive age. Therefore, chromosomal analysis is essential in such cases for the accurate diagnosis and management of the disease.
Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression
Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet
2015-01-01
Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450
Meijer, W.G; van den Bergh, E.R E; Smith, L.M
In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence
Energy Technology Data Exchange (ETDEWEB)
Aaron, F.D. [National Institute for Physics and Nuclear Engineering (NIPNE), Bucharest (Romania); Bucharest Univ. (Romania). Faculty of Physics; Alexa, C. [National Institute for Physics and Nuclear Engineering (NIPNE), Bucharest (Romania); Andreev, V. [Lebedev Physical Institute, Moscow (RU)] (and others)
2011-04-15
Inclusive production of D{sup *} mesons in deep-inelastic ep scattering at HERA is studied in the range 5 <Q{sup 2}<100 GeV{sup 2} of the photon virtuality and 0.02
Energy Technology Data Exchange (ETDEWEB)
Aaron, F.D.; Alexa, C.; Rotaru, M.; Stoicea, G. [National Inst. for Physics and Nuclear Engineering, Bucharest (Romania); Andreev, V.; Belousov, A.; Eliseev, A.; Fomenko, A.; Gogitidze, N.; Lebedev, A.; Malinovski, E.; Rusakov, S.; Shtarkov, L.N.; Soloviev, Y.; Vazdik, Y. [Lebedev Physical Inst., Moscow (Russian Federation); Backovic, S.; Dubak, A.; Lastovicka-Medin, G.; Picuric, I.; Raicevic, N. [Univ. of Montenegro, Podgorica (ME); Baghdasaryan, A.; Baghdasaryan, S.; Zohrabyan, H. [Yerevan Physics Inst. (Armenia); Barrelet, E. [Univ. Pierre et Marie Curie Paris 6, Univ. Denis Diderot Paris 7, CNRS/IN2P3, LPNHE, Paris (France); Bartel, W.; Belov, P.; Brandt, G.; Brinkmann, M.; Britzger, D.; Campbell, A.J.; Eckerlin, G.; Elsen, E.; Felst, R.; Fischer, D.J.; Fleischer, M.; Gayler, J.; Ghazaryan, S.; Glazov, A.; Gouzevitch, M.; Grebenyuk, A.; Grell, B.R.; Habib, S.; Haidt, D.; Helebrant, C.; Kleinwort, C.; Kogler, R.; Kraemer, M.; Levonian, S.; Lipka, K.; List, J.; Meyer, A.B.; Meyer, J.; Niebuhr, C.; Nowak, K.; Olsson, J.E.; Pahl, P.; Panagoulias, I.; Papadopoulou, T.; Petrukhin, A.; Piec, S.; Pitzl, D.; Schmitt, S.; Sefkow, F.; South, D.; Staykova, Z.; Steder, M.; Toll, T.; Wuensch, E. [DESY, Hamburg (Germany); Begzsuren, K.; Ravdandorj, T.; Tseepeldorj, B. [Inst. of Physics and Technology of the Mongolian Academy of Sciences, Ulaanbaatar (Mongolia); Bizot, J.C.; Brisson, V.; Delcourt, B.; Jacquet, M.; Pascaud, C.; Tran, T.H.; Zhang, Z.; Zomer, F. [Univ. Paris-Sud, CNRS/IN2P3,LAL, Orsay (France); Boenig, M.O.; Wegener, D. [TU Dortmund, Inst. fuer Physik, Dortmund (Germany); Boudry, V.; Moreau, F.; Specka, A. [Ecole Polytechnique, CNRS/IN2P3, LLR, Palaiseau (France); Bozovic-Jelisavcic, I.; Mudrinic, M.; Pandurovic, M.; Smiljanic, I. [Univ. of Belgrade (RS); Bracinik, J.; Kenyon, I.R.; Newman, P.R.; Thompson, P.D. [Univ. of Birmingham (United Kingdom); Bruncko, D.; Cerny, V.; Ferencei, J. [Slovak Academy of Sciences, Kosice (Slovakia)] [and others
2011-10-15
Inclusive production of D{sup *} mesons in deep-inelastic ep scattering at HERA is studied in the range 5<Q{sup 2}<100 GeV{sup 2} of the photon virtuality and 0.02
The ''closed'' chiral symmetry and its application to tetraquark
International Nuclear Information System (INIS)
Chen, Hua-Xing
2012-01-01
We investigate the chiral (flavor) structure of tetraquarks, and study chiral transformation properties of the ''non-exotic'' [(anti 3, 3)+(3, anti 3)] and [(8,1)+(1,8)] tetraquark chiral multiplets. We find that as long as this kind of tetraquark states contains one quark and one antiquark having the same chirality, such as q L q L anti q L anti q R + q R q R anti q R anti q L , they transform in the same way as the lowest level anti q q chiral multiplets under chiral transformations. There is only one [(anti 3, 3)+(3, anti 3)] chiral multiplet whose quark-antiquark pairs all have the opposite chirality (q L q L anti q R anti q R + q R q R anti q L anti q L ), and it transforms differently from others. Based on these studies, we construct local tetraquark currents belonging to the ''non-exotic'' chiral multiplet [(anti 3, 3)+(3, anti 3)] and having quantum numbers J PC =1 -+ . (orig.)
Dworschak, G C; Crétolle, C; Hilger, A; Engels, H; Korsch, E; Reutter, H; Ludwig, M
2017-05-01
Partial duplications of the long arm of chromosome 3, dup(3q), are a rare but well-described condition, sharing features of Cornelia de Lange syndrome. Around two thirds of cases are derived from unbalanced translocations, whereas pure dup(3q) have rarely been reported. Here, we provide an extensive review of the literature on dup(3q). This search revealed several patients with caudal malformations and anomalies, suggesting that caudal malformations or anomalies represent an inherent phenotypic feature of dup(3q). In this context, we report a patient with a pure de novo duplication 3q26.32-q27.2. The patient had the clinical diagnosis of Currarino syndrome (CS) (characterized by the triad of sacral anomalies, anorectal malformations and a presacral mass) and additional features, frequently detected in patients with a dup(3q). Mutations within the MNX1 gene were found to be causative in CS but no MNX1 mutation could be detected in our patient. Our comprehensive search for candidate genes located in the critical region of the duplication 3q syndrome, 3q26.3-q27, revealed a so far neglected phenotypic overlap of dup(3q) and the Pierpont syndrome, associated with a mutation of the TBL1XR1 gene on 3q26.32. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
A Quantitative Electrophysiological Biomarker of Duplication 15q11.2-q13.1 Syndrome.
Directory of Open Access Journals (Sweden)
Joel Frohlich
Full Text Available Duplications of 15q11.2-q13.1 (Dup15q syndrome are highly penetrant for autism spectrum disorder (ASD. A distinct electrophysiological (EEG pattern characterized by excessive activity in the beta band has been noted in clinical reports. We asked whether EEG power in the beta band, as well as in other frequency bands, distinguished children with Dup15q syndrome from those with non-syndromic ASD and then examined the clinical correlates of this electrophysiological biomarker in Dup15q syndrome.In the first study, we recorded spontaneous EEG from children with Dup15q syndrome (n = 11, age-and-IQ-matched children with ASD (n = 10 and age-matched typically developing (TD children (n = 9 and computed relative power in 6 frequency bands for 9 regions of interest (ROIs. Group comparisons were made using a repeated measures analysis of variance. In the second study, we recorded spontaneous EEG from a larger cohort of individuals with Dup15q syndrome (n = 27 across two sites and examined age, epilepsy, and duplication type as predictors of beta power using simple linear regressions.In the first study, spontaneous beta1 (12-20 Hz and beta2 (20-30 Hz power were significantly higher in Dup15q syndrome compared with both comparison groups, while delta (1-4 Hz was significantly lower than both comparison groups. Effect sizes in all three frequency bands were large (|d| > 1. In the second study, we found that beta2 power was significantly related to epilepsy diagnosis in Dup15q syndrome.Here, we have identified an electrophysiological biomarker of Dup15q syndrome that may facilitate clinical stratification, treatment monitoring, and measurement of target engagement for future clinical trials. Future work will investigate the genetic and neural underpinnings of this electrophysiological signature as well as the functional consequences of excessive beta oscillations in Dup15q syndrome.
Linear q-nonuniform difference equations
International Nuclear Information System (INIS)
Bangerezako, Gaspard
2010-01-01
We introduce basic concepts of q-nonuniform differentiation and integration and study linear q-nonuniform difference equations and systems, as well as their application in q-nonuniform difference linear control systems. (author)
Distinctive phenotype in 9 patients with deletion of chromosome 1q24-q25.
Burkardt, Deepika D'Cunha; Rosenfeld, Jill A; Helgeson, Maria L; Angle, Brad; Banks, Valerie; Smith, Wendy E; Gripp, Karen W; Moline, Jessica; Moran, Rocio T; Niyazov, Dmitriy M; Stevens, Cathy A; Zackai, Elaine; Lebel, Robert Roger; Ashley, Douglas G; Kramer, Nancy; Lachman, Ralph S; Graham, John M
2011-06-01
Reports of individuals with deletions of 1q24→q25 share common features of prenatal onset growth deficiency, microcephaly, small hands and feet, dysmorphic face and severe cognitive deficits. We report nine individuals with 1q24q25 deletions, who show distinctive features of a clinically recognizable 1q24q25 microdeletion syndrome: prenatal-onset microcephaly and proportionate growth deficiency, severe cognitive disability, small hands and feet with distinctive brachydactyly, single transverse palmar flexion creases, fifth finger clinodactyly and distinctive facial features: upper eyelid fullness, small ears, short nose with bulbous nasal tip, tented upper lip, and micrognathia. Radiographs demonstrate disharmonic osseous maturation with markedly delayed bone age. Occasional features include cleft lip and/or palate, cryptorchidism, brain and spinal cord defects, and seizures. Using oligonucleotide-based array comparative genomic hybridization, we defined the critical deletion region as 1.9 Mb at 1q24.3q25.1 (chr1: 170,135,865-172,099,327, hg18 coordinates), containing 13 genes and including CENPL, which encodes centromeric protein L, a protein essential for proper kinetochore function and mitotic progression. The growth deficiency in this syndrome is similar to what is seen in other types of primordial short stature with microcephaly, such as Majewski osteodysplastic primordial dwarfism, type II (MOPD2) and Seckel syndrome, which result from loss-of-function mutations in genes coding for centrosomal proteins. DNM3 is also in the deleted region and expressed in the brain, where it participates in the Shank-Homer complex and increases synaptic strength. Therefore, DNM3 is a candidate for the cognitive disability, and CENPL is a candidate for growth deficiency in this 1q24q25 microdeletion syndrome. Copyright © 2011 Wiley-Liss, Inc.
Chemistry and Molecular Dynamics Simulations of Heme b-HemQ and Coproheme-HemQ.
Hofbauer, Stefan; Dalla Sega, Marco; Scheiblbrandner, Stefan; Jandova, Zuzana; Schaffner, Irene; Mlynek, Georg; Djinović-Carugo, Kristina; Battistuzzi, Gianantonio; Furtmüller, Paul G; Oostenbrink, Chris; Obinger, Christian
2016-09-27
Recently, a novel pathway for heme b biosynthesis in Gram-positive bacteria has been proposed. The final poorly understood step is catalyzed by an enzyme called HemQ and includes two decarboxylation reactions leading from coproheme to heme b. Coproheme has been suggested to act as both substrate and redox active cofactor in this reaction. In the study presented here, we focus on HemQs from Listeria monocytogenes (LmHemQ) and Staphylococcus aureus (SaHemQ) recombinantly produced as apoproteins in Escherichia coli. We demonstrate the rapid and two-phase uptake of coproheme by both apo forms and the significant differences in thermal stability of the apo forms, coproheme-HemQ and heme b-HemQ. Reduction of ferric high-spin coproheme-HemQ to the ferrous form is shown to be enthalpically favored but entropically disfavored with standard reduction potentials of -205 ± 3 mV for LmHemQ and -207 ± 3 mV for SaHemQ versus the standard hydrogen electrode at pH 7.0. Redox thermodynamics suggests the presence of a pronounced H-bonding network and restricted solvent mobility in the heme cavity. Binding of cyanide to the sixth coproheme position is monophasic but relatively slow (∼1 × 10(4) M(-1) s(-1)). On the basis of the available structures of apo-HemQ and modeling of both loaded forms, molecular dynamics simulation allowed analysis of the interaction of coproheme and heme b with the protein as well as the role of the flexibility at the proximal heme cavity and the substrate access channel for coproheme binding and heme b release. Obtained data are discussed with respect to the proposed function of HemQ in monoderm bacteria.
Direct Comparison of 19F qNMR and 1H qNMR by Characterizing Atorvastatin Calcium Content
Directory of Open Access Journals (Sweden)
Yang Liu
2016-01-01
Full Text Available Quantitative nuclear magnetic resonance (qNMR is a powerful tool in measuring drug content because of its high speed, sensitivity, and precision. Most of the reports were based on proton qNMR (1H qNMR and only a few fluorine qNMR (19F qNMR were reported. No research has been conducted to directly compare the advantage and disadvantage between these two methods. In the present study, both 19F and 1H qNMR were performed to characterize the content of atorvastatin calcium with the same internal standard. Linearity, precision, and results from two methods were compared. Results showed that 19F qNMR has similar precision and sensitivity to 1H qNMR. Both methods generate similar results compared to mass balance method. Major advantage from 19F qNMR is that the analyte signal is with less or no interference from impurities. 19F qNMR is an excellent approach to quantify fluorine-containing analytes.
DEFF Research Database (Denmark)
Contaldo, Nicoletta; Bertaccini, Assunta; Nicolaisen, Mogens
2014-01-01
The setting of the Q-Bank database free available on line for quarantine phytoplasma and also for general phytoplasma identification is described. The tool was developed in the frame of the EU-FP7 project Qbol and is linked with a new project Q-collect in order to made widely available the identi......The setting of the Q-Bank database free available on line for quarantine phytoplasma and also for general phytoplasma identification is described. The tool was developed in the frame of the EU-FP7 project Qbol and is linked with a new project Q-collect in order to made widely available...
International Nuclear Information System (INIS)
Jaganathan, Ramaswamy; Sinha, Sudeshna
2005-01-01
A scheme of q-deformation of nonlinear maps is introduced. As a specific example, a q-deformation procedure related to the Tsallis q-exponential function is applied to the logistic map. Compared to the canonical logistic map, the resulting family of q-logistic maps is shown to have a wider spectrum of interesting behaviours, including the co-existence of attractors-a phenomenon rare in one-dimensional maps
International Nuclear Information System (INIS)
Barton, Nick
2003-03-01
The first Forsmark potential repository site borehole KFM 01A provided core from 101.8 to 1000.7 m depth. This was independently Q-logged during a two-day period (19th-20th February, 2003), without access to BORMAP results or regional jointing frequencies or orientations. The Q-logging was intended to be an independent check for subsequent BORMAP-derived Q-parameter estimation. The Q-logging was accomplished using the manually-recorded 'histogram method' which allows the logger to enter Q-parameter ranges and depths directly into the appropriate histograms, which facilitates subsequent data processing using Excel spreadsheets. Successive pairs of core boxes, which contain an average of 11 meters of core in ten rows, were the source of ten opinions of each of the six Q-parameters, giving a total of 4920 recordings of Q-parameter values for the 164 core boxes. Data processing was divided into several parts, with successively increasing detail. The report therefore contains Q-histograms for the whole core, for four identified fracture(d) zones combined as if one unit, and then for the whole core minus these fracture(d) zones. This background rock mass quality is subsequently divided into nine depth zones or slices, and trends of variation with depth are tabulated. The four identified fracture(d) zones, which are actually of reasonable quality, are also analysed separately, and similarities and subtle differences are discerned between them. The overall quality of this first core is very good to excellent, with Q(mean) of 48.4, and a most frequent Q-value of 100. The range of quality is from 2.1 to 2130, which is the complete upper half of the six order of magnitude Q scale. Even the relatively fracture(d) zones, representing some 13% of the 900 m cored, have a combined Q(mean) of 13.9 and a range of quality of 2.1 to 150