Detecting uber-operons in prokaryotic genomes.

Science.gov (United States)

Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

2006-01-01

We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels

DEFF Research Database (Denmark)

Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence

2005-01-01

Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...

Evidence against the selfish operon theory.

Science.gov (United States)

Pál, Csaba; Hurst, Laurence D

2004-06-01

According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

Obacunone Represses Salmonella Pathogenicity Islands 1 and 2 in an envZ-Dependent Fashion

Science.gov (United States)

Vikram, Amit; Jayaprakasha, Guddadarangavvanahally K.; Jesudhasan, Palmy R.

2012-01-01

Obacunone belongs to a class of unique triterpenoids called limonoids, present in Citrus species. Previous studies from our laboratory suggested that obacunone possesses antivirulence activity and demonstrates inhibition of cell-cell signaling in Vibrio harveyi and Escherichia coli O157:H7. The present work sought to determine the effect of obacunone on the food-borne pathogen Salmonella enterica serovar Typhimurium LT2 by using a cDNA microarray. Transcriptomic studies indicated that obacunone represses Salmonella pathogenicity island 1 (SPI1), the maltose transporter, and the hydrogenase operon. Furthermore, phenotypic data for the Caco-2 infection assay and maltose utilization were in agreement with microarray data suggesting repression of SPI1 and maltose transport. Further studies demonstrated that repression of SPI1 was plausibly mediated through hilA. Additionally, obacunone seems to repress SPI2 under SPI2-inducing conditions as well as in Caco-2 infection models. Furthermore, obacunone seems to repress hilA in an EnvZ-dependent fashion. Altogether, the results of the study seems to suggest that obacunone exerts an antivirulence effect on S. Typhimurium and may serve as a lead compound for development of antivirulence strategies for S. Typhimurium. PMID:22843534

Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

Directory of Open Access Journals (Sweden)

Altenbuchner Josef

2011-10-01

Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

REMap: Operon Map of M. tuberculosis

Science.gov (United States)

Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

2016-01-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

Distinct Residues Contribute to Motility Repression and Autoregulation in the Proteus mirabilis Fimbria-Associated Transcriptional Regulator AtfJ.

Science.gov (United States)

Bode, Nadine J; Chan, Kun-Wei; Kong, Xiang-Peng; Pearson, Melanie M

2016-08-01

Proteus mirabilis contributes to a significant number of catheter-associated urinary tract infections, where coordinated regulation of adherence and motility is critical for ascending disease progression. Previously, the mannose-resistant Proteus-like (MR/P) fimbria-associated transcriptional regulator MrpJ has been shown to both repress motility and directly induce the transcription of its own operon; in addition, it affects the expression of a wide range of cellular processes. Interestingly, 14 additional mrpJ paralogs are included in the P. mirabilis genome. Looking at a selection of MrpJ paralogs, we discovered that these proteins, which consistently repress motility, also have nonidentical functions that include cross-regulation of fimbrial operons. A subset of paralogs, including AtfJ (encoded by the ambient temperature fimbrial operon), Fim8J, and MrpJ, are capable of autoinduction. We identified an element of the atf promoter extending from 487 to 655 nucleotides upstream of the transcriptional start site that is responsive to AtfJ, and we found that AtfJ directly binds this fragment. Mutational analysis of AtfJ revealed that its two identified functions, autoregulation and motility repression, are not invariably linked. Residues within the DNA-binding helix-turn-helix domain are required for motility repression but not necessarily autoregulation. Likewise, the C-terminal domain is dispensable for motility repression but is essential for autoregulation. Supported by a three-dimensional (3D) structural model, we hypothesize that the C-terminal domain confers unique regulatory capacities on the AtfJ family of regulators. Balancing adherence with motility is essential for uropathogens to successfully establish a foothold in their host. Proteus mirabilis uses a fimbria-associated transcriptional regulator to switch between these antagonistic processes by increasing fimbrial adherence while simultaneously downregulating flagella. The discovery of multiple

ProOpDB: Prokaryotic Operon DataBase.

Science.gov (United States)

Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

2012-01-01

The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

Ribosomal protein L10(L12)4 autoregulates expression of the Bacillus subtilis rplJL operon by a transcription attenuation mechanism.

Science.gov (United States)

Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul

2015-08-18

Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The relative value of operon predictions

NARCIS (Netherlands)

Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

Role of the Escherichia coli glnALG operon in regulation of ammonium transport

International Nuclear Information System (INIS)

Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.

1986-01-01

Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt

Transcriptome dynamics-based operon prediction in prokaryotes.

Science.gov (United States)

Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

2014-05-16

Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

International Nuclear Information System (INIS)

Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

1993-01-01

Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

Problem-Solving Test: Tryptophan Operon Mutants

Science.gov (United States)

Szeberenyi, Jozsef

2010-01-01

This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

Science.gov (United States)

Narang, Atul; Oehler, Stefan

2017-05-01

The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

Gene Repression in Haloarchaea Using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas I-B System.

Science.gov (United States)

Stachler, Aris-Edda; Marchfelder, Anita

2016-07-15

The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is used by bacteria and archaea to fend off foreign genetic elements. Since its discovery it has been developed into numerous applications like genome editing and regulation of transcription in eukaryotes and bacteria. For archaea currently no tools for transcriptional repression exist. Because molecular biology analyses in archaea become more and more widespread such a tool is vital for investigating the biological function of essential genes in archaea. Here we use the model archaeon Haloferax volcanii to demonstrate that its endogenous CRISPR-Cas system I-B can be harnessed to repress gene expression in archaea. Deletion of cas3 and cas6b genes results in efficient repression of transcription. crRNAs targeting the promoter region reduced transcript levels down to 8%. crRNAs targeting the reading frame have only slight impact on transcription. crRNAs that target the coding strand repress expression only down to 88%, whereas crRNAs targeting the template strand repress expression down to 8%. Repression of an essential gene results in reduction of transcription levels down to 22%. Targeting efficiencies can be enhanced by expressing a catalytically inactive Cas3 mutant. Genes can be targeted on plasmids or on the chromosome, they can be monocistronic or part of a polycistronic operon. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Gene Repression in Haloarchaea Using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas I-B System*

Science.gov (United States)

Stachler, Aris-Edda; Marchfelder, Anita

2016-01-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is used by bacteria and archaea to fend off foreign genetic elements. Since its discovery it has been developed into numerous applications like genome editing and regulation of transcription in eukaryotes and bacteria. For archaea currently no tools for transcriptional repression exist. Because molecular biology analyses in archaea become more and more widespread such a tool is vital for investigating the biological function of essential genes in archaea. Here we use the model archaeon Haloferax volcanii to demonstrate that its endogenous CRISPR-Cas system I-B can be harnessed to repress gene expression in archaea. Deletion of cas3 and cas6b genes results in efficient repression of transcription. crRNAs targeting the promoter region reduced transcript levels down to 8%. crRNAs targeting the reading frame have only slight impact on transcription. crRNAs that target the coding strand repress expression only down to 88%, whereas crRNAs targeting the template strand repress expression down to 8%. Repression of an essential gene results in reduction of transcription levels down to 22%. Targeting efficiencies can be enhanced by expressing a catalytically inactive Cas3 mutant. Genes can be targeted on plasmids or on the chromosome, they can be monocistronic or part of a polycistronic operon. PMID:27226589

Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

Science.gov (United States)

Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

2015-01-01

Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

Metazoan operons accelerate recovery from growth arrested states

Science.gov (United States)

Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

2011-01-01

Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

Science.gov (United States)

Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

2015-05-25

Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

Science.gov (United States)

Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

2016-04-01

Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

Science.gov (United States)

Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

2016-01-01

The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

Regulation of the rhaEWRBMA Operon Involved in l-Rhamnose Catabolism through Two Transcriptional Factors, RhaR and CcpA, in Bacillus subtilis.

Science.gov (United States)

Hirooka, Kazutake; Kodoi, Yusuke; Satomura, Takenori; Fujita, Yasutaro

2015-12-28

The Bacillus subtilis rhaEWRBMA (formerly yuxG-yulBCDE) operon consists of four genes encoding enzymes for l-rhamnose catabolism and the rhaR gene encoding a DeoR-type transcriptional regulator. DNase I footprinting analysis showed that the RhaR protein specifically binds to the regulatory region upstream of the rhaEW gene, in which two imperfect direct repeats are included. Gel retardation analysis revealed that the direct repeat farther upstream is essential for the high-affinity binding of RhaR and that the DNA binding of RhaR was effectively inhibited by L-rhamnulose-1-phosphate, an intermediate of L-rhamnose catabolism. Moreover, it was demonstrated that the CcpA/P-Ser-HPr complex, primarily governing the carbon catabolite control in B. subtilis, binds to the catabolite-responsive element, which overlaps the RhaR binding site. In vivo analysis of the rhaEW promoter-lacZ fusion in the background of ccpA deletion showed that the L-rhamnose-responsive induction of the rhaEW promoter was negated by the disruption of rhaA or rhaB but not rhaEW or rhaM, whereas rhaR disruption resulted in constitutive rhaEW promoter activity. These in vitro and in vivo results clearly indicate that RhaR represses the operon by binding to the operator site, which is detached by L-rhamnulose-1-phosphate formed from L-rhamnose through a sequence of isomerization by RhaA and phosphorylation by RhaB, leading to the derepression of the operon. In addition, the lacZ reporter analysis using the strains with or without the ccpA deletion under the background of rhaR disruption supported the involvement of CcpA in the carbon catabolite repression of the operon. Since L-rhamnose is a component of various plant-derived compounds, it is a potential carbon source for plant-associating bacteria. Moreover, it is suggested that L-rhamnose catabolism plays a significant role in some bacteria-plant interactions, e.g., invasion of plant pathogens and nodulation of rhizobia. Despite the physiological

The Transcriptional Repressor, MtrR, of the mtrCDE Efflux Pump Operon of Neisseria gonorrhoeae Can Also Serve as an Activator of “off Target” Gene (glnE Expression

Directory of Open Access Journals (Sweden)

Paul J. T. Johnson

2015-06-01

Full Text Available MtrR is a well-characterized repressor of the Neisseria gonorrhoeae mtrCDE efflux pump operon. However, results from a previous transcriptional profiling study suggested that MtrR also represses or activates expression of at least sixty genes outside of the mtr locus. Evidence that MtrR can directly repress so-called “off target” genes has previously been reported; in particular, MtrR was shown to directly repress glnA, which encodes glutamine synthetase. In contrast, evidence for the ability of MtrR to directly activate expression of gonococcal genes has been lacking; herein, we provide such evidence. We now report that MtrR has the ability to directly activate expression of glnE, which encodes the dual functional adenyltransferase/deadenylase enzyme GlnE that modifies GlnA resulting in regulation of its role in glutamine biosynthesis. With its capacity to repress expression of glnA, the results presented herein emphasize the diverse and often opposing regulatory properties of MtrR that likely contributes to the overall physiology and metabolism of N. gonorrhoeae.

Teaching the Big Ideas of Biology with Operon Models

Science.gov (United States)

Cooper, Robert A.

2015-01-01

This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

Directory of Open Access Journals (Sweden)

Hiraku Takada

Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

2005-04-12

Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

Science.gov (United States)

Goh, Yong Jun; Klaenhammer, Todd R

2013-01-01

Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

Science.gov (United States)

Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

2017-01-01

Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

Science.gov (United States)

Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

2011-11-01

HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

Science.gov (United States)

Lawrence, J

1999-12-01

The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

Deregulation of the arginine deiminase (arc) operon in penicillin-tolerant mutants of Streptococcus gordonii.

Science.gov (United States)

Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P

2000-10-01

Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.

Evolution and Biophysics of the Escherichia coli lac Operon

Science.gov (United States)

Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

2011-03-01

To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

NARCIS (Netherlands)

Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

2013-01-01

Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

Science.gov (United States)

Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

2014-07-08

We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

Expression of the Agmatine Deiminase Pathway in Enterococcus faecalis Is Activated by the AguR Regulator and Repressed by CcpA and PTSMan Systems

Science.gov (United States)

Blancato, Víctor S.; Magni, Christian

2013-01-01

Although the agmatine deiminase system (AgDI) has been investigated in Enterococcus faecalis, little information is available with respect to its gene regulation. In this study we demonstrate that the presence of exogenous agmatine induces the expression of agu genes in this bacterium. In contrast to the homologous and extensively characterized AgDI system of S. mutants, the aguBDAC operon in E. faecalis is not induced in response to low pH. In spite of this, agmatine catabolism in this bacterium contributes by neutralizing the external medium while enhancing bacterial growth. Our results indicate that carbon catabolic repression (CCR) operates on the AgDI system via a mechanism that involves interaction of CcpA and P-Ser-HPr with a cre site found in an unusual position considering the aguB promoter (55 nt upstream the +1 position). In addition, we found that components of the mannose phosphotransferase (PTSMan) system also contributed to CCR in E. faecalis since a complete relief of the PTS-sugars repressive effect was observed only in a PTSMan and CcpA double defective strain. Our gene context analysis revealed that aguR is present in oral and gastrointestinal microorganisms. Thus, regulation of the aguBDAC operon in E. faecalis seems to have evolved to obtain energy and resist low pH conditions in order to persist and colonize gastrointestinal niches. PMID:24155893

Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

Directory of Open Access Journals (Sweden)

Gogarten J Peter

2008-01-01

Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

Science.gov (United States)

Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

2017-01-01

The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

REMap: Operon map of M. tuberculosis based on RNA sequence data.

Science.gov (United States)

Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

2016-07-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

Science.gov (United States)

Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

2012-01-01

During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

Science.gov (United States)

Ray, J. Christian J; Igoshin, Oleg A.

2012-01-01

Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

The Genomic Pattern of tDNA Operon Expression in E. coli.

Directory of Open Access Journals (Sweden)

2005-06-01

Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

Solving a discrete model of the lac operon using Z3

Science.gov (United States)

Gutierrez, Natalia A.

2014-05-01

A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

Expression of the agmatine deiminase pathway in Enterococcus faecalis is activated by the AguR regulator and repressed by CcpA and PTS(Man systems.

Directory of Open Access Journals (Sweden)

Cristian Suárez

Full Text Available Although the agmatine deiminase system (AgDI has been investigated in Enterococcus faecalis, little information is available with respect to its gene regulation. In this study we demonstrate that the presence of exogenous agmatine induces the expression of agu genes in this bacterium. In contrast to the homologous and extensively characterized AgDI system of S. mutants, the aguBDAC operon in E. faecalis is not induced in response to low pH. In spite of this, agmatine catabolism in this bacterium contributes by neutralizing the external medium while enhancing bacterial growth. Our results indicate that carbon catabolic repression (CCR operates on the AgDI system via a mechanism that involves interaction of CcpA and P-Ser-HPr with a cre site found in an unusual position considering the aguB promoter (55 nt upstream the +1 position. In addition, we found that components of the mannose phosphotransferase (PTS(Man system also contributed to CCR in E. faecalis since a complete relief of the PTS-sugars repressive effect was observed only in a PTS(Man and CcpA double defective strain. Our gene context analysis revealed that aguR is present in oral and gastrointestinal microorganisms. Thus, regulation of the aguBDAC operon in E. faecalis seems to have evolved to obtain energy and resist low pH conditions in order to persist and colonize gastrointestinal niches.

Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

2003-01-01

The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

2003-09-01

The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

Science.gov (United States)

García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

2017-09-01

Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

Science.gov (United States)

Igoshin, Oleg

2011-03-01

Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

Rapid customised operon assembly by yeast recombinational cloning.

Science.gov (United States)

Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

2017-06-01

We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

Science.gov (United States)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

The fruRBA Operon Is Necessary for Group A Streptococcal Growth in Fructose and for Resistance to Neutrophil Killing during Growth in Whole Human Blood

Science.gov (United States)

Valdes, Kayla M.; Sundar, Ganesh S.; Vega, Luis A.; Belew, Ashton T.; Islam, Emrul; Binet, Rachel; El-Sayed, Najib M.

2016-01-01

Bacterial pathogens rely on the availability of nutrients for survival in the host environment. The phosphoenolpyruvate-phosphotransferase system (PTS) is a global regulatory network connecting sugar uptake with signal transduction. Since the fructose PTS has been shown to impact virulence in several streptococci, including the human pathogen Streptococcus pyogenes (the group A Streptococcus [GAS]), we characterized its role in carbon metabolism and pathogenesis in the M1T1 strain 5448. Growth in fructose as a sole carbon source resulted in 103 genes affected transcriptionally, where the fru locus (fruRBA) was the most induced. Reverse transcriptase PCR showed that fruRBA formed an operon which was repressed by FruR in the absence of fructose, in addition to being under carbon catabolic repression. Growth assays and carbon utilization profiles revealed that although the entire fru operon was required for growth in fructose, FruA was the main transporter for fructose and also was involved in the utilization of three additional PTS sugars: cellobiose, mannitol, and N-acetyl-d-galactosamine. The inactivation of sloR, a fruA homolog that also was upregulated in the presence of fructose, failed to reveal a role as a secondary fructose transporter. Whereas the ability of both ΔfruR and ΔfruB mutants to survive in the presence of whole human blood or neutrophils was impaired, the phenotype was not reproduced in murine whole blood, and those mutants were not attenuated in a mouse intraperitoneal infection. Since the ΔfruA mutant exhibited no phenotype in the human or mouse assays, we propose that FruR and FruB are important for GAS survival in a human-specific environment. PMID:26787724

An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

Science.gov (United States)

Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

2013-07-01

The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

CONDOP: an R package for CONdition-Dependent Operon Predictions.

Science.gov (United States)

Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

2016-10-15

The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

Science.gov (United States)

Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

2012-01-01

Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

The pyrimidine operon pyrRPB-carA from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Schallert, J.; Andersen, Birgit

2001-01-01

The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

DEFF Research Database (Denmark)

Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

1994-01-01

Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Muhammad Afzal

2016-09-01

Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

Science.gov (United States)

Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

2016-01-01

Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

NARCIS (Netherlands)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

The post-transcriptional operon

DEFF Research Database (Denmark)

Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

2011-01-01

model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

Class IIa bacteriocin resistance in Enterococcus faecalis V583: The mannose PTS operon mediates global transcriptional responses

Directory of Open Access Journals (Sweden)

Opsata Mona

2010-08-01

Full Text Available Abstract Background The class IIa bacteriocin, pediocin PA-1, has clear potential as food preservative and in the medical field to be used against Gram negative pathogen species as Enterococcus faecalis and Listeria monocytogenes. Resistance towards class IIa bacteriocins appear in laboratory and characterization of these phenotypes is important for their application. To gain insight into bacteriocin resistance we studied mutants of E. faecalis V583 resistant to pediocin PA-1 by use of transcriptomic analyses. Results Mutants of E. faecalis V583 resistant to pediocin PA-1 were isolated, and their gene expression profiles were analyzed and compared to the wild type using whole-genome microarray. Significantly altered transcription was detected from about 200 genes; most of them encoding proteins involved in energy metabolism and transport. Glycolytic genes were down-regulated in the mutants, but most of the genes showing differential expression were up-regulated. The data indicate that the mutants were relieved from glucose repression and putative catabolic responsive elements (cre could be identified in the upstream regions of 70% of the differentially expressed genes. Bacteriocin resistance was caused by reduced expression of the mpt operon encoding the mannose-specific phosphoenolpyruvate:carbohydrate phosphotransferase system (PTS, and the same transcriptional changes were seen in a mptD-inactivated mutant. This mutant also had decreased transcription of the whole mpt operon, showing that the PTS is involved in its own transcriptional regulation. Conclusion Our data confirm the important role of mannose PTS in class IIa bacteriocin sensitivity and we demonstrate its importance involving global carbon catabolite control.

Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

OpenAIRE

Stewart, V; Yanofsky, C

1986-01-01

We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

Directory of Open Access Journals (Sweden)

Juliana Teixeira de Magalhães

2005-06-01

Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

Science.gov (United States)

Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2007-01-01

Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

Directory of Open Access Journals (Sweden)

Dharmesh Harwani

2014-12-01

Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

Science.gov (United States)

Harwani, Dharmesh

2014-01-01

Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

Science.gov (United States)

Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

2016-01-01

Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

Directory of Open Access Journals (Sweden)

Catherine E Dana

Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

Repression of branched-chain amino acid synthesis in Staphylococcus aureus is mediated by isoleucine via CodY, and by a leucine-rich attenuator peptide.

Science.gov (United States)

Kaiser, Julienne C; King, Alyssa N; Grigg, Jason C; Sheldon, Jessica R; Edgell, David R; Murphy, Michael E P; Brinsmade, Shaun R; Heinrichs, David E

2018-01-01

Staphylococcus aureus requires branched-chain amino acids (BCAAs; isoleucine, leucine, valine) for protein synthesis, branched-chain fatty acid synthesis, and environmental adaptation by responding to their availability via the global transcriptional regulator CodY. The importance of BCAAs for S. aureus physiology necessitates that it either synthesize them or scavenge them from the environment. Indeed S. aureus uses specialized transporters to scavenge BCAAs, however, its ability to synthesize them has remained conflicted by reports that it is auxotrophic for leucine and valine despite carrying an intact BCAA biosynthetic operon. In revisiting these findings, we have observed that S. aureus can engage in leucine and valine synthesis, but the level of BCAA synthesis is dependent on the BCAA it is deprived of, leading us to hypothesize that each BCAA differentially regulates the biosynthetic operon. Here we show that two mechanisms of transcriptional repression regulate the level of endogenous BCAA biosynthesis in response to specific BCAA availability. We identify a trans-acting mechanism involving isoleucine-dependent repression by the global transcriptional regulator CodY and a cis-acting leucine-responsive attenuator, uncovering how S. aureus regulates endogenous biosynthesis in response to exogenous BCAA availability. Moreover, given that isoleucine can dominate CodY-dependent regulation of BCAA biosynthesis, and that CodY is a global regulator of metabolism and virulence in S. aureus, we extend the importance of isoleucine availability for CodY-dependent regulation of other metabolic and virulence genes. These data resolve the previous conflicting observations regarding BCAA biosynthesis, and reveal the environmental signals that not only induce BCAA biosynthesis, but that could also have broader consequences on S. aureus environmental adaptation and virulence via CodY.

Repression of branched-chain amino acid synthesis in Staphylococcus aureus is mediated by isoleucine via CodY, and by a leucine-rich attenuator peptide.

Directory of Open Access Journals (Sweden)

Julienne C Kaiser

2018-01-01

Full Text Available Staphylococcus aureus requires branched-chain amino acids (BCAAs; isoleucine, leucine, valine for protein synthesis, branched-chain fatty acid synthesis, and environmental adaptation by responding to their availability via the global transcriptional regulator CodY. The importance of BCAAs for S. aureus physiology necessitates that it either synthesize them or scavenge them from the environment. Indeed S. aureus uses specialized transporters to scavenge BCAAs, however, its ability to synthesize them has remained conflicted by reports that it is auxotrophic for leucine and valine despite carrying an intact BCAA biosynthetic operon. In revisiting these findings, we have observed that S. aureus can engage in leucine and valine synthesis, but the level of BCAA synthesis is dependent on the BCAA it is deprived of, leading us to hypothesize that each BCAA differentially regulates the biosynthetic operon. Here we show that two mechanisms of transcriptional repression regulate the level of endogenous BCAA biosynthesis in response to specific BCAA availability. We identify a trans-acting mechanism involving isoleucine-dependent repression by the global transcriptional regulator CodY and a cis-acting leucine-responsive attenuator, uncovering how S. aureus regulates endogenous biosynthesis in response to exogenous BCAA availability. Moreover, given that isoleucine can dominate CodY-dependent regulation of BCAA biosynthesis, and that CodY is a global regulator of metabolism and virulence in S. aureus, we extend the importance of isoleucine availability for CodY-dependent regulation of other metabolic and virulence genes. These data resolve the previous conflicting observations regarding BCAA biosynthesis, and reveal the environmental signals that not only induce BCAA biosynthesis, but that could also have broader consequences on S. aureus environmental adaptation and virulence via CodY.

Structural organization of the transfer RNA operon I of Vibrio cholerae

Indian Academy of Sciences (India)

Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

Directory of Open Access Journals (Sweden)

Jeffrey R Johansen

Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

The interplay of StyR and IHF regulates substrate-dependent induction and carbon catabolite repression of styrene catabolism genes in Pseudomonas fluorescens ST

Directory of Open Access Journals (Sweden)

Leoni Livia

2008-06-01

Full Text Available Abstract Background In Pseudomonas fluorescens ST, the promoter of the styrene catabolic operon, PstyA, is induced by styrene and is subject to catabolite repression. PstyA regulation relies on the StyS/StyR two-component system and on the IHF global regulator. The phosphorylated response regulator StyR (StyR-P activates PstyA in inducing conditions when it binds to the high-affinity site STY2, located about -40 bp from the transcription start point. A cis-acting element upstream of STY2, named URE, contains a low-affinity StyR-P binding site (STY1, overlapping the IHF binding site. Deletion of the URE led to a decrease of promoter activity in inducing conditions and to a partial release of catabolite repression. This study was undertaken to assess the relative role played by IHF and StyR-P on the URE, and to clarify if PstyA catabolite repression could rely on the interplay of these regulators. Results StyR-P and IHF compete for binding to the URE region. PstyA full activity in inducing conditions is achieved when StyR-P and IHF bind to site STY2 and to the URE, respectively. Under catabolite repression conditions, StyR-P binds the STY1 site, replacing IHF at the URE region. StyR-P bound to both STY1 and STY2 sites oligomerizes, likely promoting the formation of a DNA loop that closes the promoter in a repressed conformation. We found that StyR and IHF protein levels did not change in catabolite repression conditions, implying that PstyA repression is achieved through an increase in the StyR-P/StyR ratio. Conclusion We propose a model according to which the activity of the PstyA promoter is determined by conformational changes. An open conformation is operative in inducing conditions when StyR-P is bound to STY2 site and IHF to the URE. Under catabolite repression conditions StyR-P cellular levels would increase, displacing IHF from the URE and closing the promoter in a repressed conformation. The balance between the open and the closed

UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

International Nuclear Information System (INIS)

Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

1994-01-01

UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans

Science.gov (United States)

Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.

2015-01-01

ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans

The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans.

Science.gov (United States)

Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G

2015-08-01

In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop

Cop-like operon: Structure and organization in species of the Lactobacillale order

Directory of Open Access Journals (Sweden)

ANGÉLICA REYES

2006-01-01

Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

Elucidation of Operon Structures across Closely Related Bacterial Genomes

Science.gov (United States)

Li, Guojun

2014-01-01

About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

Science.gov (United States)

Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

2015-03-17

Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

Science.gov (United States)

Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

2014-01-01

The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

Science.gov (United States)

Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

2011-10-01

Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

The Small Protein HemP Is a Transcriptional Activator for the Hemin Uptake Operon in Burkholderia multivorans ATCC 17616.

Science.gov (United States)

Sato, Takuya; Nonoyama, Shouta; Kimura, Akane; Nagata, Yuji; Ohtsubo, Yoshiyuki; Tsuda, Masataka

2017-08-15

Iron and heme play very important roles in various metabolic functions in bacteria, and their intracellular homeostasis is maintained because high concentrations of free forms of these molecules greatly facilitate the Fenton reaction-mediated production of large amounts of reactive oxygen species that severely damage various biomolecules. The ferric uptake regulator (Fur) from Burkholderia multivorans ATCC 17616 is an iron-responsive global transcriptional regulator, and its fur deletant exhibits pleiotropic phenotypes. In this study, we found that the phenotypes of the fur deletant were suppressed by an additional mutation in hemP The transcription of hemP was negatively regulated by Fur under iron-replete conditions and was constitutive in the fur deletant. Growth of a hemP deletant was severely impaired in a medium containing hemin as the sole iron source, demonstrating the important role of HemP in hemin utilization. HemP was required as a transcriptional activator that specifically binds the promoter-containing region upstream of a Fur-repressive hmuRSTUV operon, which encodes the proteins for hemin uptake. A hmuR deletant was still able to grow using hemin as the sole iron source, albeit at a rate clearly lower than that of the wild-type strain. These results strongly suggested (i) the involvement of HmuR in hemin uptake and (ii) the presence in ATCC 17616 of at least part of other unknown hemin uptake systems whose expression depends on the HemP function. Our in vitro analysis also indicated high-affinity binding of HemP to hemin, and such a property might modulate transcriptional activation of the hmu operon. IMPORTANCE Although the hmuRSTUV genes for the utilization of hemin as a sole iron source have been identified in a few Burkholderia strains, the regulatory expression of these genes has remained unknown. Our analysis in this study using B. multivorans ATCC 17616 showed that its HemP protein is required for expression of the hmuRSTUV operon, and the

Dynamic model of gene regulation for the lac operon

International Nuclear Information System (INIS)

Angelova, Maia; Ben-Halim, Asma

2011-01-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

Dynamic model of gene regulation for the lac operon

Energy Technology Data Exchange (ETDEWEB)

Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

2011-03-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

Functional validation of putative toxin-antitoxin genes from the Gram-positive pathogen Streptococcus pneumoniae: phd-doc is the fourth bona-fide operon.

Science.gov (United States)

Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel

2014-01-01

Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.

Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

Science.gov (United States)

Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

2016-09-01

The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

Prevalence of transcription promoters within archaeal operons and coding sequences.

Science.gov (United States)

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

Science.gov (United States)

Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

2015-03-01

The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

Science.gov (United States)

Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

2016-01-01

The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

Translational Repression in Malaria Sporozoites

Science.gov (United States)

Turque, Oliver; Tsao, Tiffany; Li, Thomas; Zhang, Min

2016-01-01

Malaria is a mosquito-borne infectious disease of humans and other animals. It is caused by the parasitic protozoan, Plasmodium. Sporozoites, the infectious form of malaria parasites, are quiescent when they remain in the salivary glands of the Anopheles mosquito until transmission into a mammalian host. Metamorphosis of the dormant sporozoite to its active form in the liver stage requires transcriptional and translational regulations. Here, we summarize recent advances in the translational repression of gene expression in the malaria sporozoite. In sporozoites, many mRNAs that are required for liver stage development are translationally repressed. Phosphorylation of eukaryotic Initiation Factor 2α (eIF2α) leads to a global translational repression in sporozoites. The eIF2α kinase, known as Upregulated in Infectious Sporozoite 1 (UIS1), is dominant in the sporozoite. The eIF2α phosphatase, UIS2, is translationally repressed by the Pumilio protein Puf2. This translational repression is alleviated when sporozoites are delivered into the mammalian host. PMID:28357358

Translational repression in malaria sporozoites

Directory of Open Access Journals (Sweden)

Oliver Turque

2016-04-01

Full Text Available Malaria is a mosquito-borne infectious disease of humans and other animals. It is caused by the parasitic protozoan, Plasmodium. Sporozoites, the infectious form of malaria parasites, are quiescent when they remain in the salivary glands of the Anopheles mosquito until transmission into a mammalian host. Metamorphosis of the dormant sporozoite to its active form in the liver stage requires transcriptional and translational regulations. Here, we summarize recent advances in the translational repression of gene expression in the malaria sporozoite. In sporozoites, many mRNAs that are required for liver stage development are translationally repressed. Phosphorylation of eukaryotic Initiation Factor 2α (eIF2α leads to a global translational repression in sporozoites. The eIF2α kinase, known as Upregulated in Infectious Sporozoite 1 (UIS1, is dominant in the sporozoite. The eIF2α phosphatase, UIS2, is translationally repressed by the Pumilio protein Puf2. This translational repression is alleviated when sporozoites are delivered into the mammalian host.

CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

Directory of Open Access Journals (Sweden)

Marasco Rosangela

2006-11-01

Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

Science.gov (United States)

Cortes, Teresa; Cox, Robert Ashley

2015-04-01

Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

DEFF Research Database (Denmark)

Danielsen, S; Kilstrup, M; Barilla, K

1992-01-01

. A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

Science.gov (United States)

Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

2013-10-01

The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

DEFF Research Database (Denmark)

Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

2014-01-01

We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

Coordinated Regulation of the EIIMan and fruRKI Operons of Streptococcus mutans by Global and Fructose-Specific Pathways.

Science.gov (United States)

Zeng, Lin; Chakraborty, Brinta; Farivar, Tanaz; Burne, Robert A

2017-11-01

The glucose/mannose-phosphotransferase system (PTS) permease EII Man encoded by manLMN in the dental caries pathogen Streptococcus mutans has a dominant influence on sugar-specific, CcpA-independent catabolite repression (CR). Mutations in manL affect energy metabolism and virulence-associated traits, including biofilm formation, acid tolerance, and competence. Using promoter::reporter fusions, expression of the manLMN and the fruRKI operons, encoding a transcriptional regulator, a fructose-1-phosphate kinase and a fructose-PTS permease EII Fru , respectively, was monitored in response to carbohydrate source and in mutants lacking CcpA, FruR, and components of EII Man Expression of genes for EII Man and EII Fru was directly regulated by CcpA and CR, as evinced by in vivo and in vitro methods. Unexpectedly, not only was the fruRKI operon negatively regulated by FruR, but also so was manLMN Carbohydrate transport by EII Man had a negative influence on expression of manLMN but not fruRKI In agreement with the proposed role of FruR in regulating these PTS operons, loss of fruR or fruK substantially altered growth on a number of carbohydrates, including fructose. RNA deep sequencing revealed profound changes in gene regulation caused by deletion of fruK or fruR Collectively, these findings demonstrate intimate interconnection of the regulation of two major PTS permeases in S. mutans and reveal novel and important contributions of fructose metabolism to global regulation of gene expression. IMPORTANCE The ability of Streptococcus mutans and other streptococcal pathogens to survive and cause human diseases is directly dependent upon their capacity to metabolize a variety of carbohydrates, including glucose and fructose. Our research reveals that metabolism of fructose has broad influences on the regulation of utilization of glucose and other sugars, and mutants with changes in certain genes involved in fructose metabolism display profoundly different abilities to grow and

Structural characterization of the Salmonella typhimurium LT2 umu operon

International Nuclear Information System (INIS)

Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

1990-01-01

The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

Differential repression of arylsulphatase synthesis in Aspergillus oryzae.

Science.gov (United States)

Burns, G R; Wynn, C H

1977-09-15

1. The activities of the three arylsulphatases (arylsulphate sulphohydrolase, EC 3.1.6.1) of Aspergillus oryzae produced under a variety of repressing and non-repressing conditions were determined. 2. These enzymes exhibit different sensitivities to repression by inorganic sulphate. 3. Arylsulphatase I, but not arylsulphatases II and III, exhibits a transient de-repression in the early growth phase in sulphate media. 4. When the fungus is cultured in repressing media and subsequently transferred to non-repressing media, the synthesis of the three enzymes is non-co-ordinate. 5. Growth of the fungus in media containing choline O-sulphate or tyrosine O-sulphate as the sole source of sulphur results in complete de-repression of arylsulphatase I, But the synthesis of arylsulphatases II and III is essentially fully repressed. 6. The marked similarities between the repression characteristics of arylsulphatases II and III, contrasted with those of arylsulphatase I, indicate that the genetic locus of arylsulphatase I is distinct from that of arylsulphatases II and III, suggesting that there are distinct physiological roles for the enzyme.

Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

Directory of Open Access Journals (Sweden)

Jan Ewald

2015-04-01

Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

Science.gov (United States)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

2015-01-01

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

The unified theory of repression.

Science.gov (United States)

Erdelyi, Matthew Hugh

2006-10-01

Repression has become an empirical fact that is at once obvious and problematic. Fragmented clinical and laboratory traditions and disputed terminology have resulted in a Babel of misunderstandings in which false distinctions are imposed (e.g., between repression and suppression) and necessary distinctions not drawn (e.g., between the mechanism and the use to which it is put, defense being just one). "Repression" was introduced by Herbart to designate the (nondefensive) inhibition of ideas by other ideas in their struggle for consciousness. Freud adapted repression to the defensive inhibition of "unbearable" mental contents. Substantial experimental literatures on attentional biases, thought avoidance, interference, and intentional forgetting exist, the oldest prototype being the work of Ebbinghaus, who showed that intentional avoidance of memories results in their progressive forgetting over time. It has now become clear, as clinicians had claimed, that the inaccessible materials are often available and emerge indirectly (e.g., procedurally, implicitly). It is also now established that the Ebbinghaus retention function can be partly reversed, with resulting increases of conscious memory over time (hypermnesia). Freud's clinical experience revealed early on that exclusion from consciousness was effected not just by simple repression (inhibition) but also by a variety of distorting techniques, some deployed to degrade latent contents (denial), all eventually subsumed under the rubric of defense mechanisms ("repression in the widest sense"). Freudian and Bartlettian distortions are essentially the same, even in name, except for motive (cognitive vs. emotional), and experimentally induced false memories and other "memory illusions" are laboratory analogs of self-induced distortions.

Decreases in average bacterial community rRNA operon copy number during succession.

Science.gov (United States)

Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

2016-05-01

Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

OpenAIRE

Riyanti, Eny Ida; Rogers, Peter L

2009-01-01

Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

Science.gov (United States)

Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

2014-10-01

Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

DEFF Research Database (Denmark)

Givskov, M; Eberl, L; Christiansen, Gunna

1995-01-01

. Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

Science.gov (United States)

Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

2014-12-01

Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

Eucaryotic operon genes can define highly conserved syntenies

Czech Academy of Sciences Publication Activity Database

Trachtulec, Zdeněk

2004-01-01

Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

Science.gov (United States)

Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

2013-02-01

Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

Mitosis-associated repression in development.

Science.gov (United States)

Esposito, Emilia; Lim, Bomyi; Guessous, Ghita; Falahati, Hanieh; Levine, Michael

2016-07-01

Transcriptional repression is a pervasive feature of animal development. Here, we employ live-imaging methods to visualize the Snail repressor, which establishes the boundary between the presumptive mesoderm and neurogenic ectoderm of early Drosophila embryos. Snail target enhancers were attached to an MS2 reporter gene, permitting detection of nascent transcripts in living embryos. The transgenes exhibit initially broad patterns of transcription but are refined by repression in the mesoderm following mitosis. These observations reveal a correlation between mitotic silencing and Snail repression. We propose that mitosis and other inherent discontinuities in transcription boost the activities of sequence-specific repressors, such as Snail. © 2016 Esposito et al.; Published by Cold Spring Harbor Laboratory Press.

Glucose repression in Saccharomyces cerevisiae.

Science.gov (United States)

Kayikci, Ömur; Nielsen, Jens

2015-09-01

Glucose is the primary source of energy for the budding yeast Saccharomyces cerevisiae. Although yeast cells can utilize a wide range of carbon sources, presence of glucose suppresses molecular activities involved in the use of alternate carbon sources as well as it represses respiration and gluconeogenesis. This dominant effect of glucose on yeast carbon metabolism is coordinated by several signaling and metabolic interactions that mainly regulate transcriptional activity but are also effective at post-transcriptional and post-translational levels. This review describes effects of glucose repression on yeast carbon metabolism with a focus on roles of the Snf3/Rgt2 glucose-sensing pathway and Snf1 signal transduction in establishment and relief of glucose repression. © FEMS 2015.

Modular Organization of the NusA- and NusG-Stimulated RNA Polymerase Pause Signal That Participates in the Bacillus subtilis trp Operon Attenuation Mechanism.

Science.gov (United States)

Mondal, Smarajit; Yakhnin, Alexander V; Babitzke, Paul

2017-07-15

The Bacillus subtilis trpEDCFBA operon is regulated by a transcription attenuation mechanism in which tryptophan-activated TRAP binds to the nascent transcript and blocks the formation of an antiterminator structure such that the formation of an overlapping intrinsic terminator causes termination in the 5' untranslated region (5' UTR). In the absence of bound TRAP, the antiterminator forms and transcription continues into the trp genes. RNA polymerase pauses at positions U107 and U144 in the 5' UTR. The general transcription elongation factors NusA and NusG stimulate pausing at both positions. NusG-stimulated pausing at U144 requires sequence-specific contacts with a T tract in the nontemplate DNA (ntDNA) strand within the paused transcription bubble. Pausing at U144 participates in a trpE translation repression mechanism. Since U107 just precedes the critical overlap between the antiterminator and terminator structures, pausing at this position is thought to participate in attenuation. Here we carried out in vitro pausing and termination experiments to identify components of the U107 pause signal and to determine whether pausing affects the termination efficiency in the 5' UTR. We determined that the U107 and U144 pause signals are organized in a modular fashion containing distinct RNA hairpin, U-tract, and T-tract components. NusA-stimulated pausing was affected by hairpin strength and the U-tract sequence, whereas NusG-stimulated pausing was affected by hairpin strength and the T-tract sequence. We also determined that pausing at U107 results in increased TRAP-dependent termination in the 5' UTR, implying that NusA- and NusG-stimulated pausing participates in the trp operon attenuation mechanism by providing additional time for TRAP binding. IMPORTANCE The expression of several bacterial operons is controlled by regulated termination in the 5' untranslated region (5' UTR). Transcription attenuation is defined as situations in which the binding of a regulatory

XRN2 Autoregulation and Control of Polycistronic Gene Expresssion in Caenorhabditis elegans.

Directory of Open Access Journals (Sweden)

Takashi S Miki

2016-09-01

Full Text Available XRN2 is a conserved 5'→3' exoribonuclease that complexes with proteins that contain XRN2-binding domains (XTBDs. In Caenorhabditis elegans (C. elegans, the XTBD-protein PAXT-1 stabilizes XRN2 to retain its activity. XRN2 activity is also promoted by 3'(2',5'-bisphosphate nucleotidase 1 (BPNT1 through hydrolysis of an endogenous XRN inhibitor 3'-phosphoadenosine-5'-phosphate (PAP. Here, we find through unbiased screening that loss of bpnt-1 function suppresses lethality caused by paxt-1 deletion. This unexpected finding is explained by XRN2 autoregulation, which occurs through repression of a cryptic promoter activity and destabilization of the xrn-2 transcript. De-repression appears to be triggered such that more robust XRN2 perturbation, by elimination of both PAXT-1 and BPNT1, is less detrimental to worm viability than absence of PAXT-1 alone. Indeed, we find that two distinct XRN2 repression mechanisms are alleviated at different thresholds of XRN2 inactivation. Like more than 15% of C. elegans genes, xrn-2 occurs in an operon, and we identify additional operons under its control, consistent with a broader function of XRN2 in polycistronic gene regulation. Regulation occurs through intercistronic regions that link genes in an operon, but a part of the mechanisms may allow XRN2 to operate on monocistronic genes in organisms lacking operons.

Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

Directory of Open Access Journals (Sweden)

Qinna Cui

Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells.

Science.gov (United States)

Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C

2015-07-07

Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

Science.gov (United States)

Kim, Moonjeong; Kim, Kwang-Sun

2017-07-06

The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis

Science.gov (United States)

Kessler, Peter S.; Blank, Carrine; Leigh, John A.

1998-01-01

Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920

Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

OpenAIRE

Chung, T; Resnik, E; Stueland, C; LaPorte, D C

1993-01-01

Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem

Science.gov (United States)

Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria

2016-01-01

The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the

GLYCOGEN IN BACILLUS-SUBTILIS - MOLECULAR CHARACTERIZATION OF AN OPERON ENCODING ENZYMES INVOLVED IN GLYCOGEN BIOSYNTHESIS AND DEGRADATION

NARCIS (Netherlands)

KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G

Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

OpenAIRE

Goh, Yong Jun; Klaenhammer, Todd R

2013-01-01

Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

Science.gov (United States)

Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

2003-01-01

Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

Science.gov (United States)

Boyd, D A; Mulvey, M R

2013-02-01

To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

Sequence analysis of the Legionella micdadei groELS operon

DEFF Research Database (Denmark)

Hindersson, P; Høiby, N; Bangsborg, Jette Marie

1991-01-01

shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

Science.gov (United States)

Sahukhal, Gyan S; Elasri, Mohamed O

2014-06-11

Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

Structural organization of the transfer RNA operon I of Vibrio cholerae

Indian Academy of Sciences (India)

Unknown

[Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

Characterization of the Leptospira interrogans S10-spc-alpha operon

NARCIS (Netherlands)

Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

2000-01-01

A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

Isoprenoid Pyrophosphate-Dependent Transcriptional Regulation of Carotenogenesis in Corynebacterium glutamicum

Directory of Open Access Journals (Sweden)

Petra Peters-Wendisch

2017-04-01

Full Text Available Corynebacterium glutamicum is a natural producer of the C50 carotenoid decaprenoxanthin. The crtEcg0722crtBIYEb operon comprises most of its genes for terpenoid biosynthesis. The MarR-type regulator encoded upstream and in divergent orientation of the carotenoid biosynthesis operon has not yet been characterized. This regulator, named CrtR in this study, is encoded in many actinobacterial genomes co-occurring with terpenoid biosynthesis genes. CrtR was shown to repress the crt operon of C. glutamicum since DNA microarray experiments revealed that transcript levels of crt operon genes were increased 10 to 70-fold in its absence. Transcriptional fusions of a promoter-less gfp gene with the crt operon and crtR promoters confirmed that CrtR represses its own gene and the crt operon. Gel mobility shift assays with purified His-tagged CrtR showed that CrtR binds to a region overlapping with the −10 and −35 promoter sequences of the crt operon. Isoprenoid pyrophosphates interfered with binding of CrtR to its target DNA, a so far unknown mechanism for regulation of carotenogenesis. The molecular details of protein-ligand interactions remain to be studied. Decaprenoxanthin synthesis by C. glutamicum wild type was enhanced 10 to 30-fold upon deletion of crtR and was decreased 5 to 6-fold as result of crtR overexpression. Moreover, deletion of crtR was shown as metabolic engineering strategy to improve production of native and non-native carotenoids including lycopene, β-carotene, C.p. 450 and sarcinaxanthin.

The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus.

Science.gov (United States)

Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan

2014-01-01

Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2.

Science.gov (United States)

Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen

The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

Science.gov (United States)

Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

2017-01-01

The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

Science.gov (United States)

Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

2017-01-01

The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

Directory of Open Access Journals (Sweden)

Arkin Adam P

2006-01-01

Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

Science.gov (United States)

Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

2015-11-17

rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

Science.gov (United States)

Dixit, R; Trivedi, P K; Nath, P; Sane, P V

1999-09-01

Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

Science.gov (United States)

Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

2016-01-01

An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents.

Science.gov (United States)

Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon

2014-01-01

Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

Science.gov (United States)

Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

2014-01-01

Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

Identification of the rctA Gene, Which Is Required for Repression of Conjugative Transfer of Rhizobial Symbiotic Megaplasmids†

Science.gov (United States)

Pérez-Mendoza, Daniel; Sepúlveda, Edgardo; Pando, Victoria; Muñoz, Socorro; Nogales, Joaquina; Olivares, José; Soto, Maria J.; Herrera-Cervera, José A.; Romero, David; Brom, Susana; Sanjuán, Juan

2005-01-01

An analysis of the conjugative transfer of pRetCFN42d, the symbiotic plasmid (pSym) of Rhizobium etli, has revealed a novel gene, rctA, as an essential element of a regulatory system for silencing the conjugative transfer of R. etli pSym by repressing the transcription of conjugal transfer genes in standard laboratory media. The rctA gene product lacks sequence conservation with other proteins of known function but may belong to the winged-helix DNA-binding subfamily of transcriptional regulators. Similar to that of many transcriptional repressors, rctA transcription seems to be positively autoregulated. rctA expression is greatly reduced upon overexpression of another gene, rctB, previously identified as a putative activator of R. etli pSym conjugal transfer. Thus, rctB seems to counteract the repressive action of rctA. rctA homologs are present in at least three other bacterial genomes within the order Rhizobiales, where they are invariably located adjacent to and divergently transcribed from putative virB-like operons. We show that similar to that of R. etli pSym, conjugative transfer of the 1.35-Mb symbiotic megaplasmid A of Sinorhizobium meliloti is also subjected to the inhibitory action of rctA. Our data provide strong evidence that the R. etli and S. meliloti pSym plasmids are indeed self-conjugative plasmids and that this property would only be expressed under optimal, as yet unknown conditions that entail inactivation of the rctA function. The rctA gene seems to represent novel but probably widespread regulatory systems controlling the transfer of conjugative elements within the order Rhizobiales. PMID:16237017

Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis.

Science.gov (United States)

Ray, Sujay; Banerjee, Arundhati

2015-10-01

Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

Science.gov (United States)

Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

2008-01-01

Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

Regulation of crp gene expression by the catabolite repressor/activator, Cra, in Escherichia coli.

Science.gov (United States)

Zhang, Zhongge; Aboulwafa, Mohammad; Saier, Milton H

2014-01-01

Growth of E. coli on several carbon sources is dependent on the catabolite repressor/activator (Cra) protein although a Cra consensus DNA-binding site is not present in the control regions of the relevant catabolic operons. We show that Cra regulates growth by activating expression of the crp gene. It thereby mediates catabolite repression of catabolic operons by an indirect mechanism. © 2014 S. Karger AG, Basel.

Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

Directory of Open Access Journals (Sweden)

Terezinha Knöbl

2006-06-01

Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

International Nuclear Information System (INIS)

Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

1988-01-01

The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

Science.gov (United States)

Chopra, Paras; Bender, Andreas

The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

Glucose repression in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Kayikci, Omur; Nielsen, Jens

2015-01-01

Glucose is the primary source of energy for the budding yeast Saccharomyces cerevisiae. Although yeast cells can utilize a wide range of carbon sources, presence of glucose suppresses molecular activities involved in the use of alternate carbon sources as well as it represses respiration and gluc......Glucose is the primary source of energy for the budding yeast Saccharomyces cerevisiae. Although yeast cells can utilize a wide range of carbon sources, presence of glucose suppresses molecular activities involved in the use of alternate carbon sources as well as it represses respiration...

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Winson, MK; Sternberg, C

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

Science.gov (United States)

Chowdhury, Nilkanta; Bagchi, Angshuman

2017-07-01

Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

Science.gov (United States)

Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

2018-01-01

Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

Science.gov (United States)

Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

2014-12-01

The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

Science.gov (United States)

Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

2012-07-15

Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

Dynamics and bistability in a reduced model of the lac operon

Science.gov (United States)

Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

2004-06-01

It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

Science.gov (United States)

Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

2014-09-01

Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Cyanobacterial flv4-2 Operon-Encoded Proteins Optimize Light Harvesting and Charge Separation in Photosystem II.

Science.gov (United States)

Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert

2015-05-01

Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

DEFF Research Database (Denmark)

Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

2015-01-01

encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

International Nuclear Information System (INIS)

Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

2007-01-01

The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

Directory of Open Access Journals (Sweden)

Lindblad Peter

2008-04-01

Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

Altered Regulation of Escherichia coli Biotin Biosynthesis in BirA Superrepressor Mutant Strains

Science.gov (United States)

Chakravartty, Vandana

2012-01-01

Transcription of the Escherichia coli biotin (bio) operon is directly regulated by the biotin protein ligase BirA, the enzyme that covalently attaches biotin to its cognate acceptor proteins. Binding of BirA to the bio operator requires dimerization of the protein, which is triggered by BirA-catalyzed synthesis of biotinoyl-adenylate (biotinoyl-5′-AMP), the obligatory intermediate of the ligation reaction. Although several aspects of this regulatory system are well understood, no BirA superrepressor mutant strains had been isolated. Such superrepressor BirA proteins would repress the biotin operon transcription in vivo at biotin concentrations well below those needed for repression by wild-type BirA. We isolated mutant strains having this phenotype by a combined selection-screening approach and resolved multiple mutations to give several birA superrepressor alleles, each having a single mutation, all of which showed repression dominant over that of the wild-type allele. All of these mutant strains repressed bio operon transcription in vivo at biotin concentrations that gave derepression of the wild-type strain and retained sufficient ligation activity for growth when overexpressed. All of the strains except that encoding G154D BirA showed derepression of bio operon transcription upon overproduction of a biotin-accepting protein. In BirA, G154D was a lethal mutation in single copy, and the purified protein was unable to transfer biotin from enzyme-bound biotinoyl-adenylate either to the natural acceptor protein or to a biotin-accepting peptide sequence. Consistent with the transcriptional repression data, each of the purified mutant proteins showed increased affinity for the biotin operator DNA in electrophoretic mobility shift assays. Surprisingly, although most of the mutations were located in the catalytic domain, all of those tested, except G154D BirA, had normal ligase activity. Most of the mutations that gave superrepressor phenotypes altered residues

Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

Science.gov (United States)

Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

2015-01-01

The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis.

Science.gov (United States)

Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent

2015-09-01

The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Interplay of protein and DNA structure revealed in simulations of the lac operon.

Directory of Open Access Journals (Sweden)

Luke Czapla

Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

Interplay of protein and DNA structure revealed in simulations of the lac operon.

Science.gov (United States)

Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K

2013-01-01

The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

OpenAIRE

Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

1993-01-01

CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

Science.gov (United States)

Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

2015-10-23

The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

Science.gov (United States)

Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

2017-05-01

Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Catabolite repression of enzyme synthesis does not prevent sporulation.

OpenAIRE

Lopez, J M; Uratani-Wong, B; Freese, E

1980-01-01

In the presence of excess glucose, a decrease of guanine nucleotides in Bacillus subtilis initiated sporulation but did not prevent catabolite repression of three enzymes. Therefore, the ultimate mechanism(s) repressing enzyme synthesis differs from that suppressing sporulation.

Lysines 72, 80 and 213 and aspartic acid 210 of the Lactococcus lactis LacR repressor are involved in the response to the inducer tagatose-6-phosphate leading to induction of lac operon expression.

Science.gov (United States)

van Rooijen, R J; Dechering, K J; Niek, C; Wilmink, J; de Vos, W M

1993-02-01

Site-directed mutagenesis of the Lactococcus lactis lacR gene was performed to identify residues in the LacR repressor that are involved in the induction of lacABCDFEGX operon expression by tagatose-6-phosphate. A putative inducer binding domain located near the C-terminus was previously postulated based on homology studies with the Escherichia coli DeoR family of repressors, which all have a phosphorylated sugar as inducer. Residues within this domain and lysine residues that are charge conserved in the DeoR family were changed into alanine or arginine. The production of the LacR mutants K72A, K80A, K80R, D210A, K213A and K213R in the LacR-deficient L.lactis strain NZ3015 resulted in repressed phospho-beta-galactosidase (LacG) activities and decreased growth rates on lactose. Gel mobility shift assays showed that the complex between a DNA fragment carrying the lac operators and LacR mutants K72A, K80A, K213A and D210A did not dissociate in the presence of tagatose-6-phosphate, in contrast to wild type LacR. Other mutations (K62A/K63A, K72R, K73A, K73R, T212A, F214R, R216R and R216K) exhibited no gross effects on inducer response. The results strongly suggest that the lysines at positions 72, 80 and 213 and aspartic acid at position 210 are involved in the induction of lac operon expression by tagatose-6-phosphate.

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Winson, MK; Sternberg, C

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

The Global Regulator Spx Functions in the Control of Organosulfur Metabolism in Bacillus subtilis†

Science.gov (United States)

Choi, Soon-Yong; Reyes, Dindo; Leelakriangsak, Montira; Zuber, Peter

2006-01-01

Spx is a global transcriptional regulator of the oxidative stress response in Bacillus subtilis. Its target is RNA polymerase, where it contacts the α subunit C-terminal domain. Recently, evidence was presented that Spx participates in sulfate-dependent control of organosulfur utilization operons, including the ytmI, yxeI, ssu, and yrrT operons. The yrrT operon includes the genes that function in cysteine synthesis from S-adenosylmethionine through intermediates S-adenosylhomocysteine, ribosylhomocysteine, homocysteine, and cystathionine. These operons are also negatively controlled by CymR, the repressor of cysteine biosynthesis operons. All of the operons are repressed in media containing cysteine or sulfate but are derepressed in medium containing the alternative sulfur source, methionine. Spx was found to negatively control the expression of these operons in sulfate medium, in part, by stimulating the expression of the cymR gene. In addition, microarray analysis, monitoring of yrrT-lacZ fusion expression, and in vitro transcription studies indicate that Spx directly activates yrrT operon expression during growth in medium containing methionine as sole sulfur source. These experiments have uncovered additional roles for Spx in the control of gene expression during unperturbed, steady-state growth. PMID:16885442

Racism and Surplus Repression.

Science.gov (United States)

Johnson, Howard

1983-01-01

Explores the relationship between Herbert Marcuse's theory of "surplus repression" and Freud's theory of the "unconscious" with respect to latent, hidden, covert, or subliminal aspects of racism in the United States. Argues that unconscious racism, manifested in evasion/avoidance, acting out/projection, and attempted…

Translational Control of the SigR-Directed Oxidative Stress Response in Streptomyces via IF3-Mediated Repression of a Noncanonical GTC Start Codon.

Science.gov (United States)

Feeney, Morgan A; Chandra, Govind; Findlay, Kim C; Paget, Mark S B; Buttner, Mark J

2017-06-13

The major oxidative stress response in Streptomyces is controlled by the sigma factor SigR and its cognate antisigma factor RsrA, and SigR activity is tightly controlled through multiple mechanisms at both the transcriptional and posttranslational levels. Here we show that sigR has a highly unusual GTC start codon and that this leads to another level of SigR regulation, in which SigR translation is repressed by translation initiation factor 3 (IF3). Changing the GTC to a canonical start codon causes SigR to be overproduced relative to RsrA, resulting in unregulated and constitutive expression of the SigR regulon. Similarly, introducing IF3* mutations that impair its ability to repress SigR translation has the same effect. Thus, the noncanonical GTC sigR start codon and its repression by IF3 are critical for the correct and proper functioning of the oxidative stress regulatory system. sigR and rsrA are cotranscribed and translationally coupled, and it had therefore been assumed that SigR and RsrA are produced in stoichiometric amounts. Here we show that RsrA can be transcribed and translated independently of SigR, present evidence that RsrA is normally produced in excess of SigR, and describe the factors that determine SigR-RsrA stoichiometry. IMPORTANCE In all sigma factor-antisigma factor regulatory switches, the relative abundance of the two proteins is critical to the proper functioning of the system. Many sigma-antisigma operons are cotranscribed and translationally coupled, leading to a generic assumption that the sigma and antisigma factors are produced in a fixed 1:1 ratio. In the case of sigR - rsrA , we show instead that the antisigma factor is produced in excess over the sigma factor, providing a buffer to prevent spurious release of sigma activity. This excess arises in part because sigR has an extremely rare noncanonical GTC start codon, and as a result, SigR translation initiation is repressed by IF3. This finding highlights the potential significance

A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

Science.gov (United States)

Kim, Dae Hun; Ko, Kwan Soo

2015-07-01

To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

Characterization of Zur-dependent genes and direct Zur targets in Yersinia pestis

Directory of Open Access Journals (Sweden)

Wang Xiaoyi

2009-06-01

Full Text Available Abstract Background The zinc uptake regulator Zur is a Zn2+-sensing metalloregulatory protein involved in the maintenance of bacterial zinc homeostasis. Up to now, regulation of zinc homeostasis by Zur is poorly understood in Y. pestis. Results We constructed a zur null mutant of Y. pestis biovar microtus strain 201. Microarray expression analysis disclosed a set of 154 Zur-dependent genes of Y. pestis upon exposure to zinc rich condition. Real-time reverse transcription (RT-PCR was subsequently used to validate the microarray data. Based on the 154 Zur-dependent genes, predicted regulatory Zur motifs were used to screen for potential direct Zur targets including three putative operons znuA, znuCB and ykgM-RpmJ2. The LacZ reporter fusion analysis verified that Zur greatly repressed the promoter activity of the above three operons. The subsequent electrophoretic mobility shift assay (EMSA demonstrated that a purified Zur protein was able to bind to the promoter regions of the above three operons. The DNase I footprinting was used to identify the Zur binding sites for the above three operons, verifying the Zur box sequence as predicted previously in γ-Proteobacteria. The primer extension assay was further used to determine the transcription start sites for the above three operons and to localize the -10 and -35 elements. Zur binding sites overlapped the -10 sequence of its target promoters, which was consistent with the previous observation that Zur binding would block the entry of the RNA polymerase to repress the transcription of its target genes. Conclusion Zur as a repressor directly controls the transcription of znuA, znuCB and ykgM-RpmJ2 in Y. pestis by employing a conserved mechanism of Zur-promoter DNA association as observed in γ-Proteobacteria. Zur contributes to zinc homeostasis in Y. pestis likely through transcriptional repression of the high-affinity zinc uptake system ZnuACB and two alternative ribosomal proteins YkgM and RpmJ2.

The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

DEFF Research Database (Denmark)

Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

2008-01-01

The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

The role of mitochondria in carbon catabolite repression in yeast.

Science.gov (United States)

Haussmann, P; Zimmermann, F K

1976-10-18

The role of mitochondria in carbon catabolite repression in Saccharomyces cerevisiae was investigated by comparing normal, respiratory competent (RHO) strains with their mitochondrially inherited, respiratory deficient mutant derivatives (rho). Formation of maltase and invertase was used as an indicator system for the effect of carbon catabolite repression on carbon catabolic reactions. Fermentation rates for glucose, maltose and sucrose were the same in RHO and rho strains. Specific activities of maltase and invertase were usually higher in the rho-mutants. A very pronounced difference in invertase levels was observed when cells were grown on maltose; rho-mutants had around 30 times more invertase than their RHO parent strains. The fact that rho-mutants were much less sensitive to carbon catabolite repression of invertase synthesis than their RHO parents was used to search for the mitochondrial factor(s) or function(s) involved in carbon catabolite repression. A possible metabolic influence of mitochondria on this system of regulation was tested after growth of RHO strains under anaerobic conditions (no respiration nor oxidative phosphorylation), in the presence of KCN (respiration inhibited), dinitrophenol (uncoupling of oxidative phosphorylation) and of both inhibitors anaerobic conditions and dinitrophenol had no effect on the extent of invertase repression. KCN reduced the degree of repression but not to the level found in rho-mutants. A combination of both inhibitors gave the same results as with KCN alone. Erythromycin and chloramphenicol were used as specific inhibitors of mitochondrial protein synthesis. Erythromycin prevented the formation of mitochondrial respiratory systems but did not induce rho-mutants under the conditions used. However, repression of invertase was as strong as in the absence of the inhibitor. Chloramphenicol led only to a slight reduction of the respiratory systems and did not affect invertase levels. A combination of both

Mechanism of ultraviolet light induced catabolite repression of L-arabinose isomerase

Energy Technology Data Exchange (ETDEWEB)

Bhatnagar, D; Bhattacharya, A K [Banaras Hindu Univ. (India). Inst. of Medical Sciences

1982-12-01

An attempt has been made to find out how U.V. irradiation of E.coli B/r cells causes catabolite repression to inhibit L-arabinose isomerase synthesis. The results presented show that U.V. irradiation leads to a lowering of the cellular cyclic AMP level and of the cyclic AMP binding activity. Unlike catabolite repression by glucose, no small molecular weight compound is involved in U.V. light induced inhibition of the binding activity. It is therefore concluded that the mechanism of catabolite repression induced by U.V. appears to be different from that of the catabolite repression by glucose.

Identification of the Staphylococcus aureus vfrAB operon, a novel virulence factor regulatory locus.

Science.gov (United States)

Bose, Jeffrey L; Daly, Seth M; Hall, Pamela R; Bayles, Kenneth W

2014-05-01

During a screen of the Nebraska Transposon Mutant Library, we identified 71 mutations in the Staphylococcus aureus genome that altered hemolysis on blood agar medium. Although many of these mutations disrupted genes known to affect the production of alpha-hemolysin, two of them were associated with an apparent operon, designated vfrAB, that had not been characterized previously. Interestingly, a ΔvfrB mutant exhibited only minor effects on the transcription of the hla gene, encoding alpha-hemolysin, when grown in broth, as well as on RNAIII, a posttranscriptional regulatory RNA important for alpha-hemolysin translation, suggesting that VfrB may function at the posttranscriptional level. Indeed, a ΔvfrB mutant had increased aur and sspAB protease expression under these conditions. However, disruption of the known secreted proteases in the ΔvfrB mutant did not restore hemolytic activity in the ΔvfrB mutant on blood agar. Further analysis revealed that, in contrast to the minor effects of VfrB on hla transcription when strains were cultured in liquid media, the level of hla transcription was decreased 50-fold in the absence of VfrB on solid media. These results demonstrate that while VfrB represses protease expression when strains are grown in broth, hla regulation is highly responsive to factors associated with growth on solid media. Intriguingly, the ΔvfrB mutant displayed increased pathogenesis in a model of S. aureus dermonecrosis, further highlighting the complexity of VfrB-dependent virulence regulation. The results of this study describe a phenotype associated with a class of highly conserved yet uncharacterized proteins found in Gram-positive bacteria, and they shed new light on the regulation of virulence factors necessary for S. aureus pathogenesis.

Sequence analysis and identification of the pyrKDbF operon from Lactococcus lactis including a novel gene, pyrK, involved in pyrimidine biosynthesis

DEFF Research Database (Denmark)

Andersen, Paal Skytt; Martinussen, Jan; Hammer, Karin

1996-01-01

Three genes encoding enzymes involved in the biosynthesis of pyrimidines have been found to constitute an operon in Lactococcus lactis. Two of the genes are the well-known pyr genes pyrDb and pyrF, encoding dihydroorotate dehydrogenase and orotidine monophosphate decarboxylase, respectively....... The third gene encodes a protein which was shown to be necessary for the activity of the pyrDb-encoded dihydroorotate dehydrogenase; we propose to name the gene pyrK. The pyrK-encoded protein is homologous to a number of proteins which are involved in electron transfer. The lactococcal pyrKDbF operon...... is highly homologous to the corresponding part of the much-larger pyr operon of Bacillus subtilis. orf2, the pyrK homolog in B. subtilis, has also been shown to be necessary for pyrimidine biosynthesis (A.E. Kahler and R.L. Switzer, J. Bacteriol. 178:5013-5016, 1996). Four genes adjacent to the operon, i...

Interference of transcription across H-NS binding sites and repression by H-NS.

Science.gov (United States)

Rangarajan, Aathmaja Anandhi; Schnetz, Karin

2018-05-01

Nucleoid-associated protein H-NS represses transcription by forming extended DNA-H-NS complexes. Repression by H-NS operates mostly at the level of transcription initiation. Less is known about how DNA-H-NS complexes interfere with transcription elongation. In vitro H-NS has been shown to enhance RNA polymerase pausing and to promote Rho-dependent termination, while in vivo inhibition of Rho resulted in a decrease of the genome occupancy by H-NS. Here we show that transcription directed across H-NS binding regions relieves H-NS (and H-NS/StpA) mediated repression of promoters in these regions. Further, we observed a correlation of transcription across the H-NS-bound region and de-repression. The data suggest that the transcribing RNA polymerase is able to remodel the H-NS complex and/or dislodge H-NS from the DNA and thus relieve repression. Such an interference of transcription and H-NS mediated repression may imply that poorly transcribed AT-rich loci are prone to be repressed by H-NS, while efficiently transcribed loci escape repression. © 2018 John Wiley & Sons Ltd.

Technique Selectively Represses Immune System

Science.gov (United States)

... Research Matters December 3, 2012 Technique Selectively Represses Immune System Myelin (green) encases and protects nerve fibers (brown). A new technique prevents the immune system from attacking myelin in a mouse model of ...

Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

Science.gov (United States)

Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

2015-11-01

Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

DEFF Research Database (Denmark)

Eberl, L; Christiansen, Gunna; Molin, S

1996-01-01

The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

Sequencing and promoter analysis of the nifENXorf3orf5fdxAnifQ operon from Azospirillum brasilense Sp7

Directory of Open Access Journals (Sweden)

Potrich D.P.

2001-01-01

Full Text Available A 40-kb DNA region containing the major cluster of nif genes has been isolated from the Azospirillum brasilense Sp7 genome. In this region three nif operons have been identified: nifHDKorf1Y, nifENXorf3orf5fdxAnifQ and orf2nifUSVorf4. The operons containing nifENX and nifUSV genes are separated from the structural nifHDKorf1Y operon by about 5 kb and 10 kb, respectively. The present study shows the sequence analysis of the 6045-bp DNA region containing the nifENX genes. The deduced amino acid sequences from the open reading frames were compared to the nif gene products of other diazotrophic bacteria and indicate the presence of seven ORFs, all reading in the same direction as that of the nifHDKorf1Y operon. Consensus sigma54 and NifA-binding sites are present only in the promoter region upstream of the nifE gene. This promoter is activated by NifA protein and is approximately two-times less active than the nifH promoter, as indicated by the ß-galactosidase assays. This result suggests the differential expression of the nif genes and their respective products in Azospirillum.

Modular Ligation Extension of Guide RNA Operons (LEGO) for Multiplexed dCas9 Regulation of Metabolic Pathways in Saccharomyces cerevisiae.

Science.gov (United States)

Deaner, Matthew; Holzman, Allison; Alper, Hal S

2018-04-16

Metabolic engineering typically utilizes a suboptimal step-wise gene target optimization approach to parse a highly connected and regulated cellular metabolism. While the endonuclease-null CRISPR/Cas system has enabled gene expression perturbations without genetic modification, it has been mostly limited to small sets of gene targets in eukaryotes due to inefficient methods to assemble and express large sgRNA operons. In this work, we develop a TEF1p-tRNA expression system and demonstrate that the use of tRNAs as splicing elements flanking sgRNAs provides higher efficiency than both Pol III and ribozyme-based expression across a variety of single sgRNA and multiplexed contexts. Next, we devise and validate a scheme to allow modular construction of tRNA-sgRNA (TST) operons using an iterative Type IIs digestion/ligation extension approach, termed CRISPR-Ligation Extension of sgRNA Operons (LEGO). This approach enables facile construction of large TST operons. We demonstrate this utility by constructing a metabolic rewiring prototype for 2,3-butanediol production in 2 distinct yeast strain backgrounds. These results demonstrate that our approach can act as a surrogate for traditional genetic modification on a much shorter design-cycle timescale. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A Growth Model of Inflation, Tax Evasion and Financial Repression

OpenAIRE

Roubini, Nouriel; Sala-i-Martin, Xavier

1992-01-01

In this paper we study the effects of policies of financial repression on long term growth and try to explain why optimizing governments might want to repress the financial sector. We also explain why inflation may be negatively related to growth, even though it does not affect growth directly. We argue that the main reason why governments repress the financial sector is that this sector is the source of "easy" resources for the public budget The source of revenue stemming from this intervent...

Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

Czech Academy of Sciences Publication Activity Database

Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav

2007-01-01

Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

Repressive coping and alexithymia in idiopathic environmental intolerance

DEFF Research Database (Denmark)

Skovbjerg, Sine; Zachariae, Robert; Rasmussen, Alice

2010-01-01

To examine if the non-expression of negative emotions (i.e., repressive coping) and differences in the ability to process and regulate emotions (i.e., alexithymia) is associated with idiopathic environmental intolerance (IEI).......To examine if the non-expression of negative emotions (i.e., repressive coping) and differences in the ability to process and regulate emotions (i.e., alexithymia) is associated with idiopathic environmental intolerance (IEI)....

Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

Science.gov (United States)

Osipiuk, J; Joachimiak, A

1997-09-12

We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

Science.gov (United States)

de Oliveira, Rafael R; Nicholson, Wayne L

2016-01-01

To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

Science.gov (United States)

Stefanski, Katherine M.

A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

Science.gov (United States)

Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

2016-08-01

To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

Czech Academy of Sciences Publication Activity Database

Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

2017-01-01

Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

CRISPR-Cas gene-editing reveals RsmA and RsmC act through FlhDC to repress the SdhE flavinylation factor and control motility and prodigiosin production in Serratia.

Science.gov (United States)

Hampton, Hannah G; McNeil, Matthew B; Paterson, Thomas J; Ney, Blair; Williamson, Neil R; Easingwood, Richard A; Bostina, Mihnea; Salmond, George P C; Fineran, Peter C

2016-06-01

SdhE is required for the flavinylation and activation of succinate dehydrogenase and fumarate reductase (FRD). In addition, SdhE is conserved in proteobacteria (α, β and γ) and eukaryotes. Although the function of this recently characterized family of proteins has been determined, almost nothing is known about how their genes are regulated. Here, the RsmA (CsrA) and RsmC (HexY) post-transcriptional and post-translational regulators have been identified and shown to repress sdhEygfX expression in Serratia sp. ATCC 39006. Conversely, the flagella master regulator complex, FlhDC, activated sdhEygfX transcription. To investigate the hierarchy of control, we developed a novel approach that utilized endogenous CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR associated) genome-editing by a type I-F system to generate a chromosomal point mutation in flhC. Mutation of flhC alleviated the ability of RsmC to repress sdhEygfX expression, whereas RsmA acted in both an FlhDC-dependent and -independent manner to inhibit sdhEygfX. Mutation of rsmA or rsmC, or overexpression of FlhDC, led to increased prodigiosin, biosurfactant, swimming and swarming. Consistent with the modulation of sdhE by motility regulators, we have demonstrated that SdhE and FRD are required for maximal flagella-dependent swimming. Together, these results demonstrate that regulators of both metabolism and motility (RsmA, RsmC and FlhDC) control the transcription of the sdhEygfX operon.

Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

Science.gov (United States)

Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

2013-11-01

Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

Mutual repression enhances the steepness and precision of gene expression boundaries.

Directory of Open Access Journals (Sweden)

Thomas R Sokolowski

Full Text Available Embryonic development is driven by spatial patterns of gene expression that determine the fate of each cell in the embryo. While gene expression is often highly erratic, embryonic development is usually exceedingly precise. In particular, gene expression boundaries are robust not only against intra-embryonic fluctuations such as noise in gene expression and protein diffusion, but also against embryo-to-embryo variations in the morphogen gradients, which provide positional information to the differentiating cells. How development is robust against intra- and inter-embryonic variations is not understood. A common motif in the gene regulation networks that control embryonic development is mutual repression between pairs of genes. To assess the role of mutual repression in the robust formation of gene expression patterns, we have performed large-scale stochastic simulations of a minimal model of two mutually repressing gap genes in Drosophila, hunchback (hb and knirps (kni. Our model includes not only mutual repression between hb and kni, but also the stochastic and cooperative activation of hb by the anterior morphogen Bicoid (Bcd and of kni by the posterior morphogen Caudal (Cad, as well as the diffusion of Hb and Kni between neighboring nuclei. Our analysis reveals that mutual repression can markedly increase the steepness and precision of the gap gene expression boundaries. In contrast to other mechanisms such as spatial averaging and cooperative gene activation, mutual repression thus allows for gene-expression boundaries that are both steep and precise. Moreover, mutual repression dramatically enhances their robustness against embryo-to-embryo variations in the morphogen levels. Finally, our simulations reveal that diffusion of the gap proteins plays a critical role not only in reducing the width of the gap gene expression boundaries via the mechanism of spatial averaging, but also in repairing patterning errors that could arise because of the

Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

Science.gov (United States)

Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

2001-01-01

Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

Induction of the Nitrate Assimilation nirA Operon and Protein-Protein Interactions in the Maturation of Nitrate and Nitrite Reductases in the Cyanobacterium Anabaena sp. Strain PCC 7120.

Science.gov (United States)

Frías, José E; Flores, Enrique

2015-07-01

Nitrate is widely used as a nitrogen source by cyanobacteria, in which the nitrate assimilation structural genes frequently constitute the so-called nirA operon. This operon contains the genes encoding nitrite reductase (nirA), a nitrate/nitrite transporter (frequently an ABC-type transporter; nrtABCD), and nitrate reductase (narB). In the model filamentous cyanobacterium Anabaena sp. strain PCC 7120, which can fix N2 in specialized cells termed heterocysts, the nirA operon is expressed at high levels only in media containing nitrate or nitrite and lacking ammonium, a preferred nitrogen source. Here we examined the genes downstream of the nirA operon in Anabaena and found that a small open reading frame of unknown function, alr0613, can be cotranscribed with the operon. The next gene in the genome, alr0614 (narM), showed an expression pattern similar to that of the nirA operon, implying correlated expression of narM and the operon. A mutant of narM with an insertion mutation failed to produce nitrate reductase activity, consistent with the idea that NarM is required for the maturation of NarB. Both narM and narB mutants were impaired in the nitrate-dependent induction of the nirA operon, suggesting that nitrite is an inducer of the operon in Anabaena. It has previously been shown that the nitrite reductase protein NirA requires NirB, a protein likely involved in protein-protein interactions, to attain maximum activity. Bacterial two-hybrid analysis confirmed possible NirA-NirB and NarB-NarM interactions, suggesting that the development of both nitrite reductase and nitrate reductase activities in cyanobacteria involves physical interaction of the corresponding enzymes with their cognate partners, NirB and NarM, respectively. Nitrate is an important source of nitrogen for many microorganisms that is utilized through the nitrate assimilation system, which includes nitrate/nitrite membrane transporters and the nitrate and nitrite reductases. Many cyanobacteria

A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

Science.gov (United States)

Tadmor, Arbel

2009-03-01

In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.

CysB-dependent upregulation of the Salmonella Typhimurium cysJIH operon in response to antimicrobial compounds that induce oxidative stress.

Science.gov (United States)

Álvarez, Ricardo; Neumann, German; Frávega, Jorge; Díaz, Fernando; Tejías, Cristóbal; Collao, Bernardo; Fuentes, Juan A; Paredes-Sabja, Daniel; Calderón, Iván L; Gil, Fernando

2015-02-27

It has been proposed that some antibiotics exert additional damage through reactive oxygen species (ROS) production. Since H₂S protects neurons and cardiac muscle from oxidative stress, it has been hypothesized that bacterial H₂S might, similarly, be a cellular protector against antibiotics. In Enterobacteriaceae, H₂S can be produced by the cysJIH pathway, which uses sulfate as the sulfur source. CysB, in turn, is a positive regulator of cysJIH. At present, the role of S. Typhimurium cysJIH operon in the protection to reactive oxygen species (ROS) induced by antimicrobial compounds remains to be elucidated. In this work, we evaluated the role of cysJIH and cysB in ROS accumulation, superoxide dismutase (SOD) activity, reduced thiol accumulation, and H₂S accumulation in S. Typhimurium, cultured in either sulfate or cysteine as the sole sulfur source. Furthermore, we assessed the effects of the addition of ceftriaxone (CEF) and menadione (MEN) in these same parameters. In sulfate as the sole sulfur source, we found that the cysJIH operon and the cysB gene were required to full growth in minimal media, independently on the addition of CEF or MEN. Most importantly, both cysJIH and cysB contributed to diminish ROS levels, increase the SOD activity, increase the reduced thiols, and increase the H₂S levels in presence of CEF or MEN. Moreover, the cysJIH operon exhibited a CysB-dependent upregulation in presence of these two antimicrobials compounds. On the other hand, when cysteine was used as the sole sulfur source, we found that cysJIH operon was completely negligible, were only cysB exhibited similar phenotypes than the described for sulfate as sulfur source. Unexpectedly, CysB downregulated cysJIH operon when cysteine was used instead of sulfate, suggesting a complex regulation of this system. Copyright © 2015 Elsevier Inc. All rights reserved.

The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

NARCIS (Netherlands)

Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.

2006-01-01

The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

An ArsR/SmtB family member is involved in the regulation by arsenic of the arsenite oxidase operon in Thiomonas arsenitoxydans.

Science.gov (United States)

Moinier, Danielle; Slyemi, Djamila; Byrne, Deborah; Lignon, Sabrina; Lebrun, Régine; Talla, Emmanuel; Bonnefoy, Violaine

2014-10-01

The genetic organization of the aioBA operon, encoding the arsenite oxidase of the moderately acidophilic and facultative chemoautotrophic bacterium Thiomonas arsenitoxydans, is different from that of the aioBA operon in the other arsenite oxidizers, in that it encodes AioF, a metalloprotein belonging to the ArsR/SmtB family. AioF is stabilized by arsenite, arsenate, or antimonite but not molybdate. Arsenic is tightly attached to AioF, likely by cysteine residues. When loaded with arsenite or arsenate, AioF is able to bind specifically to the regulatory region of the aio operon at two distinct positions. In Thiomonas arsenitoxydans, the promoters of aioX and aioB are convergent, suggesting that transcriptional interference occurs. These results indicate that the regulation of the aioBA operon is more complex in Thiomonas arsenitoxydans than in the other aioBA containing arsenite oxidizers and that the arsenic binding protein AioF is involved in this regulation. On the basis of these data, a model to explain the tight control of aioBA expression by arsenic in Thiomonas arsenitoxydans is proposed. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Mechanisms of transcriptional repression by EWS-FLl1 in Ewing Sarcoma

International Nuclear Information System (INIS)

Niedan, S.

2012-01-01

The EWS-FLI1 chimeric oncoprotein characterizing Ewing Sarcoma (ES) is a prototypic aberrant ETS transcription factor with activating and repressive gene regulatory functions. Mechanisms of transcriptional regulation, especially transcriptional repression by EWS-FLI1, are poorly understood. We report that EWS-FLI1 repressed promoters are enriched in forkhead box recognition motifs, and identify FOXO1 as a EWS-FLI1 suppressed master regulator responsible for a significant subset of EWS-FLI1 repressed genes. In addition to transcriptional FOXO1 regulation by direct promoter binding of EWS-FLI1, its subcellular localization and activity is regulated by CDK2 and AKT mediated phosphorylation downstream of EWS-FLI1. Functional restoration of nuclear FOXO1 expression in ES cells impaired proliferation and significantly reduced clonogenicity. Gene-expression profiling revealed a significant overlap between EWS-FLI1 repressed and FOXO1-activated genes. Treatment of ES cell lines with Methylseleninic acid (MSA) evoked reactivation of endogenous FOXO1 in the presence of EWS-FLI1 in a dose- and time-dependent manner and induced massive cell death which was found to be partially FOXO1-dependent. In an orthotopic xenograft mouse model, MSA increased FOXO1 expression in the tumor paralleled by a significant decrease in ES tumor growth. Together, these data suggest that a repressive sub-signature of EWS-FLI1 repressed genes precipitates suppression of FOXO1. FOXO1 re-activation by small molecules may therefore constitute a novel therapeutic strategy in the treatment of ES. (author) [de

Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance.

Science.gov (United States)

Ghosh, Semanti; Bagchi, Angshuman

2015-12-01

Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

Rule of Repression in Chile.

Science.gov (United States)

American Indian Journal, 1979

1979-01-01

This report on the current condition of the Mapuche Indians of Chile is edited from a document on the "Situation of Human Rights in Chile" and details the repressive and inhumane treatment of the largest indigenous ethnic minority in the country. (Author/RTS)

Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

Science.gov (United States)

Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

2017-11-01

Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

Science.gov (United States)

Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

2017-01-01

Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

Directory of Open Access Journals (Sweden)

Kathleen Jwanoswki

Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

Literature, Advertising and Return of the Repressed

Directory of Open Access Journals (Sweden)

Francesco Ghelli

2013-06-01

Full Text Available Since I have faced with the hypothesis elaborated by Francesco Orlando, according to which literature is a form of return of the repressed, I wondered what – in our era of deregulation, end of censorship and taboos – could occupy the place of the repressed. One of the most influential sociologists, Zygmunt Bauman, has outlined the epochal passage from “the uneasiness in civilization” to today's “uneasiness of freedom”. The problem of desire today would not be a clash with a limit, but an indefinite freedom that is likely to turn into lost, loss of intensity and meaning.

Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

Science.gov (United States)

Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

2015-01-01

Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

Social adjustment and repressive adaptive style in survivors of pediatric cancer.

Science.gov (United States)

Schulte, Fiona; Wurz, Amanda; Russell, K Brooke; Reynolds, Kathleen; Strother, Douglas; Dewey, Deborah

2018-01-01

The aim of the study was to explore the relationship between repressive adaptive style and self-reports of social adjustment in survivors of pediatric cancer compared to their siblings. We hypothesized that there would be a greater proportion of repressors among survivors of pediatric cancer compared to siblings, and that repressive adaptive style would be significantly associated with more positive self-reports of social adjustment. We utilized a cross-sectional approach. Seventy-seven families participated. Survivors of pediatric cancer (n = 77, 48% male; 8-18 years of age) and one sibling (n = 50, 48% male; 8-18 years of age) completed measures assessing repressive adaptive style and social adjustment. As well, one parent from each family completed a socio-demographic questionnaire. Questionnaire packages were mailed to eligible families who agreed to participate, and were mailed back to investigators in a pre-addressed, pre-stamped envelope. Chi-square analyses revealed there was no significant difference in the proportion of repressors among survivors and siblings. Social adjustment scores were subjected to a two (group: survivor, sibling) by two (repressor, nonrepressor) ANCOVA with gender and age as covariates. There was a significant main effect of repressive adaptive style (F = 5.69, p < .05, η 2 = 0.05) with a modest effect. Survivors and siblings with a repressive style reported significantly higher social adjustment scores (M = 106.91, SD = 11.69) compared to nonrepressors (M = 99.57, SD = 13.45). Repressive adaptive style explains some of the variance in survivors and siblings' self-reports of social adjustment. Future research should aim to better understand the role of the repressive adaptive style in survivors and siblings of children with cancer.

State Repression and its Effects on Civil Conflict, Socio-Economic Outcomes, and Leadership Tenure

Science.gov (United States)

feedback loop: how citizens respond peacefully or violently influences the type of repression rulers employ. How rulers use repression influences how and...whether citizens protest. Moreover, how rulers respond to their citizens may influence leadership duration. Obviously, the relationship among repression...US (and allied) officials may want policy options to influence rulers who are becoming increasingly repressive (as in Turkey and Egypt) or leaders who

Stochasticity or the fatal 'imperfection' of cloning

Indian Academy of Sciences (India)

Unknown

duced by a cell is the result of the integration of small quantal events (McAdams ... city in the case of de-repression of the lac operon has recently been .... Changes in the medium ..... eukaryotic gene networks: cell differentiation by graded to.

Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

Science.gov (United States)

da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

2017-07-01

One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

Mechanisms of transcriptional repression by histone lysine methylation

DEFF Research Database (Denmark)

Hublitz, Philip; Albert, Mareike; Peters, Antoine H F M

2009-01-01

. In this report, we review the recent literature to deduce mechanisms underlying Polycomb and H3K9 methylation mediated repression, and describe the functional interplay with activating H3K4 methylation. We summarize recent data that indicate a close relationship between GC density of promoter sequences......, transcription factor binding and the antagonizing activities of distinct epigenetic regulators such as histone methyltransferases (HMTs) and histone demethylases (HDMs). Subsequently, we compare chromatin signatures associated with different types of transcriptional outcomes from stable repression to highly...

Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

NARCIS (Netherlands)

Nouwen, N; Driessen, AJM

2005-01-01

Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

Polycomb group protein-mediated repression of transcription

DEFF Research Database (Denmark)

Morey, Lluís; Helin, Kristian

2010-01-01

The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work as transcri......The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work...... as transcriptional repressors is incompletely understood, but involves post-translational modifications of histones by two major PcG protein complexes: polycomb repressive complex 1 and polycomb repressive complex 2....

A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

Science.gov (United States)

Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

2015-01-01

The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

Science.gov (United States)

Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

2010-07-01

Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

Science.gov (United States)

2012-01-01

Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

miRNA-dependent translational repression in the Drosophila ovary.

Directory of Open Access Journals (Sweden)

John Reich

Full Text Available The Drosophila ovary is a tissue rich in post-transcriptional regulation of gene expression. Many of the regulatory factors are proteins identified via genetic screens. The more recent discovery of microRNAs, which in other animals and tissues appear to regulate translation of a large fraction of all mRNAs, raised the possibility that they too might act during oogenesis. However, there has been no direct demonstration of microRNA-dependent translational repression in the ovary.Here, quantitative analyses of transcript and protein levels of transgenes with or without synthetic miR-312 binding sites show that the binding sites do confer translational repression. This effect is dependent on the ability of the cells to produce microRNAs. By comparison with microRNA-dependent translational repression in other cell types, the regulated mRNAs and the protein factors that mediate repression were expected to be enriched in sponge bodies, subcellular structures with extensive similarities to the P bodies found in other cells. However, no such enrichment was observed.Our results reveal the variety of post-transcriptional regulatory mechanisms that operate in the Drosophila ovary, and have implications for the mechanisms of miRNA-dependent translational control used in the ovary.

Functional analysis of the pediocin operon of Pediococcus acidilactici PAC1.0 : PedB is the immunity protein and PedD is the precursor processing enzyme

NARCIS (Netherlands)

Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.

The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises

Salmonella enterica Typhimurium fljBA operon stability: implications regarding the origin of Salmonella enterica I 4,[5],12:i:.

Science.gov (United States)

Tomiyama, M P O; Werle, C H; Milanez, G P; Nóbrega, D B; Pereira, J P; Calarga, A P; Flores, F; Brocchi, M

2015-12-29

Salmonella enterica subsp enterica serovar 4,5,12:i:- has been responsible for many recent Salmonella outbreaks worldwide. Several studies indicate that this serovar originated from S. enterica subsp enterica serovar Typhimurium, by the loss of the flagellar phase II gene (fljB) and adjacent sequences. However, at least two different clones of S. enterica 4,5,12:i:- exist that differs in the molecular events responsible for fljB deletion. The aim of this study was to test the stability of the fljBA operon responsible for the flagellar phase variation under different growth conditions in order to verify if its deletion is a frequent event that could explain the origin and dissemination of this serovar. In fact, coding sequences for transposons are present near this operon and in some strains, such as S. enterica Typhimurium LT2, the Fels-2 prophage gene is inserted near this operon. The presence of mobile DNA could confer instability to this region. In order to examine this, the cat (chloramphenicol acetyltransferase) gene was inserted adjacent to the fljBA operon so that deletions involving this genomic region could be identified. After growing S. enterica chloramphenicol-resistant strains under different conditions, more than 104 colonies were tested for the loss of chloramphenicol resistance. However, none of the colonies were sensitive to chloramphenicol. These data suggest that the origin of S. enterica serovar 4,5,12:i:- from Typhimurium by fljBA deletion is not a frequent event. The origin and dissemination of 4,5,12:i:- raise several questions about the role of flagellar phase variation in virulence.

Nuclear AXIN2 represses MYC gene expression

Energy Technology Data Exchange (ETDEWEB)

Rennoll, Sherri A.; Konsavage, Wesley M.; Yochum, Gregory S., E-mail: gsy3@psu.edu

2014-01-03

Highlights: •AXIN2 localizes to cytoplasmic and nuclear compartments in colorectal cancer cells. •Nuclear AXIN2 represses the activity of Wnt-responsive luciferase reporters. •β-Catenin bridges AXIN2 to TCF transcription factors. •AXIN2 binds the MYC promoter and represses MYC gene expression. -- Abstract: The β-catenin transcriptional coactivator is the key mediator of the canonical Wnt signaling pathway. In the absence of Wnt, β-catenin associates with a cytosolic and multi-protein destruction complex where it is phosphorylated and targeted for proteasomal degradation. In the presence of Wnt, the destruction complex is inactivated and β-catenin translocates into the nucleus. In the nucleus, β-catenin binds T-cell factor (TCF) transcription factors to activate expression of c-MYC (MYC) and Axis inhibition protein 2 (AXIN2). AXIN2 is a member of the destruction complex and, thus, serves in a negative feedback loop to control Wnt/β-catenin signaling. AXIN2 is also present in the nucleus, but its function within this compartment is unknown. Here, we demonstrate that AXIN2 localizes to the nuclei of epithelial cells within normal and colonic tumor tissues as well as colorectal cancer cell lines. In the nucleus, AXIN2 represses expression of Wnt/β-catenin-responsive luciferase reporters and forms a complex with β-catenin and TCF. We demonstrate that AXIN2 co-occupies β-catenin/TCF complexes at the MYC promoter region. When constitutively localized to the nucleus, AXIN2 alters the chromatin structure at the MYC promoter and directly represses MYC gene expression. These findings suggest that nuclear AXIN2 functions as a rheostat to control MYC expression in response to Wnt/β-catenin signaling.

Nuclear AXIN2 represses MYC gene expression

International Nuclear Information System (INIS)

Rennoll, Sherri A.; Konsavage, Wesley M.; Yochum, Gregory S.

2014-01-01

Highlights: •AXIN2 localizes to cytoplasmic and nuclear compartments in colorectal cancer cells. •Nuclear AXIN2 represses the activity of Wnt-responsive luciferase reporters. •β-Catenin bridges AXIN2 to TCF transcription factors. •AXIN2 binds the MYC promoter and represses MYC gene expression. -- Abstract: The β-catenin transcriptional coactivator is the key mediator of the canonical Wnt signaling pathway. In the absence of Wnt, β-catenin associates with a cytosolic and multi-protein destruction complex where it is phosphorylated and targeted for proteasomal degradation. In the presence of Wnt, the destruction complex is inactivated and β-catenin translocates into the nucleus. In the nucleus, β-catenin binds T-cell factor (TCF) transcription factors to activate expression of c-MYC (MYC) and Axis inhibition protein 2 (AXIN2). AXIN2 is a member of the destruction complex and, thus, serves in a negative feedback loop to control Wnt/β-catenin signaling. AXIN2 is also present in the nucleus, but its function within this compartment is unknown. Here, we demonstrate that AXIN2 localizes to the nuclei of epithelial cells within normal and colonic tumor tissues as well as colorectal cancer cell lines. In the nucleus, AXIN2 represses expression of Wnt/β-catenin-responsive luciferase reporters and forms a complex with β-catenin and TCF. We demonstrate that AXIN2 co-occupies β-catenin/TCF complexes at the MYC promoter region. When constitutively localized to the nucleus, AXIN2 alters the chromatin structure at the MYC promoter and directly represses MYC gene expression. These findings suggest that nuclear AXIN2 functions as a rheostat to control MYC expression in response to Wnt/β-catenin signaling

Deletion of the budBAC operon in Klebsiella pneumoniae to understand the physiological role of 2,3-butanediol biosynthesis.

Science.gov (United States)

Jeong, Daun; Yang, Jeongmo; Lee, Soojin; Kim, Borim; Um, Youngsoon; Kim, Youngrok; Ha, Kyoung-Su; Lee, Jinwon

2016-05-18

Klebsiella pneumoniae is known to produce 2,3-butanediol (2,3-BDO), a valuable chemical. In K. pneumoniae, the 2,3-BDO operon (budBAC) is involved in the production of 2,3-BDO. To observe the physiological role of the 2,3-BDO operon in a mixed acid fermentation, we constructed a budBAC-deleted strain (SGSB109). The production of extracellular metabolites, CO2 emission, carbon distribution, and NADH/NAD(+) balance of SGSB109 were compared with the parent strain (SGSB100). When comparing the carbon distribution at 15 hr, four significant differences were observed: in 2,3-BDO biosynthesis, lactate and acetate production (lactate and acetate production increased 2.3-fold and 4.1-fold in SGSB109 compared to SGSB100), CO2 emission (higher in SGSB100), and carbon substrate uptake (higher in SGSB100). Previous studies on the inactivation of the 2,3-BDO operon were focused on the increase of 1,3-propanediol production. Few studies have been done observing the role of 2,3-BDO biosynthesis. This study provides a prime insight into the role of 2,3-BDO biosynthesis of K. pneumoniae.

THE DYNAMICS OF REPRESSIVE HABITUS LAWS: ETHNOGRAPHIC CASE STUDY IN UNWIMA

Directory of Open Access Journals (Sweden)

Teddy Asmara

2015-01-01

Full Text Available This research describes repressive legal habitus Unwima community by focusing on the issue of why they create a legal cognition such manner and how to empower them in the public domain when facing a lawsuit in court and examination process in higher education office. The results of the research with ethnographic methods and interpretative analysis, First, that repressive legal habitus is a part of the neo-feudalistic thinking in education management. Second, the empowerment of repressive legal habitus in the public domain potentially generate a legal behavior of impulsive that tends to a manipulative, coercive, veiled, and other immorality practices.

How social media matter: Repression and the diffusion of the Occupy Wall Street movement.

Science.gov (United States)

Suh, Chan S; Vasi, Ion Bogdan; Chang, Paul Y

2017-07-01

This study explores the role played by social media in reshaping the repression-mobilization relationship. Drawing on the case of the Occupy Wall Street movement, we examine the impact of Facebook and Twitter on the spatial diffusion of protests during a period of heightened state repression. Results from event history analyses suggest that the effects of repression on protest diffusion are contingent on the presence of social media accounts supporting the movement. We find that state repression at earlier protest sites encouraged activists to create Facebook and Twitter accounts in their own cities, which then served as important vehicles for the initiation of new Occupy protests. Moreover, results suggest that repression incidents can directly facilitate future protests in cities that already have Occupy Facebook accounts. This study highlights the potential of social media to both mediate and moderate the influence of repression on the diffusion of contemporary movements. Copyright © 2017 Elsevier Inc. All rights reserved.

Functional characterization of a cadmium resistance operon in Staphylococcus aureus ATCC12600: CadC does not function as a repressor.

Science.gov (United States)

Hoogewerf, Arlene J; Dyk, Lisa A Van; Buit, Tyler S; Roukema, David; Resseguie, Emily; Plaisier, Christina; Le, Nga; Heeringa, Lee; Griend, Douglas A Vander

2015-02-01

Sequencing of a cadmium resistance operon from a Staphylococcus aureus ATCC12600 plasmid revealed that it is identical to a cadCA operon found in MRSA strains. Compared to plasmid-cured and cadC-mutant strains, cadC-positive ATCC12600 cells had increased resistance to cadmium (1 mg ml(-1) cadmium sulfate) and zinc (4 mg ml(-1) zinc sulfate), but not to other metal ions. After growth in media containing 20 µg ml(-1) cadmium sulfate, cadC-mutant cells contained more intracellular cadmium than cadC-positive ATCC12600 cells, suggesting that cadC absence results in impaired cadmium efflux. Electrophoretic mobility shift assays were performed with CadC proteins encoded by the S. aureus ATCC12600 plasmid and by the cadC gene of pI258, which is known to act as a transcriptional repressor and shares only 47% protein sequence identity with ATCC12600 CadC. Mobility shifts occurred when pI258 CadC protein was incubated with the promoter DNA-regions from the pI258 and S. aureus ATCC12600 cadCA operons, but did not occur with S. aureus ATCC12600 CadC protein, indicating that the ATCC12600 CadC protein does not interact with promoter region DNA. This cadCA operon, found in MRSA strains and previously functionally uncharacterized, increases resistance to cadmium and zinc by an efflux mechanism, and CadC does not function as a transcriptional repressor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia.

Science.gov (United States)

Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène

2018-01-22

Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.

Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

Directory of Open Access Journals (Sweden)

Johanna Rintahaka

Full Text Available A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we

Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

Science.gov (United States)

Rintahaka, Johanna; Yu, Xia; Kant, Ravi; Palva, Airi; von Ossowski, Ingemar

2014-01-01

A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

Czech Academy of Sciences Publication Activity Database

Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

2017-01-01

Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

PROBLEM OF CRIMINAL REPRESSION, APPLIED OUTSIDE OF CRIMINAL LIABILITY

Directory of Open Access Journals (Sweden)

Vitaly Stepashin

2017-01-01

Full Text Available УДК 343.2A new institute of repressive measures applied outside the criminal liability in criminal law (including as a condition for exemption from criminal liability is forming now in Russian legislation. The author concludes that the provisions of the criminal law on monetary compensation and a court fine should be deleted because of the following reasons. 1 By their nature, and monetary compensation and a court fine, not being a formal punishment (and, therefore, a form of realization of criminal responsibility is a monetary penalty, i.e., penalty-punishment. Moreover, the rules of court fine destination identical rules of criminal sentencing. 2 Quantitatively court fine may exceed the minimum limits of criminal punish-ment in the form of fines. The dimensions of monetary compensation in the order of hours. Pt. 2, Art. 76.1 of the Criminal Code and at all close to the maximum values of fine-punishment. 3 Exemption from criminal liability requires states to refrain from prosecuting the person alleged to have committed a crime, which means that the nonuse of criminal repression. Regulatory standards analyzed, on the other hand, require mandatory use of repression, ie, virtually no exemption from criminal liability does not occur at all. 4 The use of a quasi-penalty in the form of monetary compensation and court fines are not an exemption from criminal responsibility, but on the contrary, the use of criminal repression (of responsibility, and in a simplified manner. 5 Contrary to the requirements of the Constitution and the Criminal Code of criminal repression is applied to persons whose guilt has not been established in the commission of a crime. Thus, in criminal law introduced a presumption of guilt. 6 Customization repression (in fact – of criminal responsibility in the application of the judicial penalty is substantially limited, and the application of monetary compensation is excluded at all, contrary to the requirement that the rough

Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

NARCIS (Netherlands)

Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

2005-01-01

Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

Science.gov (United States)

Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

2017-01-15

The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

Expression of the N2 fixation gene operon of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21.

Science.gov (United States)

Zhang, Lihong; Liu, Xiaomeng; Li, Xinxin; Chen, Sanfeng

2015-10-01

To investigate the transcription and translation and nitrogenase activity of the nine N2-fixing-gene (nif) operon (nifBHDKENXhesAnifX) of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21 under different conditions. The Paenibacillus nif operon under the control of the T7 promoter is significantly transcribed and effectively translated in E. coli BL21 when grown in medium containing organic N compounds (yeast extract and Tryptone) or NH4+ by using RT-PCR and Western blot analysis. Transcription and translation of foreign nif genes in E. coli are not inhibited by environmental organic or inorganic N compounds or O2. However, contrary to transcription and translation, nitrogenase activity is 4% lower in the recombinant E. coli 78-32 compared to the native Paenibacillus sp. WLY78. The Paenibacillus nif operon under the control of T7 promoter enables E. coli BL21 to synthesize active nitrogenase. This study shows how the nif gene operon can be transferred to non-N2-fixing bacteria or to eukaryotic organelles.

Glucose-mediated repression of autolysis and conidiogenesis in Emericella nidulans.

Science.gov (United States)

Emri, Tamás; Molnár, Zsolt; Veres, Tünde; Pusztahelyi, Tünde; Dudás, Gábor; Pócsi, István

2006-10-01

Glucose-mediated repression of autolysis and sporulation was studied in submerged Emericellanidulans (anam. Aspergillus nidulans) cultures. Null mutation of the creA gene, which encodes the major carbon catabolite repressor CreA in E. nidulans, resulted in a hyperautolytic phenotype characterized by increased extracellular hydrolase production and dry cell mass declination. Interestingly, glucose, as well as the glucose antimetabolite 2-deoxy-d-glucose, repressed autolysis and sporulation in both the control and the creA null mutant strains suggesting that these processes were also subjected to CreA-independent carbon regulation. For example, the glucose-mediated, but CreA-independent, repression of the sporulation transcription factor BrlA was likely to contribute to the negative regulation of conidiogenesis by glucose. Although CreA played a prominent role in the regulation of autolysis via the repression of genes encoding important autolytic hydrolases like ChiB chitinase and PrtA protease the age-related production of the chitinase activity was also negatively affected by the down-regulation of brlA expression. However, neither CreA-dependent nor CreA-independent elements of carbon regulation affected the initiation and regulation of cell death in E. nidulans under carbon starvation.

Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

Directory of Open Access Journals (Sweden)

Cataldi Angel A

2011-07-01

Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

Directory of Open Access Journals (Sweden)

Enrico eMuhr

2016-01-01

Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

Directory of Open Access Journals (Sweden)

Alexander William Eastman

2015-01-01

Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

An L-Fucose Operon in the Probiotic Lactobacillus rhamnosus GG Is Involved in Adaptation to Gastrointestinal Conditions.

Science.gov (United States)

Becerra, Jimmy E; Yebra, María J; Monedero, Vicente

2015-06-01

L-Fucose is a sugar present in human secretions as part of human milk oligosaccharides, mucins, and other glycoconjugates in the intestinal epithelium. The genome of the probiotic Lactobacillus rhamnosus GG (LGG) carries a gene cluster encoding a putative L-fucose permease (fucP), L-fucose catabolic pathway (fucI, fucK, fucU, and fucA), and a transcriptional regulator (fucR). The metabolism of L-fucose in LGG results in 1,2-propanediol production, and their fucI and fucP mutants displayed a severe and mild growth defect on L-fucose, respectively. Transcriptional analysis revealed that the fuc genes are induced by L-fucose and subject to a strong carbon catabolite repression effect. This induction was triggered by FucR, which acted as a transcriptional activator necessary for growth on L-fucose. LGG utilized fucosyl-α1,3-N-acetylglucosamine and contrarily to other lactobacilli, the presence of fuc genes allowed this strain to use the L-fucose moiety. In fucI and fucR mutants, but not in fucP mutant, L-fucose was not metabolized and it was excreted to the medium during growth on fucosyl-α1,3-N-acetylglucosamine. The fuc genes were induced by this fucosyl-disaccharide in the wild type and the fucP mutant but not in a fucI mutant, showing that FucP does not participate in the regulation of fuc genes and that L-fucose metabolism is needed for FucR activation. The l-fucose operon characterized here constitutes a new example of the many factors found in LGG that allow this strain to adapt to the gastrointestinal conditions. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Awakening sleeping beauty: production of propionic acid in Escherichia coli through the sbm operon requires the activity of a methylmalonyl-CoA epimerase.

Science.gov (United States)

Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban

2017-07-17

Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway

A single cis element maintains repression of the key developmental regulator Gata2.

Directory of Open Access Journals (Sweden)

Jonathan W Snow

2010-09-01

Full Text Available In development, lineage-restricted transcription factors simultaneously promote differentiation while repressing alternative fates. Molecular dissection of this process has been challenging as transcription factor loci are regulated by many trans-acting factors functioning through dispersed cis elements. It is not understood whether these elements function collectively to confer transcriptional regulation, or individually to control specific aspects of activation or repression, such as initiation versus maintenance. Here, we have analyzed cis element regulation of the critical hematopoietic factor Gata2, which is expressed in early precursors and repressed as GATA-1 levels rise during terminal differentiation. We engineered mice lacking a single cis element -1.8 kb upstream of the Gata2 transcriptional start site. Although Gata2 is normally repressed in late-stage erythroblasts, the -1.8 kb mutation unexpectedly resulted in reactivated Gata2 transcription, blocked differentiation, and an aberrant lineage-specific gene expression pattern. Our findings demonstrate that the -1.8 kb site selectively maintains repression, confers a specific histone modification pattern and expels RNA Polymerase II from the locus. These studies reveal how an individual cis element establishes a normal developmental program via regulating specific steps in the mechanism by which a critical transcription factor is repressed.

Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

Science.gov (United States)

Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

2016-11-08

Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

Transcript analysis of the extended hyp-operon in the cyanobacteria Nostoc sp. strain PCC 7120 and Nostoc punctiforme ATCC 29133

Science.gov (United States)

2011-01-01

Background Cyanobacteria harbor two [NiFe]-type hydrogenases consisting of a large and a small subunit, the Hup- and Hox-hydrogenase, respectively. Insertion of ligands and correct folding of nickel-iron hydrogenases require assistance of accessory maturation proteins (encoded by the hyp-genes). The intergenic region between the structural genes encoding the uptake hydrogenase (hupSL) and the accessory maturation proteins (hyp genes) in the cyanobacteria Nostoc PCC 7120 and N. punctiforme were analysed using molecular methods. Findings The five ORFs, located in between the uptake hydrogenase structural genes and the hyp-genes, can form a transcript with the hyp-genes. An identical genomic localization of these ORFs are found in other filamentous, N2-fixing cyanobacterial strains. In N. punctiforme and Nostoc PCC 7120 the ORFs upstream of the hyp-genes showed similar transcript level profiles as hupS (hydrogenase structural gene), nifD (nitrogenase structural gene), hypC and hypF (accessory hydrogenase maturation genes) after nitrogen depletion. In silico analyzes showed that these ORFs in N. punctiforme harbor the same conserved regions as their homologues in Nostoc PCC 7120 and that they, like their homologues in Nostoc PCC 7120, can be transcribed together with the hyp-genes forming a larger extended hyp-operon. DNA binding studies showed interactions of the transcriptional regulators CalA and CalB to the promoter regions of the extended hyp-operon in N. punctiforme and Nostoc PCC 7120. Conclusions The five ORFs upstream of the hyp-genes in several filamentous N2-fixing cyanobacteria have an identical genomic localization, in between the genes encoding the uptake hydrogenase and the maturation protein genes. In N. punctiforme and Nostoc PCC 7120 they are transcribed as one operon and may form transcripts together with the hyp-genes. The expression pattern of the five ORFs within the extended hyp-operon in both Nostoc punctiforme and Nostoc PCC 7120 is similar to

Political Repression in U.S. History

NARCIS (Netherlands)

van Minnen, C.A.

2009-01-01

The authors of the essays in this book amass considerable historical evidence illustrating various forms of political repression and its relationship with democracy in the United States, from the late-eighteenth century to the present. They discuss efforts, made mostly but not only by government

Extremadura: Behind the material traces of Franco’s repression

OpenAIRE

Muñoz Encinar, Laura; Chaves Palacios, Julián

2014-01-01

After the failed coup d’état of July 17th, 1936 and after the start of the Spanish Civil War that followed it, rebels carried out a repressive strategy based on the execution of thousands of people as a key tool of social control. The socialization of fear and terror through humiliation, killing and disappearance would become the main strategy employed throughout the war and the post-war period. In this context, perpetrators would exercise repressive practices on victims and their bodies. As ...

The Efficiency of Repressive Anti-Corruption Measures in Conditions of High-Level Corruption

OpenAIRE

Abramov Fedir V.

2017-01-01

The article is aimed at determining the efficiency of repressive anti-corruption measures in conditions of high-level corruption. It is shown that the formal rules regulating the use of repressive methods of countering corruption are characterized by a significant level of the target inefficiency of formal rules. Resulting from ignorance as to the causes of both occurence and spread of corruption – the inefficiency of the current formal rules – repressive anti-corruption measures are fundamen...

The Efficiency of Repressive Anti-Corruption Measures in Conditions of High-Level Corruption

Directory of Open Access Journals (Sweden)

Abramov Fedir V.

2017-12-01

Full Text Available The article is aimed at determining the efficiency of repressive anti-corruption measures in conditions of high-level corruption. It is shown that the formal rules regulating the use of repressive methods of countering corruption are characterized by a significant level of the target inefficiency of formal rules. Resulting from ignorance as to the causes of both occurence and spread of corruption – the inefficiency of the current formal rules – repressive anti-corruption measures are fundamentally incapable of achieving a significant reduction in the level of corruptness. It has been proved that, in addition to significant target inefficiency, repressive anti-corruption methods can potentially lead to increased levels of corruption because of abusing by supervisory officials of their official duties and the spread of internal corruption within anti-corruption structures. The potential threats from the uncontrolled anti-corruption structures towards other controlling organizations were considered. It is shown that in conditions of high-level corruption repressive anti-corruption measures can lead to expansion of imitation of anti-corruption activity.

Suppression and repression: A theoretical discussion illustrated by a movie

Directory of Open Access Journals (Sweden)

Maria Lucia de Souza Campos Paiva

2012-02-01

Full Text Available The first translations of Freud's work into Portuguese have presented problems because they were not translated from the German language. More than a hundred years after the beginning of Psychoanalysis, there are still many discussions on Freud's metapsychology and a considerable difficulty in obtaining a consensus on the translation of some concepts. This paper refers back to Freud's concepts of primal repression, repression and suppression. In order to discuss such concepts, we have made use of a film, co-produced by Germans and Argentineans, which is named "The Song in me" (Das Lied in mir, released to the public in 2011 and directed by Florian Micoud Cossen. Through this motion picture, the following of Freud's concepts are analyzed, and the differentiation between them is discussed: suppression and repression, as well as the importance of their precise translation.

Genome analysis of the freshwater planktonic Vulcanococcus limneticus sp. nov. reveals horizontal transfer of nitrogenase operon and alternative pathways of nitrogen utilization.

Science.gov (United States)

Di Cesare, Andrea; Cabello-Yeves, Pedro J; Chrismas, Nathan A M; Sánchez-Baracaldo, Patricia; Salcher, Michaela M; Callieri, Cristiana

2018-04-16

Many cyanobacteria are capable of fixing atmospheric nitrogen, playing a crucial role in biogeochemical cycling. Little is known about freshwater unicellular cyanobacteria Synechococcus spp. at the genomic level, despite being recognised of considerable ecological importance in aquatic ecosystems. So far, it has not been shown whether these unicellular picocyanobacteria have the potential for nitrogen fixation. Here, we present the draft-genome of the new pink-pigmented Synechococcus-like strain Vulcanococcus limneticus. sp. nov., isolated from the volcanic Lake Albano (Central Italy). The novel species Vulcanococcus limneticus sp. nov. falls inside the sub-cluster 5.2, close to the estuarine/marine strains in a maximum-likelihood phylogenetic tree generated with 259 marker genes with representatives from marine, brackish, euryhaline and freshwater habitats. V.limneticus sp. nov. possesses a complete nitrogenase and nif operon. In an experimental setup under nitrogen limiting and non-limiting conditions, growth was observed in both cases. However, the nitrogenase genes (nifHDK) were not transcribed, i.e., V.limneticus sp. nov. did not fix nitrogen, but instead degraded the phycobilisomes to produce sufficient amounts of ammonia. Moreover, the strain encoded many other pathways to incorporate ammonia, nitrate and sulphate, which are energetically less expensive for the cell than fixing nitrogen. The association of the nif operon to a genomic island, the relatively high amount of mobile genetic elements (52 transposases) and the lower observed GC content of V.limneticus sp. nov. nif operon (60.54%) compared to the average of the strain (68.35%) support the theory that this planktonic strain may have obtained, at some point of its evolution, the nif operon by horizontal gene transfer (HGT) from a filamentous or heterocystous cyanobacterium. In this study, we describe the novel species Vulcanococcus limneticus sp. nov., which possesses a complete nif operon for

Cancer, acute stress disorder, and repressive coping

DEFF Research Database (Denmark)

Pedersen, Anette Fischer; Zachariae, Robert

2010-01-01

The purpose of this study was to investigate the association between repressive coping style and Acute Stress Disorder (ASD) in a sample of cancer patients. A total of 112 cancer patients recently diagnosed with cancer participated in the study. ASD was assessed by the Stanford Acute Stress...... Reaction Questionnaire, and repressive coping was assessed by a combination of scores from the Marlowe-Crowne Social Desirability Scale, and the Bendig version of the Taylor Manifest Anxiety Scale. Significantly fewer patients classified as "repressors" were diagnosed with ASD compared to patients...... classified as "non-repressors". However, further investigations revealed that the lower incidence of ASD in repressors apparently was caused by a low score on anxiety and not by an interaction effect between anxiety and defensiveness. Future studies have to investigate whether different psychological...

Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

Directory of Open Access Journals (Sweden)

Astha Agarwal

2013-01-01

Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

The conserved nhaAR operon is drastically divergent between B2 and non-B2 Escherichia coli and is involved in extra-intestinal virulence.

Science.gov (United States)

Lescat, Mathilde; Reibel, Florence; Pintard, Coralie; Dion, Sara; Glodt, Jérémy; Gateau, Cecile; Launay, Adrien; Ledda, Alice; Cruveiller, Stephane; Cruvellier, Stephane; Tourret, Jérôme; Tenaillon, Olivier

2014-01-01

The Escherichia coli species is divided in phylogenetic groups that differ in their virulence and commensal distribution. Strains belonging to the B2 group are involved in extra-intestinal pathologies but also appear to be more prevalent as commensals among human occidental populations. To investigate the genetic specificities of B2 sub-group, we used 128 sequenced genomes and identified genes of the core genome that showed marked difference between B2 and non-B2 genomes. We focused on the gene and its surrounding region with the strongest divergence between B2 and non-B2, the antiporter gene nhaA. This gene is part of the nhaAR operon, which is in the core genome but flanked by mobile regions, and is involved in growth at high pH and high sodium concentrations. Consistently, we found that a panel of non-B2 strains grew faster than B2 at high pH and high sodium concentrations. However, we could not identify differences in expression of the nhaAR operon using fluorescence reporter plasmids. Furthermore, the operon deletion had no differential impact between B2 and non-B2 strains, and did not result in a fitness modification in a murine model of gut colonization. Nevertheless, sequence analysis and experiments in a murine model of septicemia revealed that recombination in nhaA among B2 strains was observed in strains with low virulence. Finally, nhaA and nhaAR operon deletions drastically decreased virulence in one B2 strain. This effect of nhaAR deletion appeared to be stronger than deletion of all pathogenicity islands. Thus, a population genetic approach allowed us to identify an operon in the core genome without strong effect in commensalism but with an important role in extra-intestinal virulence, a landmark of the B2 strains.

The antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 prevents premature expression of the flv4-2 operon upon shift in inorganic carbon supply.

Science.gov (United States)

Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R; Aro, Eva-Mari

2012-09-28

The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (C(i)), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the Q(B) site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by C(i) limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in C(i) conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon.

The Antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 Prevents Premature Expression of the flv4-2 Operon upon Shift in Inorganic Carbon Supply*

Science.gov (United States)

Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari

2012-01-01

The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963

Role of sugar uptake and metabolic intermediates on catabolite repression in Bacillus subtilis.

Science.gov (United States)

Lopez, J M; Thoms, B

1977-01-01

Many phosphorylated intermediates exert catabolite repression on the enzyme acetoin dehydrogenase in Bacillus subtilis. This was shown with strains that are blocked at different positions in central metabolism when they receive sugars that cannot be metabolized past enzymatic block(s). In the case of sorbitol, transport events were not involved in catabolite repression, for this sugar cannot repress acetoin dehydrogenase in a strain lacking sorbitol dehydrogenase but otherwise able to take up sorbitol. The presence of glucose did not markedly influence the uptake of acetoin. PMID:401492

The transcription factor DREAM represses A20 and mediates inflammation

OpenAIRE

Tiruppathi, Chinnaswamy; Soni, Dheeraj; Wang, Dong-Mei; Xue, Jiaping; Singh, Vandana; Thippegowda, Prabhakar B.; Cheppudira, Bopaiah P.; Mishra, Rakesh K.; DebRoy, Auditi; Qian, Zhijian; Bachmaier, Kurt; Zhao, Youyang; Christman, John W.; Vogel, Stephen M.; Ma, Averil

2014-01-01

Here we show that the transcription-repressor DREAM binds to the A20 promoter to repress the expression of A20, the deubiquitinase suppressing inflammatory NF-κB signaling. DREAM-deficient (Dream−/− ) mice displayed persistent and unchecked A20 expression in response to endotoxin. DREAM functioned by transcriptionally repressing A20 through binding to downstream regulatory elements (DREs). In contrast, USF1 binding to the DRE-associated E-box domain activated A20 expression in response to inf...

Molecular mechanism underlying juvenile hormone-mediated repression of precocious larval-adult metamorphosis.

Science.gov (United States)

Kayukawa, Takumi; Jouraku, Akiya; Ito, Yuka; Shinoda, Tetsuro

2017-01-31

Juvenile hormone (JH) represses precocious metamorphosis of larval to pupal and adult transitions in holometabolous insects. The early JH-inducible gene Krüppel homolog 1 (Kr-h1) plays a key role in the repression of metamorphosis as a mediator of JH action. Previous studies demonstrated that Kr-h1 inhibits precocious larval-pupal transition in immature larva via direct transcriptional repression of the pupal specifier Broad-Complex (BR-C). JH was recently reported to repress the adult specifier gene Ecdysone-induced protein 93F (E93); however, its mechanism of action remains unclear. Here, we found that JH suppressed ecdysone-inducible E93 expression in the epidermis of the silkworm Bombyx mori and in a B. mori cell line. Reporter assays in the cell line revealed that the JH-dependent suppression was mediated by Kr-h1. Genome-wide ChIP-seq analysis identified a consensus Kr-h1 binding site (KBS, 14 bp) located in the E93 promoter region, and EMSA confirmed that Kr-h1 directly binds to the KBS. Moreover, we identified a C-terminal conserved domain in Kr-h1 essential for the transcriptional repression of E93 Based on these results, we propose a mechanism in which JH-inducible Kr-h1 directly binds to the KBS site upstream of the E93 locus to repress its transcription in a cell-autonomous manner, thereby preventing larva from bypassing the pupal stage and progressing to precocious adult development. These findings help to elucidate the molecular mechanisms regulating the metamorphic genetic network, including the functional significance of Kr-h1, BR-C, and E93 in holometabolous insect metamorphosis.

Investigating Behavioral and Psychophysiological Reactions to Conflict-Related and Individualized Stimuli as Potential Correlates of Repression

Directory of Open Access Journals (Sweden)

Henrik Kessler

2017-09-01

Full Text Available Background: Repression is considered as a central defense mechanism in psychodynamic theory. It refers to the process by which “unbearable” mental contents (e.g., those related to internal conflicts are kept out of consciousness. The process of repression is probably closely related to concepts of emotion regulation derived from a different theoretical background. This relationship is particularly relevant because it relates repression to current research in the affective neurosciences as well as to experimental studies on emotion regulation. Due to its complex and highly individual nature, repression has been notoriously difficult to investigate. We investigated repression with an individualized experiment in healthy subjects in order to establish methods to study repression in clinical populations. To this end we operationalized repression using individualized experimental conditions, and then studied potential behavioral [memory and reaction time (RT] and psychophysiological correlates [skin conductance response (SCR].Method: Twenty-nine healthy female subjects were asked to freely associate to individualized cue sentences. Sentences were generated from individual psychodynamic interviews based on operationlized psychodynamic diagnosis (OPD, and were comprised of three different types: positive, negative non-conflictual, and negative conflict-related sentences. Subjects were asked to name the first three associations coming into their mind. Afterward, the remaining time was used for free association. SCR during each association trial and RT of the first given association were recorded. The memory for the first three associations was subsequently tested in an unexpected recall.Results: Associations to conflict-related cue sentences were associated with longer RTs and increased SCRs. Moreover, the unexpected recall task showed memory for these associations to be reduced.Conclusion: We interpret these findings as possible correlates of

Investigating Behavioral and Psychophysiological Reactions to Conflict-Related and Individualized Stimuli as Potential Correlates of Repression.

Science.gov (United States)

Kessler, Henrik; Schmidt, Anna Christine; Hildenbrand, Oliver; Scharf, Daniela; Kehyayan, Aram; Axmacher, Nikolai

2017-01-01

Background: Repression is considered as a central defense mechanism in psychodynamic theory. It refers to the process by which "unbearable" mental contents (e.g., those related to internal conflicts) are kept out of consciousness. The process of repression is probably closely related to concepts of emotion regulation derived from a different theoretical background. This relationship is particularly relevant because it relates repression to current research in the affective neurosciences as well as to experimental studies on emotion regulation. Due to its complex and highly individual nature, repression has been notoriously difficult to investigate. We investigated repression with an individualized experiment in healthy subjects in order to establish methods to study repression in clinical populations. To this end we operationalized repression using individualized experimental conditions, and then studied potential behavioral [memory and reaction time (RT)] and psychophysiological correlates [skin conductance response (SCR)]. Method: Twenty-nine healthy female subjects were asked to freely associate to individualized cue sentences. Sentences were generated from individual psychodynamic interviews based on operationlized psychodynamic diagnosis (OPD), and were comprised of three different types: positive, negative non-conflictual, and negative conflict-related sentences. Subjects were asked to name the first three associations coming into their mind. Afterward, the remaining time was used for free association. SCR during each association trial and RT of the first given association were recorded. The memory for the first three associations was subsequently tested in an unexpected recall. Results: Associations to conflict-related cue sentences were associated with longer RTs and increased SCRs. Moreover, the unexpected recall task showed memory for these associations to be reduced. Conclusion: We interpret these findings as possible correlates of repression, in line

Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

Science.gov (United States)

Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

2012-05-01

The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

Repressive effects of resveratrol on androgen receptor transcriptional activity.

Directory of Open Access Journals (Sweden)

Wen-feng Shi

2009-10-01

Full Text Available The chemopreventive effects of resveratrol (RSV on prostate cancer have been well established; the androgen receptor (AR plays pivotal roles in prostatic tumorigenesis. However, the exact underlying molecular mechanisms about the effects of RSV on AR have not been fully elucidated. A model system is needed to determine whether and how RSV represses AR transcriptional activity.The AR cDNA was first cloned into the retroviral vector pOZ-N and then integrated into the genome of AR-negative HeLa cells to generate the AR(+ cells. The constitutively expressed AR was characterized by monitoring hormone-stimulated nuclear translocation, DNA binding, and transcriptional activation, with the AR(- cells serving as controls. AR(+ cells were treated with RSV, and both AR protein levels and AR transcriptional activity were measured simultaneously. Chromatin immunoprecipitation (ChIP assays were used to detect the effects of RSV on the recruitment of AR to its cognate element (ARE.AR in the AR (+ stable cell line functions in a manner similar to that of endogenously expressed AR. Using this model system we clearly demonstrated that RSV represses AR transcriptional activity independently of any effects on AR protein levels. However, neither the hormone-mediated nucleus translocation nor the AR/ARE interaction was affected by RSV treatment.We demonstrated unambiguously that RSV regulates AR target gene expression, at least in part, by repressing AR transcriptional activity. Repressive effects of RSV on AR activity result from mechanisms other than the affects of AR nuclear translocation or DNA binding.

Transcription and replication result in distinct epigenetic marks following repression of early gene expression

OpenAIRE

Kallestad, Les; Woods, Emily; Christensen, Kendra; Gefroh, Amanda; Balakrishnan, Lata; Milavetz, Barry

2013-01-01

Simian Virus 40 (SV40) early transcription is repressed when the product of early transcription, T-antigen, binds to its cognate regulatory sequence, Site I, in the promoter of the SV40 minichromosome. Because SV40 minichromosomes undergo replication and transcription potentially repression could occur during active transcription or during DNA replication. Since repression is frequently epigenetically marked by the introduction of specific forms of methylated histone H3, we characterized th...

Daptomycin Tolerance in the Staphylococcus aureus pitA6 Mutant Is Due to Upregulation of the dlt Operon.

Science.gov (United States)

Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich

2016-05-01

Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Nitrogen Catabolite Repression in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Hofman-Bang, H Jacob Peider

1999-01-01

In Saccharomyces cerevisiae the expression of all known nitrogen catabolite pathways are regulated by four regulators known as Gln3, Gat1, Da180, and Deh1. This is known as nitrogen catabolite repression (NCR). They bind to motifs in the promoter region to the consensus sequence S' GATAA 3'. Gln3...

rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

NARCIS (Netherlands)

Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.

2016-01-01

The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted

Cloning, purification, crystallization and preliminary crystallographic analysis of LsrR from Escherichia coli

International Nuclear Information System (INIS)

Liu, Xiaotian; Wu, Minhao; Sun, Demeng; Zang, Jianye

2010-01-01

The E. coli transcription repressor LsrR has been overexpressed, purified and crystallized. Diffraction data were collected to about 3 Å resolution. In Escherichia coli, the lsr operon is composed of six genes lsrACDBFG which regulate uptake and modification of the signalling molecule AI-2. LsrR is a repressor of the lsr operon and itself, which can bind phospho-AI-2 and be released from the promoter region of the operon and thus activate gene expression. LsrR fused with an HHHHHH sequence at the C-terminus was expressed, purified and crystallized in order to determine its structure and elucidate the molecular mechanism of repression. The crystal belonged to space group I222, with unit-cell parameters a = 79.84, b = 116.65, c = 186.04 Å, and was estimated to contain two protein molecules per asymmetric unit

A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

NARCIS (Netherlands)

Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.

2004-01-01

Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

The TorR High-Affinity Binding Site Plays a Key Role in Both torR Autoregulation and torCAD Operon Expression in Escherichia coli

OpenAIRE

Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent

2000-01-01

In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...

Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade

Czech Academy of Sciences Publication Activity Database

Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav

2015-01-01

Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015

Purification and crystallization of Phd, the antitoxin of the phd/doc operon

International Nuclear Information System (INIS)

Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy

2010-01-01

The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein

fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

Science.gov (United States)

Khun, H H; Deved, V; Wong, H; Lee, B C

2000-12-01

The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA

DEFF Research Database (Denmark)

Poulsen, Peter; Jensen, Kaj Frank

1992-01-01

We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...

Drosophila DNA-Binding Proteins in Polycomb Repression

Directory of Open Access Journals (Sweden)

Maksim Erokhin

2018-01-01

Full Text Available The formation of individual gene expression patterns in different cell types is required during differentiation and development of multicellular organisms. Polycomb group (PcG proteins are key epigenetic regulators responsible for gene repression, and dysregulation of their activities leads to developmental abnormalities and diseases. PcG proteins were first identified in Drosophila, which still remains the most convenient system for studying PcG-dependent repression. In the Drosophila genome, these proteins bind to DNA regions called Polycomb response elements (PREs. A major role in the recruitment of PcG proteins to PREs is played by DNA-binding factors, several of which have been characterized in detail. However, current knowledge is insufficient for comprehensively describing the mechanism of this process. In this review, we summarize and discuss the available data on the role of DNA-binding proteins in PcG recruitment to chromatin.

miR-200b mediates post-transcriptional repression of ZFHX1B

DEFF Research Database (Denmark)

Christoffersen, Nanna Rønbjerg; Silahtaroglu, Asli; Ørom, Ulf Lupo Andersson

2007-01-01

of E-cadherin. We show that Zfhx1b and miR-200b are regionally coexpressed in the adult mouse brain and that miR-200b represses the expression of Zfhx1b via multiple sequence elements present in the 3'-untranslated region. Overexpression of miR-200b leads to repression of endogenous ZFHX1B...

Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

Directory of Open Access Journals (Sweden)

Mariana Noelia Viale

2014-01-01

Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.

Science.gov (United States)

Marincola, Gabriella; Wolz, Christiane

2017-06-02

In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Revisiting the Master-Signifier, or, Mandela and Repression.

Science.gov (United States)

Hook, Derek; Vanheule, Stijn

2015-01-01

The concept of the master-signifier has been subject to a variety of applications in Lacanian forms of political discourse theory and ideology critique. While there is much to be commended in literature of this sort, it often neglects salient issues pertaining to the role of master signifiers in the clinical domain of (individual) psychical economy. The popularity of the concept of the master (or "empty") signifier in political discourse analysis has thus proved a double-edged sword. On the one hand it demonstrates how crucial psychical processes are performed via the operations of the signifier, extending thus the Lacanian thesis that identification is the outcome of linguistic and symbolic as opposed to merely psychological processes. On the other, the use of the master signifier concept within the political realm to track discursive formations tends to distance the term from the dynamics of the unconscious and operation of repression. Accordingly, this paper revisits the master signifier concept, and does so within the socio-political domain, yet while paying particular attention to the functioning of unconscious processes of fantasy and repression. More specifically, it investigates how Nelson Mandela operates as a master signifier in contemporary South Africa, as a vital means of knitting together diverse elements of post-apartheid society, enabling the fantasy of the post-apartheid nation, and holding at bay a whole series of repressed and negated undercurrents.

Repression/depression of conjugative plasmids and their influence on the mutation-selection balance in static environments.

Directory of Open Access Journals (Sweden)

Yoav Atsmon-Raz

Full Text Available We study the effect that conjugation-mediated Horizontal Gene Transfer (HGT has on the mutation-selection balance of a population in a static environment. We consider a model whereby a population of unicellular organisms, capable of conjugation, comes to mutation-selection balance in the presence of an antibiotic, which induces a first-order death rate constant [Formula: see text] for genomes that are not resistant. We explicitly take into consideration the repression/de-repression dynamics of the conjugative plasmid, and assume that a de-repressed plasmid remains temporarily de-repressed after copying itself into another cell. We assume that both repression and de-repression are characterized by first-order rate constants [Formula: see text]and [Formula: see text], respectively. We find that conjugation has a deleterious effect on the mean fitness of the population, suggesting that HGT does not provide a selective advantage in a static environment, but is rather only useful for adapting to new environments. This effect can be ameliorated by repression, suggesting that while HGT is not necessarily advantageous for a population in a static environment, its deleterious effect on the mean fitness can be negated via repression. Therefore, it is likely that HGT is much more advantageous in a dynamic landscape. Furthermore, in the limiting case of a vanishing spontaneous de-repression rate constant, we find that the fraction of conjugators in the population undergoes a phase transition as a function of population density. Below a critical population density, the fraction of conjugators is zero, while above this critical population density the fraction of conjugators rises continuously to one. Our model for conjugation-mediated HGT is related to models of infectious disease dynamics, where the conjugators play the role of the infected (I class, and the non-conjugators play the role of the susceptible (S class.

The Bacillus subtilis GntR family repressor YtrA responds to cell wall antibiotics.

Science.gov (United States)

Salzberg, Letal I; Luo, Yun; Hachmann, Anna-Barbara; Mascher, Thorsten; Helmann, John D

2011-10-01

The transglycosylation step of cell wall synthesis is a prime antibiotic target because it is essential and specific to bacteria. Two antibiotics, ramoplanin and moenomycin, target this step by binding to the substrate lipid II and the transglycosylase enzyme, respectively. Here, we compare the ramoplanin and moenomycin stimulons in the Gram-positive model organism Bacillus subtilis. Ramoplanin strongly induces the LiaRS two-component regulatory system, while moenomycin almost exclusively induces genes that are part of the regulon of the extracytoplasmic function (ECF) σ factor σ(M). Ramoplanin additionally induces the ytrABCDEF and ywoBCD operons, which are not part of a previously characterized antibiotic-responsive regulon. Cluster analysis reveals that these two operons are selectively induced by a subset of cell wall antibiotics that inhibit lipid II function or recycling. Repression of both operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front of ywoB. These results suggest that YtrA is an additional regulator of cell envelope stress responses.

The Bacillus subtilis GntR Family Repressor YtrA Responds to Cell Wall Antibiotics▿§

Science.gov (United States)

Salzberg, Letal I.; Luo, Yun; Hachmann, Anna-Barbara; Mascher, Thorsten; Helmann, John D.

2011-01-01

The transglycosylation step of cell wall synthesis is a prime antibiotic target because it is essential and specific to bacteria. Two antibiotics, ramoplanin and moenomycin, target this step by binding to the substrate lipid II and the transglycosylase enzyme, respectively. Here, we compare the ramoplanin and moenomycin stimulons in the Gram-positive model organism Bacillus subtilis. Ramoplanin strongly induces the LiaRS two-component regulatory system, while moenomycin almost exclusively induces genes that are part of the regulon of the extracytoplasmic function (ECF) σ factor σM. Ramoplanin additionally induces the ytrABCDEF and ywoBCD operons, which are not part of a previously characterized antibiotic-responsive regulon. Cluster analysis reveals that these two operons are selectively induced by a subset of cell wall antibiotics that inhibit lipid II function or recycling. Repression of both operons requires YtrA, which recognizes an inverted repeat in front of its own operon and in front of ywoB. These results suggest that YtrA is an additional regulator of cell envelope stress responses. PMID:21856850

Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG

Directory of Open Access Journals (Sweden)

Orlando Díaz-Hernández

2010-07-01

Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.

Science.gov (United States)

Díaz-Hernández, Orlando; Santillán, Moisés

2010-01-01

In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

Polycomb complexes act redundantly to repress genomic repeats and genes

DEFF Research Database (Denmark)

Leeb, Martin; Pasini, Diego; Novatchkova, Maria

2010-01-01

Polycomb complexes establish chromatin modifications for maintaining gene repression and are essential for embryonic development in mice. Here we use pluripotent embryonic stem (ES) cells to demonstrate an unexpected redundancy between Polycomb-repressive complex 1 (PRC1) and PRC2 during...... the formation of differentiated cells. ES cells lacking the function of either PRC1 or PRC2 can differentiate into cells of the three germ layers, whereas simultaneous loss of PRC1 and PRC2 abrogates differentiation. On the molecular level, the differentiation defect is caused by the derepression of a set...

Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

OpenAIRE

Burbank, Lindsey P.; Van Horn, Christopher R.

2017-01-01

The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

Induction and catabolite repression of α-glucosidase synthesis in protoplasts of Saccharomyces carlsbergensis

NARCIS (Netherlands)

Wijk, R. van; Ouwehand, J.; Bos, T. van den; Koningsberger, V.V.

1969-01-01

1. 1. Kinetic data on the repression, the derepression and the induction of α-glucosidase synthesis in protoplasts of Saccharomyces carlsbergensis suggested that some site other than the stereospecific site for the induction by maltose was involved in the repression by glucose. 2. 2. A study of the

Legionella dumoffii Tex-KL Mutated in an Operon Homologous to traC-traD is Defective in Epithelial Cell Invasion.

Science.gov (United States)

Qin, Tian; Ken-Ichiro, Iida; Ren, Hong Yu; Zhou, Hai Jian; Yoshida, Shin-Ichi

2016-06-01

To understand the mechanism of invasion by Legionella dumoffii. The L. dumoffii strain Tex-KL was mutated using the Tn903 derivative, Tn903dIIlacZ. After screening 799 transposon insertion mutants, we isolated one defective mutant. We then constructed the gene-disrupted mutant, KL16, and studied its invasion of and intracellular growth in HeLa and A549 cells, and in A/J mice survival experiments. The structure of traC-traD operon was analyzed by RT-PCR. The transposon insertion was in a gene homologous to Salmonella typhi traC, which is required for the assembly of F pilin into the mature F pilus structure and for conjugal DNA transmission. Results from RT-PCR suggested that the traC-traD region formed an operon. We found that when the traC gene was disrupted, invasion and intracellular growth of L. dumoffii Tex-KL were impaired in human epithelial cells. When mice were infected by intranasal inoculation with a traC deficient mutant, their survival significantly increased when compared to mice infected with the wild-type strain.. Our results indicated that the traC-traD operon is required for the invasion and intracellular growth abilities of L. dumoffii Tex-KL in epithelial cells. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

RNAi and heterochromatin repress centromeric meiotic recombination

DEFF Research Database (Denmark)

Ellermeier, Chad; Higuchi, Emily C; Phadnis, Naina

2010-01-01

During meiosis, the formation of viable haploid gametes from diploid precursors requires that each homologous chromosome pair be properly segregated to produce an exact haploid set of chromosomes. Genetic recombination, which provides a physical connection between homologous chromosomes, is essen......During meiosis, the formation of viable haploid gametes from diploid precursors requires that each homologous chromosome pair be properly segregated to produce an exact haploid set of chromosomes. Genetic recombination, which provides a physical connection between homologous chromosomes....... Surprisingly, one mutant derepressed for recombination in the heterochromatic mating-type region during meiosis and several mutants derepressed for centromeric gene expression during mitotic growth are not derepressed for centromeric recombination during meiosis. These results reveal a complex relation between...... types of repression by heterochromatin. Our results also reveal a previously undemonstrated role for RNAi and heterochromatin in the repression of meiotic centromeric recombination and, potentially, in the prevention of birth defects by maintenance of proper chromosome segregation during meiosis....

Natural memory beyond the storage model: Repression, trauma, and the construction of a personal past

Directory of Open Access Journals (Sweden)

Nikolai Axmacher

2010-11-01

Full Text Available Naturally occurring memory processes show features which are difficult to investigate by conventional cognitive neuroscience paradigms. Distortions of memory for problematic contents are described both by psychoanalysis (internal conflicts and research on post-traumatic stress disorder (external traumata. Typically, declarative memory for these contents is impaired – possibly due to repression in the case of internal conflicts or due to dissociation in the case of external traumata – but they continue to exert an unconscious pathological influence: neurotic symptoms or psychosomatic disorders after repression or flashbacks and intrusions in post-traumatic stress disorder after dissociation. Several experimental paradigms aim at investigating repression in healthy control subjects. We argue that these paradigms do not adequately operationalize the clinical process of repression, because they rely on an intentional inhibition of random stimuli (suppression. Furthermore, these paradigms ignore that memory distortions due to repression or dissociation are most accurately characterized by a lack of self-referential processing, resulting in an impaired integration of these contents into the self. This aspect of repression and dissociation cannot be captured by the concept of memory as a storage device which is usually employed in the cognitive neurosciences. It can only be assessed within the framework of a constructivist memory concept, according to which successful memory involves a reconstruction of experiences such that they fit into a representation of the self. We suggest several experimental paradigms that allow for the investigation of the neural correlates of repressed memories and trauma-induced memory distortions based on a constructivist memory concept.

Global transcription regulation of RK2 plasmids: a case study in the combined use of dynamical mathematical models and statistical inference for integration of experimental data and hypothesis exploration

Directory of Open Access Journals (Sweden)

Thomas Christopher M

2011-07-01

Full Text Available Abstract Background IncP-1 plasmids are broad host range plasmids that have been found in clinical and environmental bacteria. They often carry genes for antibiotic resistance or catabolic pathways. The archetypal IncP-1 plasmid RK2 is a well-characterized biological system, with a fully sequenced and annotated genome and wide range of experimental measurements. Its central control operon, encoding two global regulators KorA and KorB, is a natural example of a negatively self-regulated operon. To increase our understanding of the regulation of this operon, we have constructed a dynamical mathematical model using Ordinary Differential Equations, and employed a Bayesian inference scheme, Markov Chain Monte Carlo (MCMC using the Metropolis-Hastings algorithm, as a way of integrating experimental measurements and a priori knowledge. We also compared MCMC and Metabolic Control Analysis (MCA as approaches for determining the sensitivity of model parameters. Results We identified two distinct sets of parameter values, with different biological interpretations, that fit and explain the experimental data. This allowed us to highlight the proportion of repressor protein as dimers as a key experimental measurement defining the dynamics of the system. Analysis of joint posterior distributions led to the identification of correlations between parameters for protein synthesis and partial repression by KorA or KorB dimers, indicating the necessary use of joint posteriors for correct parameter estimation. Using MCA, we demonstrated that the system is highly sensitive to the growth rate but insensitive to repressor monomerization rates in their selected value regions; the latter outcome was also confirmed by MCMC. Finally, by examining a series of different model refinements for partial repression by KorA or KorB dimers alone, we showed that a model including partial repression by KorA and KorB was most compatible with existing experimental data. Conclusions We

Targeted repression of AXIN2 and MYC gene expression using designer TALEs

International Nuclear Information System (INIS)

Rennoll, Sherri A.; Scott, Samantha A.; Yochum, Gregory S.

2014-01-01

Highlights: • We designed TALE–SID fusion proteins to target AXIN2 and MYC. • TALE–SIDs bound the chromosomal AXIN2 and MYC genes and repressed their expression. • TALE–SIDs repress β-catenin S45F -dependent AXIN2 and MYC transcription. - Abstract: Designer TALEs (dTALEs) are chimeric transcription factors that can be engineered to regulate gene expression in mammalian cells. Whether dTALEs can block gene transcription downstream of signal transduction cascades, however, has yet to be fully explored. Here we tested whether dTALEs can be used to target genes whose expression is controlled by Wnt/β-catenin signaling. TALE DNA binding domains were engineered to recognize sequences adjacent to Wnt responsive enhancer elements (WREs) that control expression of axis inhibition protein 2 (AXIN2) and c-MYC (MYC). These custom DNA binding domains were linked to the mSin3A interaction domain (SID) to generate TALE–SID chimeric repressors. The TALE–SIDs repressed luciferase reporter activity, bound their genomic target sites, and repressed AXIN2 and MYC expression in HEK293 cells. We generated a novel HEK293 cell line to determine whether the TALE–SIDs could function downstream of oncogenic Wnt/β-catenin signaling. Treating these cells with doxycycline and tamoxifen stimulates nuclear accumulation of a stabilized form of β-catenin found in a subset of colorectal cancers. The TALE–SIDs repressed AXIN2 and MYC expression in these cells, which suggests that dTALEs could offer an effective therapeutic strategy for the treatment of colorectal cancer

Targeted repression of AXIN2 and MYC gene expression using designer TALEs

Energy Technology Data Exchange (ETDEWEB)

Rennoll, Sherri A.; Scott, Samantha A.; Yochum, Gregory S., E-mail: gsy3@psu.edu

2014-04-18

Highlights: • We designed TALE–SID fusion proteins to target AXIN2 and MYC. • TALE–SIDs bound the chromosomal AXIN2 and MYC genes and repressed their expression. • TALE–SIDs repress β-catenin{sup S45F}-dependent AXIN2 and MYC transcription. - Abstract: Designer TALEs (dTALEs) are chimeric transcription factors that can be engineered to regulate gene expression in mammalian cells. Whether dTALEs can block gene transcription downstream of signal transduction cascades, however, has yet to be fully explored. Here we tested whether dTALEs can be used to target genes whose expression is controlled by Wnt/β-catenin signaling. TALE DNA binding domains were engineered to recognize sequences adjacent to Wnt responsive enhancer elements (WREs) that control expression of axis inhibition protein 2 (AXIN2) and c-MYC (MYC). These custom DNA binding domains were linked to the mSin3A interaction domain (SID) to generate TALE–SID chimeric repressors. The TALE–SIDs repressed luciferase reporter activity, bound their genomic target sites, and repressed AXIN2 and MYC expression in HEK293 cells. We generated a novel HEK293 cell line to determine whether the TALE–SIDs could function downstream of oncogenic Wnt/β-catenin signaling. Treating these cells with doxycycline and tamoxifen stimulates nuclear accumulation of a stabilized form of β-catenin found in a subset of colorectal cancers. The TALE–SIDs repressed AXIN2 and MYC expression in these cells, which suggests that dTALEs could offer an effective therapeutic strategy for the treatment of colorectal cancer.

1H, 13C and 15N backbone resonance assignment of the arsenate reductase from Staphylococcus aureus in its reduced state

NARCIS (Netherlands)

Jacobs, D.M.; Messens, J.; Wechselberger, R.W.|info:eu-repo/dai/nl/304829005; Brosens, E.; Willem, R.; Wyns, L.; Martins, J.C.

2001-01-01

In S. aureus, resistance to the metal(III)oxyanions arsenite As(III)O− 2 and antimonite Sb(III)O− 2 is mediated by two proteins, ArsB and ArsR, encoded in the ars operon of plasmid pI258 (Silver, 1999). ArsR acts as the transcription repressor, which is de-repressed in the presence of intracellular

The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

Science.gov (United States)

Rajagopalan, Ramya; Kroos, Lee

2017-05-15

Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

Revisiting the master-signifier, or, Mandela and repression

Directory of Open Access Journals (Sweden)

Derek eHook

2016-01-01

Full Text Available The concept of the master-signifier has been subject to a variety of applications in Lacanian forms of political discourse theory and ideology critique. While there is much to be commended in literature of this sort, it often neglects salient issues pertaining to the role of master signifiers in the clinical domain of (individual psychical economy. The popularity of the concept of the master (or ‘empty’ signifier in political discourse analysis has thus proved a double-edged sword. On the one hand it demonstrates how crucial psychical processes are performed via the operations of the signifier, extending thus the Lacanian thesis that identification is as much the outcome of linguistic and symbolic as opposed to merely psychological processes. On the other, the use of the master signifier concept within the political realm to track discursive formations tends to distance the term from the dynamics of the unconscious and operation of repression. Accordingly, this paper revisits the master signifier concept, and does so within the socio-political domain, yet while paying particular attention to the functioning of unconscious processes of fantasy and repression. More specifically, it investigates how Nelson Mandela operates as a master signifier in contemporary South Africa, as a vital means of knitting together diverse elements of post-apartheid society, enabling the fantasy of the post-apartheid nation, and holding at bay a whole series of repressed and negated undercurrents.

Financial Repression as a Policy Choice: The Case of Ukraine, 1992—2000

Directory of Open Access Journals (Sweden)

Robert S. Kravchuk

2004-10-01

Full Text Available By their nature, instruments of financial repression distort interest rates, foreign exchange rates, patterns of investment, and the economic incentives of both borrowers and lenders. In order to deal with the economic pathologies introduced by the government’s own credit and financial policies, governments inevitably find that they must intervene further, to ration credit and impose controls, generally on prices, wages, interest rates, foreign exchange rates and other transactions. Not only did Ukraine exhibit all of the symptoms of financial repression in the 1990s, but the basic policy instruments of financial repression also became too familiar in Ukraine. In fact, to one extent or another, in the 1990s Ukraine employed several of these measures (often in combination as means to suppress the effects of excessive amounts of state consumption, the resultant inflation, and its own credit policies. In the long run, economic growth will suffer, however, because repression reduces the capacity of the financial system to respond to the needs of firms and households in the real economy.

Cloning, expression, crystallization and preliminary X-ray analysis of a putative multiple antibiotic resistance repressor protein (MarR) from Xanthomonas campestris

International Nuclear Information System (INIS)

Tu, Zhi-Le; Li, Juo-Ning; Chin, Ko-Hsin; Chou, Chia-Cheng; Lee, Cheng-Chung; Shr, Hui-Lin; Lyu, Ping-Chiang; Gao, Fei Philip; Wang, Andrew H.-J.; Chou, Shan-Ho

2005-01-01

A putative repressor for the multiple antibiotic resistance operon from a plant pathogen X. campestris pv. campestris has been overexpressed in E. coli, purified and crystallized. The crystals diffracted to 2.3 Å with good quality. The multiple antibiotic resistance operon (marRAB) is a member of the multidrug-resistance system. When induced, this operon enhances resistance of bacteria to a variety of medically important antibiotics, causing a serious global health problem. MarR is a marR-encoded protein that represses the transcription of the marRAB operon. Through binding with salicylate and certain antibiotics, however, MarR can derepress and activate the marRAB operon. In this report, the cloning, expression, crystallization and preliminary X-ray analysis of XC1739, a putative MarR repressor protein present in the Xanthomonas campestris pv. campestris, a Gram-negative bacterium causing major worldwide disease of cruciferous crops, are described. The XC1739 crystals diffracted to a resolution of at least 1.8 Å. They are orthorhombic and belong to space group P2 1 2 1 2 1 , with unit-cell parameters a = 39.5, b = 54.2 and c = 139.5 Å, respectively. They contain two molecules in the asymmetric unit from calculation of the self-rotation function

CcpA-dependent carbon catabolite repression in bacteria

NARCIS (Netherlands)

Warner, JB; Lolkema, JS; Warner, Jessica B.

2003-01-01

Carbon catabolite repression (CCR) by transcriptional regulators follows different mechanisms in gram-positive and gram-negative bacteria. In gram-positive bacteria, CcpA-dependent CCR is mediated by phosphorylation of the phosphoenolpyruvate:sugar phosphotransferase system intermediate HPr at a

Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway

DEFF Research Database (Denmark)

Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.

2011-01-01

Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...

Expression, purification and functional characterization of AmiA of acetamidase operon of Mycobacterium smegmatis.

Science.gov (United States)

Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha

2014-11-01

Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.

Biofilm plasmids with a rhamnose operon are widely distributed determinants of the 'swim-or-stick' lifestyle in roseobacters.

Science.gov (United States)

Michael, Victoria; Frank, Oliver; Bartling, Pascal; Scheuner, Carmen; Göker, Markus; Brinkmann, Henner; Petersen, Jörn

2016-10-01

Alphaproteobacteria of the metabolically versatile Roseobacter group (Rhodobacteraceae) are abundant in marine ecosystems and represent dominant primary colonizers of submerged surfaces. Motility and attachment are the prerequisite for the characteristic 'swim-or-stick' lifestyle of many representatives such as Phaeobacter inhibens DSM 17395. It has recently been shown that plasmid curing of its 65-kb RepA-I-type replicon with >20 genes for exopolysaccharide biosynthesis including a rhamnose operon results in nearly complete loss of motility and biofilm formation. The current study is based on the assumption that homologous biofilm plasmids are widely distributed. We analyzed 33 roseobacters that represent the phylogenetic diversity of this lineage and documented attachment as well as swimming motility for 60% of the strains. All strong biofilm formers were also motile, which is in agreement with the proposed mechanism of surface attachment. We established transposon mutants for the four genes of the rhamnose operon from P. inhibens and proved its crucial role in biofilm formation. In the Roseobacter group, two-thirds of the predicted biofilm plasmids represent the RepA-I type and their physiological role was experimentally validated via plasmid curing for four additional strains. Horizontal transfer of these replicons was documented by a comparison of the RepA-I phylogeny with the species tree. A gene content analysis of 35 RepA-I plasmids revealed a core set of genes, including the rhamnose operon and a specific ABC transporter for polysaccharide export. Taken together, our data show that RepA-I-type biofilm plasmids are essential for the sessile mode of life in the majority of cultivated roseobacters.

The Cry Toxin Operon of Clostridium bifermentans subsp. malaysia Is Highly Toxic to Aedes Larval Mosquitoes

Science.gov (United States)

Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim

2014-01-01

The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432

The natural product peiminine represses colorectal carcinoma tumor growth by inducing autophagic cell death

International Nuclear Information System (INIS)

Lyu, Qing; Tou, Fangfang; Su, Hong; Wu, Xiaoyong; Chen, Xinyi; Zheng, Zhi

2015-01-01

Autophagy is evolutionarily conservative in eukaryotic cells that engulf cellular long-lived proteins and organelles, and it degrades the contents through fusion with lysosomes, via which the cell acquires recycled building blocks for the synthesis of new molecules. In this study, we revealed that peiminine induces cell death and enhances autophagic flux in colorectal carcinoma HCT-116 cells. We determined that peiminine enhances the autophagic flux by repressing the phosphorylation of mTOR through inhibiting upstream signals. Knocking down ATG5 greatly reduced the peiminine-induced cell death in wild-type HCT-116 cells, while treating Bax/Bak-deficient cells with peiminine resulted in significant cell death. In summary, our discoveries demonstrated that peiminine represses colorectal carcinoma cell proliferation and cell growth by inducing autophagic cell death. - Highlights: • Peiminine induces autophagy and upregulates autophagic flux. • Peiminine represses colorectal carcinoma tumor growth. • Peiminine induces autophagic cell death. • Peiminine represses mTOR phosphorylation by influencing PI3K/Akt and AMPK pathway

The natural product peiminine represses colorectal carcinoma tumor growth by inducing autophagic cell death

Energy Technology Data Exchange (ETDEWEB)

Lyu, Qing [School of Life Sciences, Tsinghua University, Beijing, 100084 (China); Key Lab in Healthy Science and Technology, Division of Life Science, Graduate School at Shenzhen, Tsinghua University, Shenzhen, 518055 (China); Tou, Fangfang [Jiangxi Provincial Key Lab of Oncology Translation Medicine, Jiangxi Cancer Hospital, Nanchang, 330029 (China); Su, Hong; Wu, Xiaoyong [First Affiliated Hospital, Guiyang College of Traditional Chinese Medicine, Guiyang, 550002 (China); Chen, Xinyi [Department of Hematology and Oncology, Beijing University of Chinese Medicine, Beijing, 100029 (China); Zheng, Zhi, E-mail: zheng_sheva@hotmail.com [Jiangxi Provincial Key Lab of Oncology Translation Medicine, Jiangxi Cancer Hospital, Nanchang, 330029 (China)

2015-06-19

Autophagy is evolutionarily conservative in eukaryotic cells that engulf cellular long-lived proteins and organelles, and it degrades the contents through fusion with lysosomes, via which the cell acquires recycled building blocks for the synthesis of new molecules. In this study, we revealed that peiminine induces cell death and enhances autophagic flux in colorectal carcinoma HCT-116 cells. We determined that peiminine enhances the autophagic flux by repressing the phosphorylation of mTOR through inhibiting upstream signals. Knocking down ATG5 greatly reduced the peiminine-induced cell death in wild-type HCT-116 cells, while treating Bax/Bak-deficient cells with peiminine resulted in significant cell death. In summary, our discoveries demonstrated that peiminine represses colorectal carcinoma cell proliferation and cell growth by inducing autophagic cell death. - Highlights: • Peiminine induces autophagy and upregulates autophagic flux. • Peiminine represses colorectal carcinoma tumor growth. • Peiminine induces autophagic cell death. • Peiminine represses mTOR phosphorylation by influencing PI3K/Akt and AMPK pathway.

Transcriptional analysis of the MrpJ network: modulation of diverse virulence-associated genes and direct regulation of mrp fimbrial and flhDC flagellar operons in Proteus mirabilis.

Science.gov (United States)

Bode, Nadine J; Debnath, Irina; Kuan, Lisa; Schulfer, Anjelique; Ty, Maureen; Pearson, Melanie M

2015-06-01

The enteric bacterium Proteus mirabilis is associated with a significant number of catheter-associated urinary tract infections (UTIs). Strict regulation of the antagonistic processes of adhesion and motility, mediated by fimbriae and flagella, respectively, is essential for disease progression. Previously, the transcriptional regulator MrpJ, which is encoded by the mrp fimbrial operon, has been shown to repress both swimming and swarming motility. Here we show that MrpJ affects an array of cellular processes beyond adherence and motility. Microarray analysis found that expression of mrpJ mimicking levels observed during UTIs leads to differential expression of 217 genes related to, among other functions, bacterial virulence, type VI secretion, and metabolism. We probed the molecular mechanism of transcriptional regulation by MrpJ using transcriptional reporters and chromatin immunoprecipitation (ChIP). Binding of MrpJ to two virulence-associated target gene promoters, the promoters of the flagellar master regulator flhDC and mrp itself, appears to be affected by the condensation state of the native chromosome, although both targets share a direct MrpJ binding site proximal to the transcriptional start. Furthermore, an mrpJ deletion mutant colonized the bladders of mice at significantly lower levels in a transurethral model of infection. Additionally, we observed that mrpJ is widely conserved in a collection of recent clinical isolates. Altogether, these findings support a role of MrpJ as a global regulator of P. mirabilis virulence. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Transcriptional Analysis of the MrpJ Network: Modulation of Diverse Virulence-Associated Genes and Direct Regulation of mrp Fimbrial and flhDC Flagellar Operons in Proteus mirabilis

Science.gov (United States)

Bode, Nadine J.; Debnath, Irina; Kuan, Lisa; Schulfer, Anjelique; Ty, Maureen

2015-01-01

The enteric bacterium Proteus mirabilis is associated with a significant number of catheter-associated urinary tract infections (UTIs). Strict regulation of the antagonistic processes of adhesion and motility, mediated by fimbriae and flagella, respectively, is essential for disease progression. Previously, the transcriptional regulator MrpJ, which is encoded by the mrp fimbrial operon, has been shown to repress both swimming and swarming motility. Here we show that MrpJ affects an array of cellular processes beyond adherence and motility. Microarray analysis found that expression of mrpJ mimicking levels observed during UTIs leads to differential expression of 217 genes related to, among other functions, bacterial virulence, type VI secretion, and metabolism. We probed the molecular mechanism of transcriptional regulation by MrpJ using transcriptional reporters and chromatin immunoprecipitation (ChIP). Binding of MrpJ to two virulence-associated target gene promoters, the promoters of the flagellar master regulator flhDC and mrp itself, appears to be affected by the condensation state of the native chromosome, although both targets share a direct MrpJ binding site proximal to the transcriptional start. Furthermore, an mrpJ deletion mutant colonized the bladders of mice at significantly lower levels in a transurethral model of infection. Additionally, we observed that mrpJ is widely conserved in a collection of recent clinical isolates. Altogether, these findings support a role of MrpJ as a global regulator of P. mirabilis virulence. PMID:25847961

Derangement of a factor upstream of RARalpha triggers the repression of a pleiotropic epigenetic network.

Directory of Open Access Journals (Sweden)

Francesca Corlazzoli

Full Text Available Chromatin adapts and responds to extrinsic and intrinsic cues. We hypothesize that inheritable aberrant chromatin states in cancer and aging are caused by genetic/environmental factors. In previous studies we demonstrated that either genetic mutations, or loss, of retinoic acid receptor alpha (RARalpha, can impair the integration of the retinoic acid (RA signal at the chromatin of RA-responsive genes downstream of RARalpha, and can lead to aberrant repressive chromatin states marked by epigenetic modifications. In this study we tested whether the mere interference with the availability of RA signal at RARalpha, in cells with an otherwise functional RARalpha, can also induce epigenetic repression at RA-responsive genes downstream of RARalpha.To hamper the availability of RA at RARalpha in untransformed human mammary epithelial cells, we targeted the cellular RA-binding protein 2 (CRABP2, which transports RA from the cytoplasm onto the nuclear RARs. Stable ectopic expression of a CRABP2 mutant unable to enter the nucleus, as well as stable knock down of endogenous CRABP2, led to the coordinated transcriptional repression of a few RA-responsive genes downstream of RARalpha. The chromatin at these genes acquired an exacerbated repressed state, or state "of no return". This aberrant state is unresponsive to RA, and therefore differs from the physiologically repressed, yet "poised" state, which is responsive to RA. Consistent with development of homozygosis for epigenetically repressed loci, a significant proportion of cells with a defective CRABP2-mediated RA transport developed heritable phenotypes indicative of loss of function.Derangement/lack of a critical factor necessary for RARalpha function induces epigenetic repression of a RA-regulated gene network downstream of RARalpha, with major pleiotropic biological outcomes.

Repressive coping and alexithymia in ideopathic environmental intolerance

DEFF Research Database (Denmark)

Skovbjerg, Sine; Zachariae, Robert; Rasmussen, Alice

2010-01-01

participated in a general population-based study and reported symptoms of environmental intolerance (n = 787) and patients with IEI (n = 237). The participants completed questionnaires assessing IEI, namely, a measure of repressive coping combining scores on the Marlowe–Crowne Social Desirability Scale (MCSDS...

Repressive Tolerance and the Practice of Adult Education

Science.gov (United States)

Brookfield, Stephen D.

2014-01-01

Herbert Marcuse's concept of repressive tolerance argues that behind the justification of tolerance lies the possibility of ideological domination. Tolerance allows intolerable practices to go unchallenged and flattens discussion to assume all viewpoints have equal validity. When alternative, dissenting views are inserted into the curriculum…

Drosophila Pumilio protein contains multiple autonomous repression domains that regulate mRNAs independently of Nanos and brain tumor.

Science.gov (United States)

Weidmann, Chase A; Goldstrohm, Aaron C

2012-01-01

Drosophila melanogaster Pumilio is an RNA-binding protein that potently represses specific mRNAs. In developing embryos, Pumilio regulates a key morphogen, Hunchback, in collaboration with the cofactor Nanos. To investigate repression by Pumilio and Nanos, we created cell-based assays and found that Pumilio inhibits translation and enhances mRNA decay independent of Nanos. Nanos robustly stimulates repression through interactions with the Pumilio RNA-binding domain. We programmed Pumilio to recognize a new binding site, which garners repression of new target mRNAs. We show that cofactors Brain Tumor and eIF4E Homologous Protein are not obligatory for Pumilio and Nanos activity. The conserved RNA-binding domain of Pumilio was thought to be sufficient for its function. Instead, we demonstrate that three unique domains in the N terminus of Pumilio possess the major repressive activity and can function autonomously. The N termini of insect and vertebrate Pumilio and Fem-3 binding factors (PUFs) are related, and we show that corresponding regions of human PUM1 and PUM2 have repressive activity. Other PUF proteins lack these repression domains. Our findings suggest that PUF proteins have evolved new regulatory functions through protein sequences appended to their conserved PUF repeat RNA-binding domains.

Epigenetic regulation of puberty via Zinc finger protein-mediated transcriptional repression.

Science.gov (United States)

Lomniczi, Alejandro; Wright, Hollis; Castellano, Juan Manuel; Matagne, Valerie; Toro, Carlos A; Ramaswamy, Suresh; Plant, Tony M; Ojeda, Sergio R

2015-12-16

In primates, puberty is unleashed by increased GnRH release from the hypothalamus following an interval of juvenile quiescence. GWAS implicates Zinc finger (ZNF) genes in timing human puberty. Here we show that hypothalamic expression of several ZNFs decreased in agonadal male monkeys in association with the pubertal reactivation of gonadotropin secretion. Expression of two of these ZNFs, GATAD1 and ZNF573, also decreases in peripubertal female monkeys. However, only GATAD1 abundance increases when gonadotropin secretion is suppressed during late infancy. Targeted delivery of GATAD1 or ZNF573 to the rat hypothalamus delays puberty by impairing the transition of a transcriptional network from an immature repressive epigenetic configuration to one of activation. GATAD1 represses transcription of two key puberty-related genes, KISS1 and TAC3, directly, and reduces the activating histone mark H3K4me2 at each promoter via recruitment of histone demethylase KDM1A. We conclude that GATAD1 epitomizes a subset of ZNFs involved in epigenetic repression of primate puberty.

Timing is critical for effective glucocorticoid receptor mediated repression of the cAMP-induced CRH gene.

Directory of Open Access Journals (Sweden)

Siem van der Laan

Full Text Available Glucocorticoid negative feedback of the hypothalamus-pituitary-adrenal axis is mediated in part by direct repression of gene transcription in glucocorticoid receptor (GR expressing cells. We have investigated the cross talk between the two main signaling pathways involved in activation and repression of corticotrophin releasing hormone (CRH mRNA expression: cyclic AMP (cAMP and GR. We report that in the At-T20 cell-line the glucocorticoid-mediated repression of the cAMP-induced human CRH proximal promoter activity depends on the relative timing of activation of both signaling pathways. Activation of the GR prior to or in conjunction with cAMP signaling results in an effective repression of the cAMP-induced transcription of the CRH gene. In contrast, activation of the GR 10 minutes after onset of cAMP treatment, results in a significant loss of GR-mediated repression. In addition, translocation of ligand-activated GR to the nucleus was found as early as 10 minutes after glucocorticoid treatment. Interestingly, while both signaling cascades counteract each other on the CRH proximal promoter, they synergize on a synthetic promoter containing 'positive' response elements. Since the order of activation of both signaling pathways may vary considerably in vivo, we conclude that a critical time-window exists for effective repression of the CRH gene by glucocorticoids.

Role of GntR Family Regulatory Gene SCO1678 in Gluconate Metabolism in Streptomyces coelicolor M145

Directory of Open Access Journals (Sweden)

Olga Tsypik

2017-01-01

Full Text Available Here we report functional characterization of the Streptomyces coelicolor M145 gene SCO1678, which encodes a GntR-like regulator of the FadR subfamily. Bioinformatic analysis suggested that SCO1678 is part of putative operon (gnt involved in gluconate metabolism. Combining the results of SCO1678 knockout, transcriptional analysis of gnt operon, and Sco1678 protein-DNA electromobility shift assays, we established that Sco1678 protein controls the gluconate operon. It does so via repression of its transcription from a single promoter located between genes SCO1678 and SCO1679. The knockout also influenced, in a medium-dependent manner, the production of secondary metabolites by S. coelicolor. In comparison to the wild type, on gluconate-containing minimal medium, the SCO1678 mutant produced much less actinorhodin and accumulated a yellow-colored pigment, likely to be the cryptic polyketide coelimycin. Possible links between gluconate metabolism and antibiotic production are discussed.

Clinical events in coronary patients who report low distress: adverse effect of repressive coping.

Science.gov (United States)

Denollet, Johan; Martens, Elisabeth J; Nyklícek, Ivan; Conraads, Viviane M; de Gelder, Beatrice

2008-05-01

Coronary artery disease (CAD) patients who report low distress are considered to be at low psychological risk for clinical events. However, patients with a repressive coping style may fail to detect and report signals of emotional distress. The authors hypothesized that repressive CAD patients are at risk for clinical events, despite low self-rated distress. This was a prospective 5- to 10-year follow-up study, with a mean follow-up of 6.6 years. At baseline, 731 CAD patients filled out Trait-Anxiety (distress), Marlowe-Crowne (defensiveness), and Type D scales; 159 patients were classified as "repressive," 360 as "nonrepressive," and 212 as "Type D." The primary endpoint was a composite of total mortality or myocardial infarction (MI); the secondary endpoint was cardiac mortality/MI. No patients were lost to follow-up; 91 patients had a clinical event (including 35 cardiac death and 32 MI). Repressive patients reported low levels of anxiety, anger and depression at baseline, but were at increased risk for death/MI (21/159 = 13%) compared with nonrepressive patients (22/360 = 6%), p = .009. Poor systolic function, poor exercise tolerance, 3-vessel disease, index MI and Type-D personality--but not depression, anxiety or anger--also independently predicted clinical events. After controlling for these variables, repressive patients still had a twofold increased risk of death/MI, OR = 2.17, 95% CI = 1.10-4.08, p = .025). These findings were replicated for cardiac mortality/MI. CAD patients who use a repressive coping style are at increased risk for clinical events, despite their claims of low emotional distress. This phenomenon may cause an underestimation of the effect of stress on the heart. (PsycINFO Database Record (c) 2008 APA, all rights reserved).

"The Neurosis That Has Possessed Us": Political Repression in the Cold War Medical Profession.

Science.gov (United States)

Chowkwanyun, Merlin

2018-04-27

Political repression played a central role in shaping the political complexion of the American medical profession, the policies it advocated, and those allowed to function comfortably in it. Previous work on the impact of McCarthyism and medicine focuses heavily on the mid-century failure of national health insurance (NHI) and medical reform organizations that suffered from McCarthyist attacks. The focus is national and birds-eye but says less about the impact on day-to-day life of physicians caught in a McCarthyist web; and how exactly the machinery of political repression within the medical profession worked on the ground. This study shifts orientation by using the abrupt dismissal of three Los Angeles physicians from their jobs as a starting point for exploring these dynamics. I argue that the rise of the medical profession and the repressive state in the mid-century, frequently studied apart, worked hand-in-hand, with institutions from each playing symbiotic and mutually reinforcing roles. I also explore tactics of resistance - rhetorical and organizational - to medical repression by physicians who came under attack.

Global transcriptional repression in C. elegans germline precursors by regulated sequestration of TAF-4.

Science.gov (United States)

Guven-Ozkan, Tugba; Nishi, Yuichi; Robertson, Scott M; Lin, Rueyling

2008-10-03

In C. elegans, four asymmetric divisions, beginning with the zygote (P0), generate transcriptionally repressed germline blastomeres (P1-P4) and somatic sisters that become transcriptionally active. The protein PIE-1 represses transcription in the later germline blastomeres but not in the earlier germline blastomeres P0 and P1. We show here that OMA-1 and OMA-2, previously shown to regulate oocyte maturation, repress transcription in P0 and P1 by binding to and sequestering in the cytoplasm TAF-4, a component critical for assembly of TFIID and the pol II preinitiation complex. OMA-1/2 binding to TAF-4 is developmentally regulated, requiring phosphorylation by the DYRK kinase MBK-2, which is activated at meiosis II after fertilization. OMA-1/2 are normally degraded after the first mitosis, but ectopic expression of wild-type OMA-1 is sufficient to repress transcription in both somatic and later germline blastomeres. We propose that phosphorylation by MBK-2 serves as a developmental switch, converting OMA-1/2 from oocyte to embryo regulators.

Analysis of the multimer resolution system encoded by the parCBA operon of broad-host-range plasmid RP4

DEFF Research Database (Denmark)

Eberl, Leo; Sternberg, Claus; Givskov, Michael Christian

1994-01-01

specific sites situated in the promoter region of the parCBA operon. The two ParA proteins that are produced as a result of independent translation initiation at two different start codons within the same open reading frame were overexpressed in Escherichia coli and partially purified. Both forms...

Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model

Science.gov (United States)

Cao, Xin; Song, Yongli; Zhang, Tonghua

In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.

Real-time PCR analysis of carbon catabolite repression of cellobiose gene transcription in Trametes versicolor

Energy Technology Data Exchange (ETDEWEB)

Stapleton, P. C.; O' Mahoney, J.; Dobson, A. D. W. [National University of Ireland, Microbiology Department, Cork (Ireland)

2004-02-01

Previous reports indicate that in white rot fungi such as Trametes versicolor, the production of cellobiose dehydrogenase (CDH), an extracellular haemo-flavo-enzyme, is subject to carbon catabolite repression by both glucose and maltose, and that the repression is mediated at the transcriptional level. This paper describes the results of an investigation of CDH gene transcription in cellulolytic cultures of T. versicolor, in the presence of other additional carbon sources such as glucose, arabinose, and xylose. Using real time polymerase chain reaction (RT-PCR) assay methods in the presence of these other additional carbon sources, the levels of repression observed are quantitatively determined in an effort to obtain more accurate measurements of carbon catabolite repression of CDH production in this ligninolytic fungus. Ninety-six hours after addition, results of the analysis showed reduction in CDH transcript levels of 19-fold for galactose, 92-fold for arabinose and 114-fold for xylose. The greatest repressive effect was exhibited by glucose. In this case the reduction in CDH transcript levels was 3400-fold. CDH plays an important role in lignin degradation, and there is also substantial interest in the biotechnological applications of CDH, most particularly in the pulp and paper industry. 24 refs., 4 figs.

Lactose-mediated carbon catabolite repression of putrescine production in dairy Lactococcus lactis is strain dependent.

Science.gov (United States)

del Rio, Beatriz; Ladero, Victor; Redruello, Begoña; Linares, Daniel M; Fernández, Maria; Martín, Maria Cruz; Alvarez, Miguel A

2015-06-01

Lactococcus lactis is the lactic acid bacterial (LAB) species most widely used as a primary starter in the dairy industry. However, several strains of L. lactis produce the biogenic amine putrescine via the agmatine deiminase (AGDI) pathway. We previously reported the putrescine biosynthesis pathway in L. lactis subsp. cremoris GE2-14 to be regulated by carbon catabolic repression (CCR) via glucose but not lactose (Linares et al., 2013). The present study shows that both these sugars repress putrescine biosynthesis in L. lactis subsp. lactis T3/33, a strain isolated from a Spanish artisanal cheese. Furthermore, we demonstrated that both glucose and lactose repressed the transcriptional activity of the aguBDAC catabolic genes of the AGDI route. Finally, a screening performed in putrescine-producing dairy L. lactis strains determined that putrescine biosynthesis was repressed by lactose in all the L. lactis subsp. lactis strains tested, but in only one L. lactis subsp. cremoris strain. Given the obvious importance of the lactose-repression in cheese putrescine accumulation, it is advisable to consider the diversity of L. lactis in this sense and characterize consequently the starter cultures to select the safest strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

Science.gov (United States)

Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

2016-10-15

Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

Financial repression and high public debt in Europe

NARCIS (Netherlands)

van Riet, Ad

2018-01-01

The sharp rise in public debt-to-GDP ratios in the aftermath of the global financial crisis of 2008 posed serious challenges for fiscal policy in euro area countries. This thesis examines whether and to what extent modern financial repression has been applied in Europe to address these challenges.

Mutation of a Broadly Conserved Operon (RL3499-RL3502) from Rhizobium leguminosarum Biovar viciae Causes Defects in Cell Morphology and Envelope Integrity▿†

Science.gov (United States)

Vanderlinde, Elizabeth M.; Magnus, Samantha A.; Tambalo, Dinah D.; Koval, Susan F.; Yost, Christopher K.

2011-01-01

The bacterial cell envelope is of critical importance to the function and survival of the cell; it acts as a barrier against harmful toxins while allowing the flow of nutrients into the cell. It also serves as a point of physical contact between a bacterial cell and its host. Hence, the cell envelope of Rhizobium leguminosarum is critical to cell survival under both free-living and symbiotic conditions. Transposon mutagenesis of R. leguminosarum strain 3841 followed by a screen to isolate mutants with defective cell envelopes led to the identification of a novel conserved operon (RL3499-RL3502) consisting of a putative moxR-like AAA+ ATPase, a hypothetical protein with a domain of unknown function (designated domain of unknown function 58), and two hypothetical transmembrane proteins. Mutation of genes within this operon resulted in increased sensitivity to membrane-disruptive agents such as detergents, hydrophobic antibiotics, and alkaline pH. On minimal media, the mutants retain their rod shape but are roughly 3 times larger than the wild type. On media containing glycine or peptides such as yeast extract, the mutants form large, distorted spheres and are incapable of sustained growth under these culture conditions. Expression of the operon is maximal during the stationary phase of growth and is reduced in a chvG mutant, indicating a role for this sensor kinase in regulation of the operon. Our findings provide the first functional insight into these genes of unknown function, suggesting a possible role in cell envelope development in Rhizobium leguminosarum. Given the broad conservation of these genes among the Alphaproteobacteria, the results of this study may also provide insight into the physiological role of these genes in other Alphaproteobacteria, including the animal pathogen Brucella. PMID:21357485

UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon

International Nuclear Information System (INIS)

Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.

1988-01-01

Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs

Political Repressions in USSR (Against Speculations, Perversion and Mystifications

Directory of Open Access Journals (Sweden)

Viktor N. Zemskov

2012-12-01

Full Text Available In the article the great numbers of political repressions, which were exaggerated by authors: R.A. Medvedev, A.I. Solzhenitsyn, O.G. Shatunovskoy, A.V. Antonov-Ovseenko in 80-90s are criticized. The author characterizes figures given in tens and even in hundreds of millions of victims as a statistical charlatanism.After checking up the KGB archives, and documents of division responsible for NKVD-MVD special settlements, the author spills the light on real numbers of political repressions in USSR. In his view, the total number of political victims does not exceed 2, 6 million people. This number implies over 800 thousand of death sentenced for political reasons, around 600 thousand political prisoners who died in labor camps, and about 1, 2 million people died in exile (including ‘Kulak Exile’ and during transportation (deported ethnic groups and others.

recA mediated spontaneous deletions of the icaADBC operon of clinical Staphylococcus epidermidis isolates : a new mechanism of phenotypic variations

NARCIS (Netherlands)

Nuryastuti, Titik; van der Mei, Henny C.; Busscher, Henk J.; Kuijer, Roel; Aman, Abu T.; Krom, Bastiaan P.

Phenotypic variation of Staphylococcus epidermidis involving the slime related ica operon results in heterogeneity in surface characteristics of individual bacteria in axenic cultures. Five clinical S. epidermidis isolates demonstrated phenotypic variation, i.e. both black and red colonies on Congo

Acetate repression of methane oxidation by supplemental Methylocella silvestris in a peat soil microcosm.

Science.gov (United States)

Rahman, M Tanvir; Crombie, Andrew; Moussard, Hélène; Chen, Yin; Murrell, J Colin

2011-06-01

Methylocella spp. are facultative methanotrophs that grow on methane and multicarbon substrates, such as acetate. Acetate represses transcription of methane monooxygenase of Methylocella silvestris in laboratory culture. DNA stable-isotope probing (DNA-SIP) using (13)C-methane and (12)C-acetate, carried out with Methylocella-spiked peat soil, showed that acetate also repressed methane oxidation by Methylocella in environmental samples.

Glucocorticoid and cytokine crosstalk: Feedback, feedforward, and co-regulatory interactions determine repression or resistance.

Science.gov (United States)

Newton, Robert; Shah, Suharsh; Altonsy, Mohammed O; Gerber, Antony N

2017-04-28

Inflammatory signals induce feedback and feedforward systems that provide temporal control. Although glucocorticoids can repress inflammatory gene expression, glucocorticoid receptor recruitment increases expression of negative feedback and feedforward regulators, including the phosphatase, DUSP1, the ubiquitin-modifying enzyme, TNFAIP3, or the mRNA-destabilizing protein, ZFP36. Moreover, glucocorticoid receptor cooperativity with factors, including nuclear factor-κB (NF-κB), may enhance regulator expression to promote repression. Conversely, MAPKs, which are inhibited by glucocorticoids, provide feedforward control to limit expression of the transcription factor IRF1, and the chemokine, CXCL10. We propose that modulation of feedback and feedforward control can determine repression or resistance of inflammatory gene expression toglucocorticoid. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

The CsoR-like sulfurtransferase repressor (CstR) is a persulfide sensor in Staphylococcus aureus.

Science.gov (United States)

Luebke, Justin L; Shen, Jiangchuan; Bruce, Kevin E; Kehl-Fie, Thomas E; Peng, Hui; Skaar, Eric P; Giedroc, David P

2014-12-01

How cells regulate the bioavailability of utilizable sulfur while mitigating the effects of hydrogen sulfide toxicity is poorly understood. CstR [Copper-sensing operon repressor (CsoR)-like sulfurtransferase repressor] represses the expression of the cst operon encoding a putative sulfide oxidation system in Staphylococcus aureus. Here, we show that the cst operon is strongly and transiently induced by cellular sulfide stress in an acute phase and specific response and that cst-encoded genes are necessary to mitigate the effects of sulfide toxicity. Growth defects are most pronounced when S. aureus is cultured in chemically defined media with thiosulfate (TS) as a sole sulfur source, but are also apparent when cystine is used or in rich media. Under TS growth conditions, cells fail to grow as a result of either unregulated expression of the cst operon in a ΔcstR strain or transformation with a non-inducible C31A/C60A CstR that blocks cst induction. This suggests that the cst operon contributes to cellular sulfide homeostasis. Tandem high-resolution mass spectrometry reveals derivatization of CstR by both inorganic tetrasulfide and an organic persulfide, glutathione persulfide, to yield a mixture of Cys31-Cys60' interprotomer cross-links, including di-, tri- and tetrasulfide bonds, which allosterically inhibit cst operator DNA binding by CstR. © 2014 John Wiley & Sons Ltd.

Interferon-Stimulated Genes Are Transcriptionally Repressed by PR in Breast Cancer.

Science.gov (United States)

Walter, Katherine R; Goodman, Merit L; Singhal, Hari; Hall, Jade A; Li, Tianbao; Holloran, Sean M; Trinca, Gloria M; Gibson, Katelin A; Jin, Victor X; Greene, Geoffrey L; Hagan, Christy R

2017-10-01

The progesterone receptor (PR) regulates transcriptional programs that drive proliferation, survival, and stem cell phenotypes. Although the role of native progesterone in the development of breast cancer remains controversial, PR clearly alters the transcriptome in breast tumors. This study identifies a class of genes, Interferon (IFN)-stimulated genes (ISGs), potently downregulated by ligand-activated PR which have not been previously shown to be regulated by PR. Progestin-dependent transcriptional repression of ISGs was observed in breast cancer cell line models and human breast tumors. Ligand-independent regulation of ISGs was also observed, as basal transcript levels were markedly higher in cells with PR knockdown. PR repressed ISG transcription in response to IFN treatment, the canonical mechanism through which these genes are activated. Liganded PR is robustly recruited to enhancer regions of ISGs, and ISG transcriptional repression is dependent upon PR's ability to bind DNA. In response to PR activation, key regulatory transcription factors that are required for IFN-activated ISG transcription, STAT2 and IRF9, exhibit impaired recruitment to ISG promoter regions, correlating with PR/ligand-dependent ISG transcriptional repression. IFN activation is a critical early step in nascent tumor recognition and destruction through immunosurveillance. As the large majority of breast tumors are PR positive at the time of diagnosis, PR-dependent downregulation of IFN signaling may be a mechanism through which early PR-positive breast tumors evade the immune system and develop into clinically relevant tumors. Implications: This study highlights a novel transcriptional mechanism through which PR drives breast cancer development and potentially evades the immune system. Mol Cancer Res; 15(10); 1331-40. ©2017 AACR . ©2017 American Association for Cancer Research.

Targeted transcriptional repression using a chimeric TALE-SRDX repressor protein

KAUST Repository

Mahfouz, Magdy M.

2011-12-14

Transcriptional activator-like effectors (TALEs) are proteins secreted by Xanthomonas bacteria when they infect plants. TALEs contain a modular DNA binding domain that can be easily engineered to bind any sequence of interest, and have been used to provide user-selected DNA-binding modules to generate chimeric nucleases and transcriptional activators in mammalian cells and plants. Here we report the use of TALEs to generate chimeric sequence-specific transcriptional repressors. The dHax3 TALE was used as a scaffold to provide a DNA-binding module fused to the EAR-repression domain (SRDX) to generate a chimeric repressor that targets the RD29A promoter. The dHax3. SRDX protein efficiently repressed the transcription of the RD29A

Targeted transcriptional repression using a chimeric TALE-SRDX repressor protein

KAUST Repository

Mahfouz, Magdy M.; Li, Lixin; Piatek, Marek J.; Fang, Xiaoyun; Mansour, Hicham; Bangarusamy, Dhinoth K.; Zhu, Jian-Kang

2011-01-01

Transcriptional activator-like effectors (TALEs) are proteins secreted by Xanthomonas bacteria when they infect plants. TALEs contain a modular DNA binding domain that can be easily engineered to bind any sequence of interest, and have been used to provide user-selected DNA-binding modules to generate chimeric nucleases and transcriptional activators in mammalian cells and plants. Here we report the use of TALEs to generate chimeric sequence-specific transcriptional repressors. The dHax3 TALE was used as a scaffold to provide a DNA-binding module fused to the EAR-repression domain (SRDX) to generate a chimeric repressor that targets the RD29A promoter. The dHax3. SRDX protein efficiently repressed the transcription of the RD29A

Repressive Tolerance

DEFF Research Database (Denmark)

Pedersen, Morten Jarlbæk

2017-01-01

Consultation of organised interests and others when drafting laws is often seen as an important source of both input and output legitimacy. But whereas the input side of the equation stems from the very process of listening to societal actors, output legitimacy can only be strengthened if consult......Consultation of organised interests and others when drafting laws is often seen as an important source of both input and output legitimacy. But whereas the input side of the equation stems from the very process of listening to societal actors, output legitimacy can only be strengthened...... a substantial effect on the substance of laws – shows that there is a great difference in the amenability of different branches of government but that, in general, authorities do not listen much despite a very strong consultation institution and tradition. A suggestion for an explanation could be pointing...... to an administrative culture of repressive tolerance of organised interests: authorities listen but only reacts in a very limited sense. This bears in it the risk of jeopardising the knowledge transfer from societal actors to administrative ditto thus harming the consultation institutions’ potential for strengthening...

The Agr Quorum Sensing System Represses Persister Formation through Regulation of Phenol Soluble Modulins in Staphylococcus aureus

Directory of Open Access Journals (Sweden)

Tao Xu

2017-11-01

Full Text Available The opportunistic pathogen Staphylococcus aureus has become an increasing threat to public health. While the Agr quorum sensing (QS system is a master regulator of S. aureus virulence, its dysfunction has been frequently reported to promote bacteremia and mortality in clinical infections. Here we show that the Agr system is involved in persister formation in S. aureus. Mutation of either agrCA or agrD but not RNAIII resulted in increased persister formation of stationary phase cultures. RNA-seq analysis showed that in stationary phase AgrCA/AgrD and RNAIII mutants showed consistent up-regulation of virulence associated genes (lip and splE, etc. and down-regulation of metabolism genes (bioA and nanK, etc.. Meanwhile, though knockout of agrCA or agrD strongly repressed expression of phenol soluble modulin encoding genes psmα1-4, psmβ1-2 and phenol soluble modulins (PSM transporter encoding genes in the pmt operon, mutation of RNAIII enhanced expression of the genes. We further found that knockout of psmα1-4 or psmβ1-2 augmented persister formation and that co-overexpression of PSMαs and PSMβs reversed the effects of AgrCA mutation on persister formation. We also detected the effects on persister formation by mutations of metabolism genes (arcA, hutU, narG, nanK, etc. that are potentially regulated by Agr system. It was found that deletion of the ManNAc kinase encoding gene nanK decreased persister formation. Taken together, these results shed new light on the PSM dependent regulatory role of Agr system in persister formation and may have implications for clinical treatment of MRSA persistent infections.

Nitrogen Metabolite Repression of Metabolism and Virulence in the Human Fungal Pathogen Cryptococcus neoformans

Science.gov (United States)

Lee, I. Russel; Chow, Eve W. L.; Morrow, Carl A.; Djordjevic, Julianne T.; Fraser, James A.

2011-01-01

Proper regulation of metabolism is essential to maximizing fitness of organisms in their chosen environmental niche. Nitrogen metabolite repression is an example of a regulatory mechanism in fungi that enables preferential utilization of easily assimilated nitrogen sources, such as ammonium, to conserve resources. Here we provide genetic, transcriptional, and phenotypic evidence of nitrogen metabolite repression in the human pathogen Cryptococcus neoformans. In addition to loss of transcriptional activation of catabolic enzyme-encoding genes of the uric acid and proline assimilation pathways in the presence of ammonium, nitrogen metabolite repression also regulates the production of the virulence determinants capsule and melanin. Since GATA transcription factors are known to play a key role in nitrogen metabolite repression, bioinformatic analyses of the C. neoformans genome were undertaken and seven predicted GATA-type genes were identified. A screen of these deletion mutants revealed GAT1, encoding the only global transcription factor essential for utilization of a wide range of nitrogen sources, including uric acid, urea, and creatinine—three predominant nitrogen constituents found in the C. neoformans ecological niche. In addition to its evolutionarily conserved role in mediating nitrogen metabolite repression and controlling the expression of catabolic enzyme and permease-encoding genes, Gat1 also negatively regulates virulence traits, including infectious basidiospore production, melanin formation, and growth at high body temperature (39°–40°). Conversely, Gat1 positively regulates capsule production. A murine inhalation model of cryptococcosis revealed that the gat1Δ mutant is slightly more virulent than wild type, indicating that Gat1 plays a complex regulatory role during infection. PMID:21441208

ATF3 represses PPARγ expression and inhibits adipocyte differentiation

Energy Technology Data Exchange (ETDEWEB)

Jang, Min-Kyung; Jung, Myeong Ho, E-mail: jung0603@pusan.ac.kr

2014-11-07

Highlights: • ATF3 decrease the expression of PPARγ and its target gene in 3T3-L1 adipocytes. • ATF3 represses the promoter activity of PPARγ2 gene. • ATF/CRE (−1537/−1530) is critical for ATF3-mediated downregulation of PPARγ. • ATF3 binds to the promoter region containing the ATF/CRE. • ER stress inhibits adipocyte differentiation through downregulation of PPARγ by ATF3. - Abstract: Activating transcription factor 3 (ATF3) is a stress-adaptive transcription factor that mediates cellular stress response signaling. We previously reported that ATF3 represses CCAAT/enhancer binding protein α (C/EBPα) expression and inhibits 3T3-L1 adipocyte differentiation. In this study, we explored potential role of ATF3 in negatively regulating peroxisome proliferator activated receptor-γ (PPARγ). ATF3 decreased the expression of PPARγ and its target gene in 3T3-L1 adipocytes. ATF3 also repressed the activity of −2.6 Kb promoter of mouse PPARγ2. Overexpression of PPARγ significantly prevented the ATF3-mediated inhibition of 3T3-L1 differentiation. Transfection studies with 5′ deleted-reporters showed that ATF3 repressed the activity of −2037 bp promoter, whereas it did not affect the activity of −1458 bp promoter, suggesting that ATF3 responsive element is located between the −2037 and −1458. An electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that ATF3 binds to ATF/CRE site (5′-TGACGTTT-3′) between −1537 and −1530. Mutation of the ATF/CRE site abrogated ATF3-mediated transrepression of the PPARγ2 promoter. Treatment with thapsigargin, endoplasmic reticulum (ER) stress inducer, increased ATF3 expression, whereas it decreased PPARγ expression. ATF3 knockdown significantly blocked the thapsigargin-mediated downregulation of PPARγ expression. Furthermore, overexpression of PPARγ prevented inhibition of 3T3-L1 differentiation by thapsigargin. Collectively, these results suggest that ATF3-mediated

Existential Choice as Repressed Theism: Jean-Paul Sartre and Giorgio Agamben in Conversation

Directory of Open Access Journals (Sweden)

Marcos Antonio Norris

2018-04-01

Full Text Available This article brings Sartre’s notion of existential authenticity, or sovereign decisionism, into conversation with the work of contemporary political theorist Giorgio Agamben, who argues that sovereign decisionism is the repressed theological foundation of authoritarian governments. As such, the article seeks to accomplish two goals. The first is to show that Sartre’s depiction of sovereign decisionism directly parallels how modern democratic governments conduct themselves during a state of emergency. The second is to show that Sartre’s notion of existential authenticity models, what Agamben calls, secularized theism. Through an ontotheological critique of Sartre’s professed atheism, the article concludes that an existential belief in sovereign decision represses, rather than profanes, the divine origins of authoritarian law. I frame the argument with a reading of Sartre’s 1943 play The Flies, which models the repressed theological underpinnings of Sartre’s theory.

Proteomic pleiotropy of OpgGH, an operon necessary for efficient growth of Salmonella enterica serovar Typhimurium under low-osmotic conditions

Science.gov (United States)

Salmonella enterica, a bacterial, food-borne pathogen of humans, can contaminate raw fruits and vegetables. Causing much public concern, the bacteria can survive in water used to wash produce. The ability to survive the low-osmolarity of the wash waters is attributed to the OpgGH operon that leads...

Cloning and identification of Group 1 mrp operon encoding a novel monovalent cation/proton antiporter system from the moderate halophile Halomonas zhaodongensis.

Science.gov (United States)

Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan

2014-11-01

The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.

Pseudomonas fluorescens ATCC 13525 Containing an Artificial Oxalate Operon and Vitreoscilla Hemoglobin Secretes Oxalic Acid and Solubilizes Rock Phosphate in Acidic Alfisols

Science.gov (United States)

Archana, G.; Naresh Kumar, G.

2014-01-01

Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah), Fomitopsis plaustris oxalate transporter (FpOAR) and Vitreoscilla hemoglobin (vgb) in various combinations. Pf (pKCN2) transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4) secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2) transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2) containing artificial oxalate operon (plac-FpOAR-oah) and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp) secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil. PMID:24705024

Pseudomonas fluorescens ATCC 13525 containing an artificial oxalate operon and Vitreoscilla hemoglobin secretes oxalic acid and solubilizes rock phosphate in acidic alfisols.

Directory of Open Access Journals (Sweden)

Kavita Yadav

Full Text Available Oxalate secretion was achieved in Pseudomonas fluorescens ATCC 13525 by incorporation of genes encoding Aspergillus niger oxaloacetate acetyl hydrolase (oah, Fomitopsis plaustris oxalate transporter (FpOAR and Vitreoscilla hemoglobin (vgb in various combinations. Pf (pKCN2 transformant containing oah alone accumulated 19 mM oxalic acid intracellularly but secreted 1.2 mM. However, in the presence of an artificial oxalate operon containing oah and FpOAR genes in plasmid pKCN4, Pf (pKCN4 secreted 13.6 mM oxalate in the medium while 3.6 mM remained inside. This transformant solubilized 509 μM of phosphorus from rock phosphate in alfisol which is 4.5 fold higher than the Pf (pKCN2 transformant. Genomic integrants of P. fluorescens (Pf int1 and Pf int2 containing artificial oxalate operon (plac-FpOAR-oah and artificial oxalate gene cluster (plac-FpOAR-oah, vgb, egfp secreted 4.8 mM and 5.4 mM oxalic acid, released 329 μM and 351 μM P, respectively, in alfisol. The integrants showed enhanced root colonization, improved growth and increased P content of Vigna radiata plants. This study demonstrates oxalic acid secretion in P. fluorescens by incorporation of an artificial operon constituted of genes for oxalate synthesis and transport, which imparts mineral phosphate solubilizing ability to the organism leading to enhanced growth and P content of V. radiata in alfisol soil.

The Transcription Factor STAT6 Mediates Direct Repression of Inflammatory Enhancers and Limits Activation of Alternatively Polarized Macrophages

OpenAIRE

Czimmerer, Zsolt; Daniel, Bence; Horvath, Attila; Rückerl, Dominik; Nagy, Gergely; Kiss, Mate; Peloquin, Matthew; Budai, Marietta M.; Cuaranta-Monroy, Ixchelt; Simandi, Zoltan; Steiner, Laszlo; Nagy, Bela; Poliska, Szilard; Banko, Csaba; Bacso, Zsolt

2018-01-01

Summary The molecular basis of signal-dependent transcriptional activation has been extensively studied in macrophage polarization, but our understanding remains limited regarding the molecular determinants of repression. Here we show that IL-4-activated STAT6 transcription factor is required for the direct transcriptional repression of a large number of genes during in vitro and in vivo alternative macrophage polarization. Repression results in decreased lineage-determining transcription fac...

Repression of competition favours cooperation : experimental evidence from bacteria

NARCIS (Netherlands)

Kümmerli, Rolf; van den Berg, Piet; Griffin, Ashleigh S; West, Stuart A; Gardner, Andy

Repression of competition (RC) within social groups has been suggested as a key mechanism driving the evolution of cooperation, because it aligns the individual's proximate interest with the interest of the group. Despite its enormous potential for explaining cooperation across all levels of

Financial repression, money growth, and seignorage: The Polish experience

NARCIS (Netherlands)

Aarle, B. van; Budina, N.

1997-01-01

Financial Repression, Money Growth and Seignorage: The Polish Experience. — A small analytical framework is developed to analyze the relation between reserve requirements, base money growth and seignorage revenues. From the analysis, the authors can derive of steady-state seignorage revenues as a

Dopamine signaling leads to loss of Polycomb repression and aberrant gene activation in experimental parkinsonism.

Directory of Open Access Journals (Sweden)

Erik Södersten

2014-09-01

Full Text Available Polycomb group (PcG proteins bind to and repress genes in embryonic stem cells through lineage commitment to the terminal differentiated state. PcG repressed genes are commonly characterized by the presence of the epigenetic histone mark H3K27me3, catalyzed by the Polycomb repressive complex 2. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation. The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP experiments showed that increased H3K27me3S28p was accompanied by reduced PcG binding to regulatory regions of genes. An analysis of the genome wide distribution of L-DOPA-induced H3K27me3S28 phosphorylation by ChIP sequencing (ChIP-seq in combination with expression analysis by RNA-sequencing (RNA-seq showed that the induction of H3K27me3S28p correlated with increased expression of a subset of PcG repressed genes. We found that induction of H3K27me3S28p persisted during chronic L-DOPA administration to parkisonian mice and correlated with aberrant gene expression. We propose that dopaminergic transmission can activate PcG repressed genes in the adult brain and thereby contribute to long-term maladaptive responses including the motor complications, or dyskinesia, caused by prolonged administration of L-DOPA in Parkinson's disease.

Dissecting the Photoprotective Mechanism Encoded by the flv4-2 Operon: a Distinct Contribution of Sll0218 in Photosystem II Stabilization.

Science.gov (United States)

Bersanini, Luca; Allahverdiyeva, Yagut; Battchikova, Natalia; Heinz, Steffen; Lespinasse, Maija; Ruohisto, Essi; Mustila, Henna; Nickelsen, Jörg; Vass, Imre; Aro, Eva-Mari

2017-03-01

In Synechocystis sp. PCC 6803, the flv4-2 operon encodes the flavodiiron proteins Flv2 and Flv4 together with a small protein, Sll0218, providing photoprotection for Photosystem II (PSII). Here, the distinct roles of Flv2/Flv4 and Sll0218 were addressed, using a number of flv4-2 operon mutants. In the ∆sll0218 mutant, the presence of Flv2/Flv4 rescued PSII functionality as compared with ∆sll0218-flv2, where neither Sll0218 nor the Flv2/Flv4 heterodimer are expressed. Nevertheless, both the ∆sll0218 and ∆sll0218-flv2 mutants demonstrated deficiency in accumulation of PSII proteins suggesting a role for Sll0218 in PSII stabilization, which was further supported by photoinhibition experiments. Moreover, the accumulation of PSII assembly intermediates occurred in Sll0218-lacking mutants. The YFP-tagged Sll0218 protein localized in a few spots per cell at the external side of the thylakoid membrane, and biochemical membrane fractionation revealed clear enrichment of Sll0218 in the PratA-defined membranes, where the early biogenesis steps of PSII occur. Further, the characteristic antenna uncoupling feature of the ∆flv4-2 operon mutants is shown to be related to PSII destabilization in the absence of Sll0218. It is concluded that the Flv2/Flv4 heterodimer supports PSII functionality, while the Sll0218 protein assists PSII assembly and stabilization, including optimization of light harvesting. © 2016 The Authors. Plant, Cell & Enviroment Published by John Wiley & Sons Ltd.

The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis

OpenAIRE

Ahn, Sang-Joon; Burne, Robert A.

2006-01-01

The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...

Use of the Operon Structure of the C. elegans Genome as a Tool to Identify Functionally Related Proteins

Directory of Open Access Journals (Sweden)

Silvia Dossena

2013-12-01

Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.

Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

Directory of Open Access Journals (Sweden)

Thibaut Josse

2007-09-01

Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

IS FINANCIAL REPRESSION REALLY BAD?

Directory of Open Access Journals (Sweden)

Eun Young OH

2011-01-01

Full Text Available This paper examines the relationship between reserve requirements, interest rate taxes, and long-term growth. I present a model which shows that the government might repress the financial sector as this is the easy way of channelling resources to productive sectors. In this endogenous model, I employ the government input in the firm production function. The implications of the model are confirmed in that, an increase in reserve requirements and interest rate controls have two different reverse effects on growth - one is the negative effect on the financial sector. The other is a growth enhancing effect from the effective public spending on the real sectors.

Very low amounts of glucose cause repression of the stress-responsive gene HSP12 in Saccharomyces cerevisiae.

Science.gov (United States)

de Groot, E; Bebelman, J P; Mager, W H; Planta, R J

2000-02-01

Changing the growth mode of Saccharomyces cerevisiae by adding fermentable amounts of glucose to cells growing on a non-fermentable carbon source leads to rapid repression of general stress-responsive genes like HSP12. Remarkably, glucose repression of HSP12 appeared to occur even at very low glucose concentrations, down to 0.005%. Although these low levels of glucose do not induce fermentative growth, they do act as a growth signal, since upon addition of glucose to a concentration of 0.02%, growth rate increased and ribosomal protein gene transcription was up-regulated. In an attempt to elucidate how this type of glucose signalling may operate, several signalling mutants were examined. Consistent with the low amounts of glucose that elicit HSP12 repression, neither the main glucose-repression pathway nor cAMP-dependent activation of protein kinase A appeared to play a role in this regulation. Using mutants involved in glucose metabolism, evidence was obtained suggesting that glucose 6-phosphate serves as a signalling molecule. To identify the target for glucose repression on the promoter of the HSP12 gene, a promoter deletion series was used. The major transcription factors governing (stress-induced) transcriptional activation of HSP12 are Msn2p and Msn4p, binding to the general stress-responsive promoter elements (STREs). Surprisingly, glucose repression of HSP12 appeared to be independent of Msn2/4p: HSP12 transcription in glycerol-grown cells was unaffected in a deltamsn2deltamsn4 strain. Nevertheless, evidence was obtained that STRE-mediated transcription is the target of repression by low amounts of glucose. These data suggest that an as yet unidentified factor is involved in STRE-mediated transcriptional regulation of HSP12.

EWS/FLI mediates transcriptional repression via NKX2.2 during oncogenic transformation in Ewing's sarcoma.

Directory of Open Access Journals (Sweden)

Leah A Owen

2008-04-01

Full Text Available EWS/FLI is a master regulator of Ewing's sarcoma formation. Gene expression studies in A673 Ewing's sarcoma cells have demonstrated that EWS/FLI downregulates more genes than it upregulates, suggesting that EWS/FLI, and/or its targets, function as transcriptional repressors. One critical EWS/FLI target, NKX2.2, is a transcription factor that contains both transcriptional activation and transcriptional repression domains, raising the possibility that it mediates portions of the EWS/FLI transcriptional signature. We now report that microarray analysis demonstrated that the transcriptional profile of NKX2.2 consists solely of downregulated genes, and overlaps with the EWS/FLI downregulated signature, suggesting that NKX2.2 mediates oncogenic transformation via transcriptional repression. Structure-function analysis revealed that the DNA binding and repressor domains in NKX2.2 are required for oncogenesis in Ewing's sarcoma cells, while the transcriptional activation domain is completely dispensable. Furthermore, blockade of TLE or HDAC function, two protein families thought to mediate the repressive function of NKX2.2, inhibited the transformed phenotype and reversed the NKX2.2 transcriptional profile in Ewing's sarcoma cells. Whole genome localization studies (ChIP-chip revealed that a significant portion of the NKX2.2-repressed gene expression signature was directly mediated by NKX2.2 binding. These data demonstrate that the transcriptional repressive function of NKX2.2 is necessary, and sufficient, for the oncogenic phenotype of Ewing's sarcoma, and suggest a therapeutic approach to this disease.

Generation of a glucose de-repressed mutant of Trichoderma reesei using disparity mutagenesis.

Science.gov (United States)

Iwakuma, Hidekazu; Koyama, Yoshiyuki; Miyachi, Ayako; Nasukawa, Masashi; Matsumoto, Hitoshi; Yano, Shuntaro; Ogihara, Jun; Kasumi, Takafumi

2016-01-01

We obtained a novel glucose de-repressed mutant of Trichoderma reesei using disparity mutagenesis. A plasmid containing DNA polymerase δ lacking proofreading activity, and AMAI, an autonomously replicating sequence was introduced into T. reesei ATCC66589. The rate of mutation evaluated with 5-fluoroorotic acid resistance was approximately 30-fold higher than that obtained by UV irradiation. The transformants harboring incompetent DNA polymerase δ were then selected on 2-deoxyglucose agar plates with hygromycin B. The pNP-lactoside hydrolyzing activities of mutants were 2 to 5-fold higher than the parent in liquid medium containing glucose. Notably, the amino acid sequence of cre1, a key gene involved in glucose repression, was identical in the mutant and parent strains, and further, the cre1 expression levels was not abolished in the mutant. Taken together, these results demonstrate that the strains of T. reesei generated by disparity mutagenesis are glucose de-repressed variants that contain mutations in yet-unidentified factors other than cre1.

Stringent Expression Control of Pathogenic R-body Production in Legume Symbiont Azorhizobium caulinodans

Directory of Open Access Journals (Sweden)

Jun-ichi Matsuoka

2017-07-01

Full Text Available R bodies are insoluble large polymers consisting of small proteins encoded by reb genes and are coiled into cylindrical structures in bacterial cells. They were first discovered in Caedibacter species, which are obligate endosymbionts of paramecia. Caedibacter confers a killer trait on the host paramecia. R-body-producing symbionts are released from their host paramecia and kill symbiont-free paramecia after ingestion. The roles of R bodies have not been explained in bacteria other than Caedibacter. Azorhizobium caulinodans ORS571, a microsymbiont of the legume Sesbania rostrata, carries a reb operon containing four reb genes that are regulated by the repressor PraR. Herein, deletion of the praR gene resulted in R-body formation and death of host plant cells. The rebR gene in the reb operon encodes an activator. Three PraR binding sites and a RebR binding site are present in the promoter region of the reb operon. Expression analyses using strains with mutations within the PraR binding site and/or the RebR binding site revealed that PraR and RebR directly control the expression of the reb operon and that PraR dominantly represses reb expression. Furthermore, we found that the reb operon is highly expressed at low temperatures and that 2-oxoglutarate induces the expression of the reb operon by inhibiting PraR binding to the reb promoter. We conclude that R bodies are toxic not only in paramecium symbiosis but also in relationships between other bacteria and eukaryotic cells and that R-body formation is controlled by environmental factors.

Structural insights into RipC, a putative citrate lyase β subunit from a Yersinia pestis virulence operon

International Nuclear Information System (INIS)

Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.

2011-01-01

Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein

Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.

Science.gov (United States)

Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S

2006-03-01

Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

The base pairing RNA Spot 42 participates in a multi-output feedforward loop to help enact catabolite repression in Escherichia coli

Science.gov (United States)

Beisel, Chase L.; Storz, Gisela

2011-01-01

SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161

Repression of violence at public meetings and sporting events within the European legal space

Directory of Open Access Journals (Sweden)

Božović Milenko

2014-01-01

Full Text Available Violence and unbecoming behaviour at sporting events stand for a most acute problem in numerous European countries. However, the method and modes of its' repression have been determined within the frames of each country, that is its' national legislation. Thus, a wide range of various regulations referring to the distinctions of this type of violence can be spotted in legislative of each European country. Nevertheless, along with the development and maturing of the idea of the necessity of implementation of both international and regional legal instruments, used for setting up national law of individual states, a number of European legal instruments have also come to life. It comes as no surprise, though, the growing need for more both general and separate legal instruments in the repression of violence and unbecoming behaviour at sporting events in the European legislative. Based on the analysis, it is possible to single out the ones to achieve the strongest effect to our national legislative. Consequently, the general frames of the repression of violence and unbecoming behaviour at sporting events are founded on European Convention on Human Rights and Fundamental Freedoms (1950, whereas the separated ones lie in the Convention of the European Council on the Repression of Violence and Unbecoming Behaviour at Sporting Events, especially the soccer games, with the Recommendation (1985. The subject of this paper is based on analysis of the legal frames established by the European legal instruments in the field of the repression of violence and unbecoming behaviour at sporting events. The methodological framework throughout the research considers the usage of various methods: historical, linguistic, sociological, logical, normative, analysis of content, etc.

An Alternative Transcript of the FOG-2 Gene Encodes a FOG-2 Isoform lacking the FOG Repression Motif

OpenAIRE

Dale, Rodney M.; Remo, Benjamin F.; Svensson, Eric C.

2007-01-01

The FOG family of transcriptional co-factors is composed of two members in mammals: FOG-1 and FOG-2. Both have been shown to bind to GATA factors and function as transcriptional co-repressors in specific cell and promoter contexts. We have previously defined a novel repression domain localized to the N-terminus of each FOG family member, the FOG Repression Motif, which is necessary for FOG-mediated transcriptional repression. In this report, we describe the identification and characterization...

Inter-genomic displacement via lateral gene transfer of bacterial trp operons in an overall context of vertical genealogy

Directory of Open Access Journals (Sweden)

Keyhani Nemat O

2004-06-01

Full Text Available Abstract Background The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis. Results In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely or specialized metabolism (more frequently. Conclusions (i Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer. (ii The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered

Polycomb repressive complex 2 regulates MiR-200b in retinal endothelial cells: potential relevance in diabetic retinopathy.

Directory of Open Access Journals (Sweden)

Michael Anthony Ruiz

Full Text Available Glucose-induced augmented vascular endothelial growth factor (VEGF production is a key event in diabetic retinopathy. We have previously demonstrated that downregulation of miR-200b increases VEGF, mediating structural and functional changes in the retina in diabetes. However, mechanisms regulating miR-200b in diabetes are not known. Histone methyltransferase complex, Polycomb Repressive Complex 2 (PRC2, has been shown to repress miRNAs in neoplastic process. We hypothesized that, in diabetes, PRC2 represses miR-200b through its histone H3 lysine-27 trimethylation mark. We show that human retinal microvascular endothelial cells exposed to high levels of glucose regulate miR-200b repression through histone methylation and that inhibition of PRC2 increases miR-200b while reducing VEGF. Furthermore, retinal tissue from animal models of diabetes showed increased expression of major PRC2 components, demonstrating in vivo relevance. This research established a repressive relationship between PRC2 and miR-200b, providing evidence of a novel mechanism of miRNA regulation through histone methylation.

High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

Science.gov (United States)

Berendsen, Erwin M.; Koning, Rosella A.; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P.; Wells-Bennik, Marjon H. J.

2016-01-01

Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA2mob, present on a Tn1546 transposon in Bacillus subtilis, leads to profoundly increased wet heat resistance of B. subtilis spores. Such Tn1546 transposon elements including the spoVA2mob operon were also found in several strains of Bacillus amyloliquefaciens and Bacillus licheniformis, and these strains were shown to produce spores with significantly higher resistances to wet heat than their counterparts lacking this transposon. In this study, the locations and compositions of Tn1546 transposons encompassing the spoVA2mob operons in B. amyloliquefaciens and B. licheniformis were analyzed. Introduction of these spoVA2mob operons into B. subtilis 168 (producing spores that are not highly heat resistant) rendered mutant 168 strains that produced high-level heat resistant spores, demonstrating that these elements in B. amyloliquefaciens and B. licheniformis are responsible for high level heat resistance of spores. Assessment of growth of the nine strains of each species between 5.2°C and 57.7°C showed some differences between strains, especially at lower temperatures, but all strains were able to grow at 57.7°C. Strains of B. amyloliquefaciens and B. licheniformis that contain the Tn1546 elements (and produce high-level heat resistant spores) grew at temperatures similar to those of their Tn1546-negative counterparts that produce low-level heat resistant spores. The findings presented in this study allow for detection of B. amyloliquefaciens and B. licheniformis strains that produce highly heat resistant spores in the food chain. PMID:27994575

Chromosomal insertion of the entire Escherichia coli lactose operon, into two strains of Pseudomonas, using a modified mini-Tn5 delivery system

DEFF Research Database (Denmark)

Hansen, L. H.; Sørensen, S. J.; Jensen, Lars Bogø

1997-01-01

A 12-kb PstI fragment including the entire E. coli lactose operon (lacIPOZYA) was inserted in one copy into the chromosome of Pseudomonas putida, Pseudomonas fluorescens and an E. coli strain with lac(-) phenotype. This was made possible by improvements of an already existing mini-Tn5 transposon...... flanked by NotI sites needed in the mini-Tn5 delivery system; (b) the generation of E. coli nonlysogenic strains expressing the pi protein thus being capable of maintaining and delivering R6K-based mini-Tn5 vectors to other E. coli strains; (c) the successful insertion of the E. coli lactose operon...... into the P. fluorescens chromosome giving P. fluorescens the ability to grow on lactose; (d) evidence from Southern blotting that contradicts the assumption that the mini-Tn5 delivery system always creates one-copy inserts. These improvements allow insertion of large DNA fragments encoding highly expressed...

Repression of meiotic genes by antisense transcription and by Fkh2 transcription factor in Schizosaccharomyces pombe.

Science.gov (United States)

Chen, Huei-Mei; Rosebrock, Adam P; Khan, Sohail R; Futcher, Bruce; Leatherwood, Janet K

2012-01-01

In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s) of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the "unspliced" signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression.

Oxygen sensitivity of the nifLA promoter of Klebsiella pneumoniae.

OpenAIRE

Kong, Q T; Wu, Q L; Ma, Z F; Shen, S C

1986-01-01

Oxygen sensitivity of the nifLA promoter of Klebsiella pneumoniae has been demonstrated. Studies on the oxygen regulation of nifB-lacZ and nifH-lacZ fusions in the presence of the nifLA operon, which contains either an intact or a deleted nifL gene, indicate that possibly both the nifL promoter and the nifL product are responsible for nif repression by oxygen.

Hypothesis Formation and Qualitative Reasoning in Molecular Biology

Science.gov (United States)

1989-06-01

Dr. Fumio Imamoto (a former coworkcr of Professor Yanofsky), Dr. Stanley Artz (who worked on the histidine operon), Drs. Robert Landick and Gerard...increase was not predicted by the tradi- tional repression theory. At this point, the paths diverged. Kasai postulated the existence of a protein that...his operator is downstream of the promoter, Kasai concluded that this mutation deleted a barrier to transcription elongation, which he called the

Dynamic in vivo mutations within the ica operon during persistence of Staphylococcus aureus in the airways of cystic fibrosis patients.

Directory of Open Access Journals (Sweden)

Bianca Schwartbeck

2016-11-01

Full Text Available Cystic fibrosis (CF is associated with chronic bacterial airway infections leading to lung insufficiency and decreased life expectancy. Staphylococcus aureus is one of the most prevalent pathogens isolated from the airways of CF patients. Mucoid colony morphology has been described for Pseudomonas aeruginosa, the most common pathogen in CF, but not for S. aureus. From the airways of 8 of 313 CF patients (2.5% mucoid S. aureus isolates (n = 115 were cultured with a mean persistence of 29 months (range 1 month, 126 months. In contrast to non-mucoid S. aureus, mucoid isolates were strong biofilm formers. The upstream region of the ica operon, which encodes the proteins responsible for the synthesis of the polysaccharide intercellular adhesin (PIA, of mucoid isolates was sequenced. Spa-types of mucoid and non-mucoid strains were identical, but differed between patients. Mucoid isolates carried a 5 bp deletion in the intergenic region between icaR and icaA. During long-term persistence, from two patients subsequent non-mucoid isolates (n = 12 with 5 bp deletions were cultured, which did not produce biofilm. Sequencing of the entire ica operon identified compensatory mutations in various ica-genes including icaA (n = 7, icaD (n = 3 and icaC (n = 2. Six sequential isolates of each of these two patients with non-mucoid and mucoid phenotypes were subjected to whole genome sequencing revealing a very close relationship of the individual patient's isolates. Transformation of strains with vectors expressing the respective wild-type genes restored mucoidy. In contrast to the non-mucoid phenotype, mucoid strains were protected against neutrophilic killing and survived better under starvation conditions. In conclusion, the special conditions present in CF airways seem to facilitate ongoing mutations in the ica operon during S. aureus persistence.

Reconstruction and logical modeling of glucose repression signaling pathways in Saccharomyces cerevisiae

Directory of Open Access Journals (Sweden)

Oliveira Ana

2009-01-01

Full Text Available Abstract Background In the yeast Saccharomyces cerevisiae, the presence of high levels of glucose leads to an array of down-regulatory effects known as glucose repression. This process is complex due to the presence of feedback loops and crosstalk between different pathways, complicating the use of intuitive approaches to analyze the system. Results We established a logical model of yeast glucose repression, formalized as a hypergraph. The model was constructed based on verified regulatory interactions and it includes 50 gene transcripts, 22 proteins, 5 metabolites and 118 hyperedges. We computed the logical steady states of all nodes in the network in order to simulate wildtype and deletion mutant responses to different sugar availabilities. Evaluation of the model predictive power was achieved by comparing changes in the logical state of gene nodes with transcriptome data. Overall, we observed 71% true predictions, and analyzed sources of errors and discrepancies for the remaining. Conclusion Though the binary nature of logical (Boolean models entails inherent limitations, our model constitutes a primary tool for storing regulatory knowledge, searching for incoherencies in hypotheses and evaluating the effect of deleting regulatory elements involved in glucose repression.

Inhibition of tumor cell growth by Sigma1 ligand mediated translational repression

International Nuclear Information System (INIS)

Kim, Felix J.; Schrock, Joel M.; Spino, Christina M.; Marino, Jacqueline C.; Pasternak, Gavril W.

2012-01-01

Highlights: ► Sigma1 ligand treatment mediates decrease in tumor cell mass. ► Identification of a Sigma1 ligand with reversible translational repressor actions. ► Demonstration of a role for Sigma1 in cellular protein synthesis. -- Abstract: Treatment with sigma1 receptor (Sigma1) ligands can inhibit cell proliferation in vitro and tumor growth in vivo. However, the cellular pathways engaged in response to Sigma1 ligand treatment that contribute to these outcomes remain largely undefined. Here, we show that treatment with putative antagonists of Sigma1 decreases cell mass. This effect corresponds with repressed cap-dependent translation initiation in multiple breast and prostate cancer cell lines. Sigma1 antagonist treatment suppresses phosphorylation of translational regulator proteins p70S6K, S6, and 4E-BP1. RNAi-mediated knockdown of Sigma1 also results in translational repression, consistent with the effects of antagonist treatment. Sigma1 antagonist mediated translational repression and decreased cell size are both reversible. Together, these data reveal a role for Sigma1 in tumor cell protein synthesis, and demonstrate that small molecule Sigma1 ligands can be used as modulators of protein translation.

The Perils of Repressive Tolerance in Music Education Curriculum

Science.gov (United States)

Perrine, William M.

2017-01-01

In recent years, philosophers of music education have called for a greater degree of political engagement by music education practitioners. Using Marcuse's discussion of "repressive tolerance" as a conceptual framework, I argue that a politicized curriculum in music education works against the liberal ideas of free speech and a free…

Global transcriptional repression in C. elegans germline precursors by regulated sequestration of TFIID component TAF-4

Science.gov (United States)

Guven-Ozkan, Tugba; Nishi, Yuichi; Robertson, Scott M.; Lin, Rueyling

2008-01-01

In C. elegans, four asymmetric divisions, beginning with the zygote (P0), generate transcriptionally repressed germline blastomeres (P1–P4) and somatic sisters that become transcriptionally active. The protein PIE-1 represses transcription in the later germline blastomeres, but not in the earlier germline blastomeres P0 and P1. We show here that OMA-1 and OMA-2, previously shown to regulate oocyte maturation, repress transcription in P0 and P1 by binding to and sequestering in the cytoplasm TAF-4, a component critical for assembly of TFIID and the pol II preinitiation complex. OMA-1/2 binding to TAF-4 is developmentally regulated, requiring phosphorylation by the DYRK kinase MBK-2, which is activated at meiosis II following fertilization. OMA-1/2 are normally degraded after the first mitosis, but ectopic expression of wildtype OMA-1 is sufficient to repress transcription in both somatic and later germline blastomeres. We propose that phosphorylation by MBK-2 serves as a developmental switch, converting OMA-1/2 from oocyte to embryo regulators. PMID:18854162

X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

Science.gov (United States)

Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

2000-01-01

A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the gln

The flagellar master operon flhDC is a pleiotropic regulator involved in motility and virulence of the fish pathogen Yersinia ruckeri

Science.gov (United States)

Aims: To investigate the function of the master flagellar operon flhDC in the fish pathogen Yersinia ruckeri and compare the effect of flhD mutation to a naturally occurring mutation causing loss-of-motility in emergent biotype 2 (BT2) strains. Methods and Results: In this study isogenic Y. ruckeri ...

Deregulation of purine pathway in Bacillus subtilis and its use in riboflavin biosynthesis

Science.gov (United States)

2014-01-01

Background Purine nucleotides are essential metabolites for living organisms because they are involved in many important processes, such as nucleic acid synthesis, energy supply, and biosynthesis of several amino acids and riboflavin. Owing to the pivotal roles of purines in cell physiology, the pool of intracellular purine nucleotides must be maintained under strict control, and hence the de novo purine biosynthetic pathway is tightly regulated by transcription repression and inhibition mechanism. Deregulation of purine pathway is essential for this pathway engineering in Bacillus subtilis. Results Deregulation of purine pathway was attempted to improve purine nucleotides supply, based on a riboflavin producer B. subtilis strain with modification of its rib operon. To eliminate transcription repression, the pur operon repressor PurR and the 5’-UTR of pur operon containing a guanine-sensing riboswitch were disrupted. Quantitative RT-PCR analysis revealed that the relative transcription levels of purine genes were up-regulated about 380 times. Furthermore, site-directed mutagenesis was successfully introduced into PRPP amidotransferase (encoded by purF) to remove feedback inhibition by homologous alignment and analysis. Overexpression of the novel mutant PurF (D293V, K316Q and S400W) significantly increased PRPP amidotransferase activity and triggered a strong refractory effect on purine nucleotides mediated inhibition. Intracellular metabolite target analysis indicated that the purine nucleotides supply in engineered strains was facilitated by a stepwise gene-targeted deregulation. With these genetic manipulations, we managed to enhance the metabolic flow through purine pathway and consequently increased riboflavin production 3-fold (826.52 mg/L) in the purF-VQW mutant strain. Conclusions A sequential optimization strategy was applied to deregulate the rib operon and purine pathway of B. subtilis to create genetic diversities and to improve riboflavin production

SOS-like induction in Bacillus subtilis: induction of the RecA protein analog and a damage-inducible operon by DNA damage in Rec+ and DNA repair-deficient strains

International Nuclear Information System (INIS)

Lovett, C.M. Jr.; Love, P.E.; Yasbin, R.E.; Roberts, J.W.

1988-01-01

We quantitated the induction of the Bacillus subtilis Rec protein (the analog of Escherichia coli RecA protein) and the B. subtilis din-22 operon (representative of a set of DNA damage-inducible operons in B. subtilis) following DNA damage in Rec+ and DNA repair-deficient strains. After exposure to mitomycin C or UV irradiation, each of four distinct rec (recA1, recB2, recE4, and recM13) mutations reduced to the same extent the rates of both Rec protein induction (determined by densitometric scanning of immunoblot transfers) and din-22 operon induction (determined by assaying beta-galactosidase activity in din-22::Tn917-lacZ fusion strains). The induction deficiencies in recA1 and recE4 strains were partially complemented by the E. coli RecA protein, which was expressed on a plasmid in B. subtilis; the E. coli RecA protein had no effect on either induction event in Rec+, recB2, or recM13 strains. These results suggest that (i) the expression of both the B. subtilis Rec protein and the din-22 operon share a common regulatory component, (ii) the recA1 and recE4 mutations affect the regulation and/or activity of the B. subtilis Rec protein, and (iii) an SOS regulatory system like the E. coli system is highly conserved in B. subtilis. We also showed that the basal level of B. subtilis Rec protein is about 4,500 molecules per cell and that maximum induction by DNA damage causes an approximately fivefold increase in the rate of Rec protein accumulation

Stability of XIST repression in relation to genomic imprinting following global genome demethylation in a human cell line

International Nuclear Information System (INIS)

Araújo, E.S.S. de; Vasques, L.R.; Stabellini, R.; Krepischi, A.C.V.; Pereira, L.V.

2014-01-01

DNA methylation is essential in X chromosome inactivation and genomic imprinting, maintaining repression of XIST in the active X chromosome and monoallelic repression of imprinted genes. Disruption of the DNA methyltransferase genes DNMT1 and DNMT3B in the HCT116 cell line (DKO cells) leads to global DNA hypomethylation and biallelic expression of the imprinted gene IGF2 but does not lead to reactivation of XIST expression, suggesting that XIST repression is due to a more stable epigenetic mark than imprinting. To test this hypothesis, we induced acute hypomethylation in HCT116 cells by 5-aza-2′-deoxycytidine (5-aza-CdR) treatment (HCT116-5-aza-CdR) and compared that to DKO cells, evaluating DNA methylation by microarray and monitoring the expression of XIST and imprinted genes IGF2, H19, and PEG10. Whereas imprinted genes showed biallelic expression in HCT116-5-aza-CdR and DKO cells, the XIST locus was hypomethylated and weakly expressed only under acute hypomethylation conditions, indicating the importance of XIST repression in the active X to cell survival. Given that DNMT3A is the only active DNMT in DKO cells, it may be responsible for ensuring the repression of XIST in those cells. Taken together, our data suggest that XIST repression is more tightly controlled than genomic imprinting and, at least in part, is due to DNMT3A

Stability of XIST repression in relation to genomic imprinting following global genome demethylation in a human cell line

Energy Technology Data Exchange (ETDEWEB)

Araújo, E.S.S. de [Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Centro Internacional de Pesquisa, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Vasques, L.R. [Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Stabellini, R.; Krepischi, A.C.V. [Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Centro Internacional de Pesquisa, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Pereira, L.V. [Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil)

2014-10-17

DNA methylation is essential in X chromosome inactivation and genomic imprinting, maintaining repression of XIST in the active X chromosome and monoallelic repression of imprinted genes. Disruption of the DNA methyltransferase genes DNMT1 and DNMT3B in the HCT116 cell line (DKO cells) leads to global DNA hypomethylation and biallelic expression of the imprinted gene IGF2 but does not lead to reactivation of XIST expression, suggesting that XIST repression is due to a more stable epigenetic mark than imprinting. To test this hypothesis, we induced acute hypomethylation in HCT116 cells by 5-aza-2′-deoxycytidine (5-aza-CdR) treatment (HCT116-5-aza-CdR) and compared that to DKO cells, evaluating DNA methylation by microarray and monitoring the expression of XIST and imprinted genes IGF2, H19, and PEG10. Whereas imprinted genes showed biallelic expression in HCT116-5-aza-CdR and DKO cells, the XIST locus was hypomethylated and weakly expressed only under acute hypomethylation conditions, indicating the importance of XIST repression in the active X to cell survival. Given that DNMT3A is the only active DNMT in DKO cells, it may be responsible for ensuring the repression of XIST in those cells. Taken together, our data suggest that XIST repression is more tightly controlled than genomic imprinting and, at least in part, is due to DNMT3A.

Determinants of RNA binding and translational repression by the Bicaudal-C regulatory protein.

Science.gov (United States)

Zhang, Yan; Park, Sookhee; Blaser, Susanne; Sheets, Michael D

2014-03-14

Bicaudal-C (Bic-C) RNA binding proteins function as important translational repressors in multiple biological contexts within metazoans. However, their RNA binding sites are unknown. We recently demonstrated that Bic-C functions in spatially regulated translational repression of the xCR1 mRNA during Xenopus development. This repression contributes to normal development by confining the xCR1 protein, a regulator of key signaling pathways, to specific cells of the embryo. In this report, we combined biochemical approaches with in vivo mRNA reporter assays to define the minimal Bic-C target site within the xCR1 mRNA. This 32-nucleotide Bic-C target site is predicted to fold into a stem-loop secondary structure. Mutational analyses provided evidence that this stem-loop structure is important for Bic-C binding. The Bic-C target site was sufficient for Bic-C mediated repression in vivo. Thus, we describe the first RNA binding site for a Bic-C protein. This identification provides an important step toward understanding the mechanisms by which evolutionarily conserved Bic-C proteins control cellular function in metazoans.

Repression of Meiotic Genes by Antisense Transcription and by Fkh2 Transcription Factor in Schizosaccharomyces pombe

Science.gov (United States)

Chen, Huei-Mei; Rosebrock, Adam P.; Khan, Sohail R.; Futcher, Bruce; Leatherwood, Janet K.

2012-01-01

In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s) of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the “unspliced” signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression. PMID:22238674

Repression of meiotic genes by antisense transcription and by Fkh2 transcription factor in Schizosaccharomyces pombe.

Directory of Open Access Journals (Sweden)

Huei-Mei Chen

Full Text Available In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the "unspliced" signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression.

Repression of death consciousness and the psychedelic trip

Directory of Open Access Journals (Sweden)

Varsha Dutta

2012-01-01

Full Text Available Death is our most repressed consciousness, it inheres our condition as the primordial fear. Perhaps it was necessary that this angst be repressed in man or he would be hurled against the dark forces of nature. Modern ethos was built on this edifice, where the ′denial of death′ while ′embracing one′s symbolic immortality′ would be worshipped, so this ideology simply overturned and repressed looking into the morass of the inevitable when it finally announced itself. Once this slowly pieced its way into all of life, ′death′ would soon become a terminology in medicine too and assert its position, by giving a push to those directly dealing with the dying to shy away from its emotional and spiritual affliction. The need to put off death and prolong one′s life would become ever more urgent. Research using psychedelics on the terminally ill which had begun in the 1950s and 1960s would coerce into another realm and alter the face of medicine; but the aggression with which it forced itself in the 1960s would soon be politically maimed, and what remained would be sporadic outpours that trickled its way from European labs and underground boot camps. Now, with the curtain rising, the question has etched itself again, about the use of psychedelic drugs in medicine, particularly psychedelic psychotherapy with the terminally ill. This study is an attempt to philosophically explore death anxiety from its existential context and how something that is innate in our condition cannot be therapeutically cured. Psychedelic use was immutably linked with ancient cultures and only recently has it seen its scientific revival, from which a scientific culture grew around psychedelic therapy. How much of what was threaded in the ritual and spiritual mores can be extricated and be interpreted in our own mechanized language of medicine is the question that nudges many.

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Cellular components required for mutagenesis

International Nuclear Information System (INIS)

Elledge, S.J.; Perry, K.L.; Krueger, J.H.; Mitchell, B.B.; Walker, G.C.

1983-01-01

We have cloned the umuD and umuC genes of Escherichia coli and have shown that they code for two proteins of 16,000 and 45,000 daltons respectively; the two genes are organized in an operon that is repressed by the LexA protein. Similarly, we have shown that the mucA and mucB genes of the mutagenesis-enhancing plasmid pKM101 code for proteins of 16,000 and 45,000 daltons respectively and, like umuD/C, the genes are organized in an operon. Preliminary sequencing studies have indicated that the umuD/C and mucA/B loci are approximately 50% homologous at both the nucleic acid and deduced protein sequence levels and that the umuD gene is preceeded by two putative LexA binding sites separated by 4 basepairs. Like umuD/C, the mucA/B genes of pKM101 are induced by DNA damage and are repressed by LexA. In addition to inducing recA + lexA + -regulated din genes, DNA damaging agents such as uv and nalidixic acid also induce the heat shock proteins GroEL and DnaK in an htpR-dependent fashion. 22 references, 1 figure, 1 table

The transcription factor Mlc promotes Vibrio cholerae biofilm formation through repression of phosphotransferase system components.

Science.gov (United States)

Pickering, Bradley S; Lopilato, Jane E; Smith, Daniel R; Watnick, Paula I

2014-07-01

The phosphoenol phosphotransferase system (PTS) is a multicomponent signal transduction cascade that regulates diverse aspects of bacterial cellular physiology in response to the availability of high-energy sugars in the environment. Many PTS components are repressed at the transcriptional level when the substrates they transport are not available. In Escherichia coli, the transcription factor Mlc (for makes large colonies) represses transcription of the genes encoding enzyme I (EI), histidine protein (HPr), and the glucose-specific enzyme IIBC (EIIBC(Glc)) in defined media that lack PTS substrates. When glucose is present, the unphosphorylated form of EIIBC(Glc) sequesters Mlc to the cell membrane, preventing its interaction with DNA. Very little is known about Vibrio cholerae Mlc. We found that V. cholerae Mlc activates biofilm formation in LB broth but not in defined medium supplemented with either pyruvate or glucose. Therefore, we questioned whether V. cholerae Mlc functions differently than E. coli Mlc. Here we have shown that, like E. coli Mlc, V. cholerae Mlc represses transcription of PTS components in both defined medium and LB broth and that E. coli Mlc is able to rescue the biofilm defect of a V. cholerae Δmlc mutant. Furthermore, we provide evidence that Mlc indirectly activates transcription of the vps genes by repressing expression of EI. Because activation of the vps genes by Mlc occurs under only a subset of the conditions in which repression of PTS components is observed, we conclude that additional inputs present in LB broth are required for activation of vps gene transcription by Mlc. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

From sensorimotor inhibition to Freudian repression: insights from psychosis applied to neurosis

Directory of Open Access Journals (Sweden)

Ariane eBazan

2012-11-01

Full Text Available First, three case studies are presented of psychotic patients having in common an inability to hold something down or out. In line with other theories on psychosis, we propose that a key change is at the efference copy system. Going back to Freud’s mental apparatus, we propose that the messages of discharge of the motor neurones, mobilised to direct perception, also called indications of reality, are equivalent to the modern efference copies. With this key, the reading of the cases is coherent with the psychodynamic understanding of psychosis, being a downplay of secondary processes, and consequently, a dominance of primary processes. Moreover, putting together the sensorimotor idea of a failure of efference copy-mediated inhibition with the psychoanalytic idea of a failing repression in psychosis, the hypothesis emerges that the attenuation enabled by the efference copy dynamics is, in some instances, the physiological instantiation of repression. Second, we applied this idea to the mental organisation in neurosis. Indeed, the efference copy-mediated attenuation is thought to be the mechanism through which sustained activation of an intention, without reaching it – i.e. inhibition of an action – gives rise to mental imagery. Therefore, as inhibition is needed for any targeted action or for normal language understanding, acting in the world or processing language structurally induces mental imagery, constituting a subjective unconscious mental reality. Repression is a special instance of inhibition for emotionally threatening stimuli. These stimuli require stronger inhibition, leaving (the attenuation of the motor intentions totally unanswered, in order to radically prevent execution which would lead to development of excess affect. This inhibition, then, yields a specific type of motor imagery, called phantoms, which induce mental preoccupation, as well as symptoms which, especially through their form, refer to the repressed motor

Acetate Repression of Methane Oxidation by Supplemental Methylocella silvestris in a Peat Soil Microcosm ▿ †

Science.gov (United States)

Rahman, M. Tanvir; Crombie, Andrew; Moussard, Hélène; Chen, Yin; Murrell, J. Colin

2011-01-01

Methylocella spp. are facultative methanotrophs that grow on methane and multicarbon substrates, such as acetate. Acetate represses transcription of methane monooxygenase of Methylocella silvestris in laboratory culture. DNA stable-isotope probing (DNA-SIP) using 13C-methane and 12C-acetate, carried out with Methylocella-spiked peat soil, showed that acetate also repressed methane oxidation by Methylocella in environmental samples. PMID:21515721

Acetate Repression of Methane Oxidation by Supplemental Methylocella silvestris in a Peat Soil Microcosm ▿ †

OpenAIRE

Rahman, M. Tanvir; Crombie, Andrew; Moussard, Hélène; Chen, Yin; Murrell, J. Colin

2011-01-01

Methylocella spp. are facultative methanotrophs that grow on methane and multicarbon substrates, such as acetate. Acetate represses transcription of methane monooxygenase of Methylocella silvestris in laboratory culture. DNA stable-isotope probing (DNA-SIP) using 13C-methane and 12C-acetate, carried out with Methylocella-spiked peat soil, showed that acetate also repressed methane oxidation by Methylocella in environmental samples.

Participation of the arcRACME protein in self-activation of the arc operon located in the arginine catabolism mobile element in pandemic clone USA300.

Science.gov (United States)

Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier

2017-07-01

Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.

THE CALVIN CYCLE ENZYME PHOSPHOGLYCERATE KINASE OF XANTHOBACTER-FLAVUS REQUIRED FOR AUTOTROPHIC CO2 FIXATION IS NOT ENCODED BY THE CBB OPERON

NARCIS (Netherlands)

MEIJER, WG

1994-01-01

During autotrophic growth of Xanthobacter flavus, energy derived from the oxidation of hydrogen methanol or formate is used to drive the assimilation of CO2 via the Calvin cycle. The genes encoding the Calvin cycle enzymes are organized in the cbb operon, which is expressed only during autotrophic

Regulation of the cellulolytic system in Trichoderma reesei by sophorose: induction of cellulase and repression of beta-glucosidase.

OpenAIRE

Sternberg, D; Mandels, G R

1980-01-01

Sophorose has two regulatory roles in the production of cellulase enzymes in Trichoderma reesei: beta-glucosidase repression and cellulase induction. Sophorose also is hydrolyzed by the mycelial-associated beta-glucosidase. Repression of beta-glucosidase reduces sophorose hydrolysis and thus may increase cellulase induction.

Repression of both isoforms of disproportionating enzyme leads to higher malto-oligosaccharide content and reduced growth in potato

DEFF Research Database (Denmark)

Mogensen, Henrik Lütken; Lloyd, James Richard; Glaring, Mikkel A.

2010-01-01

Two glucanotransferases, disproportionating enzyme 1 (StDPE1) and disproportionating enzyme 2 (StDPE2), were repressed using RNA interference technology in potato, leading to plants repressed in either isoform individually, or both simultaneously. This is the first detailed report of their combin...

EseE of Edwardsiella tarda Augments Secretion of Translocon Protein EseC and Expression of the escC-eseE Operon.

Science.gov (United States)

Yi, Jia; Xiao, Shui Bing; Zeng, Zhi Xiong; Lu, Jin Fang; Liu, Lu Yi; Laghari, Zubair Ahmed; Nie, Pin; Yu, Hong Bing; Xie, Hai Xia

2016-08-01

Edwardsiella tarda is an important Gram-negative pathogen that employs a type III secretion system (T3SS) to deliver effectors into host cells to facilitate bacterial survival and replication. These effectors are translocated into host cells through a translocon complex composed of three secreted proteins, namely, EseB, EseC, and EseD. The secretion of EseB and EseD requires a chaperone protein called EscC, whereas the secretion of EseC requires the chaperone EscA. In this study, we identified a novel protein (EseE) that also regulates the secretion of EseC. An eseE deletion mutant secreted much less EseC into supernatants, accompanied by increased EseC levels within bacterial cells. We also demonstrated that EseE interacted directly with EseC in a pulldown assay. Interestingly, EseC, EseE, and EscA were able to form a ternary complex, as revealed by pulldown and gel filtration assays. Of particular importance, the deletion of eseE resulted in decreased levels of EseB and EseD proteins in both the bacterial pellet and supernatant fraction. Furthermore, real-time PCR assays showed that EseE positively regulated the transcription of the translocon operon escC-eseE, comprising escC, eseB, escA, eseC, eseD, and eseE These effects of EseE on the translocon components/operon appeared to have a functional consequence, since the ΔeseE strain was outcompeted by wild-type E. tarda in a mixed infection in blue gourami fish. Collectively, our results demonstrate that EseE not only functions as a chaperone for EseC but also acts as a positive regulator controlling the expression of the translocon operon escC-eseE, thus contributing to the pathogenesis of E. tarda in fish. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Analysis of gene order data supports vertical inheritance of the leukotoxin operon and genome rearrangements in the 5' flanking region in genus Mannheimia

DEFF Research Database (Denmark)

Larsen, Jesper; Kuhnert, Peter; Frey, Joachim

2007-01-01

subclades, thus reaffirming the hypothesis of vertical inheritance of the leukotoxin operon. The presence of individual 5' flanking regions in M. haemolytica + M. glucosida and M. granulomatis reflects later genome rearrangements within each subclade. The evolution of the novel 5' flanking region in M...

Nonencapsulated or nontypeable Haemophilus influenzae are more likely than their encapsulated or serotypeable counterparts to have mutations in their fucose operon.

Science.gov (United States)

Shuel, Michelle L; Karlowsky, Kathleen E; Law, Dennis K S; Tsang, Raymond S W

2011-12-01

Population biology of Haemophilus influenzae can be studied by multilocus sequence typing (MLST), and isolates are assigned sequence types (STs) based on nucleotide sequence variations in seven housekeeping genes, including fucK. However, the ST cannot be assigned if one of the housekeeping genes is absent or cannot be detected by the current protocol. Occasionally, strains of H. influenzae have been reported to lack the fucK gene. In this study, we examined the prevalence of this mutation among our collection of H. influenzae isolates. Of the 704 isolates studied, including 282 encapsulated and 422 nonencapsulated isolates, nine were not typeable by MLST owing to failure to detect the fucK gene. All nine fucK-negative isolates were nonencapsulated and belonged to various biotypes. DNA sequencing of the fucose operon region confirmed complete deletion of genes in the operon in seven of the nine isolates, while in the remaining two isolates, some of the genes were found intact or in parts. The significance of these findings is discussed.

EBNA3C Directs Recruitment of RBPJ (CBF1) to Chromatin during the Process of Gene Repression in EBV Infected B Cells.

Science.gov (United States)

Kalchschmidt, Jens S; Gillman, Adam C T; Paschos, Kostas; Bazot, Quentin; Kempkes, Bettina; Allday, Martin J

2016-01-01

It is well established that Epstein-Barr virus nuclear antigen 3C (EBNA3C) can act as a potent repressor of gene expression, but little is known about the sequence of events occurring during the repression process. To explore further the role of EBNA3C in gene repression-particularly in relation to histone modifications and cell factors involved-the three host genes previously reported as most robustly repressed by EBNA3C were investigated. COBLL1, a gene of unknown function, is regulated by EBNA3C alone and the two co-regulated disintegrin/metalloproteases, ADAM28 and ADAMDEC1 have been described previously as targets of both EBNA3A and EBNA3C. For the first time, EBNA3C was here shown to be the main regulator of all three genes early after infection of primary B cells. Using various EBV-recombinants, repression over orders of magnitude was seen only when EBNA3C was expressed. Unexpectedly, full repression was not achieved until 30 days after infection. This was accurately reproduced in established LCLs carrying EBV-recombinants conditional for EBNA3C function, demonstrating the utility of the conditional system to replicate events early after infection. Using this system, detailed chromatin immunoprecipitation analysis revealed that the initial repression was associated with loss of activation-associated histone modifications (H3K9ac, H3K27ac and H3K4me3) and was independent of recruitment of polycomb proteins and deposition of the repressive H3K27me3 modification, which were only observed later in repression. Most remarkable, and in contrast to current models of RBPJ in repression, was the observation that this DNA-binding factor accumulated at the EBNA3C-binding sites only when EBNA3C was functional. Transient reporter assays indicated that repression of these genes was dependent on the interaction between EBNA3C and RBPJ. This was confirmed with a novel EBV-recombinant encoding a mutant of EBNA3C unable to bind RBPJ, by showing this virus was incapable of

Estradiol represses Insulin-like 3 expression and promoter activity in MA-10 Leydig cells

International Nuclear Information System (INIS)

Lague, Eric; Tremblay, Jacques J.

2009-01-01

There are increasing evidence in the literature reporting the detrimental effects of endocrine disruptors on the development and function of the male reproductive system. One example is cryptorchidism, or undescended testis, caused by exposure to excessive estrogens. Estrogens, acting through the estrogen receptor α (ERα), have been shown to repress expression of the gene encoding insulin-like 3 (INSL3), a small peptide produced by testicular Leydig cells that is essential for normal testis descent. The molecular mechanism of estrogen/ER action on Insl3 expression, however, remains poorly understood. Here we report estradiol (E 2 ) represses Insl3 mRNA levels in MA-10 cells, a Leydig cell line model. We also found that E 2 represses the activity of the human and mouse Insl3 promoter in these cells. The E 2 -responsive region of the human INSL3 promoter was located to the proximal INSL3 promoter. This region does not contain a consensus estrogen response element indicating an indirect mechanism of action. In agreement with this, we found that E 2 -responsiveness was lost when two previously characterized binding sites for the nuclear receptors NUR77 and SF1 were mutated. Finally we show that the E 2 repressive effect could be overcome by cotreatment with testosterone, a positive regulator of Insl3 transcription. Collectively our data provide important new insights into the molecular mechanism of estrogen action in Insl3 transcription in Leydig cells

DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

DEFF Research Database (Denmark)

Mygind, T; Birkelund, Svend; Christiansen, Gunna

1998-01-01

To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...

Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.

Science.gov (United States)

Burbank, Lindsey P; Van Horn, Christopher R

2017-11-01

The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

Msx1 Homeodomain Protein Represses the αGSU and GnRH Receptor Genes During Gonadotrope Development

Science.gov (United States)

Xie, Huimin; Cherrington, Brian D.; Meadows, Jason D.; Witham, Emily A.

2013-01-01

Multiple homeodomain transcription factors are crucial for pituitary organogenesis and cellular differentiation. A homeodomain repressor, Msx1, is expressed from the ventral aspect of the developing anterior pituitary and implicated in gonadotrope differentiation. Here, we find that Msx1 represses transcription of lineage-specific pituitary genes such as the common α-glycoprotein subunit (αGSU) and GnRH receptor (GnRHR) promoters in the mouse gonadotrope-derived cell lines, αT3-1 and LβT2. Repression of the mouse GnRHR promoter by Msx1 is mediated through a consensus-binding motif in the downstream activin regulatory element (DARE). Truncation and mutation analyses of the human αGSU promoter map Msx1 repression to a site at −114, located at the junctional regulatory element (JRE). Dlx activators are closely related to the Msx repressors, acting through the same elements, and Dlx3 and Dlx2 act as transcriptional activators for GnRHR and αGSU, respectively. Small interfering RNA knockdown of Msx1 in αT3-1 cells increases endogenous αGSU and GnRHR mRNA expression. Msx1 gene expression reaches its maximal expression at the rostral edge at e13.5. The subsequent decline in Msx1 expression specifically coincides with the onset of expression of both αGSU and GnRHR. The expression levels of both αGSU and GnRHR in Msx1-null mice at e18.5 are higher compared with wild type, further confirming a role for Msx1 in the repression of αGSU and GnRHR. In summary, Msx1 functions as a negative regulator early in pituitary development by repressing the gonadotrope-specific αGSU and GnRHR genes, but a temporal decline in Msx1 expression alleviates this repression allowing induction of GnRHR and αGSU, thus serving to time the onset of gonadotrope-specific gene program. PMID:23371388

Msx1 homeodomain protein represses the αGSU and GnRH receptor genes during gonadotrope development.

Science.gov (United States)

Xie, Huimin; Cherrington, Brian D; Meadows, Jason D; Witham, Emily A; Mellon, Pamela L

2013-03-01

Multiple homeodomain transcription factors are crucial for pituitary organogenesis and cellular differentiation. A homeodomain repressor, Msx1, is expressed from the ventral aspect of the developing anterior pituitary and implicated in gonadotrope differentiation. Here, we find that Msx1 represses transcription of lineage-specific pituitary genes such as the common α-glycoprotein subunit (αGSU) and GnRH receptor (GnRHR) promoters in the mouse gonadotrope-derived cell lines, αT3-1 and LβT2. Repression of the mouse GnRHR promoter by Msx1 is mediated through a consensus-binding motif in the downstream activin regulatory element (DARE). Truncation and mutation analyses of the human αGSU promoter map Msx1 repression to a site at -114, located at the junctional regulatory element (JRE). Dlx activators are closely related to the Msx repressors, acting through the same elements, and Dlx3 and Dlx2 act as transcriptional activators for GnRHR and αGSU, respectively. Small interfering RNA knockdown of Msx1 in αT3-1 cells increases endogenous αGSU and GnRHR mRNA expression. Msx1 gene expression reaches its maximal expression at the rostral edge at e13.5. The subsequent decline in Msx1 expression specifically coincides with the onset of expression of both αGSU and GnRHR. The expression levels of both αGSU and GnRHR in Msx1-null mice at e18.5 are higher compared with wild type, further confirming a role for Msx1 in the repression of αGSU and GnRHR. In summary, Msx1 functions as a negative regulator early in pituitary development by repressing the gonadotrope-specific αGSU and GnRHR genes, but a temporal decline in Msx1 expression alleviates this repression allowing induction of GnRHR and αGSU, thus serving to time the onset of gonadotrope-specific gene program.

RNAi mediates post-transcriptional repression of gene expression in fission yeast Schizosaccharomyces pombe

International Nuclear Information System (INIS)

Smialowska, Agata; Djupedal, Ingela; Wang, Jingwen; Kylsten, Per; Swoboda, Peter; Ekwall, Karl

2014-01-01

Highlights: • Protein coding genes accumulate anti-sense sRNAs in fission yeast S. pombe. • RNAi represses protein-coding genes in S. pombe. • RNAi-mediated gene repression is post-transcriptional. - Abstract: RNA interference (RNAi) is a gene silencing mechanism conserved from fungi to mammals. Small interfering RNAs are products and mediators of the RNAi pathway and act as specificity factors in recruiting effector complexes. The Schizosaccharomyces pombe genome encodes one of each of the core RNAi proteins, Dicer, Argonaute and RNA-dependent RNA polymerase (dcr1, ago1, rdp1). Even though the function of RNAi in heterochromatin assembly in S. pombe is established, its role in controlling gene expression is elusive. Here, we report the identification of small RNAs mapped anti-sense to protein coding genes in fission yeast. We demonstrate that these genes are up-regulated at the protein level in RNAi mutants, while their mRNA levels are not significantly changed. We show that the repression by RNAi is not a result of heterochromatin formation. Thus, we conclude that RNAi is involved in post-transcriptional gene silencing in S. pombe

Functional improvement of dystrophic muscle by repression of utrophin: let-7c interaction.

Directory of Open Access Journals (Sweden)

Manoj K Mishra

Full Text Available Duchenne muscular dystrophy (DMD is a fatal genetic disease caused by an absence of the 427kD muscle-specific dystrophin isoform. Utrophin is the autosomal homolog of dystrophin and when overexpressed, can compensate for the absence of dystrophin and rescue the dystrophic phenotype of the mdx mouse model of DMD. Utrophin is subject to miRNA mediated repression by several miRNAs including let-7c. Inhibition of utrophin: let-7c interaction is predicted to 'repress the repression' and increase utrophin expression. We developed and tested the ability of an oligonucleotide, composed of 2'-O-methyl modified bases on a phosphorothioate backbone, to anneal to the utrophin 3'UTR and prevent let-7c miRNA binding, thereby upregulating utrophin expression and improving the dystrophic phenotype in vivo. Suppression of utrophin: let-7c interaction using bi-weekly intraperitoneal injections of let7 site blocking oligonucleotides (SBOs for 1 month in the mdx mouse model for DMD, led to increased utrophin expression along with improved muscle histology, decreased fibrosis and increased specific force. The functional improvement of dystrophic muscle achieved using let7-SBOs suggests a novel utrophin upregulation-based therapeutic strategy for DMD.

I-mfa domain proteins specifically interact with HTLV-1 Tax and repress its transactivating functions

International Nuclear Information System (INIS)

Kusano, Shuichi; Yoshimitsu, Makoto; Hachiman, Miho; Ikeda, Masanori

2015-01-01

The I-mfa domain proteins HIC (also known as MDFIC) and I-mfa (also known as MDFI) are candidate tumor suppressor genes that are involved in cellular and viral transcriptional regulation. Here, we show that HIC and I-mfa directly interact with human T-cell leukemia virus type-1 (HTLV-1) Tax protein in vitro. In addition, HIC and I-mfa repress Tax-dependent transactivation of an HTLV-1 long terminal repeat (LTR) reporter construct in COS-1, Jurkat and high-Tax-producing HTLV-1-infected T cells. HIC also interacts with Tax through its I-mfa domain in vivo and represses Tax-dependent transactivation of HTLV-1 LTR and NF-κB reporter constructs in an interaction-dependent manner. Furthermore, we show that HIC decreases the nuclear distribution and stimulates the proteasomal degradation of Tax. These data reveal that HIC specifically interacts with HTLV-1 Tax and negatively regulates Tax transactivational activity by altering its subcellular distribution and stability. - Highlights: • I-mfa domain proteins, HIC and I-mfa, specifically interact with HTLV-1 Tax. • HIC and I-mfa repress the Tax-dependent transactivation of HTLV-1 LTR. • HIC represses the Tax-dependent transactivation of NF-κΒ. • HIC decreases the nuclear distribution of Tax. • HIC stimulates the proteasomal degradation of Tax.

Direct Repression of Evening Genes by CIRCADIAN CLOCK-ASSOCIATED1 in the Arabidopsis Circadian Clock.

Science.gov (United States)

Kamioka, Mari; Takao, Saori; Suzuki, Takamasa; Taki, Kyomi; Higashiyama, Tetsuya; Kinoshita, Toshinori; Nakamichi, Norihito

2016-03-01

The circadian clock is a biological timekeeping system that provides organisms with the ability to adapt to day-night cycles. Timing of the expression of four members of the Arabidopsis thaliana PSEUDO-RESPONSE REGULATOR(PRR) family is crucial for proper clock function, and transcriptional control of PRRs remains incompletely defined. Here, we demonstrate that direct regulation of PRR5 by CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) determines the repression state of PRR5 in the morning. Chromatin immunoprecipitation followed by deep sequencing (ChIP-seq) analyses indicated that CCA1 associates with three separate regions upstream of PRR5 CCA1 and its homolog LATE ELONGATED HYPOCOTYL (LHY) suppressed PRR5 promoter activity in a transient assay. The regions bound by CCA1 in the PRR5 promoter gave rhythmic patterns with troughs in the morning, when CCA1 and LHY are at high levels. Furthermore,ChIP-seq revealed that CCA1 associates with at least 449 loci with 863 adjacent genes. Importantly, this gene set contains genes that are repressed but upregulated incca1 lhy double mutants in the morning. This study shows that direct binding by CCA1 in the morning provides strong repression of PRR5, and repression by CCA1 also temporally regulates an evening-expressed gene set that includes PRR5. © 2016 American Society of Plant Biologists. All rights reserved.

I-mfa domain proteins specifically interact with HTLV-1 Tax and repress its transactivating functions

Energy Technology Data Exchange (ETDEWEB)

Kusano, Shuichi, E-mail: skusano@m2.kufm.kagoshima-u.ac.jp [Division of Persistent and Oncogenic Viruses, Center for Chronic Viral Diseases, Graduate School of Medical and Dental Sciences, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890-8544 (Japan); Yoshimitsu, Makoto; Hachiman, Miho [Division of Hematology and Immunology, Center for Chronic Viral Diseases, Graduate School of Medical and Dental Sciences, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890-8544 (Japan); Ikeda, Masanori [Division of Persistent and Oncogenic Viruses, Center for Chronic Viral Diseases, Graduate School of Medical and Dental Sciences, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890-8544 (Japan)

2015-12-15

The I-mfa domain proteins HIC (also known as MDFIC) and I-mfa (also known as MDFI) are candidate tumor suppressor genes that are involved in cellular and viral transcriptional regulation. Here, we show that HIC and I-mfa directly interact with human T-cell leukemia virus type-1 (HTLV-1) Tax protein in vitro. In addition, HIC and I-mfa repress Tax-dependent transactivation of an HTLV-1 long terminal repeat (LTR) reporter construct in COS-1, Jurkat and high-Tax-producing HTLV-1-infected T cells. HIC also interacts with Tax through its I-mfa domain in vivo and represses Tax-dependent transactivation of HTLV-1 LTR and NF-κB reporter constructs in an interaction-dependent manner. Furthermore, we show that HIC decreases the nuclear distribution and stimulates the proteasomal degradation of Tax. These data reveal that HIC specifically interacts with HTLV-1 Tax and negatively regulates Tax transactivational activity by altering its subcellular distribution and stability. - Highlights: • I-mfa domain proteins, HIC and I-mfa, specifically interact with HTLV-1 Tax. • HIC and I-mfa repress the Tax-dependent transactivation of HTLV-1 LTR. • HIC represses the Tax-dependent transactivation of NF-κΒ. • HIC decreases the nuclear distribution of Tax. • HIC stimulates the proteasomal degradation of Tax.

The davDT operon of Pseudomonas putida, involved in lysine catabolism, is induced in response to the pathway intermediate delta-aminovaleric acid

DEFF Research Database (Denmark)

Revelles, O.; Espinosa-Urgel, M.; Molin, Søren

2004-01-01

-aminovaleric acid and then further degraded to glutaric acid via the action of the davDT gene products. We show that the davDT genes form an operon transcribed from a single sigma(70)-dependent promoter. The relatively high level of basal expression from the davD promoter increased about fourfold in response...

Bureau-repression: Administrative Sanction and Social Control in Modern Spain

Directory of Open Access Journals (Sweden)

Pedro Oliver Olmo

2015-12-01

Full Text Available This paper explains the creation of an intelligible suggestion for better understanding the administrative sanction in many disciplines in social sciences: the bureau-repression. The coining of this concept is due especially to the repression to which social protestors and demonstrators have been subject since the birth of the 15-M movement in Spain. However, bureau-repression had already begun being exercised in the years following the Transition, and it has developed in parallel to the stage of Security State that characterizes the state system of social control. A detailed analysis of the administrative sanction is performed for many benefits which such sanction provides for those in power, who use it both to silence voices from the street and to dispose of elements which are harmful for the neoliberal system (disadvantaged groups or immigrants. In short, the reader will find the underlying political and repressive background which, at first glance, is usually a monetary fine, and will discover that there are ways to avoid this dense surveillance exercised over the governed people (bureau-resistance. Este artículo explica la creación de una sugerencia inteligible para una mejor comprensión de la sanción administrativa en muchas disciplinas de las ciencias sociales: la burorrepresión. Este término nació especialmente a raíz de la represión que han sufrido los manifestantes de las protestas sociales desde el nacimiento del movimiento 15-M en España. Sin embargo, la burorrepresión ya había comenzado a ejercerse en los años que siguieron a la Transición, y se ha desarrollado de forma paralela al estado de seguridad que caracteriza el sistema estatal de control social. Se realiza un análisis detallado de la sanción administrativa, desarrollada en beneficio de los que están en el poder, quienes la usan tanto para silenciar las voces de la calle como para deshacerse de elementos que sean perjudiciales para el sistema neoliberal

The pvc operon regulates the expression of the Pseudomonas aeruginosa fimbrial chaperone/usher pathway (cup genes.

Directory of Open Access Journals (Sweden)

Uzma Qaisar

Full Text Available The Pseudomonas aeruginosa fimbrial structures encoded by the cup gene clusters (cupB and cupC contribute to its attachment to abiotic surfaces and biofilm formation. The P. aeruginosa pvcABCD gene cluster encodes enzymes that synthesize a novel isonitrile functionalized cumarin, paerucumarin. Paerucumarin has already been characterized chemically, but this is the first report elucidating its role in bacterial biology. We examined the relationship between the pvc operon and the cup gene clusters in the P. aeruginosa strain MPAO1. Mutations within the pvc genes compromised biofilm development and significantly reduced the expression of cupB1-6 and cupC1-3, as well as different genes of the cupB/cupC two-component regulatory systems, roc1/roc2. Adjacent to pvc is the transcriptional regulator ptxR. A ptxR mutation in MPAO1 significantly reduced the expression of the pvc genes, the cupB/cupC genes, and the roc1/roc2 genes. Overexpression of the intact chromosomally-encoded pvc operon by a ptxR plasmid significantly enhanced cupB2, cupC2, rocS1, and rocS2 expression and biofilm development. Exogenously added paerucumarin significantly increased the expression of cupB2, cupC2, rocS1 and rocS2 in the pvcA mutant. Our results suggest that pvc influences P. aeruginosa biofilm development through the cup gene clusters in a pathway that involves paerucumarin, PtxR, and different cup regulators.

Pluripotency factors and Polycomb Group proteins repress aryl hydrocarbon receptor expression in murine embryonic stem cells

Directory of Open Access Journals (Sweden)

Chia-I Ko

2014-01-01

Full Text Available The aryl hydrocarbon receptor (AHR is a transcription factor and environmental sensor that regulates expression of genes involved in drug-metabolism and cell cycle regulation. Chromatin immunoprecipitation analyses, Ahr ablation in mice and studies with orthologous genes in invertebrates suggest that AHR may also play a significant role in embryonic development. To address this hypothesis, we studied the regulation of Ahr expression in mouse embryonic stem cells and their differentiated progeny. In ES cells, interactions between OCT3/4, NANOG, SOX2 and Polycomb Group proteins at the Ahr promoter repress AHR expression, which can also be repressed by ectopic expression of reprogramming factors in hepatoma cells. In ES cells, unproductive RNA polymerase II binds at the Ahr transcription start site and drives the synthesis of short abortive transcripts. Activation of Ahr expression during differentiation follows from reversal of repressive marks in Ahr promoter chromatin, release of pluripotency factors and PcG proteins, binding of Sp factors, establishment of histone marks of open chromatin, and engagement of active RNAPII to drive full-length RNA transcript elongation. Our results suggest that reversible Ahr repression in ES cells holds the gene poised for expression and allows for a quick switch to activation during embryonic development.

The MSX1 homeoprotein recruits G9a methyltransferase to repressed target genes in myoblast cells.

Directory of Open Access Journals (Sweden)

Jingqiang Wang

Full Text Available Although the significance of lysine modifications of core histones for regulating gene expression is widely appreciated, the mechanisms by which these modifications are incorporated at specific regulatory elements during cellular differentiation remains largely unknown. In our previous studies, we have shown that in developing myoblasts the Msx1 homeoprotein represses gene expression by influencing the modification status of chromatin at its target genes. We now show that genomic binding by Msx1 promotes enrichment of the H3K9me2 mark on repressed target genes via recruitment of G9a histone methyltransferase, the enzyme responsible for catalyzing this histone mark. Interaction of Msx1 with G9a is mediated via the homeodomain and is required for transcriptional repression and regulation of cellular differentiation, as well as enrichment of the H3K9me2 mark in proximity to Msx1 binding sites on repressed target genes in myoblast cells as well as the developing limb. We propose that regulation of chromatin status by Msx1 recruitment of G9a and other histone modifying enzymes to regulatory regions of target genes represents an important means of regulating the gene expression during development.

Cyclin D1 represses p300 transactivation through a cyclin-dependent kinase-independent mechanism.

Science.gov (United States)

Fu, Maofu; Wang, Chenguang; Rao, Mahadev; Wu, Xiaofang; Bouras, Toula; Zhang, Xueping; Li, Zhiping; Jiao, Xuanmao; Yang, Jianguo; Li, Anping; Perkins, Neil D; Thimmapaya, Bayar; Kung, Andrew L; Munoz, Alberto; Giordano, Antonio; Lisanti, Michael P; Pestell, Richard G

2005-08-19

Cyclin D1 encodes a regulatory subunit, which with its cyclin-dependent kinase (Cdk)-binding partner forms a holoenzyme that phosphorylates and inactivates the retinoblastoma protein. In addition to its Cdk binding-dependent functions, cyclin D1 regulates cellular differentiation in part by modifying several transcription factors and nuclear receptors. The molecular mechanism through which cyclin D1 regulates the function of transcription factors involved in cellular differentiation remains to be clarified. The histone acetyltransferase protein p300 is a co-integrator required for regulation of multiple transcription factors. Here we show that cyclin D1 physically interacts with p300 and represses p300 transactivation. We demonstrated further that the interaction of the two proteins occurs at the peroxisome proliferator-activated receptor gamma-responsive element of the lipoprotein lipase promoter in the context of the local chromatin structure. We have mapped the domains in p300 and cyclin D1 involved in this interaction. The bromo domain and cysteine- and histidine-rich domains of p300 were required for repression by cyclin D1. Cyclin D1 repression of p300 was independent of the Cdk- and retinoblastoma protein-binding domains of cyclin D1. Cyclin D1 inhibits histone acetyltransferase activity of p300 in vitro. Microarray analysis identified a signature of genes repressed by cyclin D1 and induced by p300 that promotes cellular differentiation and induces cell cycle arrest. Together, our results suggest that cyclin D1 plays an important role in cellular proliferation and differentiation through regulation of p300.

The cell wall and cell division gene cluster in the Mra operon of Pseudomonas aeruginosa: cloning, production, and purification of active enzymes.

Science.gov (United States)

Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M

2001-04-01

We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.

A molecular doorstop ensures a trickle through translational repression.

Science.gov (United States)

Brook, Matthew; Smith, Richard W P; Gray, Nicola K

2012-03-30

Switching mRNA translation off and on is central to regulated gene expression, but what mechanisms moderate the extent of switch-off? Yao et al. describe how basal expression from interferon-gamma-induced transcripts is maintained during mRNA-specific translational repression. This antagonistic mechanism utilizes a truncated RNA-binding factor generated by a unique alternative polyadenylation event. Copyright © 2012 Elsevier Inc. All rights reserved.

Mutations in nif genes that cause Klebsiella pneumoniae to be derepressed for nitrogenase synthesis in the presence of ammonium.

OpenAIRE

MacNeil, D; Brill, W J

1980-01-01

Four Nif+ revertants from strains with polar insertions in nifL, were insensitive to ammonium and amino acid repression of nitrogenase synthesis. These strains have mutations located in or near the nifL region. The derepressed phenotype was dominant in a merodiploid containing a nif+ plasmid. These nif regulatory mutations also suppressed the Nif- phenotype of Gln- strains. Thus, regulation by fixed nitrogen (possible via glutamine synthetase) occurs on the nifLA operon but not on the other s...

Evidence of mercury trapping in biofilm-EPS and mer operon-based volatilization of inorganic mercury in a marine bacterium Bacillus cereus BW-201B.

Science.gov (United States)

Dash, Hirak R; Basu, Subham; Das, Surajit

2017-04-01

Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.

ME31B globally represses maternal mRNAs by two distinct mechanisms during the Drosophila maternal-to-zygotic transition.

Science.gov (United States)

Wang, Miranda; Ly, Michael; Lugowski, Andrew; Laver, John D; Lipshitz, Howard D; Smibert, Craig A; Rissland, Olivia S

2017-09-06

In animal embryos, control of development is passed from exclusively maternal gene products to those encoded by the embryonic genome in a process referred to as the maternal-to-zygotic transition (MZT). We show that the RNA-binding protein, ME31B, binds to and represses the expression of thousands of maternal mRNAs during the Drosophila MZT. However, ME31B carries out repression in different ways during different phases of the MZT. Early, it represses translation while, later, its binding leads to mRNA destruction, most likely as a consequence of translational repression in the context of robust mRNA decay. In a process dependent on the PNG kinase, levels of ME31B and its partners, Cup and Trailer Hitch (TRAL), decrease by over 10-fold during the MZT, leading to a change in the composition of mRNA-protein complexes. We propose that ME31B is a global repressor whose regulatory impact changes based on its biological context.

A noncanonical Flt3ITD/NF-κB signaling pathway represses DAPK1 in acute myeloid leukemia.

Science.gov (United States)

Shanmugam, Rajasubramaniam; Gade, Padmaja; Wilson-Weekes, Annique; Sayar, Hamid; Suvannasankha, Attaya; Goswami, Chirayu; Li, Lang; Gupta, Sushil; Cardoso, Angelo A; Baghdadi, Tareq Al; Sargent, Katie J; Cripe, Larry D; Kalvakolanu, Dhananjaya V; Boswell, H Scott

2012-01-15

Death-associated protein kinase 1 (DAPK1), a tumor suppressor, is a rate-limiting effector in an endoplasmic reticulum (ER) stress-dependent apoptotic pathway. Its expression is epigenetically suppressed in several tumors. A mechanistic basis for epigenetic/transcriptional repression of DAPK1 was investigated in certain forms of acute myeloid leukemia (AML) with poor prognosis, which lacked ER stress-induced apoptosis. Heterogeneous primary AMLs were screened to identify a subgroup with Flt3ITD in which repression of DAPK1, among NF-κB-and c-Jun-responsive genes, was studied. RNA interference knockdown studies were carried out in an Flt3ITD(+) cell line, MV-4-11, to establish genetic epistasis in the pathway Flt3ITD-TAK1-DAPK1 repression, and chromatin immunoprecipitations were carried out to identify proximate effector proteins, including TAK1-activated p52NF-κB, at the DAPK1 locus. AMLs characterized by normal karyotype with Flt3ITD were found to have 10- to 100-fold lower DAPK1 transcripts normalized to the expression of c-Jun, a transcriptional activator of DAPK1, as compared with a heterogeneous cytogenetic category. In addition, Meis1, a c-Jun-responsive adverse AML prognostic gene signature was measured as control. These Flt3ITD(+) AMLs overexpress relB, a transcriptional repressor, which forms active heterodimers with p52NF-κB. Chromatin immunoprecipitation assays identified p52NF-κB binding to the DAPK1 promoter together with histone deacetylase 2 (HDAC2) and HDAC6 in the Flt3ITD(+) human AML cell line MV-4-11. Knockdown of p52NF-κB or its upstream regulator, NF-κB-inducing kinase (NIK), de-repressed DAPK1. DAPK1-repressed primary Flt3ITD(+) AMLs had selective nuclear activation of p52NF-κB. Flt3ITD promotes a noncanonical pathway via TAK1 and p52NF-κB to suppress DAPK1 in association with HDACs, which explains DAPK1 repression in Flt3ITD(+) AML. ©2011 AACR.

Trichostatin A enhances estrogen receptor-alpha repression in MCF-7 breast cancer cells under hypoxia

International Nuclear Information System (INIS)

Noh, Hyunggyun; Park, Joonwoo; Shim, Myeongguk; Lee, YoungJoo

2016-01-01

Estrogen receptor (ER) is a crucial determinant of resistance to endocrine therapy, which may change during the progression of breast cancer. We previously showed that hypoxia induces ESR1 gene repression and ERα protein degradation via proteasome-mediated pathway in breast cancer cells. HDAC plays important roles in the regulation of histone and non-histone protein post-translational modification. HDAC inhibitors can induce epigenetic changes and have therapeutic potential for targeting various cancers. Trichostatin A exerts potent antitumor activities against breast cancer cells in vitro and in vivo. In this report, we show that TSA augments ESR1 gene repression at the transcriptional level and downregulates ERα protein expression under hypoxic conditions through a proteasome-mediated pathway. TSA-induced estrogen response element-driven reporter activity in the absence of estrogen was synergistically enhanced under hypoxia; however, TSA inhibited cell proliferation under both normoxia and hypoxia. Our data show that the hypoxia-induced repression of ESR1 and degradation of ERα are enhanced by concomitant treatment with TSA. These findings expand our understanding of hormone responsiveness in the tumor microenvironment; however, additional in-depth studies are required to elucidate the detailed mechanisms of TSA-induced ERα regulation under hypoxia. - Highlights: • TSA augments ESR1 gene repression at the transcriptional level under hypoxia. • TSA downregulates ERα protein expression under hypoxia. • TSA-induced ERα regulation under hypoxia is essential for understanding the behavior and progression of breast cancer.

Trichostatin A enhances estrogen receptor-alpha repression in MCF-7 breast cancer cells under hypoxia

Energy Technology Data Exchange (ETDEWEB)

Noh, Hyunggyun; Park, Joonwoo; Shim, Myeongguk; Lee, YoungJoo, E-mail: yjlee@sejong.ac.kr

2016-02-12

Estrogen receptor (ER) is a crucial determinant of resistance to endocrine therapy, which may change during the progression of breast cancer. We previously showed that hypoxia induces ESR1 gene repression and ERα protein degradation via proteasome-mediated pathway in breast cancer cells. HDAC plays important roles in the regulation of histone and non-histone protein post-translational modification. HDAC inhibitors can induce epigenetic changes and have therapeutic potential for targeting various cancers. Trichostatin A exerts potent antitumor activities against breast cancer cells in vitro and in vivo. In this report, we show that TSA augments ESR1 gene repression at the transcriptional level and downregulates ERα protein expression under hypoxic conditions through a proteasome-mediated pathway. TSA-induced estrogen response element-driven reporter activity in the absence of estrogen was synergistically enhanced under hypoxia; however, TSA inhibited cell proliferation under both normoxia and hypoxia. Our data show that the hypoxia-induced repression of ESR1 and degradation of ERα are enhanced by concomitant treatment with TSA. These findings expand our understanding of hormone responsiveness in the tumor microenvironment; however, additional in-depth studies are required to elucidate the detailed mechanisms of TSA-induced ERα regulation under hypoxia. - Highlights: • TSA augments ESR1 gene repression at the transcriptional level under hypoxia. • TSA downregulates ERα protein expression under hypoxia. • TSA-induced ERα regulation under hypoxia is essential for understanding the behavior and progression of breast cancer.

A combination of luxR1 and luxR2 genes activates Pr-promoters of psychrophilic Aliivibrio logei lux-operon independently of chaperonin GroEL/ES and protease Lon at high concentrations of autoinducer.

Science.gov (United States)

Konopleva, Maria N; Khrulnova, Svetlana A; Baranova, Ancha; Ekimov, Leonid V; Bazhenov, Sergey V; Goryanin, Ignatiy I; Manukhov, Ilya V

2016-05-13

Lux-operon of psychrophilic bacteria Aliivibrio logei contains two copies of luxR and is regulated by Type I quorum sensing (QS). Activation of lux-operon of psychrophilic bacteria A. logei by LuxR1 requires about 100 times higher concentrations of autoinducer (AI) than the activation by LuxR2. On the other hand, LuxR1 does not require GroEL/ES chaperonin for its folding and cannot be degraded by protease Lon, while LuxR2 sensitive to Lon and requires GroEL/ES. Here we show that at 10(-5) - 10(-4)М concentrations of AI a combination of luxR1 and luxR2 products is capable of activating the Pr-promoters of A. logei lux-operon in Escherichia coli independently of GroEL/ES and protease Lon. The presence of LuxR1 assists LuxR2 in gro(-) cells when AI was added at high concentration, while at low concentration of AI in a cell LuxR1 decreases the LuxR2 activity. These observations may be explained by the formation of LuxR1/LuxR2 heterodimers that act in complex with AI independently from GroEL/ES and protease Lon. This study expands current understanding of QS regulation in A. logei as it implies cooperative regulation of lux-operon by LuxR1 and LuxR2 proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

Oncolytic adenovirus targeting cyclin E overexpression repressed tumor growth in syngeneic immunocompetent mice

International Nuclear Information System (INIS)

Cheng, Pei-Hsin; Rao, Xiao-Mei; Wechman, Stephen L.; Li, Xiao-Feng; McMasters, Kelly M.; Zhou, Heshan Sam

2015-01-01

Clinical trials have indicated that preclinical results obtained with human tumor xenografts in mouse models may overstate the potential of adenovirus (Ad)-mediated oncolytic therapies. We have previously demonstrated that the replication of human Ads depends on cyclin E dysregulation or overexpression in cancer cells. ED-1 cell derived from mouse lung adenocarcinomas triggered by transgenic overexpression of human cyclin E may be applied to investigate the antitumor efficacy of oncolytic Ads. Ad-cycE was used to target cyclin E overexpression in ED-1 cells and repress tumor growth in a syngeneic mouse model for investigation of oncolytic virotherapies. Murine ED-1 cells were permissive for human Ad replication and Ad-cycE repressed ED-1 tumor growth in immunocompetent FVB mice. ED-1 cells destroyed by oncolytic Ads in tumors were encircled in capsule-like structures, while cells outside the capsules were not infected and survived the treatment. Ad-cycE can target cyclin E overexpression in cancer cells and repress tumor growth in syngeneic mouse models. The capsule structures formed after Ad intratumoral injection may prevent viral particles from spreading to the entire tumor. The online version of this article (doi:10.1186/s12885-015-1731-x) contains supplementary material, which is available to authorized users

A central regulatory system largely controls transcriptional activation and repression responses to phosphate starvation in Arabidopsis.

Directory of Open Access Journals (Sweden)

Regla Bustos

2010-09-01

Full Text Available Plants respond to different stresses by inducing or repressing transcription of partially overlapping sets of genes. In Arabidopsis, the PHR1 transcription factor (TF has an important role in the control of phosphate (Pi starvation stress responses. Using transcriptomic analysis of Pi starvation in phr1, and phr1 phr1-like (phl1 mutants and in wild type plants, we show that PHR1 in conjunction with PHL1 controls most transcriptional activation and repression responses to phosphate starvation, regardless of the Pi starvation specificity of these responses. Induced genes are enriched in PHR1 binding sequences (P1BS in their promoters, whereas repressed genes do not show such enrichment, suggesting that PHR1(-like control of transcriptional repression responses is indirect. In agreement with this, transcriptomic analysis of a transgenic plant expressing PHR1 fused to the hormone ligand domain of the glucocorticoid receptor showed that PHR1 direct targets (i.e., displaying altered expression after GR:PHR1 activation by dexamethasone in the presence of cycloheximide corresponded largely to Pi starvation-induced genes that are highly enriched in P1BS. A minimal promoter containing a multimerised P1BS recapitulates Pi starvation-specific responsiveness. Likewise, mutation of P1BS in the promoter of two Pi starvation-responsive genes impaired their responsiveness to Pi starvation, but not to other stress types. Phylogenetic footprinting confirmed the importance of P1BS and PHR1 in Pi starvation responsiveness and indicated that P1BS acts in concert with other cis motifs. All together, our data show that PHR1 and PHL1 are partially redundant TF acting as central integrators of Pi starvation responses, both specific and generic. In addition, they indicate that transcriptional repression responses are an integral part of adaptive responses to stress.

E2F repression by C/EBPalpha is required for adipogenesis and granulopoiesis in vivo

DEFF Research Database (Denmark)

Porse, B T; Pedersen TA; Xu, X

2001-01-01

-dependent transcription and found them to be impaired in their ability to suppress cellular proliferation, and to induce adipocyte differentiation in vitro. Using targeted mutagenesis of the mouse germline, we show that E2F repression-deficient C/EBPalpha alleles failed to support adipocyte and granulocyte...... differentiation in vivo. These results indicate that E2F repression by C/EBPalpha is critical for its ability to induce terminal differentiation, and thus provide genetic evidence that direct cell cycle control by a mammalian lineage-instructive transcription factor couples cellular growth arrest...

Integration Host Factor (IHF binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121

Directory of Open Access Journals (Sweden)

Álvarez-Morales Ariel

2011-05-01

Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.

The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.

Science.gov (United States)

Ahn, Sang-Joon; Burne, Robert A

2006-10-01

The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.

SIRT1 deacetylates RFX5 and antagonizes repression of collagen type I (COL1A2) transcription in smooth muscle cells

Energy Technology Data Exchange (ETDEWEB)

Xia, Jun [Department of Respiratory Medicine, The First Affiliated Hospital of Nanjing Medical University (China); Department of Respiratory Medicine, Jiangsu Provincial Hospital of Chinese Traditional Medicine (China); Wu, Xiaoyan; Yang, Yuyu; Zhao, Yuhao [Atherosclerosis Research Center, Key Laboratory of Cardiovascular Disease and Molecular Intervention, Department of Pathophysiology, Nanjing Medical University (China); Fang, Mingming [Jiangsu Jiankang Vocational Institute (China); Xie, Weiping, E-mail: wpxienjmu@gmail.com [Department of Respiratory Medicine, The First Affiliated Hospital of Nanjing Medical University (China); Wang, Hong, E-mail: hwangnjmu@gmail.com [Department of Respiratory Medicine, The First Affiliated Hospital of Nanjing Medical University (China); Xu, Yong [Atherosclerosis Research Center, Key Laboratory of Cardiovascular Disease and Molecular Intervention, Department of Pathophysiology, Nanjing Medical University (China)

2012-11-16

Highlights: Black-Right-Pointing-Pointer SIRT1 interacts with and deacetylates RFX5. Black-Right-Pointing-Pointer SIRT1 activation attenuates whereas SIRT1 inhibition enhances collagen repression by RFX5 in vascular smooth muscle cells. Black-Right-Pointing-Pointer SIRT1 promotes cytoplasmic localization and proteasomal degradation of RFX5 and cripples promoter recruitment of RFX5. Black-Right-Pointing-Pointer IFN-{gamma} represses SIRT1 expression in vascular smooth muscle cells. Black-Right-Pointing-Pointer SIRT1 agonist alleviates collagen repression by IFN-{gamma} in vascular smooth muscle cells. -- Abstract: Decreased expression of collagen by vascular smooth muscle cells (SMCs) within the atherosclerotic plaque contributes to the thinning of the fibrous cap and poses a great threat to plaque rupture. Elucidation of the mechanism underlying repressed collagen type I (COL1A2) gene would potentially provide novel solutions that can prevent rupture-induced complications. We have previously shown that regulatory factor for X-box (RFX5) binds to the COL1A2 transcription start site and represses its transcription. Here we report that SIRT1, an NAD-dependent, class III deacetylase, forms a complex with RFX5. Over-expression of SIRT1 or NAMPT, which synthesizes NAD+ to activate SIRT1, or treatment with the SIRT1 agonist resveratrol decreases RFX5 acetylation and disrupts repression of the COL1A2 promoter activity by RFX5. On the contrary, knockdown of SIRT1 or treatment with SIRT1 inhibitors induces RFX5 acetylation and enhances the repression of collagen transcription. SIRT1 antagonizes RFX5 activity by promoting its nuclear expulsion and proteasomal degradation hence dampening its binding to the COL1A2 promoter. The pro-inflammatory cytokine IFN-{gamma} represses COL1A2 transcription by down-regulating SIRT1 expression in SMCs. Therefore, our data have identified as novel pathway whereby SIRT1 maintains collagen synthesis in SMCs by modulating RFX5 activity.

Isolation of a solventogenic Clostridium sp. strain: fermentation of glycerol to n-butanol, analysis of the bcs operon region and its potential regulatory elements.

Science.gov (United States)

Panitz, J C; Zverlov, V V; Pham, V T T; Stürzl, S; Schieder, D; Schwarz, W H

2014-02-01

A new solventogenic bacterium, strain GT6, was isolated from standing water sediment. 16S-rRNA gene analysis revealed that GT6 belongs to the heterogeneous Clostridium tetanomorphum group of bacteria exhibiting 99% sequence identity with C. tetanomorphum 4474(T). GT6 can utilize a wide range of carbohydrate substrates including glucose, fructose, maltose, xylose and glycerol to produce mainly n-butanol without any acetone. Additional products of GT6 metabolism were ethanol, butyric acid, acetic acid, and trace amounts of 1,3-propanediol. Medium and substrate composition, and culture conditions such as pH and temperature influenced product formation. The major fermentation product from glycerol was n-butanol with a final concentration of up to 11.5 g/L. 3% (v/v) glycerol lead to a total solvent concentration of 14 g/L within 72 h. Growth was not inhibited by glycerol concentrations as high as 15% (v/v). The solventogenesis genes crt, bcd, etfA/B and hbd composing the bcs (butyryl-CoA synthesis) operon of C. tetanomorphum GT6 were sequenced. They occur in a genomic arrangement identical to those in other solventogenic clostridia. Furthermore, the sequence of a potential regulator gene highly similar to that of the NADH-sensing Rex family of regulatory genes was found upstream of the bcs operon. Potential binding sites for Rex have been identified in the promoter region of the bcs operon of solvent producing clostridia as well as upstream of other genes involved in NADH oxidation. This indicates a fundamental role of Rex in the regulation of fermentation products in anaerobic, and especially in solventogenic bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

The CodY-dependent clhAB2 operon is involved in cell shape, chaining and autolysis in Bacillus cereus ATCC 14579.

Science.gov (United States)

Huillet, Eugénie; Bridoux, Ludovic; Wanapaisan, Pagakrong; Rejasse, Agnès; Peng, Qi; Panbangred, Watanalai; Lereclus, Didier

2017-01-01

The Gram-positive pathogen Bacillus cereus is able to grow in chains of rod-shaped cells, but the regulation of chaining remains largely unknown. Here, we observe that glucose-grown cells of B. cereus ATCC 14579 form longer chains than those grown in the absence of glucose during the late exponential and transition growth phases, and identify that the clhAB2 operon is required for this chain lengthening phenotype. The clhAB2 operon is specific to the B. cereus group (i.e., B. thuringiensis, B. anthracis and B. cereus) and encodes two membrane proteins of unknown function, which are homologous to the Staphylococcus aureus CidA and CidB proteins involved in cell death control within glucose-grown cells. A deletion mutant (ΔclhAB2) was constructed and our quantitative image analyses show that ΔclhAB2 cells formed abnormal short chains regardless of the presence of glucose. We also found that glucose-grown cells of ΔclhAB2 were significantly wider than wild-type cells (1.47 μm ±CI95% 0.04 vs 1.19 μm ±CI95% 0.03, respectively), suggesting an alteration of the bacterial cell wall. Remarkably, ΔclhAB2 cells showed accelerated autolysis under autolysis-inducing conditions, compared to wild-type cells. Overall, our data suggest that the B. cereus clhAB2 operon modulates peptidoglycan hydrolase activity, which is required for proper cell shape and chain length during cell growth, and down-regulates autolysin activity. Lastly, we studied the transcription of clhAB2 using a lacZ transcriptional reporter in wild-type, ccpA and codY deletion-mutant strains. We found that the global transcriptional regulatory protein CodY is required for the basal level of clhAB2 expression under all conditions tested, including the transition growth phase while CcpA, the major global carbon regulator, is needed for the high-level expression of clhAB2 in glucose-grown cells.

Military westernization and state repression in the post-Cold War era.

Science.gov (United States)

Swed, Ori; Weinreb, Alexander

2015-09-01

The waves of unrest that have shaken the Arab world since December 2010 have highlighted significant differences in the readiness of the military to intervene in political unrest by forcefully suppressing dissent. We suggest that in the post-Cold War period, this readiness is inversely associated with the level of military westernization, which is a product of the acquisition of arms from western countries. We identify two mechanisms linking the acquisition of arms from western countries to less repressive responses: dependence and conditionality; and a longer-term diffusion of ideologies regarding the proper form of civil-military relations. Empirical support for our hypothesis is found in an analysis of 2523 cases of government response to political unrest in 138 countries in the 1996-2005 period. We find that military westernization mitigates state repression in general, with more pronounced effects in the poorest countries. However, we also identify substantial differences between the pre- and post-9/11 periods. Copyright © 2015 Elsevier Inc. All rights reserved.

Repressive coping among British college women: A potential protective factor against body image concerns, drive for thinness, and bulimia symptoms.

Science.gov (United States)

Mohiyeddini, Changiz

2017-09-01

Repressive coping, as a means of preserving a positive self-image, has been widely explored in the context of dealing with self-evaluative cues. The current study extends this research by exploring whether repressive coping is associated with lower levels of body image concerns, drive for thinness, bulimic symptoms, and higher positive rational acceptance. A sample of 229 female college students was recruited in South London. Repressive coping was measured via the interaction between trait anxiety and defensiveness. The results of moderated regression analysis with simple slope analysis show that compared to non-repressors, repressors reported lower levels of body image concerns, drive for thinness, and bulimic symptoms while exhibiting a higher use of positive rational acceptance. These findings, in line with previous evidence, suggest that repressive coping may be adaptive particularly in the context of body image. Copyright © 2017 Elsevier Ltd. All rights reserved.

Acute TNF-induced repression of cell identity genes is mediated by NFκB-directed redistribution of cofactors from super-enhancers

DEFF Research Database (Denmark)

Schmidt, Søren Fisker; Larsen, Bjørk Ditlev; Loft, Anne

2015-01-01

The proinflammatory cytokine tumor necrosis factor (TNF) plays a central role in low-grade adipose tissue inflammation and development of insulin resistance during obesity. In this context, nuclear factor κ-light-chain-enhancer of activated B cells (NFκB) is directly involved and required for the...... specifically repressing super-enhancer-associated cell identity genes....... binding to the associated enhancers but rather loss of cofactors and enhancer RNA (eRNA) selectively from high-occupancy sites within super-enhancers. Based on these data, we have developed models that, with high accuracy, predict which enhancers and genes are repressed by TNF in adipocytes. We show...... that these models are applicable to other cell types where TNF represses genes associated with super-enhancers in a highly cell-type-specific manner. Our results propose a novel paradigm for NFκB-mediated repression, whereby NFκB selectively redistributes cofactors from high-occupancy enhancers, thereby...

Interpreting suffering from illness: The role of culture and repressive suffering construal.

Science.gov (United States)

Yang, Qian; Liu, Shi; Sullivan, Daniel; Pan, Shengdong

2016-07-01

Mental and physical illnesses are among the most prominent forms of suffering. Cultural worldviews provide tools for making sense of and coping with suffering. In this research, we examine how culture influences both experts' and laypeople's interpretation of suffering from illness. We focus on one type of interpretation of suffering- repressive suffering construal-an interpretation that frames suffering both as the result of immorality on the part of the sufferer and as having the function of maintaining social order by curtailing deviance. We sought to test whether this type of suffering interpretation is more common in cultural ecologies (e.g., urban vs. rural; higher vs. lower status) traditionally associated with collectivist values. Study 1 used data from the General Social Survey to examine variation in suffering interpretation in a representative sample of the U.S. Study 2 examined variation in suffering interpretation with a survey completed by a subsample of Chinese health-care professionals. Study 1 found that U.S. citizens living in a rural environment are more likely to interpret illnesses as being the fault of the sufferer. Study 2 found that those from a lower-SES background are more likely to interpret illnesses in a repressive fashion. In these studies, family size mediates the effect of ecological conditions on RSC. Our research highlights how ecological variables associated with collectivism may bias both laypeople and professionals to interpret suffering from illness in a more repressive way. Copyright © 2016 Elsevier Ltd. All rights reserved.

HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.

Science.gov (United States)

Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong

2016-01-01

Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.

A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

Science.gov (United States)

Zhu, Y; Lin, E C

1988-05-01

L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

Genomic Analysis Reveals Contrasting PIFq Contribution to Diurnal Rhythmic Gene Expression in PIF-Induced and -Repressed Genes.

Science.gov (United States)

Martin, Guiomar; Soy, Judit; Monte, Elena

2016-01-01

Members of the PIF quartet (PIFq; PIF1, PIF3, PIF4, and PIF5) collectively contribute to induce growth in Arabidopsis seedlings under short day (SD) conditions, specifically promoting elongation at dawn. Their action involves the direct regulation of growth-related and hormone-associated genes. However, a comprehensive definition of the PIFq-regulated transcriptome under SD is still lacking. We have recently shown that SD and free-running (LL) conditions correspond to "growth" and "no growth" conditions, respectively, correlating with greater abundance of PIF protein in SD. Here, we present a genomic analysis whereby we first define SD-regulated genes at dawn compared to LL in the wild type, followed by identification of those SD-regulated genes whose expression depends on the presence of PIFq. By using this sequential strategy, we have identified 349 PIF/SD-regulated genes, approximately 55% induced and 42% repressed by both SD and PIFq. Comparison with available databases indicates that PIF/SD-induced and PIF/SD-repressed sets are differently phased at dawn and mid-morning, respectively. In addition, we found that whereas rhythmicity of the PIF/SD-induced gene set is lost in LL, most PIF/SD-repressed genes keep their rhythmicity in LL, suggesting differential regulation of both gene sets by the circadian clock. Moreover, we also uncovered distinct overrepresented functions in the induced and repressed gene sets, in accord with previous studies in other examined PIF-regulated processes. Interestingly, promoter analyses showed that, whereas PIF/SD-induced genes are enriched in direct PIF targets, PIF/SD-repressed genes are mostly indirectly regulated by the PIFs and might be more enriched in ABA-regulated genes.

A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

Science.gov (United States)

Santangelo, G M; Tornow, J

1997-12-01

As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

Science.gov (United States)

Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

2011-06-10

The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

DEFF Research Database (Denmark)

van Wezel, G P; Krab, I M; Douthwaite, S

1994-01-01

Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

Epigenetic involvement of Alien/ESET complex in thyroid hormone-mediated repression of E2F1 gene expression and cell proliferation

International Nuclear Information System (INIS)

Hong, Wei; Li, Jinru; Wang, Bo; Chen, Linfeng; Niu, Wenyan; Yao, Zhi; Baniahmad, Aria

2011-01-01

Highlights: ► Corepressor Alien interacts with histone methyltransferase ESET in vivo. ► Alien/ESET complex is recruited to nTRE of T3-responsive gene by liganded TRβ1. ► ESET-mediated H3K9 methylation is required for liganded TRβ1-repressed transcription. ► ESET is involved in T3-repressed G1/S phase transition and proliferation. -- Abstract: The ligand-bound thyroid hormone receptor (TR) is known to repress via a negative TRE (nTRE) the expression of E2F1, a key transcription factor that controls the G1/S phase transition. Alien has been identified as a novel interacting factor of E2F1 and acts as a corepressor of E2F1. The detailed molecular mechanism by which Alien inhibits E2F1 gene expression remains unclear. Here, we report that the histone H3 lysine 9 (H3K9) methyltransferase (HMT) ESET is an integral component of the corepressor Alien complex and the Alien/ESET complex is recruited to both sites, the E2F1 and the nTRE site of the E2F1 gene while the recruitment to the negative thyroid hormone response element (nTRE) is induced by the ligand-bound TRβ1 within the E2F1 gene promoter. We show that, overexpression of ESET promotes, whereas knockdown of ESET releases, the inhibition of TRβ1-regulated gene transcription upon T3 stimulation; and H3K9 methylation is required for TRβ1-repressed transcription. Furthermore, depletion of ESET impairs thyroid hormone-repressed proliferation as well as the G1/S transition of the cell cycle. Taken together, our data indicate that ESET is involved in TRβ1-mediated transcription repression and provide a molecular basis of thyroid hormone-induced repression of proliferation.

SUMO modification of Stra13 is required for repression of cyclin D1 expression and cellular growth arrest.

Directory of Open Access Journals (Sweden)

Yaju Wang

Full Text Available Stra13, a basic helix-loop-helix (bHLH transcription factor is involved in myriad biological functions including cellular growth arrest, differentiation and senescence. However, the mechanisms by which its transcriptional activity and function are regulated remain unclear. In this study, we provide evidence that post-translational modification of Stra13 by Small Ubiquitin-like Modifier (SUMO dramatically potentiates its ability to transcriptionally repress cyclin D1 and mediate G(1 cell cycle arrest in fibroblast cells. Mutation of SUMO acceptor lysines 159 and 279 located in the C-terminal repression domain has no impact on nuclear localization; however, it abrogates association with the co-repressor histone deacetylase 1 (HDAC1, attenuates repression of cyclin D1, and prevents Stra13-mediated growth suppression. HDAC1, which promotes cellular proliferation and cell cycle progression, antagonizes Stra13 sumoylation-dependent growth arrest. Our results uncover an unidentified regulatory axis between Stra13 and HDAC1 in progression through the G(1/S phase of the cell cycle, and provide new mechanistic insights into regulation of Stra13-mediated transcriptional repression by sumoylation.

Catabolite repression and nitrogen control of allantoin-degrading enzymes in Pseudomonas aeruginosa

NARCIS (Netherlands)

Janssen, D.B.; Drift, C. van der

1983-01-01

The formation of the allantoin-degrading enzymes allantoinase, allantoicase and ureidoglycolase in Pseudomonas aeruginosa was found to be regulated by induction, catabolite repression and nitrogen control. Induction was observed when urate, allantoin or allantoate were included in the growth medium,

Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

Directory of Open Access Journals (Sweden)

April M Sapp

Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and

Interplay between the catabolite repression control protein Crc, Hfq and RNA in Hfq-dependent translational regulation in Pseudomonas aeruginosa.

Science.gov (United States)

Sonnleitner, Elisabeth; Wulf, Alexander; Campagne, Sébastien; Pei, Xue-Yuan; Wolfinger, Michael T; Forlani, Giada; Prindl, Konstantin; Abdou, Laetitia; Resch, Armin; Allain, Frederic H-T; Luisi, Ben F; Urlaub, Henning; Bläsi, Udo

2018-02-16

In Pseudomonas aeruginosa the RNA chaperone Hfq and the catabolite repression control protein (Crc) act as post-transcriptional regulators during carbon catabolite repression (CCR). In this regard Crc is required for full-fledged Hfq-mediated translational repression of catabolic genes. RNAseq based transcriptome analyses revealed a significant overlap between the Crc and Hfq regulons, which in conjunction with genetic data supported a concerted action of both proteins. Biochemical and biophysical approaches further suggest that Crc and Hfq form an assembly in the presence of RNAs containing A-rich motifs, and that Crc interacts with both, Hfq and RNA. Through these interactions, Crc enhances the stability of Hfq/Crc/RNA complexes, which can explain its facilitating role in Hfq-mediated translational repression. Hence, these studies revealed for the first time insights into how an interacting protein can modulate Hfq function. Moreover, Crc is shown to interfere with binding of a regulatory RNA to Hfq, which bears implications for riboregulation. These results are discussed in terms of a working model, wherein Crc prioritizes the function of Hfq toward utilization of favored carbon sources.

Genetic interactions of MAF1 identify a role for Med20 in transcriptional repression of ribosomal protein genes.

Directory of Open Access Journals (Sweden)

Ian M Willis

2008-07-01

Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.

The Reg1-interacting proteins, Bmh1, Bmh2, Ssb1, and Ssb2, have roles in maintaining glucose repression in Saccharomyces cerevisiae.

Science.gov (United States)

Dombek, Kenneth M; Kacherovsky, Nataly; Young, Elton T

2004-09-10

In Saccharomyces cerevisiae, a type 1 protein phosphatase complex composed of the Glc7 catalytic subunit and the Reg1 regulatory subunit represses expression of many glucose-regulated genes. Here we show that the Reg1-interacting proteins Bmh1, Bmh2, Ssb1, and Ssb2 have roles in glucose repression. Deleting both BMH genes causes partially constitutive ADH2 expression without significantly increasing the level of Adr1 protein, the major activator of ADH2 expression. Adr1 and Bcy1, the regulatory subunit of cAMP-dependent protein kinase, are both required for this effect indicating that constitutive expression in Deltabmh1Deltabmh2 cells uses the same activation pathway that operates in Deltareg1 cells. Deletion of both BMH genes and REG1 causes a synergistic relief from repression, suggesting that Bmh proteins also act independently of Reg1 during glucose repression. A two-hybrid interaction with the Bmh proteins was mapped to amino acids 187-232, a region of Reg1 that is conserved in different classes of fungi. Deleting this region partially releases SUC2 from glucose repression. This indicates a role for the Reg1-Bmh interaction in glucose repression and also suggests a broad role for Bmh proteins in this process. An in vivo Reg1-Bmh interaction was confirmed by copurification of Bmh proteins with HA(3)-TAP-tagged Reg1. The nonconventional heat shock proteins Ssb1 and Ssb2 are also copurified with HA(3)-TAP-tagged Reg1. Deletion of both SSB genes modestly decreases repression of ADH2 expression in the presence of glucose, suggesting that Ssb proteins, perhaps through their interaction with Reg1, play a minor role in glucose repression.

Regulating repression: roles for the sir4 N-terminus in linker DNA protection and stabilization of epigenetic states.

Directory of Open Access Journals (Sweden)

Stephanie Kueng

Full Text Available Silent information regulator proteins Sir2, Sir3, and Sir4 form a heterotrimeric complex that represses transcription at subtelomeric regions and homothallic mating type (HM loci in budding yeast. We have performed a detailed biochemical and genetic analysis of the largest Sir protein, Sir4. The N-terminal half of Sir4 is dispensable for SIR-mediated repression of HM loci in vivo, except in strains that lack Yku70 or have weak silencer elements. For HM silencing in these cells, the C-terminal domain (Sir4C, residues 747-1,358 must be complemented with an N-terminal domain (Sir4N; residues 1-270, expressed either independently or as a fusion with Sir4C. Nonetheless, recombinant Sir4C can form a complex with Sir2 and Sir3 in vitro, is catalytically active, and has sedimentation properties similar to a full-length Sir4-containing SIR complex. Sir4C-containing SIR complexes bind nucleosomal arrays and protect linker DNA from nucleolytic digestion, but less effectively than wild-type SIR complexes. Consistently, full-length Sir4 is required for the complete repression of subtelomeric genes. Supporting the notion that the Sir4 N-terminus is a regulatory domain, we find it extensively phosphorylated on cyclin-dependent kinase consensus sites, some being hyperphosphorylated during mitosis. Mutation of two major phosphoacceptor sites (S63 and S84 derepresses natural subtelomeric genes when combined with a serendipitous mutation (P2A, which alone can enhance the stability of either the repressed or active state. The triple mutation confers resistance to rapamycin-induced stress and a loss of subtelomeric repression. We conclude that the Sir4 N-terminus plays two roles in SIR-mediated silencing: it contributes to epigenetic repression by stabilizing the SIR-mediated protection of linker DNA; and, as a target of phosphorylation, it can destabilize silencing in a regulated manner.

Conditional expression of the vesicular stomatitis virus glycoprotein gene in Escherichia coli.

OpenAIRE

Rose, J K; Shafferman, A

1981-01-01

Bacterial plasmids that directed expression of the vesicular stomatitis virus glycoprotein (G-protein) gene under control of the tryptophan operon regulatory region were constructed. A plasmid directing the synthesis of a G-protein-like protein (containing the NH2-terminal segment of seven amino acids encoded by the trpE gene fused to the complete G-protein sequence lacking only its NH2-terminal methionine) could be transformed into trpR+ (repressed) but not into trpR- (derepressed) cells. Th...

The Transcriptional Repressive Activity of KRAB Zinc Finger Proteins Does Not Correlate with Their Ability to Recruit TRIM28.

Directory of Open Access Journals (Sweden)

Kristin E Murphy

Full Text Available KRAB domain Zinc finger proteins are one of the most abundant families of transcriptional regulators in higher vertebrates. The prevailing view is that KRAB domain proteins function as potent transcriptional repressors by recruiting TRIM28 and promoting heterochromatin spreading. However, the extent to which all KRAB domain proteins are TRIM28-dependent transcriptional repressors is currently unclear. Our studies on mouse ZFP568 revealed that TRIM28 recruitment by KRAB domain proteins is not sufficient to warrant transcriptional repressive activity. By using luciferase reporter assays and yeast two-hybrid experiments, we tested the ability of ZFP568 and other mouse KRAB domain proteins to repress transcription and bind TRIM28. We found that some mouse KRAB domain proteins are poor transcriptional repressors despite their ability to recruit TRIM28, while others showed strong KRAB-dependent transcriptional repression, but no TRIM28 binding. Together, our results show that the transcriptional repressive activity of KRAB-ZNF proteins does not correlate with their ability to recruit TRIM28, and provide evidence that KRAB domains can regulate transcription in a TRIM28-independent fashion. Our findings challenge the current understanding of the molecular mechanisms used by KRAB domain proteins to control gene expression and highlight that a high percentage of KRAB domain proteins in the mouse genome differ from the consensus KRAB sequence at amino acid residues that are critical for TRIM28 binding and/or repressive activity.

SUN2 Modulates HIV-1 Infection and Latency through Association with Lamin A/C To Maintain the Repressive Chromatin.

Science.gov (United States)

Sun, Wei-Wei; Jiao, Shi; Sun, Li; Zhou, Zhaocai; Jin, Xia; Wang, Jian-Hua

2018-05-01

The postintegrational latency of HIV-1 is characterized by reversible silencing of long terminal repeat (LTR)-driven transcription of the HIV genome. It is known that the formation of repressive chromatin at the 5'-LTR of HIV-1 proviral DNA impedes viral transcription by blocking the recruitment of positive transcription factors. How the repressive chromatin is formed and modulated during HIV-1 infection remains elusive. Elucidation of which chromatin reassembly factor mediates the reorganization of chromatin is likely to facilitate the understanding of the host's modulation of HIV-1 transcription and latency. Here we revealed that "Sad1 and UNC84 domain containing 2" (SUN2), an inner nuclear membrane protein, maintained the repressive chromatin and inhibited HIV LTR-driven transcription of proviral DNA through an association with lamin A/C. Specifically, lamin A/C tethered SUN2 to the nucleosomes 1 and 2 of the HIV-1 5'-LTR to block the initiation and elongation of HIV-1 transcription. SUN2 knockdown converted chromatin to an active form and thus enhanced the phosphorylation of RNA polymerase II and its recruitment to the 5'-LTR HIV-1 proviral DNA, leading to reactivation of HIV-1 from latency. Conversely, the exogenous factors such as tumor necrosis factor alpha (TNF-α) induced reactivation, and the replication of HIV-1 led to the disassociation between SUN2 and lamin A/C, suggesting that disruption of the association between SUN2 and lamin A/C to convert the repressive chromatin to the active form might be a prerequisite for the initiation of HIV-1 transcription and replication. Together, our findings indicate that SUN2 is a novel chromatin reassembly factor that helps to maintain chromatin in a repressive state and consequently inhibits HIV-1 transcription. IMPORTANCE Despite the successful use of scores of antiretroviral drugs, HIV latency poses a major impediment to virus eradication. Elucidation of the mechanism of latency facilitates the discovery of new

Insomnia symptoms and repressive coping in a sample of older Black and White women

Directory of Open Access Journals (Sweden)

Pierre-Louis Jessy

2007-01-01

Full Text Available Abstract Background This study examined whether ethnic differences in insomnia symptoms are mediated by differences in repressive coping styles. Methods A total of 1274 women (average age = 59.36 ± 6.53 years participated in the study; 28% were White and 72% were Black. Older women in Brooklyn, NY were recruited using a stratified, cluster-sampling technique. Trained staff conducted face-to-face interviews lasting 1.5 hours acquiring sociodemographic data, health characteristics, and risk factors. A sleep questionnaire was administered and individual repressive coping styles were assessed. Fisher's exact test and Spearman and Pearson analyses were used to analyze the data. Results The rate of insomnia symptoms was greater among White women [74% vs. 46%; χ2 = 87.67, p 1,1272 = 304.75, p s = -0.43, p s = -0.18, p Conclusion Relationships between ethnicity and insomnia symptoms are jointly dependent on the degree of repressive coping, suggesting that Black women may be reporting fewer insomnia symptoms because of a greater ability to route negative emotions from consciousness. It may be that Blacks cope with sleep problems within a positive self-regulatory framework, which allows them to deal more effectively with sleep-interfering psychological processes to stressful life events and to curtail dysfunctional sleep-interpreting processes.

MicroRNA-22 promotes cell survival upon UV radiation by repressing PTEN

International Nuclear Information System (INIS)

Tan, Guangyun; Shi, Yuling; Wu, Zhao-Hui

2012-01-01

Highlights: ► miR-22 is induced in cells treated with UV radiation. ► ATM is required for miR-22 induction in response to UV. ► miR-22 targets 3′-UTR of PTEN to repress its expression in UV-treated cells. ► Upregulated miR-22 inhibits apoptosis in cells exposed to UV. -- Abstract: DNA damage response upon UV radiation involves a complex network of cellular events required for maintaining the homeostasis and restoring genomic stability of the cells. As a new class of players involved in DNA damage response, the regulation and function of microRNAs in response to UV remain poorly understood. Here we show that UV radiation induces a significant increase of miR-22 expression, which appears to be dependent on the activation of DNA damage responding kinase ATM (ataxia telangiectasia mutated). Increased miR-22 expression may result from enhanced miR-22 maturation in cells exposed to UV. We further found that tumor suppressor gene phosphatase and tensin homolog (PTEN) expression was inversely correlated with miR-22 induction and UV-induced PTEN repression was attenuated by overexpression of a miR-22 inhibitor. Moreover, increased miR-22 expression significantly inhibited the activation of caspase signaling cascade, leading to enhanced cell survival upon UV radiation. Collectively, these results indicate that miR-22 is an important player in the cellular stress response upon UV radiation, which may promote cell survival via the repression of PTEN expression.

Repression of RNA polymerase by the archaeo-viral regulator ORF145/RIP

DEFF Research Database (Denmark)

Sheppard, Carol; Blombach, Fabian; Belsom, Adam

2016-01-01

Little is known about how archaeal viruses perturb the transcription machinery of their hosts. Here we provide the first example of an archaeo-viral transcription factor that directly targets the host RNA polymerase (RNAP) and efficiently represses its activity. ORF145 from the temperate Acidianus...

VDAC electronics: 4. Novel electrical mechanism and thermodynamic estimations of glucose repression of yeast respiration.

Science.gov (United States)

Lemeshko, Victor V

2017-11-01

Inhibition of cell respiration by high concentrations of glucose (glucose repression), known as "Crabtree effect", has been demonstrated for various cancerous strains, highly proliferating cells and yeast lines. Although significant progress in understanding metabolic events associated with the glucose repression of cell respiration has been achieved, it is not yet clear whether the Crabtree effect is the result of a limited activity of the respiratory chain, or of some glucose-mediated regulation of mitochondrial metabolic state. In this work we propose an electrical mechanism of glucose repression of the yeast S. cerevisiae, resulting from generation of the mitochondrial outer membrane potential (OMP) coupled to the direct oxidation of cytosolic NADH in mitochondria. This yeast-type mechanism of OMP generation is different from the earlier proposed VDAC-hexokinase-mediated voltage generation of cancer-type, associated with the mitochondrial outer membrane. The model was developed assuming that VDAC is more permeable to NADH than to NAD + . Thermodynamic estimations of OMP, generated as a result of NADH(2-)/NAD + (1-) turnover through the outer membrane, demonstrated that the values of calculated negative OMP match the known range of VDAC voltage sensitivity, thus suggesting a possibility of OMP-dependent VDAC-mediated regulation of cell energy metabolism. According to the proposed mechanism, we suggest that the yeast-type Crabtree effect is the result of a fast VDAC-mediated electrical repression of mitochondria due to a decrease in the outer membrane permeability to charged metabolites and owing their redistribution between the mitochondrial intermembrane space and the cytosol, both controlled by metabolically-derived OMP. Copyright © 2017 Elsevier B.V. All rights reserved.

Malondialdehyde inhibits an AMPK-mediated nuclear translocation and repression activity of ALDH2 in transcription

International Nuclear Information System (INIS)

Choi, Ji-Woong; Kim, Jae-Hwan; Cho, Sung-Chun; Ha, Moon-Kyung; Song, Kye-Yong; Youn, Hong-Duk; Park, Sang Chul

2011-01-01

Research highlights: → ALDH2 is an MDA-modified protein in old rat kidney tissues. → AMPK associates with ALDH2 and triggers the nuclear localization of ALDH2. → ALDH2 serves as a general transcriptional repressor by associating with HDACs. → MDA inhibits the AMPK-mediated translocation of ALDH2 and its repression activity. -- Abstract: Aging process results from deleterious damages by reactive oxygen species, in particular, various metabolic aldehydes. Aldehyde dehydrogenase 2 (ALDH2) is one of metabolic enzymes detoxifying various aldehydes under oxidative conditions. AMP-activated protein kinase (AMPK) plays a key role in controlling metabolic process. However, little was known about the relationship of ALDH2 with AMPK under oxidative conditions. Here, we, by using MDA-specific monoclonal antibody, screened the tissues of young and old rats for MDA-modified proteins and identified an ALDH2 as a prominent MDA-modified protein band in the old rat kidney tissue. ALDH2 associates with AMPK and is phosphorylated by AMPK. In addition, AICAR, an activator of AMP-activated protein kinase, induces the nuclear translocation of ALDH2. ALDH2 in nucleus is involved in general transcription repression by association with histone deacetylases. Furthermore, MDA modification inhibited the translocation of ALDH2 and the association with AMPK, and ultimately led to de-repression of transcription in the reporter system analysis. In this study, we have demonstrated that ALDH2 acts as a transcriptional repressor in response to AMPK activation, and MDA modifies ALDH2 and inhibits repressive activity of ALDH2 in general transcription. We thus suggest that increasing amount of MDA during aging process may interrupt the nuclear function of ALDH2, modulated by AMPK.

Malondialdehyde inhibits an AMPK-mediated nuclear translocation and repression activity of ALDH2 in transcription

Energy Technology Data Exchange (ETDEWEB)

Choi, Ji-Woong [Department of Biomedical Sciences and Biochemistry and Molecular Biology, Seoul National University College of Medicine, 28 Yongon-dong, Chongro-gu, Seoul 110-799 (Korea, Republic of); Aging and Apoptosis Research Center (AARC), Seoul National University College of Medicine, 28 Yongon-dong, Chongro-gu, Seoul 110-799, (Korea, Republic of); Kim, Jae-Hwan [Department of Biomedical Sciences and Biochemistry and Molecular Biology, Seoul National University College of Medicine, 28 Yongon-dong, Chongro-gu, Seoul 110-799 (Korea, Republic of); Cho, Sung-Chun; Ha, Moon-Kyung [Department of Biomedical Sciences and Biochemistry and Molecular Biology, Seoul National University College of Medicine, 28 Yongon-dong, Chongro-gu, Seoul 110-799 (Korea, Republic of); Aging and Apoptosis Research Center (AARC), Seoul National University College of Medicine, 28 Yongon-dong, Chongro-gu, Seoul 110-799, (Korea, Republic of); Song, Kye-Yong [Department of Pathology, Chung-Ang University College of Medicine, Seoul 156-756 (Korea, Republic of); Youn, Hong-Duk, E-mail: hdyoun@snu.ac.kr [Department of Biomedical Sciences and Biochemistry and Molecular Biology, Seoul National University College of Medicine, 28 Yongon-dong, Chongro-gu, Seoul 110-799 (Korea, Republic of); Park, Sang Chul, E-mail: scpark@snu.ac.kr [Department of Biomedical Sciences and Biochemistry and Molecular Biology, Seoul National University College of Medicine, 28 Yongon-dong, Chongro-gu, Seoul 110-799 (Korea, Republic of); Aging and Apoptosis Research Center (AARC), Seoul National University College of Medicine, 28 Yongon-dong, Chongro-gu, Seoul 110-799, (Korea, Republic of)

2011-01-07

Research highlights: {yields} ALDH2 is an MDA-modified protein in old rat kidney tissues. {yields} AMPK associates with ALDH2 and triggers the nuclear localization of ALDH2. {yields} ALDH2 serves as a general transcriptional repressor by associating with HDACs. {yields} MDA inhibits the AMPK-mediated translocation of ALDH2 and its repression activity. -- Abstract: Aging process results from deleterious damages by reactive oxygen species, in particular, various metabolic aldehydes. Aldehyde dehydrogenase 2 (ALDH2) is one of metabolic enzymes detoxifying various aldehydes under oxidative conditions. AMP-activated protein kinase (AMPK) plays a key role in controlling metabolic process. However, little was known about the relationship of ALDH2 with AMPK under oxidative conditions. Here, we, by using MDA-specific monoclonal antibody, screened the tissues of young and old rats for MDA-modified proteins and identified an ALDH2 as a prominent MDA-modified protein band in the old rat kidney tissue. ALDH2 associates with AMPK and is phosphorylated by AMPK. In addition, AICAR, an activator of AMP-activated protein kinase, induces the nuclear translocation of ALDH2. ALDH2 in nucleus is involved in general transcription repression by association with histone deacetylases. Furthermore, MDA modification inhibited the translocation of ALDH2 and the association with AMPK, and ultimately led to de-repression of transcription in the reporter system analysis. In this study, we have demonstrated that ALDH2 acts as a transcriptional repressor in response to AMPK activation, and MDA modifies ALDH2 and inhibits repressive activity of ALDH2 in general transcription. We thus suggest that increasing amount of MDA during aging process may interrupt the nuclear function of ALDH2, modulated by AMPK.

pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.

Science.gov (United States)

Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

2016-07-15

Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.

Salt Sensitive Tet-Off-Like Systems to Knockdown Primordial Germ Cell Genes for Repressible Transgenic Sterilization in Channel Catfish, Ictalurus punctatus.

Science.gov (United States)

Li, Hanbo; Su, Baofeng; Qin, Guyu; Ye, Zhi; Alsaqufi, Ahmed; Perera, Dayan A; Shang, Mei; Odin, Ramjie; Vo, Khoi; Drescher, David; Robinson, Dalton; Zhang, Dan; Abass, Nermeen; Dunham, Rex A

2017-05-31

Repressible knockdown approaches were investigated for transgenic sterilization in channel catfish, Ictalurus punctatus . Two primordial germ cell (PGC) marker genes, nanos and dead end , were targeted for knockdown, and an off-target gene, vasa , was monitored. Two potentially salt sensitive repressible promoters, zebrafish adenylosuccinate synthase 2 (ADSS) and zebrafish racemase (Rm), were each coupled with four knockdown strategies: ds-sh RNA targeting the 5' end (N1) or 3' end (N2) of channel catfish nanos , full-length cDNA sequence of channel catfish nanos for overexpression (cDNA) and ds-sh RNA targeting channel catfish dead end (DND). Each construct had an untreated group and treated group with sodium chloride as the repressor compound. Spawning rates of full-sibling P₁ fish exposed or not exposed to the constructs as treated and untreated embryos were 93% and 59%, respectively, indicating potential sterilization of fish and repression of the constructs. Although the mRNA expression data of PGC marker genes were inconsistent in P₁ fish, most F₁ individuals were able to downregulate the target genes in untreated groups and repress the knockdown process in treated groups. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but more data from F₂ or F₃ are needed for evaluation.

PPARγ partial agonist GQ-16 strongly represses a subset of genes in 3T3-L1 adipocytes

Energy Technology Data Exchange (ETDEWEB)

Milton, Flora Aparecida [Faculdade de Ciências da Saúde, Laboratório de Farmacologia Molecular, Universidade de Brasília (Brazil); Genomic Medicine, Houston Methodist Research Institute, Houston, TX (United States); Cvoro, Aleksandra [Genomic Medicine, Houston Methodist Research Institute, Houston, TX (United States); Amato, Angelica A. [Faculdade de Ciências da Saúde, Laboratório de Farmacologia Molecular, Universidade de Brasília (Brazil); Sieglaff, Douglas H.; Filgueira, Carly S.; Arumanayagam, Anithachristy Sigamani [Genomic Medicine, Houston Methodist Research Institute, Houston, TX (United States); Caro Alves de Lima, Maria do; Rocha Pitta, Ivan [Laboratório de Planejamento e Síntese de Fármacos – LPSF, Universidade Federal de Pernambuco (Brazil); Assis Rocha Neves, Francisco de [Faculdade de Ciências da Saúde, Laboratório de Farmacologia Molecular, Universidade de Brasília (Brazil); Webb, Paul, E-mail: pwebb@HoustonMethodist.org [Genomic Medicine, Houston Methodist Research Institute, Houston, TX (United States)

2015-08-28

Thiazolidinediones (TZDs) are peroxisome proliferator-activated receptor gamma (PPARγ) agonists that improve insulin resistance but trigger side effects such as weight gain, edema, congestive heart failure and bone loss. GQ-16 is a PPARγ partial agonist that improves glucose tolerance and insulin sensitivity in mouse models of obesity and diabetes without inducing weight gain or edema. It is not clear whether GQ-16 acts as a partial agonist at all PPARγ target genes, or whether it displays gene-selective actions. To determine how GQ-16 influences PPARγ activity on a gene by gene basis, we compared effects of rosiglitazone (Rosi) and GQ-16 in mature 3T3-L1 adipocytes using microarray and qRT-PCR. Rosi changed expression of 1156 genes in 3T3-L1, but GQ-16 only changed 89 genes. GQ-16 generally showed weak effects upon Rosi induced genes, consistent with partial agonist actions, but a subset of modestly Rosi induced and strongly repressed genes displayed disproportionately strong GQ-16 responses. PPARγ partial agonists MLR24 and SR1664 also exhibit disproportionately strong effects on transcriptional repression. We conclude that GQ-16 displays a continuum of weak partial agonist effects but efficiently represses some negatively regulated PPARγ responsive genes. Strong repressive effects could contribute to physiologic actions of GQ-16. - Highlights: • GQ-16 is an insulin sensitizing PPARγ ligand with reduced harmful side effects. • GQ-16 displays a continuum of weak partial agonist activities at PPARγ-induced genes. • GQ-16 exerts strong repressive effects at a subset of genes. • These inhibitor actions should be evaluated in models of adipose tissue inflammation.

PPARγ partial agonist GQ-16 strongly represses a subset of genes in 3T3-L1 adipocytes

International Nuclear Information System (INIS)

Milton, Flora Aparecida; Cvoro, Aleksandra; Amato, Angelica A.; Sieglaff, Douglas H.; Filgueira, Carly S.; Arumanayagam, Anithachristy Sigamani; Caro Alves de Lima, Maria do; Rocha Pitta, Ivan; Assis Rocha Neves, Francisco de; Webb, Paul

2015-01-01

Thiazolidinediones (TZDs) are peroxisome proliferator-activated receptor gamma (PPARγ) agonists that improve insulin resistance but trigger side effects such as weight gain, edema, congestive heart failure and bone loss. GQ-16 is a PPARγ partial agonist that improves glucose tolerance and insulin sensitivity in mouse models of obesity and diabetes without inducing weight gain or edema. It is not clear whether GQ-16 acts as a partial agonist at all PPARγ target genes, or whether it displays gene-selective actions. To determine how GQ-16 influences PPARγ activity on a gene by gene basis, we compared effects of rosiglitazone (Rosi) and GQ-16 in mature 3T3-L1 adipocytes using microarray and qRT-PCR. Rosi changed expression of 1156 genes in 3T3-L1, but GQ-16 only changed 89 genes. GQ-16 generally showed weak effects upon Rosi induced genes, consistent with partial agonist actions, but a subset of modestly Rosi induced and strongly repressed genes displayed disproportionately strong GQ-16 responses. PPARγ partial agonists MLR24 and SR1664 also exhibit disproportionately strong effects on transcriptional repression. We conclude that GQ-16 displays a continuum of weak partial agonist effects but efficiently represses some negatively regulated PPARγ responsive genes. Strong repressive effects could contribute to physiologic actions of GQ-16. - Highlights: • GQ-16 is an insulin sensitizing PPARγ ligand with reduced harmful side effects. • GQ-16 displays a continuum of weak partial agonist activities at PPARγ-induced genes. • GQ-16 exerts strong repressive effects at a subset of genes. • These inhibitor actions should be evaluated in models of adipose tissue inflammation

Arabidopsis ETR1 and ERS1 Differentially Repress the Ethylene Response in Combination with Other Ethylene Receptor Genes1[W

Science.gov (United States)

Liu, Qian; Wen, Chi-Kuang

2012-01-01

The ethylene response is negatively regulated by a family of five ethylene receptor genes in Arabidopsis (Arabidopsis thaliana). The five members of the ethylene receptor family can physically interact and form complexes, which implies that cooperativity for signaling may exist among the receptors. The ethylene receptor gene mutations etr1-1(C65Y)(for ethylene response1-1), ers1-1(I62P) (for ethylene response sensor1-1), and ers1C65Y are dominant, and each confers ethylene insensitivity. In this study, the repression of the ethylene response by these dominant mutant receptor genes was examined in receptor-defective mutants to investigate the functional significance of receptor cooperativity in ethylene signaling. We showed that etr1-1(C65Y), but not ers1-1(I62P), substantially repressed various ethylene responses independent of other receptor genes. In contrast, wild-type receptor genes differentially supported the repression of ethylene responses by ers1-1(I62P); ETR1 and ETHYLENE INSENSITIVE4 (EIN4) supported ers1-1(I62P) functions to a greater extent than did ERS2, ETR2, and ERS1. The lack of both ETR1 and EIN4 almost abolished the repression of ethylene responses by ers1C65Y, which implied that ETR1 and EIN4 have synergistic effects on ers1C65Y functions. Our data indicated that a dominant ethylene-insensitive receptor differentially repressed ethylene responses when coupled with a wild-type ethylene receptor, which supported the hypothesis that the formation of a variety of receptor complexes may facilitate differential receptor signal output, by which ethylene responses can be repressed to different extents. We hypothesize that plants can respond to a broad ethylene concentration range and exhibit tissue-specific ethylene responsiveness with differential cooperation of the multiple ethylene receptors. PMID:22227969

Two small RNAs, CrcY and CrcZ, act in concert to sequester the Crc global regulator in Pseudomonas putida, modulating catabolite repression.

Science.gov (United States)

Moreno, Renata; Fonseca, Pilar; Rojo, Fernando

2012-01-01

The Crc protein is a translational repressor that recognizes a specific target at some mRNAs, controlling catabolite repression and co-ordinating carbon metabolism in pseudomonads. In Pseudomonas aeruginosa, the levels of free Crc protein are controlled by CrcZ, a sRNA that sequesters Crc, acting as an antagonist. We show that, in Pseudomonas putida, the levels of free Crc are controlled by CrcZ and by a novel 368 nt sRNA named CrcY. CrcZ and CrcY, which contain six potential targets for Crc, were able to bind Crc specifically in vitro. The levels of CrcZ and CrcY were low under conditions generating a strong catabolite repression, and increased strongly when catabolite repression was absent. Deletion of either crcZ or crcY had no effect on catabolite repression, but the simultaneous absence of both sRNAs led to constitutive catabolite repression that compromised growth on some carbon sources. Overproduction of CrcZ or CrcY significantly reduced repression. We propose that CrcZ and CrcY act in concert, sequestering and modulating the levels of free Crc according to metabolic conditions. The CbrA/CbrB two-component system activated crcZ transcription, but had little effect on crcY. CrcY was detected in P. putida, Pseudomonas fluorescens and Pseudomonas syringae, but not in P. aeruginosa. © 2011 Blackwell Publishing Ltd.

Repressive Adaptive Style and Self-Reported Psychological Functioning in Adolescent Cancer Survivors

Science.gov (United States)

Erickson, Sarah J.; Gerstle, Melissa; Montague, Erica Q.

2008-01-01

Low levels of posttraumatic stress disorder (PTSD), posttraumatic stress symptoms (PTSS), and psychosocial distress have been reported in pediatric cancer survivors. One explanation is the relatively high prevalence of the repressive adaptive style (low distress, high restraint) in this population. We investigated the relationship between this…

Expression, crystallization and preliminary diffraction studies of the Pseudomonas putida cytochrome P450cam operon repressor CamR

International Nuclear Information System (INIS)

Maenaka, Katsumi; Fukushi, Kouji; Aramaki, Hironori; Shirakihara, Yasuo

2005-01-01

The P. putida cytochrome P450cam operon repressor CamR has been expressed in E. coli and crystallized in space group P2 1 2 1 2. The Pseudomonas putida cam repressor (CamR) is a homodimeric protein that binds to the camO DNA operator to inhibit the transcription of the cytochrome P450cam operon camDCAB. CamR has two functional domains: a regulatory domain and a DNA-binding domain. The binding of the inducer d-camphor to the regulatory domain renders the DNA-binding domain unable to bind camO. Native CamR and its selenomethionyl derivative have been overproduced in Escherichia coli and purified. Native CamR was crystallized under the following conditions: (i) 12–14% PEG 4000, 50 mM Na PIPES, 0.1 M KCl, 1% glycerol pH 7.3 at 288 K with and without camphor and (ii) 1.6 M P i , 50 mM Na PIPES, 2 mM camphor pH 6.7 at 278 K. The selenomethionyl derivative CamR did not crystallize under either of these conditions, but did crystallize using 12.5% PEG MME 550, 25 mM Na PIPES, 2.5 mM MgCl 2 pH 7.3 at 298 K. Preliminary X-ray diffraction studies revealed the space group to be orthorhombic (P2 1 2 1 2), with unit-cell parameters a = 48.0, b = 73.3, c = 105.7 Å. Native and selenomethionyl derivative data sets were collected to 3 Å resolution at SPring-8 and the Photon Factory

Epigenetic involvement of Alien/ESET complex in thyroid hormone-mediated repression of E2F1 gene expression and cell proliferation

Energy Technology Data Exchange (ETDEWEB)

Hong, Wei, E-mail: hongwei@tijmu.edu.cn [Department of Immunology, Tianjin Medical University, 300070 Tianjin (China); College of Basic Medicine, Tianjin Medical University, 300070 Tianjin (China); Li, Jinru; Wang, Bo [College of Basic Medicine, Tianjin Medical University, 300070 Tianjin (China); Chen, Linfeng [Department of Medical Oncology, Harvard Medical School, Dana Farber Cancer Institute, Boston, 02115 MA (United States); Niu, Wenyan; Yao, Zhi [Department of Immunology, Tianjin Medical University, 300070 Tianjin (China); Baniahmad, Aria, E-mail: aban@mti.uni-jena.de [Institute for Human Genetics, Jena University Hospital, 07740 Jena (Germany)

2011-12-02

Highlights: Black-Right-Pointing-Pointer Corepressor Alien interacts with histone methyltransferase ESET in vivo. Black-Right-Pointing-Pointer Alien/ESET complex is recruited to nTRE of T3-responsive gene by liganded TR{beta}1. Black-Right-Pointing-Pointer ESET-mediated H3K9 methylation is required for liganded TR{beta}1-repressed transcription. Black-Right-Pointing-Pointer ESET is involved in T3-repressed G1/S phase transition and proliferation. -- Abstract: The ligand-bound thyroid hormone receptor (TR) is known to repress via a negative TRE (nTRE) the expression of E2F1, a key transcription factor that controls the G1/S phase transition. Alien has been identified as a novel interacting factor of E2F1 and acts as a corepressor of E2F1. The detailed molecular mechanism by which Alien inhibits E2F1 gene expression remains unclear. Here, we report that the histone H3 lysine 9 (H3K9) methyltransferase (HMT) ESET is an integral component of the corepressor Alien complex and the Alien/ESET complex is recruited to both sites, the E2F1 and the nTRE site of the E2F1 gene while the recruitment to the negative thyroid hormone response element (nTRE) is induced by the ligand-bound TR{beta}1 within the E2F1 gene promoter. We show that, overexpression of ESET promotes, whereas knockdown of ESET releases, the inhibition of TR{beta}1-regulated gene transcription upon T3 stimulation; and H3K9 methylation is required for TR{beta}1-repressed transcription. Furthermore, depletion of ESET impairs thyroid hormone-repressed proliferation as well as the G1/S transition of the cell cycle. Taken together, our data indicate that ESET is involved in TR{beta}1-mediated transcription repression and provide a molecular basis of thyroid hormone-induced repression of proliferation.

NFE2 Induces miR-423-5p to Promote Gluconeogenesis and Hyperglycemia by Repressing the Hepatic FAM3A-ATP-Akt Pathway.

Science.gov (United States)

Yang, Weili; Wang, Junpei; Chen, Zhenzhen; Chen, Ji; Meng, Yuhong; Chen, Liming; Chang, Yongsheng; Geng, Bin; Sun, Libo; Dou, Lin; Li, Jian; Guan, Youfei; Cui, Qinghua; Yang, Jichun

2017-07-01

Hepatic FAM3A expression is repressed under obese conditions, but the underlying mechanism remains unknown. This study determined the role and mechanism of miR-423-5p in hepatic glucose and lipid metabolism by repressing FAM3A expression. miR-423-5p expression was increased in the livers of obese diabetic mice and in patients with nonalcoholic fatty liver disease (NAFLD) with decreased FAM3A expression. miR-423-5p directly targeted FAM3A mRNA to repress its expression and the FAM3A-ATP-Akt pathway in cultured hepatocytes. Hepatic miR-423-5p inhibition suppressed gluconeogenesis and improved insulin resistance, hyperglycemia, and fatty liver in obese diabetic mice. In contrast, hepatic miR-423-5p overexpression promoted gluconeogenesis and hyperglycemia and increased lipid deposition in normal mice. miR-423-5p inhibition activated the FAM3A-ATP-Akt pathway and repressed gluconeogenic and lipogenic gene expression in diabetic mouse livers. The miR-423 precursor gene was further shown to be a target gene of NFE2, which induced miR-423-5p expression to repress the FAM3A-ATP-Akt pathway in cultured hepatocytes. Hepatic NFE2 overexpression upregulated miR-423-5p to repress the FAM3A-ATP-Akt pathway, promoting gluconeogenesis and lipid deposition and causing hyperglycemia in normal mice. In conclusion, under the obese condition, activation of the hepatic NFE2/miR-423-5p axis plays important roles in the progression of type 2 diabetes and NAFLD by repressing the FAM3A-ATP-Akt signaling pathway. © 2017 by the American Diabetes Association.

High-Level Heat Resistance of Spores of Bacillus amyloliquefaciens and Bacillus licheniformis Results from the Presence of a spoVA Operon in a Tn1546 Transposon

NARCIS (Netherlands)

Berendsen, Erwin M; Koning, Rosella A; Boekhorst, Jos; de Jong, Anne; Kuipers, Oscar P; Wells-Bennik, Marjon H J

2016-01-01

Bacterial endospore formers can produce spores that are resistant to many food processing conditions, including heat. Some spores may survive heating processes aimed at production of commercially sterile foods. Recently, it was shown that a spoVA operon, designated spoVA(2mob), present on a Tn1546

Revisiting progesterone receptor (PR) actions in breast cancer: Insights into PR repressive functions.

Science.gov (United States)

Proietti, Cecilia J; Cenciarini, Mauro E; Elizalde, Patricia V

2018-05-01

Progesterone receptor (PR) is a master regulator in female reproductive tissues that controls developmental processes and proliferation and differentiation during the reproductive cycle and pregnancy. PR also plays a role in progression of endocrine-dependent breast cancer. As a member of the nuclear receptor family of ligand-dependent transcription factors, the main action of PR is to regulate networks of target gene expression in response to binding its cognate steroid hormone, progesterone. Liganded-PR transcriptional activation has been thoroughly studied and associated mechanisms have been described while progesterone-mediated repression has remained less explored. The present work summarizes recent advances in the understanding of how PR-mediated repression is accomplished in breast cancer cells and highlights the significance of fully understanding the determinants of context-dependent PR action. Copyright © 2018 Elsevier Inc. All rights reserved.

A non-canonical Flt3ITD/NF-κB signaling pathway represses DAPK1 in acute myeloid leukemia (AML)

Science.gov (United States)

Shanmugam, Rajasubramaniam; Sayar, Hamid; Suvannasankha, Attaya; Goswami, Chirayu; Li, Lang; Gupta, Sushil; Cardoso, Angelo A.; Baghdadi, Tareq Al; Sargent, Katie J.; Cripe, Larry D.; Kalvakolanu, Dhananjaya V.; Boswell, H. Scott

2014-01-01

Purpose DAPK1, a tumor suppressor, is a rate-limiting effector in an ER stress-dependent apoptotic pathway. Its expression is epigenetically suppressed in several tumors. A mechanistic basis for epigenetic/transcriptional repression of DAPK1 was investigated in certain forms of AML with poor prognosis, which lacked ER stress-induced apoptosis. Experimental Design Heterogeneous primary AMLs were screened to identify a subgroup with Flt3ITD in which repression of DAPK1, among NF-κB- and c- jun-responsive genes, was studied. RNAi knockdown studies were performed in Flt3ITD+ve cell line, MV-4-11, to establish genetic epistasis in the pathway Flt3ITD-TAK1-DAPK1 repression, and chromatin immunoprecipitations were performed to identify proximate effector proteins, including TAK1-activated p52NF-κB, at the DAPK1 locus. Results AMLs characterized by normal karyotype with Flt3ITD were found to have 10-100-fold lower DAPK1 transcripts normalized to the expression of c-jun, a transcriptional activator of DAPK1, as compared to a heterogeneous cytogenetic category. Meis1, a c-jun-responsive adverse AML prognostic gene signature was also measured as control. These Flt3ITD+ve AMLs over-express relB, a transcriptional repressor, which forms active heterodimers with p52NF-κB. Chromatin immunoprecipitation assays identified p52NF-κB binding to the DAPK1 promoter along with HDAC2 and HDAC6 in the Flt3ITD+ve human AML cell line MV-4-11. Knockdown of p52NF-κB or its upstream regulator, NIK, de-repressed DAPK1. DAPK1-repressed primary Flt3ITD+ve AMLs had selective nuclear activation of p52NF-κB. Conclusions Flt3ITD promotes a non-canonical pathway via TAK1 and p52NF-κB to suppress DAPK1 in association with HDACs, which explains DAPK1 repression in Flt3ITD+ve AML. PMID:22096027

Blood-Brain Glucose Transfer: Repression in Chronic Hyperglycemia

Science.gov (United States)

Gjedde, Albert; Crone, Christian

1981-10-01

Diabetic patients with increased plasma glucose concentrations may develop cerebral symptoms of hypoglycemia when their plasma glucose is rapidly lowered to normal concentrations. The symptoms may indicate insufficient transport of glucose from blood to brain. In rats with chronic hyperglycemia the maximum glucose transport capacity of the blood-brain barrier decreased from 400 to 290 micromoles per 100 grams per minute. When plasma glucose was lowered to normal values, the glucose transport rate into brain was 20 percent below normal. This suggests that repressive changes of the glucose transport mechanism occur in brain endothelial cells in response to increased plasma glucose.

SMRT repression of nuclear receptors controls the adipogenic set point and metabolic homeostasis

NARCIS (Netherlands)

Nofsinger, Russell R.; Li, Pingping; Hong, Suk-Hyun; Jonker, Johan W.; Barish, Grant D.; Ying, Hao; Cheng, Sheue-Yann; LeBlanc, Mathias; Xu, Wei; Pei, Liming; Kang, Yeon-Joo; Nelson, Michael; Downes, Michael; Yu, Ruth T.; Olefsky, Jerrold M.; Lee, Chih-Hao; Evans, Ronald M.

2008-01-01

The nuclear receptor corepressor, silencing mediator of retinoid and thyroid hormone receptors (SMRT), is recruited by a plethora of transcription factors to mediate lineage and signal-dependent transcriptional repression. We generated a knockin mutation in the receptor interaction domain (RID) of

Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression

Science.gov (United States)

Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet

2015-01-01

Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450

Light represses transcription of asparagine synthetase genes in photosynthetic and nonphotosynthetic organs of plants

Energy Technology Data Exchange (ETDEWEB)

Tsai, Fongying; Coruzzi, G. (Rockefeller Univ., New York, NY (United States))

1991-10-01

Asparagine synthetase (AS) mRNA in Pisum sativum accumulates preferentially in plants grown in the dark. Nuclear run-on experiments demonstrate that expression of both the AS1 and AS2 genes is negatively regulated by light at the level of transcription. A decrease in the transcriptional rate of the AS1 gene can be detected as early as 20 min after exposure to light. Time course experiments reveal that the levels of AS mRNA fluctuate dramatically during a normal light/dark cycle. This is due to a direct effect of light and not to changes associated with circadian rhythm. A novel finding is that the light-repressed expression of the AS1 gene is as dramatic nonphotosynthetic organs such as roots as it is in leaves. Experiments demonstrate that the small amount of light which passes through the soil is sufficient to repress AS1 expression in roots, indicating that light has a direct effect on AS1 gene expression in roots. The negative regulation of AS gene expression by light was shown to be a general phenomenon in plants which also occurs in nonlegumes such as Nicotiana plumbaginifolia and Nicotiana tabacum. Thus, the AS genes can serve as a model with which to dissect the molecular basis for light-regulated transcriptional repression in plants.

Induction of the gap-pgk operon encoding glyceraldehyde-3-phosphate dehydrogenase and 3-phosphoglycerate kinase of Xanthobacter flavus requires the LysR-type transcriptional activator CbbR

NARCIS (Netherlands)

Meijer, W.G; van den Bergh, E.R E; Smith, L.M

In a previous study, a gene (pgk) encoding phosphoglycerate kinase was isolated from a genomic labrid of Xanthobacter flavus. Although this gene is essential for autotrophic growth, it is not located within the cbb operon encoding other Calvin cycle enzymes. An analysis of the nucleotide sequence

Salt Sensitive Tet-Off-Like Systems to Knockdown Primordial Germ Cell Genes for Repressible Transgenic Sterilization in Channel Catfish, Ictalurus punctatus

Directory of Open Access Journals (Sweden)

Hanbo Li

2017-05-01

Full Text Available Repressible knockdown approaches were investigated for transgenic sterilization in channel catfish, Ictalurus punctatus. Two primordial germ cell (PGC marker genes, nanos and dead end, were targeted for knockdown, and an off-target gene, vasa, was monitored. Two potentially salt sensitive repressible promoters, zebrafish adenylosuccinate synthase 2 (ADSS and zebrafish racemase (Rm, were each coupled with four knockdown strategies: ds-sh RNA targeting the 5′ end (N1 or 3′ end (N2 of channel catfish nanos, full-length cDNA sequence of channel catfish nanos for overexpression (cDNA and ds-sh RNA targeting channel catfish dead end (DND. Each construct had an untreated group and treated group with sodium chloride as the repressor compound. Spawning rates of full-sibling P1 fish exposed or not exposed to the constructs as treated and untreated embryos were 93% and 59%, respectively, indicating potential sterilization of fish and repression of the constructs. Although the mRNA expression data of PGC marker genes were inconsistent in P1 fish, most F1 individuals were able to downregulate the target genes in untreated groups and repress the knockdown process in treated groups. The results indicate that repressible transgenic sterilization is feasible for reproductive control of fish, but more data from F2 or F3 are needed for evaluation.

DNA residence time is a regulatory factor of transcription repression

Science.gov (United States)

Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette

2017-01-01

Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492

Histone deacetylase 3 represses p15INK4b and p21WAF1/cip1 transcription by interacting with Sp1