WorldWideScience

Sample records for previous studies identified

  1. Case-control study for colorectal cancer genetic susceptibility in EPICOLON: previously identified variants and mucins

    Directory of Open Access Journals (Sweden)

    Moreno Victor

    2011-08-01

    Full Text Available Abstract Background Colorectal cancer (CRC is the second leading cause of cancer death in developed countries. Familial aggregation in CRC is also important outside syndromic forms and, in this case, a polygenic model with several common low-penetrance alleles contributing to CRC genetic predisposition could be hypothesized. Mucins and GALNTs (N-acetylgalactosaminyltransferase are interesting candidates for CRC genetic susceptibility and have not been previously evaluated. We present results for ten genetic variants linked to CRC risk in previous studies (previously identified category and 18 selected variants from the mucin gene family in a case-control association study from the Spanish EPICOLON consortium. Methods CRC cases and matched controls were from EPICOLON, a prospective, multicenter, nationwide Spanish initiative, comprised of two independent stages. Stage 1 corresponded to 515 CRC cases and 515 controls, whereas stage 2 consisted of 901 CRC cases and 909 controls. Also, an independent cohort of 549 CRC cases and 599 controls outside EPICOLON was available for additional replication. Genotyping was performed for ten previously identified SNPs in ADH1C, APC, CCDN1, IL6, IL8, IRS1, MTHFR, PPARG, VDR and ARL11, and 18 selected variants in the mucin gene family. Results None of the 28 SNPs analyzed in our study was found to be associated with CRC risk. Although four SNPs were significant with a P-value ADH1C (OR = 1.63, 95% CI = 1.06-2.50, P-value = 0.02, recessive, rs1800795 in IL6 (OR = 1.62, 95% CI = 1.10-2.37, P-value = 0.01, recessive, rs3803185 in ARL11 (OR = 1.58, 95% CI = 1.17-2.15, P-value = 0.007, codominant, and rs2102302 in GALNTL2 (OR = 1.20, 95% CI = 1.00-1.44, P-value = 0.04, log-additive 0, 1, 2 alleles], only rs3803185 achieved statistical significance in EPICOLON stage 2 (OR = 1.34, 95% CI = 1.06-1.69, P-value = 0.01, recessive. In the joint analysis for both stages, results were only significant for rs3803185 (OR = 1

  2. Case-control study for colorectal cancer genetic susceptibility in EPICOLON: previously identified variants and mucins

    International Nuclear Information System (INIS)

    Abulí, Anna; Morillas, Juan D; Rigau, Joaquim; Latorre, Mercedes; Fernández-Bañares, Fernando; Peña, Elena; Riestra, Sabino; Payá, Artemio; Jover, Rodrigo; Xicola, Rosa M; Llor, Xavier; Fernández-Rozadilla, Ceres; Carvajal-Carmona, Luis; Villanueva, Cristina M; Moreno, Victor; Piqué, Josep M; Carracedo, Angel; Castells, Antoni; Andreu, Montserrat; Ruiz-Ponte, Clara; Castellví-Bel, Sergi; Alonso-Espinaco, Virginia; Muñoz, Jenifer; Gonzalo, Victoria; Bessa, Xavier; González, Dolors; Clofent, Joan; Cubiella, Joaquin

    2011-01-01

    Colorectal cancer (CRC) is the second leading cause of cancer death in developed countries. Familial aggregation in CRC is also important outside syndromic forms and, in this case, a polygenic model with several common low-penetrance alleles contributing to CRC genetic predisposition could be hypothesized. Mucins and GALNTs (N-acetylgalactosaminyltransferase) are interesting candidates for CRC genetic susceptibility and have not been previously evaluated. We present results for ten genetic variants linked to CRC risk in previous studies (previously identified category) and 18 selected variants from the mucin gene family in a case-control association study from the Spanish EPICOLON consortium. CRC cases and matched controls were from EPICOLON, a prospective, multicenter, nationwide Spanish initiative, comprised of two independent stages. Stage 1 corresponded to 515 CRC cases and 515 controls, whereas stage 2 consisted of 901 CRC cases and 909 controls. Also, an independent cohort of 549 CRC cases and 599 controls outside EPICOLON was available for additional replication. Genotyping was performed for ten previously identified SNPs in ADH1C, APC, CCDN1, IL6, IL8, IRS1, MTHFR, PPARG, VDR and ARL11, and 18 selected variants in the mucin gene family. None of the 28 SNPs analyzed in our study was found to be associated with CRC risk. Although four SNPs were significant with a P-value < 0.05 in EPICOLON stage 1 [rs698 in ADH1C (OR = 1.63, 95% CI = 1.06-2.50, P-value = 0.02, recessive), rs1800795 in IL6 (OR = 1.62, 95% CI = 1.10-2.37, P-value = 0.01, recessive), rs3803185 in ARL11 (OR = 1.58, 95% CI = 1.17-2.15, P-value = 0.007, codominant), and rs2102302 in GALNTL2 (OR = 1.20, 95% CI = 1.00-1.44, P-value = 0.04, log-additive 0, 1, 2 alleles], only rs3803185 achieved statistical significance in EPICOLON stage 2 (OR = 1.34, 95% CI = 1.06-1.69, P-value = 0.01, recessive). In the joint analysis for both stages, results were only significant for rs3803185 (OR = 1.12, 95% CI = 1

  3. Detection of previously undiagnosed cases of COPD in a high-risk population identified in general practice

    DEFF Research Database (Denmark)

    Løkke, Anders; Ulrik, Charlotte Suppli; Dahl, Ronald

    2012-01-01

    Background and Aim: Under-diagnosis of COPD is a widespread problem. This study aimed to identify previously undiagnosed cases of COPD in a high-risk population identified through general practice. Methods: Participating GPs (n = 241) recruited subjects with no previous diagnosis of lung disease,...

  4. Previously unidentified changes in renal cell carcinoma gene expression identified by parametric analysis of microarray data

    International Nuclear Information System (INIS)

    Lenburg, Marc E; Liou, Louis S; Gerry, Norman P; Frampton, Garrett M; Cohen, Herbert T; Christman, Michael F

    2003-01-01

    Renal cell carcinoma is a common malignancy that often presents as a metastatic-disease for which there are no effective treatments. To gain insights into the mechanism of renal cell carcinogenesis, a number of genome-wide expression profiling studies have been performed. Surprisingly, there is very poor agreement among these studies as to which genes are differentially regulated. To better understand this lack of agreement we profiled renal cell tumor gene expression using genome-wide microarrays (45,000 probe sets) and compare our analysis to previous microarray studies. We hybridized total RNA isolated from renal cell tumors and adjacent normal tissue to Affymetrix U133A and U133B arrays. We removed samples with technical defects and removed probesets that failed to exhibit sequence-specific hybridization in any of the samples. We detected differential gene expression in the resulting dataset with parametric methods and identified keywords that are overrepresented in the differentially expressed genes with the Fisher-exact test. We identify 1,234 genes that are more than three-fold changed in renal tumors by t-test, 800 of which have not been previously reported to be altered in renal cell tumors. Of the only 37 genes that have been identified as being differentially expressed in three or more of five previous microarray studies of renal tumor gene expression, our analysis finds 33 of these genes (89%). A key to the sensitivity and power of our analysis is filtering out defective samples and genes that are not reliably detected. The widespread use of sample-wise voting schemes for detecting differential expression that do not control for false positives likely account for the poor overlap among previous studies. Among the many genes we identified using parametric methods that were not previously reported as being differentially expressed in renal cell tumors are several oncogenes and tumor suppressor genes that likely play important roles in renal cell

  5. Development of a Simple Tool for Identifying Alcohol Use Disorder in Female Korean Drinkers from Previous Questionnaires.

    Science.gov (United States)

    Seo, Yu Ri; Kim, Jong Sung; Kim, Sung Soo; Yoon, Seok Joon; Suh, Won Yoon; Youn, Kwangmi

    2016-01-01

    This study aimed to develop a simple tool for identifying alcohol use disorders in female Korean drinkers from previous questionnaires. This research was conducted on 400 women who consumed at least one alcoholic drink during the past month and visited the health promotion center at Chungnam National University Hospital between June 2013 to May 2014. Drinking habits and alcohol use disorders were assessed by structured interviews using the Diagnostic and Statistical Manual of Mental Disorders, 5th Edition diagnostic criteria. The subjects were also asked to answer the Alcohol Use Disorders Identification Test (AUDIT), AUDIT-Consumption, CAGE (Cut down, Annoyed, Guilty, Eye-opener), TWEAK (Tolerance, Worried, Eye-opener, Amnesia, Kut down), TACE (Tolerance, Annoyed, Cut down, Eye-opener), and NET (Normal drinker, Eye-opener, Tolerance) questionnaires. The area under receiver operating characteristic (AUROC) of each question of the questionnaires on alcohol use disorders was assessed. After combining two questions with the largest AUROC, it was compared to other previous questionnaires. Among the 400 subjects, 58 (14.5%) were identified as having an alcohol use disorder. Two questions with the largest AUROC were question no. 7 in AUDIT, "How often during the last year have you had a feeling of guilt or remorse after drinking?" and question no. 5 in AUDIT, "How often during the past year have you failed to do what was normally expected from you because of drinking?" with an AUROC (95% confidence interval [CI]) of 0.886 (0.850-0.915) and 0.862 (0.824-0.894), respectively. The AUROC (95% CI) of the combination of the two questions was 0.958 (0.934-0.976) with no significant difference as compared to the existing AUDIT with the largest AUROC. The above results suggest that the simple tool consisting of questions no. 5 and no. 7 in AUDIT is useful in identifying alcohol use disorders in Korean female drinkers.

  6. Using an epiphytic moss to identify previously unknown sources of atmospheric cadmium pollution

    Science.gov (United States)

    Geoffrey H. Donovan; Sarah E. Jovan; Demetrios Gatziolis; Igor Burstyn; Yvonne L. Michael; Michael C. Amacher; Vicente J. Monleon

    2016-01-01

    Urban networks of air-quality monitors are often too widely spaced to identify sources of air pollutants, especially if they do not disperse far from emission sources. The objectives of this study were to test the use of moss bio-indicators to develop a fine-scale map of atmospherically-derived cadmium and to identify the sources of cadmium in a complex urban setting....

  7. On the Tengiz petroleum deposit previous study

    International Nuclear Information System (INIS)

    Nysangaliev, A.N.; Kuspangaliev, T.K.

    1997-01-01

    Tengiz petroleum deposit previous study is described. Some consideration about structure of productive formation, specific characteristic properties of petroleum-bearing collectors are presented. Recommendation on their detail study and using of experience on exploration and development of petroleum deposit which have analogy on most important geological and industrial parameters are given. (author)

  8. Estimating the effect of current, previous and never use of drugs in studies based on prescription registries

    DEFF Research Database (Denmark)

    Nielsen, Lars Hougaard; Løkkegaard, Ellen; Andreasen, Anne Helms

    2009-01-01

    of this misclassification for analysing the risk of breast cancer. MATERIALS AND METHODS: Prescription data were obtained from Danish Registry of Medicinal Products Statistics and we applied various methods to approximate treatment episodes. We analysed the duration of HT episodes to study the ability to identify......PURPOSE: Many studies which investigate the effect of drugs categorize the exposure variable into never, current, and previous use of the study drug. When prescription registries are used to make this categorization, the exposure variable possibly gets misclassified since the registries do...... not carry any information on the time of discontinuation of treatment.In this study, we investigated the amount of misclassification of exposure (never, current, previous use) to hormone therapy (HT) when the exposure variable was based on prescription data. Furthermore, we evaluated the significance...

  9. 40 CFR 152.93 - Citation of a previously submitted valid study.

    Science.gov (United States)

    2010-07-01

    ... Data Submitters' Rights § 152.93 Citation of a previously submitted valid study. An applicant may demonstrate compliance for a data requirement by citing a valid study previously submitted to the Agency. The... the original data submitter, the applicant may cite the study only in accordance with paragraphs (b...

  10. Association between previously identified loci affecting telomere length and coronary heart disease (CHD in Han Chinese population

    Directory of Open Access Journals (Sweden)

    Ding H

    2014-05-01

    Full Text Available Hui Ding,1 Fen Yan,1 Lin-Lin Zhou,2 Xiu-Hai Ji,3 Xin-Nan Gu,1 Zhi-Wei Tang,1 Ru-Hua Chen11Department of Pulmonary Medicine, The Affiliated Yixing People's Hospital, Jiangsu University, Zhenjiang, Jiangsu Province, 2Department of Cardiology, Affiliated Cixi Hospital, Wenzhou Medical University, Wenzhou, Zhejiang Province, 3Department of Oncology, Affiliated Taicang Hospital of Traditional Chinese Medicine, Suzhou, Jiangsu Province, People's Republic of ChinaPurpose: To replicate previously confirmed telomere-length loci in a Chinese Han population with coronary heart disease (CHD, and investigate these loci and the possibility of and age at onset of CHD.Patients and methods: 1514 CHD patients and 2470 normal controls were recruited. Medical data including age, sex, body mass index, lipid profiles, history of hypertension, type 2 diabetes mellitus, and dyslipidemia were collected from all the participants. Seven previously identified single-nucleotide polymorphisms (SNPs related to leucocyte telomere length were genotyped, including rs10936599 in TERC, rs2736100 in TERT, rs7675998 in NAF1, rs9420907 in OBFC1, rs8105767 in ZNF208, rs755017 in RTEL1, and rs11125529 in ACYP2.Results: No significant difference in genotype frequencies from the Hardy–Weinberg equilibrium test was noted for all tested SNPs both in the CHD patients and the normal controls. No polymorphism was observed for rs9420907, and AA genotype was noted in both the CHD patients and the controls. Neither the genotype nor the allele frequencies of rs2736100, rs8105767, rs11125529, and rs2967374 were significantly different between the CHD patients and the normal controls. For rs10936599 and rs755017, statistical difference was found for the allele frequency but not genotype. Distributions of genotype and allele were significantly different between the two groups for rs7675998. The odds ratio for carriers of CHD was 2.127 (95% confidence interval: 1.909–2.370 for the A allele of rs

  11. Genome-wide association study identifies multiple risk loci for chronic lymphocytic leukemia

    OpenAIRE

    Berndt, S.I.; Skibola, C.F.; Joseph, V.; Camp, N.J.; Nieters, A.; Wang, Z.; Cozen, W.; Monnereau, A.; Wang, S.S.; Kelly, R.S.; Lan, Q.; Teras, L.R.; Chatterjee, N.; Chung, C.C.; Yeager, M.

    2013-01-01

    Genome-wide association studies (GWAS) have previously identified 13 loci associated with risk of chronic lymphocytic leukemia or small lymphocytic lymphoma (CLL). To identify additional CLL susceptibility loci, we conducted the largest meta-analysis for CLL thus far, including four GWAS with a total of 3,100 individuals with CLL (cases) and 7,667 controls. In the meta-analysis, we identified ten independent associated SNPs in nine new loci at 10q23.31 (ACTA2 or FAS (ACTA2/FAS), P = 1.22 × 10...

  12. Sudden unexpected death in children with a previously diagnosed cardiovascular disorder

    NARCIS (Netherlands)

    Polderman, Florens N.; Cohen, Joeri; Blom, Nico A.; Delhaas, Tammo; Helbing, Wim A.; Lam, Jan; Sobotka-Plojhar, Marta A.; Temmerman, Arno M.; Sreeram, Narayanswani

    2004-01-01

    BACKGROUND: It is known that children with previously diagnosed heart defects die suddenly. The causes of death are often unknown. OBJECTIVE: The aim of the study was to identify all infants and children within the Netherlands with previously diagnosed heart disease who had a sudden unexpected death

  13. Sudden unexpected death in children with a previously diagnosed cardiovascular disorder

    NARCIS (Netherlands)

    Polderman, F.N.; Cohen, Joeri; Blom, N.A.; Delhaas, T.; Helbing, W.A.; Lam, J.; Sobotka-Plojhar, M.A.; Temmerman, Arno M.; Sreeram, N.

    2004-01-01

    Background: It is known that children with previously diagnosed heart defects die suddenly. The causes of death are often unknown. Objective: The aim of the study was to identify all infants and children within the Netherlands with previously diagnosed heart disease who had a sudden unexpected death

  14. Efficient Culture Adaptation of Hepatitis C Virus Recombinants with Genotype-Specific Core-NS2 by Using Previously Identified Mutations

    DEFF Research Database (Denmark)

    Scheel, Troels Kasper Høyer; Gottwein, Judith M; Carlsen, Thomas H R

    2011-01-01

    Hepatitis C virus (HCV) is an important cause of chronic liver disease, and interferon-based therapy cures only 40 to 80% of patients, depending on HCV genotype. Research was accelerated by genotype 2a (strain JFH1) infectious cell culture systems. We previously developed viable JFH1-based...... (HC-TN and DH6), 1b (DH1 and DH5), and 3a (DBN) isolates, using previously identified adaptive mutations. Introduction of mutations from isolates of the same subtype either led to immediate efficient virus production or accelerated culture adaptation. The DH6 and DH5 recombinants without introduced...... mutations did not adapt to culture. Universal adaptive effects of mutations in NS3 (Q1247L, I1312V, K1398Q, R1408W, and Q1496L) and NS5A (V2418L) were investigated for JFH1-based genotype 1 to 5 core-NS2 recombinants; several mutations conferred adaptation to H77C (1a), J4 (1b), S52 (3a), and SA13 (5a...

  15. Genome-wide Association Study Identifies Five Susceptibility Loci for Follicular Lymphoma outside the HLA Region

    NARCIS (Netherlands)

    Skibola, Christine F.; Berndt, Sonja I.; Vijai, Joseph; Conde, Lucia; Wang, Zhaoming; Yeager, Meredith; de Bakker, Paul I. W.; Birmann, Brenda M.; Vajdic, Claire M.; Foo, Jia-Nee; Bracci, Paige M.; Vermeulen, Roel C. H.; Slager, Susan L.; de Sanjose, Silvia; Wang, Sophia S.; Linet, Martha S.; Salles, Gilles; Lan, Qing; Severi, Gianluca; Hjalgrim, Henrik; Lightfoot, Tracy; Melbye, Mads; Gu, Jian; Ghesquieres, Herve; Link, Brian K.; Morton, Lindsay M.; Holly, Elizabeth A.; Smith, Alex; Tinker, Lesley F.; Teras, Lauren R.; Kricker, Anne; Becker, Nikolaus; Purdue, Mark P.; Spinelli, John J.; Zhang, Yawei; Giles, Graham G.; Vineis, Paolo; Monnereau, Alain; Bertrand, Kimberly A.; Albanes, Demetrius; Zeleniuch-Jacquotte, Anne; Gabbas, Attilio; Chung, Charles C.; Burdett, Laurie; Hutchinson, Amy; Lawrence, Charles; Montalvan, Rebecca; Liang, Liming; Huang, Jinyan; Ma, Baoshan; Liu, Jianjun; Adami, Hans-Olov; Glimelius, Bengt; Ye, Yuanqing; Nowakowski, Grzegorz S.; Dogan, Ahmet; Thompson, Carrie A.; Habermann, Thomas M.; Novak, Anne J.; Liebow, Mark; Witzig, Thomas E.; Weiner, George J.; Schenk, Maryjean; Hartge, Patricia; De Roos, Anneclaire J.; Cozen, Wendy; Zhi, Degui; Akers, Nicholas K.; Riby, Jacques; Smith, Martyn T.; Lacher, Mortimer; Villano, Danylo J.; Maria, Ann; Roman, Eve; Kane, Eleanor; Jackson, Rebecca D.; North, Kari E.; Diver, W. Ryan; Turner, Jenny; Armstrong, Bruce K.; Benavente, Yolanda; Boffetta, Paolo; Brennan, Paul; Foretova, Lenka; Maynadie, Marc; Staines, Anthony; McKay, James; Brooks-Wilson, Angela R.; Zheng, Tongzhang; Holford, Theodore R.; Chamosa, Saioa; Kaaks, Rudolph; Kelly, Rachel S.; Ohlsson, Bodil; Travis, Ruth C.; Weiderpass, Elisabete; Clave, Jacqueline; Giovannucci, Edward; Kraft, Peter; Virtamo, Jarmo; Mazza, Patrizio; Cocco, Pierluigi; Ennas, Maria Grazia; Chiu, Brian C. H.; Fraumeni, Joseph R.; Nieters, Alexandra; Offit, Kenneth; Wu, Xifeng; Cerhan, James R.; Smedby, Karin E.; Chanock, Stephen J.; Rothman, Nathaniel

    2014-01-01

    Genome-wide association studies (GWASs) of follicular lymphoma (FL) have previously identified human leukocyte antigen (HLA) gene variants. To identify additional FL susceptibility loci, we conducted a large-scale two-stage GWAS in 4,523 case subjects and 13,344 control subjects of European

  16. The job satisfaction of principals of previously disadvantaged schools

    African Journals Online (AJOL)

    The aim of this study was to identify influences on the job satisfaction of previously disadvantaged ..... I am still riding the cloud … I hope it lasts. .... as a way of creating a climate and culture in schools where individuals are willing to explore.

  17. Cardiorespiratory interactions previously identified as mammalian are present in the primitive lungfish.

    Science.gov (United States)

    Monteiro, Diana A; Taylor, Edwin W; Sartori, Marina R; Cruz, André L; Rantin, Francisco T; Leite, Cleo A C

    2018-02-01

    The present study has revealed that the lungfish has both structural and functional features of its system for physiological control of heart rate, previously considered solely mammalian, that together generate variability (HRV). Ultrastructural and electrophysiological investigation revealed that the nerves connecting the brain to the heart are myelinated, conferring rapid conduction velocities, comparable to mammalian fibers that generate instantaneous changes in heart rate at the onset of each air breath. These respiration-related changes in beat-to-beat cardiac intervals were detected by complex analysis of HRV and shown to maximize oxygen uptake per breath, a causal relationship never conclusively demonstrated in mammals. Cardiac vagal preganglionic neurons, responsible for controlling heart rate via the parasympathetic vagus nerve, were shown to have multiple locations, chiefly within the dorsal vagal motor nucleus that may enable interactive control of the circulatory and respiratory systems, similar to that described for tetrapods. The present illustration of an apparently highly evolved control system for HRV in a fish with a proven ancient lineage, based on paleontological, morphological, and recent genetic evidence, questions much of the anthropocentric thinking implied by some mammalian physiologists and encouraged by many psychobiologists. It is possible that some characteristics of mammalian respiratory sinus arrhythmia, for which functional roles have been sought, are evolutionary relics that had their physiological role defined in ancient representatives of the vertebrates with undivided circulatory systems.

  18. Cardiorespiratory interactions previously identified as mammalian are present in the primitive lungfish

    Science.gov (United States)

    Monteiro, Diana A.; Taylor, Edwin W.; Sartori, Marina R.; Cruz, André L.; Rantin, Francisco T.; Leite, Cleo A. C.

    2018-01-01

    The present study has revealed that the lungfish has both structural and functional features of its system for physiological control of heart rate, previously considered solely mammalian, that together generate variability (HRV). Ultrastructural and electrophysiological investigation revealed that the nerves connecting the brain to the heart are myelinated, conferring rapid conduction velocities, comparable to mammalian fibers that generate instantaneous changes in heart rate at the onset of each air breath. These respiration-related changes in beat-to-beat cardiac intervals were detected by complex analysis of HRV and shown to maximize oxygen uptake per breath, a causal relationship never conclusively demonstrated in mammals. Cardiac vagal preganglionic neurons, responsible for controlling heart rate via the parasympathetic vagus nerve, were shown to have multiple locations, chiefly within the dorsal vagal motor nucleus that may enable interactive control of the circulatory and respiratory systems, similar to that described for tetrapods. The present illustration of an apparently highly evolved control system for HRV in a fish with a proven ancient lineage, based on paleontological, morphological, and recent genetic evidence, questions much of the anthropocentric thinking implied by some mammalian physiologists and encouraged by many psychobiologists. It is possible that some characteristics of mammalian respiratory sinus arrhythmia, for which functional roles have been sought, are evolutionary relics that had their physiological role defined in ancient representatives of the vertebrates with undivided circulatory systems. PMID:29507882

  19. Using an epiphytic moss to identify previously unknown sources of atmospheric cadmium pollution

    International Nuclear Information System (INIS)

    Donovan, Geoffrey H.; Jovan, Sarah E.; Gatziolis, Demetrios; Burstyn, Igor; Michael, Yvonne L.; Amacher, Michael C.; Monleon, Vicente J.

    2016-01-01

    Urban networks of air-quality monitors are often too widely spaced to identify sources of air pollutants, especially if they do not disperse far from emission sources. The objectives of this study were to test the use of moss bio-indicators to develop a fine-scale map of atmospherically-derived cadmium and to identify the sources of cadmium in a complex urban setting. We collected 346 samples of the moss Orthotrichum lyellii from deciduous trees in December, 2013 using a modified randomized grid-based sampling strategy across Portland, Oregon. We estimated a spatial linear model of moss cadmium levels and predicted cadmium on a 50 m grid across the city. Cadmium levels in moss were positively correlated with proximity to two stained-glass manufacturers, proximity to the Oregon–Washington border, and percent industrial land in a 500 m buffer, and negatively correlated with percent residential land in a 500 m buffer. The maps showed very high concentrations of cadmium around the two stained-glass manufacturers, neither of which were known to environmental regulators as cadmium emitters. In addition, in response to our findings, the Oregon Department of Environmental Quality placed an instrumental monitor 120 m from the larger stained-glass manufacturer in October, 2015. The monthly average atmospheric cadmium concentration was 29.4 ng/m"3, which is 49 times higher than Oregon's benchmark of 0.6 ng/m"3, and high enough to pose a health risk from even short-term exposure. Both stained-glass manufacturers voluntarily stopped using cadmium after the monitoring results were made public, and the monthly average cadmium levels precipitously dropped to 1.1 ng/m"3 for stained-glass manufacturer #1 and 0.67 ng/m"3 for stained-glass manufacturer #2. - Highlights: • Bio-indicators are a valid method for measuring atmospheric pollutants • We used moss to map atmospheric cadmium in Portland, Oregon • Using a spatial linear model, we identified two stained

  20. The job satisfaction of principals of previously disadvantaged schools

    African Journals Online (AJOL)

    The aim of this study was to identify influences on the job satisfaction of previously disadvantaged school principals in North-West Province. Evans's theory of job satisfaction, morale and motivation was useful as a conceptual framework. A mixedmethods explanatory research design was important in discovering issues with ...

  1. Study of functional-performance deficits in athletes with previous ankle sprains

    Directory of Open Access Journals (Sweden)

    hamid Babaee

    2008-04-01

    Full Text Available Abstract Background: Despite the importance of functional-performance deficits in athletes with history of ankle sprain few, studies have been carried out in this area. The aim of this research was to study relationship between previous ankle sprains and functional-performance deficits in athletes. Materials and methods: The subjects were 40 professional athletes selected through random sampling among volunteer participants in soccer, basketball, volleyball and handball teams of Lorestan province. The subjects were divided into 2 groups: Injured group (athletes with previous ankle sprains and healthy group (athletes without previous ankle sprains. In this descriptive study we used Functional-performance tests (figure 8 hop test and side hop test to determine ankle deficits and limitations. They participated in figure 8 hop test including hopping in 8 shape course with the length of 5 meters and side hop test including 10 side hop repetitions in course with the length of 30 centimeters. Time were recorded via stopwatch. Results: After data gathering and assessing information distributions, Pearson correlation was used to assess relationships, and independent T test to assess differences between variables. Finally the results showed that there is a significant relationship between previous ankle sprains and functional-performance deficits in the athletes. Conclusion: The athletes who had previous ankle sprains indicated functional-performance deficits more than healthy athletes in completion of mentioned functional-performance tests. The functional-performance tests (figure 8 hop test and side hop test are sensitive and suitable to assess and detect functional-performance deficits in athletes. Therefore we can use the figure 8 hop and side hop tests for goals such as prevention, assessment and rehabilitation of ankle sprains without spending too much money and time.

  2. Using an epiphytic moss to identify previously unknown sources of atmospheric cadmium pollution

    Energy Technology Data Exchange (ETDEWEB)

    Donovan, Geoffrey H., E-mail: gdonovan@fs.fed.us [USDA Forest Service, PNW Research Station, 620 SW Main, Suite 400, Portland, OR 97205 (United States); Jovan, Sarah E., E-mail: sjovan@fs.fed.us [USDA Forest Service, PNW Research Station, 620 SW Main, Suite 400, Portland, OR 97205 (United States); Gatziolis, Demetrios, E-mail: dgatziolis@fs.fed.us [USDA Forest Service, PNW Research Station, 620 SW Main, Suite 400, Portland, OR 97205 (United States); Burstyn, Igor, E-mail: igor.burstyn@drexel.edu [Dornsife School of Public Health, Drexel University, Nesbitt Hall, 3215 Market St, Philadelphia, PA 19104 (United States); Michael, Yvonne L., E-mail: ylm23@drexel.edu [Dornsife School of Public Health, Drexel University, Nesbitt Hall, 3215 Market St, Philadelphia, PA 19104 (United States); Amacher, Michael C., E-mail: mcamacher1@outlook.com [USDA Forest Service, Logan Forest Sciences Laboratory, 860 North 1200 East, Logan, UT 84321 (United States); Monleon, Vicente J., E-mail: vjmonleon@fs.fed.us [USDA Forest Service, PNW Research Station, 3200 SW Jefferson Way, Corvallis, OR 97331 (United States)

    2016-07-15

    Urban networks of air-quality monitors are often too widely spaced to identify sources of air pollutants, especially if they do not disperse far from emission sources. The objectives of this study were to test the use of moss bio-indicators to develop a fine-scale map of atmospherically-derived cadmium and to identify the sources of cadmium in a complex urban setting. We collected 346 samples of the moss Orthotrichum lyellii from deciduous trees in December, 2013 using a modified randomized grid-based sampling strategy across Portland, Oregon. We estimated a spatial linear model of moss cadmium levels and predicted cadmium on a 50 m grid across the city. Cadmium levels in moss were positively correlated with proximity to two stained-glass manufacturers, proximity to the Oregon–Washington border, and percent industrial land in a 500 m buffer, and negatively correlated with percent residential land in a 500 m buffer. The maps showed very high concentrations of cadmium around the two stained-glass manufacturers, neither of which were known to environmental regulators as cadmium emitters. In addition, in response to our findings, the Oregon Department of Environmental Quality placed an instrumental monitor 120 m from the larger stained-glass manufacturer in October, 2015. The monthly average atmospheric cadmium concentration was 29.4 ng/m{sup 3}, which is 49 times higher than Oregon's benchmark of 0.6 ng/m{sup 3}, and high enough to pose a health risk from even short-term exposure. Both stained-glass manufacturers voluntarily stopped using cadmium after the monitoring results were made public, and the monthly average cadmium levels precipitously dropped to 1.1 ng/m{sup 3} for stained-glass manufacturer #1 and 0.67 ng/m{sup 3} for stained-glass manufacturer #2. - Highlights: • Bio-indicators are a valid method for measuring atmospheric pollutants • We used moss to map atmospheric cadmium in Portland, Oregon • Using a spatial linear model, we identified two

  3. Personality disorders in previously detained adolescent females: a prospective study

    NARCIS (Netherlands)

    Krabbendam, A.; Colins, O.F.; Doreleijers, T.A.H.; van der Molen, E.; Beekman, A.T.F.; Vermeiren, R.R.J.M.

    2015-01-01

    This longitudinal study investigated the predictive value of trauma and mental health problems for the development of antisocial personality disorder (ASPD) and borderline personality disorder (BPD) in previously detained women. The participants were 229 detained adolescent females who were assessed

  4. Evolutionary Analysis Predicts Sensitive Positions of MMP20 and Validates Newly- and Previously-Identified MMP20 Mutations Causing Amelogenesis Imperfecta

    Directory of Open Access Journals (Sweden)

    Barbara Gasse

    2017-06-01

    Full Text Available Amelogenesis imperfecta (AI designates a group of genetic diseases characterized by a large range of enamel disorders causing important social and health problems. These defects can result from mutations in enamel matrix proteins or protease encoding genes. A range of mutations in the enamel cleavage enzyme matrix metalloproteinase-20 gene (MMP20 produce enamel defects of varying severity. To address how various alterations produce a range of AI phenotypes, we performed a targeted analysis to find MMP20 mutations in French patients diagnosed with non-syndromic AI. Genomic DNA was isolated from saliva and MMP20 exons and exon-intron boundaries sequenced. We identified several homozygous or heterozygous mutations, putatively involved in the AI phenotypes. To validate missense mutations and predict sensitive positions in the MMP20 sequence, we evolutionarily compared 75 sequences extracted from the public databases using the Datamonkey webserver. These sequences were representative of mammalian lineages, covering more than 150 million years of evolution. This analysis allowed us to find 324 sensitive positions (out of the 483 MMP20 residues, pinpoint functionally important domains, and build an evolutionary chart of important conserved MMP20 regions. This is an efficient tool to identify new- and previously-identified mutations. We thus identified six functional MMP20 mutations in unrelated families, finding two novel mutated sites. The genotypes and phenotypes of these six mutations are described and compared. To date, 13 MMP20 mutations causing AI have been reported, making these genotypes and associated hypomature enamel phenotypes the most frequent in AI.

  5. Evolutionary Analysis Predicts Sensitive Positions of MMP20 and Validates Newly- and Previously-Identified MMP20 Mutations Causing Amelogenesis Imperfecta.

    Science.gov (United States)

    Gasse, Barbara; Prasad, Megana; Delgado, Sidney; Huckert, Mathilde; Kawczynski, Marzena; Garret-Bernardin, Annelyse; Lopez-Cazaux, Serena; Bailleul-Forestier, Isabelle; Manière, Marie-Cécile; Stoetzel, Corinne; Bloch-Zupan, Agnès; Sire, Jean-Yves

    2017-01-01

    Amelogenesis imperfecta (AI) designates a group of genetic diseases characterized by a large range of enamel disorders causing important social and health problems. These defects can result from mutations in enamel matrix proteins or protease encoding genes. A range of mutations in the enamel cleavage enzyme matrix metalloproteinase-20 gene ( MMP20 ) produce enamel defects of varying severity. To address how various alterations produce a range of AI phenotypes, we performed a targeted analysis to find MMP20 mutations in French patients diagnosed with non-syndromic AI. Genomic DNA was isolated from saliva and MMP20 exons and exon-intron boundaries sequenced. We identified several homozygous or heterozygous mutations, putatively involved in the AI phenotypes. To validate missense mutations and predict sensitive positions in the MMP20 sequence, we evolutionarily compared 75 sequences extracted from the public databases using the Datamonkey webserver. These sequences were representative of mammalian lineages, covering more than 150 million years of evolution. This analysis allowed us to find 324 sensitive positions (out of the 483 MMP20 residues), pinpoint functionally important domains, and build an evolutionary chart of important conserved MMP20 regions. This is an efficient tool to identify new- and previously-identified mutations. We thus identified six functional MMP20 mutations in unrelated families, finding two novel mutated sites. The genotypes and phenotypes of these six mutations are described and compared. To date, 13 MMP20 mutations causing AI have been reported, making these genotypes and associated hypomature enamel phenotypes the most frequent in AI.

  6. Genome-wide association study identifies multiple susceptibility loci for diffuse large B cell lymphoma

    NARCIS (Netherlands)

    Cerhan, James R.; Berndt, Sonja I.; Vijai, Joseph; Ghesquières, Hervé; McKay, James; Wang, Sophia S.; Wang, Zhaoming; Yeager, Meredith; Conde, Lucia; De Bakker, Paul I W; Nieters, Alexandra; Cox, David; Burdett, Laurie; Monnereau, Alain; Flowers, Christopher R.; De Roos, Anneclaire J.; Brooks-Wilson, Angela R.; Lan, Qing; Severi, Gianluca; Melbye, Mads; Gu, Jian; Jackson, Rebecca D.; Kane, Eleanor; Teras, Lauren R.; Purdue, Mark P.; Vajdic, Claire M.; Spinelli, John J.; Giles, Graham G.; Albanes, Demetrius; Kelly, Rachel S.; Zucca, Mariagrazia; Bertrand, Kimberly A.; Zeleniuch-Jacquotte, Anne; Lawrence, Charles; Hutchinson, Amy; Zhi, Degui; Habermann, Thomas M.; Link, Brian K.; Novak, Anne J.; Dogan, Ahmet; Asmann, Yan W.; Liebow, Mark; Thompson, Carrie A.; Ansell, Stephen M.; Witzig, Thomas E.; Weiner, George J.; Veron, Amelie S.; Zelenika, Diana; Tilly, Hervé; Haioun, Corinne; Molina, Thierry Jo; Hjalgrim, Henrik; Glimelius, Bengt; Adami, Hans Olov; Bracci, Paige M.; Riby, Jacques; Smith, Martyn T.; Holly, Elizabeth A.; Cozen, Wendy; Hartge, Patricia; Morton, Lindsay M.; Severson, Richard K.; Tinker, Lesley F.; North, Kari E.; Becker, Nikolaus; Benavente, Yolanda; Boffetta, Paolo; Brennan, Paul; Foretova, Lenka; Maynadie, Marc; Staines, Anthony; Lightfoot, Tracy; Crouch, Simon; Smith, Alex; Roman, Eve; Diver, W. Ryan; Offit, Kenneth; Zelenetz, Andrew; Klein, Robert J.; Villano, Danylo J.; Zheng, Tongzhang; Zhang, Yawei; Holford, Theodore R.; Kricker, Anne; Turner, Jenny; Southey, Melissa C.; Clavel, Jacqueline; Virtamo, Jarmo; Weinstein, Stephanie; Riboli, Elio; Vineis, Paolo; Kaaks, Rudolph; Trichopoulos, Dimitrios; Vermeulen, Roel C H; Boeing, Heiner; Tjonneland, Anne; Angelucci, Emanuele; Di Lollo, Simonetta; Rais, Marco; Birmann, Brenda M.; Laden, Francine; Giovannucci, Edward; Kraft, Peter; Huang, Jinyan; Ma, Baoshan; Ye, Yuanqing; Chiu, Brian C H; Sampson, Joshua; Liang, Liming; Park, Ju Hyun; Chung, Charles C.; Weisenburger, Dennis D.; Chatterjee, Nilanjan; Fraumeni, Joseph F.; Slager, Susan L.; Wu, Xifeng; De Sanjose, Silvia; Smedby, Karin E.; Salles, Gilles; Skibola, Christine F.; Rothman, Nathaniel; Chanock, Stephen J.

    2014-01-01

    Diffuse large B cell lymphoma (DLBCL) is the most common lymphoma subtype and is clinically aggressive. To identify genetic susceptibility loci for DLBCL, we conducted a meta-analysis of 3 new genome-wide association studies (GWAS) and 1 previous scan, totaling 3,857 cases and 7,666 controls of

  7. Using an epiphytic moss to identify previously unknown sources of atmospheric cadmium pollution.

    Science.gov (United States)

    Donovan, Geoffrey H; Jovan, Sarah E; Gatziolis, Demetrios; Burstyn, Igor; Michael, Yvonne L; Amacher, Michael C; Monleon, Vicente J

    2016-07-15

    Urban networks of air-quality monitors are often too widely spaced to identify sources of air pollutants, especially if they do not disperse far from emission sources. The objectives of this study were to test the use of moss bio-indicators to develop a fine-scale map of atmospherically-derived cadmium and to identify the sources of cadmium in a complex urban setting. We collected 346 samples of the moss Orthotrichum lyellii from deciduous trees in December, 2013 using a modified randomized grid-based sampling strategy across Portland, Oregon. We estimated a spatial linear model of moss cadmium levels and predicted cadmium on a 50m grid across the city. Cadmium levels in moss were positively correlated with proximity to two stained-glass manufacturers, proximity to the Oregon-Washington border, and percent industrial land in a 500m buffer, and negatively correlated with percent residential land in a 500m buffer. The maps showed very high concentrations of cadmium around the two stained-glass manufacturers, neither of which were known to environmental regulators as cadmium emitters. In addition, in response to our findings, the Oregon Department of Environmental Quality placed an instrumental monitor 120m from the larger stained-glass manufacturer in October, 2015. The monthly average atmospheric cadmium concentration was 29.4ng/m(3), which is 49 times higher than Oregon's benchmark of 0.6ng/m(3), and high enough to pose a health risk from even short-term exposure. Both stained-glass manufacturers voluntarily stopped using cadmium after the monitoring results were made public, and the monthly average cadmium levels precipitously dropped to 1.1ng/m(3) for stained-glass manufacturer #1 and 0.67ng/m(3) for stained-glass manufacturer #2. Published by Elsevier B.V.

  8. Seven prostate cancer susceptibility loci identified by a multi-stage genome-wide association study

    DEFF Research Database (Denmark)

    Kote-Jarai, Zsofia; Olama, Ali Amin Al; Giles, Graham G

    2011-01-01

    Prostate cancer (PrCa) is the most frequently diagnosed male cancer in developed countries. We conducted a multi-stage genome-wide association study for PrCa and previously reported the results of the first two stages, which identified 16 PrCa susceptibility loci. We report here the results of st...

  9. Fire Risk Scoping Study: Investigation of nuclear power plant fire risk, including previously unaddressed issues

    International Nuclear Information System (INIS)

    Lambright, J.A.; Nowlen, S.P.; Nicolette, V.F.; Bohn, M.P.

    1989-01-01

    An investigation of nuclear power plant fire risk issues raised as a result of the USNRC sponsored Fire Protection Research Program at Sandia National Laboratories has been performed. The specific objectives of this study were (1) to review and requantify fire risk scenarios from four fire probabilistic risk assessments (PRAs) in light of updated data bases made available as a result of USNRC sponsored Fire Protection Research Program and updated computer fire modeling capabilities, (2) to identify potentially significant fire risk issues that have not been previously addressed in a fire risk context and to quantify the potential impact of those identified fire risk issues where possible, and (3) to review current fire regulations and plant implementation practices for relevance to the identified unaddressed fire risk issues. In performance of the fire risk scenario requantifications several important insights were gained. It was found that utilization of a more extensive operational experience base resulted in both fire occurrence frequencies and fire duration times (i.e., time required for fire suppression) increasing significantly over those assumed in the original works. Additionally, some thermal damage threshold limits assumed in the original works were identified as being nonconservative based on more recent experimental data. Finally, application of the COMPBRN III fire growth model resulted in calculation of considerably longer fire damage times than those calculated in the original works using COMPBRN I. 14 refs., 2 figs., 16 tabs

  10. A study about the interest and previous contact of high school students with Astronomy

    Science.gov (United States)

    Carvalho, C. L.; Zanitti, M. H. R.; Felicidade, B. L.; Gomes, A. D. T.; Dias, E. W.; Coelho, F. O.

    2016-04-01

    The currently problems in Astronomy teaching in Brazilian Basic Education contrast with the space, and the popularity that astronomical themes have in various media in the country. In this work, we present the results of a study about the interest, and previous contact of high school students from a public school in the city of "São João del-Rei"/MG with topics related to Astronomy. The study and the pedagogical intervention were carried out by students of the PIBID/CAPES/UFSJ. The intervention was performed through an oral exposition with the students' participation, followed by the use of the Stellarium program. The results suggest the majority of students surveyed are interested in Astronomy, and have had some contact with the area. However, some inconsistencies in their responses were identified and examined. The implications for research and for Astronomy Education are discussed. We also make some considerations about relationship between the lack of specific knowledge and the misinformation as one possible reason for the little interest of students in various areas of Science.

  11. Matched cohort study of external cephalic version in women with previous cesarean delivery.

    Science.gov (United States)

    Keepanasseril, Anish; Anand, Keerthana; Soundara Raghavan, Subrahmanian

    2017-07-01

    To evaluate the efficacy and safety of external cephalic version (ECV) among women with previous cesarean delivery. A retrospective study was conducted using data for women with previous cesarean delivery and breech presentation who underwent ECV at or after 36 weeks of pregnancy during 2011-2016. For every case, two multiparous women without previous cesarean delivery who underwent ECV and were matched for age and pregnancy duration were included. Characteristics and outcomes were compared between groups. ECV was successful for 32 (84.2%) of 38 women with previous cesarean delivery and 62 (81.6%) in the control group (P=0.728). Multivariate regression analysis confirmed that previous cesarean was not associated with ECV success (odds ratio 1.89, 95% confidence interval 0.19-18.47; P=0.244). Successful vaginal delivery after successful ECV was reported for 19 (59.4%) women in the previous cesarean delivery group and 52 (83.9%) in the control group (P<0.001). No ECV-associated complications occurred in women with previous cesarean delivery. To avoid a repeat cesarean delivery, ECV can be offered to women with breech presentation and previous cesarean delivery who are otherwise eligible for a trial of labor. © 2017 International Federation of Gynecology and Obstetrics.

  12. Predictive factors for the development of diabetes in women with previous gestational diabetes mellitus

    DEFF Research Database (Denmark)

    Damm, P.; Kühl, C.; Bertelsen, Aksel

    1992-01-01

    OBJECTIVES: The purpose of this study was to determine the incidence of diabetes in women with previous dietary-treated gestational diabetes mellitus and to identify predictive factors for development of diabetes. STUDY DESIGN: Two to 11 years post partum, glucose tolerance was investigated in 241...... women with previous dietary-treated gestational diabetes mellitus and 57 women without previous gestational diabetes mellitus (control group). RESULTS: Diabetes developed in 42 (17.4%) women with previous gestational diabetes mellitus (3.7% insulin-dependent diabetes mellitus and 13.7% non...... of previous patients with gestational diabetes mellitus in whom plasma insulin was measured during an oral glucose tolerance test in late pregnancy a low insulin response at diagnosis was found to be an independent predictive factor for diabetes development. CONCLUSIONS: Women with previous dietary...

  13. Iterative Outlier Removal: A Method for Identifying Outliers in Laboratory Recalibration Studies.

    Science.gov (United States)

    Parrinello, Christina M; Grams, Morgan E; Sang, Yingying; Couper, David; Wruck, Lisa M; Li, Danni; Eckfeldt, John H; Selvin, Elizabeth; Coresh, Josef

    2016-07-01

    Extreme values that arise for any reason, including those through nonlaboratory measurement procedure-related processes (inadequate mixing, evaporation, mislabeling), lead to outliers and inflate errors in recalibration studies. We present an approach termed iterative outlier removal (IOR) for identifying such outliers. We previously identified substantial laboratory drift in uric acid measurements in the Atherosclerosis Risk in Communities (ARIC) Study over time. Serum uric acid was originally measured in 1990-1992 on a Coulter DACOS instrument using an uricase-based measurement procedure. To recalibrate previous measured concentrations to a newer enzymatic colorimetric measurement procedure, uric acid was remeasured in 200 participants from stored plasma in 2011-2013 on a Beckman Olympus 480 autoanalyzer. To conduct IOR, we excluded data points >3 SDs from the mean difference. We continued this process using the resulting data until no outliers remained. IOR detected more outliers and yielded greater precision in simulation. The original mean difference (SD) in uric acid was 1.25 (0.62) mg/dL. After 4 iterations, 9 outliers were excluded, and the mean difference (SD) was 1.23 (0.45) mg/dL. Conducting only one round of outlier removal (standard approach) would have excluded 4 outliers [mean difference (SD) = 1.22 (0.51) mg/dL]. Applying the recalibration (derived from Deming regression) from each approach to the original measurements, the prevalence of hyperuricemia (>7 mg/dL) was 28.5% before IOR and 8.5% after IOR. IOR is a useful method for removal of extreme outliers irrelevant to recalibrating laboratory measurements, and identifies more extraneous outliers than the standard approach. © 2016 American Association for Clinical Chemistry.

  14. Effectively identifying regulatory hotspots while capturing expression heterogeneity in gene expression studies

    Science.gov (United States)

    2014-01-01

    Expression quantitative trait loci (eQTL) mapping is a tool that can systematically identify genetic variation affecting gene expression. eQTL mapping studies have shown that certain genomic locations, referred to as regulatory hotspots, may affect the expression levels of many genes. Recently, studies have shown that various confounding factors may induce spurious regulatory hotspots. Here, we introduce a novel statistical method that effectively eliminates spurious hotspots while retaining genuine hotspots. Applied to simulated and real datasets, we validate that our method achieves greater sensitivity while retaining low false discovery rates compared to previous methods. PMID:24708878

  15. Presence in the pre-surgical fine-needle aspiration of potential thyroid biomarkers previously identified in the post-surgical one.

    Directory of Open Access Journals (Sweden)

    Federica Ciregia

    Full Text Available Fine-needle aspiration biopsy (FNA is usually applied to distinguish benign from malignant thyroid nodules. However, cytological analysis cannot always allow a proper diagnosis. We believe that the improvement of the diagnostic capability of pre-surgical FNA could avoid unnecessary thyroidectomy. In a previous study, we performed a proteome analysis to examine FNA collected after thyroidectomy. With the present study, we examined the applicability of these results on pre-surgical FNA. We collected pre-surgical FNA from 411 consecutive patients, and to obtain a correct comparison with our previous results, we processed only benign (n=114, papillary classical variant (cPTC (n=34 and papillary tall cell variant (TcPTC (n=14 FNA. We evaluated levels of five proteins previously found up-regulated in thyroid cancer with respect to benign nodules. ELISA and western blot (WB analysis were used to assay levels of L-lactate dehydrogenase B chain (LDHB, Ferritin heavy chain, Ferritin light chain, Annexin A1 (ANXA1, and Moesin in FNA. ELISA assays and WB analysis confirmed the increase of LDHB, Moesin, and ANXA1 in pre-surgical FNA of thyroid papillary cancer. Sensitivity and specificity of ANXA1 were respectively 87 and 94% for cPTC, 85 and 100% for TcPTC. In conclusion, a proteomic analysis of FNA from patients with thyroid nodules may help to distinguish benign versus malignant thyroid nodules. Moreover, ANXA1 appears to be an ideal candidate given the high sensitivity and specificity obtained from ROC curve analysis.

  16. Comparison of screening questionnaires to identify psoriatic arthritis in a primary-care population: a cross-sectional study.

    Science.gov (United States)

    Coates, L C; Savage, L; Waxman, R; Moverley, A R; Worthington, S; Helliwell, P S

    2016-09-01

    Many questionnaires are available for assessment of psoriatic arthritis (PsA), but there is little evidence comparing them. To test the proposed CONTEST questionnaire, which was developed to identify patients with psoriasis who have undiagnosed PsA, and compare it with the validated Psoriasis Epidemiology Screening Tool (PEST) questionnaire in a primary-care setting. A random sample of adult patients with psoriasis and no diagnosis of arthritis was identified from five general practice surgeries in Yorkshire, U.K. Consenting patients completed both questionnaires and were assessed by a dermatologist and rheumatologist. Diagnosis of PsA was made by the assessing rheumatologist. Receiver operator characteristic (ROC) curve analysis examined the sensitivity and specificity of potential cut points. In total 932 packs were sent to recruit 191 (20·5%) participants. Of these, 169 (88·5%) were confirmed to have current or previous psoriasis. Using physician diagnosis 17 (10·1%) were found to have previously undiagnosed PsA, while 90 (53·3%) had another musculoskeletal complaint and 62 (36·7%) had no musculoskeletal problems. Using ROC curve analysis, all of the questionnaires showed a significant ability to identify PsA. The area under the curve (AUC) for the CONTEST questionnaires was slightly higher than that of PEST (0·69 and 0·70 vs. 0·65), but there was no significant difference identified. Examining the sensitivities and specificities for the different cut points suggested that a PEST score ≥ 2 would perform better in this dataset, and the optimal scores for CONTEST and CONTEST plus joint manikin were 3 and 4, respectively. The accuracy of the questionnaires to identify PsA appeared similar, with a slightly higher AUC for the CONTEST questionnaires. The optimal cut points in this study appeared lower than in previous studies. © 2016 British Association of Dermatologists.

  17. Identifying Primary Spontaneous Pneumothorax from Administrative Databases: A Validation Study

    Directory of Open Access Journals (Sweden)

    Eric Frechette

    2016-01-01

    Full Text Available Introduction. Primary spontaneous pneumothorax (PSP is a disorder commonly encountered in healthy young individuals. There is no differentiation between PSP and secondary pneumothorax (SP in the current version of the International Classification of Diseases (ICD-10. This complicates the conduct of epidemiological studies on the subject. Objective. To validate the accuracy of an algorithm that identifies cases of PSP from administrative databases. Methods. The charts of 150 patients who consulted the emergency room (ER with a recorded main diagnosis of pneumothorax were reviewed to define the type of pneumothorax that occurred. The corresponding hospital administrative data collected during previous hospitalizations and ER visits were processed through the proposed algorithm. The results were compared over two different age groups. Results. There were 144 cases of pneumothorax correctly coded (96%. The results obtained from the PSP algorithm demonstrated a significantly higher sensitivity (97% versus 81%, p=0.038 and positive predictive value (87% versus 46%, p<0.001 in patients under 40 years of age than in older patients. Conclusions. The proposed algorithm is adequate to identify cases of PSP from administrative databases in the age group classically associated with the disease. This makes possible its utilization in large population-based studies.

  18. A new commelinid monocot seed fossil from the early Eocene previously identified as Solanaceae.

    Science.gov (United States)

    Särkinen, Tiina; Kottner, Sören; Stuppy, Wolfgang; Ahmed, Farah; Knapp, Sandra

    2018-01-01

    Fossils provide minimum age estimates for extant lineages. Here we critically evaluate Cantisolanum daturoides Reid & Chandler and two other early putative seed fossils of Solanaceae, an economically important plant family in the Asteridae. Three earliest seed fossil taxa of Solanaceae from the London Clay Formation (Cantisolanum daturoides) and the Poole and Branksome Sand Formations (Solanum arnense Chandler and Solanispermum reniforme Chandler) were studied using x-ray microcomputed tomography (MCT) and scanning electron microscopy (SEM). The MCT scans of Cantisolanum daturoides revealed a high level of pyrite preservation at the cellular level. Cantisolanum daturoides can be clearly excluded from Solanaceae and has more affinities to the commelinid monocots based on a straight longitudinal axis, a prominent single layer of relatively thin-walled cells in the testa, and a clearly differentiated micropyle surrounded by radially elongated and inwardly curved testal cells. While the MCT scans show no internal preservation in Solanum arnense and Solanispermum reniforme, SEM images show the presence of several characteristics that allow the placement of these taxa at the stem node of Solanaceae. Cantisolanum daturoides is likely a member of commelinid monocots and not Solanaceae as previously suggested. The earliest fossil record of Solanaceae is revised to consist of fruit fossil with inflated calyces from the early Eocene of Patagonia (52 Ma) and fossilized seeds from the early to mid-Eocene of Europe (48-46 Ma). The new identity for Cantisolanum daturoides does not alter a late Cretaceous minimum age for commelinids. © 2018 Botanical Society of America.

  19. Meta-Analysis of Genome-Wide Association Studies Identifies Genetic Risk Factors for Stroke in African Americans.

    Science.gov (United States)

    Carty, Cara L; Keene, Keith L; Cheng, Yu-Ching; Meschia, James F; Chen, Wei-Min; Nalls, Mike; Bis, Joshua C; Kittner, Steven J; Rich, Stephen S; Tajuddin, Salman; Zonderman, Alan B; Evans, Michele K; Langefeld, Carl D; Gottesman, Rebecca; Mosley, Thomas H; Shahar, Eyal; Woo, Daniel; Yaffe, Kristine; Liu, Yongmei; Sale, Michèle M; Dichgans, Martin; Malik, Rainer; Longstreth, W T; Mitchell, Braxton D; Psaty, Bruce M; Kooperberg, Charles; Reiner, Alexander; Worrall, Bradford B; Fornage, Myriam

    2015-08-01

    The majority of genome-wide association studies (GWAS) of stroke have focused on European-ancestry populations; however, none has been conducted in African Americans, despite the disproportionately high burden of stroke in this population. The Consortium of Minority Population Genome-Wide Association Studies of Stroke (COMPASS) was established to identify stroke susceptibility loci in minority populations. Using METAL, we conducted meta-analyses of GWAS in 14 746 African Americans (1365 ischemic and 1592 total stroke cases) from COMPASS, and tested genetic variants with Pstroke genetic studies in European-ancestry populations. We also evaluated stroke loci previously identified in European-ancestry populations. The 15q21.3 locus linked with lipid levels and hypertension was associated with total stroke (rs4471613; P=3.9×10(-8)) in African Americans. Nominal associations (Pstroke were observed for 18 variants in or near genes implicated in cell cycle/mRNA presplicing (PTPRG, CDC5L), platelet function (HPS4), blood-brain barrier permeability (CLDN17), immune response (ELTD1, WDFY4, and IL1F10-IL1RN), and histone modification (HDAC9). Two of these loci achieved nominal significance in METASTROKE: 5q35.2 (P=0.03), and 1p31.1 (P=0.018). Four of 7 previously reported ischemic stroke loci (PITX2, HDAC9, CDKN2A/CDKN2B, and ZFHX3) were nominally associated (Pstroke in COMPASS. We identified a novel genetic variant associated with total stroke in African Americans and found that ischemic stroke loci identified in European-ancestry populations may also be relevant for African Americans. Our findings support investigation of diverse populations to identify and characterize genetic risk factors, and the importance of shared genetic risk across populations. © 2015 American Heart Association, Inc.

  20. Validation of transcutaneous bilirubin nomogram for identifying neonatal hyperbilirubinemia in healthy Chinese term and late-preterm infants: a multicenter study

    Directory of Open Access Journals (Sweden)

    Zhangbin Yu

    2014-06-01

    Full Text Available OBJECTIVE: to prospectively validate a previously constructed transcutaneous bilirubin (TcB nomogram for identifying severe hyperbilirubinemia in healthy Chinese term and late-preterm infants. METHODS: this was a multicenter study that included 9,174 healthy term and late-preterm infants in eight hospitals of China. TcB measurements were performed using a JM-103 bilirubinometer. TcB values were plotted on a previously developed TcB nomogram, to identify the predictive ability for subsequent significant hyperbilirubinemia. RESULTS: in the present study, 972 neonates (10.6% developed significant hyperbilirubinemia. The 40th percentile of the nomogram could identify all neonates who were at risk of significant hyperbilirubinemia, but with a low positive predictive value (PPV (18.9%. Of the 453 neonates above the 95th percentile, 275 subsequently developed significant hyperbilirubinemia, with a high PPV (60.7%, but with low sensitivity (28.3%. The 75th percentile was highly specific (81.9% and moderately sensitive (79.8%. The area under the curve (AUC for the TcB nomogram was 0.875. CONCLUSIONS: this study validated the previously developed TcB nomogram, which could be used to predict subsequent significant hyperbilirubinemia in healthy Chinese term and late-preterm infants. However, combining TcB nomogram and clinical risk factors could improve the predictive accuracy for severe hyperbilirubinemia, which was not assessed in the study. Further studies are necessary to confirm this combination.

  1. Validation of transcutaneous bilirubin nomogram for identifying neonatal hyperbilirubinemia in healthy Chinese term and late-preterm infants: a multicenter study.

    Science.gov (United States)

    Yu, Zhangbin; Han, Shuping; Wu, Jinxia; Li, Mingxia; Wang, Huaiyan; Wang, Jimei; Liu, Jiebo; Pan, Xinnian; Yang, Jie; Chen, Chao

    2014-01-01

    to prospectively validate a previously constructed transcutaneous bilirubin (TcB) nomogram for identifying severe hyperbilirubinemia in healthy Chinese term and late-preterm infants. this was a multicenter study that included 9,174 healthy term and late-preterm infants in eight hospitals of China. TcB measurements were performed using a JM-103 bilirubinometer. TcB values were plotted on a previously developed TcB nomogram, to identify the predictive ability for subsequent significant hyperbilirubinemia. in the present study, 972 neonates (10.6%) developed significant hyperbilirubinemia. The 40(th) percentile of the nomogram could identify all neonates who were at risk of significant hyperbilirubinemia, but with a low positive predictive value (PPV) (18.9%). Of the 453 neonates above the 95(th) percentile, 275 subsequently developed significant hyperbilirubinemia, with a high PPV (60.7%), but with low sensitivity (28.3%). The 75(th) percentile was highly specific (81.9%) and moderately sensitive (79.8%). The area under the curve (AUC) for the TcB nomogram was 0.875. this study validated the previously developed TcB nomogram, which could be used to predict subsequent significant hyperbilirubinemia in healthy Chinese term and late-preterm infants. However, combining TcB nomogram and clinical risk factors could improve the predictive accuracy for severe hyperbilirubinemia, which was not assessed in the study. Further studies are necessary to confirm this combination. Copyright © 2014 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  2. Treatment response in psychotic patients classified according to social and clinical needs, drug side effects, and previous treatment; a method to identify functional remission.

    Science.gov (United States)

    Alenius, Malin; Hammarlund-Udenaes, Margareta; Hartvig, Per; Sundquist, Staffan; Lindström, Leif

    2009-01-01

    Various approaches have been made over the years to classify psychotic patients according to inadequate treatment response, using terms such as treatment resistant or treatment refractory. Existing classifications have been criticized for overestimating positive symptoms; underestimating residual symptoms, negative symptoms, and side effects; or being to open for individual interpretation. The aim of this study was to present and evaluate a new method of classification according to treatment response and, thus, to identify patients in functional remission. A naturalistic, cross-sectional study was performed using patient interviews and information from patient files. The new classification method CANSEPT, which combines the Camberwell Assessment of Need rating scale, the Udvalg for Kliniske Undersøgelser side effect rating scale (SE), and the patient's previous treatment history (PT), was used to group the patients according to treatment response. CANSEPT was evaluated by comparison of expected and observed results. In the patient population (n = 123), the patients in functional remission, as defined by CANSEPT, had higher quality of life, fewer hospitalizations, fewer psychotic symptoms, and higher rate of workers than those with the worst treatment outcome. In the evaluation, CANSEPT showed validity in discriminating the patients of interest and was well tolerated by the patients. CANSEPT could secure inclusion of correct patients in the clinic or in research.

  3. The pathogenicity of genetic variants previously associated with left ventricular non-compaction

    DEFF Research Database (Denmark)

    Abbasi, Yeganeh; Jabbari, Javad; Jabbari, Reza

    2016-01-01

    BACKGROUND: Left ventricular non-compaction (LVNC) is a rare cardiomyopathy. Many genetic variants have been associated with LVNC. However, the number of the previous LVNC-associated variants that are common in the background population remains unknown. The aim of this study was to provide...... an updated list of previously reported LVNC-associated variants with biologic description and investigate the prevalence of LVNC variants in healthy general population to find false-positive LVNC-associated variants. METHODS AND RESULTS: The Human Gene Mutation Database and PubMed were systematically...... searched to identify all previously reported LVNC-associated variants. Thereafter, the Exome Sequencing Project (ESP) and the Exome Aggregation Consortium (ExAC), that both represent the background population, was searched for all variants. Four in silico prediction tools were assessed to determine...

  4. Genome-wide association studies of autoimmune vitiligo identify 23 new risk loci and highlight key pathways and regulatory variants

    NARCIS (Netherlands)

    Jin, Ying; Andersen, Genevieve; Yorgov, Daniel; Ferrara, Tracey M.; Ben, Songtao; Brownson, Kelly M.; Holland, Paulene J.; Birlea, Stanca A.; Siebert, Janet; Hartmann, Anke; Lienert, Anne; van Geel, Nanja; Lambert, Jo; Luiten, Rosalie M.; Wolkerstorfer, Albert; Wietze van der Veen, J. P.; Bennett, Dorothy C.; Taïeb, Alain; Ezzedine, Khaled; Kemp, E. Helen; Gawkrodger, David J.; Weetman, Anthony P.; Kõks, Sulev; Prans, Ele; Kingo, Külli; Karelson, Maire; Wallace, Margaret R.; McCormack, Wayne T.; Overbeck, Andreas; Moretti, Silvia; Colucci, Roberta; Picardo, Mauro; Silverberg, Nanette B.; Olsson, Mats; Valle, Yan; Korobko, Igor; Böhm, Markus; Lim, Henry W.; Hamzavi, Iltefat; Zhou, Li; Mi, Qing-Sheng; Fain, Pamela R.; Santorico, Stephanie A.; Spritz, Richard A.

    2016-01-01

    Vitiligo is an autoimmune disease in which depigmented skin results from the destruction of melanocytes, with epidemiological association with other autoimmune diseases. In previous linkage and genome-wide association studies (GWAS1 and GWAS2), we identified 27 vitiligo susceptibility loci in

  5. Surveillance for previously unmonitored organic contaminants in the San Francisco Estuary.

    Science.gov (United States)

    Oros, Daniel R; Jarman, Walter M; Lowe, Theresa; David, Nicole; Lowe, Sarah; Davis, Jay A

    2003-09-01

    The San Francisco Estuary Regional Monitoring Program initiated surveillance monitoring to identify previously unmonitored synthetic organic contaminants in the San Francisco Estuary. Organic extracts of water samples were analyzed using gas chromatography-mass spectrometry in full scan mode. The major contaminant classes identified in the samples were fire retardants, pesticides, personal care product ingredients, and plasticizers. Evidence from the literature suggests that some of these contaminants can persist in the environment, induce toxicity, and accumulate in marine biota and in higher food chain consumers. The major sources of these contaminants into the marine environment are the discharge of municipal and industrial wastewater effluents, urban stormwater, and agricultural runoff. As a proactive effort, it is suggested that surveillance studies be used routinely in monitoring programs to identify and prevent potential problem contaminants from harming the marine environment.

  6. Dietary self-efficacy predicts AHEI diet quality in women with previous gestational diabetes.

    Science.gov (United States)

    Ferranti, Erin Poe; Narayan, K M Venkat; Reilly, Carolyn M; Foster, Jennifer; McCullough, Marjorie; Ziegler, Thomas R; Guo, Ying; Dunbar, Sandra B

    2014-01-01

    The purpose of this study was to examine the association of intrapersonal influences of diet quality as defined by the Health Belief Model constructs in women with recent histories of gestational diabetes. A descriptive, correlational, cross-sectional design was used to analyze relationships between diet quality and intrapersonal variables, including perceptions of threat of type 2 diabetes mellitus development, benefits and barriers of healthy eating, and dietary self-efficacy, in a convenience sample of 75 community-dwelling women (55% minority; mean age, 35.5 years; SD, 5.5 years) with previous gestational diabetes mellitus. Diet quality was defined by the Alternative Healthy Eating Index (AHEI). Multiple regression was used to identify predictors of AHEI diet quality. Women had moderate AHEI diet quality (mean score, 47.6; SD, 14.3). Only higher levels of education and self-efficacy significantly predicted better AHEI diet quality, controlling for other contributing variables. There is a significant opportunity to improve diet quality in women with previous gestational diabetes mellitus. Improving self-efficacy may be an important component to include in nutrition interventions. In addition to identifying other important individual components, future studies of diet quality in women with previous gestational diabetes mellitus are needed to investigate the scope of influence beyond the individual to potential family, social, and environmental factors. © 2014 The Author(s).

  7. A genome-wide association study identifies five loci influencing facial morphology in Europeans.

    Directory of Open Access Journals (Sweden)

    Fan Liu

    2012-09-01

    Full Text Available Inter-individual variation in facial shape is one of the most noticeable phenotypes in humans, and it is clearly under genetic regulation; however, almost nothing is known about the genetic basis of normal human facial morphology. We therefore conducted a genome-wide association study for facial shape phenotypes in multiple discovery and replication cohorts, considering almost ten thousand individuals of European descent from several countries. Phenotyping of facial shape features was based on landmark data obtained from three-dimensional head magnetic resonance images (MRIs and two-dimensional portrait images. We identified five independent genetic loci associated with different facial phenotypes, suggesting the involvement of five candidate genes--PRDM16, PAX3, TP63, C5orf50, and COL17A1--in the determination of the human face. Three of them have been implicated previously in vertebrate craniofacial development and disease, and the remaining two genes potentially represent novel players in the molecular networks governing facial development. Our finding at PAX3 influencing the position of the nasion replicates a recent GWAS of facial features. In addition to the reported GWA findings, we established links between common DNA variants previously associated with NSCL/P at 2p21, 8q24, 13q31, and 17q22 and normal facial-shape variations based on a candidate gene approach. Overall our study implies that DNA variants in genes essential for craniofacial development contribute with relatively small effect size to the spectrum of normal variation in human facial morphology. This observation has important consequences for future studies aiming to identify more genes involved in the human facial morphology, as well as for potential applications of DNA prediction of facial shape such as in future forensic applications.

  8. A Genome-Wide Association Study Identifies Five Loci Influencing Facial Morphology in Europeans

    Science.gov (United States)

    Liu, Fan; van der Lijn, Fedde; Schurmann, Claudia; Zhu, Gu; Chakravarty, M. Mallar; Hysi, Pirro G.; Wollstein, Andreas; Lao, Oscar; de Bruijne, Marleen; Ikram, M. Arfan; van der Lugt, Aad; Rivadeneira, Fernando; Uitterlinden, André G.; Hofman, Albert; Niessen, Wiro J.; Homuth, Georg; de Zubicaray, Greig; McMahon, Katie L.; Thompson, Paul M.; Daboul, Amro; Puls, Ralf; Hegenscheid, Katrin; Bevan, Liisa; Pausova, Zdenka; Medland, Sarah E.; Montgomery, Grant W.; Wright, Margaret J.; Wicking, Carol; Boehringer, Stefan; Spector, Timothy D.; Paus, Tomáš; Martin, Nicholas G.; Biffar, Reiner; Kayser, Manfred

    2012-01-01

    Inter-individual variation in facial shape is one of the most noticeable phenotypes in humans, and it is clearly under genetic regulation; however, almost nothing is known about the genetic basis of normal human facial morphology. We therefore conducted a genome-wide association study for facial shape phenotypes in multiple discovery and replication cohorts, considering almost ten thousand individuals of European descent from several countries. Phenotyping of facial shape features was based on landmark data obtained from three-dimensional head magnetic resonance images (MRIs) and two-dimensional portrait images. We identified five independent genetic loci associated with different facial phenotypes, suggesting the involvement of five candidate genes—PRDM16, PAX3, TP63, C5orf50, and COL17A1—in the determination of the human face. Three of them have been implicated previously in vertebrate craniofacial development and disease, and the remaining two genes potentially represent novel players in the molecular networks governing facial development. Our finding at PAX3 influencing the position of the nasion replicates a recent GWAS of facial features. In addition to the reported GWA findings, we established links between common DNA variants previously associated with NSCL/P at 2p21, 8q24, 13q31, and 17q22 and normal facial-shape variations based on a candidate gene approach. Overall our study implies that DNA variants in genes essential for craniofacial development contribute with relatively small effect size to the spectrum of normal variation in human facial morphology. This observation has important consequences for future studies aiming to identify more genes involved in the human facial morphology, as well as for potential applications of DNA prediction of facial shape such as in future forensic applications. PMID:23028347

  9. Study of some physical aspects previous to design of an exponential experiment

    International Nuclear Information System (INIS)

    Caro, R.; Francisco, J. L. de

    1961-01-01

    This report presents the theoretical study of some physical aspects previous to the design of an exponential facility. The are: Fast and slow flux distribution in the multiplicative medium and in the thermal column, slowing down in the thermal column, geometrical distribution and minimum needed intensity of sources access channels and perturbations produced by possible variations in its position and intensity. (Author) 4 refs

  10. Radon anomalies prior to earthquakes (1). Review of previous studies

    International Nuclear Information System (INIS)

    Ishikawa, Tetsuo; Tokonami, Shinji; Yasuoka, Yumi; Shinogi, Masaki; Nagahama, Hiroyuki; Omori, Yasutaka; Kawada, Yusuke

    2008-01-01

    The relationship between radon anomalies and earthquakes has been studied for more than 30 years. However, most of the studies dealt with radon in soil gas or in groundwater. Before the 1995 Hyogoken-Nanbu earthquake, an anomalous increase of atmospheric radon was observed at Kobe Pharmaceutical University. The increase was well fitted with a mathematical model related to earthquake fault dynamics. This paper reports the significance of this observation, reviewing previous studies on radon anomaly before earthquakes. Groundwater/soil radon measurements for earthquake prediction began in 1970's in Japan as well as foreign countries. One of the most famous studies in Japan is groundwater radon anomaly before the 1978 Izu-Oshima-kinkai earthquake. We have recognized the significance of radon in earthquake prediction research, but recently its limitation was also pointed out. Some researchers are looking for a better indicator for precursors; simultaneous measurements of radon and other gases are new trials in recent studies. Contrary to soil/groundwater radon, we have not paid much attention to atmospheric radon before earthquakes. However, it might be possible to detect precursors in atmospheric radon before a large earthquake. In the next issues, we will discuss the details of the anomalous atmospheric radon data observed before the Hyogoken-Nanbu earthquake. (author)

  11. HPV knowledge, burden and genital wart location among heterosexually identified versus homosexually identified men who have sex with men in Lima, Peru: cross-sectional results from a cohort study.

    Science.gov (United States)

    Galea, Jerome T; León, Segundo R; Peinado, Jesús; Calvo, Gino; Zamora, Jonathan; Sánchez, Hugo; Brown, Brandon J

    2017-10-24

    The relationship between sexual practices, identity and role among Latino men who have sex with men (MSM) and HIV risk is the subject of ongoing investigation but less is known about how these aspects of sexuality relate to human papilloma-virus (HPV), an independent risk factor for HIV. This observational study investigated the relationship between HPV and sexual practices, identity and role as well as other sexually transmitted infection (STI)/HIV risk factors among HIV-negative heterosexually and homosexually identified Peruvian MSM. Community-based clinic for MSM in Lima, Peru. 756 subjects were screened based on inclusion criteria of: born anatomically male; age ≥18 years; had any anal intercourse with a man during the previous 12 months; residing in metropolitan Lima; HIV negative; willing to commit to twice-yearly clinic visits for 24 months; had not participated in an HIV or HPV vaccine study. 600/756 participants met the inclusion criteria and were enrolled, of whom 48% (284) identified as homosexual and 10% (57) as heterosexual, the basis of the analyses performed. Compared with homosexually identified MSM, heterosexually identified MSM had completed fewer years of formal education and were less likely to have: anogenital HPV or visible anal warts; given oral sex to a man; or used a condom with their most recent female sexual partner (all p<0.05). Conversely, heterosexually identified MSM were more likely to have: visible penile warts; used a condom during last anal intercourse; smoked cigarettes; had transactional sex; and used drugs during sex in the previous month (all p<0.01). There was no difference found between heterosexually and homosexually identified MSM by syphilis or high-risk HPV prevalence. HPV burden, wart type (penile vs anal) and select HIV/STI risk behaviours differed between heterosexually and homosexually identified Peruvian MSM. Understanding the implications of these differences can lead to tailored HIV/STI prevention interventions

  12. Genetic association study of exfoliation syndrome identifies a protective rare variant at LOXL1 and five new susceptibility loci.

    Science.gov (United States)

    Aung, Tin; Ozaki, Mineo; Lee, Mei Chin; Schlötzer-Schrehardt, Ursula; Thorleifsson, Gudmar; Mizoguchi, Takanori; Igo, Robert P; Haripriya, Aravind; Williams, Susan E; Astakhov, Yury S; Orr, Andrew C; Burdon, Kathryn P; Nakano, Satoko; Mori, Kazuhiko; Abu-Amero, Khaled; Hauser, Michael; Li, Zheng; Prakadeeswari, Gopalakrishnan; Bailey, Jessica N Cooke; Cherecheanu, Alina Popa; Kang, Jae H; Nelson, Sarah; Hayashi, Ken; Manabe, Shin-Ichi; Kazama, Shigeyasu; Zarnowski, Tomasz; Inoue, Kenji; Irkec, Murat; Coca-Prados, Miguel; Sugiyama, Kazuhisa; Järvelä, Irma; Schlottmann, Patricio; Lerner, S Fabian; Lamari, Hasnaa; Nilgün, Yildirim; Bikbov, Mukharram; Park, Ki Ho; Cha, Soon Cheol; Yamashiro, Kenji; Zenteno, Juan C; Jonas, Jost B; Kumar, Rajesh S; Perera, Shamira A; Chan, Anita S Y; Kobakhidze, Nino; George, Ronnie; Vijaya, Lingam; Do, Tan; Edward, Deepak P; de Juan Marcos, Lourdes; Pakravan, Mohammad; Moghimi, Sasan; Ideta, Ryuichi; Bach-Holm, Daniella; Kappelgaard, Per; Wirostko, Barbara; Thomas, Samuel; Gaston, Daniel; Bedard, Karen; Greer, Wenda L; Yang, Zhenglin; Chen, Xueyi; Huang, Lulin; Sang, Jinghong; Jia, Hongyan; Jia, Liyun; Qiao, Chunyan; Zhang, Hui; Liu, Xuyang; Zhao, Bowen; Wang, Ya-Xing; Xu, Liang; Leruez, Stéphanie; Reynier, Pascal; Chichua, George; Tabagari, Sergo; Uebe, Steffen; Zenkel, Matthias; Berner, Daniel; Mossböck, Georg; Weisschuh, Nicole; Hoja, Ursula; Welge-Luessen, Ulrich-Christoph; Mardin, Christian; Founti, Panayiota; Chatzikyriakidou, Anthi; Pappas, Theofanis; Anastasopoulos, Eleftherios; Lambropoulos, Alexandros; Ghosh, Arkasubhra; Shetty, Rohit; Porporato, Natalia; Saravanan, Vijayan; Venkatesh, Rengaraj; Shivkumar, Chandrashekaran; Kalpana, Narendran; Sarangapani, Sripriya; Kanavi, Mozhgan R; Beni, Afsaneh Naderi; Yazdani, Shahin; Lashay, Alireza; Naderifar, Homa; Khatibi, Nassim; Fea, Antonio; Lavia, Carlo; Dallorto, Laura; Rolle, Teresa; Frezzotti, Paolo; Paoli, Daniela; Salvi, Erika; Manunta, Paolo; Mori, Yosai; Miyata, Kazunori; Higashide, Tomomi; Chihara, Etsuo; Ishiko, Satoshi; Yoshida, Akitoshi; Yanagi, Masahide; Kiuchi, Yoshiaki; Ohashi, Tsutomu; Sakurai, Toshiya; Sugimoto, Takako; Chuman, Hideki; Aihara, Makoto; Inatani, Masaru; Miyake, Masahiro; Gotoh, Norimoto; Matsuda, Fumihiko; Yoshimura, Nagahisa; Ikeda, Yoko; Ueno, Morio; Sotozono, Chie; Jeoung, Jin Wook; Sagong, Min; Park, Kyu Hyung; Ahn, Jeeyun; Cruz-Aguilar, Marisa; Ezzouhairi, Sidi M; Rafei, Abderrahman; Chong, Yaan Fun; Ng, Xiao Yu; Goh, Shuang Ru; Chen, Yueming; Yong, Victor H K; Khan, Muhammad Imran; Olawoye, Olusola O; Ashaye, Adeyinka O; Ugbede, Idakwo; Onakoya, Adeola; Kizor-Akaraiwe, Nkiru; Teekhasaenee, Chaiwat; Suwan, Yanin; Supakontanasan, Wasu; Okeke, Suhanya; Uche, Nkechi J; Asimadu, Ifeoma; Ayub, Humaira; Akhtar, Farah; Kosior-Jarecka, Ewa; Lukasik, Urszula; Lischinsky, Ignacio; Castro, Vania; Grossmann, Rodolfo Perez; Sunaric Megevand, Gordana; Roy, Sylvain; Dervan, Edward; Silke, Eoin; Rao, Aparna; Sahay, Priti; Fornero, Pablo; Cuello, Osvaldo; Sivori, Delia; Zompa, Tamara; Mills, Richard A; Souzeau, Emmanuelle; Mitchell, Paul; Wang, Jie Jin; Hewitt, Alex W; Coote, Michael; Crowston, Jonathan G; Astakhov, Sergei Y; Akopov, Eugeny L; Emelyanov, Anton; Vysochinskaya, Vera; Kazakbaeva, Gyulli; Fayzrakhmanov, Rinat; Al-Obeidan, Saleh A; Owaidhah, Ohoud; Aljasim, Leyla Ali; Chowbay, Balram; Foo, Jia Nee; Soh, Raphael Q; Sim, Kar Seng; Xie, Zhicheng; Cheong, Augustine W O; Mok, Shi Qi; Soo, Hui Meng; Chen, Xiao Yin; Peh, Su Qin; Heng, Khai Koon; Husain, Rahat; Ho, Su-Ling; Hillmer, Axel M; Cheng, Ching-Yu; Escudero-Domínguez, Francisco A; González-Sarmiento, Rogelio; Martinon-Torres, Frederico; Salas, Antonio; Pathanapitoon, Kessara; Hansapinyo, Linda; Wanichwecharugruang, Boonsong; Kitnarong, Naris; Sakuntabhai, Anavaj; Nguyn, Hip X; Nguyn, Giang T T; Nguyn, Trình V; Zenz, Werner; Binder, Alexander; Klobassa, Daniela S; Hibberd, Martin L; Davila, Sonia; Herms, Stefan; Nöthen, Markus M; Moebus, Susanne; Rautenbach, Robyn M; Ziskind, Ari; Carmichael, Trevor R; Ramsay, Michele; Álvarez, Lydia; García, Montserrat; González-Iglesias, Héctor; Rodríguez-Calvo, Pedro P; Fernández-Vega Cueto, Luis; Oguz, Çilingir; Tamcelik, Nevbahar; Atalay, Eray; Batu, Bilge; Aktas, Dilek; Kasım, Burcu; Wilson, M Roy; Coleman, Anne L; Liu, Yutao; Challa, Pratap; Herndon, Leon; Kuchtey, Rachel W; Kuchtey, John; Curtin, Karen; Chaya, Craig J; Crandall, Alan; Zangwill, Linda M; Wong, Tien Yin; Nakano, Masakazu; Kinoshita, Shigeru; den Hollander, Anneke I; Vesti, Eija; Fingert, John H; Lee, Richard K; Sit, Arthur J; Shingleton, Bradford J; Wang, Ningli; Cusi, Daniele; Qamar, Raheel; Kraft, Peter; Pericak-Vance, Margaret A; Raychaudhuri, Soumya; Heegaard, Steffen; Kivelä, Tero; Reis, André; Kruse, Friedrich E; Weinreb, Robert N; Pasquale, Louis R; Haines, Jonathan L; Thorsteinsdottir, Unnur; Jonasson, Fridbert; Allingham, R Rand; Milea, Dan; Ritch, Robert; Kubota, Toshiaki; Tashiro, Kei; Vithana, Eranga N; Micheal, Shazia; Topouzis, Fotis; Craig, Jamie E; Dubina, Michael; Sundaresan, Periasamy; Stefansson, Kari; Wiggs, Janey L; Pasutto, Francesca; Khor, Chiea Chuen

    2017-07-01

    Exfoliation syndrome (XFS) is the most common known risk factor for secondary glaucoma and a major cause of blindness worldwide. Variants in two genes, LOXL1 and CACNA1A, have previously been associated with XFS. To further elucidate the genetic basis of XFS, we collected a global sample of XFS cases to refine the association at LOXL1, which previously showed inconsistent results across populations, and to identify new variants associated with XFS. We identified a rare protective allele at LOXL1 (p.Phe407, odds ratio (OR) = 25, P = 2.9 × 10 -14 ) through deep resequencing of XFS cases and controls from nine countries. A genome-wide association study (GWAS) of XFS cases and controls from 24 countries followed by replication in 18 countries identified seven genome-wide significant loci (P < 5 × 10 -8 ). We identified association signals at 13q12 (POMP), 11q23.3 (TMEM136), 6p21 (AGPAT1), 3p24 (RBMS3) and 5q23 (near SEMA6A). These findings provide biological insights into the pathology of XFS and highlight a potential role for naturally occurring rare LOXL1 variants in disease biology.

  13. A Systematic Approach to Identify Promising New Items for Small to Medium Enterprises: A Case Study

    Directory of Open Access Journals (Sweden)

    Sukjae Jeong

    2016-11-01

    Full Text Available Despite the growing importance of identifying new business items for small and medium enterprises (SMEs, most previous studies focus on conglomerates. The paucity of empirical studies has also led to limited real-life applications. Hence, this study proposes a systematic approach to find new business items (NBIs that help the prospective SMEs develop, evaluate, and select viable business items to survive the competitive environment. The proposed approach comprises two stages: (1 the classification of diversification of SMEs; and (2 the searching and screening of business items. In the first stage, SMEs are allocated to five groups, based on their internal technological competency and external market conditions. In the second stage, based on the types of SMEs identified in the first stage, a set of alternative business items is derived by combining the results of portfolio analysis and benchmarking analysis. After deriving new business items, a market and technology-driven matrix analysis is utilized to screen suitable business items, and the Bruce Merrifield-Ohe (BMO method is used to categorize and identify prospective items based on market attractiveness and internal capability. To illustrate the applicability of the proposed approach, a case study is presented.

  14. Twelve previously unknown phage genera are ubiquitous in global oceans.

    Science.gov (United States)

    Holmfeldt, Karin; Solonenko, Natalie; Shah, Manesh; Corrier, Kristen; Riemann, Lasse; Verberkmoes, Nathan C; Sullivan, Matthew B

    2013-07-30

    Viruses are fundamental to ecosystems ranging from oceans to humans, yet our ability to study them is bottlenecked by the lack of ecologically relevant isolates, resulting in "unknowns" dominating culture-independent surveys. Here we present genomes from 31 phages infecting multiple strains of the aquatic bacterium Cellulophaga baltica (Bacteroidetes) to provide data for an underrepresented and environmentally abundant bacterial lineage. Comparative genomics delineated 12 phage groups that (i) each represent a new genus, and (ii) represent one novel and four well-known viral families. This diversity contrasts the few well-studied marine phage systems, but parallels the diversity of phages infecting human-associated bacteria. Although all 12 Cellulophaga phages represent new genera, the podoviruses and icosahedral, nontailed ssDNA phages were exceptional, with genomes up to twice as large as those previously observed for each phage type. Structural novelty was also substantial, requiring experimental phage proteomics to identify 83% of the structural proteins. The presence of uncommon nucleotide metabolism genes in four genera likely underscores the importance of scavenging nutrient-rich molecules as previously seen for phages in marine environments. Metagenomic recruitment analyses suggest that these particular Cellulophaga phages are rare and may represent a first glimpse into the phage side of the rare biosphere. However, these analyses also revealed that these phage genera are widespread, occurring in 94% of 137 investigated metagenomes. Together, this diverse and novel collection of phages identifies a small but ubiquitous fraction of unknown marine viral diversity and provides numerous environmentally relevant phage-host systems for experimental hypothesis testing.

  15. IDGenerator: unique identifier generator for epidemiologic or clinical studies

    Directory of Open Access Journals (Sweden)

    Matthias Olden

    2016-09-01

    Full Text Available Abstract Background Creating study identifiers and assigning them to study participants is an important feature in epidemiologic studies, ensuring the consistency and privacy of the study data. The numbering system for identifiers needs to be random within certain number constraints, to carry extensions coding for organizational information, or to contain multiple layers of numbers per participant to diversify data access. Available software can generate globally-unique identifiers, but identifier-creating tools meeting the special needs of epidemiological studies are lacking. We have thus set out to develop a software program to generate IDs for epidemiological or clinical studies. Results Our software IDGenerator creates unique identifiers that not only carry a random identifier for a study participant, but also support the creation of structured IDs, where organizational information is coded into the ID directly. This may include study center (for multicenter-studies, study track (for studies with diversified study programs, or study visit (baseline, follow-up, regularly repeated visits. Our software can be used to add a check digit to the ID to minimize data entry errors. It facilitates the generation of IDs in batches and the creation of layered IDs (personal data ID, study data ID, temporary ID, external data ID to ensure a high standard of data privacy. The software is supported by a user-friendly graphic interface that enables the generation of IDs in both standard text and barcode 128B format. Conclusion Our software IDGenerator can create identifiers meeting the specific needs for epidemiologic or clinical studies to facilitate study organization and data privacy. IDGenerator is freeware under the GNU General Public License version 3; a Windows port and the source code can be downloaded at the Open Science Framework website: https://osf.io/urs2g/ .

  16. Summary of Previous Chamber or Controlled Anthrax Studies and Recommendations for Possible Additional Studies

    Energy Technology Data Exchange (ETDEWEB)

    Piepel, Gregory F.; Amidan, Brett G.; Morrow, Jayne B.

    2010-12-29

    This report and an associated Excel file(a) summarizes the investigations and results of previous chamber and controlled studies(b) to characterize the performance of methods for collecting, storing and/or transporting, extracting, and analyzing samples from surfaces contaminated by Bacillus anthracis (BA) or related simulants. This report and the Excel are the joint work of the Pacific Northwest National Laboratory (PNNL) and the National Institute of Standards and Technology (NIST) for the Department of Homeland Security, Science and Technology Directorate. The report was originally released as PNNL-SA-69338, Rev. 0 in November 2009 with limited distribution, but was subsequently cleared for release with unlimited distribution in this Rev. 1. Only minor changes were made to Rev. 0 to yield Rev. 1. A more substantial update (including summarizing data from other studies and more condensed summary tables of data) is underway

  17. An fMRI study of neuronal activation in schizophrenia patients with and without previous cannabis use

    Directory of Open Access Journals (Sweden)

    Else-Marie eLøberg

    2012-10-01

    Full Text Available Previous studies have mostly shown positive effects of cannabis use on cognition in patients with schizophrenia, which could reflect lower neurocognitive vulnerability. There are however no studies comparing whether such cognitive differences have neuronal correlates. Thus, the aim of the present study was to compare whether patients with previous cannabis use differ in brain activation from patients who has never used cannabis. The patients groups were compared on the ability to up-regulate an effort mode network during a cognitive task and down-regulate activation in the same network during a task-absent condition. Task-present and task-absent brain activation was measured by functional magnetic resonance neuroimaging (fMRI. Twenty-six patients with a DSM-IV and ICD-10 diagnosis of schizophrenia were grouped into a previous cannabis user group and a no-cannabis group. An auditory dichotic listening task with instructions of attention focus on either the right or left ear stimulus was used to tap verbal processing, attention and cognitive control, calculated as an aggregate score. When comparing the two groups, there were remaining activations in the task-present condition for the cannabis group, not seen in the no-cannabis group, while there was remaining activation in the task-absent condition for the no-cannabis group, not seen in the cannabis group. Thus, the patients with previous cannabis use showed increased activation in an effort mode network and decreased activation in the default mode network as compared to the no-cannabis group. It is concluded that the present study show some differences in brain activation to a cognitively challenging task between previous cannabis and no-cannabis schizophrenia patients.

  18. Previous experiences and emotional baggage as barriers to lifestyle change - a qualitative study of Norwegian Healthy Life Centre participants.

    Science.gov (United States)

    Følling, Ingrid S; Solbjør, Marit; Helvik, Anne-S

    2015-06-23

    Changing lifestyle is challenging and difficult. The Norwegian Directorate of Health recommends that all municipalities establish Healthy Life Centres targeted to people with lifestyle issues. Little is known about the background, experiences and reflections of participants. More information is needed about participants to shape effective lifestyle interventions with lasting effect. This study explores how participants in a lifestyle intervention programme describe previous life experiences in relation to changing lifestyle. Semi-structured qualitative in-depth interviews were performed with 23 participants (16 women and 7 men) aged 18 - 70 years. The data were analysed using systematic text condensation searching for issues describing participants' responses, and looking for the essence, aiming to share the basis of life-world experiences as valid knowledge. Participants identified two main themes: being stuck in old habits, and being burdened with emotional baggage from their previous negative experiences. Participants expressed a wish to change their lifestyles, but were unable to act in accordance with the health knowledge they possessed. Previous experiences with lifestyle change kept them from initiating attempts without professional assistance. Participants also described being burdened by an emotional baggage with problems from childhood and/or with family, work and social life issues. Respondents said that they felt that emotional baggage was an important explanation for why they were stuck in old habits and that conversely, being stuck in old habits added load to their already emotional baggage and made it heavier. Behavioural change can be hard to perform as psychological distress from life baggage can influence the ability to change. The study participants' experience of being stuck in old habits and having substantial emotional baggage raises questions as to whether or not Healthy Life Centres are able to help participants who need to make a lifestyle

  19. Previous dropout from diabetic care as a predictor of patients' willingness to use mobile applications for self-management: A cross-sectional study.

    Science.gov (United States)

    Yamaguchi, Satoko; Waki, Kayo; Tomizawa, Nobuko; Waki, Hironori; Nannya, Yasuhito; Nangaku, Masaomi; Kadowaki, Takashi; Ohe, Kazuhiko

    2017-07-01

    Preventing dropout is crucial in managing diabetes. Accordingly, we investigated whether patients who had dropped out of diabetic care are suitable candidates for the use of mobile technologies - such as smartphone applications - to support self-management (mHealth), which might help prevent dropout. We carried out a cross-sectional study in Tokyo, Japan. Patients aged 20 years or older who were clinically diagnosed as diabetic and who regularly visited the outpatient unit at the University of Tokyo Hospital were recruited between August 2014 and March 2015. Data were collected through face-to-face structured interviews, physical measurements and medical records. Participants were asked whether they were willing to use mHealth after being shown DialBetics - an mHealth application for diabetics - as an example, and about their history of dropout and previous mHealth experience. Data were analyzed by multivariate logistic regression models. Of 307 patients with type 1 and type 2 diabetes, 34 (11.1%) had previously dropped out from diabetic care. Multivariate analysis identified previous mHealth experience as a negative predictor of dropout (odds ratio 0.211, P = 0.023). Of those 34 patients, 27 (79.4%) expressed willingness to use mHealth, a significantly higher percentage than for those who had never dropped out (51.5%, P = 0.002). After adjusting for confounders, history of dropout remained a strong predictor of willingness (odds ratio 3.870, P = 0.004). Patients who previously dropped out of diabetic care are suitable candidates for mHealth. Future studies must evaluate whether mHealth is effective for preventing repeated dropout and improving glycemic control among this population. © 2016 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.

  20. Laparoscopy After Previous Laparotomy

    Directory of Open Access Journals (Sweden)

    Zulfo Godinjak

    2006-11-01

    Full Text Available Following the abdominal surgery, extensive adhesions often occur and they can cause difficulties during laparoscopic operations. However, previous laparotomy is not considered to be a contraindication for laparoscopy. The aim of this study is to present that an insertion of Veres needle in the region of umbilicus is a safe method for creating a pneumoperitoneum for laparoscopic operations after previous laparotomy. In the last three years, we have performed 144 laparoscopic operations in patients that previously underwent one or two laparotomies. Pathology of digestive system, genital organs, Cesarean Section or abdominal war injuries were the most common causes of previouslaparotomy. During those operations or during entering into abdominal cavity we have not experienced any complications, while in 7 patients we performed conversion to laparotomy following the diagnostic laparoscopy. In all patients an insertion of Veres needle and trocar insertion in the umbilical region was performed, namely a technique of closed laparoscopy. Not even in one patient adhesions in the region of umbilicus were found, and no abdominal organs were injured.

  1. Data from studies of previous radioactive waste disposal in Massachusetts Bay

    International Nuclear Information System (INIS)

    Curtis, W.R.; Mardis, H.M.

    1984-12-01

    This report presents the results of studies conducted in Massachusetts Bay during 1981 and 1982. Included are data from: (1) a side scan sonar survey of disposal areas in the Bay that was carried out by the National Oceanic and Atmospheric Administration (NOAA) for EPA; (2) Collections of sediment and biota by NOAA for radiochemical analysis by EPA; (3) collections of marketplace seafood samples by the Food and Drug Administration (FDA) for radioanalysis by both FDA and EPA; and (4) a radiological monitoring survey of LLW disposal areas by EPA to determine whether there should be any concern for public health resulting from previous LLW disposals in the Bay

  2. Cellular signaling identifiability analysis: a case study.

    Science.gov (United States)

    Roper, Ryan T; Pia Saccomani, Maria; Vicini, Paolo

    2010-05-21

    Two primary purposes for mathematical modeling in cell biology are (1) simulation for making predictions of experimental outcomes and (2) parameter estimation for drawing inferences from experimental data about unobserved aspects of biological systems. While the former purpose has become common in the biological sciences, the latter is less common, particularly when studying cellular and subcellular phenomena such as signaling-the focus of the current study. Data are difficult to obtain at this level. Therefore, even models of only modest complexity can contain parameters for which the available data are insufficient for estimation. In the present study, we use a set of published cellular signaling models to address issues related to global parameter identifiability. That is, we address the following question: assuming known time courses for some model variables, which parameters is it theoretically impossible to estimate, even with continuous, noise-free data? Following an introduction to this problem and its relevance, we perform a full identifiability analysis on a set of cellular signaling models using DAISY (Differential Algebra for the Identifiability of SYstems). We use our analysis to bring to light important issues related to parameter identifiability in ordinary differential equation (ODE) models. We contend that this is, as of yet, an under-appreciated issue in biological modeling and, more particularly, cell biology. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  3. Association between previous splenectomy and gastric dilatation-volvulus in dogs: 453 cases (2004-2009).

    Science.gov (United States)

    Sartor, Angela J; Bentley, Adrienne M; Brown, Dorothy C

    2013-05-15

    To evaluate the association between previous splenectomy and gastric dilatation-volvulus (GDV) in dogs. Multi-institutional retrospective case-control study. Animals-151 dogs treated surgically for GDV and 302 control dogs with no history of GDV. Computerized records of dogs evaluated via exploratory laparotomy or abdominal ultrasonography were searched, and dogs with GDV and dogs without GDV (control dogs) were identified. Two control dogs were matched with respect to age, body weight, sex, neuter status, and breed to each dog with GDV. Data were collected on the presence or absence of the spleen for both dogs with GDV and control dogs. Conditional logistic regression analysis was used to investigate the association of previous splenectomy with GDV. 6 (4%) dogs in the GDV group and 3 (1%) dogs in the control group had a history of previous splenectomy. The odds of GDV in dogs with a history of previous splenectomy in this population of dogs were 5.3 times those of dogs without a history of previous splenectomy (95% confidence interval, 1.1 to 26.8). For the patients in the present study, there was an increased odds of GDV in dogs with a history of splenectomy. Prophylactic gastropexy may be considered in dogs undergoing a splenectomy, particularly if other risk factors for GDV are present.

  4. Genomic Regions Affecting Cheese Making Properties Identified in Danish Holsteins

    DEFF Research Database (Denmark)

    Gregersen, Vivi Raundahl; Bertelsen, Henriette Pasgaard; Poulsen, Nina Aagaard

    The cheese renneting process is affected by a number of factors associated to milk composition and a number of Danish Holsteins has previously been identified to have poor milk coagulation ability. Therefore, the aim of this study was to identify genomic regions affecting the technological...

  5. Rapid fish stock depletion in previously unexploited seamounts: the ...

    African Journals Online (AJOL)

    Rapid fish stock depletion in previously unexploited seamounts: the case of Beryx splendens from the Sierra Leone Rise (Gulf of Guinea) ... A spectral analysis and red-noise spectra procedure (REDFIT) algorithm was used to identify the red-noise spectrum from the gaps in the observed time-series of catch per unit effort by ...

  6. Exome-wide Association Study Identifies GREB1L Mutations in Congenital Kidney Malformations.

    Science.gov (United States)

    Sanna-Cherchi, Simone; Khan, Kamal; Westland, Rik; Krithivasan, Priya; Fievet, Lorraine; Rasouly, Hila Milo; Ionita-Laza, Iuliana; Capone, Valentina P; Fasel, David A; Kiryluk, Krzysztof; Kamalakaran, Sitharthan; Bodria, Monica; Otto, Edgar A; Sampson, Matthew G; Gillies, Christopher E; Vega-Warner, Virginia; Vukojevic, Katarina; Pediaditakis, Igor; Makar, Gabriel S; Mitrotti, Adele; Verbitsky, Miguel; Martino, Jeremiah; Liu, Qingxue; Na, Young-Ji; Goj, Vinicio; Ardissino, Gianluigi; Gigante, Maddalena; Gesualdo, Loreto; Janezcko, Magdalena; Zaniew, Marcin; Mendelsohn, Cathy Lee; Shril, Shirlee; Hildebrandt, Friedhelm; van Wijk, Joanna A E; Arapovic, Adela; Saraga, Marijan; Allegri, Landino; Izzi, Claudia; Scolari, Francesco; Tasic, Velibor; Ghiggeri, Gian Marco; Latos-Bielenska, Anna; Materna-Kiryluk, Anna; Mane, Shrikant; Goldstein, David B; Lifton, Richard P; Katsanis, Nicholas; Davis, Erica E; Gharavi, Ali G

    2017-11-02

    Renal agenesis and hypodysplasia (RHD) are major causes of pediatric chronic kidney disease and are highly genetically heterogeneous. We conducted whole-exome sequencing in 202 case subjects with RHD and identified diagnostic mutations in genes known to be associated with RHD in 7/202 case subjects. In an additional affected individual with RHD and a congenital heart defect, we found a homozygous loss-of-function (LOF) variant in SLIT3, recapitulating phenotypes reported with Slit3 inactivation in the mouse. To identify genes associated with RHD, we performed an exome-wide association study with 195 unresolved case subjects and 6,905 control subjects. The top signal resided in GREB1L, a gene implicated previously in Hoxb1 and Shha signaling in zebrafish. The significance of the association, which was p = 2.0 × 10 -5 for novel LOF, increased to p = 4.1 × 10 -6 for LOF and deleterious missense variants combined, and augmented further after accounting for segregation and de novo inheritance of rare variants (joint p = 2.3 × 10 -7 ). Finally, CRISPR/Cas9 disruption or knockdown of greb1l in zebrafish caused specific pronephric defects, which were rescued by wild-type human GREB1L mRNA, but not mRNA containing alleles identified in case subjects. Together, our study provides insight into the genetic landscape of kidney malformations in humans, presents multiple candidates, and identifies SLIT3 and GREB1L as genes implicated in the pathogenesis of RHD. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  7. Do attitudes of families concerned influence features of children who claim to remember previous lives?

    Science.gov (United States)

    Pasricha, Satwant K

    2011-01-01

    Reported cases of nearly 2600 children (subjects) who claim to remember previous lives have been investigated in cultures with and without belief in reincarnation. The authenticity in most cases has been established. To study the influence of attitudes of parents of the subjects, families of the deceased person with whom they are identified and attention paid by others on the features of the cases. The study is based on field investigations. Data is derived from analysis of a larger series of an ongoing project. Information on initial and subsequent attitudes of subjects' mothers was available for 292 and 136 cases, respectively; attitudes of 227 families of deceased person (previous personality) with whom he is identified, and the extent of attention received from outsiders for 252 cases. Observations and interviews with multiple firsthand informants on both sides of the case as well as some neutral informants supplemented by examination of objective data were the chief methods of investigation. The initial attitude of mothers varied from encouragement (21%) to neutral or tolerance (51%) to discouragement (28%). However, it changed significantly from neutrality to taking measures to induce amnesia in their children for previous life memories due to various psychosocial pressures and prevalent beliefs. Families of the previous personalities, once convinced, showed complete acceptance in a majority of cases. Outside attention was received in 58% cases. The positive attitude of parents might facilitate expression of memories but subsequently attitudes of persons concerned do not seem to alter features of the cases.

  8. Repeat immigration: A previously unobserved source of heterogeneity?

    Science.gov (United States)

    Aradhya, Siddartha; Scott, Kirk; Smith, Christopher D

    2017-07-01

    Register data allow for nuanced analyses of heterogeneities between sub-groups which are not observable in other data sources. One heterogeneity for which register data is particularly useful is in identifying unique migration histories of immigrant populations, a group of interest across disciplines. Years since migration is a commonly used measure of integration in studies seeking to understand the outcomes of immigrants. This study constructs detailed migration histories to test whether misclassified migrations may mask important heterogeneities. In doing so, we identify a previously understudied group of migrants called repeat immigrants, and show that they differ systematically from permanent immigrants. In addition, we quantify the degree to which migration information is misreported in the registers. The analysis is carried out in two steps. First, we estimate income trajectories for repeat immigrants and permanent immigrants to understand the degree to which they differ. Second, we test data validity by cross-referencing migration information with changes in income to determine whether there are inconsistencies indicating misreporting. From the first part of the analysis, the results indicate that repeat immigrants systematically differ from permanent immigrants in terms of income trajectories. Furthermore, income trajectories differ based on the way in which years since migration is calculated. The second part of the analysis suggests that misreported migration events, while present, are negligible. Repeat immigrants differ in terms of income trajectories, and may differ in terms of other outcomes as well. Furthermore, this study underlines that Swedish registers provide a reliable data source to analyze groups which are unidentifiable in other data sources.

  9. Preoperative screening: value of previous tests.

    Science.gov (United States)

    Macpherson, D S; Snow, R; Lofgren, R P

    1990-12-15

    To determine the frequency of tests done in the year before elective surgery that might substitute for preoperative screening tests and to determine the frequency of test results that change from a normal value to a value likely to alter perioperative management. Retrospective cohort analysis of computerized laboratory data (complete blood count, sodium, potassium, and creatinine levels, prothrombin time, and partial thromboplastin time). Urban tertiary care Veterans Affairs Hospital. Consecutive sample of 1109 patients who had elective surgery in 1988. At admission, 7549 preoperative tests were done, 47% of which duplicated tests performed in the previous year. Of 3096 previous results that were normal as defined by hospital reference range and done closest to the time of but before admission (median interval, 2 months), 13 (0.4%; 95% CI, 0.2% to 0.7%), repeat values were outside a range considered acceptable for surgery. Most of the abnormalities were predictable from the patient's history, and most were not noted in the medical record. Of 461 previous tests that were abnormal, 78 (17%; CI, 13% to 20%) repeat values at admission were outside a range considered acceptable for surgery (P less than 0.001, frequency of clinically important abnormalities of patients with normal previous results with those with abnormal previous results). Physicians evaluating patients preoperatively could safely substitute the previous test results analyzed in this study for preoperative screening tests if the previous tests are normal and no obvious indication for retesting is present.

  10. Genome-Wide Association Study Identifies Loci for Salt Tolerance during Germination in Autotetraploid Alfalfa (Medicago sativa L.) Using Genotyping-by-Sequencing

    Science.gov (United States)

    Yu, Long-Xi; Liu, Xinchun; Boge, William; Liu, Xiang-Ping

    2016-01-01

    Salinity is one of major abiotic stresses limiting alfalfa (Medicago sativa L.) production in the arid and semi-arid regions in US and other counties. In this study, we used a diverse panel of alfalfa accessions previously described by Zhang et al. (2015) to identify molecular markers associated with salt tolerance during germination using genome-wide association study (GWAS) and genotyping-by-sequencing (GBS). Phenotyping was done by germinating alfalfa seeds under different levels of salt stress. Phenotypic data of adjusted germination rates and SNP markers generated by GBS were used for marker-trait association. Thirty six markers were significantly associated with salt tolerance in at least one level of salt treatments. Alignment of sequence tags to the Medicago truncatula genome revealed genetic locations of the markers on all chromosomes except chromosome 3. Most significant markers were found on chromosomes 1, 2, and 4. BLAST search using the flanking sequences of significant markers identified 14 putative candidate genes linked to 23 significant markers. Most of them were repeatedly identified in two or three salt treatments. Several loci identified in the present study had similar genetic locations to the reported QTL associated with salt tolerance in M. truncatula. A locus identified on chromosome 6 by this study overlapped with that by drought in our previous study. To our knowledge, this is the first report on mapping loci associated with salt tolerance during germination in autotetraploid alfalfa. Further investigation on these loci and their linked genes would provide insight into understanding molecular mechanisms by which salt and drought stresses affect alfalfa growth. Functional markers closely linked to the resistance loci would be useful for MAS to improve alfalfa cultivars with enhanced resistance to drought and salt stresses. PMID:27446182

  11. Survival after early-stage breast cancer of women previously treated for depression

    DEFF Research Database (Denmark)

    Suppli, Nis Frederik Palm; Johansen, Christoffer; Kessing, Lars Vedel

    2017-01-01

    treatment of depression and risk of receiving nonguideline treatment of breast cancer were assessed in multivariable logistic regression analyses. We compared the overall survival, breast cancer-specific survival, and risk of death by suicide of women who were and were not treated for depression before......Purpose The aim of this nationwide, register-based cohort study was to determine whether women treated for depression before primary early-stage breast cancer are at increased risk for receiving treatment that is not in accordance with national guidelines and for poorer survival. Material...... and Methods We identified 45,325 women with early breast cancer diagnosed in Denmark from 1998 to 2011. Of these, 744 women (2%) had had a previous hospital contact (as an inpatient or outpatient) for depression and another 6,068 (13%) had been treated with antidepressants. Associations between previous...

  12. Genome-wide association study for levels of total serum IgE identifies HLA-C in a Japanese population.

    Directory of Open Access Journals (Sweden)

    Yohei Yatagai

    Full Text Available Most of the previously reported loci for total immunoglobulin E (IgE levels are related to Th2 cell-dependent pathways. We undertook a genome-wide association study (GWAS to identify genetic loci responsible for IgE regulation. A total of 479,940 single nucleotide polymorphisms (SNPs were tested for association with total serum IgE levels in 1180 Japanese adults. Fine-mapping with SNP imputation demonstrated 6 candidate regions: the PYHIN1/IFI16, MHC classes I and II, LEMD2, GRAMD1B, and chr13∶60576338 regions. Replication of these candidate loci in each region was assessed in 2 independent Japanese cohorts (n = 1110 and 1364, respectively. SNP rs3130941 in the HLA-C region was consistently associated with total IgE levels in 3 independent populations, and the meta-analysis yielded genome-wide significance (P = 1.07×10(-10. Using our GWAS results, we also assessed the reproducibility of previously reported gene associations with total IgE levels. Nine of 32 candidate genes identified by a literature search were associated with total IgE levels after correction for multiple testing. Our findings demonstrate that SNPs in the HLA-C region are strongly associated with total serum IgE levels in the Japanese population and that some of the previously reported genetic associations are replicated across ethnic groups.

  13. Transcriptomic analysis in a Drosophila model identifies previously implicated and novel pathways in the therapeutic mechanism in neuropsychiatric disorders

    Directory of Open Access Journals (Sweden)

    Priyanka eSingh

    2011-03-01

    Full Text Available We have taken advantage of a newly described Drosophila model to gain insights into the potential mechanism of antiepileptic drugs (AEDs, a group of drugs that are widely used in the treatment of several neurological and psychiatric conditions besides epilepsy. In the recently described Drosophila model that is inspired by pentylenetetrazole (PTZ induced kindling epileptogenesis in rodents, chronic PTZ treatment for seven days causes a decreased climbing speed and an altered CNS transcriptome, with the latter mimicking gene expression alterations reported in epileptogenesis. In the model, an increased climbing speed is further observed seven days after withdrawal from chronic PTZ. We used this post-PTZ withdrawal regime to identify potential AED mechanism. In this regime, treatment with each of the five AEDs tested, namely, ethosuximide (ETH, gabapentin (GBP, vigabatrin (VGB, sodium valproate (NaVP and levetiracetam (LEV, resulted in rescuing of the altered climbing behavior. The AEDs also normalized PTZ withdrawal induced transcriptomic perturbation in fly heads; whereas AED untreated flies showed a large number of up- and down-regulated genes which were enriched in several processes including gene expression and cell communication, the AED treated flies showed differential expression of only a small number of genes that did not enrich gene expression and cell communication processes. Gene expression and cell communication related upregulated genes in AED untreated flies overrepresented several pathways - spliceosome, RNA degradation, and ribosome in the former category, and inositol phosphate metabolism, phosphatidylinositol signaling, endocytosis and hedgehog signaling in the latter. Transcriptome remodeling effect of AEDs was overall confirmed by microarray clustering that clearly separated the profiles of AED treated and untreated flies. Besides being consistent with previously implicated pathways, our results provide evidence for a role of

  14. Meta-Analysis of Genome-Wide Association Studies for Abdominal Aortic Aneurysm Identifies Four New Disease-Specific Risk Loci

    NARCIS (Netherlands)

    Jones, G.T.; Tromp, G.; Kuivaniemi, H.; Gretarsdottir, S.; Baas, A.F.; Giusti, B.; Strauss, E.; Hof, F.N. van 't; Webb, T.R.; Erdman, R.; Ritchie, M.D.; Elmore, J.R.; Verma, A.; Pendergrass, S.; Kullo, I.J.; Ye, Z.; Peissig, P.L.; Gottesman, O.; Verma, S.S.; Malinowski, J.; Rasmussen-Torvik, L.J.; Borthwick, K.M.; Smelser, D.T.; Crosslin, D.R.; Andrade, M. de; Ryer, E.J.; McCarty, C.A.; Bottinger, E.P.; Pacheco, J.A.; Crawford, D.C.; Carrell, D.S.; Gerhard, G.S.; Franklin, D.P.; Carey, D.J.; Phillips, V.L.; Williams, M.J.; Wei, W.; Blair, R.; Hill, A.A.; Vasudevan, T.M.; Lewis, D.R.; Thomson, I.A.; Krysa, J.; Hill, G.B.; Roake, J.; Merriman, T.R.; Oszkinis, G.; Galora, S.; Saracini, C.; Abbate, R.; Pulli, R.; Pratesi, C.; Saratzis, A.; Verissimo, A.R.; Bumpstead, S.; Badger, S.A.; Clough, R.E.; Cockerill, G.; Hafez, H.; Scott, D.J.; Futers, T.S.; Romaine, S.P.; Bridge, K.; Griffin, K.J.; Bailey, M.A.; Smith, A.; Thompson, M.M.; Bockxmeer, F.M. van; Matthiasson, S.E.; Thorleifsson, G.; Thorsteinsdottir, U.; Blankensteijn, J.D.; Teijink, J.A.; Wijmenga, C.; Graaf, J. de; Kiemeney, L.A.L.M.; Lindholt, J.S.; Hughes, A.; Bradley, D.T.; Stirrups, K.; Golledge, J.; Norman, P.E.; Powell, J.T.; Humphries, S.E.; Hamby, S.E.; Goodall, A.H.; Nelson, C.P.; Sakalihasan, N.; Courtois, A.; Ferrell, R.E.; Eriksson, P.; Folkersen, L.; Franco-Cereceda, A.; Eicher, J.D.; Johnson, A.D.; Betsholtz, C.; Ruusalepp, A.; Franzen, O.; Schadt, E.E.; Bjorkegren, J.L.; et al.,

    2017-01-01

    RATIONALE: Abdominal aortic aneurysm (AAA) is a complex disease with both genetic and environmental risk factors. Together, 6 previously identified risk loci only explain a small proportion of the heritability of AAA. OBJECTIVE: To identify additional AAA risk loci using data from all available

  15. Prevention of type 2 diabetes mellitus in women with previous gestational diabetes mellitus.

    Science.gov (United States)

    Moon, Joon Ho; Kwak, Soo Heon; Jang, Hak C

    2017-01-01

    Gestational diabetes mellitus (GDM), defined as any degree of glucose intolerance with onset or first recognition during pregnancy, is characterized by underlying maternal defects in the β-cell response to insulin during pregnancy. Women with a previous history of GDM have a greater than 7-fold higher risk of developing postpartum diabetes compared with women without GDM. Various risk factors for postpartum diabetes have been identified, including maternal age, glucose levels in pregnancy, family history of diabetes, pre-pregnancy and postpartum body mass index, dietary patterns, physical activity, and breastfeeding. Genetic studies revealed that GDM shares common genetic variants with type 2 diabetes. A number of lifestyle interventional trials that aimed to ameliorate modifiable risk factors, including diet, exercise, and breastfeeding, succeeded in reducing the incidence of postpartum diabetes, weight retention, and other obesity-related morbidities. The present review summarizes the findings of previous studies on the incidence and risk factors of postpartum diabetes and discusses recent lifestyle interventional trials that attempted to prevent postpartum diabetes.

  16. NIH Researchers Identify OCD Risk Gene

    Science.gov (United States)

    ... News From NIH NIH Researchers Identify OCD Risk Gene Past Issues / Summer 2006 Table of Contents For ... and Alcoholism (NIAAA) have identified a previously unknown gene variant that doubles an individual's risk for obsessive- ...

  17. Thirty new loci for age at menarche identified by a meta-analysis of genome-wide association studies

    Science.gov (United States)

    Elks, Cathy E.; Perry, John R.B.; Sulem, Patrick; Chasman, Daniel I.; Franceschini, Nora; He, Chunyan; Lunetta, Kathryn L.; Visser, Jenny A.; Byrne, Enda M.; Cousminer, Diana L.; Gudbjartsson, Daniel F.; Esko, Tõnu; Feenstra, Bjarke; Hottenga, Jouke-Jan; Koller, Daniel L.; Kutalik, Zoltán; Lin, Peng; Mangino, Massimo; Marongiu, Mara; McArdle, Patrick F.; Smith, Albert V.; Stolk, Lisette; van Wingerden, Sophie W.; Zhao, Jing Hua; Albrecht, Eva; Corre, Tanguy; Ingelsson, Erik; Hayward, Caroline; Magnusson, Patrik K.E.; Smith, Erin N.; Ulivi, Shelia; Warrington, Nicole M.; Zgaga, Lina; Alavere, Helen; Amin, Najaf; Aspelund, Thor; Bandinelli, Stefania; Barroso, Ines; Berenson, Gerald S.; Bergmann, Sven; Blackburn, Hannah; Boerwinkle, Eric; Buring, Julie E.; Busonero, Fabio; Campbell, Harry; Chanock, Stephen J.; Chen, Wei; Cornelis, Marilyn C.; Couper, David; Coviello, Andrea D.; d’Adamo, Pio; de Faire, Ulf; de Geus, Eco J.C.; Deloukas, Panos; Döring, Angela; Smith, George Davey; Easton, Douglas F.; Eiriksdottir, Gudny; Emilsson, Valur; Eriksson, Johan; Ferrucci, Luigi; Folsom, Aaron R.; Foroud, Tatiana; Garcia, Melissa; Gasparini, Paolo; Geller, Frank; Gieger, Christian; Gudnason, Vilmundur; Hall, Per; Hankinson, Susan E.; Ferreli, Liana; Heath, Andrew C.; Hernandez, Dena G.; Hofman, Albert; Hu, Frank B.; Illig, Thomas; Järvelin, Marjo-Riitta; Johnson, Andrew D.; Karasik, David; Khaw, Kay-Tee; Kiel, Douglas P.; Kilpeläinen, Tuomas O.; Kolcic, Ivana; Kraft, Peter; Launer, Lenore J.; Laven, Joop S.E.; Li, Shengxu; Liu, Jianjun; Levy, Daniel; Martin, Nicholas G.; McArdle, Wendy L.; Melbye, Mads; Mooser, Vincent; Murray, Jeffrey C.; Murray, Sarah S.; Nalls, Michael A.; Navarro, Pau; Nelis, Mari; Ness, Andrew R.; Northstone, Kate; Oostra, Ben A.; Peacock, Munro; Palmer, Lyle J.; Palotie, Aarno; Paré, Guillaume; Parker, Alex N.; Pedersen, Nancy L.; Peltonen, Leena; Pennell, Craig E.; Pharoah, Paul; Polasek, Ozren; Plump, Andrew S.; Pouta, Anneli; Porcu, Eleonora; Rafnar, Thorunn; Rice, John P.; Ring, Susan M.; Rivadeneira, Fernando; Rudan, Igor; Sala, Cinzia; Salomaa, Veikko; Sanna, Serena; Schlessinger, David; Schork, Nicholas J.; Scuteri, Angelo; Segrè, Ayellet V.; Shuldiner, Alan R.; Soranzo, Nicole; Sovio, Ulla; Srinivasan, Sathanur R.; Strachan, David P.; Tammesoo, Mar-Liis; Tikkanen, Emmi; Toniolo, Daniela; Tsui, Kim; Tryggvadottir, Laufey; Tyrer, Jonathon; Uda, Manuela; van Dam, Rob M.; van Meurs, Joyve B.J.; Vollenweider, Peter; Waeber, Gerard; Wareham, Nicholas J.; Waterworth, Dawn M.; Weedon, Michael N.; Wichmann, H. Erich; Willemsen, Gonneke; Wilson, James F.; Wright, Alan F.; Young, Lauren; Zhai, Guangju; Zhuang, Wei Vivian; Bierut, Laura J.; Boomsma, Dorret I.; Boyd, Heather A.; Crisponi, Laura; Demerath, Ellen W.; van Duijn, Cornelia M.; Econs, Michael J.; Harris, Tamara B.; Hunter, David J.; Loos, Ruth J.F.; Metspalu, Andres; Montgomery, Grant W.; Ridker, Paul M.; Spector, Tim D.; Streeten, Elizabeth A.; Stefansson, Kari; Thorsteinsdottir, Unnur; Uitterlinden, André G.; Widen, Elisabeth; Murabito, Joanne M.; Ong, Ken K.; Murray, Anna

    2011-01-01

    To identify loci for age at menarche, we performed a meta-analysis of 32 genome-wide association studies in 87,802 women of European descent, with replication in up to 14,731 women. In addition to the known loci at LIN28B (P=5.4×10−60) and 9q31.2 (P=2.2×10−33), we identified 30 novel menarche loci (all P<5×10−8) and found suggestive evidence for a further 10 loci (P<1.9×10−6). New loci included four previously associated with BMI (in/near FTO, SEC16B, TRA2B and TMEM18), three in/near other genes implicated in energy homeostasis (BSX, CRTC1, and MCHR2), and three in/near genes implicated in hormonal regulation (INHBA, PCSK2 and RXRG). Ingenuity and MAGENTA pathway analyses identified coenzyme A and fatty acid biosynthesis as biological processes related to menarche timing. PMID:21102462

  18. Genome-wide association study of PR interval in Hispanics/Latinos identifies novel locus at ID2.

    Science.gov (United States)

    Seyerle, Amanda A; Lin, Henry J; Gogarten, Stephanie M; Stilp, Adrienne; Méndez Giráldez, Raul; Soliman, Elsayed; Baldassari, Antoine; Graff, Mariaelisa; Heckbert, Susan; Kerr, Kathleen F; Kooperberg, Charles; Rodriguez, Carlos; Guo, Xiuqing; Yao, Jie; Sotoodehnia, Nona; Taylor, Kent D; Whitsel, Eric A; Rotter, Jerome I; Laurie, Cathy C; Avery, Christy L

    2017-11-10

    PR interval (PR) is a heritable electrocardiographic measure of atrial and atrioventricular nodal conduction. Changes in PR duration may be associated with atrial fibrillation, heart failure and all-cause mortality. Hispanic/Latino populations have high burdens of cardiovascular morbidity and mortality, are highly admixed and represent exceptional opportunities for novel locus identification. However, they remain chronically understudied. We present the first genome-wide association study (GWAS) of PR in 14 756 participants of Hispanic/Latino ancestry from three studies. Study-specific summary results of the association between 1000 Genomes Phase 1 imputed single-nucleotide polymorphisms (SNPs) and PR assumed an additive genetic model and were adjusted for global ancestry, study centre/region and clinical covariates. Results were combined using fixed-effects, inverse variance weighted meta-analysis. Sequential conditional analyses were used to identify independent signals. Replication of novel loci was performed in populations of Asian, African and European descent. ENCODE and RoadMap data were used to annotate results. We identified a novel genome-wide association (PPR at ID2 (rs6730558), which replicated in Asian and European populations (PPR loci to Hispanics/Latinos. Bioinformatics annotation provided evidence for regulatory function in cardiac tissue. Further, for six loci that generalised, the Hispanic/Latino index SNP was genome-wide significant and identical to (or in high linkage disequilibrium with) the previously identified GWAS lead SNP. Our results suggest that genetic determinants of PR are consistent across race/ethnicity, but extending studies to admixed populations can identify novel associations, underscoring the importance of conducting genetic studies in diverse populations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise

  19. Protein Supplement Usage Among Male University Students: Comparisons Between Current and Previous Users.

    Science.gov (United States)

    Sung, Youngmo; Choi, Jinkyung

    2018-02-01

    Interest in specialized dietary supplements is leading market growth, and protein supplements are popular for increasing muscle mass among young males. Therefore, this study investigated the attitudes toward and satisfaction with protein supplements to identify detailed consumer behaviors related to the consumption of protein supplements. The study sample includes male university students in their 20s in South Korea. In total, 223 responses were entered for analysis. Questions related to attitudes, satisfaction, and future behavioral intentions were asked using 5-point Likert scales. The responses were divided into two groups, current and previous users, to identify significant differences in terms of attitudes, satisfaction, and future behavioral intentions. A descriptive analysis, analysis of variance (ANOVA), and multiple regression were run. The majority of respondents prefer the powdered form of supplements in bulk with a price range between 30,000 won and 60,000 won. Online shopping was preferred, while word of mouth and friends/family were considered credible information sources. The most common side effects experienced were problems with digestion and hives, although more than 78% did not experience side effects. In comparison between current and previous users in terms of attitudes and satisfaction, the following areas showed significances. Regarding attitudes, the importance of brand, preference for products from overseas, the search for nutritional facts, and reading carefully all product information were significant, while regarding satisfaction, price, effectiveness, and ease of consumption were significant. All significances showed that current users had more positive attitudes and greater satisfaction. Overall, consumers' satisfaction regarding ease of consumption influenced future behavioral intentions. The market for protein supplements has been growing, so measuring consumers' attitudes and satisfaction would help attract potential consumers. In

  20. Thinking ahead of the surgeon. An interview study to identify scrub nurses' non-technical skills.

    Science.gov (United States)

    Mitchell, Lucy; Flin, Rhona; Yule, Steven; Mitchell, Janet; Coutts, Kathy; Youngson, George

    2011-07-01

    Efforts to reduce adverse event rates in healthcare have revealed the importance of identifying the essential non-technical (cognitive and social) skills for safe and effective performance. Previous research on non-technical skills for operating theatre staff has concentrated on doctors rather than nursing professionals. The aim of the study was to identify the critical non-technical skills that are essential for safe and effective performance as an operating theatre scrub nurse. Experienced scrub nurses (n = 25) and consultant surgeons (n = 9) from four Scottish hospitals were interviewed using a semi-structured format. The protocols were designed to identify the main social and cognitive skills required by scrub nurses. Interviews were digitally recorded, transcribed verbatim and independently coded to extract behaviours in order to produce a list of the main non-technical skills for safe and effective scrub nurse performance. The non-technical skills of situation awareness, communication, teamwork, task management and coping with stress were identified as key to successful scrub nurse task performance. Component sets of behaviours for each of these categories were also noted. The interviews with subject matter experts from scrub nursing and surgery produced preliminary evidence that situation awareness, communication, teamwork and coping with stress are the principal non-technical skills required for effective performance as a scrub nurse. Copyright © 2010 Elsevier Ltd. All rights reserved.

  1. Meta-analysis of Drosophila circadian microarray studies identifies a novel set of rhythmically expressed genes.

    Directory of Open Access Journals (Sweden)

    Kevin P Keegan

    2007-11-01

    Full Text Available Five independent groups have reported microarray studies that identify dozens of rhythmically expressed genes in the fruit fly Drosophila melanogaster. Limited overlap among the lists of discovered genes makes it difficult to determine which, if any, exhibit truly rhythmic patterns of expression. We reanalyzed data from all five reports and found two sources for the observed discrepancies, the use of different expression pattern detection algorithms and underlying variation among the datasets. To improve upon the methods originally employed, we developed a new analysis that involves compilation of all existing data, application of identical transformation and standardization procedures followed by ANOVA-based statistical prescreening, and three separate classes of post hoc analysis: cross-correlation to various cycling waveforms, autocorrelation, and a previously described fast Fourier transform-based technique. Permutation-based statistical tests were used to derive significance measures for all post hoc tests. We find application of our method, most significantly the ANOVA prescreening procedure, significantly reduces the false discovery rate relative to that observed among the results of the original five reports while maintaining desirable statistical power. We identify a set of 81 cycling transcripts previously found in one or more of the original reports as well as a novel set of 133 transcripts not found in any of the original studies. We introduce a novel analysis method that compensates for variability observed among the original five Drosophila circadian array reports. Based on the statistical fidelity of our meta-analysis results, and the results of our initial validation experiments (quantitative RT-PCR, we predict many of our newly found genes to be bona fide cyclers, and suggest that they may lead to new insights into the pathways through which clock mechanisms regulate behavioral rhythms.

  2. Evaluating genome-wide association study-identified breast cancer risk variants in African-American women.

    Directory of Open Access Journals (Sweden)

    Jirong Long

    Full Text Available Genome-wide association studies (GWAS, conducted mostly in European or Asian descendants, have identified approximately 67 genetic susceptibility loci for breast cancer. Given the large differences in genetic architecture between the African-ancestry genome and genomes of Asians and Europeans, it is important to investigate these loci in African-ancestry populations. We evaluated index SNPs in all 67 breast cancer susceptibility loci identified to date in our study including up to 3,300 African-American women (1,231 cases and 2,069 controls, recruited in the Southern Community Cohort Study (SCCS and the Nashville Breast Health Study (NBHS. Seven SNPs were statistically significant (P ≤ 0.05 with the risk of overall breast cancer in the same direction as previously reported: rs10069690 (5p15/TERT, rs999737 (14q24/RAD51L1, rs13387042 (2q35/TNP1, rs1219648 (10q26/FGFR2, rs8170 (19p13/BABAM1, rs17817449 (16q12/FTO, and rs13329835 (16q23/DYL2. A marginally significant association (P<0.10 was found for three additional SNPs: rs1045485 (2q33/CASP8, rs4849887 (2q14/INHBB, and rs4808801 (19p13/ELL. Three additional SNPs, including rs1011970 (9p21/CDKN2A/2B, rs941764 (14q32/CCDC88C, and rs17529111 (6q14/FAM46A, showed a significant association in analyses conducted by breast cancer subtype. The risk of breast cancer was elevated with an increasing number of risk variants, as measured by quintile of the genetic risk score, from 1.00 (reference, to 1.75 (1.30-2.37, 1.56 (1.15-2.11, 2.02 (1.50-2.74 and 2.63 (1.96-3.52, respectively, (P = 7.8 × 10(-10. Results from this study highlight the need for large genetic studies in AAs to identify risk variants impacting this population.

  3. Hormone profile in juvenile systemic lupus erythematosus with previous or current amenorrhea

    NARCIS (Netherlands)

    Silva, Clovis A.; Deen, Maria E. J.; Febronio, Marilia V.; Oliveira, Sheila K.; Terreri, Maria T.; Sacchetti, Silvana B.; Sztajnbok, Flavio R.; Marini, Roberto; Quintero, Maria V.; Bica, Blanca E.; Pereira, Rosa M.; Bonfa, Eloisa; Ferriani, Virginia P.; Robazzi, Teresa C.; Magalhaes, Claudia S.; Hilario, Maria O.

    To identify the underlying mechanism of amenorrhea in juvenile systemic lupus erythematosus (JSLE) patients, thirty-five (11.7%) JSLE patients with current or previous amenorrhea were consecutively selected among the 298 post-menarche patients followed in 12 Brazilian pediatric rheumatology centers.

  4. Prevention of type 2 diabetes mellitus in women with previous gestational diabetes mellitus

    Science.gov (United States)

    Moon, Joon Ho; Kwak, Soo Heon; Jang, Hak C.

    2017-01-01

    Gestational diabetes mellitus (GDM), defined as any degree of glucose intolerance with onset or first recognition during pregnancy, is characterized by underlying maternal defects in the β-cell response to insulin during pregnancy. Women with a previous history of GDM have a greater than 7-fold higher risk of developing postpartum diabetes compared with women without GDM. Various risk factors for postpartum diabetes have been identified, including maternal age, glucose levels in pregnancy, family history of diabetes, pre-pregnancy and postpartum body mass index, dietary patterns, physical activity, and breastfeeding. Genetic studies revealed that GDM shares common genetic variants with type 2 diabetes. A number of lifestyle interventional trials that aimed to ameliorate modifiable risk factors, including diet, exercise, and breastfeeding, succeeded in reducing the incidence of postpartum diabetes, weight retention, and other obesity-related morbidities. The present review summarizes the findings of previous studies on the incidence and risk factors of postpartum diabetes and discusses recent lifestyle interventional trials that attempted to prevent postpartum diabetes. PMID:28049284

  5. High-risk populations identified in Childhood Cancer Survivor Study investigations: implications for risk-based surveillance.

    Science.gov (United States)

    Hudson, Melissa M; Mulrooney, Daniel A; Bowers, Daniel C; Sklar, Charles A; Green, Daniel M; Donaldson, Sarah S; Oeffinger, Kevin C; Neglia, Joseph P; Meadows, Anna T; Robison, Leslie L

    2009-05-10

    Childhood cancer survivors often experience complications related to cancer and its treatment that may adversely affect quality of life and increase the risk of premature death. The purpose of this manuscript is to review how data derived from Childhood Cancer Survivor Study (CCSS) investigations have facilitated identification of childhood cancer survivor populations at high risk for specific organ toxicity and secondary carcinogenesis and how this has informed clinical screening practices. Articles previously published that used the resource of the CCSS to identify risk factors for specific organ toxicity and subsequent cancers were reviewed and results summarized. CCSS investigations have characterized specific groups to be at highest risk of morbidity related to endocrine and reproductive dysfunction, pulmonary toxicity, cerebrovascular injury, neurologic and neurosensory sequelae, and subsequent neoplasms. Factors influencing risk for specific outcomes related to the individual survivor (eg, sex, race/ethnicity, age at diagnosis, attained age), sociodemographic status (eg, education, household income, health insurance) and cancer history (eg, diagnosis, treatment, time from diagnosis) have been consistently identified. These CCSS investigations that clarify risk for treatment complications related to specific treatment modalities, cumulative dose exposures, and sociodemographic factors identify profiles of survivors at high risk for cancer-related morbidity who deserve heightened surveillance to optimize outcomes after treatment for childhood cancer.

  6. Late preterm birth and previous cesarean section: a population-based cohort study.

    Science.gov (United States)

    Yasseen Iii, Abdool S; Bassil, Kate; Sprague, Ann; Urquia, Marcelo; Maguire, Jonathon L

    2018-02-21

    Late preterm birth (LPB) is increasingly common and associated with higher morbidity and mortality than term birth. Yet, little is known about the influence of previous cesarean section (PCS) and the occurrence of LPB in subsequent pregnancies. We aim to evaluate this association along with the potential mediation by cesarean sections in the current pregnancy. We use population-based birth registry data (2005-2012) to establish a cohort of live born singleton infants born between 34 and 41 gestational weeks to multiparous mothers. PCS was the primary exposure, LPB (34-36 weeks) was the primary outcome, and an unplanned or emergency cesarean section in the current pregnancy was the potential mediator. Associations were quantified using propensity weighted multivariable Poisson regression, and mediating associations were explored using the Baron-Kenny approach. The cohort included 481,531 births, 21,893 (4.5%) were LPB, and 119,983 (24.9%) were predated by at least one PCS. Among mothers with at least one PCS, 6307 (5.26%) were LPB. There was increased risk of LPB among women with at least one PCS (adjusted Relative Risk (aRR): 1.20 (95%CI [1.16, 1.23]). Unplanned or emergency cesarean section in the current pregnancy was identified as a strong mediator to this relationship (mediation ratio = 97%). PCS was associated with higher risk of LPB in subsequent pregnancies. This may be due to an increased risk of subsequent unplanned or emergency preterm cesarean sections. Efforts to minimize index cesarean sections may reduce the risk of LPB in subsequent pregnancies.

  7. Blood Pressure Loci Identified with a Gene-Centric Array

    NARCIS (Netherlands)

    Johnson, Toby; Gaunt, Tom R.; Newhouse, Stephen J.; Padmanabhan, Sandosh; Tomaszewski, Maciej; Kumari, Meena; Morris, Richard W.; Tzoulaki, Ioanna; O'Brien, Eoin T.; Poulter, Neil R.; Sever, Peter; Shields, Denis C.; Thom, Simon; Wannamethee, Sasiwarang G.; Whincup, Peter H.; Brown, Morris J.; Connell, John M.; Dobson, Richard J.; Howard, Philip J.; Mein, Charles A.; Onipinla, Abiodun; Shaw-Hawkins, Sue; Zhang, Yun; Smith, George Davey; Day, Ian N. M.; Lawlor, Debbie A.; Goodall, Alison H.; Fowkes, F. Gerald; Abecasis, Goncalo R.; Elliott, Paul; Gateva, Vesela; Braund, Peter S.; Burton, Paul R.; Nelson, Christopher P.; Tobin, Martin D.; van der Harst, Pim; Glorioso, Nicola; Neuvrith, Hani; Salvi, Erika; Staessen, Jan A.; Stucchi, Andrea; Devos, Nabila; Jeunemaitre, Xavier; Plouin, Pierre-Francois; Tichet, Jean; Juhanson, Peeter; Org, Elin; Westra, Harm-Jan; Wolfs, Marcel G. M.; Franke, Lude

    2011-01-01

    Raised blood pressure (BP) is a major risk factor for cardiovascular disease. Previous studies have identified 47 distinct genetic variants robustly associated with BP, but collectively these explain only a few percent of the heritability for BP phenotypes. To find additional BP loci, we used a

  8. Sun exposure habits and health risk-related behaviours among individuals with previous history of skin cancer.

    Science.gov (United States)

    Falk, Magnus; Faresjö, Ashild; Faresjö, Tomas

    2013-02-01

    The aim of the present study was to investigate possible associations between UV exposure and other health risk behaviours in different social environments and in regard to previous history of skin cancer. In two closely-located, equally-sized cities in Sweden, representing different social environments (blue collar and white collar), patients aged 55-69 years, diagnosed with skin cancer (study group, n=489) or seborrhoeic keratosis (control group, n=664), were identified through a regional Health Care Register, and were given a questionnaire mapping for sun habits, tobacco smoking, alcohol use, and physical activity. A previous history of skin cancer was associated with reduced UV exposure (phistory of skin cancer appears to promote increased UV protection. In contrast to alcohol/smoking habits, no association between social environment and sun habits was found.

  9. Genome-wide association study for type 2 diabetes in Indians identifies a new susceptibility locus at 2q21.

    Science.gov (United States)

    Tabassum, Rubina; Chauhan, Ganesh; Dwivedi, Om Prakash; Mahajan, Anubha; Jaiswal, Alok; Kaur, Ismeet; Bandesh, Khushdeep; Singh, Tejbir; Mathai, Benan John; Pandey, Yogesh; Chidambaram, Manickam; Sharma, Amitabh; Chavali, Sreenivas; Sengupta, Shantanu; Ramakrishnan, Lakshmi; Venkatesh, Pradeep; Aggarwal, Sanjay K; Ghosh, Saurabh; Prabhakaran, Dorairaj; Srinath, Reddy K; Saxena, Madhukar; Banerjee, Monisha; Mathur, Sandeep; Bhansali, Anil; Shah, Viral N; Madhu, Sri Venkata; Marwaha, Raman K; Basu, Analabha; Scaria, Vinod; McCarthy, Mark I; Venkatesan, Radha; Mohan, Viswanathan; Tandon, Nikhil; Bharadwaj, Dwaipayan

    2013-03-01

    Indians undergoing socioeconomic and lifestyle transitions will be maximally affected by epidemic of type 2 diabetes (T2D). We conducted a two-stage genome-wide association study of T2D in 12,535 Indians, a less explored but high-risk group. We identified a new type 2 diabetes-associated locus at 2q21, with the lead signal being rs6723108 (odds ratio 1.31; P = 3.32 × 10⁻⁹). Imputation analysis refined the signal to rs998451 (odds ratio 1.56; P = 6.3 × 10⁻¹²) within TMEM163 that encodes a probable vesicular transporter in nerve terminals. TMEM163 variants also showed association with decreased fasting plasma insulin and homeostatic model assessment of insulin resistance, indicating a plausible effect through impaired insulin secretion. The 2q21 region also harbors RAB3GAP1 and ACMSD; those are involved in neurologic disorders. Forty-nine of 56 previously reported signals showed consistency in direction with similar effect sizes in Indians and previous studies, and 25 of them were also associated (P < 0.05). Known loci and the newly identified 2q21 locus altogether explained 7.65% variance in the risk of T2D in Indians. Our study suggests that common susceptibility variants for T2D are largely the same across populations, but also reveals a population-specific locus and provides further insights into genetic architecture and etiology of T2D.

  10. Age, training, and previous experience predict race performance in long-distance inline skaters, not anthropometry.

    Science.gov (United States)

    Knechtle, Beat; Knechtle, Patrizia; Rüst, Christoph Alexander; Rosemann, Thomas; Lepers, Romuald

    2012-02-01

    The association of characteristics of anthropometry, training, and previous experience with race time in 84 recreational, long-distance, inline skaters at the longest inline marathon in Europe (111 km), the Inline One-eleven in Switzerland, was investigated to identify predictor variables for performance. Age, duration per training unit, and personal best time were the only three variables related to race time in a multiple regression, while none of the 16 anthropometric variables were related. Anthropometric characteristics seem to be of no importance for a fast race time in a long-distance inline skating race in contrast to training volume and previous experience, when controlled with covariates. Improving performance in a long-distance inline skating race might be related to a high training volume and previous race experience. Also, doing such a race requires a parallel psychological effort, mental stamina, focus, and persistence. This may be reflected in the preparation and training for the event. Future studies should investigate what motivates these athletes to train and compete.

  11. Previously unknown species of Aspergillus.

    Science.gov (United States)

    Gautier, M; Normand, A-C; Ranque, S

    2016-08-01

    The use of multi-locus DNA sequence analysis has led to the description of previously unknown 'cryptic' Aspergillus species, whereas classical morphology-based identification of Aspergillus remains limited to the section or species-complex level. The current literature highlights two main features concerning these 'cryptic' Aspergillus species. First, the prevalence of such species in clinical samples is relatively high compared with emergent filamentous fungal taxa such as Mucorales, Scedosporium or Fusarium. Second, it is clearly important to identify these species in the clinical laboratory because of the high frequency of antifungal drug-resistant isolates of such Aspergillus species. Matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) has recently been shown to enable the identification of filamentous fungi with an accuracy similar to that of DNA sequence-based methods. As MALDI-TOF MS is well suited to the routine clinical laboratory workflow, it facilitates the identification of these 'cryptic' Aspergillus species at the routine mycology bench. The rapid establishment of enhanced filamentous fungi identification facilities will lead to a better understanding of the epidemiology and clinical importance of these emerging Aspergillus species. Based on routine MALDI-TOF MS-based identification results, we provide original insights into the key interpretation issues of a positive Aspergillus culture from a clinical sample. Which ubiquitous species that are frequently isolated from air samples are rarely involved in human invasive disease? Can both the species and the type of biological sample indicate Aspergillus carriage, colonization or infection in a patient? Highly accurate routine filamentous fungi identification is central to enhance the understanding of these previously unknown Aspergillus species, with a vital impact on further improved patient care. Copyright © 2016 European Society of Clinical Microbiology and

  12. A review of the reporting of web searching to identify studies for Cochrane systematic reviews.

    Science.gov (United States)

    Briscoe, Simon

    2018-03-01

    The literature searches that are used to identify studies for inclusion in a systematic review should be comprehensively reported. This ensures that the literature searches are transparent and reproducible, which is important for assessing the strengths and weaknesses of a systematic review and re-running the literature searches when conducting an update review. Web searching using search engines and the websites of topically relevant organisations is sometimes used as a supplementary literature search method. Previous research has shown that the reporting of web searching in systematic reviews often lacks important details and is thus not transparent or reproducible. Useful details to report about web searching include the name of the search engine or website, the URL, the date searched, the search strategy, and the number of results. This study reviews the reporting of web searching to identify studies for Cochrane systematic reviews published in the 6-month period August 2016 to January 2017 (n = 423). Of these reviews, 61 reviews reported using web searching using a search engine or website as a literature search method. In the majority of reviews, the reporting of web searching was found to lack essential detail for ensuring transparency and reproducibility, such as the search terms. Recommendations are made on how to improve the reporting of web searching in Cochrane systematic reviews. Copyright © 2017 John Wiley & Sons, Ltd.

  13. Implant breast reconstruction after salvage mastectomy in previously irradiated patients.

    Science.gov (United States)

    Persichetti, Paolo; Cagli, Barbara; Simone, Pierfranco; Cogliandro, Annalisa; Fortunato, Lucio; Altomare, Vittorio; Trodella, Lucio

    2009-04-01

    The most common surgical approach in case of local tumor recurrence after quadrantectomy and radiotherapy is salvage mastectomy. Breast reconstruction is the subsequent phase of the treatment and the plastic surgeon has to operate on previously irradiated and manipulated tissues. The medical literature highlights that breast reconstruction with tissue expanders is not a pursuable option, considering previous radiotherapy a contraindication. The purpose of this retrospective study is to evaluate the influence of previous radiotherapy on 2-stage breast reconstruction (tissue expander/implant). Only patients with analogous timing of radiation therapy and the same demolitive and reconstructive procedures were recruited. The results of this study prove that, after salvage mastectomy in previously irradiated patients, implant reconstruction is still possible. Further comparative studies are, of course, advisable to draw any conclusion on the possibility to perform implant reconstruction in previously irradiated patients.

  14. Characterization of previously unidentified lunar pyroclastic deposits using Lunar Reconnaissance Orbiter Camera (LROC) data

    Science.gov (United States)

    Gustafson, J. Olaf; Bell, James F.; Gaddis, Lisa R.R.; Hawke, B. Ray Ray; Giguere, Thomas A.

    2012-01-01

    We used a Lunar Reconnaissance Orbiter Camera (LROC) global monochrome Wide-angle Camera (WAC) mosaic to conduct a survey of the Moon to search for previously unidentified pyroclastic deposits. Promising locations were examined in detail using LROC multispectral WAC mosaics, high-resolution LROC Narrow Angle Camera (NAC) images, and Clementine multispectral (ultraviolet-visible or UVVIS) data. Out of 47 potential deposits chosen for closer examination, 12 were selected as probable newly identified pyroclastic deposits. Potential pyroclastic deposits were generally found in settings similar to previously identified deposits, including areas within or near mare deposits adjacent to highlands, within floor-fractured craters, and along fissures in mare deposits. However, a significant new finding is the discovery of localized pyroclastic deposits within floor-fractured craters Anderson E and F on the lunar farside, isolated from other known similar deposits. Our search confirms that most major regional and localized low-albedo pyroclastic deposits have been identified on the Moon down to ~100 m/pix resolution, and that additional newly identified deposits are likely to be either isolated small deposits or additional portions of discontinuous, patchy deposits.

  15. Internally readable identifying tag

    International Nuclear Information System (INIS)

    Jefferts, K.B.; Jefferts, E.R.

    1980-01-01

    A method of identifying non-metallic objects by means of X-ray equipment is described in detail. A small metal pin with a number of grooves cut in a pre-determined equi-spaced pattern is implanted into the non-metallic object and by decoding the groove patterns using X-ray equipment, the object is uniquely identified. A specific example of such an application is in studying the migratory habits of fish. The pin inserted into the snout of the fish is 0.010 inch in diameter, 0.040 inch in length with 8 possible positions for grooves if spaced 0.005 inch apart. With 6 of the groove positions available for data, the capacity is 2 6 or 64 combinations; clearly longer pins would increase the data capacity. This method of identification is a major advance over previous techniques which necessitated destruction of the fish in order to recover the identification tag. (UK)

  16. Identifying Relevant Studies in Software Engineering

    DEFF Research Database (Denmark)

    Zhang, He; Ali Babar, Muhammad; Tell, Paolo

    2011-01-01

    Context: Systematic literature review (SLR) has become an important research methodology in software engineering since the introduction of evidence-based software engineering (EBSE) in 2004. One critical step in applying this methodology is to design and execute appropriate and effective search....... Objective: The main objective of the research reported in this paper is to improve the search step of undertaking SLRs in software engineering (SE) by devising and evaluating systematic and practical approaches to identifying relevant studies in SE. Method: We have systematically selected and analytically...

  17. Patterns and Determinants of Treatment Seeking among Previously Untreated Psychotic Patients in Aceh Province, Indonesia: A Qualitative Study

    Directory of Open Access Journals (Sweden)

    Marthoenis Marthoenis

    2016-01-01

    Full Text Available Immediate treatment of first-episode psychosis is essential in order to achieve a positive outcome. However, Indonesian psychiatric patients often delay accessing health services, the reason for which is not yet fully understood. The current study aimed to understand patterns of treatment seeking and to reveal determinants of the delay in accessing psychiatric care among first-time user psychotic patients. Qualitative interviews were conducted with sixteen family members who accompanied the patients to a psychiatric hospital. Many families expressed beliefs that mental illness appertains to village sickness and not hospital sickness; therefore, they usually take the patients to traditional or religious healers before taking them to a health professional. They also identified various factors that potentially delay accessing psychiatric treatment: low literacy and beliefs about the cause of the illness, stigmatisation, the role of extended family, financial problems, and long distance to the psychiatric hospital. On the other hand, the family mentioned various factors related to timely help seeking, including being a well-educated family, living closer to health facilities, previous experience of successful psychotic therapy, and having more positive symptoms of psychosis. The findings call for mental health awareness campaigns in the community.

  18. Urinary tract infections in hospital pediatrics: many previous antibiotherapy and antibiotics resistance, including fluoroquinolones.

    Science.gov (United States)

    Garraffo, A; Marguet, C; Checoury, A; Boyer, S; Gardrat, A; Houivet, E; Caron, F

    2014-02-01

    We studied antibiotic resistance in pediatric UTIs and we evaluated the impact of antibiotic exposure in the previous 12 months, very little French data being available for this population. We conducted a multicenter prospective study including children consulting for, or admitted in 2 hospitals. Prior antibiotic exposure was documented from their health record. One hundred and ten patients (73 girls), 11 days to 12 years of age, were included in 10 months. Ninety-six percent presented with pyelonephritis, associated to uropathy for 25%. Escherichia coli was predominant (78%), followed by Proteus spp. and Enterococcus spp. The antibiotic resistance rate of E. coli was high and close to that reported for adults with complicated UTIs: amoxicillin 60%, amoxicillin-clavulanate 35%, cefotaxim 5%, trimethoprim-sulfametoxazole 26%, nalidixic acid 9%, ciprofloxacin 7%, gentamycin 1%, nitrofurantoin and fosfomycin 0%. The antibiotic exposure in the previous 12 months involved 62 children (56%) most frequently with β-lactams (89%) for a respiratory tract infection (56%). A clear relationship between exposure and resistance was observed for amoxicillin (71% vs. 46%), first generation (65% vs. 46%) and third generation (9% vs. 3%) cephalosporins, or trimethoprim-sulfamethoxazole (36% vs. 15%). However, antibiotic exposure could not account alone for the results, as suggested by the 7% of ciprofloxacin resistance, observed without any identified previous treatment. Bacterial species and antibiotic resistance level in children are similar to those reported for adults. Antibiotic exposure in the previous 12 months increases the risk of resistance but other factors are involved (previous antibiotic therapies and fecal-oral or mother-to-child transmission). Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  19. Expression profiling identifies genes involved in emphysema severity

    Directory of Open Access Journals (Sweden)

    Bowman Rayleen V

    2009-09-01

    Full Text Available Abstract Chronic obstructive pulmonary disease (COPD is a major public health problem. The aim of this study was to identify genes involved in emphysema severity in COPD patients. Gene expression profiling was performed on total RNA extracted from non-tumor lung tissue from 30 smokers with emphysema. Class comparison analysis based on gas transfer measurement was performed to identify differentially expressed genes. Genes were then selected for technical validation by quantitative reverse transcriptase-PCR (qRT-PCR if also represented on microarray platforms used in previously published emphysema studies. Genes technically validated advanced to tests of biological replication by qRT-PCR using an independent test set of 62 lung samples. Class comparison identified 98 differentially expressed genes (p p Gene expression profiling of lung from emphysema patients identified seven candidate genes associated with emphysema severity including COL6A3, SERPINF1, ZNHIT6, NEDD4, CDKN2A, NRN1 and GSTM3.

  20. Antimetabolites in cataract surgery to prevent failure of a previous trabeculectomy.

    Science.gov (United States)

    Thomas, Roger E; Crichton, Andrew; Thomas, Bennett C

    2014-07-28

    Patients having cataract surgery have often earlier undergone a trabeculectomy for glaucoma. However, cataract surgery may be associated with failure of the previous glaucoma surgery and antimetabolites may be used with cataract surgery to prevent such failure. There is no systematic review on whether antimetabolites with cataract surgery prevent failure of a previous trabeculectomy. To assess the effects of antimetabolites with cataract surgery on functioning of a previous trabeculectomy. We searched CENTRAL (which contains the Cochrane Eyes and Vision Group Trials Register) (2014, Issue 5), Ovid MEDLINE, Ovid MEDLINE In-Process and Other Non-Indexed Citations, Ovid MEDLINE Daily, Ovid OLDMEDLINE (January 1946 to June 2014), EMBASE (January 1980 to June 2014), Latin American and Caribbean Health Sciences Literature Database (LILACS) (January 1982 to June 2014), the metaRegister of Controlled Trials (mRCT) (www.controlled-trials.com), ClinicalTrials.gov (www.clinicaltrials.gov) and the World Health Organization (WHO) International Clinical Trials Registry Platform (ICTRP) (www.who.int/ictrp/search/en). We did not use any date or language restrictions in the electronic searches for trials. We last searched the electronic databases on 10 June 2014. We also searched the Science Citation Index database (July 2013) and reference lists of potentially relevant studies. Randomised controlled trials (RCTs) of antimetabolites with cataract surgery in people with a functioning trabeculectomy. Two review authors independently reviewed the titles and abstracts from the electronic searches. Two review authors independently assessed relevant full-text articles and entered data. We identified no RCTs to test the effectiveness of antimetabolites with cataract surgery in individuals with the intention of preventing failure of a previous trabeculectomy. There are no RCTs of antimetabolites with cataract surgery in people with a functioning trabeculectomy. Appropriately powered RCTs

  1. Genome-wide association study identifies genetic loci associated with iron deficiency.

    Directory of Open Access Journals (Sweden)

    Christine E McLaren

    2011-03-01

    Full Text Available The existence of multiple inherited disorders of iron metabolism in man, rodents and other vertebrates suggests genetic contributions to iron deficiency. To identify new genomic locations associated with iron deficiency, a genome-wide association study (GWAS was performed using DNA collected from white men aged≥25 y and women≥50 y in the Hemochromatosis and Iron Overload Screening (HEIRS Study with serum ferritin (SF≤12 µg/L (cases and iron replete controls (SF>100 µg/L in men, SF>50 µg/L in women. Regression analysis was used to examine the association between case-control status (336 cases, 343 controls and quantitative serum iron measures and 331,060 single nucleotide polymorphism (SNP genotypes, with replication analyses performed in a sample of 71 cases and 161 controls from a population of white male and female veterans screened at a US Veterans Affairs (VA medical center. Five SNPs identified in the GWAS met genome-wide statistical significance for association with at least one iron measure, rs2698530 on chr. 2p14; rs3811647 on chr. 3q22, a known SNP in the transferrin (TF gene region; rs1800562 on chr. 6p22, the C282Y mutation in the HFE gene; rs7787204 on chr. 7p21; and rs987710 on chr. 22q11 (GWAS observed P<1.51×10(-7 for all. An association between total iron binding capacity and SNP rs3811647 in the TF gene (GWAS observed P=7.0×10(-9, corrected P=0.012 was replicated within the VA samples (observed P=0.012. Associations with the C282Y mutation in the HFE gene also were replicated. The joint analysis of the HEIRS and VA samples revealed strong associations between rs2698530 on chr. 2p14 and iron status outcomes. These results confirm a previously-described TF polymorphism and implicate one potential new locus as a target for gene identification.

  2. Parameter identifiability and redundancy: theoretical considerations.

    Directory of Open Access Journals (Sweden)

    Mark P Little

    Full Text Available BACKGROUND: Models for complex biological systems may involve a large number of parameters. It may well be that some of these parameters cannot be derived from observed data via regression techniques. Such parameters are said to be unidentifiable, the remaining parameters being identifiable. Closely related to this idea is that of redundancy, that a set of parameters can be expressed in terms of some smaller set. Before data is analysed it is critical to determine which model parameters are identifiable or redundant to avoid ill-defined and poorly convergent regression. METHODOLOGY/PRINCIPAL FINDINGS: In this paper we outline general considerations on parameter identifiability, and introduce the notion of weak local identifiability and gradient weak local identifiability. These are based on local properties of the likelihood, in particular the rank of the Hessian matrix. We relate these to the notions of parameter identifiability and redundancy previously introduced by Rothenberg (Econometrica 39 (1971 577-591 and Catchpole and Morgan (Biometrika 84 (1997 187-196. Within the widely used exponential family, parameter irredundancy, local identifiability, gradient weak local identifiability and weak local identifiability are shown to be largely equivalent. We consider applications to a recently developed class of cancer models of Little and Wright (Math Biosciences 183 (2003 111-134 and Little et al. (J Theoret Biol 254 (2008 229-238 that generalize a large number of other recently used quasi-biological cancer models. CONCLUSIONS/SIGNIFICANCE: We have shown that the previously developed concepts of parameter local identifiability and redundancy are closely related to the apparently weaker properties of weak local identifiability and gradient weak local identifiability--within the widely used exponential family these concepts largely coincide.

  3. Genome-wide association studies of autoimmune vitiligo identify 23 new risk loci and highlight key pathways and regulatory variants

    Science.gov (United States)

    Jin, Ying; Andersen, Genevieve; Yorgov, Daniel; Ferrara, Tracey M; Ben, Songtao; Brownson, Kelly M; Holland, Paulene J; Birlea, Stanca A; Siebert, Janet; Hartmann, Anke; Lienert, Anne; van Geel, Nanja; Lambert, Jo; Luiten, Rosalie M; Wolkerstorfer, Albert; van der Veen, JP Wietze; Bennett, Dorothy C; Taïeb, Alain; Ezzedine, Khaled; Kemp, E Helen; Gawkrodger, David J; Weetman, Anthony P; Kõks, Sulev; Prans, Ele; Kingo, Külli; Karelson, Maire; Wallace, Margaret R; McCormack, Wayne T; Overbeck, Andreas; Moretti, Silvia; Colucci, Roberta; Picardo, Mauro; Silverberg, Nanette B; Olsson, Mats; Valle, Yan; Korobko, Igor; Böhm, Markus; Lim, Henry W.; Hamzavi, Iltefat; Zhou, Li; Mi, Qing-Sheng; Fain, Pamela R.; Santorico, Stephanie A; Spritz, Richard A

    2016-01-01

    Vitiligo is an autoimmune disease in which depigmented skin results from destruction of melanocytes1, with epidemiologic association with other autoimmune diseases2. In previous linkage and genome-wide association studies (GWAS1, GWAS2), we identified 27 vitiligo susceptibility loci in patients of European (EUR) ancestry. We carried out a third GWAS (GWAS3) in EUR subjects, with augmented GWAS1 and GWAS2 controls, genome-wide imputation, and meta-analysis of all three GWAS, followed by an independent replication. The combined analyses, with 4,680 cases and 39,586 controls, identified 23 new loci and 7 suggestive loci, most encoding immune and apoptotic regulators, some also associated with other autoimmune diseases, as well as several melanocyte regulators. Bioinformatic analyses indicate a predominance of causal regulatory variation, some corresponding to eQTL at these loci. Together, the identified genes provide a framework for vitiligo genetic architecture and pathobiology, highlight relationships to other autoimmune diseases and melanoma, and offer potential targets for treatment. PMID:27723757

  4. Impact of Availability and Use of ART/PMTCT Services on Fertility Desires of Previously Pregnant Women in Rakai, Uganda: A Retrospective Cohort Study.

    Science.gov (United States)

    Litwin, Lindsay E; Makumbi, Frederick E; Gray, Ronald; Wawer, Maria; Kigozi, Godfrey; Kagaayi, Joseph; Nakigozi, Gertrude; Lutalo, Tom; Serwada, David; Brahmbhatt, Heena

    2015-07-01

    To assess fertility desires by availability and use of antiretroviral therapy and prevention of mother-to-child transmission (ART/PMTCT) services in Rakai, Uganda. Retrospective analyses of longitudinal data from the Rakai Community Cohort Study. Study participants were retrospectively identified and categorized by HIV status. Availability of ART/PMTCT services in Rakai was defined in three periods: (1) pre-ART/PMTCT (ART/PMTCT rollout (2005-2006), and (3) universal ART/PMTCT (>2006); and use of ART/PMTCT was coded as yes if the woman received services. Trends in fertility desires were assessed by χ. "Modified" Poisson regression was performed using generalized linear models with a log link and Poisson family to estimate prevalence rate ratios (PRRs) and 95% confidence intervals (CIs) of desire for another child among previously and currently pregnant women; PRRs were adjusted for demographic and behavioral factors. A total of 4227 sexually active women in Rakai, including 436 HIV+ women, contributed 13,970 observations over 5 survey rounds. Fertility desires increased in the population in the ART/PMTCT rollout [adjusted (adj.) PRR: 1.08, 95% CI: 1.04 to 1.13] and the universal availability periods (adj. PRR: 1.11, 95% CI: 1.08 to 1.14) compared with pre-ART/PMTCT period. A total of 862 woman observations used ART/PMTCT services. Fertility desires were similar among ART/PMTCT service users and nonusers in cross-sectional analysis (adj. PRR: 0.84, 95% CI: 0.62 to 1.14) and 1 year after ART/PMTCT use (adj. PRR: 1.27, 95% CI: 0.83 to 1.94). Availability of ART/PMTCT may increase fertility desires of previously pregnant women in Rakai, Uganda. Use of ART/PMTCT services was not correlated with fertility desires of previously or current pregnant women.

  5. Genome-wide association study of telomere length among South Asians identifies a second RTEL1 association signal.

    Science.gov (United States)

    Delgado, Dayana A; Zhang, Chenan; Chen, Lin S; Gao, Jianjun; Roy, Shantanu; Shinkle, Justin; Sabarinathan, Mekala; Argos, Maria; Tong, Lin; Ahmed, Alauddin; Islam, Tariqul; Rakibuz-Zaman, Muhammad; Sarwar, Golam; Shahriar, Hasan; Rahman, Mahfuzar; Yunus, Mohammad; Jasmine, Farzana; Kibriya, Muhammad G; Ahsan, Habibul; Pierce, Brandon L

    2018-01-01

    Leucocyte telomere length (TL) is a potential biomarker of ageing and risk for age-related disease. Leucocyte TL is heritable and shows substantial differences by race/ethnicity. Recent genome-wide association studies (GWAS) report ~10 loci harbouring SNPs associated with leucocyte TL, but these studies focus primarily on populations of European ancestry. This study aims to enhance our understanding of genetic determinants of TL across populations. We performed a GWAS of TL using data on 5075 Bangladeshi adults. We measured TL using one of two technologies (qPCR or a Luminex-based method) and used standardised variables as TL phenotypes. Our results replicate previously reported associations in the TERC and TERT regions (P=2.2×10 -8 and P=6.4×10 -6 , respectively). We observed a novel association signal in the RTEL1 gene (intronic SNP rs2297439; P=2.82×10 -7 ) that is independent of previously reported TL-associated SNPs in this region. The minor allele for rs2297439 is common in South Asian populations (≥0.25) but at lower frequencies in other populations (eg, 0.07 in Northern Europeans). Among the eight other previously reported association signals, all were directionally consistent with our study, but only rs8105767 ( ZNF208 ) was nominally significant (P=0.003). SNP-based heritability estimates were as high as 44% when analysing close relatives but much lower when analysing distant relatives only. In this first GWAS of TL in a South Asian population, we replicate some, but not all, of the loci reported in prior GWAS of individuals of European ancestry, and we identify a novel second association signal at the RTEL1 locus. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  6. A genome-wide association study identifies risk loci for spirometric measures among smokers of European and African ancestry.

    Science.gov (United States)

    Lutz, Sharon M; Cho, Michael H; Young, Kendra; Hersh, Craig P; Castaldi, Peter J; McDonald, Merry-Lynn; Regan, Elizabeth; Mattheisen, Manuel; DeMeo, Dawn L; Parker, Margaret; Foreman, Marilyn; Make, Barry J; Jensen, Robert L; Casaburi, Richard; Lomas, David A; Bhatt, Surya P; Bakke, Per; Gulsvik, Amund; Crapo, James D; Beaty, Terri H; Laird, Nan M; Lange, Christoph; Hokanson, John E; Silverman, Edwin K

    2015-12-03

    Pulmonary function decline is a major contributor to morbidity and mortality among smokers. Post bronchodilator FEV1 and FEV1/FVC ratio are considered the standard assessment of airflow obstruction. We performed a genome-wide association study (GWAS) in 9919 current and former smokers in the COPDGene study (6659 non-Hispanic Whites [NHW] and 3260 African Americans [AA]) to identify associations with spirometric measures (post-bronchodilator FEV1 and FEV1/FVC). We also conducted meta-analysis of FEV1 and FEV1/FVC GWAS in the COPDGene, ECLIPSE, and GenKOLS cohorts (total n = 13,532). Among NHW in the COPDGene cohort, both measures of pulmonary function were significantly associated with SNPs at the 15q25 locus [containing CHRNA3/5, AGPHD1, IREB2, CHRNB4] (lowest p-value = 2.17 × 10(-11)), and FEV1/FVC was associated with a genomic region on chromosome 4 [upstream of HHIP] (lowest p-value = 5.94 × 10(-10)); both regions have been previously associated with COPD. For the meta-analysis, in addition to confirming associations to the regions near CHRNA3/5 and HHIP, genome-wide significant associations were identified for FEV1 on chromosome 1 [TGFB2] (p-value = 8.99 × 10(-9)), 9 [DBH] (p-value = 9.69 × 10(-9)) and 19 [CYP2A6/7] (p-value = 3.49 × 10(-8)) and for FEV1/FVC on chromosome 1 [TGFB2] (p-value = 8.99 × 10(-9)), 4 [FAM13A] (p-value = 3.88 × 10(-12)), 11 [MMP3/12] (p-value = 3.29 × 10(-10)) and 14 [RIN3] (p-value = 5.64 × 10(-9)). In a large genome-wide association study of lung function in smokers, we found genome-wide significant associations at several previously described loci with lung function or COPD. We additionally identified a novel genome-wide significant locus with FEV1 on chromosome 9 [DBH] in a meta-analysis of three study populations.

  7. Oculocutaneous albinism: identifying and overcoming barriers to vision care in a Nigerian population.

    Science.gov (United States)

    Udeh, N N; Eze, B I; Onwubiko, S N; Arinze, O C; Onwasigwe, E N; Umeh, R E

    2014-06-01

    To assess eye care service utilization, and identify access barriers in a south-eastern Nigerian albino population. The study was a population-based, cross-sectional survey conducted in Enugu state between August, 2011 and January, 2012. Using the data base of the state's Albino Foundation and tailored awareness creation, persons living with albinism were identified and recruited at two study centres. Data on participants' socio-demographics, perception of vision, visual needs, previous eye examination and or low vision assessment, use of glasses or low vision devices were collected. Reasons for non-utilisation of available vision care services were also obtained. Descriptive and comparative statistics were performed. A p low vision assessment and none--0.0% had used low vision device. Of the participants, 82.4% reported previous eye examination, 33.3% had not used spectacles previously, despite the existing need. Ignorance--88.9% and poor access--8.5% were the main barriers to uptake of vision care services. In Enugu, Nigeria, there is poor awareness and low utilization of vision care services among people with albinism. The identified barriers to vision care access are amenable to awareness creation and logistic change in the provision of appropriate vision care services.

  8. Genome-wide association study identifies single-nucleotide polymorphism in KCNB1 associated with left ventricular mass in humans: The HyperGEN Study

    Directory of Open Access Journals (Sweden)

    Kraemer Rachel

    2009-05-01

    Full Text Available Abstract Background We conducted a genome-wide association study (GWAS and validation study for left ventricular (LV mass in the Family Blood Pressure Program – HyperGEN population. LV mass is a sensitive predictor of cardiovascular mortality and morbidity in all genders, races, and ages. Polymorphisms of candidate genes in diverse pathways have been associated with LV mass. However, subsequent studies have often failed to replicate these associations. Genome-wide association studies have unprecedented power to identify potential genes with modest effects on left LV mass. We describe here a GWAS for LV mass in Caucasians using the Affymetrix GeneChip Human Mapping 100 k Set. Cases (N = 101 and controls (N = 101 were selected from extreme tails of the LV mass index distribution from 906 individuals in the HyperGEN study. Eleven of 12 promising (Q Results Despite the relatively small sample, we identified 12 promising SNPs in the GWAS. Eleven SNPs were successfully genotyped in the validation study of 704 Caucasians and 1467 African Americans; 5 SNPs on chromosomes 5, 12, and 20 were significantly (P ≤ 0.05 associated with LV mass after correction for multiple testing. One SNP (rs756529 is intragenic within KCNB1, which is dephosphorylated by calcineurin, a previously reported candidate gene for LV hypertrophy within this population. Conclusion These findings suggest KCNB1 may be involved in the development of LV hypertrophy in humans.

  9. Validation of search filters for identifying pediatric studies in PubMed.

    Science.gov (United States)

    Leclercq, Edith; Leeflang, Mariska M G; van Dalen, Elvira C; Kremer, Leontien C M

    2013-03-01

    To identify and validate PubMed search filters for retrieving studies including children and to develop a new pediatric search filter for PubMed. We developed 2 different datasets of studies to evaluate the performance of the identified pediatric search filters, expressed in terms of sensitivity, precision, specificity, accuracy, and number needed to read (NNR). An optimal search filter will have a high sensitivity and high precision with a low NNR. In addition to the PubMed Limits: All Child: 0-18 years filter (in May 2012 renamed to PubMed Filter Child: 0-18 years), 6 search filters for identifying studies including children were identified: 3 developed by Kastner et al, 1 developed by BestBets, one by the Child Health Field, and 1 by the Cochrane Childhood Cancer Group. Three search filters (Cochrane Childhood Cancer Group, Child Health Field, and BestBets) had the highest sensitivity (99.3%, 99.5%, and 99.3%, respectively) but a lower precision (64.5%, 68.4%, and 66.6% respectively) compared with the other search filters. Two Kastner search filters had a high precision (93.0% and 93.7%, respectively) but a low sensitivity (58.5% and 44.8%, respectively). They failed to identify many pediatric studies in our datasets. The search terms responsible for false-positive results in the reference dataset were determined. With these data, we developed a new search filter for identifying studies with children in PubMed with an optimal sensitivity (99.5%) and precision (69.0%). Search filters to identify studies including children either have a low sensitivity or a low precision with a high NNR. A new pediatric search filter with a high sensitivity and a low NNR has been developed. Copyright © 2013 Mosby, Inc. All rights reserved.

  10. Exome sequencing of a large family identifies potential candidate genes contributing risk to bipolar disorder.

    Science.gov (United States)

    Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P

    2018-03-01

    Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. A prospective cohort study identifying risk factors for shoulder injuries in adolescent elite handball players: the Karolinska Handball Study (KHAST) study protocol.

    Science.gov (United States)

    Asker, Martin; Waldén, Markus; Källberg, Henrik; Holm, Lena W; Skillgate, Eva

    2017-11-22

    Handball is a physical contact sport that includes frequent overhead throwing, and this combination leads to a high rate of shoulder injuries. Several factors have been associated with shoulder injuries in overhead athletes, but strong scientific evidence is lacking for most suggested risk factors. We therefore designed the Karolinska Handball Study (KHAST) with the aim to identify risk factors for shoulder injuries in adolescent male and female elite handball players studying at handball-profiled secondary schools in Sweden. Secondary objectives are to investigate whether shoulder function changes during the competition season and whether the physical profile of the players changes during their time in secondary school. Players aged 15 to 19 years were included during the pre-season period of the 2014-2015 and the 2015-2016 seasons. At inclusion, players signed informed consent and filled in a questionnaire regarding playing position, playing level, previous handball experience, history of shoulder problems and athletic identity. Players also completed a detailed test battery at baseline evaluating the shoulder, neck and trunk. Players were then prospectively monitored weekly during the 2014-2015 and/or 2015-2016 competitive seasons regarding injuries and training/match workload. Results from the annual routine physical tests in the secondary school curriculum including bench press, deep squat, hand grip strength, clean lifts, squat jumps, counter movement jumps, handball players and a reduction of these injuries is therefore warranted. However, in order to introduce appropriate preventive measures, a detailed understanding of the underlying risk factors is needed. Our study has a high potential to identify important risk factors for shoulder injuries in adolescent elite handball players owing to a large study sample, a high response rate, data collection during consecutive seasons, and recording of potential confounding factors.

  12. Incidence of cancer in adolescent idiopathic scoliosis patients treated 25 years previously

    DEFF Research Database (Denmark)

    Simony, Ane; Hansen, Emil Jesper; Christensen, Steen Bach

    2016-01-01

    , is comparable to modern equipment. This is to our knowledge the first study to report increased rates of endometrial cancers in a cohort of AIS patients, and future attention is needed to reduce the radiation dose distributed to the AIS patients both pre-operatively and during surgery.......PURPOSE: To report the incidence of cancer in a cohort of adolescent idiopathic scoliosis (AIS) patients treated 25 years previously. METHODS: 215 consecutive AIS patients treated between 1983 and 1990 were identified and requested to return for clinical and radiographic examination. The incidence....... RESULTS: From the original cohort of 215 consecutive AIS patients, radiation information was available in 211 of the patients, and medical charts were available in 209 AIS patients. 170 (83 %) of the 205 AIS patients participated in the follow-up study with questionnaires. The calculated mean total...

  13. 78 FR 76050 - Airworthiness Directives; EADS CASA (Type Certificate Previously Held by Construcciones...

    Science.gov (United States)

    2013-12-16

    ... Airworthiness Directives; EADS CASA (Type Certificate Previously Held by Construcciones Aeron[aacute]uticas, S.A... rule. SUMMARY: We are adopting a new airworthiness directive (AD) for certain EADS CASA (Type...., Washington, DC. For EADS-CASA service information identified in this AD, contact EADS-CASA, Military...

  14. Robust Intratumor Partitioning to Identify High-Risk Subregions in Lung Cancer: A Pilot Study

    International Nuclear Information System (INIS)

    Wu, Jia; Gensheimer, Michael F.; Dong, Xinzhe; Rubin, Daniel L.; Napel, Sandy; Diehn, Maximilian; Loo, Billy W.; Li, Ruijiang

    2016-01-01

    Purpose: To develop an intratumor partitioning framework for identifying high-risk subregions from "1"8F-fluorodeoxyglucose positron emission tomography (FDG-PET) and computed tomography (CT) imaging and to test whether tumor burden associated with the high-risk subregions is prognostic of outcomes in lung cancer. Methods and Materials: In this institutional review board–approved retrospective study, we analyzed the pretreatment FDG-PET and CT scans of 44 lung cancer patients treated with radiation therapy. A novel, intratumor partitioning method was developed, based on a 2-stage clustering process: first at the patient level, each tumor was over-segmented into many superpixels by k-means clustering of integrated PET and CT images; next, tumor subregions were identified by merging previously defined superpixels via population-level hierarchical clustering. The volume associated with each of the subregions was evaluated using Kaplan-Meier analysis regarding its prognostic capability in predicting overall survival (OS) and out-of-field progression (OFP). Results: Three spatially distinct subregions were identified within each tumor that were highly robust to uncertainty in PET/CT co-registration. Among these, the volume of the most metabolically active and metabolically heterogeneous solid component of the tumor was predictive of OS and OFP on the entire cohort, with a concordance index or CI of 0.66-0.67. When restricting the analysis to patients with stage III disease (n=32), the same subregion achieved an even higher CI of 0.75 (hazard ratio 3.93, log-rank P=.002) for predicting OS, and a CI of 0.76 (hazard ratio 4.84, log-rank P=.002) for predicting OFP. In comparison, conventional imaging markers, including tumor volume, maximum standardized uptake value, and metabolic tumor volume using threshold of 50% standardized uptake value maximum, were not predictive of OS or OFP, with CI mostly below 0.60 (log-rank P>.05). Conclusion: We propose a robust intratumor

  15. Robust Intratumor Partitioning to Identify High-Risk Subregions in Lung Cancer: A Pilot Study

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Jia; Gensheimer, Michael F.; Dong, Xinzhe [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Rubin, Daniel L. [Department of Radiology, Stanford University School of Medicine, Stanford, California (United States); Department of Medicine (Biomedical Informatics Research), Stanford University School of Medicine, Stanford, California (United States); Napel, Sandy [Department of Radiology, Stanford University School of Medicine, Stanford, California (United States); Diehn, Maximilian [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Stanford Cancer Institute, Stanford University School of Medicine, Stanford, California (United States); Institute for Stem Cell Biology and Regenerative Medicine, Stanford University School of Medicine, Stanford, California (United States); Loo, Billy W. [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Stanford Cancer Institute, Stanford University School of Medicine, Stanford, California (United States); Li, Ruijiang, E-mail: rli2@stanford.edu [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, California (United States); Stanford Cancer Institute, Stanford University School of Medicine, Stanford, California (United States)

    2016-08-01

    Purpose: To develop an intratumor partitioning framework for identifying high-risk subregions from {sup 18}F-fluorodeoxyglucose positron emission tomography (FDG-PET) and computed tomography (CT) imaging and to test whether tumor burden associated with the high-risk subregions is prognostic of outcomes in lung cancer. Methods and Materials: In this institutional review board–approved retrospective study, we analyzed the pretreatment FDG-PET and CT scans of 44 lung cancer patients treated with radiation therapy. A novel, intratumor partitioning method was developed, based on a 2-stage clustering process: first at the patient level, each tumor was over-segmented into many superpixels by k-means clustering of integrated PET and CT images; next, tumor subregions were identified by merging previously defined superpixels via population-level hierarchical clustering. The volume associated with each of the subregions was evaluated using Kaplan-Meier analysis regarding its prognostic capability in predicting overall survival (OS) and out-of-field progression (OFP). Results: Three spatially distinct subregions were identified within each tumor that were highly robust to uncertainty in PET/CT co-registration. Among these, the volume of the most metabolically active and metabolically heterogeneous solid component of the tumor was predictive of OS and OFP on the entire cohort, with a concordance index or CI of 0.66-0.67. When restricting the analysis to patients with stage III disease (n=32), the same subregion achieved an even higher CI of 0.75 (hazard ratio 3.93, log-rank P=.002) for predicting OS, and a CI of 0.76 (hazard ratio 4.84, log-rank P=.002) for predicting OFP. In comparison, conventional imaging markers, including tumor volume, maximum standardized uptake value, and metabolic tumor volume using threshold of 50% standardized uptake value maximum, were not predictive of OS or OFP, with CI mostly below 0.60 (log-rank P>.05). Conclusion: We propose a robust

  16. Validation of search filters for identifying pediatric studies in PubMed

    NARCIS (Netherlands)

    Leclercq, Edith; Leeflang, Mariska M. G.; van Dalen, Elvira C.; Kremer, Leontien C. M.

    2013-01-01

    To identify and validate PubMed search filters for retrieving studies including children and to develop a new pediatric search filter for PubMed. We developed 2 different datasets of studies to evaluate the performance of the identified pediatric search filters, expressed in terms of sensitivity,

  17. Tacit knowledge of public health nurses in identifying community health problems and need for new services: a case study.

    Science.gov (United States)

    Yoshioka-Maeda, Kyoko; Murashima, Sachiyo; Asahara, Kiyomi

    2006-09-01

    The purpose of this study was to explore the tacit knowledge of public health nurses in identifying community health problems and developing relevant new projects. Previous research only roughly showed those skills for creating new community health services, such as lobbying. Nine Japanese public health nurses who had created new projects in their municipalities were selected by theoretical sampling and interviewed in 2002-2003. Yin's Case Study Method, especially the multiple-case study design, was used. All 9 public health nurses used similar approaches in identifying community health problems and the need for creating new services, even though their experiences differed and the kinds of projects varied. They identified the difficulties of clients, recognized clients who had the same problems, elucidated the limitations of existing services, and forecasted outcomes from the neglect of the clients' problems. Then they succeeded in creating a new project by examining individual health problems in the context of their community's characteristics, societal factors, and using existing policies to support their clients. This is the first study to explore the skills of public health nurses and their intention to use such skills in creating new projects as well as the exact process. They could identify community health problems that will be the basis for developing new services to provide care for individual clients. This is different from the traditional community assessment approach that requires the collection of a huge amount of information to clarify community health problems. The tacit knowledge of public health nurses will help to create needs-oriented new services more smoothly.

  18. Identifying Risk Factors of Boot Procurement: A Case Study of Stadium Australia

    Directory of Open Access Journals (Sweden)

    Marcus Jefferies

    2012-11-01

    Full Text Available Private sector input into the procurement of public works and services is continuing to increase. This has partly arisen out of a requirement for infrastructure development to be undertaken at a rate that maintains and allows growth. This has become a major challange for the construction industry that cannot be met by government alone. The emergence of Build-Own-Operate-Transfer (BOOT schemes as a response to this challange provides a means for developing the infrastructure of a country without directly impacting on the governments budgetary constraints. The concepts of BOOT are without doubt extremely complex arrangements, which bring to the construction sector risks not experienced previously. Many of the infrastructure partnerships between public and private sector in the pastare yet to provide evidence of successful completion, since few of the concession periods have expired. This paper provides an identified list of risk factors to a case study of Stadium Australia. The most significant risk associated with Stadium Australia include the bidding process, the high level of public scrutiny, post-Olympic Games facility revenue and the complicated nature of the consortium structure.  

  19. Identifying Risk Factors of Boot Procurement: A Case Study of Stadium Australia

    Directory of Open Access Journals (Sweden)

    Marcus Jefferies

    2012-11-01

    Full Text Available Private sector input into the procurement of public works and services is continuing to increase. This has partly arisen out of a requirement for infrastructure development to be undertaken at a rate that maintains and allows growth. This has become a major challange for the construction industry that cannot be met by government alone. The emergence of Build-Own-Operate-Transfer (BOOT schemes as a response to this challange provides a means for developing the infrastructure of a country without directly impacting on the governments budgetary constraints. The concepts of BOOT are without doubt extremely complex arrangements, which bring to the construction sector risks not experienced previously. Many of the infrastructure partnerships between public and private sector in the pastare yet to provide evidence of successful completion, since few of the concession periods have expired. This paper provides an identified list of risk factors to a case study of Stadium Australia. The most significant risk associated with Stadium Australia include the bidding process, the high level of public scrutiny, post-Olympic Games facility revenue and the complicated nature of the consortium structure.

  20. Polychlorinated biphenyl exposure, diabetes and endogenous hormones: a cross-sectional study in men previously employed at a capacitor manufacturing plant.

    Science.gov (United States)

    Persky, Victoria; Piorkowski, Julie; Turyk, Mary; Freels, Sally; Chatterton, Robert; Dimos, John; Bradlow, H Leon; Chary, Lin Kaatz; Burse, Virlyn; Unterman, Terry; Sepkovic, Daniel W; McCann, Kenneth

    2012-08-29

    Studies have shown associations of diabetes and endogenous hormones with exposure to a wide variety of organochlorines. We have previously reported positive associations of polychlorinated biphenyls (PCBs) and inverse associations of selected steroid hormones with diabetes in postmenopausal women previously employed in a capacitor manufacturing plant. This paper examines associations of PCBs with diabetes and endogenous hormones in 63 men previously employed at the same plant who in 1996 underwent surveys of their exposure and medical history and collection of bloods and urine for measurements of PCBs, lipids, liver function, hematologic markers and endogenous hormones. PCB exposure was positively associated with diabetes and age and inversely associated with thyroid stimulating hormone and triiodothyronine-uptake. History of diabetes was significantly related to total PCBs and all PCB functional groupings, but not to quarters worked and job score, after control for potential confounders. None of the exposures were related to insulin resistance (HOMA-IR) in non-diabetic men. Associations of PCBs with specific endogenous hormones differ in some respects from previous findings in postmenopausal women employed at the capacitor plant. Results from this study, however, do confirm previous reports relating PCB exposure to diabetes and suggest that these associations are not mediated by measured endogenous hormones.

  1. Mediastinal involvement in lymphangiomatosis: a previously unreported MRI sign

    Energy Technology Data Exchange (ETDEWEB)

    Shah, Vikas; Shah, Sachit; Barnacle, Alex; McHugh, Kieran [Great Ormond Street Hospital for Children, Department of Radiology, London (United Kingdom); Sebire, Neil J. [Great Ormond Street Hospital for Children, Department of Histopathology, London (United Kingdom); Brock, Penelope [Great Ormond Street Hospital for Children, Department of Oncology, London (United Kingdom); Harper, John I. [Great Ormond Street Hospital for Children, Department of Dermatology, London (United Kingdom)

    2011-08-15

    Multifocal lymphangiomatosis is a rare systemic disorder affecting children. Due to its rarity and wide spectrum of clinical, histological and imaging features, establishing the diagnosis of multifocal lymphangiomatosis can be challenging. The purpose of this study was to describe a new imaging sign in this disorder: paraspinal soft tissue and signal abnormality at MRI. We retrospectively reviewed the imaging, clinical and histopathological findings in a cohort of eight children with thoracic involvement from this condition. Evidence of paraspinal chest disease was identified at MRI and CT in all eight of these children. The changes comprise heterogeneous intermediate-to-high signal parallel to the thoracic vertebrae on T2-weighted sequences at MRI, with abnormal paraspinal soft tissue at CT and plain radiography. Multifocal lymphangiomatosis is a rare disorder with a broad range of clinicopathological and imaging features. MRI allows complete evaluation of disease extent without the use of ionising radiation and has allowed us to describe a previously unreported imaging sign in this disorder, namely, heterogeneous hyperintense signal in abnormal paraspinal tissue on T2-weighted images. (orig.)

  2. Quasi-experimental study designs series-paper 8: identifying quasi-experimental studies to inform systematic reviews.

    Science.gov (United States)

    Glanville, Julie; Eyers, John; Jones, Andrew M; Shemilt, Ian; Wang, Grace; Johansen, Marit; Fiander, Michelle; Rothstein, Hannah

    2017-09-01

    This article reviews the available evidence and guidance on methods to identify reports of quasi-experimental (QE) studies to inform systematic reviews of health care, public health, international development, education, crime and justice, and social welfare. Research, guidance, and examples of search strategies were identified by searching a range of databases, key guidance documents, selected reviews, conference proceedings, and personal communication. Current practice and research evidence were summarized. Four thousand nine hundred twenty-four records were retrieved by database searches, and additional documents were obtained by other searches. QE studies are challenging to identify efficiently because they have no standardized nomenclature and may be indexed in various ways. Reliable search filters are not available. There is a lack of specific resources devoted to collecting QE studies and little evidence on where best to search. Searches to identify QE studies should search a range of resources and, until indexing improves, use strategies that focus on the topic rather than the study design. Better definitions, better indexing in databases, prospective registers, and reporting guidance are required to improve the retrieval of QE studies and promote systematic reviews of what works based on the evidence from such studies. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Acceleration and Orientation Jumping Performance Differences Among Elite Professional Male Handball Players With or Without Previous ACL Reconstruction: An Inertial Sensor Unit-Based Study.

    Science.gov (United States)

    Setuain, Igor; González-Izal, Miriam; Alfaro, Jesús; Gorostiaga, Esteban; Izquierdo, Mikel

    2015-12-01

    Handball is one of the most challenging sports for the knee joint. Persistent biomechanical and jumping capacity alterations can be observed in athletes with an anterior cruciate ligament (ACL) injury. Commonly identified jumping biomechanical alterations have been described by the use of laboratory technologies. However, portable and easy-to-handle technologies that enable an evaluation of jumping biomechanics at the training field are lacking. To analyze unilateral/bilateral acceleration and orientation jumping performance differences among elite male handball athletes with or without previous ACL reconstruction via a single inertial sensor unit device. Case control descriptive study. At the athletes' usual training court. Twenty-two elite male (6 ACL-reconstructed and 16 uninjured control players) handball players were evaluated. The participants performed a vertical jump test battery that included a 50-cm vertical bilateral drop jump, a 20-cm vertical unilateral drop jump, and vertical unilateral countermovement jump maneuvers. Peak 3-dimensional (X, Y, Z) acceleration (m·s(-2)), jump phase duration and 3-dimensional orientation values (°) were obtained from the inertial sensor unit device. Two-tailed t-tests and a one-way analysis of variance were performed to compare means. The P value cut-off for significance was set at P handball athletes with previous ACL reconstruction demonstrated a jumping biomechanical profile similar to control players, including similar jumping performance values in both bilateral and unilateral jumping maneuvers, several years after ACL reconstruction. These findings are in agreement with previous research showing full functional restoration of abilities in top-level male athletes after ACL reconstruction, rehabilitation and subsequent return to sports at the previous level. Copyright © 2015 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.

  4. Kidnapping Detection and Recognition in Previous Unknown Environment

    Directory of Open Access Journals (Sweden)

    Yang Tian

    2017-01-01

    Full Text Available An unaware event referred to as kidnapping makes the estimation result of localization incorrect. In a previous unknown environment, incorrect localization result causes incorrect mapping result in Simultaneous Localization and Mapping (SLAM by kidnapping. In this situation, the explored area and unexplored area are divided to make the kidnapping recovery difficult. To provide sufficient information on kidnapping, a framework to judge whether kidnapping has occurred and to identify the type of kidnapping with filter-based SLAM is proposed. The framework is called double kidnapping detection and recognition (DKDR by performing two checks before and after the “update” process with different metrics in real time. To explain one of the principles of DKDR, we describe a property of filter-based SLAM that corrects the mapping result of the environment using the current observations after the “update” process. Two classical filter-based SLAM algorithms, Extend Kalman Filter (EKF SLAM and Particle Filter (PF SLAM, are modified to show that DKDR can be simply and widely applied in existing filter-based SLAM algorithms. Furthermore, a technique to determine the adapted thresholds of metrics in real time without previous data is presented. Both simulated and experimental results demonstrate the validity and accuracy of the proposed method.

  5. Genome-wide association studies of autoimmune vitiligo identify 23 new risk loci and highlight key pathways and regulatory variants.

    Science.gov (United States)

    Jin, Ying; Andersen, Genevieve; Yorgov, Daniel; Ferrara, Tracey M; Ben, Songtao; Brownson, Kelly M; Holland, Paulene J; Birlea, Stanca A; Siebert, Janet; Hartmann, Anke; Lienert, Anne; van Geel, Nanja; Lambert, Jo; Luiten, Rosalie M; Wolkerstorfer, Albert; Wietze van der Veen, J P; Bennett, Dorothy C; Taïeb, Alain; Ezzedine, Khaled; Kemp, E Helen; Gawkrodger, David J; Weetman, Anthony P; Kõks, Sulev; Prans, Ele; Kingo, Külli; Karelson, Maire; Wallace, Margaret R; McCormack, Wayne T; Overbeck, Andreas; Moretti, Silvia; Colucci, Roberta; Picardo, Mauro; Silverberg, Nanette B; Olsson, Mats; Valle, Yan; Korobko, Igor; Böhm, Markus; Lim, Henry W; Hamzavi, Iltefat; Zhou, Li; Mi, Qing-Sheng; Fain, Pamela R; Santorico, Stephanie A; Spritz, Richard A

    2016-11-01

    Vitiligo is an autoimmune disease in which depigmented skin results from the destruction of melanocytes, with epidemiological association with other autoimmune diseases. In previous linkage and genome-wide association studies (GWAS1 and GWAS2), we identified 27 vitiligo susceptibility loci in patients of European ancestry. We carried out a third GWAS (GWAS3) in European-ancestry subjects, with augmented GWAS1 and GWAS2 controls, genome-wide imputation, and meta-analysis of all three GWAS, followed by an independent replication. The combined analyses, with 4,680 cases and 39,586 controls, identified 23 new significantly associated loci and 7 suggestive loci. Most encode immune and apoptotic regulators, with some also associated with other autoimmune diseases, as well as several melanocyte regulators. Bioinformatic analyses indicate a predominance of causal regulatory variation, some of which corresponds to expression quantitative trait loci (eQTLs) at these loci. Together, the identified genes provide a framework for the genetic architecture and pathobiology of vitiligo, highlight relationships with other autoimmune diseases and melanoma, and offer potential targets for treatment.

  6. Are previous episodes of bacterial vaginosis a predictor for vaginal symptoms in breast cancer patients treated with aromatase inhibitors?

    DEFF Research Database (Denmark)

    Gade, Malene R; Goukasian, Irina; Panduro, Nathalie

    2018-01-01

    Objective To estimate the prevalence of vaginal symptoms in postmenopausal women with breast cancer exposed to aromatase inhibitors, and to investigate if the risk of vaginal symptoms is associated with previous episodes of bacterial vaginosis. Methods Patients from Rigshospitalet and Herlev...... University Hospital, Denmark, were identified through the register of Danish Breast Cancer Cooperation Group and 78 patients participated in the study. Semiquantitave questionnaires and telephone interview were used to assess the prevalence of vaginal symptoms and previous episode(s) of bacterial vaginosis....... Multivariable logistic regression models were used to assess the association between vaginal symptoms and previous episodes of bacterial vaginosis. Results Moderate to severe symptoms due to vaginal itching/irritation were experienced by 6.4% (95% CI: 2.8-14.1%), vaginal dryness by 28.4% (95% CI: 19...

  7. Do emotional intelligence and previous caring experience influence student nurse performance? A comparative analysis.

    Science.gov (United States)

    Stenhouse, Rosie; Snowden, Austyn; Young, Jenny; Carver, Fiona; Carver, Hannah; Brown, Norrie

    2016-08-01

    Reports of poor nursing care have focused attention on values based selection of candidates onto nursing programmes. Values based selection lacks clarity and valid measures. Previous caring experience might lead to better care. Emotional intelligence (EI) might be associated with performance, is conceptualised and measurable. To examine the impact of 1) previous caring experience, 2) emotional intelligence 3) social connection scores on performance and retention in a cohort of first year nursing and midwifery students in Scotland. A longitudinal, quasi experimental design. Adult and mental health nursing, and midwifery programmes in a Scottish University. Adult, mental health and midwifery students (n=598) completed the Trait Emotional Intelligence Questionnaire-short form and Schutte's Emotional Intelligence Scale on entry to their programmes at a Scottish University, alongside demographic and previous caring experience data. Social connection was calculated from a subset of questions identified within the TEIQue-SF in a prior factor and Rasch analysis. Student performance was calculated as the mean mark across the year. Withdrawal data were gathered. 598 students completed baseline measures. 315 students declared previous caring experience, 277 not. An independent-samples t-test identified that those without previous caring experience scored higher on performance (57.33±11.38) than those with previous caring experience (54.87±11.19), a statistically significant difference of 2.47 (95% CI, 0.54 to 4.38), t(533)=2.52, p=.012. Emotional intelligence scores were not associated with performance. Social connection scores for those withdrawing (mean rank=249) and those remaining (mean rank=304.75) were statistically significantly different, U=15,300, z=-2.61, p$_amp_$lt;0.009. Previous caring experience led to worse performance in this cohort. Emotional intelligence was not a useful indicator of performance. Lower scores on the social connection factor were associated

  8. IDENTIFYING COLLISIONAL FAMILIES IN THE KUIPER BELT

    International Nuclear Information System (INIS)

    Marcus, Robert A.; Ragozzine, Darin; Murray-Clay, Ruth A.; Holman, Matthew J.

    2011-01-01

    The identification and characterization of numerous collisional families-clusters of bodies with a common collisional origin-in the asteroid belt has added greatly to the understanding of asteroid belt formation and evolution. More recent study has also led to an appreciation of physical processes that had previously been neglected (e.g., the Yarkovsky effect). Collisions have certainly played an important role in the evolution of the Kuiper Belt as well, though only one collisional family has been identified in that region to date, around the dwarf planet Haumea. In this paper, we combine insights into collisional families from numerical simulations with the current observational constraints on the dynamical structure of the Kuiper Belt to investigate the ideal sizes and locations for identifying collisional families. We find that larger progenitors (r ∼ 500 km) result in more easily identifiable families, given the difficulty in identifying fragments of smaller progenitors in magnitude-limited surveys, despite their larger spread and less frequent occurrence. However, even these families do not stand out well from the background. Identifying families as statistical overdensities is much easier than characterizing families by distinguishing individual members from interlopers. Such identification seems promising, provided the background population is well known. In either case, families will also be much easier to study where the background population is small, i.e., at high inclinations. Overall, our results indicate that entirely different techniques for identifying families will be needed for the Kuiper Belt, and we provide some suggestions.

  9. Identifying, studying and making good use of macromolecular crystals

    Energy Technology Data Exchange (ETDEWEB)

    Calero, Guillermo [University of Pittsburgh Medical School, Pittsburgh, PA 15261 (United States); Cohen, Aina E. [SLAC National Accelerator Laboratory, Stanford University, Menlo Park, CA 94025 (United States); Luft, Joseph R. [Hauptman–Woodward Medical Research Institute, 700 Ellicott Street, Buffalo, NY 14203 (United States); State University of New York at Buffalo, 700 Ellicott Street, Buffalo, NY 14203 (United States); Newman, Janet [CSIRO Collaborative Crystallisation Centre, 343 Royal Parade, Parkville, Victoria 3052 (Australia); Snell, Edward H., E-mail: esnell@hwi.buffalo.edu [Hauptman–Woodward Medical Research Institute, 700 Ellicott Street, Buffalo, NY 14203 (United States); State University of New York at Buffalo, 700 Ellicott Street, Buffalo, NY 14203 (United States); University of Pittsburgh Medical School, Pittsburgh, PA 15261 (United States)

    2014-07-25

    As technology advances, the crystal volume that can be used to collect useful X-ray diffraction data decreases. The technologies available to detect and study growing crystals beyond the optical resolution limit and methods to successfully place the crystal into the X-ray beam are discussed. Structural biology has contributed tremendous knowledge to the understanding of life on the molecular scale. The Protein Data Bank, a depository of this structural knowledge, currently contains over 100 000 protein structures, with the majority stemming from X-ray crystallography. As the name might suggest, crystallography requires crystals. As detectors become more sensitive and X-ray sources more intense, the notion of a crystal is gradually changing from one large enough to embellish expensive jewellery to objects that have external dimensions of the order of the wavelength of visible light. Identifying these crystals is a prerequisite to their study. This paper discusses developments in identifying these crystals during crystallization screening and distinguishing them from other potential outcomes. The practical aspects of ensuring that once a crystal is identified it can then be positioned in the X-ray beam for data collection are also addressed.

  10. Identifying, studying and making good use of macromolecular crystals

    International Nuclear Information System (INIS)

    Calero, Guillermo; Cohen, Aina E.; Luft, Joseph R.; Newman, Janet; Snell, Edward H.

    2014-01-01

    As technology advances, the crystal volume that can be used to collect useful X-ray diffraction data decreases. The technologies available to detect and study growing crystals beyond the optical resolution limit and methods to successfully place the crystal into the X-ray beam are discussed. Structural biology has contributed tremendous knowledge to the understanding of life on the molecular scale. The Protein Data Bank, a depository of this structural knowledge, currently contains over 100 000 protein structures, with the majority stemming from X-ray crystallography. As the name might suggest, crystallography requires crystals. As detectors become more sensitive and X-ray sources more intense, the notion of a crystal is gradually changing from one large enough to embellish expensive jewellery to objects that have external dimensions of the order of the wavelength of visible light. Identifying these crystals is a prerequisite to their study. This paper discusses developments in identifying these crystals during crystallization screening and distinguishing them from other potential outcomes. The practical aspects of ensuring that once a crystal is identified it can then be positioned in the X-ray beam for data collection are also addressed

  11. A follow-up study for left ventricular mass on chromosome 12p11 identifies potential candidate genes

    Directory of Open Access Journals (Sweden)

    Slifer Susan

    2011-07-01

    Full Text Available Abstract Background Left ventricular mass (LVM is an important risk factor for cardiovascular disease. Previously we found evidence for linkage to chromosome 12p11 in Dominican families, with a significant increase in a subset of families with high average waist circumference (WC. In the present study, we use association analysis to further study the genetic effect on LVM. Methods Association analysis with LVM was done in the one LOD critical region of the linkage peak in an independent sample of 897 Caribbean Hispanics. Genotype data were available on 7085 SNPs from 23 to 53 MB on chromosome 12p11. Adjustment was made for vascular risk factors and population substructure using an additive genetic model. Subset analysis by WC was performed to test for a difference in genetic effects between the high and low WC subsets. Results In the overall analysis, the most significant association was found to rs10743465, downstream of the SOX5 gene (p = 1.27E-05. Also, 19 additional SNPs had nominal p TMTC1. Twelve additional SNPs in or near 6 genes had p Conclusions The current study supports previously identified evidence by linkage for a genetic effect on LVM on chromosome 12p11 using association analysis in population-based Caribbean Hispanic cohort. SOX5 may play an important role in the regulation of LVM. An interaction of TMTC1 with abdominal obesity may contribute to phenotypic variation of LVM.

  12. A meta-analysis of 120 246 individuals identifies 18 new loci for fibrinogen concentration

    DEFF Research Database (Denmark)

    de Vries, Paul S; Chasman, Daniel I; Sabater-Lleal, Maria

    2016-01-01

    Genome-wide association studies have previously identified 23 genetic loci associated with circulating fibrinogen concentration. These studies used HapMap imputation and did not examine the X chromosome. 1000 Genomes imputation provides better coverage of uncommon variants, and includes indels. W...

  13. A meta-analysis of 120 246 individuals identifies 18 new loci for fibrinogen concentration

    NARCIS (Netherlands)

    P.S. de Vries (Paul); D.I. Chasman (Daniel); M. Sabater-Lleal (Maria); M.-H. Chen (Ming-Huei); J.E. Huffman (Jennifer E.); M. Steri (Maristella); W. Tang (Weihong); A. Teumer (Alexander); R.E. Marioni (Riccardo); V. Grossmann (Vera); J.J. Hottenga (Jouke Jan); S. Trompet (Stella); M. Müller-Nurasyid (Martina); J.H. Zhao (Jing Hua); J. Brody (Jennifer); M.E. Kleber (Marcus); X. Guo (Xiuqing); J.J. Wang (Jie Jin); P. Auer (Paul); J. Attia (John); L.R. Yanek (Lisa); T.S. Ahluwalia (Tarunveer Singh); J. Lahti (Jari); C. Venturini (Cristina); T. Tanaka (Toshiko); L.F. Bielak (Lawrence F.); P.K. Joshi (Peter); A. Rocanin-Arjo (Ares); I. Kolcic (Ivana); P. Navarro (Pau); L.M. Rose (Lynda); C. Oldmeadow (Christopher); H. Riess (Helene); J. Mazur (Johanna); S. Basu (Saonli); A. Goel (Anuj); Q. Yang (Qiong); M. Ghanbari (Mohsen); Gonnekewillemsen; A. Rumley (Ann); E. Fiorillo (Edoardo); A.J. de Craen (Anton); A. Grotevendt (Anne); R.A. Scott (Robert); K.D. Taylor (Kent D.); G.E. Delgado (Graciela E.); J. Yao (Jie); A. Kifley (Annette); C. Kooperberg (Charles); Q. Qayyum (Rehan); L. Lopez (Lornam); T.L. Berentzen (Tina L.); K. Räikkönen (Katri); Massimomangino; S. Bandinelli (Stefania); P.A. Peyser (Patricia A.); S. Wild (Sarah); D.-A. Tregouet (David-Alexandre); A.F. Wright (Alan); J. Marten (Jonathan); T. Zemunik (Tatijana); A.C. Morrison (Alanna); B. Sennblad (Bengt); G.H. Tofler (Geoffrey); M.P.M. de Maat (Moniek); E.J.C. de Geus (Eco); G.D. Lowe (Gordon D.); M. Zoledziewska (Magdalena); N. Sattar (Naveed); H. Binder (Harald); U. Völker (Uwe); M. Waldenberger (Melanie); K.-T. Khaw (Kay-Tee); B. McKnight (Barbara); J. Huang (Jian); N.S. Jenny (Nancy); E.G. Holliday (Elizabeth); L. Qi (Lihong); M.G. Mcevoy (Mark G.); D.M. Becker (Diane); J.M. Starr (John); A.-P. Sarin; P.G. Hysi (Pirro); D.G. Hernandez (Dena); M.A. Jhun (Min A.); H. Campbell (Harry); A. Hamsten (Anders); F. Sarin (Fernando); W.L. McArdle (Wendy); P. Eline Slagboom; T. Zeller (Tanja); W. Koenig (Wolfgang); B. Psaty (Brucem); T. Haritunians (Talin); J. Liu (Jingmin); A. Palotie (Aarno); A.G. Uitterlinden (André); D.J. Stott (David J.); A. Hofman (Albert); O.H. Franco (Oscar); O. Polasek (Ozren); I. Rudan (Igor); P.-E. Morange (P.); J.F. Wilson (James F.); S.L. Kardia (Sharon L.r); L. Ferrucci (Luigi); T.D. Spector (Timothy); J.G. Eriksson (Johan G.); T. Hansen (Torben); I.J. Deary (Ian); L.C. Becker (Lewis); R.J. Scott (Rodney); P. Mitchell (Paul); W. März (Winfried); N.J. Wareham (Nick J.); A. Peters (Annette); A. Greinacher (Andreas); P.S. Wild (Philipp S.); J.W. Jukema (Jan Wouter); D.I. Boomsma (Dorret I.); C. Hayward (Caroline); F. Cucca (Francesco); R.P. Tracy (Russell); H. Watkins (Hugh); A.P. Reiner (Alex P.); A.R. Folsom (Aaron); P.M. Ridker (Paul); C.J. O'Donnell (Christopher J.); N.L. Smith (Nicholas L.); D.P. Strachan (David P.); A. Dehghan (Abbas)

    2016-01-01

    textabstractGenome-wide association studies have previously identified 23 genetic loci associated with circulating fibrinogen concentration. These studies used HapMap imputation and did not examine the X-chromosome. 1000 Genomes imputation provides better coverage of uncommon variants, and includes

  14. Subsequent pregnancy outcome after previous foetal death

    NARCIS (Netherlands)

    Nijkamp, J. W.; Korteweg, F. J.; Holm, J. P.; Timmer, A.; Erwich, J. J. H. M.; van Pampus, M. G.

    Objective: A history of foetal death is a risk factor for complications and foetal death in subsequent pregnancies as most previous risk factors remain present and an underlying cause of death may recur. The purpose of this study was to evaluate subsequent pregnancy outcome after foetal death and to

  15. Evaluation of an interdisciplinary re-isolation policy for patients with previous Clostridium difficile diarrhea.

    Science.gov (United States)

    Boone, N; Eagan, J A; Gillern, P; Armstrong, D; Sepkowitz, K A

    1998-12-01

    Diarrhea caused by Clostridium difficile is increasingly recognized as a nosocomial problem. The effectiveness and cost of a new program to decrease nosocomial spread by identifying patients scheduled for readmission who were previously positive for toxin was evaluated. The Memorial Sloan-Kettering Cancer Center is a 410-bed comprehensive cancer center in New York City. Many patients are readmitted during their course of cancer therapy. In 1995 as a result of concern about the nosocomial spread of C difficile, we implemented a policy that all patients who were positive for C difficile toxin in the previous 6 months with no subsequent toxin-negative stool as an outpatient would be placed into contact isolation on readmission pending evaluation of stool specimens. Patients who were previously positive for C difficile toxin were identified to infection control and admitting office databases via computer. Admitting personnel contacted infection control with all readmissions to determine whether a private room was required. Between July 1, 1995, and June 30, 1996, 47 patients who were previously positive for C difficile toxin were readmitted. Before their first scheduled readmission, the specimens for 15 (32%) of these patients were negative for C difficile toxin. They were subsequently cleared as outpatients and were readmitted without isolation. Workup of the remaining 32 patients revealed that the specimens for 7 patients were positive for C difficile toxin and 86 isolation days were used. An additional 25 patients used 107 isolation days and were either cleared after a negative specimen was obtained in-house or discharged without having an appropriate specimen sent. Four patients (9%) had reoccurring C difficile after having toxin-negative stools. We estimate (because outpatient specimens were not collected) the cost incurred at $48,500 annually, including the incremental cost of hospital isolation and equipment. Our policy to control the spread of nosocomial C

  16. Analysis of 60 706 Exomes Questions the Role of De Novo Variants Previously Implicated in Cardiac Disease

    DEFF Research Database (Denmark)

    Paludan-Müller, Christian; Ahlberg, Gustav; Ghouse, Jonas

    2017-01-01

    BACKGROUND: De novo variants in the exome occur at a rate of 1 per individual per generation, and because of the low reproductive fitness for de novo variants causing severe disease, the likelihood of finding these as standing variations in the general population is low. Therefore, this study...... sought to evaluate the pathogenicity of de novo variants previously associated with cardiac disease based on a large population-representative exome database. METHODS AND RESULTS: We performed a literature search for previous publications on de novo variants associated with severe arrhythmias...... trio studies (>1000 subjects). Of the monogenic variants, 11% (23/211) were present in ExAC, whereas 26% (802/3050) variants believed to increase susceptibility of disease were identified in ExAC. Monogenic de novo variants in ExAC had a total allele count of 109 and with ≈844 expected cases in Ex...

  17. The biomechanics of running in athletes with previous hamstring injury: A case-control study.

    Science.gov (United States)

    Daly, C; Persson, U McCarthy; Twycross-Lewis, R; Woledge, R C; Morrissey, D

    2016-04-01

    Hamstring injury is prevalent with persistently high reinjury rates. We aim to inform hamstring rehabilitation by exploring the electromyographic and kinematic characteristics of running in athletes with previous hamstring injury. Nine elite male Gaelic games athletes who had returned to sport after hamstring injury and eight closely matched controls sprinted while lower limb kinematics and muscle activity of the previously injured biceps femoris, bilateral gluteus maximus, lumbar erector spinae, rectus femoris, and external oblique were recorded. Intergroup comparisons of muscle activation ratios and kinematics were performed. Previously injured athletes demonstrated significantly reduced biceps femoris muscle activation ratios with respect to ipsilateral gluteus maximus (maximum difference -12.5%, P = 0.03), ipsilateral erector spinae (maximum difference -12.5%, P = 0.01), ipsilateral external oblique (maximum difference -23%, P = 0.01), and contralateral rectus femoris (maximum difference -22%, P = 0.02) in the late swing phase. We also detected sagittal asymmetry in hip flexion (maximum 8°, P = 0.01), pelvic tilt (maximum 4°, P = 0.02), and medial rotation of the knee (maximum 6°, P = 0.03) effectively putting the hamstrings in a lengthened position just before heel strike. Previous hamstring injury is associated with altered biceps femoris associated muscle activity and potentially injurious kinematics. These deficits should be considered and addressed during rehabilitation. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Maternal red blood cell alloantibodies identified in blood samples obtained from Iranian pregnant women: the first population study in Iran.

    Science.gov (United States)

    Shahverdi, Ehsan; Moghaddam, Mostafa; Gorzin, Fateme

    2017-01-01

    The objective was to determine the frequency of occurrence of alloantibodies among pregnant women in Iran. This was a prospective cross-sectional study, which was carried out in the immunohematology reference laboratory of the Iranian Blood Transfusion Organization in Tehran, Iran, in 2008 to 2015. Screening and identification of red blood cell (RBC) alloantibodies was done on the sera of 7340 pregnant females using the standard tube method and gel column agglutination technique. Alloantibodies were identified in the serum of 332 of the 7340 (4.5%) pregnant women. A total of 410 antibodies were detected in 332 positive maternal serum samples with no previous history of blood transfusion. Anti-D was the most common antibody accounting for 70.5% of all the antibodies formed in D- women. The incidence of specific alloimmunization other than Rh group was 14.4%. We concluded that the alloimmunization rate was high in comparison with wide pattern in previous studies. In Iran, like other developing countries, alloimmunization screening tests are performed only to detect anti-D in pregnant D- women. This high rate of alloimmunization, quite possibly, is due to the fact that the majority of blood samples came from pregnant women known to have previous obstetric problems. However, we suggest that RBC antibody screening tests should be extended to all D+ women. © 2016 AABB.

  19. High prevalence of genetic variants previously associated with LQT syndrome in new exome data

    DEFF Research Database (Denmark)

    Refsgaard, Lena; Holst, Anders G; Sadjadieh, Golnaz

    2012-01-01

    To date, hundreds of variants in 13 genes have been associated with long QT syndrome (LQTS). The prevalence of LQTS is estimated to be between 1:2000 and 1:5000. The knowledge of genetic variation in the general population has until recently been limited, but newly published data from NHLBI GO...... variants KCNH2 P347S; SCN5A: S216L, V1951L; and CAV3 T78M in the control population (n=704) revealed prevalences comparable to those of ESP. Thus, we identified a much higher prevalence of previously LQTS-associated variants than expected in exome data from population studies. Great caution regarding...

  20. Human Papilloma Virus Identification in Breast Cancer Patients with Previous Cervical Neoplasia.

    Science.gov (United States)

    Lawson, James S; Glenn, Wendy K; Salyakina, Daria; Clay, Rosemary; Delprado, Warick; Cheerala, Bharathi; Tran, Dinh D; Ngan, Christopher C; Miyauchi, Shingo; Karim, Martha; Antonsson, Annika; Whitaker, Noel J

    2015-01-01

    Women with human papilloma virus (HPV)-associated cervical neoplasia have a higher risk of developing breast cancer than the general female population. The purpose of this study was to (i) identify high-risk HPVs in cervical neoplasia and subsequent HPV positive breast cancers which developed in the same patients and (ii) determine if these HPVs were biologically active. A range of polymerase chain reaction and immunohistochemical techniques were used to conduct a retrospective cohort study of cervical precancers and subsequent breast cancers in the same patients. The same high-risk HPV types were identified in both the cervical and breast specimens in 13 (46%) of 28 patients. HPV type 18 was the most prevalent. HPVs appeared to be biologically active as demonstrated by the expression of HPV E7 proteins and the presence of HPV-associated koilocytes. The average age of these patients diagnosed with breast cancer following prior cervical precancer was 51 years, as compared to 60 years for all women with breast cancer (p for difference = 0.001). These findings indicate that high-risk HPVs can be associated with cervical neoplasia and subsequent young age breast cancer. However, these associations are unusual and are a very small proportion of breast cancers. These outcomes confirm and extend the observations of two similar previous studies and offer one explanation for the increased prevalence of serious invasive breast cancer among young women.

  1. Human papilloma virus identification in breast cancer patients with previous cervical neoplasia

    Directory of Open Access Journals (Sweden)

    James Sutherland Lawson

    2016-01-01

    Full Text Available Purpose: Women with human papilloma virus (HPV associated cervical neoplasia have a higher risk of developing breast cancer than the general female population. The purpose of this study was to (i identify high risk for cancer HPVs in cervical neoplasia and subsequent HPV positive breast cancers which developed in the same patients and (ii determine if these HPVs were biologically active.Methods: A range of polymerase chain reaction (PCR and immunohistochemical techniques were used to conduct a retrospective cohort study of cervical precancers and subsequent breast cancers in the same patients. Results: The same high risk HPV types were identified in both the cervical and breast specimens in 13 (46% of 28 patients. HPV type 18 was the most prevalent. HPVs appeared to be biologically active as demonstrated by the expression of HPV E7 proteins and the presence of HPV associated koilocytes. The average age of these patients diagnosed with breast cancer following prior cervical precancer was 51 years, as compared to 60 years for all women with breast cancer (p for difference = 0.001. Conclusions: These findings indicate that high risk HPVs can be associated with cervical neoplasia and subsequent young age breast cancer. However these associations are unusual and are a very small proportion of breast cancers. These outcomes confirm and extend the observations of 2 similar previous studies and offer one explanation for the increased prevalence of serious invasive breast cancer among young women.

  2. Fine mapping of breast cancer genome-wide association studies loci in women of African ancestry identifies novel susceptibility markers.

    Science.gov (United States)

    Zheng, Yonglan; Ogundiran, Temidayo O; Falusi, Adeyinka G; Nathanson, Katherine L; John, Esther M; Hennis, Anselm J M; Ambs, Stefan; Domchek, Susan M; Rebbeck, Timothy R; Simon, Michael S; Nemesure, Barbara; Wu, Suh-Yuh; Leske, Maria Cristina; Odetunde, Abayomi; Niu, Qun; Zhang, Jing; Afolabi, Chibuzor; Gamazon, Eric R; Cox, Nancy J; Olopade, Christopher O; Olopade, Olufunmilayo I; Huo, Dezheng

    2013-07-01

    Numerous single nucleotide polymorphisms (SNPs) associated with breast cancer susceptibility have been identified by genome-wide association studies (GWAS). However, these SNPs were primarily discovered and validated in women of European and Asian ancestry. Because linkage disequilibrium is ancestry-dependent and heterogeneous among racial/ethnic populations, we evaluated common genetic variants at 22 GWAS-identified breast cancer susceptibility loci in a pooled sample of 1502 breast cancer cases and 1378 controls of African ancestry. None of the 22 GWAS index SNPs could be validated, challenging the direct generalizability of breast cancer risk variants identified in Caucasians or Asians to other populations. Novel breast cancer risk variants for women of African ancestry were identified in regions including 5p12 (odds ratio [OR] = 1.40, 95% confidence interval [CI] = 1.11-1.76; P = 0.004), 5q11.2 (OR = 1.22, 95% CI = 1.09-1.36; P = 0.00053) and 10p15.1 (OR = 1.22, 95% CI = 1.08-1.38; P = 0.0015). We also found positive association signals in three regions (6q25.1, 10q26.13 and 16q12.1-q12.2) previously confirmed by fine mapping in women of African ancestry. In addition, polygenic model indicated that eight best markers in this study, compared with 22 GWAS-identified SNPs, could better predict breast cancer risk in women of African ancestry (per-allele OR = 1.21, 95% CI = 1.16-1.27; P = 9.7 × 10(-16)). Our results demonstrate that fine mapping is a powerful approach to better characterize the breast cancer risk alleles in diverse populations. Future studies and new GWAS in women of African ancestry hold promise to discover additional variants for breast cancer susceptibility with clinical implications throughout the African diaspora.

  3. Dexamethasone intravitreal implant in previously treated patients with diabetic macular edema : Subgroup analysis of the MEAD study

    OpenAIRE

    Augustin, A.J.; Kuppermann, B.D.; Lanzetta, P.; Loewenstein, A.; Li, X.; Cui, H.; Hashad, Y.; Whitcup, S.M.; Abujamra, S.; Acton, J.; Ali, F.; Antoszyk, A.; Awh, C.C.; Barak, A.; Bartz-Schmidt, K.U.

    2015-01-01

    Background Dexamethasone intravitreal implant 0.7?mg (DEX 0.7) was approved for treatment of diabetic macular edema (DME) after demonstration of its efficacy and safety in the MEAD registration trials. We performed subgroup analysis of MEAD study results to evaluate the efficacy and safety of DEX 0.7 treatment in patients with previously treated DME. Methods Three-year, randomized, sham-controlled phase 3 study in patients with DME, best-corrected visual acuity (BCVA) of 34?68 Early Treatment...

  4. Subsequent childbirth after a previous traumatic birth.

    Science.gov (United States)

    Beck, Cheryl Tatano; Watson, Sue

    2010-01-01

    Nine percent of new mothers in the United States who participated in the Listening to Mothers II Postpartum Survey screened positive for meeting the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition criteria for posttraumatic stress disorder after childbirth. Women who have had a traumatic birth experience report fewer subsequent children and a longer length of time before their second baby. Childbirth-related posttraumatic stress disorder impacts couples' physical relationship, communication, conflict, emotions, and bonding with their children. The purpose of this study was to describe the meaning of women's experiences of a subsequent childbirth after a previous traumatic birth. Phenomenology was the research design used. An international sample of 35 women participated in this Internet study. Women were asked, "Please describe in as much detail as you can remember your subsequent pregnancy, labor, and delivery following your previous traumatic birth." Colaizzi's phenomenological data analysis approach was used to analyze the stories of the 35 women. Data analysis yielded four themes: (a) riding the turbulent wave of panic during pregnancy; (b) strategizing: attempts to reclaim their body and complete the journey to motherhood; (c) bringing reverence to the birthing process and empowering women; and (d) still elusive: the longed-for healing birth experience. Subsequent childbirth after a previous birth trauma has the potential to either heal or retraumatize women. During pregnancy, women need permission and encouragement to grieve their prior traumatic births to help remove the burden of their invisible pain.

  5. Robust Intratumor Partitioning to Identify High-Risk Subregions in Lung Cancer: A Pilot Study.

    Science.gov (United States)

    Wu, Jia; Gensheimer, Michael F; Dong, Xinzhe; Rubin, Daniel L; Napel, Sandy; Diehn, Maximilian; Loo, Billy W; Li, Ruijiang

    2016-08-01

    To develop an intratumor partitioning framework for identifying high-risk subregions from (18)F-fluorodeoxyglucose positron emission tomography (FDG-PET) and computed tomography (CT) imaging and to test whether tumor burden associated with the high-risk subregions is prognostic of outcomes in lung cancer. In this institutional review board-approved retrospective study, we analyzed the pretreatment FDG-PET and CT scans of 44 lung cancer patients treated with radiation therapy. A novel, intratumor partitioning method was developed, based on a 2-stage clustering process: first at the patient level, each tumor was over-segmented into many superpixels by k-means clustering of integrated PET and CT images; next, tumor subregions were identified by merging previously defined superpixels via population-level hierarchical clustering. The volume associated with each of the subregions was evaluated using Kaplan-Meier analysis regarding its prognostic capability in predicting overall survival (OS) and out-of-field progression (OFP). Three spatially distinct subregions were identified within each tumor that were highly robust to uncertainty in PET/CT co-registration. Among these, the volume of the most metabolically active and metabolically heterogeneous solid component of the tumor was predictive of OS and OFP on the entire cohort, with a concordance index or CI of 0.66-0.67. When restricting the analysis to patients with stage III disease (n=32), the same subregion achieved an even higher CI of 0.75 (hazard ratio 3.93, log-rank P=.002) for predicting OS, and a CI of 0.76 (hazard ratio 4.84, log-rank P=.002) for predicting OFP. In comparison, conventional imaging markers, including tumor volume, maximum standardized uptake value, and metabolic tumor volume using threshold of 50% standardized uptake value maximum, were not predictive of OS or OFP, with CI mostly below 0.60 (log-rank P>.05). We propose a robust intratumor partitioning method to identify clinically relevant, high

  6. 76 FR 41432 - Airworthiness Directives; Gulfstream Aerospace LP (Type Certificate Previously Held by Israel...

    Science.gov (United States)

    2011-07-14

    ... Aerospace LP (Type Certificate Previously Held by Israel Aircraft Industries, Ltd.) Model Galaxy, Gulfstream... proposed AD. Discussion The Civil Aviation Authority (CAA), which is the aviation authority for Israel, has... Held by Israel Aircraft Industries, Ltd.): Docket No. FAA-2011-0716; Directorate Identifier 2011-NM-013...

  7. Guidance for Identifying, Selecting and Evaluating Open Literature Studies

    Science.gov (United States)

    This guidance for Office of Pesticide Program staff will assist in their evaluation of open literature studies of pesticides. It also describes how we identify, select, and ensure that data we use in risk assessments is of sufficient scientific quality.

  8. Challenging previous conceptions of vegetarianism and eating disorders.

    Science.gov (United States)

    Fisak, B; Peterson, R D; Tantleff-Dunn, S; Molnar, J M

    2006-12-01

    The purpose of this study was to replicate and expand upon previous research that has examined the potential association between vegetarianism and disordered eating. Limitations of previous research studies are addressed, including possible low reliability of measures of eating pathology within vegetarian samples, use of only a few dietary restraint measures, and a paucity of research examining potential differences in body image and food choice motives of vegetarians versus nonvegetarians. Two hundred and fifty-six college students completed a number of measures of eating pathology and body image, and a food choice motives questionnaire. Interestingly, no significant differences were found between vegetarians and nonvegetarians in measures of eating pathology or body image. However, significant differences in food choice motives were found. Implications for both researchers and clinicians are discussed.

  9. Genome wide association study identifies KCNMA1 contributing to human obesity

    DEFF Research Database (Denmark)

    Jiao, Hong; Arner, Peter; Hoffstedt, Johan

    2011-01-01

    Recent genome-wide association (GWA) analyses have identified common single nucleotide polymorphisms (SNPs) that are associated with obesity. However, the reported genetic variation in obesity explains only a minor fraction of the total genetic variation expected to be present in the population....... Thus many genetic variants controlling obesity remain to be identified. The aim of this study was to use GWA followed by multiple stepwise validations to identify additional genes associated with obesity....

  10. A trans-ethnic genome-wide association study identifies gender-specific loci influencing pediatric aBMD and BMC at the distal radius.

    Science.gov (United States)

    Chesi, Alessandra; Mitchell, Jonathan A; Kalkwarf, Heidi J; Bradfield, Jonathan P; Lappe, Joan M; McCormack, Shana E; Gilsanz, Vicente; Oberfield, Sharon E; Hakonarson, Hakon; Shepherd, John A; Kelly, Andrea; Zemel, Babette S; Grant, Struan F A

    2015-09-01

    Childhood fractures are common, with the forearm being the most common site. Genome-wide association studies (GWAS) have identified more than 60 loci associated with bone mineral density (BMD) in adults but less is known about genetic influences specific to bone in childhood. To identify novel genetic factors that influence pediatric bone strength at a common site for childhood fractures, we performed a sex-stratified trans-ethnic genome-wide association study of areal BMD (aBMD) and bone mineral content (BMC) Z-scores measured by dual energy X-ray absorptiometry at the one-third distal radius, in a cohort of 1399 children without clinical abnormalities in bone health. We tested signals with P BMC-Z). Signals at the CPED1-WNT16-FAM3C locus have been previously associated with BMD at other skeletal sites in adults and children. Our result at the distal radius underscores the importance of this locus at multiple skeletal sites. The 9p21.3 locus is within a gene desert, with the nearest gene flanking each side being MIR31HG and MTAP, neither of which has been implicated in BMD or BMC previously. These findings suggest that genetic determinants of childhood bone accretion at the radius, a skeletal site that is primarily cortical bone, exist and also differ by sex. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. A previous hamstring injury affects kicking mechanics in soccer players.

    Science.gov (United States)

    Navandar, Archit; Veiga, Santiago; Torres, Gonzalo; Chorro, David; Navarro, Enrique

    2018-01-10

    Although the kicking skill is influenced by limb dominance and sex, how a previous hamstring injury affects kicking has not been studied in detail. Thus, the objective of this study was to evaluate the effect of sex and limb dominance on kicking in limbs with and without a previous hamstring injury. 45 professional players (males: n=19, previously injured players=4, age=21.16 ± 2.00 years; females: n=19, previously injured players=10, age=22.15 ± 4.50 years) performed 5 kicks each with their preferred and non-preferred limb at a target 7m away, which were recorded with a three-dimensional motion capture system. Kinematic and kinetic variables were extracted for the backswing, leg cocking, leg acceleration and follow through phases. A shorter backswing (20.20 ± 3.49% vs 25.64 ± 4.57%), and differences in knee flexion angle (58 ± 10o vs 72 ± 14o) and hip flexion velocity (8 ± 0rad/s vs 10 ± 2rad/s) were observed in previously injured, non-preferred limb kicks for females. A lower peak hip linear velocity (3.50 ± 0.84m/s vs 4.10 ± 0.45m/s) was observed in previously injured, preferred limb kicks of females. These differences occurred in the backswing and leg-cocking phases where the hamstring muscles were the most active. A variation in the functioning of the hamstring muscles and that of the gluteus maximus and iliopsoas in the case of a previous injury could account for the differences observed in the kicking pattern. Therefore, the effects of a previous hamstring injury must be considered while designing rehabilitation programs to re-educate kicking movement.

  12. Meta-analysis of 375,000 individuals identifies 38 susceptibility loci for migraine.

    Science.gov (United States)

    Gormley, Padhraig; Anttila, Verneri; Winsvold, Bendik S; Palta, Priit; Esko, Tonu; Pers, Tune H; Farh, Kai-How; Cuenca-Leon, Ester; Muona, Mikko; Furlotte, Nicholas A; Kurth, Tobias; Ingason, Andres; McMahon, George; Ligthart, Lannie; Terwindt, Gisela M; Kallela, Mikko; Freilinger, Tobias M; Ran, Caroline; Gordon, Scott G; Stam, Anine H; Steinberg, Stacy; Borck, Guntram; Koiranen, Markku; Quaye, Lydia; Adams, Hieab H H; Lehtimäki, Terho; Sarin, Antti-Pekka; Wedenoja, Juho; Hinds, David A; Buring, Julie E; Schürks, Markus; Ridker, Paul M; Hrafnsdottir, Maria Gudlaug; Stefansson, Hreinn; Ring, Susan M; Hottenga, Jouke-Jan; Penninx, Brenda W J H; Färkkilä, Markus; Artto, Ville; Kaunisto, Mari; Vepsäläinen, Salli; Malik, Rainer; Heath, Andrew C; Madden, Pamela A F; Martin, Nicholas G; Montgomery, Grant W; Kurki, Mitja I; Kals, Mart; Mägi, Reedik; Pärn, Kalle; Hämäläinen, Eija; Huang, Hailiang; Byrnes, Andrea E; Franke, Lude; Huang, Jie; Stergiakouli, Evie; Lee, Phil H; Sandor, Cynthia; Webber, Caleb; Cader, Zameel; Muller-Myhsok, Bertram; Schreiber, Stefan; Meitinger, Thomas; Eriksson, Johan G; Salomaa, Veikko; Heikkilä, Kauko; Loehrer, Elizabeth; Uitterlinden, Andre G; Hofman, Albert; van Duijn, Cornelia M; Cherkas, Lynn; Pedersen, Linda M; Stubhaug, Audun; Nielsen, Christopher S; Männikkö, Minna; Mihailov, Evelin; Milani, Lili; Göbel, Hartmut; Esserlind, Ann-Louise; Christensen, Anne Francke; Hansen, Thomas Folkmann; Werge, Thomas; Kaprio, Jaakko; Aromaa, Arpo J; Raitakari, Olli; Ikram, M Arfan; Spector, Tim; Järvelin, Marjo-Riitta; Metspalu, Andres; Kubisch, Christian; Strachan, David P; Ferrari, Michel D; Belin, Andrea C; Dichgans, Martin; Wessman, Maija; van den Maagdenberg, Arn M J M; Zwart, John-Anker; Boomsma, Dorret I; Smith, George Davey; Stefansson, Kari; Eriksson, Nicholas; Daly, Mark J; Neale, Benjamin M; Olesen, Jes; Chasman, Daniel I; Nyholt, Dale R; Palotie, Aarno

    2016-08-01

    Migraine is a debilitating neurological disorder affecting around one in seven people worldwide, but its molecular mechanisms remain poorly understood. There is some debate about whether migraine is a disease of vascular dysfunction or a result of neuronal dysfunction with secondary vascular changes. Genome-wide association (GWA) studies have thus far identified 13 independent loci associated with migraine. To identify new susceptibility loci, we carried out a genetic study of migraine on 59,674 affected subjects and 316,078 controls from 22 GWA studies. We identified 44 independent single-nucleotide polymorphisms (SNPs) significantly associated with migraine risk (P < 5 × 10(-8)) that mapped to 38 distinct genomic loci, including 28 loci not previously reported and a locus that to our knowledge is the first to be identified on chromosome X. In subsequent computational analyses, the identified loci showed enrichment for genes expressed in vascular and smooth muscle tissues, consistent with a predominant theory of migraine that highlights vascular etiologies.

  13. A Prospective Cohort Study of Absconsion Incidents in Forensic Psychiatric Settings: Can We Identify Those at High-Risk?

    Directory of Open Access Journals (Sweden)

    Alexis E Cullen

    Full Text Available Incidents of absconsion in forensic psychiatric units can have potentially serious consequences, yet surprisingly little is known about the characteristics of patients who abscond from these settings. The few previous studies conducted to date have employed retrospective designs, and no attempt has been made to develop an empirically-derived risk assessment scale. In this prospective study, we aimed to identify predictors of absconsion over a two-year period and investigate the feasibility of developing a brief risk assessment scale.The study examined a representative sample of 135 patients treated in forensic medium- and low-secure wards. At baseline, demographic, clinical, treatment-related, and offending/behavioural factors were ascertained from electronic medical records and the treating teams. Incidents of absconsion (i.e., failure to return from leave, incidents of escape, and absconding whilst on escorted leave were assessed at a two-year follow-up. Logistic regression analyses were used to determine the strongest predictors of absconsion which were then weighted according to their ability to discriminate absconders and non-absconders. The predictive utility of a brief risk assessment scale based on these weighted items was evaluated using receiver operator characteristics (ROC.During the two-year follow-up period, 27 patients (20% absconded, accounting for 56 separate incidents. In multivariate analyses, four factors relating to offending and behaviour emerged as the strongest predictors of absconsion: history of sexual offending, previous absconsion, recent inpatient verbal aggression, and recent inpatient substance use. The weighted risk scale derived from these factors had moderate-to-good predictive accuracy (ROC area under the curve: 0.80; sensitivity: 067; specificity: 0.71, a high negative predictive value (0.91, but a low positive predictive value (0.34.Potentially-targetable recent behaviours, such as inpatient verbal aggression

  14. Strategies to design clinical studies to identify predictive biomarkers in cancer research.

    Science.gov (United States)

    Perez-Gracia, Jose Luis; Sanmamed, Miguel F; Bosch, Ana; Patiño-Garcia, Ana; Schalper, Kurt A; Segura, Victor; Bellmunt, Joaquim; Tabernero, Josep; Sweeney, Christopher J; Choueiri, Toni K; Martín, Miguel; Fusco, Juan Pablo; Rodriguez-Ruiz, Maria Esperanza; Calvo, Alfonso; Prior, Celia; Paz-Ares, Luis; Pio, Ruben; Gonzalez-Billalabeitia, Enrique; Gonzalez Hernandez, Alvaro; Páez, David; Piulats, Jose María; Gurpide, Alfonso; Andueza, Mapi; de Velasco, Guillermo; Pazo, Roberto; Grande, Enrique; Nicolas, Pilar; Abad-Santos, Francisco; Garcia-Donas, Jesus; Castellano, Daniel; Pajares, María J; Suarez, Cristina; Colomer, Ramon; Montuenga, Luis M; Melero, Ignacio

    2017-02-01

    The discovery of reliable biomarkers to predict efficacy and toxicity of anticancer drugs remains one of the key challenges in cancer research. Despite its relevance, no efficient study designs to identify promising candidate biomarkers have been established. This has led to the proliferation of a myriad of exploratory studies using dissimilar strategies, most of which fail to identify any promising targets and are seldom validated. The lack of a proper methodology also determines that many anti-cancer drugs are developed below their potential, due to failure to identify predictive biomarkers. While some drugs will be systematically administered to many patients who will not benefit from them, leading to unnecessary toxicities and costs, others will never reach registration due to our inability to identify the specific patient population in which they are active. Despite these drawbacks, a limited number of outstanding predictive biomarkers have been successfully identified and validated, and have changed the standard practice of oncology. In this manuscript, a multidisciplinary panel reviews how those key biomarkers were identified and, based on those experiences, proposes a methodological framework-the DESIGN guidelines-to standardize the clinical design of biomarker identification studies and to develop future research in this pivotal field. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. No discrimination against previous mates in a sexually cannibalistic spider

    Science.gov (United States)

    Fromhage, Lutz; Schneider, Jutta M.

    2005-09-01

    In several animal species, females discriminate against previous mates in subsequent mating decisions, increasing the potential for multiple paternity. In spiders, female choice may take the form of selective sexual cannibalism, which has been shown to bias paternity in favor of particular males. If cannibalistic attacks function to restrict a male's paternity, females may have little interest to remate with males having survived such an attack. We therefore studied the possibility of female discrimination against previous mates in sexually cannibalistic Argiope bruennichi, where females almost always attack their mate at the onset of copulation. We compared mating latency and copulation duration of males having experienced a previous copulation either with the same or with a different female, but found no evidence for discrimination against previous mates. However, males copulated significantly shorter when inserting into a used, compared to a previously unused, genital pore of the female.

  16. Abiraterone in metastatic prostate cancer without previous chemotherapy

    NARCIS (Netherlands)

    Ryan, Charles J.; Smith, Matthew R.; de Bono, Johann S.; Molina, Arturo; Logothetis, Christopher J.; de Souza, Paul; Fizazi, Karim; Mainwaring, Paul; Piulats, Josep M.; Ng, Siobhan; Carles, Joan; Mulders, Peter F. A.; Basch, Ethan; Small, Eric J.; Saad, Fred; Schrijvers, Dirk; van Poppel, Hendrik; Mukherjee, Som D.; Suttmann, Henrik; Gerritsen, Winald R.; Flaig, Thomas W.; George, Daniel J.; Yu, Evan Y.; Efstathiou, Eleni; Pantuck, Allan; Winquist, Eric; Higano, Celestia S.; Taplin, Mary-Ellen; Park, Youn; Kheoh, Thian; Griffin, Thomas; Scher, Howard I.; Rathkopf, Dana E.; Boyce, A.; Costello, A.; Davis, I.; Ganju, V.; Horvath, L.; Lynch, R.; Marx, G.; Parnis, F.; Shapiro, J.; Singhal, N.; Slancar, M.; van Hazel, G.; Wong, S.; Yip, D.; Carpentier, P.; Luyten, D.; de Reijke, T.

    2013-01-01

    Abiraterone acetate, an androgen biosynthesis inhibitor, improves overall survival in patients with metastatic castration-resistant prostate cancer after chemotherapy. We evaluated this agent in patients who had not received previous chemotherapy. In this double-blind study, we randomly assigned

  17. Secondary recurrent miscarriage is associated with previous male birth.

    LENUS (Irish Health Repository)

    Ooi, Poh Veh

    2012-01-31

    Secondary recurrent miscarriage (RM) is defined as three or more consecutive pregnancy losses after delivery of a viable infant. Previous reports suggest that a firstborn male child is associated with less favourable subsequent reproductive potential, possibly due to maternal immunisation against male-specific minor histocompatibility antigens. In a retrospective cohort study of 85 cases of secondary RM we aimed to determine if secondary RM was associated with (i) gender of previous child, maternal age, or duration of miscarriage history, and (ii) increased risk of pregnancy complications. Fifty-three women (62.0%; 53\\/85) gave birth to a male child prior to RM compared to 32 (38.0%; 32\\/85) who gave birth to a female child (p=0.002). The majority (91.7%; 78\\/85) had uncomplicated, term deliveries and normal birth weight neonates, with one quarter of the women previously delivered by Caesarean section. All had routine RM investigations and 19.0% (16\\/85) had an abnormal result. Fifty-seven women conceived again and 33.3% (19\\/57) miscarried, but there was no significant difference in failure rates between those with a previous male or female child (13\\/32 vs. 6\\/25, p=0.2). When patients with abnormal results were excluded, or when women with only one previous child were considered, there was still no difference in these rates. A previous male birth may be associated with an increased risk of secondary RM but numbers preclude concluding whether this increases recurrence risk. The suggested association with previous male birth provides a basis for further investigations at a molecular level.

  18. Secondary recurrent miscarriage is associated with previous male birth.

    LENUS (Irish Health Repository)

    Ooi, Poh Veh

    2011-01-01

    Secondary recurrent miscarriage (RM) is defined as three or more consecutive pregnancy losses after delivery of a viable infant. Previous reports suggest that a firstborn male child is associated with less favourable subsequent reproductive potential, possibly due to maternal immunisation against male-specific minor histocompatibility antigens. In a retrospective cohort study of 85 cases of secondary RM we aimed to determine if secondary RM was associated with (i) gender of previous child, maternal age, or duration of miscarriage history, and (ii) increased risk of pregnancy complications. Fifty-three women (62.0%; 53\\/85) gave birth to a male child prior to RM compared to 32 (38.0%; 32\\/85) who gave birth to a female child (p=0.002). The majority (91.7%; 78\\/85) had uncomplicated, term deliveries and normal birth weight neonates, with one quarter of the women previously delivered by Caesarean section. All had routine RM investigations and 19.0% (16\\/85) had an abnormal result. Fifty-seven women conceived again and 33.3% (19\\/57) miscarried, but there was no significant difference in failure rates between those with a previous male or female child (13\\/32 vs. 6\\/25, p=0.2). When patients with abnormal results were excluded, or when women with only one previous child were considered, there was still no difference in these rates. A previous male birth may be associated with an increased risk of secondary RM but numbers preclude concluding whether this increases recurrence risk. The suggested association with previous male birth provides a basis for further investigations at a molecular level.

  19. Suicidality and Intersectionality among Students Identifying as Nonheterosexual and with a Disability

    Science.gov (United States)

    King, Matthew T.; Merrin, Gabriel J.; Espelage, Dorothy L.; Grant, Nickholas J.; Bub, Kristen L.

    2018-01-01

    Research about students with disabilities and students identifying as LGBQ (lesbian, gay, bisexual, or questioning) reveals that both populations report more suicidality and peer victimization and less school connectedness than do their peers. No study has previously examined the intersection of these identities with regard to peer victimization,…

  20. Identifying Multiple Levels of Discussion-Based Teaching Strategies for Constructing Scientific Models

    Science.gov (United States)

    Williams, Grant; Clement, John

    2015-01-01

    This study sought to identify specific types of discussion-based strategies that two successful high school physics teachers using a model-based approach utilized in attempting to foster students' construction of explanatory models for scientific concepts. We found evidence that, in addition to previously documented dialogical strategies that…

  1. Identifying cognitive preferences for attractive female faces: an event-related potential experiment using a study-test paradigm.

    Science.gov (United States)

    Zhang, Yan; Kong, Fanchang; Chen, Hong; Jackson, Todd; Han, Li; Meng, Jing; Yang, Zhou; Gao, Jianguo; Najam ul Hasan, Abbasi

    2011-11-01

    In this experiment, sensitivity to female facial attractiveness was examined by comparing event-related potentials (ERPs) in response to attractive and unattractive female faces within a study-test paradigm. Fourteen heterosexual participants (age range 18-24 years, mean age 21.67 years) were required to judge 84 attractive and 84 unattractive face images as either "attractive" or "unattractive." They were then asked whether they had previously viewed each face in a recognition task in which 50% of the images were novel. Analyses indicated that attractive faces elicited more enhanced ERP amplitudes than did unattractive faces in judgment (N300 and P350-550 msec) and recognition (P160 and N250-400 msec and P400-700 msec) tasks on anterior locations. Moreover, longer reaction times and higher accuracy rate were observed in identifying attractive faces than unattractive faces. In sum, this research identified neural and behavioral bases related to cognitive preferences for judging and recognizing attractive female faces. Explanations for the results are that attractive female faces arouse more intense positive emotions in participants than do unattractive faces, and they also represent reproductive fitness and mating value from the evolutionary perspective. Copyright © 2011 Wiley-Liss, Inc.

  2. Retrospective analysis on malignant calcification previously misdiagnosed as benign on screening mammography

    International Nuclear Information System (INIS)

    Ha, Su Min; Cha, Joo Hee; Kim, Hak Hee; Shin, Hee Jung; Chae, Eun Young; Choi, Woo Jung

    2017-01-01

    The purpose of our study was to investigate the morphology and distribution of calcifications initially interpreted as benign or probably benign, but proven to be malignant by subsequent stereotactic biopsy, and to identify the reason for misinterpretation or underestimation at the initial diagnosis. Out of 567 women who underwent stereotactic biopsy for calcifications at our hospital between January 2012 and December 2014, 167 women were diagnosed with malignancy. Forty-six of these 167 women had previous mammography assessed as benign or probably benign which was changed to suspicious malignancy on follow-up mammography. Of these 46 women, three women with biopsy-proven benign calcifications at the site of subsequent cancer were excluded, and 43 patients were finally included. The calcifications (morphology, distribution, extent, associated findings) in the previous and follow-up mammography examinations were analyzed according to the Breast Imaging Reporting and Data System (BI-RADS) lexicon and assessment category. We classified the patients into two groups: 1) group A patients who were still retrospectively re-categorized as less than or equal to BI-RADS 3 and 2) group B patients who were re-categorized as equal to or higher than BI-RADS 4a and whose results should have prompted previous diagnostic assessment. In the follow-up mammography examinations, change in calcification morphology (n = 27, 63%) was the most frequent cause of assessment change. The most frequent previous mammographic findings of malignant calcification were amorphous morphology (n = 26, 60%) and grouped distribution (n = 36, 84%). The most frequent calcification findings at reassessment were amorphous morphology (n = 4, 9%), fine pleomorphic calcification (n = 30, 70%), grouped distribution (n = 23, 53%), and segmental calcification (n = 12, 28%). There were 33 (77%) patients in group A, and 10 patients (23%) in group B. Amorphous morphology and grouped distribution were the most frequent

  3. Retrospective analysis on malignant calcification previously misdiagnosed as benign on screening mammography

    Energy Technology Data Exchange (ETDEWEB)

    Ha, Su Min [Dept. of Radiology, Research Institute of Radiology, Chung Ang University Hospital, Seoul(Korea, Republic of); Cha, Joo Hee; Kim, Hak Hee; Shin, Hee Jung; Chae, Eun Young; Choi, Woo Jung [Dept. of Radiology, Research Institute of Radiology, Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea, Republic of)

    2017-04-15

    The purpose of our study was to investigate the morphology and distribution of calcifications initially interpreted as benign or probably benign, but proven to be malignant by subsequent stereotactic biopsy, and to identify the reason for misinterpretation or underestimation at the initial diagnosis. Out of 567 women who underwent stereotactic biopsy for calcifications at our hospital between January 2012 and December 2014, 167 women were diagnosed with malignancy. Forty-six of these 167 women had previous mammography assessed as benign or probably benign which was changed to suspicious malignancy on follow-up mammography. Of these 46 women, three women with biopsy-proven benign calcifications at the site of subsequent cancer were excluded, and 43 patients were finally included. The calcifications (morphology, distribution, extent, associated findings) in the previous and follow-up mammography examinations were analyzed according to the Breast Imaging Reporting and Data System (BI-RADS) lexicon and assessment category. We classified the patients into two groups: 1) group A patients who were still retrospectively re-categorized as less than or equal to BI-RADS 3 and 2) group B patients who were re-categorized as equal to or higher than BI-RADS 4a and whose results should have prompted previous diagnostic assessment. In the follow-up mammography examinations, change in calcification morphology (n = 27, 63%) was the most frequent cause of assessment change. The most frequent previous mammographic findings of malignant calcification were amorphous morphology (n = 26, 60%) and grouped distribution (n = 36, 84%). The most frequent calcification findings at reassessment were amorphous morphology (n = 4, 9%), fine pleomorphic calcification (n = 30, 70%), grouped distribution (n = 23, 53%), and segmental calcification (n = 12, 28%). There were 33 (77%) patients in group A, and 10 patients (23%) in group B. Amorphous morphology and grouped distribution were the most frequent

  4. A longitudinal study of plasma insulin and glucagon in women with previous gestational diabetes

    DEFF Research Database (Denmark)

    Damm, P; Kühl, C; Hornnes, P

    1995-01-01

    OBJECTIVE: To investigate whether plasma insulin or glucagon predicts later development of diabetes in women with gestational diabetes mellitus (GDM). RESEARCH DESIGN AND METHODS: The subjects studied were 91 women with diet-treated GDM and 33 healthy women. Plasma insulin and glucagon during a 50...... at follow-up (2 had insulin-dependent diabetes mellitus, 13 had non-insulin-dependent diabetes mellitus, and 12 had impaired glucose tolerance). Compared with the control subjects, women with previous GDM had relatively impaired insulin secretion (decreased insulinogenic index and delayed peak insulin...... for subsequent development of overt diabetes (logistic regression analysis). CONCLUSIONS: Women who develop GDM have a relative insulin secretion deficiency, the severity of which is predictive for later development of diabetes. Furthermore, our data indicate that their relatively reduced beta-cell function may...

  5. Females use self-referent cues to avoid mating with previous mates.

    Science.gov (United States)

    Ivy, Tracie M; Weddle, Carie B; Sakaluk, Scott K

    2005-12-07

    Females of many species mate repeatedly throughout their lives, often with many different males (polyandry). Females can secure genetic benefits by maximizing their diversity of mating partners, and might be expected, therefore, to forego matings with previous partners in favour of novel males. Indeed, a female preference for novel mating partners has been shown in several taxa, but the mechanism by which females distinguish between novel males and previous mates remains unknown. We show that female crickets (Gryllodes sigillatus) mark males with their own unique chemical signatures during mating, enabling females to recognize prior mates in subsequent encounters and to avoid remating with them. Because self-referent chemosensory cues provide females with a simple, but reliable mechanism of identifying individuals with whom they have mated without requiring any special cognitive ability, they may be a widespread means by which females across a broad range of animal mating systems maximize the genetic benefits of polyandry.

  6. Integration of genome-wide association studies with biological knowledge identifies six novel genes related to kidney function.

    Science.gov (United States)

    Chasman, Daniel I; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C; O'Seaghdha, Conall M; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V; O'Connell, Jeffrey R; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D; Gierman, Hinco J; Feitosa, Mary F; Hwang, Shih-Jen; Atkinson, Elizabeth J; Lohman, Kurt; Cornelis, Marilyn C; Johansson, Asa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B; Launer, Lenore J; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A; de Andrade, Mariza; Turner, Stephen T; Ding, Jingzhong; Andrews, Jeanette S; Freedman, Barry I; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H; Wright, Alan F; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G; Rivadeneira, Fernando; Aulchenko, Yurii S; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K; Portas, Laura; Ford, Ian; Buckley, Brendan M; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J Wouter; Probst-Hensch, Nicole M; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S; van Duijn, Cornelia M; Borecki, Ingrid B; Kardia, Sharon L R; Liu, Yongmei; Curhan, Gary C; Rudan, Igor; Gyllensten, Ulf; Wilson, James F; Franke, Andre; Pramstaller, Peter P; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M; Kao, W H Linda; Fox, Caroline S; Köttgen, Anna

    2012-12-15

    In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10(-9)) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10(-4)-2.2 × 10(-7). Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general.

  7. Structural Identifiability of Dynamic Systems Biology Models.

    Science.gov (United States)

    Villaverde, Alejandro F; Barreiro, Antonio; Papachristodoulou, Antonis

    2016-10-01

    A powerful way of gaining insight into biological systems is by creating a nonlinear differential equation model, which usually contains many unknown parameters. Such a model is called structurally identifiable if it is possible to determine the values of its parameters from measurements of the model outputs. Structural identifiability is a prerequisite for parameter estimation, and should be assessed before exploiting a model. However, this analysis is seldom performed due to the high computational cost involved in the necessary symbolic calculations, which quickly becomes prohibitive as the problem size increases. In this paper we show how to analyse the structural identifiability of a very general class of nonlinear models by extending methods originally developed for studying observability. We present results about models whose identifiability had not been previously determined, report unidentifiabilities that had not been found before, and show how to modify those unidentifiable models to make them identifiable. This method helps prevent problems caused by lack of identifiability analysis, which can compromise the success of tasks such as experiment design, parameter estimation, and model-based optimization. The procedure is called STRIKE-GOLDD (STRuctural Identifiability taKen as Extended-Generalized Observability with Lie Derivatives and Decomposition), and it is implemented in a MATLAB toolbox which is available as open source software. The broad applicability of this approach facilitates the analysis of the increasingly complex models used in systems biology and other areas.

  8. Previously Unidentified Single Nucleotide Polymorphisms in HIV/AIDS Cases Associate with Clinical Parameters and Disease Progression

    Directory of Open Access Journals (Sweden)

    Vladimir V. Anokhin

    2016-01-01

    Full Text Available The genetic background of an individual plays an important role in the progression of HIV infection to AIDS. Identifying previously unknown or uncharacterized single nucleotide polymorphisms (SNPs that associate with disease progression may reveal important therapeutic targets and provide a greater understanding of disease pathogenesis. In the present study, we employed ultra-high multiplex PCR on an Ion Torrent next-generation sequencing platform to sequence 23 innate immune genes from 94 individuals with HIV/AIDS. This data was used to identify potential associations of SNPs with clinical parameters and disease progression. SNPs that associated with an increased viral load were identified in the genes for the interleukin 15 receptor (IL15RA, toll-like receptor 7 (TLR7, tripartite motif-containing protein 5 (TRIM5, and two killer-cell immunoglobulin-like receptors (KIR2DL1 and KIR2DL3. Additionally, SNPs that associated with progression from HIV infection to AIDS were identified in two 2′-5′-oligoadenylate synthetase genes (OAS2 and OAS3. In contrast, other SNPs identified in OAS2 and OAS3 genes, as well as in the TRIM5 and KIR2DS4 genes, were associated with a slower progression of disease. Taken together, our data demonstrates the utility of ultra-high multiplex PCR in identifying polymorphisms of potential clinical significance and further,identifies SNPs that may play a role in HIV pathogenesis.

  9. Ifosfamide in previously untreated disseminated neuroblastoma. Results of Study 3A of the European Neuroblastoma Study Group.

    Science.gov (United States)

    Kellie, S J; De Kraker, J; Lilleyman, J S; Bowman, A; Pritchard, J

    1988-05-01

    A prospective study of the effectiveness of ifosfamide as a single agent in the management of previously untreated patients with Evans stage IV neuroblastoma was undertaken. Eighteen children aged more than 1 year were treated with ifosfamide (IFX) 3 g/m2 daily for 2 days immediately after diagnosis and 3 weeks later. Treatment was continued with combination chemotherapy using vincristine, cyclophosphamide, cisplatinum and etoposide (OPEC) or a variant. Mesna (2-mercaptoethane sulphonate) was given to all patients during IFX treatment to prevent urotoxicity. Eight of the 18 patients (44%) responded to IFX. Nine had greater than 66% reduction in baseline tumor volume. Of 15 evaluable patients with raised pre-treatment urinary catecholamine excretion, six (40%) achieved greater than 50% reduction in pretreatment levels. Two of 10 patients evaluable for bone marrow response had complete clearance. Toxicity was mild in all patients. Upon completing 'first line' therapy, only four patients (22%) achieved a good partial remission (GPR) or complete response (CR). Median survival was 11 months. There was a lower rate of attaining GPR and shortened median survival in patients receiving phase II IFX before OPEC or variant, compared to patients with similar pre-treatment characteristics treated with OPEC from diagnosis in an earlier study.

  10. Energy dispersive X-ray diffraction as a means to identify illicit materials: A preliminary optimisation study

    Energy Technology Data Exchange (ETDEWEB)

    Cook, Emily [Department of Medical Physics and Bioengineering, UCL, London WC1E 6BT (United Kingdom)]. E-mail: ecook@medphys.ucl.ac.uk; Fong, Ruby [Clinical Physics Department, St Bartholomew' s Hospital, London EC1A 7BE (United Kingdom); Horrocks, Julie [Clinical Physics Department, St Bartholomew' s Hospital, London EC1A 7BE (United Kingdom); Wilkinson, David [HOSDB, Woodcock Hill, Sandridge, Herts. AL4 9HQ (United Kingdom); Speller, Robert [Department of Medical Physics and Bioengineering, UCL, London WC1E 6BT (United Kingdom)

    2007-08-15

    Energy dispersive X-ray diffraction is proposed as a suitable non-destructive method to rapidly identify illicit drugs in parcels. A preliminary data set of 7 illicit drug samples and a possible cutting agent has been collected with a range of count times using a tungsten target X-ray source, a high resolution HpGe detector and a variable geometry diffraction cell. These results have been used to calibrate and train multivariate analysis software to predict the drug content in previously unseen spectra.

  11. Energy dispersive X-ray diffraction as a means to identify illicit materials: A preliminary optimisation study

    International Nuclear Information System (INIS)

    Cook, Emily; Fong, Ruby; Horrocks, Julie; Wilkinson, David; Speller, Robert

    2007-01-01

    Energy dispersive X-ray diffraction is proposed as a suitable non-destructive method to rapidly identify illicit drugs in parcels. A preliminary data set of 7 illicit drug samples and a possible cutting agent has been collected with a range of count times using a tungsten target X-ray source, a high resolution HpGe detector and a variable geometry diffraction cell. These results have been used to calibrate and train multivariate analysis software to predict the drug content in previously unseen spectra

  12. New population-based exome data are questioning the pathogenicity of previously cardiomyopathy-associated genetic variants

    DEFF Research Database (Denmark)

    Andreasen, Charlotte Hartig; Nielsen, Jonas B; Refsgaard, Lena

    2013-01-01

    Cardiomyopathies are a heterogeneous group of diseases with various etiologies. We focused on three genetically determined cardiomyopathies: hypertrophic (HCM), dilated (DCM), and arrhythmogenic right ventricular cardiomyopathy (ARVC). Eighty-four genes have so far been associated with these card......Cardiomyopathies are a heterogeneous group of diseases with various etiologies. We focused on three genetically determined cardiomyopathies: hypertrophic (HCM), dilated (DCM), and arrhythmogenic right ventricular cardiomyopathy (ARVC). Eighty-four genes have so far been associated...... with these cardiomyopathies, but the disease-causing effect of reported variants is often dubious. In order to identify possible false-positive variants, we investigated the prevalence of previously reported cardiomyopathy-associated variants in recently published exome data. We searched for reported missense and nonsense...... variants in the NHLBI-Go Exome Sequencing Project (ESP) containing exome data from 6500 individuals. In ESP, we identified 94 variants out of 687 (14%) variants previously associated with HCM, 58 out of 337 (17%) variants associated with DCM, and 38 variants out of 209 (18%) associated with ARVC...

  13. Youth suicide: an insight into previous hospitalisation for injury and sociodemographic conditions from a nationwide cohort study.

    Science.gov (United States)

    Zambon, Francesco; Laflamme, Lucie; Spolaore, Paolo; Visentin, Cristiana; Hasselberg, Marie

    2011-06-01

    This study investigates the degree to which a previous hospitalisation for injury of any intent is a risk of subsequent youth suicide and whether this association is influenced by family socioeconomic status or economic stress. A nationwide register-based cohort study was conducted covering all Swedish subjects born between January 1977 and December 1991 (N=1,616,342, male/female ratio=1.05). The cohort subjects were followed-up from January 1998 to December 2003, when aged 7-26 years. Poisson regression and the likelihood ratio test (95% CI) were used to assess the age-adjusted effect of hospitalisation for injuries of various intent on youth suicide and its effect once adjusted for family sociodemographic and social circumstances. Each set of exposures was associated independently and significantly with suicide mortality. Being hospitalised for self-inflicted injuries or injuries of undetermined intent was associated with a risk of suicide 36 to 47 times, respectively, that of subjects never hospitalised in the period under study (95% CI 28.36 to 45.58 and 26.67 to 83.87 for self-inflicted injuries and for events of undetermined intent, respectively; overall psuicide (RR 3.08; 95% CI 2.26 to 4.19). These effects were solid and not substantially altered after adjustment for family demographic and socioeconomic circumstances. A strong association exists between previous hospitalisation for injury of any intent and youth suicide. The association is robust and unaltered by family socioeconomic circumstances.

  14. Fine-scale mapping of 8q24 locus identifies multiple independent risk variants for breast cancer

    NARCIS (Netherlands)

    J. Shi (Jiajun); Zhang, Y. (Yanfeng); W. Zheng (Wei); K. Michailidou (Kyriaki); M. Ghoussaini (Maya); M.K. Bolla (Manjeet K.); Wang, Q. (Qin); J. Dennis (Joe); Lush, M. (Michael); R.L. Milne (Roger); X.-O. Shu (Xiao-Ou); J. Beesley (Jonathan); S. Kar (Siddhartha); I.L. Andrulis (Irene); H. Anton-Culver (Hoda); Arndt, V. (Volker); M.W. Beckmann (Matthias); Z. Zhao (Zhiguo); Guo, X. (Xingyi); J. Benítez (Javier); A. Beeghly-Fadiel (Alicia); W.J. Blot (William); N.V. Bogdanova (Natalia); S.E. Bojesen (Stig); H. Brauch (Hiltrud); H. Brenner (Hermann); L.A. Brinton (Louise); A. Broeks (Annegien); T. Brüning (Thomas); B. Burwinkel (Barbara); H. Cai (Hui); S. Canisius (Sander); J. Chang-Claude (Jenny); Choi, J.-Y. (Ji-Yeob); F.J. Couch (Fergus); A. Cox (Angela); S.S. Cross (Simon); K. Czene (Kamila); H. Darabi (Hatef); P. Devilee (Peter); A. Droit (Arnaud); T. Dörk (Thilo); P.A. Fasching (Peter); O. Fletcher (Olivia); H. Flyger (Henrik); F. Fostira (Florentia); Gaborieau, V. (Valerie); M. García-Closas (Montserrat); G.G. Giles (Graham); Grip, M. (Mervi); P. Guénel (Pascal); C.A. Haiman (Christopher A.); U. Hamann (Ute); J.M. Hartman (Joost); X. Miao; A. Hollestelle (Antoinette); J.L. Hopper (John); Hsiung, C.-N. (Chia-Ni); H. Ito (Hidemi); A. Jakubowska (Anna); Johnson, N. (Nichola); D. Torres (Diana); M. Kabisch (Maria); D. Kang (Daehee); S. Khan (Sofia); J.A. Knight (Julia); V-M. Kosma (Veli-Matti); Lambrechts, D. (Diether); J. Li (Jingmei); A. Lindblom (Annika); A. Lophatananon (Artitaya); J. Lubinski (Jan); A. Mannermaa (Arto); S. Manoukian (Siranoush); L. Le Marchand (Loic); S. Margolin (Sara); Marme, F. (Frederik); K. Matsuo (Keitaro); C.A. McLean (Catriona Ann); A. Meindl (Alfons); K.R. Muir (K.); S.L. Neuhausen (Susan); H. Nevanlinna (Heli); S. Nord (Silje); A.-L. Borresen-Dale (Anne-Lise); J.E. Olson (Janet); N. Orr (Nick); A.M.W. van den Ouweland (Ans); P. Peterlongo (Paolo); T.C. Putti (Thomas Choudary); Rudolph, A. (Anja); Sangrajrang, S. (Suleeporn); E.J. Sawyer (Elinor); M.K. Schmidt (Marjanka); R.K. Schmutzler (Rita); C.-Y. Shen (Chen-Yang); M.-F. Hou (Ming-Feng); M. Shrubsole (Martha); M.C. Southey (Melissa); A.J. Swerdlow (Anthony ); Hwang Teo, S. (Soo); B. Thienpont (Bernard); A.E. Toland (Amanda); R.A.E.M. Tollenaar (Rob); I.P. Tomlinson (Ian); T. Truong (Thérèse); C.-C. Tseng (Chiu-Chen); W. Wen (Wanqing); R. Winqvist (Robert); A.H. Wu (Anna); C. Har Yip (Cheng); P.M. Zamora (Pilar M.); Zheng, Y. (Ying); O.A.M. Floris; Cheng, C.-Y. (Ching-Yu); M.J. Hooning (Maartje); J.W.M. Martens (John); C.M. Seynaeve (Caroline); V. Kristensen (Vessela); P. Hall (Per); P.D.P. Pharoah (Paul); J. Simard (Jacques); G. Chenevix-Trench (Georgia); A.M. Dunning (Alison); A.C. Antoniou (Antonis C.); D.F. Easton (Douglas F.); Q. Cai (Qiuyin); J. Long (Jirong)

    2016-01-01

    textabstractPrevious genome-wide association studies among women of European ancestry identified two independent breast cancer susceptibility loci represented by single nucleotide polymorphisms (SNPs) rs13281615 and rs11780156 at 8q24. A fine-mapping study across 2.06 Mb

  15. Outcome of trial of scar in patients with previous caesarean section

    International Nuclear Information System (INIS)

    Khan, B.; Bashir, R.; Khan, W.

    2016-01-01

    Medical evidence indicates that 60-80% of women can achieve vaginal delivery after a previous lower segment caesarean section. Proper selection of patients for trial of scar and vigilant monitoring during labour will achieve successful maternal and perinatal outcome. The objective of our study is to establish the fact that vaginal delivery after one caesarean section has a high success rate in patients with previous one caesarean section for non-recurrent cause. Methods: The study was conducted in Ayub Teaching Abbottabad, Gynae-B Unit. All labouring patients, during the study period of five years, with previous one caesarean section and between 37 weeks to 41 weeks of gestation for a non-recurrent cause were included in the study. Data was recorded on special proforma designed for the purpose. Patients who had previous classical caesarean section, more than one caesarean section, and previous caesarean section with severe wound infection, transverse lie and placenta previa in present pregnancy were excluded. Foetal macrosomia (wt>4 kg) and severe IUGR with compromised blood flow on Doppler in present pregnancy were also not considered suitable for the study. Patients who had any absolute contraindication for vaginal delivery were also excluded. Results: There were 12505 deliveries during the study period. Total vaginal deliveries were 8790 and total caesarean sections were 3715. Caesarean section rate was 29.7%. Out of these 8790 patients, 764 patients were given a trial of scar and 535 patients delivered successfully vaginally (70%). Women who presented with spontaneous onset of labour were more likely to deliver vaginally (74.8%) as compared to induction group (27.1%). Conclusion: Trial of vaginal birth after caesarean (VBAC) in selected cases has great importance in the present era of the rising rate of primary caesarean section. (author)

  16. Genome-wide association study identifies a novel canine glaucoma locus.

    Directory of Open Access Journals (Sweden)

    Saija J Ahonen

    Full Text Available Glaucoma is an optic neuropathy and one of the leading causes of blindness. Its hereditary forms are classified into primary closed-angle (PCAG, primary open-angle (POAG and primary congenital glaucoma (PCG. Although many loci have been mapped in human, only a few genes have been identified that are associated with the development of glaucoma and the genetic basis of the disease remains poorly understood. Glaucoma has also been described in many dog breeds, including Dandie Dinmont Terriers (DDT in which it is a late-onset (>7 years disease. We designed clinical and genetic studies to better define the clinical features of glaucoma in the DDT and to identify the genetic cause. Clinical diagnosis was based on ophthalmic examinations of the affected dogs and 18 additionally investigated unaffected DDTs. We collected DNA from over 400 DTTs and a genome wide association study was performed in a cohort of 23 affected and 23 controls, followed by a fine mapping, a replication study and candidate gene sequencing. The clinical study suggested that ocular abnormalities including abnormal iridocorneal angles and pectinate ligament dysplasia are common (50% and 72%, respectively in the breed and the disease resembles human PCAG. The genetic study identified a novel 9.5 Mb locus on canine chromosome 8 including the 1.6 Mb best associated region (p = 1.63 × 10(-10, OR = 32 for homozygosity. Mutation screening in five candidate genes did not reveal any causative variants. This study indicates that although ocular abnormalities are common in DDTs, the genetic risk for glaucoma is conferred by a novel locus on CFA8. The canine locus shares synteny to a region in human chromosome 14q, which harbors several loci associated with POAG and PCG. Our study reveals a new locus for canine glaucoma and ongoing molecular studies will likely help to understand the genetic etiology of the disease.

  17. Enhanced intensity dependence and aggression history indicate previous regular ecstasy use in abstinent polydrug users.

    Science.gov (United States)

    Wan, Li; Baldridge, Robyn M; Colby, Amanda M; Stanford, Matthew S

    2009-11-13

    Intensity dependence is an electrophysiological measure of intra-individual stability of the augmenting/reducing characteristic of N1/ P2 event-related potential amplitudes in response to stimuli of varying intensities. Abstinent ecstasy users typically show enhanced intensity dependence and higher levels of impulsivity and aggression. Enhanced intensity dependence and high impulsivity and aggression levels may be due to damage in the brain's serotonergic neurons as a result of ecstasy use. The present study investigated whether intensity dependence, impulsivity and aggression history can be used as indicators of previous chronic ecstasy usage. Forty-four abstinent polydrug users (8 women; age 19 to 61 years old) were recruited. All participants were currently residents at a local substance abuse facility receiving treatment and had been free of all drugs for a minimum of 21 days. The study found significantly enhanced intensity dependence of tangential dipole source activity and a history of more aggressive behavior in those who had previously been involved in chronic ecstasy use. Intensity dependence of the tangential dipole source and aggressive behavior history correctly identified 73.3% of those who had been regular ecstasy users and 78.3% of those who had not. Overall, 76.3% of the participants were correctly classified.

  18. Analyses of more than 60,000 exomes questions the role of numerous genes previously associated with dilated cardiomyopathy

    DEFF Research Database (Denmark)

    Nouhravesh, Nina; Ahlberg, Gustav; Ghouse, Jonas

    2016-01-01

    BACKGROUND: Hundreds of genetic variants have been described as disease causing in dilated cardiomyopathy (DCM). Some of these associations are now being questioned. We aimed to identify the prevalence of previously DCM associated variants in the Exome Aggregation Consortium (ExAC), in order...... to identify potentially false-positive DCM variants. METHODS: Variants listed as DCM disease-causing variants in the Human Gene Mutation Database were extracted from ExAC. Pathogenicity predictions for these variants were mined from dbNSFP v 2.9 database. RESULTS: Of the 473 DCM variants listed in HGMD, 148...... (31%) were found in ExAC. The expected number of individuals with DCM in ExAC is 25 based on the prevalence in the general population. Yet, 35 variants were found in more than 25 individuals. In 13 genes, we identified all variants previously associated with DCM; four genes contained variants above...

  19. The Relationship of Lumbar Multifidus Muscle Morphology to Previous, Current, and Future Low Back Pain

    DEFF Research Database (Denmark)

    Hebert, Jeffrey J; Kjær, Per; Fritz, Julie M

    2014-01-01

    of LBP after five and nine years.Summary of Background Data. Although low back pain (LBP) is a major source of disease burden, the biologic determinants of LBP are poorly understood.Methods. Participants were 40-year-old adults randomly sampled from a Danish population and followed-up at ages 45 and 49....... At each time point, participants underwent magnetic resonance imaging and reported ever having had LBP, LBP in the previous year, non-trivial LBP in the previous year, or a history of pain radiating into the legs. Pixel intensity and frequencies from T1-weighted magnetic resonance images identified...

  20. HIV risk-taking behaviour among injecting drug users currently, previously and never enrolled in methadone treatment.

    Science.gov (United States)

    Baker, A; Kochan, N; Dixon, J; Wodak, A; Heather, N

    1995-04-01

    This study compares the injecting and sexual risk-taking behaviour among injecting drug users (IDUs) currently, previously and never enrolled in methadone maintenance treatment (MMT). All subjects had injected during the 6 months prior to the day of interview. The current MMT group showed significantly lower injecting risk-taking behaviour subscale scores on the HIV Risk-taking Behaviour Scale (HRBS) of the Opiate Treatment Index than the previous MMT and non-MMT groups together. The current MMT group differed from the other two groups in the frequency of injecting and cleaning of injection equipment with bleach. There was no difference between the current MMT group and the other two groups combined in sexual risk-taking behaviour scores on the HRBS. There were no differences between the previous MMT and non-MMT groups in injecting and sexual risk-taking behaviour. HIV seroprevalence was low and there was no difference in seroprevalence between groups. Thus, IDUs currently enrolled in MMT are at reduced risk for HIV infection when compared with IDUs who have previously or never been enrolled in MMT. However, the absence of a difference between the current MMT and other two groups in frequency of sharing behaviours suggests the need for additional strategies among MMT clients to reduce needle-sharing. Possible strategies include the application of relapse prevention interventions and the availability of sterile injecting equipment in MMT clinics. Further research is needed to identify factors which increase attraction and retention of IDUs to MMT.

  1. Genome-wide association study identifies five new schizophrenia loci.

    LENUS (Irish Health Repository)

    Ripke, Stephan

    2011-10-01

    We examined the role of common genetic variation in schizophrenia in a genome-wide association study of substantial size: a stage 1 discovery sample of 21,856 individuals of European ancestry and a stage 2 replication sample of 29,839 independent subjects. The combined stage 1 and 2 analysis yielded genome-wide significant associations with schizophrenia for seven loci, five of which are new (1p21.3, 2q32.3, 8p23.2, 8q21.3 and 10q24.32-q24.33) and two of which have been previously implicated (6p21.32-p22.1 and 18q21.2). The strongest new finding (P = 1.6 × 10(-11)) was with rs1625579 within an intron of a putative primary transcript for MIR137 (microRNA 137), a known regulator of neuronal development. Four other schizophrenia loci achieving genome-wide significance contain predicted targets of MIR137, suggesting MIR137-mediated dysregulation as a previously unknown etiologic mechanism in schizophrenia. In a joint analysis with a bipolar disorder sample (16,374 affected individuals and 14,044 controls), three loci reached genome-wide significance: CACNA1C (rs4765905, P = 7.0 × 10(-9)), ANK3 (rs10994359, P = 2.5 × 10(-8)) and the ITIH3-ITIH4 region (rs2239547, P = 7.8 × 10(-9)).

  2. Fear and anxiety previous to dental treatment in children from Acaraú-CE

    Directory of Open Access Journals (Sweden)

    Karyne Barreto Gonçalves Marques

    2010-12-01

    Full Text Available Objective: To identify the main causing factors of fear and anxiety of children previously to dental treatment. Methods: A descriptive and qualitative study held in the municipal district of Acaraú - CE with 10 children aged 4 to 6 years old, who did not present strong pain between August and September, 2006. At first, we applied the modified VPT (Venham Picture Test, an instrument containing a set of figures of children in different emotional states, which were presented to each child so that he pointed to what he considered to be further identified at the time. The second test, held before the consultation, consisted in asking to the children to free-hand draw the dental office, the dentist and auxiliary personnel asking to each child: what do you think about the dental office and the dentist? The drawings were submitted to idiographic analysis and categorized in units of significance for interpretation. Results: Three children on VPT and nine children on the drawings presented an increased level of anxiety. Causing factors such as the motor (high speed rotation, tooth extraction and white clothes could be found. Final considerations: By means of drawing we were able to efficiently obtain results in identifying some factors that cause fear and anxiety to the child patient. The modified VPT showed to be quick, easy to apply and acceptable to children, but sometimes was contradictory with the drawings.

  3. Everolimus for Previously Treated Advanced Gastric Cancer: Results of the Randomized, Double-Blind, Phase III GRANITE-1 Study

    Science.gov (United States)

    Ohtsu, Atsushi; Ajani, Jaffer A.; Bai, Yu-Xian; Bang, Yung-Jue; Chung, Hyun-Cheol; Pan, Hong-Ming; Sahmoud, Tarek; Shen, Lin; Yeh, Kun-Huei; Chin, Keisho; Muro, Kei; Kim, Yeul Hong; Ferry, David; Tebbutt, Niall C.; Al-Batran, Salah-Eddin; Smith, Heind; Costantini, Chiara; Rizvi, Syed; Lebwohl, David; Van Cutsem, Eric

    2013-01-01

    Purpose The oral mammalian target of rapamycin inhibitor everolimus demonstrated promising efficacy in a phase II study of pretreated advanced gastric cancer. This international, double-blind, phase III study compared everolimus efficacy and safety with that of best supportive care (BSC) in previously treated advanced gastric cancer. Patients and Methods Patients with advanced gastric cancer that progressed after one or two lines of systemic chemotherapy were randomly assigned to everolimus 10 mg/d (assignment schedule: 2:1) or matching placebo, both given with BSC. Randomization was stratified by previous chemotherapy lines (one v two) and region (Asia v rest of the world [ROW]). Treatment continued until disease progression or intolerable toxicity. Primary end point was overall survival (OS). Secondary end points included progression-free survival (PFS), overall response rate, and safety. Results Six hundred fifty-six patients (median age, 62.0 years; 73.6% male) were enrolled. Median OS was 5.4 months with everolimus and 4.3 months with placebo (hazard ratio, 0.90; 95% CI, 0.75 to 1.08; P = .124). Median PFS was 1.7 months and 1.4 months in the everolimus and placebo arms, respectively (hazard ratio, 0.66; 95% CI, 0.56 to 0.78). Common grade 3/4 adverse events included anemia, decreased appetite, and fatigue. The safety profile was similar in patients enrolled in Asia versus ROW. Conclusion Compared with BSC, everolimus did not significantly improve overall survival for advanced gastric cancer that progressed after one or two lines of previous systemic chemotherapy. The safety profile observed for everolimus was consistent with that observed for everolimus in other cancers. PMID:24043745

  4. 77 FR 14316 - Airworthiness Directives; Piper Aircraft, Inc. (Type Certificate Previously Held by The New Piper...

    Science.gov (United States)

    2012-03-09

    ...-0251; Directorate Identifier 2012-CE-002-AD] RIN 2120-AA64 Airworthiness Directives; Piper Aircraft, Inc. (Type Certificate Previously Held by The New Piper Aircraft Inc.) Airplanes AGENCY: Federal... supersede an existing airworthiness directive (AD) that applies to certain Piper Aircraft, Inc. (type...

  5. Response to health insurance by previously uninsured rural children.

    Science.gov (United States)

    Tilford, J M; Robbins, J M; Shema, S J; Farmer, F L

    1999-08-01

    To examine the healthcare utilization and costs of previously uninsured rural children. Four years of claims data from a school-based health insurance program located in the Mississippi Delta. All children who were not Medicaid-eligible or were uninsured, were eligible for limited benefits under the program. The 1987 National Medical Expenditure Survey (NMES) was used to compare utilization of services. The study represents a natural experiment in the provision of insurance benefits to a previously uninsured population. Premiums for the claims cost were set with little or no information on expected use of services. Claims from the insurer were used to form a panel data set. Mixed model logistic and linear regressions were estimated to determine the response to insurance for several categories of health services. The use of services increased over time and approached the level of utilization in the NMES. Conditional medical expenditures also increased over time. Actuarial estimates of claims cost greatly exceeded actual claims cost. The provision of a limited medical, dental, and optical benefit package cost approximately $20-$24 per member per month in claims paid. An important uncertainty in providing health insurance to previously uninsured populations is whether a pent-up demand exists for health services. Evidence of a pent-up demand for medical services was not supported in this study of rural school-age children. States considering partnerships with private insurers to implement the State Children's Health Insurance Program could lower premium costs by assembling basic data on previously uninsured children.

  6. Low-dose computed tomography image restoration using previous normal-dose scan

    International Nuclear Information System (INIS)

    Ma, Jianhua; Huang, Jing; Feng, Qianjin; Zhang, Hua; Lu, Hongbing; Liang, Zhengrong; Chen, Wufan

    2011-01-01

    of the previous normal-dose scan via the presented ndiNLM algorithm is noticeable as compared to a similar approach without using the previous normal-dose scan. Conclusions: For low-dose CT image restoration, the presented ndiNLM method is robust in preserving the spatial resolution and identifying the low-contrast structure. The authors can draw the conclusion that the presented ndiNLM algorithm may be useful for some clinical applications such as in perfusion imaging, radiotherapy, tumor surveillance, etc.

  7. Study Identifies New Lymphoma Treatment Target

    Science.gov (United States)

    NCI researchers have identified new therapeutic targets for diffuse large B-cell lymphoma. Drugs that hit these targets are under clinical development and the researchers hope to begin testing them in clinical trials of patients with DLBCL.

  8. Meta-analysis of genome-wide association studies identifies 8 novel loci involved in shape variation of human head hair

    Science.gov (United States)

    Liu, Fan; Chen, Yan; Zhu, Gu; Hysi, Pirro G; Wu, Sijie; Adhikari, Kaustubh; Breslin, Krystal; Pośpiech, Ewelina; Hamer, Merel A; Peng, Fuduan; Muralidharan, Charanya; Acuna-Alonzo, Victor; Canizales-Quinteros, Samuel; Bedoya, Gabriel; Gallo, Carla; Poletti, Giovanni; Rothhammer, Francisco; Bortolini, Maria Catira; Gonzalez-Jose, Rolando; Zeng, Changqing; Xu, Shuhua; Jin, Li; Uitterlinden, André G; Ikram, M Arfan; van Duijn, Cornelia M; Nijsten, Tamar; Walsh, Susan; Branicki, Wojciech; Wang, Sijia; Ruiz-Linares, Andrés; Spector, Timothy D; Martin, Nicholas G; Medland, Sarah E; Kayser, Manfred

    2018-01-01

    Abstract Shape variation of human head hair shows striking variation within and between human populations, while its genetic basis is far from being understood. We performed a series of genome-wide association studies (GWASs) and replication studies in a total of 28 964 subjects from 9 cohorts from multiple geographic origins. A meta-analysis of three European GWASs identified 8 novel loci (1p36.23 ERRFI1/SLC45A1, 1p36.22 PEX14, 1p36.13 PADI3, 2p13.3 TGFA, 11p14.1 LGR4, 12q13.13 HOXC13, 17q21.2 KRTAP, and 20q13.33 PTK6), and confirmed 4 previously known ones (1q21.3 TCHH/TCHHL1/LCE3E, 2q35 WNT10A, 4q21.21 FRAS1, and 10p14 LINC00708/GATA3), all showing genome-wide significant association with hair shape (P < 5e-8). All except one (1p36.22 PEX14) were replicated with nominal significance in at least one of the 6 additional cohorts of European, Native American and East Asian origins. Three additional previously known genes (EDAR, OFCC1, and PRSS53) were confirmed at the nominal significance level. A multivariable regression model revealed that 14 SNPs from different genes significantly and independently contribute to hair shape variation, reaching a cross-validated AUC value of 0.66 (95% CI: 0.62–0.70) and an AUC value of 0.64 in an independent validation cohort, providing an improved accuracy compared with a previous model. Prediction outcomes of 2504 individuals from a multiethnic sample were largely consistent with general knowledge on the global distribution of hair shape variation. Our study thus delivers target genes and DNA variants for future functional studies to further evaluate the molecular basis of hair shape in humans. PMID:29220522

  9. Meta-analysis of genome-wide association studies identifies 8 novel loci involved in shape variation of human head hair.

    Science.gov (United States)

    Liu, Fan; Chen, Yan; Zhu, Gu; Hysi, Pirro G; Wu, Sijie; Adhikari, Kaustubh; Breslin, Krystal; Pospiech, Ewelina; Hamer, Merel A; Peng, Fuduan; Muralidharan, Charanya; Acuna-Alonzo, Victor; Canizales-Quinteros, Samuel; Bedoya, Gabriel; Gallo, Carla; Poletti, Giovanni; Rothhammer, Francisco; Bortolini, Maria Catira; Gonzalez-Jose, Rolando; Zeng, Changqing; Xu, Shuhua; Jin, Li; Uitterlinden, André G; Ikram, M Arfan; van Duijn, Cornelia M; Nijsten, Tamar; Walsh, Susan; Branicki, Wojciech; Wang, Sijia; Ruiz-Linares, Andrés; Spector, Timothy D; Martin, Nicholas G; Medland, Sarah E; Kayser, Manfred

    2018-02-01

    Shape variation of human head hair shows striking variation within and between human populations, while its genetic basis is far from being understood. We performed a series of genome-wide association studies (GWASs) and replication studies in a total of 28 964 subjects from 9 cohorts from multiple geographic origins. A meta-analysis of three European GWASs identified 8 novel loci (1p36.23 ERRFI1/SLC45A1, 1p36.22 PEX14, 1p36.13 PADI3, 2p13.3 TGFA, 11p14.1 LGR4, 12q13.13 HOXC13, 17q21.2 KRTAP, and 20q13.33 PTK6), and confirmed 4 previously known ones (1q21.3 TCHH/TCHHL1/LCE3E, 2q35 WNT10A, 4q21.21 FRAS1, and 10p14 LINC00708/GATA3), all showing genome-wide significant association with hair shape (P 5e-8). All except one (1p36.22 PEX14) were replicated with nominal significance in at least one of the 6 additional cohorts of European, Native American and East Asian origins. Three additional previously known genes (EDAR, OFCC1, and PRSS53) were confirmed at the nominal significance level. A multivariable regression model revealed that 14 SNPs from different genes significantly and independently contribute to hair shape variation, reaching a cross-validated AUC value of 0.66 (95% CI: 0.62-0.70) and an AUC value of 0.64 in an independent validation cohort, providing an improved accuracy compared with a previous model. Prediction outcomes of 2504 individuals from a multiethnic sample were largely consistent with general knowledge on the global distribution of hair shape variation. Our study thus delivers target genes and DNA variants for future functional studies to further evaluate the molecular basis of hair shape in humans. © The Author(s) 2017. Published by Oxford University Press.

  10. Three novel approaches to structural identifiability analysis in mixed-effects models.

    Science.gov (United States)

    Janzén, David L I; Jirstrand, Mats; Chappell, Michael J; Evans, Neil D

    2016-05-06

    Structural identifiability is a concept that considers whether the structure of a model together with a set of input-output relations uniquely determines the model parameters. In the mathematical modelling of biological systems, structural identifiability is an important concept since biological interpretations are typically made from the parameter estimates. For a system defined by ordinary differential equations, several methods have been developed to analyse whether the model is structurally identifiable or otherwise. Another well-used modelling framework, which is particularly useful when the experimental data are sparsely sampled and the population variance is of interest, is mixed-effects modelling. However, established identifiability analysis techniques for ordinary differential equations are not directly applicable to such models. In this paper, we present and apply three different methods that can be used to study structural identifiability in mixed-effects models. The first method, called the repeated measurement approach, is based on applying a set of previously established statistical theorems. The second method, called the augmented system approach, is based on augmenting the mixed-effects model to an extended state-space form. The third method, called the Laplace transform mixed-effects extension, is based on considering the moment invariants of the systems transfer function as functions of random variables. To illustrate, compare and contrast the application of the three methods, they are applied to a set of mixed-effects models. Three structural identifiability analysis methods applicable to mixed-effects models have been presented in this paper. As method development of structural identifiability techniques for mixed-effects models has been given very little attention, despite mixed-effects models being widely used, the methods presented in this paper provides a way of handling structural identifiability in mixed-effects models previously not

  11. Impact of previous virological treatment failures and adherence on the outcome of antiretroviral therapy in 2007.

    Directory of Open Access Journals (Sweden)

    Marie Ballif

    Full Text Available BACKGROUND: Combination antiretroviral treatment (cART has been very successful, especially among selected patients in clinical trials. The aim of this study was to describe outcomes of cART on the population level in a large national cohort. METHODS: Characteristics of participants of the Swiss HIV Cohort Study on stable cART at two semiannual visits in 2007 were analyzed with respect to era of treatment initiation, number of previous virologically failed regimens and self reported adherence. Starting ART in the mono/dual era before HIV-1 RNA assays became available was counted as one failed regimen. Logistic regression was used to identify risk factors for virological failure between the two consecutive visits. RESULTS: Of 4541 patients 31.2% and 68.8% had initiated therapy in the mono/dual and cART era, respectively, and been on treatment for a median of 11.7 vs. 5.7 years. At visit 1 in 2007, the mean number of previous failed regimens was 3.2 vs. 0.5 and the viral load was undetectable (4 previous failures compared to 1 were 0.9 (95% CI 0.4-1.7, 0.8 (0.4-1.6, 1.6 (0.8-3.2, 3.3 (1.7-6.6 respectively, and 2.3 (1.1-4.8 for >2 missed cART doses during the last month, compared to perfect adherence. From the cART era, odds ratios with a history of 1, 2 and >2 previous failures compared to none were 1.8 (95% CI 1.3-2.5, 2.8 (1.7-4.5 and 7.8 (4.5-13.5, respectively, and 2.8 (1.6-4.8 for >2 missed cART doses during the last month, compared to perfect adherence. CONCLUSIONS: A higher number of previous virologically failed regimens, and imperfect adherence to therapy were independent predictors of imminent virological failure.

  12. A study on the re-identifiability of Dutch citizens

    OpenAIRE

    Koot, M.R.; van 't Noordende, G.; de Laat, C.; Serjantov, A.; Troncoso, C.

    2010-01-01

    This paper analyses the re-identifiability of Dutch citizens by various demographics. Our analysis is based on registry office data of 2.7 million Dutch citizens, ~16% of the total population. We provide overall statistics on re-identifiability for a range of quasi-identifiers, and present an in-depth analysis of quasi-identifiers found in two de-identified data sets. We found that 67.0% of the sampled population is unambiguously identifiable by date of birth and four-digit postal code alone,...

  13. Second malignancies in high-dose areas of previous tumor radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Welte, Birgitta; Suhr, Peter; Bottke, Dirk; Bartkowiak, Detlef; Wiegel, Thomas [Dept. of Radiotherapy and Radiation Oncology, Univ. of Ulm (Germany); Doerr, Wolfgang [Dept. of Radiotherapy and Radiation Oncology, Radiobiology Lab., Univ. of Technology Dresden (Germany); Trott, Klaus Ruediger [UCL Cancer Centre, Univ. Coll. London (United Kingdom)

    2010-03-15

    Purpose: To characterize second tumors that developed in or near the high-dose areas of a previous radiotherapy, regarding their frequency, entities, latency, and dose dependence. Patients and Methods: 9,995/15,449 tumor patients of the Radiation Oncology Department in Ulm, Germany, treated between 1981 and 2003, survived at least 1 year after radiotherapy. By long-term follow-up and review of treatment documentation, 100 of them were identified who developed an independent second cancer in or near the irradiated first tumor site. Results: Major primary malignancies were breast cancer (27%), lymphoma (24%), and pelvic gynecologic tumors (17%). Main second tumors were carcinomas of the upper (18%) and lower (12%) gastrointestinal tract, head and neck tumors (10%), lymphoma (10%), breast cancer (9%), sarcoma (9%), and lung cancer (8%). Overall median second tumor latency was 7.4 years (1-42 years). For colorectal cancer it was 3.5 and for leukemia 4.3 years, but for sarcoma 11.7 and for breast cancer 17.1 years. The relatively frequent second tumors of the upper gastrointestinal tract were associated with median radiation doses of 24 Gy. By contrast, second colorectal cancer and sarcoma developed after median doses of 50 Gy. Conclusion: The 5- and 15-year probability to develop a histopathologically independent second tumor in or near the irradiated first tumor site, i.e., after intermediate or high radiation doses, was 0.5% and 2.2%, respectively. To identify potentially radiogenic second malignancies, a follow-up far beyond 5 years is mandatory. The incidence and potential dose-response relationship intermediate will be analyzed by a case-case and a case-control study of the Ulm data. (orig.)

  14. Plantar pressure in diabetic peripheral neuropathy patients with active foot ulceration, previous ulceration and no history of ulceration: a meta-analysis of observational studies.

    Science.gov (United States)

    Fernando, Malindu Eranga; Crowther, Robert George; Pappas, Elise; Lazzarini, Peter Anthony; Cunningham, Margaret; Sangla, Kunwarjit Singh; Buttner, Petra; Golledge, Jonathan

    2014-01-01

    Elevated dynamic plantar pressures are a consistent finding in diabetes patients with peripheral neuropathy with implications for plantar foot ulceration. This meta-analysis aimed to compare the plantar pressures of diabetes patients that had peripheral neuropathy and those with neuropathy with active or previous foot ulcers. Published articles were identified from Medline via OVID, CINAHL, SCOPUS, INFORMIT, Cochrane Central EMBASE via OVID and Web of Science via ISI Web of Knowledge bibliographic databases. Observational studies reporting barefoot dynamic plantar pressure in adults with diabetic peripheral neuropathy, where at least one group had a history of plantar foot ulcers were included. Interventional studies, shod plantar pressure studies and studies not published in English were excluded. Overall mean peak plantar pressure (MPP) and pressure time integral (PTI) were primary outcomes. The six secondary outcomes were MPP and PTI at the rear foot, mid foot and fore foot. The protocol of the meta-analysis was published with PROPSERO, (registration number CRD42013004310). Eight observational studies were included. Overall MPP and PTI were greater in diabetic peripheral neuropathy patients with foot ulceration compared to those without ulceration (standardised mean difference 0.551, 95% CI 0.290-0.811, pdiabetic peripheral neuropathy with a history of foot ulceration compared to those with diabetic neuropathy without a history of ulceration. More homogenous data is needed to confirm these findings.

  15. Genome-Wide Temporal Expression Profiling in Caenorhabditis elegans Identifies a Core Gene Set Related to Long-Term Memory.

    Science.gov (United States)

    Freytag, Virginie; Probst, Sabine; Hadziselimovic, Nils; Boglari, Csaba; Hauser, Yannick; Peter, Fabian; Gabor Fenyves, Bank; Milnik, Annette; Demougin, Philippe; Vukojevic, Vanja; de Quervain, Dominique J-F; Papassotiropoulos, Andreas; Stetak, Attila

    2017-07-12

    The identification of genes related to encoding, storage, and retrieval of memories is a major interest in neuroscience. In the current study, we analyzed the temporal gene expression changes in a neuronal mRNA pool during an olfactory long-term associative memory (LTAM) in Caenorhabditis elegans hermaphrodites. Here, we identified a core set of 712 (538 upregulated and 174 downregulated) genes that follows three distinct temporal peaks demonstrating multiple gene regulation waves in LTAM. Compared with the previously published positive LTAM gene set (Lakhina et al., 2015), 50% of the identified upregulated genes here overlap with the previous dataset, possibly representing stimulus-independent memory-related genes. On the other hand, the remaining genes were not previously identified in positive associative memory and may specifically regulate aversive LTAM. Our results suggest a multistep gene activation process during the formation and retrieval of long-term memory and define general memory-implicated genes as well as conditioning-type-dependent gene sets. SIGNIFICANCE STATEMENT The identification of genes regulating different steps of memory is of major interest in neuroscience. Identification of common memory genes across different learning paradigms and the temporal activation of the genes are poorly studied. Here, we investigated the temporal aspects of Caenorhabditis elegans gene expression changes using aversive olfactory associative long-term memory (LTAM) and identified three major gene activation waves. Like in previous studies, aversive LTAM is also CREB dependent, and CREB activity is necessary immediately after training. Finally, we define a list of memory paradigm-independent core gene sets as well as conditioning-dependent genes. Copyright © 2017 the authors 0270-6474/17/376661-12$15.00/0.

  16. Identifying strategies to assist final semester nursing students to develop numeracy skills: a mixed methods study.

    Science.gov (United States)

    Ramjan, Lucie M; Stewart, Lyn; Salamonson, Yenna; Morris, Maureen M; Armstrong, Lyn; Sanchez, Paula; Flannery, Liz

    2014-03-01

    It remains a grave concern that many nursing students within tertiary institutions continue to experience difficulties with achieving medication calculation competency. In addition, universities have a moral responsibility to prepare proficient clinicians for graduate practice. This requires risk management strategies to reduce adverse medication errors post registration. To identify strategies and potential predictors that may assist nurse academics to tailor their drug calculation teaching and assessment methods. This project builds on previous experience and explores students' perceptions of newly implemented interventions designed to increase confidence and competence in medication calculation. This mixed method study surveyed students (n=405) enrolled in their final semester of study at a large, metropolitan university in Sydney, Australia. Tailored, contextualised interventions included online practice quizzes, simulated medication calculation scenarios developed for clinical practice classes, contextualised 'pen and paper' tests, visually enhanced didactic remediation and 'hands-on' contextualised workshops. Surveys were administered to students to determine their perceptions of interventions and to identify whether these interventions assisted with calculation competence. Test scores were analysed using SPSS v. 20 for correlations between students' perceptions and actual performance. Qualitative open-ended survey questions were analysed manually and thematically. The study reinforced that nursing students preferred a 'hands-on,' contextualised approach to learning that was 'authentic' and aligned with clinical practice. Our interventions assisted with supporting students' learning and improvement of calculation confidence. Qualitative data provided further insight into students' awareness of their calculation errors and preferred learning styles. Some of the strongest predictors for numeracy skill performance included (1) being an international student, (2

  17. Identifying ambassador species for conservation marketing

    Directory of Open Access Journals (Sweden)

    E.A. Macdonald

    2017-10-01

    Full Text Available Conservation relies heavily on external funding, much of it from a supportive public. Therefore it is important to know which species are most likely to catalyse such funding. Whilst previous work has looked at the physical attributes that contribute to a species' appeal, no previous studies have tried to examine the extent to which a species' sympatriots might contribute to it's potential as flagship for wider conservation. Therefore, here we estimate ‘flexibility’ and ‘appeal’ scores for all terrestrial mammals (n = 4320 and identify which of these might serve as ambassadors (defined as both highly appealing and flexible. Relatively few mammals (between 240 and 331 emerged as ambassadors, with carnivores featuring heavily in this group (representing 5% of terrestrial mammals but 39% of ambassadors. ‘Top ambassadors’ were defined as those with both flexibility and appeal scores greater than 1 standard deviation above the mean. Less than a quarter of the 20 most endangered and evolutionary distinct species in this study were classed as ambassadors, highlighting the need for surrogate species to catalyse conservation effort in areas with such priority species. This is the first global analysis bringing together flexibility and appeal for all terrestrial mammals, and demonstrates an approach for determining how best to market species in order to achieve maximal conservation gain in a world with urgent conservation need but limited resources.

  18. Identification and pathway analysis of microRNAs with no previous involvement in breast cancer.

    Directory of Open Access Journals (Sweden)

    Sandra Romero-Cordoba

    Full Text Available microRNA expression signatures can differentiate normal and breast cancer tissues and can define specific clinico-pathological phenotypes in breast tumors. In order to further evaluate the microRNA expression profile in breast cancer, we analyzed the expression of 667 microRNAs in 29 tumors and 21 adjacent normal tissues using TaqMan Low-density arrays. 130 miRNAs showed significant differential expression (adjusted P value = 0.05, Fold Change = 2 in breast tumors compared to the normal adjacent tissue. Importantly, the role of 43 of these microRNAs has not been previously reported in breast cancer, including several evolutionary conserved microRNA*, showing similar expression rates to that of their corresponding leading strand. The expression of 14 microRNAs was replicated in an independent set of 55 tumors. Bioinformatic analysis of mRNA targets of the altered miRNAs, identified oncogenes like ERBB2, YY1, several MAP kinases, and known tumor-suppressors like FOXA1 and SMAD4. Pathway analysis identified that some biological process which are important in breast carcinogenesis are affected by the altered microRNA expression, including signaling through MAP kinases and TP53 pathways, as well as biological processes like cell death and communication, focal adhesion and ERBB2-ERBB3 signaling. Our data identified the altered expression of several microRNAs whose aberrant expression might have an important impact on cancer-related cellular pathways and whose role in breast cancer has not been previously described.

  19. Genome-Wide Association Study Identifies Risk Variants for Lichen Planus in Patients With Hepatitis C Virus Infection.

    Science.gov (United States)

    Nagao, Yumiko; Nishida, Nao; Toyo-Oka, Licht; Kawaguchi, Atsushi; Amoroso, Antonio; Carrozzo, Marco; Sata, Michio; Mizokami, Masashi; Tokunaga, Katsushi; Tanaka, Yasuhito

    2017-06-01

    There is a close relationship between hepatitis C virus (HCV) infection and lichen planus, a chronic inflammatory mucocutaneous disease. We performed a genome-wide association study (GWAS) to identify genetic variants associated with HCV-related lichen planus. We conducted a GWAS of 261 patients with HCV infection treated at a tertiary medical center in Japan from October 2007 through January 2013; a total of 71 had lichen planus and 190 had normal oral mucosa. We validated our findings in a GWAS of 38 patients with HCV-associated lichen planus and 7 HCV-infected patients with normal oral mucosa treated at a medical center in Italy. Single-nucleotide polymorphisms in NRP2 (rs884000) and IGFBP4 (rs538399) were associated with risk of HCV-associated lichen planus (P lichen planus. The odds ratios for the minor alleles of rs884000, rs538399, and rs9461799 were 3.25 (95% confidence interval, 1.95-5.41), 0.40 (95% confidence interval, 0.25-0.63), and 2.15 (95% confidence interval, 1.41-3.28), respectively. In a GWAS of Japanese patients with HCV infection, we replicated associations between previously reported polymorphisms in HLA class II genes and risk for lichen planus. We also identified single-nucleotide polymorphisms in NRP2 and IGFBP4 loci that increase and reduce risk of lichen planus, respectively. These genetic variants might be used to identify patients with HCV infection who are at risk for lichen planus. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  20. Combining complexity measures of EEG data: multiplying measures reveal previously hidden information.

    Science.gov (United States)

    Burns, Thomas; Rajan, Ramesh

    2015-01-01

    Many studies have noted significant differences among human electroencephalograph (EEG) results when participants or patients are exposed to different stimuli, undertaking different tasks, or being affected by conditions such as epilepsy or Alzheimer's disease. Such studies often use only one or two measures of complexity and do not regularly justify their choice of measure beyond the fact that it has been used in previous studies. If more measures were added to such studies, however, more complete information might be found about these reported differences. Such information might be useful in confirming the existence or extent of such differences, or in understanding their physiological bases. In this study we analysed publically-available EEG data using a range of complexity measures to determine how well the measures correlated with one another. The complexity measures did not all significantly correlate, suggesting that different measures were measuring unique features of the EEG signals and thus revealing information which other measures were unable to detect. Therefore, the results from this analysis suggests that combinations of complexity measures reveal unique information which is in addition to the information captured by other measures of complexity in EEG data. For this reason, researchers using individual complexity measures for EEG data should consider using combinations of measures to more completely account for any differences they observe and to ensure the robustness of any relationships identified.

  1. The frequency of previously undetectable deletions involving 3' Exons of the PMS2 gene.

    Science.gov (United States)

    Vaughn, Cecily P; Baker, Christine L; Samowitz, Wade S; Swensen, Jeffrey J

    2013-01-01

    Lynch syndrome is characterized by mutations in one of four mismatch repair genes, MLH1, MSH2, MSH6, or PMS2. Clinical mutation analysis of these genes includes sequencing of exonic regions and deletion/duplication analysis. However, detection of deletions and duplications in PMS2 has previously been confined to Exons 1-11 due to gene conversion between PMS2 and the pseudogene PMS2CL in the remaining 3' exons (Exons 12-15). We have recently described an MLPA-based method that permits detection of deletions of PMS2 Exons 12-15; however, the frequency of such deletions has not yet been determined. To address this question, we tested for 3' deletions in 58 samples that were reported to be negative for PMS2 mutations using previously available methods. All samples were from individuals whose tumors exhibited loss of PMS2 immunohistochemical staining without concomitant loss of MLH1 immunostaining. We identified seven samples in this cohort with deletions in the 3' region of PMS2, including three previously reported samples with deletions of Exons 13-15 (two samples) and Exons 14-15. Also detected were deletions of Exons 12-15, Exon 13, and Exon 14 (two samples). Breakpoint analysis of the intragenic deletions suggests they occurred through Alu-mediated recombination. Our results indicate that ∼12% of samples suspected of harboring a PMS2 mutation based on immunohistochemical staining, for which mutations have not yet been identified, would benefit from testing using the new methodology. Copyright © 2012 Wiley Periodicals, Inc.

  2. A cross-study gene set enrichment analysis identifies critical pathways in endometriosis

    Directory of Open Access Journals (Sweden)

    Bai Chunyan

    2009-09-01

    Full Text Available Abstract Background Endometriosis is an enigmatic disease. Gene expression profiling of endometriosis has been used in several studies, but few studies went further to classify subtypes of endometriosis based on expression patterns and to identify possible pathways involved in endometriosis. Some of the observed pathways are more inconsistent between the studies, and these candidate pathways presumably only represent a fraction of the pathways involved in endometriosis. Methods We applied a standardised microarray preprocessing and gene set enrichment analysis to six independent studies, and demonstrated increased concordance between these gene datasets. Results We find 16 up-regulated and 19 down-regulated pathways common in ovarian endometriosis data sets, 22 up-regulated and one down-regulated pathway common in peritoneal endometriosis data sets. Among them, 12 up-regulated and 1 down-regulated were found consistent between ovarian and peritoneal endometriosis. The main canonical pathways identified are related to immunological and inflammatory disease. Early secretory phase has the most over-represented pathways in the three uterine cycle phases. There are no overlapping significant pathways between the dataset from human endometrial endothelial cells and the datasets from ovarian endometriosis which used whole tissues. Conclusion The study of complex diseases through pathway analysis is able to highlight genes weakly connected to the phenotype which may be difficult to detect by using classical univariate statistics. By standardised microarray preprocessing and GSEA, we have increased the concordance in identifying many biological mechanisms involved in endometriosis. The identified gene pathways will shed light on the understanding of endometriosis and promote the development of novel therapies.

  3. Previously identified patellar tendinopathy risk factors differ between elite and sub-elite volleyball players.

    Science.gov (United States)

    Janssen, I; Steele, J R; Munro, B J; Brown, N A T

    2015-06-01

    Patellar tendinopathy is the most common knee injury incurred in volleyball, with its prevalence in elite athletes more than three times that of their sub-elite counterparts. The purpose of this study was to determine whether patellar tendinopathy risk factors differed between elite and sub-elite male volleyball players. Nine elite and nine sub-elite male volleyball players performed a lateral stop-jump block movement. Maximum vertical jump, training history, muscle extensibility and strength, three-dimensional landing kinematics (250 Hz), along with lower limb neuromuscular activation patterns (1500 Hz), and patellar tendon loading were collected during each trial. Multivariate analyses of variance (P volleyball players. Interventions designed to reduce landing frequency and improve quadriceps extensibility are recommended to reduce patellar tendinopathy prevalence in volleyball players. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Dementia and cognitive disorder identified at a forensic psychiatric examination - a study from Sweden.

    Science.gov (United States)

    Ekström, Anette; Kristiansson, Marianne; Björkstén, Karin Sparring

    2017-09-18

    Few studies have addressed the relationship between dementia and crime. We conducted a study of persons who got a primary or secondary diagnosis of dementia or cognitive disorder in a forensic psychiatric examination. In Sweden, annually about 500 forensic psychiatric examinations are carried out. All cases from 2008 to 2010 with the diagnoses dementia or cognitive disorder were selected from the database of the Swedish National Board of Forensic Medicine. Out of 1471 cases, there were 54 cases of dementia or cognitive disorder. Case files were scrutinized and 17 cases of dementia and 4 cases of cognitive disorder likely to get a dementia diagnosis in a clinical setting were identified and further studied. There were 18 men and 3 women; Median age 66 (n = 21; Range 35-77) years of age. Eleven men but no women had a previous criminal record. There were a total of 38 crimes, mostly violent, committed by the 21 persons. The crimes were of impulsive rather that pre-meditated character. According to the forensic psychiatric diagnoses, dementia was caused by cerebrovascular disorder (n = 4), alcohol or substance abuse (n = 3), cerebral haemorrhage and alcohol (n = 1), head trauma and alcohol (n = 2), Alzheimer's disease (n = 2), Parkinson's disease (n = 1), herpes encephalitis (n = 1) and unspecified (3). Out of four persons diagnosed with cognitive disorder, one also had delusional disorder and another one psychotic disorder and alcohol dependence. An alcohol-related diagnosis was established in ten cases. There were only two cases of Dementia of Alzheimer's type, one of whom also had alcohol intoxication. None was diagnosed with a personality disorder. All but one had a history of somatic or psychiatric comorbidity like head traumas, stroke, other cardio-vascular disorders, epilepsy, depression, psychotic disorders and suicide attempts. In this very ill group, the suggested verdict was probation in one case and different forms of care in the remaining

  5. Students' Understanding on Newton's Third Law in Identifying the Reaction Force in Gravity Interactions

    Science.gov (United States)

    Zhou, Shaona; Zhang, Chunbin; Xiao, Hua

    2015-01-01

    In the past three decades, previous researches showed that students had various misconceptions of Newton's Third Law. The present study focused on students' difficulties in identifying the third-law force pair in gravity interaction situations. An instrument involving contexts with gravity and non-gravity associated interactions was designed and…

  6. Multi-stage genome-wide association study identifies new susceptibility locus for testicular germ cell tumour on chromosome 3q25

    DEFF Research Database (Denmark)

    Litchfield, Kevin; Sultana, Razvan; Renwick, Anthony

    2015-01-01

    , we report new genotyping of eight SNPs showing some evidence of association in combined analysis of Stage 1 and Stage 2 in an additional 2048 cases of TGCT and 3944 controls (Stage 3). Through fixed-effects meta-analysis across three stages, we identified a novel locus at 3q25.31 (rs1510272......-stage experiment, involving 4098 cases and 18 972 controls. Stage 1 comprised previously published GWAS analysis of 307 291 SNPs in 986 cases and 4946 controls. In Stage 2, we used previously published customised Illumina iSelect genotyping array (iCOGs) data across 694 SNPs in 1064 cases and 10 082 controls. Here...

  7. Validation of rearrangement break points identified by paired-end sequencing in natural populations of Drosophila melanogaster.

    Science.gov (United States)

    Cridland, Julie M; Thornton, Kevin R

    2010-01-13

    Several recent studies have focused on the evolution of recently duplicated genes in Drosophila. Currently, however, little is known about the evolutionary forces acting upon duplications that are segregating in natural populations. We used a high-throughput, paired-end sequencing platform (Illumina) to identify structural variants in a population sample of African D. melanogaster. Polymerase chain reaction and sequencing confirmation of duplications detected by multiple, independent paired-ends showed that paired-end sequencing reliably uncovered the break points of structural rearrangements and allowed us to identify a number of tandem duplications segregating within a natural population. Our confirmation experiments show that rates of confirmation are very high, even at modest coverage. Our results also compare well with previous studies using microarrays (Emerson J, Cardoso-Moreira M, Borevitz JO, Long M. 2008. Natural selection shapes genome wide patterns of copy-number polymorphism in Drosophila melanogaster. Science. 320:1629-1631. and Dopman EB, Hartl DL. 2007. A portrait of copy-number polymorphism in Drosophila melanogaster. Proc Natl Acad Sci U S A. 104:19920-19925.), which both gives us confidence in the results of this study as well as confirms previous microarray results.We were also able to identify whole-gene duplications, such as a novel duplication of Or22a, an olfactory receptor, and identify copy-number differences in genes previously known to be under positive selection, like Cyp6g1, which confers resistance to dichlorodiphenyltrichloroethane. Several "hot spots" of duplications were detected in this study, which indicate that particular regions of the genome may be more prone to generating duplications. Finally, population frequency analysis of confirmed events also showed an excess of rare variants in our population, which indicates that duplications segregating in the population may be deleterious and ultimately destined to be lost from the

  8. Meta-analysis of genome-wide association studies in celiac disease and rheumatoid arthritis identifies fourteen non-HLA shared loci.

    Directory of Open Access Journals (Sweden)

    Alexandra Zhernakova

    2011-02-01

    Full Text Available Epidemiology and candidate gene studies indicate a shared genetic basis for celiac disease (CD and rheumatoid arthritis (RA, but the extent of this sharing has not been systematically explored. Previous studies demonstrate that 6 of the established non-HLA CD and RA risk loci (out of 26 loci for each disease are shared between both diseases. We hypothesized that there are additional shared risk alleles and that combining genome-wide association study (GWAS data from each disease would increase power to identify these shared risk alleles. We performed a meta-analysis of two published GWAS on CD (4,533 cases and 10,750 controls and RA (5,539 cases and 17,231 controls. After genotyping the top associated SNPs in 2,169 CD cases and 2,255 controls, and 2,845 RA cases and 4,944 controls, 8 additional SNPs demonstrated P<5 × 10(-8 in a combined analysis of all 50,266 samples, including four SNPs that have not been previously confirmed in either disease: rs10892279 near the DDX6 gene (P(combined =  1.2 × 10(-12, rs864537 near CD247 (P(combined =  2.2 × 10(-11, rs2298428 near UBE2L3 (P(combined =  2.5 × 10(-10, and rs11203203 near UBASH3A (P(combined =  1.1 × 10(-8. We also confirmed that 4 gene loci previously established in either CD or RA are associated with the other autoimmune disease at combined P<5 × 10(-8 (SH2B3, 8q24, STAT4, and TRAF1-C5. From the 14 shared gene loci, 7 SNPs showed a genome-wide significant effect on expression of one or more transcripts in the linkage disequilibrium (LD block around the SNP. These associations implicate antigen presentation and T-cell activation as a shared mechanism of disease pathogenesis and underscore the utility of cross-disease meta-analysis for identification of genetic risk factors with pleiotropic effects between two clinically distinct diseases.

  9. 49 CFR 173.23 - Previously authorized packaging.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Previously authorized packaging. 173.23 Section... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Preparation of Hazardous Materials for Transportation § 173.23 Previously authorized packaging. (a) When the regulations specify a packaging with a specification marking...

  10. Correlates of postpartum depression in first time mothers without previous psychiatric contact.

    Science.gov (United States)

    Sylvén, S M; Thomopoulos, T P; Kollia, N; Jonsson, M; Skalkidou, A

    2017-02-01

    Postpartum depression (PPD) is a common disorder after childbirth. The strongest known predictors are a history of depression and/or a history of PPD. However, for a significant proportion of women, PPD constitutes their first depressive episode. This study aimed to gain further insight into the risk factors for PPD in first time mothers without previous psychiatric contact. Women delivering in Uppsala University Hospital, Sweden, from May 2006 to June 2007, were asked to participate and filled out questionnaires five days and six weeks postpartum, containing inter alia the Edinburgh Postnatal Depression Scale (EPDS). Univariate logistic regression models, as well as a path analysis, were performed to unveil the complex interplay between the study variables. Of the 653 participating primiparas, 10.3% and 6.4% reported depressive symptoms (EPDS≥12 points) five days and six weeks postpartum, respectively. In the path analysis, a positive association between anxiety proneness and depressive symptoms at five days and six weeks postpartum was identified. For depressive symptoms six weeks after delivery, additional risk factors were detected, namely depressive symptoms five days postpartum and subjective experience of problems with the baby. Caesarean section and assisted vaginal delivery were associated with fewer depressive symptoms at 6 six weeks postpartum. Identification of anxiety proneness, delivery mode and problems with the baby as risk factors for self-reported depressive symptoms postpartum in this group of primiparas can be important in helping health care professionals identify women at increased risk of affective disorders in the perinatal period, and provide a base for early intervention. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  11. 22 CFR 40.91 - Certain aliens previously removed.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Certain aliens previously removed. 40.91... IMMIGRANTS UNDER THE IMMIGRATION AND NATIONALITY ACT, AS AMENDED Aliens Previously Removed § 40.91 Certain aliens previously removed. (a) 5-year bar. An alien who has been found inadmissible, whether as a result...

  12. Is email a reliable means of contacting authors of previously published papers? A study of the Emergency Medicine Journal for 2001.

    Science.gov (United States)

    O'Leary, F

    2003-07-01

    To determine whether it is possible to contact authors of previously published papers via email. A cross sectional study of the Emergency Medicine Journal for 2001. 118 articles were included in the study. The response rate from those with valid email addresses was 73%. There was no statistical difference between the type of email address used and the address being invalid (p=0.392) or between the type of article and the likelihood of a reply (p=0.197). More responses were obtained from work addresses when compared with Hotmail addresses (86% v 57%, p=0.02). Email is a valid means of contacting authors of previously published articles, particularly within the emergency medicine specialty. A work based email address may be a more valid means of contact than a Hotmail address.

  13. Does the patients′ educational level and previous counseling affect their medication knowledge?

    Directory of Open Access Journals (Sweden)

    Abdulmalik M Alkatheri

    2013-01-01

    Conclusions: The education level of the patient and previous counseling are positively linked to medication knowledge. Knowledge of the medications′ side effects proved to be the most difficult task for the participants in this study, requiring the highest level of education, and was improved by previous counseling.

  14. Protocol: a systematic review of studies developing and/or evaluating search strategies to identify prognosis studies.

    Science.gov (United States)

    Corp, Nadia; Jordan, Joanne L; Hayden, Jill A; Irvin, Emma; Parker, Robin; Smith, Andrea; van der Windt, Danielle A

    2017-04-20

    Prognosis research is on the rise, its importance recognised because chronic health conditions and diseases are increasingly common and costly. Prognosis systematic reviews are needed to collate and synthesise these research findings, especially to help inform effective clinical decision-making and healthcare policy. A detailed, comprehensive search strategy is central to any systematic review. However, within prognosis research, this is challenging due to poor reporting and inconsistent use of available indexing terms in electronic databases. Whilst many published search filters exist for finding clinical trials, this is not the case for prognosis studies. This systematic review aims to identify and compare existing methodological filters developed and evaluated to identify prognosis studies of any of the three main types: overall prognosis, prognostic factors, and prognostic [risk prediction] models. Primary studies reporting the development and/or evaluation of methodological search filters to retrieve any type of prognosis study will be included in this systematic review. Multiple electronic bibliographic databases will be searched, grey literature will be sought from relevant organisations and websites, experts will be contacted, and citation tracking of key papers and reference list checking of all included papers will be undertaken. Titles will be screened by one person, and abstracts and full articles will be reviewed for inclusion independently by two reviewers. Data extraction and quality assessment will also be undertaken independently by two reviewers with disagreements resolved by discussion or by a third reviewer if necessary. Filters' characteristics and performance metrics reported in the included studies will be extracted and tabulated. To enable comparisons, filters will be grouped according to database, platform, type of prognosis study, and type of filter for which it was intended. This systematic review will identify all existing validated

  15. SONOGRAPHIC PREDICTION OF SCAR DEHISCENCE IN WOMEN WITH PREVIOUS CAESAREAN SECTION

    Directory of Open Access Journals (Sweden)

    Shubhada Suhas Jajoo

    2018-01-01

    Full Text Available BACKGROUND Caesarean section (Sectio Caesarea is a surgical method for the completion of delivery. After various historical modifications of operative techniques, modern approach consists in the transverse dissection of the anterior wall of the uterus. The rate of vaginal birth after caesarean section was significantly reduced from year to year and the rate of repeated caesarean section is increased during the past 10 years. Evaluation of scar thickness is done by ultrasound, but it is still debatable size of thick scar that would be guiding “cut-off value” for the completion of the delivery method. To better assess the risk of uterine rupture, some authors have proposed sonographic measurement of lower uterine segment thickness near term assuming that there is an inverse correlation between LUS thickness and the risk of uterine scar defect. Therefore, this assessment for the management of women with prior CS may increase safety during labour by selecting women with the lowest risk of uterine rupture. The aim of the study is to study the diagnostic accuracy of sonographic measurements of the Lower Uterine Segment (LUS thickness near term in predicting uterine scar defects in women with prior Caesarean Section (CS. We aim to ascertain the best cut-off values for predicting uterine rupture. MATERIALS AND METHODS 100 antenatal women with history of previous one LSCS who come to attend antenatal clinic will be assessed for scar thickness by transabdominal ultrasonography and its correlation with intraoperative findings. This prospective longitudinal study was conducted for 1 year after IEC approval with inclusion criteria previous one LSCS. Exclusion criteria- 1 Previous myomectomy scar; 2 Previous 2 LSCS; 3 Previous hysterotomy scar. RESULTS Our findings indicate that there is a strong association between degree of LUS thinning measured near term and the risk of uterine scar defect at birth. In our study, optimal cut-off value for predicting

  16. Genome-Wide Association Studies Identify Candidate Genes for Coat Color and Mohair Traits in the Iranian Markhoz Goat.

    Science.gov (United States)

    Nazari-Ghadikolaei, Anahit; Mehrabani-Yeganeh, Hassan; Miarei-Aashtiani, Seyed R; Staiger, Elizabeth A; Rashidi, Amir; Huson, Heather J

    2018-01-01

    The Markhoz goat provides an opportunity to study the genetics underlying coat color and mohair traits of an Angora type goat using genome-wide association studies (GWAS). This indigenous Iranian breed is valued for its quality mohair used in ceremonial garments and has the distinction of exhibiting an array of coat colors including black, brown, and white. Here, we performed 16 GWAS for different fleece (mohair) traits and coat color in 228 Markhoz goats sampled from the Markhoz Goat Research Station in Sanandaj, Kurdistan province, located in western Iran using the Illumina Caprine 50K beadchip. The Efficient Mixed Model Linear analysis was used to identify genomic regions with potential candidate genes contributing to coat color and mohair characteristics while correcting for population structure. Significant associations to coat color were found within or near the ASIP, ITCH, AHCY , and RALY genes on chromosome 13 for black and brown coat color and the KIT and PDGFRA genes on chromosome 6 for white coat color. Individual mohair traits were analyzed for genetic association along with principal components that allowed for a broader perspective of combined traits reflecting overall mohair quality and volume. A multitude of markers demonstrated significant association to mohair traits highlighting potential candidate genes of POU1F1 on chromosome 1 for mohair quality, MREG on chromosome 2 for mohair volume, DUOX1 on chromosome 10 for yearling fleece weight, and ADGRV1 on chromosome 7 for grease percentage. Variation in allele frequencies and haplotypes were identified for coat color and differentiated common markers associated with both brown and black coat color. This demonstrates the potential for genetic markers to be used in future breeding programs to improve selection for coat color and mohair traits. Putative candidate genes, both novel and previously identified in other species or breeds, require further investigation to confirm phenotypic causality and

  17. Extending existing structural identifiability analysis methods to mixed-effects models.

    Science.gov (United States)

    Janzén, David L I; Jirstrand, Mats; Chappell, Michael J; Evans, Neil D

    2018-01-01

    The concept of structural identifiability for state-space models is expanded to cover mixed-effects state-space models. Two methods applicable for the analytical study of the structural identifiability of mixed-effects models are presented. The two methods are based on previously established techniques for non-mixed-effects models; namely the Taylor series expansion and the input-output form approach. By generating an exhaustive summary, and by assuming an infinite number of subjects, functions of random variables can be derived which in turn determine the distribution of the system's observation function(s). By considering the uniqueness of the analytical statistical moments of the derived functions of the random variables, the structural identifiability of the corresponding mixed-effects model can be determined. The two methods are applied to a set of examples of mixed-effects models to illustrate how they work in practice. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Do family physicians retrieve synopses of clinical research previously read as email alerts?

    Science.gov (United States)

    Grad, Roland; Pluye, Pierre; Johnson-Lafleur, Janique; Granikov, Vera; Shulha, Michael; Bartlett, Gillian; Marlow, Bernard

    2011-11-30

    A synopsis of new clinical research highlights important aspects of one study in a brief structured format. When delivered as email alerts, synopses enable clinicians to become aware of new developments relevant for practice. Once read, a synopsis can become a known item of clinical information. In time-pressured situations, remembering a known item may facilitate information retrieval by the clinician. However, exactly how synopses first delivered as email alerts influence retrieval at some later time is not known. We examined searches for clinical information in which a synopsis previously read as an email alert was retrieved (defined as a dyad). Our study objectives were to (1) examine whether family physicians retrieved synopses they previously read as email alerts and then to (2) explore whether family physicians purposefully retrieved these synopses. We conducted a mixed-methods study in which a qualitative multiple case study explored the retrieval of email alerts within a prospective longitudinal cohort of practicing family physicians. Reading of research-based synopses was tracked in two contexts: (1) push, meaning to read on email and (2) pull, meaning to read after retrieval from one electronic knowledge resource. Dyads, defined as synopses first read as email alerts and subsequently retrieved in a search of a knowledge resource, were prospectively identified. Participants were interviewed about all of their dyads. Outcomes were the total number of dyads and their type. Over a period of 341 days, 194 unique synopses delivered to 41 participants resulted in 4937 synopsis readings. In all, 1205 synopses were retrieved over an average of 320 days. Of the 1205 retrieved synopses, 21 (1.7%) were dyads made by 17 family physicians. Of the 1205 retrieved synopses, 6 (0.5%) were known item type dyads. However, dyads also occurred serendipitously. In the single knowledge resource we studied, email alerts containing research-based synopses were rarely retrieved

  19. A New Method for Identifying Hazardous Road Locations Using GPS and Accelerometer

    DEFF Research Database (Denmark)

    Reinau, Kristian Hegner; Andersen, Camilla Sloth; Agerholm, Niels

    2016-01-01

    and validated through a case study of Aalborg city, where HRLs identified on the basis of accident statistics are compared to the HCLs identified with the new method on a dataset of more than 36.531 hours of driving tracked with accelerometer and GPS, containing 131 million GPS and 1.1 billion acceleration...... a new method relying on GPS data and accelerometer data. The method developed in this article is superior to previous methods since it utilizes acceleration measurements to identify both a deceleration and a significant drop in speed by integrating acceleration measurements over time in a moving time......-window. This calculation is combined with measurements of jerks to distinguish between planned decelerations and unplanned decelerations, which occurs when drivers react to hazardous situations. Finally, using GPS data, the unplanned decelerations identified are linked to specific locations. The method is tested...

  20. From control system security indices to attack identifiability

    NARCIS (Netherlands)

    Herdeiro Teixeira, A.M.; Sandberg, H

    2016-01-01

    In this paper, we investigate detectability and identifiability of attacks on linear dynamical systems that are subjected to external disturbances. We generalize a concept for a security index, which was previously introduced for static systems. The index exactly quantifies the resources

  1. [Incidence and clinical risk factors for the development of diabetes mellitus in women with previous gestational diabetes].

    Science.gov (United States)

    Domínguez-Vigo, P; Álvarez-Silvares, E; Alves-Pérez M T; Domínguez-Sánchez, J; González-González, A

    2016-04-01

    Gestational diabetes is considered a variant of diabetes mellitus as they share a common pathophysiological basis: insulin resistance in target and insufficient secretion of it by pancreatic p-cell bodies. Pregnancy is a unique physiological situation provides an opportunity to identify future risk of diabetes mellitus. To determine the long-term incidence of diabetes mellitus in women who have previously been diagnosed with gestational diabetes and identifying clinical risk factors for developing the same. nested case-control cohort study. 671 patients between 1996 and 2009 were diagnosed with gestational diabetes were selected. The incidence of diabetes mellitus was estimated and 2 subgroups were formed: Group A or cases: women who develop diabetes mellitus after diagnosis of gestational diabetes. Group B or control: random sample of 71 women with a history of gestational diabetes in the follow-up period remained normoglycemic. Both groups were studied up to 18 years postpartum. By studying Kaplan Meier survival of the influence of different gestational variables it was obtained in the later development of diabetes mellitus with time parameter and COX models for categorical variables were applied. Significant variables were studied by multivariate Cox analysis. In all analyzes the Hazard ratio was calculated with confidence intervals at 95%. The incidence of diabetes mellitus was 10.3% in patients with a history of gestational diabetes. They were identified as risk factors in the index pregnancy to later development of diabetes mellitus: greater than 35 and younger than 27 years maternal age, BMI greater than 30 kg/m2, hypertensive disorders of pregnancy, insulin therapy, poor metabolic control and more than a complicated pregnancy with gestational diabetes. Clinical factors have been identified in the pregnancy complicated by gestational diabetes that determine a higher probability of progression to diabetes mellitus in the medium and long term.

  2. 76 FR 18033 - Airworthiness Directives; Piper Aircraft, Inc. (Type Certificate Previously Held by The New Piper...

    Science.gov (United States)

    2011-04-01

    ... Airworthiness Directives; Piper Aircraft, Inc. (Type Certificate Previously Held by The New Piper Aircraft, Inc... applies to certain Piper Aircraft, Inc. Models PA-46-310P and PA- 46-350P airplanes that are equipped with... information identified in this AD, contact Piper Aircraft, Inc., 2926 Piper Drive, Vero Beach, Florida 32960...

  3. A nonmusical paradigm for identifying absolute pitch possessors

    Science.gov (United States)

    Ross, David A.; Olson, Ingrid R.; Marks, Lawrence E.; Gore, John C.

    2004-09-01

    The ability to identify and reproduce sounds of specific frequencies is remarkable and uncommon. The etiology and defining characteristics of this skill, absolute pitch (AP), have been very controversial. One theory suggests that AP requires a specific type of early musical training and that the ability to encode and remember tones depends on these learned musical associations. An alternate theory argues that AP may be strongly dependent on hereditary factors and relatively independent of musical experience. To date, it has been difficult to test these hypotheses because all previous paradigms for identifying AP have required subjects to employ knowledge of musical nomenclature. As such, these tests are insensitive to the possibility of discovering AP in either nonmusicians or musicians of non-Western training. Based on previous literature in pitch memory, a paradigm is presented that is intended to distinguish between AP possessors and nonpossessors independent of the subjects' musical experience. The efficacy of this method is then tested with 20 classically defined AP possessors and 22 nonpossessors. Data from these groups strongly support the validity of the paradigm. The use of a nonmusical paradigm to identify AP may facilitate research into many aspects of this phenomenon.

  4. Proteomics Analysis Reveals Previously Uncharacterized Virulence Factors in Vibrio proteolyticus

    Directory of Open Access Journals (Sweden)

    Ann Ray

    2016-07-01

    Full Text Available Members of the genus Vibrio include many pathogens of humans and marine animals that share genetic information via horizontal gene transfer. Hence, the Vibrio pan-genome carries the potential to establish new pathogenic strains by sharing virulence determinants, many of which have yet to be characterized. Here, we investigated the virulence properties of Vibrio proteolyticus, a Gram-negative marine bacterium previously identified as part of the Vibrio consortium isolated from diseased corals. We found that V. proteolyticus causes actin cytoskeleton rearrangements followed by cell lysis in HeLa cells in a contact-independent manner. In search of the responsible virulence factor involved, we determined the V. proteolyticus secretome. This proteomics approach revealed various putative virulence factors, including active type VI secretion systems and effectors with virulence toxin domains; however, these type VI secretion systems were not responsible for the observed cytotoxic effects. Further examination of the V. proteolyticus secretome led us to hypothesize and subsequently demonstrate that a secreted hemolysin, belonging to a previously uncharacterized clan of the leukocidin superfamily, was the toxin responsible for the V. proteolyticus-mediated cytotoxicity in both HeLa cells and macrophages. Clearly, there remains an armory of yet-to-be-discovered virulence factors in the Vibrio pan-genome that will undoubtedly provide a wealth of knowledge on how a pathogen can manipulate host cells.

  5. Doxorubicin and ifosfamide combination chemotherapy in previously treated acute leukemia in adults: a Southwest Oncology Group pilot study.

    Science.gov (United States)

    Ryan, D H; Bickers, J N; Vial, R H; Hussein, K; Bottomley, R; Hewlett, J S; Wilson, H E; Stuckey, W J

    1980-01-01

    The Southwest Oncology Group did a limited institutional pilot study of the combination of doxorubicin and ifosfamide in the treatment of previously treated adult patients with acute leukemia. Thirty-four patients received one or two courses of the combination. All patients had received prior chemotherapy and 32 had received prior anthracycline chemotherapy. Three patients died before their responses could be fully evaluated. Fourteen patients achieved complete remission (41%) and one patient achieved partial remission. The complete remission rate was 27% for patients with acute myeloblastic leukemia (myelomonoblastic leukemia, monoblastic leukemia, and erythroleukemia) and 89% for patients with acute lymphocytic and undifferentiated leukemia (ALL). Toxic effects included severe hematologic reactions in 33 of 34 patients, hematuria in six patients, altered sensorium in one patient, and congestive heart failure in one patient. The safety of the combination was established and toxic side effects of this therapy were tolerable. The 89% complete remission rate for previously treated patients with ALL suggests that the combination of doxorubicin and ifosfamide may be particularly effective in ALL.

  6. Deep Coverage Proteomics Identifies More Low-Abundance Missing Proteins in Human Testis Tissue with Q-Exactive HF Mass Spectrometer.

    Science.gov (United States)

    Wei, Wei; Luo, Weijia; Wu, Feilin; Peng, Xuehui; Zhang, Yao; Zhang, Manli; Zhao, Yan; Su, Na; Qi, YingZi; Chen, Lingsheng; Zhang, Yangjun; Wen, Bo; He, Fuchu; Xu, Ping

    2016-11-04

    Since 2012, missing proteins (MPs) investigation has been one of the critical missions of Chromosome-Centric Human Proteome Project (C-HPP) through various biochemical strategies. On the basis of our previous testis MPs study, faster scanning and higher resolution mass-spectrometry-based proteomics might be conducive to MPs exploration, especially for low-abundance proteins. In this study, Q-Exactive HF (HF) was used to survey proteins from the same testis tissues separated by two separating methods (tricine- and glycine-SDS-PAGE), as previously described. A total of 8526 proteins were identified, of which more low-abundance proteins were uniquely detected in HF data but not in our previous LTQ Orbitrap Velos (Velos) reanalysis data. Further transcriptomics analysis showed that these uniquely identified proteins by HF also had lower expression at the mRNA level. Of the 81 total identified MPs, 74 and 39 proteins were listed as MPs in HF and Velos data sets, respectively. Among the above MPs, 47 proteins (43 neXtProt PE2 and 4 PE3) were ranked as confirmed MPs after verifying with the stringent spectra match and isobaric and single amino acid variants filtering. Functional investigation of these 47 MPs revealed that 11 MPs were testis-specific proteins and 7 MPs were involved in spermatogenesis process. Therefore, we concluded that higher scanning speed and resolution of HF might be factors for improving the low-abundance MP identification in future C-HPP studies. All mass-spectrometry data from this study have been deposited in the ProteomeXchange with identifier PXD004092.

  7. A Framework for Identifying and Understanding Enterprise Systems Benefits

    DEFF Research Database (Denmark)

    Schubert, Petra; Williams, Susan P.

    2011-01-01

    Purpose – Identifying the benefits arising from implementations of enterprise systems and realizing business value remains a significant challenge for both research and industry. This paper aims to consolidate previous work. It presents a framework for investigating enterprise systems benefits...... into aspects and criteria plus an attributed appraisal value. The resulting scheme for the “three-level benefit codes” provides a greater level of detail about the nature of expected and realized benefits. Practical implications – The high level of detail and the code scheme comprising 60 different codes...... and the method for deriving the codes allows companies to identify and define benefits as well as to assess the outcome of enterprise systems implementation projects. Originality/value – The paper empirically develops an applicable benefits framework, which addresses the lack of detail of previous frameworks....

  8. ATLANTIC DIP: simplifying the follow-up of women with previous gestational diabetes.

    LENUS (Irish Health Repository)

    Noctor, E

    2013-11-01

    Previous gestational diabetes (GDM) is associated with a significant lifetime risk of type 2 diabetes. In this study, we assessed the performance of HbA1c and fasting plasma glucose (FPG) measurements against that of 75 g oral glucose tolerance testing (OGTT) for the follow-up screening of women with previous GDM.

  9. The Effect of Previous Co-Worker Experience on the Survival of Knowledge Intensive Start-Ups

    DEFF Research Database (Denmark)

    Timmermans, Bram

    The aim of the paper is to investigate the effect of previous co-worker experience on the survival of knowledge intensive start-ups. For the empirical analysis I use the Danish Integrated Database of Labor Market Research (IDA). This longitudinal employer-employee database allows me to identify co-worker...... experience among all members of the firm. In addition, I will make a distinction between ordinary start-ups and entrepreneurial spin-offs. The results show that previous co-worker experience has a positive effect on new firm survival. This effect appears to be valid predominantly for ordinary start-ups than...

  10. The Importance of Business Model Factors for Cloud Computing Adoption: Role of Previous Experiences

    Directory of Open Access Journals (Sweden)

    Bogataj Habjan Kristina

    2017-08-01

    Full Text Available Background and Purpose: Bringing several opportunities for more effective and efficient IT governance and service exploitation, cloud computing is expected to impact the European and global economies significantly. Market data show that despite many advantages and promised benefits the adoption of cloud computing is not as fast and widespread as foreseen. This situation shows the need for further exploration of the potentials of cloud computing and its implementation on the market. The purpose of this research was to identify individual business model factors with the highest impact on cloud computing adoption. In addition, the aim was to identify the differences in opinion regarding the importance of business model factors on cloud computing adoption according to companies’ previous experiences with cloud computing services.

  11. A comparison of morbidity associated with placenta previa with and without previous caesarean sections

    International Nuclear Information System (INIS)

    Baqai, S.; Siraj, A.; Noor, N.

    2018-01-01

    To compare the morbidity associated with placenta previa with and without previous caesarean sections. Study Design: Retrospective comparative study. Place and Duration of Study: From March 2014 till March 2016 in the department of Obstetrics and Gynaecology at PNS Shifa hospital Karachi. Material and Methods: After the approval from hospital ethical committee, antenatal patients with singleton pregnancy of gestational age >32 weeks, in the age group of 20-40 years diagnosed to have placenta previa included in the study. All patients with twin pregnancy less than 20 years and more than 40 years of age were excluded. The records of all patients fulfilling the inclusion criteria were reviewed. Data had been collected for demographic and maternal variables, placenta previa, history of previous lower segment caesarean section (LSCS), complications associated with placenta previa and techniques used to control blood loss were recorded. Results: During the study period, 6879 patients were delivered in PNS Shifa, out of these, 2060 (29.9%) had caesarean section out of these, 47.3% patients had previous history of LSCS. Thirty three (1.6%) patients were diagnosed to have placenta previa and frequency of placenta previa was significantly higher in patients with previous history of LSCS than previous normal delivery of LSCS i.e. 22 vs. 11 (p=0.023). It was observed that the frequency of morbidly adherent placenta (MAP) and Intensive care unit (ICU) stay were significantly higher in patients with previous history of LSCS than previous history of normal delivery. Conclusion: Frequency of placenta previa was significantly higher in patients with history of LSCS. Also placenta previa remains a major risk factor for various maternal complications. (author)

  12. Males Perform Better in Identifying Voices During Menstruation Than Females: A Pilot Study.

    Science.gov (United States)

    Wang, Xue; Xu, Xin; Liu, Yangyang

    2016-10-01

    The objective of the present study is to investigate gender differences in the ability to identify females' voice during menstruation. In Study 1, 55 male participants (M age = 19.6 years, SD = 1.0) were asked to listen to vocal samples from women during both ovulation and menstruation and to identify which recordings featured menstruating women. The results showed that the accuracy of men's responses (M = 56.73%, SD = 0.21) was significantly higher than 50%. In Study 2, 118 female students (M age = 19.4 years, SD = 1.6) completed the same task. The results indicated that the accuracy of women's performance was nearly 50%. These preliminary findings suggest that men are better able to identify women's voices during menstruation than women. Future work could consider several significant variables for the purpose of validating the results. © The Author(s) 2016.

  13. Sunburn and sun-protective behaviors among adults with and without previous nonmelanoma skin cancer: a population-based study

    Science.gov (United States)

    Fischer, Alexander H.; Wang, Timothy S.; Yenokyan, Gayane; Kang, Sewon; Chien, Anna L.

    2016-01-01

    Background Individuals with previous nonmelanoma skin cancer (NMSC) are at increased risk for subsequent skin cancer, and should therefore limit UV exposure. Objective To determine whether individuals with previous NMSC engage in better sun protection than those with no skin cancer history. Methods We pooled self-reported data (2005 and 2010 National Health Interview Surveys) from US non-Hispanic white adults (758 with and 34,161 without previous NMSC). We calculated adjusted prevalence odds ratios (aPOR) and 95% confidence intervals (95% CI), taking into account the complex survey design. Results Individuals with previous NMSC versus no history of NMSC had higher rates of frequent use of shade (44.3% versus 27.0%; aPOR=1.41; 1.16–1.71), long sleeves (20.5% versus 7.7%; aPOR=1.55; 1.21–1.98), a wide-brimmed hat (26.1% versus 10.5%; aPOR=1.52; 1.24–1.87), and sunscreen (53.7% versus 33.1%; aPOR=2.11; 95% CI=1.73–2.59), but did not have significantly lower odds of recent sunburn (29.7% versus 40.7%; aPOR=0.95; 0.77–1.17). Among subjects with previous NMSC, recent sunburn was inversely associated with age, sun avoidance, and shade but not sunscreen. Limitations Self-reported cross-sectional data and unavailable information quantifying regular sun exposure. Conclusion Physicians should emphasize sunburn prevention when counseling patients with previous NMSC, especially younger adults, focusing on shade and sun avoidance over sunscreen. PMID:27198078

  14. Identifying web usage behavior of bank customers

    Science.gov (United States)

    Araya, Sandro; Silva, Mariano; Weber, Richard

    2002-03-01

    The bank Banco Credito e Inversiones (BCI) started its virtual bank in 1996 and its registered customers perform currently more than 10,000 Internet transactions daily, which typically cause les than 10% of traditional transaction costs. Since most of the customers are still not registered for online banking, one of the goals of the virtual bank is to increase then umber of registered customers. Objective of the presented work was to identify customers who are likely to perform online banking but still do not use this medium for their transactions. This objective has been reached by determining profiles of registered customers who perform many transactions online. Based on these profiles the bank's Data Warehouse is explored for twins of these heavy users that are still not registered for online banking. We applied clustering in order to group the registered customers into five classes. One of these classes contained almost 30% of all registered customers and could clearly be identified as class of heavy users. Next a neural network assigned online customers to the previously found five classes. Applying the network trained on online customers to all the bank customers identified twins of heavy users that, however had not performed online transactions so far. A mailing to these candidates informing about the advantages of online banking doubled the number of registrations compared to previous campaigns.

  15. Previous Fractures at Multiple Sites Increase the Risk for Subsequent Fractures: The Global Longitudinal Study of Osteoporosis in Women

    Science.gov (United States)

    Gehlbach, Stephen; Saag, Kenneth G.; Adachi, Jonathan D.; Hooven, Fred H.; Flahive, Julie; Boonen, Steven; Chapurlat, Roland D.; Compston, Juliet E.; Cooper, Cyrus; Díez-Perez, Adolfo; Greenspan, Susan L.; LaCroix, Andrea Z.; Netelenbos, J. Coen; Pfeilschifter, Johannes; Rossini, Maurizio; Roux, Christian; Sambrook, Philip N.; Silverman, Stuart; Siris, Ethel S.; Watts, Nelson B.; Lindsay, Robert

    2016-01-01

    Previous fractures of the hip, spine, or wrist are well-recognized predictors of future fracture, but the role of other fracture sites is less clear. We sought to assess the relationship between prior fracture at 10 skeletal locations and incident fracture. The Global Longitudinal Study of Osteoporosis in Women (GLOW) is an observational cohort study being conducted in 17 physician practices in 10 countries. Women ≥ 55 years answered questionnaires at baseline and at 1 and/or 2 years (fractures in previous year). Of 60,393 women enrolled, follow-up data were available for 51,762. Of these, 17.6%, 4.0%, and 1.6% had suffered 1, 2, or ≥3 fractures since age 45. During the first 2 years of follow-up, 3149 women suffered 3683 incident fractures. Compared with women with no prior fractures, women with 1, 2, or ≥ 3 prior fractures were 1.8-, 3.0-, and 4.8-fold more likely to have any incident fracture; those with ≥3 prior fractures were 9.1-fold more likely to sustain a new vertebral fracture. Nine of 10 prior fracture locations were associated with an incident fracture. The strongest predictors of incident spine and hip fractures were prior spine fracture (hazard ratio 7.3) and hip (hazard ratio 3.5). Prior rib fractures were associated with a 2.3-fold risk of subsequent vertebral fracture, previous upper leg fracture predicted a 2.2-fold increased risk of hip fracture; women with a history of ankle fracture were at 1.8-fold risk of future fracture of a weight-bearing bone. Our findings suggest that a broad range of prior fracture sites are associated with an increased risk of incident fractures, with important implications for clinical assessments and risk model development. PMID:22113888

  16. Identifying Requirements for Effective Human-Automation Teamwork

    Energy Technology Data Exchange (ETDEWEB)

    Jeffrey C. Joe; John O' Hara; Heather D. Medema; Johanna H. Oxstrand

    2014-06-01

    Previous studies have shown that poorly designed human-automation collaboration, such as poorly designed communication protocols, often leads to problems for the human operators, such as: lack of vigilance, complacency, and loss of skills. These problems often lead to suboptimal system performance. To address this situation, a considerable amount of research has been conducted to improve human-automation collaboration and to make automation function better as a “team player.” Much of this research is based on an understanding of what it means to be a good team player from the perspective of a human team. However, the research is often based on a simplified view of human teams and teamwork. In this study, we sought to better understand the capabilities and limitations of automation from the standpoint of human teams. We first examined human teams to identify the principles for effective teamwork. We next reviewed the research on integrating automation agents and human agents into mixed agent teams to identify the limitations of automation agents to conform to teamwork principles. This research resulted in insights that can lead to more effective human-automation collaboration by enabling a more realistic set of requirements to be developed based on the strengths and limitations of all agents.

  17. 75 FR 82329 - Airworthiness Directives; Piper Aircraft, Inc. (Type Certificate Previously Held by The New Piper...

    Science.gov (United States)

    2010-12-30

    ...-1295; Directorate Identifier 2010-CE-060-AD] RIN 2120-AA64 Airworthiness Directives; Piper Aircraft, Inc. (Type Certificate Previously Held by The New Piper Aircraft, Inc.) Models PA-46-310P, PA- 46-350P... applies to certain Piper Aircraft, Inc. Models PA-46-310P and PA-46-350P airplanes that are equipped with...

  18. Genome-wide association study identifies novel breast cancer susceptibility loci

    Science.gov (United States)

    Easton, Douglas F.; Pooley, Karen A.; Dunning, Alison M.; Pharoah, Paul D. P.; Thompson, Deborah; Ballinger, Dennis G.; Struewing, Jeffery P.; Morrison, Jonathan; Field, Helen; Luben, Robert; Wareham, Nicholas; Ahmed, Shahana; Healey, Catherine S.; Bowman, Richard; Meyer, Kerstin B.; Haiman, Christopher A.; Kolonel, Laurence K.; Henderson, Brian E.; Marchand, Loic Le; Brennan, Paul; Sangrajrang, Suleeporn; Gaborieau, Valerie; Odefrey, Fabrice; Shen, Chen-Yang; Wu, Pei-Ei; Wang, Hui-Chun; Eccles, Diana; Evans, D. Gareth; Peto, Julian; Fletcher, Olivia; Johnson, Nichola; Seal, Sheila; Stratton, Michael R.; Rahman, Nazneen; Chenevix-Trench, Georgia; Bojesen, Stig E.; Nordestgaard, Børge G.; Axelsson, Christen K.; Garcia-Closas, Montserrat; Brinton, Louise; Chanock, Stephen; Lissowska, Jolanta; Peplonska, Beata; Nevanlinna, Heli; Fagerholm, Rainer; Eerola, Hannaleena; Kang, Daehee; Yoo, Keun-Young; Noh, Dong-Young; Ahn, Sei-Hyun; Hunter, David J.; Hankinson, Susan E.; Cox, David G.; Hall, Per; Wedren, Sara; Liu, Jianjun; Low, Yen-Ling; Bogdanova, Natalia; Schürmann, Peter; Dörk, Thilo; Tollenaar, Rob A. E. M.; Jacobi, Catharina E.; Devilee, Peter; Klijn, Jan G. M.; Sigurdson, Alice J.; Doody, Michele M.; Alexander, Bruce H.; Zhang, Jinghui; Cox, Angela; Brock, Ian W.; MacPherson, Gordon; Reed, Malcolm W. R.; Couch, Fergus J.; Goode, Ellen L.; Olson, Janet E.; Meijers-Heijboer, Hanne; van den Ouweland, Ans; Uitterlinden, André; Rivadeneira, Fernando; Milne, Roger L.; Ribas, Gloria; Gonzalez-Neira, Anna; Benitez, Javier; Hopper, John L.; McCredie, Margaret; Southey, Melissa; Giles, Graham G.; Schroen, Chris; Justenhoven, Christina; Brauch, Hiltrud; Hamann, Ute; Ko, Yon-Dschun; Spurdle, Amanda B.; Beesley, Jonathan; Chen, Xiaoqing; Mannermaa, Arto; Kosma, Veli-Matti; Kataja, Vesa; Hartikainen, Jaana; Day, Nicholas E.; Cox, David R.; Ponder, Bruce A. J.; Luccarini, Craig; Conroy, Don; Shah, Mitul; Munday, Hannah; Jordan, Clare; Perkins, Barbara; West, Judy; Redman, Karen; Driver, Kristy; Aghmesheh, Morteza; Amor, David; Andrews, Lesley; Antill, Yoland; Armes, Jane; Armitage, Shane; Arnold, Leanne; Balleine, Rosemary; Begley, Glenn; Beilby, John; Bennett, Ian; Bennett, Barbara; Berry, Geoffrey; Blackburn, Anneke; Brennan, Meagan; Brown, Melissa; Buckley, Michael; Burke, Jo; Butow, Phyllis; Byron, Keith; Callen, David; Campbell, Ian; Chenevix-Trench, Georgia; Clarke, Christine; Colley, Alison; Cotton, Dick; Cui, Jisheng; Culling, Bronwyn; Cummings, Margaret; Dawson, Sarah-Jane; Dixon, Joanne; Dobrovic, Alexander; Dudding, Tracy; Edkins, Ted; Eisenbruch, Maurice; Farshid, Gelareh; Fawcett, Susan; Field, Michael; Firgaira, Frank; Fleming, Jean; Forbes, John; Friedlander, Michael; Gaff, Clara; Gardner, Mac; Gattas, Mike; George, Peter; Giles, Graham; Gill, Grantley; Goldblatt, Jack; Greening, Sian; Grist, Scott; Haan, Eric; Harris, Marion; Hart, Stewart; Hayward, Nick; Hopper, John; Humphrey, Evelyn; Jenkins, Mark; Jones, Alison; Kefford, Rick; Kirk, Judy; Kollias, James; Kovalenko, Sergey; Lakhani, Sunil; Leary, Jennifer; Lim, Jacqueline; Lindeman, Geoff; Lipton, Lara; Lobb, Liz; Maclurcan, Mariette; Mann, Graham; Marsh, Deborah; McCredie, Margaret; McKay, Michael; McLachlan, Sue Anne; Meiser, Bettina; Milne, Roger; Mitchell, Gillian; Newman, Beth; O'Loughlin, Imelda; Osborne, Richard; Peters, Lester; Phillips, Kelly; Price, Melanie; Reeve, Jeanne; Reeve, Tony; Richards, Robert; Rinehart, Gina; Robinson, Bridget; Rudzki, Barney; Salisbury, Elizabeth; Sambrook, Joe; Saunders, Christobel; Scott, Clare; Scott, Elizabeth; Scott, Rodney; Seshadri, Ram; Shelling, Andrew; Southey, Melissa; Spurdle, Amanda; Suthers, Graeme; Taylor, Donna; Tennant, Christopher; Thorne, Heather; Townshend, Sharron; Tucker, Kathy; Tyler, Janet; Venter, Deon; Visvader, Jane; Walpole, Ian; Ward, Robin; Waring, Paul; Warner, Bev; Warren, Graham; Watson, Elizabeth; Williams, Rachael; Wilson, Judy; Winship, Ingrid; Young, Mary Ann; Bowtell, David; Green, Adele; deFazio, Anna; Chenevix-Trench, Georgia; Gertig, Dorota; Webb, Penny

    2009-01-01

    Breast cancer exhibits familial aggregation, consistent with variation in genetic susceptibility to the disease. Known susceptibility genes account for less than 25% of the familial risk of breast cancer, and the residual genetic variance is likely to be due to variants conferring more moderate risks. To identify further susceptibility alleles, we conducted a two-stage genome-wide association study in 4,398 breast cancer cases and 4,316 controls, followed by a third stage in which 30 single nucleotide polymorphisms (SNPs) were tested for confirmation in 21,860 cases and 22,578 controls from 22 studies. We used 227,876 SNPs that were estimated to correlate with 77% of known common SNPs in Europeans at r2>0.5. SNPs in five novel independent loci exhibited strong and consistent evidence of association with breast cancer (P<10−7). Four of these contain plausible causative genes (FGFR2, TNRC9, MAP3K1 and LSP1). At the second stage, 1,792 SNPs were significant at the P<0.05 level compared with an estimated 1,343 that would be expected by chance, indicating that many additional common susceptibility alleles may be identifiable by this approach. PMID:17529967

  19. IDENTIFYING MARKETING EFFECTIVENESS METRICS (Case study: East Azerbaijan`s industrial units)

    OpenAIRE

    Faridyahyaie, Reza; Faryabi, Mohammad; Bodaghi Khajeh Noubar, Hossein

    2012-01-01

    The Paper attempts to identify marketing eff ectiveness metrics in industrial units. The metrics investigated in this study are completely applicable and comprehensive, and consequently they can evaluate marketing eff ectiveness in various industries. The metrics studied include: Market Share, Profitability, Sales Growth, Customer Numbers, Customer Satisfaction and Customer Loyalty. The findings indicate that these six metrics are impressive when measuring marketing effectiveness. Data was ge...

  20. Previous experience of family violence and intimate partner violence in pregnancy.

    Science.gov (United States)

    Ludermir, Ana Bernarda; Araújo, Thália Velho Barreto de; Valongueiro, Sandra Alves; Muniz, Maria Luísa Corrêa; Silva, Elisabete Pereira

    2017-01-01

    To estimate differential associations between the exposure to violence in the family of origin and victimization and perpetration of intimate partner violence in pregnancy. A nested case-control study was carried out within a cohort study with 1,120 pregnant women aged 18-49 years old, who were registered in the Family Health Strategy of the city of Recife, State of Pernambuco, Brazil, between 2005 and 2006. The cases were the 233 women who reported intimate partner violence in pregnancy and the controls were the 499 women who did not report it. Partner violence in pregnancy and previous experiences of violence committed by parents or other family members were assessed with a standardized questionnaire. Multivariate logistic regression analyses were modeled to identify differential associations between the exposure to violence in the family of origin and victimization and perpetration of intimate partner violence in pregnancy. Having seen the mother suffer intimate partner violence was associated with physical violence in childhood (OR = 2.62; 95%CI 1.89-3.63) and in adolescence (OR = 1.47; 95%CI 1.01-2.13), sexual violence in childhood (OR = 3.28; 95%CI 1.68-6.38) and intimate partner violence during pregnancy (OR = 1.47; 95% CI 1.01 - 2.12). The intimate partner violence during pregnancy was frequent in women who reported more episodes of physical violence in childhood (OR = 2.08; 95%CI 1.43-3.02) and adolescence (OR = 1.63; 95%CI 1.07-2.47), who suffered sexual violence in childhood (OR = 3.92; 95%CI 1.86-8.27), and who perpetrated violence against the partner (OR = 8.67; 95%CI 4.57-16.45). Experiences of violence committed by parents or other family members emerge as strong risk factors for intimate partner violence in pregnancy. Identifying and understanding protective and risk factors for the emergence of intimate partner violence in pregnancy and its maintenance may help policymakers and health service managers to develop intervention strategies.

  1. Combining modelling and mutagenesis studies of synaptic vesicle protein 2A to identify a series of residues involved in racetam binding.

    Science.gov (United States)

    Shi, Jiye; Anderson, Dina; Lynch, Berkley A; Castaigne, Jean-Gabriel; Foerch, Patrik; Lebon, Florence

    2011-10-01

    LEV (levetiracetam), an antiepileptic drug which possesses a unique profile in animal models of seizure and epilepsy, has as its unique binding site in brain, SV2A (synaptic vesicle protein 2A). Previous studies have used a chimaeric and site-specific mutagenesis approach to identify three residues in the putative tenth transmembrane helix of SV2A that, when mutated, alter binding of LEV and related racetam derivatives to SV2A. In the present paper, we report a combined modelling and mutagenesis study that successfully identifies another 11 residues in SV2A that appear to be involved in ligand binding. Sequence analysis and modelling of SV2A suggested residues equivalent to critical functional residues of other MFS (major facilitator superfamily) transporters. Alanine scanning of these and other SV2A residues resulted in the identification of residues affecting racetam binding, including Ile273 which differentiated between racetam analogues, when mutated to alanine. Integrating mutagenesis results with docking analysis led to the construction of a mutant in which six SV2A residues were replaced with corresponding SV2B residues. This mutant showed racetam ligand-binding affinity intermediate to the affinities observed for SV2A and SV2B.

  2. Previous utilization of service does not improve timely booking in ...

    African Journals Online (AJOL)

    Previous utilization of service does not improve timely booking in antenatal care: Cross sectional study ... Journal Home > Vol 24, No 3 (2010) > ... Results: Past experience on antenatal care service utilization did not come out as a predictor for ...

  3. Impact of previously disadvantaged land-users on sustainable ...

    African Journals Online (AJOL)

    Impact of previously disadvantaged land-users on sustainable agricultural ... about previously disadvantaged land users involved in communal farming systems ... of input, capital, marketing, information and land use planning, with effect on ...

  4. Response to deep TMS in depressive patients with previous electroconvulsive treatment.

    Science.gov (United States)

    Rosenberg, Oded; Zangen, Abraham; Stryjer, Rafael; Kotler, Moshe; Dannon, Pinhas N

    2010-10-01

    The efficacy of transcranial magnetic stimulation (TMS) in the treatment of major depression has already been shown. Novel TMS coils allowing stimulation of deeper brain regions have recently been developed and studied. Our study is aimed at exploring the possible efficacy of deep TMS in patients with resistant depression, who previously underwent electroconvalsive therapy (ECT). Using Brainsway's deep TMS H1 coil, six patients who previously underwent ECT, were treated with 120% power of the motor threshold at a frequency of 20 Hz. Patients underwent five sessions per week, up to 4 weeks. Before the study, patients were evaluated using the Hamilton depression rating scale (HDRS, 24 items), the Hamilton anxiety scale, and the Beck depression inventory and were again evaluated after 5, 10, 15, and 20 daily treatments. Response to treatment was considered a reduction in the HDRS of at least 50%, and remission was considered a reduction of the HDRS-24 below 10 points. Two of six patients responded to the treatment with deep TMS, including one who achieved full remission. Our results suggest the possibility of a subpopulation of depressed patients who may benefit from deep TMS treatment, including patients who did not respond to ECT previously. However, the power of the study is small and similar larger samples are needed. Copyright © 2010 Elsevier Inc. All rights reserved.

  5. Identifying Adverse Drug Events by Relational Learning.

    Science.gov (United States)

    Page, David; Costa, Vítor Santos; Natarajan, Sriraam; Barnard, Aubrey; Peissig, Peggy; Caldwell, Michael

    2012-07-01

    The pharmaceutical industry, consumer protection groups, users of medications and government oversight agencies are all strongly interested in identifying adverse reactions to drugs. While a clinical trial of a drug may use only a thousand patients, once a drug is released on the market it may be taken by millions of patients. As a result, in many cases adverse drug events (ADEs) are observed in the broader population that were not identified during clinical trials. Therefore, there is a need for continued, post-marketing surveillance of drugs to identify previously-unanticipated ADEs. This paper casts this problem as a reverse machine learning task , related to relational subgroup discovery and provides an initial evaluation of this approach based on experiments with an actual EMR/EHR and known adverse drug events.

  6. Influence of previous knowledge in Torrance tests of creative thinking

    OpenAIRE

    Aranguren, María; Consejo Nacional de Investigaciones Científicas y Técnicas CONICET

    2015-01-01

    The aim of this work is to analyze the influence of study field, expertise and recreational activities participation in Torrance Tests of Creative Thinking (TTCT, 1974) performance. Several hypotheses were postulated to explore the possible effects of previous knowledge in TTCT verbal and TTCT figural university students’ outcomes. Participants in this study included 418 students from five study fields: Psychology;Philosophy and Literature, Music; Engineering; and Journalism and Advertisin...

  7. Brief Report: Using the Internet to Identify Persons with Cognitive Impairment for Participation in Clinical Trials

    Directory of Open Access Journals (Sweden)

    Lindsay F. Morra

    2017-04-01

    Full Text Available Identifying, recruiting, and enrolling persons in clinical trials of dementia treatments is extremely difficult. One approach to first-wave screening of potential participants is the use of online assessment tools. Initial studies using the Dementia Risk Assessment (DRA—which includes a previously validated recognition memory test—support the use of this self-administered assessment to identify individuals with “suspected MCI” or “suspected dementia.” In this study, we identified between 71 and 622 persons with suspected dementia and between 128 and 1653 persons with suspected mild cognitive impairment (depending on specific criteria over the course of 22 months. Assessment tools that can inexpensively and easily identify individuals with higher than average risk for cognitive impairment can facilitate recruitment for large-scale clinical trials for dementia treatments.

  8. Determining root correspondence between previously and newly detected objects

    Science.gov (United States)

    Paglieroni, David W.; Beer, N Reginald

    2014-06-17

    A system that applies attribute and topology based change detection to networks of objects that were detected on previous scans of a structure, roadway, or area of interest. The attributes capture properties or characteristics of the previously detected objects, such as location, time of detection, size, elongation, orientation, etc. The topology of the network of previously detected objects is maintained in a constellation database that stores attributes of previously detected objects and implicitly captures the geometrical structure of the network. A change detection system detects change by comparing the attributes and topology of new objects detected on the latest scan to the constellation database of previously detected objects.

  9. 16S rRNA gene-based association study identified microbial taxa associated with pork intramuscular fat content in feces and cecum lumen.

    Science.gov (United States)

    Fang, Shaoming; Xiong, Xingwei; Su, Ying; Huang, Lusheng; Chen, Congying

    2017-07-19

    Intramuscular fat (IMF) that deposits among muscle fibers or within muscle cells is an important meat quality trait in pigs. Previous studies observed the effects of dietary nutrients and additives on improving the pork IMF. Gut microbiome plays an important role in host metabolism and energy harvest. Whether gut microbiota exerts effect on IMF remains unknown. In this study, we investigated the microbial community structure of 500 samples from porcine cecum and feces using high-throughput 16S rRNA gene sequencing. We found that phylogenetic composition and potential function capacity of microbiome varied between two types of samples. Bacteria wide association study identified 119 OTUs significantly associated with IMF in the two types of samples (FDR microbiome associated with IMF might be caused by the IMF-associated microbial taxa. This study firstly evaluated the contribution of gut microbiome to porcine IMF content. The results presented a potential capacity for improving IMF through modulating gut microbiota.

  10. High-throughput respirometric assay identifies predictive toxicophore of mitochondrial injury

    Energy Technology Data Exchange (ETDEWEB)

    Wills, Lauren P. [MitoHealth Inc., Charleston, SC 29403 (United States); Beeson, Gyda C.; Trager, Richard E.; Lindsey, Christopher C. [Department of Drug Discovery and Biomedical Sciences, Medical University of South Carolina, Charleston, SC 29425 (United States); Beeson, Craig C. [MitoHealth Inc., Charleston, SC 29403 (United States); Peterson, Yuri K. [Department of Drug Discovery and Biomedical Sciences, Medical University of South Carolina, Charleston, SC 29425 (United States); Schnellmann, Rick G., E-mail: schnell@musc.edu [Department of Drug Discovery and Biomedical Sciences, Medical University of South Carolina, Charleston, SC 29425 (United States); Ralph H. Johnson VA Medical Center, Charleston, SC 29401 (United States)

    2013-10-15

    Many environmental chemicals and drugs negatively affect human health through deleterious effects on mitochondrial function. Currently there is no chemical library of mitochondrial toxicants, and no reliable methods for predicting mitochondrial toxicity. We hypothesized that discrete toxicophores defined by distinct chemical entities can identify previously unidentified mitochondrial toxicants. We used a respirometric assay to screen 1760 compounds (5 μM) from the LOPAC and ChemBridge DIVERSet libraries. Thirty-one of the assayed compounds decreased uncoupled respiration, a stress test for mitochondrial dysfunction, prior to a decrease in cell viability and reduced the oxygen consumption rate in isolated mitochondria. The mitochondrial toxicants were grouped by chemical similarity and two clusters containing four compounds each were identified. Cheminformatic analysis of one of the clusters identified previously uncharacterized mitochondrial toxicants from the ChemBridge DIVERSet. This approach will enable the identification of mitochondrial toxicants and advance the prediction of mitochondrial toxicity for both drug discovery and risk assessment. - Highlights: • Respirometric assay conducted in RPTC to create mitochondrial toxicant database. • Chemically similar mitochondrial toxicants aligned as mitochondrial toxicophores • Mitochondrial toxicophore identifies five novel mitochondrial toxicants.

  11. High-throughput respirometric assay identifies predictive toxicophore of mitochondrial injury

    International Nuclear Information System (INIS)

    Wills, Lauren P.; Beeson, Gyda C.; Trager, Richard E.; Lindsey, Christopher C.; Beeson, Craig C.; Peterson, Yuri K.; Schnellmann, Rick G.

    2013-01-01

    Many environmental chemicals and drugs negatively affect human health through deleterious effects on mitochondrial function. Currently there is no chemical library of mitochondrial toxicants, and no reliable methods for predicting mitochondrial toxicity. We hypothesized that discrete toxicophores defined by distinct chemical entities can identify previously unidentified mitochondrial toxicants. We used a respirometric assay to screen 1760 compounds (5 μM) from the LOPAC and ChemBridge DIVERSet libraries. Thirty-one of the assayed compounds decreased uncoupled respiration, a stress test for mitochondrial dysfunction, prior to a decrease in cell viability and reduced the oxygen consumption rate in isolated mitochondria. The mitochondrial toxicants were grouped by chemical similarity and two clusters containing four compounds each were identified. Cheminformatic analysis of one of the clusters identified previously uncharacterized mitochondrial toxicants from the ChemBridge DIVERSet. This approach will enable the identification of mitochondrial toxicants and advance the prediction of mitochondrial toxicity for both drug discovery and risk assessment. - Highlights: • Respirometric assay conducted in RPTC to create mitochondrial toxicant database. • Chemically similar mitochondrial toxicants aligned as mitochondrial toxicophores • Mitochondrial toxicophore identifies five novel mitochondrial toxicants

  12. Treatment response in psychotic patients classified according to social and clinical needs, drug side effects, and previous treatment; a method to identify functional remission

    DEFF Research Database (Denmark)

    Alenius, Malin; Hammarlund-Udenaes, Margareta; Honoré, Per Gustaf Hartvig

    2009-01-01

    , fewer psychotic symptoms, and higher rate of workers than those with the worst treatment outcome. CONCLUSION: In the evaluation, CANSEPT showed validity in discriminating the patients of interest and was well tolerated by the patients. CANSEPT could secure inclusion of correct patients in the clinic......BACKGROUND: Various approaches have been made over the years to classify psychotic patients according to inadequate treatment response, using terms such as treatment resistant or treatment refractory. Existing classifications have been criticized for overestimating positive symptoms......; underestimating residual symptoms, negative symptoms, and side effects; or being to open for individual interpretation. The aim of this study was to present and evaluate a new method of classification according to treatment response and, thus, to identify patients in functional remission. METHOD: A naturalistic...

  13. 75 FR 42487 - Supplementary Identifying Information of Previously-Designated Individual, Foreign Narcotics...

    Science.gov (United States)

    2010-07-21

    ... State, and the Secretary of Homeland Security when designating and blocking the property and interests... in, or providing financial or technological support for or to, or providing goods or services in... Agustin, Colombia; DOB 19 Feb 1976; Citizen Colombia; Cedula No. 79928745 (Colombia); Passport AF392658...

  14. Treatment satisfaction with paliperidone extended-release tablets: open-label study in schizophrenia patients dissatisfied with previous antipsychotic medication

    Directory of Open Access Journals (Sweden)

    Yang FD

    2017-04-01

    Full Text Available Fu De Yang,1 Juan Li,1 Yun Long Tan,1 Wei Ye Liang,1 Rongzhen Zhang,1 Ning Wang,1 Wei Feng,1 Shangli Cai,2 Jian Min Zhuo,2 Li Li Zhang2 1Beijing Hui-Long-Guan Hospital, 2Department of Medical Affairs, Xian Janssen Pharmaceutical Ltd, Beijing, People’s Republic of China Objective: The aim of this study was to evaluate the changes in treatment satisfaction after switching to paliperidone extended-release (ER in Chinese schizophrenia patients dissatisfied with their previous antipsychotic treatment.Methods: In this 8-week, open-label, single-arm, multicenter, prospective study, 1,693 patients dissatisfied with previous antipsychotic medication were enrolled and switched to paliperidone ER tablets (3–12 mg/d based on clinical judgment. The primary efficacy end point was change in Medication Satisfaction Questionnaire (MSQ score from baseline to week 8. The secondary end points included percentage of patients with MSQ score ≥4, as well as changes in Clinical Global Improvement-Severity (CGI-S and Personal and Social Performance (PSP scores.Results: MSQ scores increased significantly from baseline (mean [standard deviation {SD}]: 2.48 [0.55] to week 8 (5.47 [0.89], P<0.0001; primary end point, full analysis set. The percentage of patients with MSQ score ≥4 was 95.9% at week 8, indicating that most of the patients were satisfied with their treatment. Significant (P<0.0001 improvements from baseline to week 8 were noted in CGI-S score (2.37 [1.20] and PSP score (25.5 [15.0]. A total of 174 (10.28% patients experienced adverse events (AEs. The most common (>10 patients events were extrapyramidal disorder (n=84, 4.96%, poor quality sleep (n=18, 1.06% and akathisia (n=13, 0.77%. The majority of AEs were mild to moderate in severity. No deaths occurred.Conclusion: Treatment satisfaction improved after switching to paliperidone ER from the previous antipsychotic in Chinese patients with schizophrenia. Keywords: atypical antipsychotics, open label

  15. Identify and Classify Critical Success Factor of Agile Software Development Methodology Using Mind Map

    OpenAIRE

    Tasneem Abd El Hameed; Mahmoud Abd EL Latif; Sherif Kholief

    2016-01-01

    Selecting the right method, right personnel and right practices, and applying them adequately, determine the success of software development. In this paper, a qualitative study is carried out among the critical factors of success from previous studies. The factors of success match with their relative principles to illustrate the most valuable factor for agile approach success, this paper also prove that the twelve principles poorly identified for few factors resulting from qualitative and qua...

  16. Exploration to Identify Professional Dispositions of School Librarians: A Delphi Study

    Science.gov (United States)

    Bush, Gail; Jones, Jami L.

    2010-01-01

    This article reports the findings of an exploratory study to identify professional dispositions of school librarians. The authors employed the Delphi method, a qualitative research method that emphasizes expert knowledge and consensus within a particular field. The Delphi panel consisted of members of the editorial boards of nationally recognized…

  17. FDG-PET and CT patterns of bone metastases and their relationship to previously administered anti-cancer therapy

    International Nuclear Information System (INIS)

    Israel, Ora; Bar-Shalom, Rachel; Keidar, Zohar; Goldberg, Anat; Nachtigal, Alicia; Militianu, Daniela; Fogelman, Ignac

    2006-01-01

    To assess 18 F-fluorodeoxyglucose (FDG) uptake in bone metastases in patients with and without previous treatment, and compare positive positron emission tomography (PET) with osteolytic or osteoblastic changes on computed tomography (CT). One hundred and thirty-one FDG-PET/CT studies were reviewed for bone metastases. A total of 294 lesions were found in 76 patients, 81 in untreated patients and 213 in previously treated patients. PET was assessed for abnormal FDG uptake localised by PET/CT to the skeleton. CT was evaluated for bone metastases and for blastic or lytic pattern. The relationship between the presence and pattern of bone metastases on PET and CT, and prior treatment was statistically analysed using the chi-square test. PET identified 174 (59%) metastases, while CT detected 280 (95%). FDG-avid metastases included 74/81 (91%) untreated and 100/213 (47%) treated lesions (p<0.001). On CT there were 76/81 (94%) untreated and 204/213 (96%) treated metastases (p NS). In untreated patients, 85% of lesions were seen on both PET and CT (26 blastic, 43 lytic). In treated patients, 53% of lesions were seen only on CT (95 blastic, 18 lytic). Of the osteoblastic metastases, 65/174 (37%) were PET positive and 98/120 (82%), PET negative (p<0.001). The results of the present study indicate that when imaging bone metastases, prior treatment can alter the relationship between PET and CT findings. Most untreated bone metastases are PET positive and lytic on CT, while in previously treated patients most lesions are PET negative and blastic on CT. PET and CT therefore appear to be complementary in the assessment of bone metastases. (orig.)

  18. Erlotinib-induced rash spares previously irradiated skin

    International Nuclear Information System (INIS)

    Lips, Irene M.; Vonk, Ernest J.A.; Koster, Mariska E.Y.; Houwing, Ronald H.

    2011-01-01

    Erlotinib is an epidermal growth factor receptor inhibitor prescribed to patients with locally advanced or metastasized non-small cell lung carcinoma after failure of at least one earlier chemotherapy treatment. Approximately 75% of the patients treated with erlotinib develop acneiform skin rashes. A patient treated with erlotinib 3 months after finishing concomitant treatment with chemotherapy and radiotherapy for non-small cell lung cancer is presented. Unexpectedly, the part of the skin that had been included in his previously radiotherapy field was completely spared from the erlotinib-induced acneiform skin rash. The exact mechanism of erlotinib-induced rash sparing in previously irradiated skin is unclear. The underlying mechanism of this phenomenon needs to be explored further, because the number of patients being treated with a combination of both therapeutic modalities is increasing. The therapeutic effect of erlotinib in the area of the previously irradiated lesion should be assessed. (orig.)

  19. Nine Loci for Ocular Axial Length Identified through Genome-wide Association Studies, Including Shared Loci with Refractive Error

    Science.gov (United States)

    Cheng, Ching-Yu; Schache, Maria; Ikram, M. Kamran; Young, Terri L.; Guggenheim, Jeremy A.; Vitart, Veronique; MacGregor, Stuart; Verhoeven, Virginie J.M.; Barathi, Veluchamy A.; Liao, Jiemin; Hysi, Pirro G.; Bailey-Wilson, Joan E.; St. Pourcain, Beate; Kemp, John P.; McMahon, George; Timpson, Nicholas J.; Evans, David M.; Montgomery, Grant W.; Mishra, Aniket; Wang, Ya Xing; Wang, Jie Jin; Rochtchina, Elena; Polasek, Ozren; Wright, Alan F.; Amin, Najaf; van Leeuwen, Elisabeth M.; Wilson, James F.; Pennell, Craig E.; van Duijn, Cornelia M.; de Jong, Paulus T.V.M.; Vingerling, Johannes R.; Zhou, Xin; Chen, Peng; Li, Ruoying; Tay, Wan-Ting; Zheng, Yingfeng; Chew, Merwyn; Rahi, Jugnoo S.; Hysi, Pirro G.; Yoshimura, Nagahisa; Yamashiro, Kenji; Miyake, Masahiro; Delcourt, Cécile; Maubaret, Cecilia; Williams, Cathy; Guggenheim, Jeremy A.; Northstone, Kate; Ring, Susan M.; Davey-Smith, George; Craig, Jamie E.; Burdon, Kathryn P.; Fogarty, Rhys D.; Iyengar, Sudha K.; Igo, Robert P.; Chew, Emily; Janmahasathian, Sarayut; Iyengar, Sudha K.; Igo, Robert P.; Chew, Emily; Janmahasathian, Sarayut; Stambolian, Dwight; Wilson, Joan E. Bailey; MacGregor, Stuart; Lu, Yi; Jonas, Jost B.; Xu, Liang; Saw, Seang-Mei; Baird, Paul N.; Rochtchina, Elena; Mitchell, Paul; Wang, Jie Jin; Jonas, Jost B.; Nangia, Vinay; Hayward, Caroline; Wright, Alan F.; Vitart, Veronique; Polasek, Ozren; Campbell, Harry; Vitart, Veronique; Rudan, Igor; Vatavuk, Zoran; Vitart, Veronique; Paterson, Andrew D.; Hosseini, S. Mohsen; Iyengar, Sudha K.; Igo, Robert P.; Fondran, Jeremy R.; Young, Terri L.; Feng, Sheng; Verhoeven, Virginie J.M.; Klaver, Caroline C.; van Duijn, Cornelia M.; Metspalu, Andres; Haller, Toomas; Mihailov, Evelin; Pärssinen, Olavi; Wedenoja, Juho; Wilson, Joan E. Bailey; Wojciechowski, Robert; Baird, Paul N.; Schache, Maria; Pfeiffer, Norbert; Höhn, René; Pang, Chi Pui; Chen, Peng; Meitinger, Thomas; Oexle, Konrad; Wegner, Aharon; Yoshimura, Nagahisa; Yamashiro, Kenji; Miyake, Masahiro; Pärssinen, Olavi; Yip, Shea Ping; Ho, Daniel W.H.; Pirastu, Mario; Murgia, Federico; Portas, Laura; Biino, Genevra; Wilson, James F.; Fleck, Brian; Vitart, Veronique; Stambolian, Dwight; Wilson, Joan E. Bailey; Hewitt, Alex W.; Ang, Wei; Verhoeven, Virginie J.M.; Klaver, Caroline C.; van Duijn, Cornelia M.; Saw, Seang-Mei; Wong, Tien-Yin; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Wong, Tien-Yin; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Wong, Tien-Yin; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Tai, E-Shyong; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Mackey, David A.; MacGregor, Stuart; Hammond, Christopher J.; Hysi, Pirro G.; Deangelis, Margaret M.; Morrison, Margaux; Zhou, Xiangtian; Chen, Wei; Paterson, Andrew D.; Hosseini, S. Mohsen; Mizuki, Nobuhisa; Meguro, Akira; Lehtimäki, Terho; Mäkelä, Kari-Matti; Raitakari, Olli; Kähönen, Mika; Burdon, Kathryn P.; Craig, Jamie E.; Iyengar, Sudha K.; Igo, Robert P.; Lass, Jonathan H.; Reinhart, William; Belin, Michael W.; Schultze, Robert L.; Morason, Todd; Sugar, Alan; Mian, Shahzad; Soong, Hunson Kaz; Colby, Kathryn; Jurkunas, Ula; Yee, Richard; Vital, Mark; Alfonso, Eduardo; Karp, Carol; Lee, Yunhee; Yoo, Sonia; Hammersmith, Kristin; Cohen, Elisabeth; Laibson, Peter; Rapuano, Christopher; Ayres, Brandon; Croasdale, Christopher; Caudill, James; Patel, Sanjay; Baratz, Keith; Bourne, William; Maguire, Leo; Sugar, Joel; Tu, Elmer; Djalilian, Ali; Mootha, Vinod; McCulley, James; Bowman, Wayne; Cavanaugh, H. Dwight; Verity, Steven; Verdier, David; Renucci, Ann; Oliva, Matt; Rotkis, Walter; Hardten, David R.; Fahmy, Ahmad; Brown, Marlene; Reeves, Sherman; Davis, Elizabeth A.; Lindstrom, Richard; Hauswirth, Scott; Hamilton, Stephen; Lee, W. Barry; Price, Francis; Price, Marianne; Kelly, Kathleen; Peters, Faye; Shaughnessy, Michael; Steinemann, Thomas; Dupps, B.J.; Meisler, David M.; Mifflin, Mark; Olson, Randal; Aldave, Anthony; Holland, Gary; Mondino, Bartly J.; Rosenwasser, George; Gorovoy, Mark; Dunn, Steven P.; Heidemann, David G.; Terry, Mark; Shamie, Neda; Rosenfeld, Steven I.; Suedekum, Brandon; Hwang, David; Stone, Donald; Chodosh, James; Galentine, Paul G.; Bardenstein, David; Goddard, Katrina; Chin, Hemin; Mannis, Mark; Varma, Rohit; Borecki, Ingrid; Chew, Emily Y.; Haller, Toomas; Mihailov, Evelin; Metspalu, Andres; Wedenoja, Juho; Simpson, Claire L.; Wojciechowski, Robert; Höhn, René; Mirshahi, Alireza; Zeller, Tanja; Pfeiffer, Norbert; Lackner, Karl J.; Donnelly, Peter; Barroso, Ines; Blackwell, Jenefer M.; Bramon, Elvira; Brown, Matthew A.; Casas, Juan P.; Corvin, Aiden; Deloukas, Panos; Duncanson, Audrey; Jankowski, Janusz; Markus, Hugh S.; Mathew, Christopher G.; Palmer, Colin N.A.; Plomin, Robert; Rautanen, Anna; Sawcer, Stephen J.; Trembath, Richard C.; Viswanathan, Ananth C.; Wood, Nicholas W.; Spencer, Chris C.A.; Band, Gavin; Bellenguez, Céline; Freeman, Colin; Hellenthal, Garrett; Giannoulatou, Eleni; Pirinen, Matti; Pearson, Richard; Strange, Amy; Su, Zhan; Vukcevic, Damjan; Donnelly, Peter; Langford, Cordelia; Hunt, Sarah E.; Edkins, Sarah; Gwilliam, Rhian; Blackburn, Hannah; Bumpstead, Suzannah J.; Dronov, Serge; Gillman, Matthew; Gray, Emma; Hammond, Naomi; Jayakumar, Alagurevathi; McCann, Owen T.; Liddle, Jennifer; Potter, Simon C.; Ravindrarajah, Radhi; Ricketts, Michelle; Waller, Matthew; Weston, Paul; Widaa, Sara; Whittaker, Pamela; Barroso, Ines; Deloukas, Panos; Mathew, Christopher G.; Blackwell, Jenefer M.; Brown, Matthew A.; Corvin, Aiden; Spencer, Chris C.A.; Bettecken, Thomas; Meitinger, Thomas; Oexle, Konrad; Pirastu, Mario; Portas, Laura; Nag, Abhishek; Williams, Katie M.; Yonova-Doing, Ekaterina; Klein, Ronald; Klein, Barbara E.; Hosseini, S. Mohsen; Paterson, Andrew D.; Genuth, S.; Nathan, D.M.; Zinman, B.; Crofford, O.; Crandall, J.; Reid, M.; Brown-Friday, J.; Engel, S.; Sheindlin, J.; Martinez, H.; Shamoon, H.; Engel, H.; Phillips, M.; Gubitosi-Klug, R.; Mayer, L.; Pendegast, S.; Zegarra, H.; Miller, D.; Singerman, L.; Smith-Brewer, S.; Novak, M.; Quin, J.; Dahms, W.; Genuth, Saul; Palmert, M.; Brillon, D.; Lackaye, M.E.; Kiss, S.; Chan, R.; Reppucci, V.; Lee, T.; Heinemann, M.; Whitehouse, F.; Kruger, D.; Jones, J.K.; McLellan, M.; Carey, J.D.; Angus, E.; Thomas, A.; Galprin, A.; Bergenstal, R.; Johnson, M.; Spencer, M.; Morgan, K.; Etzwiler, D.; Kendall, D.; Aiello, Lloyd Paul; Golden, E.; Jacobson, A.; Beaser, R.; Ganda, O.; Hamdy, O.; Wolpert, H.; Sharuk, G.; Arrigg, P.; Schlossman, D.; Rosenzwieg, J.; Rand, L.; Nathan, D.M.; Larkin, M.; Ong, M.; Godine, J.; Cagliero, E.; Lou, P.; Folino, K.; Fritz, S.; Crowell, S.; Hansen, K.; Gauthier-Kelly, C.; Service, J.; Ziegler, G.; Luttrell, L.; Caulder, S.; Lopes-Virella, M.; Colwell, J.; Soule, J.; Fernandes, J.; Hermayer, K.; Kwon, S.; Brabham, M.; Blevins, A.; Parker, J.; Lee, D.; Patel, N.; Pittman, C.; Lindsey, P.; Bracey, M.; Lee, K.; Nutaitis, M.; Farr, A.; Elsing, S.; Thompson, T.; Selby, J.; Lyons, T.; Yacoub-Wasef, S.; Szpiech, M.; Wood, D.; Mayfield, R.; Molitch, M.; Schaefer, B.; Jampol, L.; Lyon, A.; Gill, M.; Strugula, Z.; Kaminski, L.; Mirza, R.; Simjanoski, E.; Ryan, D.; Kolterman, O.; Lorenzi, G.; Goldbaum, M.; Sivitz, W.; Bayless, M.; Counts, D.; Johnsonbaugh, S.; Hebdon, M.; Salemi, P.; Liss, R.; Donner, T.; Gordon, J.; Hemady, R.; Kowarski, A.; Ostrowski, D.; Steidl, S.; Jones, B.; Herman, W.H.; Martin, C.L.; Pop-Busui, R.; Sarma, A.; Albers, J.; Feldman, E.; Kim, K.; Elner, S.; Comer, G.; Gardner, T.; Hackel, R.; Prusak, R.; Goings, L.; Smith, A.; Gothrup, J.; Titus, P.; Lee, J.; Brandle, M.; Prosser, L.; Greene, D.A.; Stevens, M.J.; Vine, A.K.; Bantle, J.; Wimmergren, N.; Cochrane, A.; Olsen, T.; Steuer, E.; Rath, P.; Rogness, B.; Hainsworth, D.; Goldstein, D.; Hitt, S.; Giangiacomo, J.; Schade, D.S.; Canady, J.L.; Chapin, J.E.; Ketai, L.H.; Braunstein, C.S.; Bourne, P.A.; Schwartz, S.; Brucker, A.; Maschak-Carey, B.J.; Baker, L.; Orchard, T.; Silvers, N.; Ryan, C.; Songer, T.; Doft, B.; Olson, S.; Bergren, R.L.; Lobes, L.; Rath, P. Paczan; Becker, D.; Rubinstein, D.; Conrad, P.W.; Yalamanchi, S.; Drash, A.; Morrison, A.; Bernal, M.L.; Vaccaro-Kish, J.; Malone, J.; Pavan, P.R.; Grove, N.; Iyer, M.N.; Burrows, A.F.; Tanaka, E.A.; Gstalder, R.; Dagogo-Jack, S.; Wigley, C.; Ricks, H.; Kitabchi, A.; Murphy, M.B.; Moser, S.; Meyer, D.; Iannacone, A.; Chaum, E.; Yoser, S.; Bryer-Ash, M.; Schussler, S.; Lambeth, H.; Raskin, P.; Strowig, S.; Zinman, B.; Barnie, A.; Devenyi, R.; Mandelcorn, M.; Brent, M.; Rogers, S.; Gordon, A.; Palmer, J.; Catton, S.; Brunzell, J.; Wessells, H.; de Boer, I.H.; Hokanson, J.; Purnell, J.; Ginsberg, J.; Kinyoun, J.; Deeb, S.; Weiss, M.; Meekins, G.; Distad, J.; Van Ottingham, L.; Dupre, J.; Harth, J.; Nicolle, D.; Driscoll, M.; Mahon, J.; Canny, C.; May, M.; Lipps, J.; Agarwal, A.; Adkins, T.; Survant, L.; Pate, R.L.; Munn, G.E.; Lorenz, R.; Feman, S.; White, N.; Levandoski, L.; Boniuk, I.; Grand, G.; Thomas, M.; Joseph, D.D.; Blinder, K.; Shah, G.; Boniuk; Burgess; Santiago, J.; Tamborlane, W.; Gatcomb, P.; Stoessel, K.; Taylor, K.; Goldstein, J.; Novella, S.; Mojibian, H.; Cornfeld, D.; Lima, J.; Bluemke, D.; Turkbey, E.; van der Geest, R.J.; Liu, C.; Malayeri, A.; Jain, A.; Miao, C.; Chahal, H.; Jarboe, R.; Maynard, J.; Gubitosi-Klug, R.; Quin, J.; Gaston, P.; Palmert, M.; Trail, R.; Dahms, W.; Lachin, J.; Cleary, P.; Backlund, J.; Sun, W.; Braffett, B.; Klumpp, K.; Chan, K.; Diminick, L.; Rosenberg, D.; Petty, B.; Determan, A.; Kenny, D.; Rutledge, B.; Younes, Naji; Dews, L.; Hawkins, M.; Cowie, C.; Fradkin, J.; Siebert, C.; Eastman, R.; Danis, R.; Gangaputra, S.; Neill, S.; Davis, M.; Hubbard, L.; Wabers, H.; Burger, M.; Dingledine, J.; Gama, V.; Sussman, R.; Steffes, M.; Bucksa, J.; Nowicki, M.; Chavers, B.; O’Leary, D.; Polak, J.; Harrington, A.; Funk, L.; Crow, R.; Gloeb, B.; Thomas, S.; O’Donnell, C.; Soliman, E.; Zhang, Z.M.; Prineas, R.; Campbell, C.; Ryan, C.; Sandstrom, D.; Williams, T.; Geckle, M.; Cupelli, E.; Thoma, F.; Burzuk, B.; Woodfill, T.; Low, P.; Sommer, C.; Nickander, K.; Budoff, M.; Detrano, R.; Wong, N.; Fox, M.; Kim, L.; Oudiz, R.; Weir, G.; Espeland, M.; Manolio, T.; Rand, L.; Singer, D.; Stern, M.; Boulton, A.E.; Clark, C.; D’Agostino, R.; Lopes-Virella, M.; Garvey, W.T.; Lyons, T.J.; Jenkins, A.; Virella, G.; Jaffa, A.; Carter, Rickey; Lackland, D.; Brabham, M.; McGee, D.; Zheng, D.; Mayfield, R.K.; Boright, A.; Bull, S.; Sun, L.; Scherer, S.; Zinman, B.; Natarajan, R.; Miao, F.; Zhang, L.; Chen;, Z.; Nathan, D.M.; Makela, Kari-Matti; Lehtimaki, Terho; Kahonen, Mika; Raitakari, Olli; Yoshimura, Nagahisa; Matsuda, Fumihiko; Chen, Li Jia; Pang, Chi Pui; Yip, Shea Ping; Yap, Maurice K.H.; Meguro, Akira; Mizuki, Nobuhisa; Inoko, Hidetoshi; Foster, Paul J.; Zhao, Jing Hua; Vithana, Eranga; Tai, E-Shyong; Fan, Qiao; Xu, Liang; Campbell, Harry; Fleck, Brian; Rudan, Igor; Aung, Tin; Hofman, Albert; Uitterlinden, André G.; Bencic, Goran; Khor, Chiea-Chuen; Forward, Hannah; Pärssinen, Olavi; Mitchell, Paul; Rivadeneira, Fernando; Hewitt, Alex W.; Williams, Cathy; Oostra, Ben A.; Teo, Yik-Ying; Hammond, Christopher J.; Stambolian, Dwight; Mackey, David A.; Klaver, Caroline C.W.; Wong, Tien-Yin; Saw, Seang-Mei; Baird, Paul N.

    2013-01-01

    Refractive errors are common eye disorders of public health importance worldwide. Ocular axial length (AL) is the major determinant of refraction and thus of myopia and hyperopia. We conducted a meta-analysis of genome-wide association studies for AL, combining 12,531 Europeans and 8,216 Asians. We identified eight genome-wide significant loci for AL (RSPO1, C3orf26, LAMA2, GJD2, ZNRF3, CD55, MIP, and ALPPL2) and confirmed one previously reported AL locus (ZC3H11B). Of the nine loci, five (LAMA2, GJD2, CD55, ALPPL2, and ZC3H11B) were associated with refraction in 18 independent cohorts (n = 23,591). Differential gene expression was observed for these loci in minus-lens-induced myopia mouse experiments and human ocular tissues. Two of the AL genes, RSPO1 and ZNRF3, are involved in Wnt signaling, a pathway playing a major role in the regulation of eyeball size. This study provides evidence of shared genes between AL and refraction, but importantly also suggests that these traits may have unique pathways. PMID:24144296

  20. Quantifying the influence of previously burned areas on suppression effectiveness and avoided exposure: A case study of the Las Conchas Fire

    Science.gov (United States)

    Matthew P. Thompson; Patrick Freeborn; Jon D. Rieck; Dave Calkin; Julie W. Gilbertson-Day; Mark A. Cochrane; Michael S. Hand

    2016-01-01

    We present a case study of the Las Conchas Fire (2011) to explore the role of previously burned areas (wildfires and prescribed fires) on suppression effectiveness and avoided exposure. Methodological innovations include characterisation of the joint dynamics of fire growth and suppression activities, development of a fire line effectiveness framework, and...

  1. Enhanced Morbidity of Pectoralis Major Myocutaneous Flap Used for Salvage after Previously Failed Oncological Treatment and Unsuccessful Reconstructive Head and Neck Surgery

    Directory of Open Access Journals (Sweden)

    Christiana Maria Ribeiro Salles Vanni

    2012-01-01

    Full Text Available Introduction. The reconstruction of complex cervicofacial defects arising from surgical treatment for cancer is a real challenge for head and neck surgeons, especially in salvage reconstruction surgery and/or failed previous reconstruction. The pectoralis major myocutaneous flap (PMMF has been widely used in these specific situations due to its reliability and low rate of failure or complications. Objectives. Identify factors that determine complications and influence the final outcome of the reconstructions with PMMF in salvage cancer surgery or in salvage reconstruction. Methods. A cross-sectional study design was used to evaluate a sample including 17 surgical patients treated over a period of ten years that met the inclusion criteria. Results. Reconstruction was successful in 13 cases (76.5%, with two cases of partial flap loss and no case of total loss. Complications occurred in 13 cases (76.5% and were specifically related to the flap in nine instances (52.9%. An association was identified between the development of major complications and reconstruction of the hypopharynx (=0.013 as well as in patients submitted to surgery in association with radiation therapy as a previous cancer treatment (=0.002. The former condition is also associated with major reconstruction failure (=0.018. An even lower incidence of major complications was noted in patients under the age of 53 (=0.044. Conclusion. Older patients, with hypopharyngeal defects and submitted to previous surgery plus radiation therapy, presented a higher risk of complications and reconstruction failure with PMMF.

  2. Genome-Wide Association Studies Identify Candidate Genes for Coat Color and Mohair Traits in the Iranian Markhoz Goat

    Directory of Open Access Journals (Sweden)

    Anahit Nazari-Ghadikolaei

    2018-04-01

    Full Text Available The Markhoz goat provides an opportunity to study the genetics underlying coat color and mohair traits of an Angora type goat using genome-wide association studies (GWAS. This indigenous Iranian breed is valued for its quality mohair used in ceremonial garments and has the distinction of exhibiting an array of coat colors including black, brown, and white. Here, we performed 16 GWAS for different fleece (mohair traits and coat color in 228 Markhoz goats sampled from the Markhoz Goat Research Station in Sanandaj, Kurdistan province, located in western Iran using the Illumina Caprine 50K beadchip. The Efficient Mixed Model Linear analysis was used to identify genomic regions with potential candidate genes contributing to coat color and mohair characteristics while correcting for population structure. Significant associations to coat color were found within or near the ASIP, ITCH, AHCY, and RALY genes on chromosome 13 for black and brown coat color and the KIT and PDGFRA genes on chromosome 6 for white coat color. Individual mohair traits were analyzed for genetic association along with principal components that allowed for a broader perspective of combined traits reflecting overall mohair quality and volume. A multitude of markers demonstrated significant association to mohair traits highlighting potential candidate genes of POU1F1 on chromosome 1 for mohair quality, MREG on chromosome 2 for mohair volume, DUOX1 on chromosome 10 for yearling fleece weight, and ADGRV1 on chromosome 7 for grease percentage. Variation in allele frequencies and haplotypes were identified for coat color and differentiated common markers associated with both brown and black coat color. This demonstrates the potential for genetic markers to be used in future breeding programs to improve selection for coat color and mohair traits. Putative candidate genes, both novel and previously identified in other species or breeds, require further investigation to confirm phenotypic

  3. Dissociation in decision bias mechanism between probabilistic information and previous decision

    Directory of Open Access Journals (Sweden)

    Yoshiyuki eKaneko

    2015-05-01

    Full Text Available Target detection performance is known to be influenced by events in the previous trials. It has not been clear, however, whether this bias effect is due to the previous sensory stimulus, motor response, or decision. Also it remains open whether or not the previous trial effect emerges via the same mechanism as the effect of knowledge about the target probability. In the present study, we asked normal human subjects to make a decision about the presence or absence of a visual target. We presented a pre-cue indicating the target probability before the stimulus, and also a decision-response mapping cue after the stimulus so as to tease apart the effect of decision from that of motor response. We found that the target detection performance was significantly affected by the probability cue in the current trial and also by the decision in the previous trial. While the information about the target probability modulated the decision criteria, the previous decision modulated the sensitivity to target-relevant sensory signals (d-prime. Using functional magnetic resonance imaging, we also found that activation in the left intraparietal sulcus was decreased when the probability cue indicated a high probability of the target. By contrast, activation in the right inferior frontal gyrus was increased when the subjects made a target-present decision in the previous trial, but this change was observed specifically when the target was present in the current trial. Activation in these regions was associated with individual-difference in the decision computation parameters. We argue that the previous decision biases the target detection performance by modulating the processing of target-selective information, and this mechanism is distinct from modulation of decision criteria due to expectation of a target.

  4. Dissociation in decision bias mechanism between probabilistic information and previous decision

    Science.gov (United States)

    Kaneko, Yoshiyuki; Sakai, Katsuyuki

    2015-01-01

    Target detection performance is known to be influenced by events in the previous trials. It has not been clear, however, whether this bias effect is due to the previous sensory stimulus, motor response, or decision. Also it remains open whether or not the previous trial effect emerges via the same mechanism as the effect of knowledge about the target probability. In the present study, we asked normal human subjects to make a decision about the presence or absence of a visual target. We presented a pre-cue indicating the target probability before the stimulus, and also a decision-response mapping cue after the stimulus so as to tease apart the effect of decision from that of motor response. We found that the target detection performance was significantly affected by the probability cue in the current trial and also by the decision in the previous trial. While the information about the target probability modulated the decision criteria, the previous decision modulated the sensitivity to target-relevant sensory signals (d-prime). Using functional magnetic resonance imaging (fMRI), we also found that activation in the left intraparietal sulcus (IPS) was decreased when the probability cue indicated a high probability of the target. By contrast, activation in the right inferior frontal gyrus (IFG) was increased when the subjects made a target-present decision in the previous trial, but this change was observed specifically when the target was present in the current trial. Activation in these regions was associated with individual-difference in the decision computation parameters. We argue that the previous decision biases the target detection performance by modulating the processing of target-selective information, and this mechanism is distinct from modulation of decision criteria due to expectation of a target. PMID:25999844

  5. Identifying desertification risk areas using fuzzy membership and geospatial technique - A case study, Kota District, Rajasthan

    Science.gov (United States)

    Dasgupta, Arunima; Sastry, K. L. N.; Dhinwa, P. S.; Rathore, V. S.; Nathawat, M. S.

    2013-08-01

    Desertification risk assessment is important in order to take proper measures for its prevention. Present research intends to identify the areas under risk of desertification along with their severity in terms of degradation in natural parameters. An integrated model with fuzzy membership analysis, fuzzy rule-based inference system and geospatial techniques was adopted, including five specific natural parameters namely slope, soil pH, soil depth, soil texture and NDVI. Individual parameters were classified according to their deviation from mean. Membership of each individual values to be in a certain class was derived using the normal probability density function of that class. Thus if a single class of a single parameter is with mean μ and standard deviation σ, the values falling beyond μ + 2 σ and μ - 2 σ are not representing that class, but a transitional zone between two subsequent classes. These are the most important areas in terms of degradation, as they have the lowest probability to be in a certain class, hence highest probability to be extended or narrowed down in next or previous class respectively. Eventually, these are the values which can be easily altered, under extrogenic influences, hence are identified as risk areas. The overall desertification risk is derived by incorporating the different risk severity of each parameter using fuzzy rule-based interference system in GIS environment. Multicriteria based geo-statistics are applied to locate the areas under different severity of desertification risk. The study revealed that in Kota, various anthropogenic pressures are accelerating land deterioration, coupled with natural erosive forces. Four major sources of desertification in Kota are, namely Gully and Ravine erosion, inappropriate mining practices, growing urbanization and random deforestation.

  6. Validation of de-identified record linkage to ascertain hospital admissions in a cohort study

    Directory of Open Access Journals (Sweden)

    English Dallas R

    2011-04-01

    Full Text Available Abstract Background Cohort studies can provide valuable evidence of cause and effect relationships but are subject to loss of participants over time, limiting the validity of findings. Computerised record linkage offers a passive and ongoing method of obtaining health outcomes from existing routinely collected data sources. However, the quality of record linkage is reliant upon the availability and accuracy of common identifying variables. We sought to develop and validate a method for linking a cohort study to a state-wide hospital admissions dataset with limited availability of unique identifying variables. Methods A sample of 2000 participants from a cohort study (n = 41 514 was linked to a state-wide hospitalisations dataset in Victoria, Australia using the national health insurance (Medicare number and demographic data as identifying variables. Availability of the health insurance number was limited in both datasets; therefore linkage was undertaken both with and without use of this number and agreement tested between both algorithms. Sensitivity was calculated for a sub-sample of 101 participants with a hospital admission confirmed by medical record review. Results Of the 2000 study participants, 85% were found to have a record in the hospitalisations dataset when the national health insurance number and sex were used as linkage variables and 92% when demographic details only were used. When agreement between the two methods was tested the disagreement fraction was 9%, mainly due to "false positive" links when demographic details only were used. A final algorithm that used multiple combinations of identifying variables resulted in a match proportion of 87%. Sensitivity of this final linkage was 95%. Conclusions High quality record linkage of cohort data with a hospitalisations dataset that has limited identifiers can be achieved using combinations of a national health insurance number and demographic data as identifying variables.

  7. Genome-wide association study identifies 74 loci associated with educational attainment

    OpenAIRE

    Okbay, Aysu; Beauchamp, Jonathan; Fontana, M.A. (Mark Alan); Lee, James J.; Pers, Tune; Rietveld, C.A. (Cornelius A.); Turley, Patrick; Chen, G.-B. (Guo-Bo); Emilsson, Valur; Meddens, S.F.W. (S. Fleur W.); Oskarsson, S. (Sven); Pickrell, J.K. (Joseph K.); Thom, K. (Kevin); Timshel, P. (Pascal); Vlaming, Ronald

    2016-01-01

    textabstractEducational attainment is strongly influenced by social and other environmental factors, but genetic factors are estimated to account for at least 20% of the variation across individuals. Here we report the results of a genome-wide association study (GWAS) for educational attainment that extends our earlier discovery sample of 101,069 individuals to 293,723 individuals, and a replication study in an independent sample of 111,349 individuals from the UK Biobank. We identify 74 geno...

  8. Predictive effects of previous episodes on the risk of recurrence in depressive and bipolar disorders

    DEFF Research Database (Denmark)

    Kessing, Lars Vedel; Andersen, Per Kragh

    2005-01-01

    Findings from several studies have suggested that the risk of recurrence increases with the number of previous episodes in depressive and bipolar disorders. However, a comprehensive and critical review of the literature published during the past century shows that in several previous studies...

  9. Chromosome 17 alterations identify good-risk and poor-risk tumors independently of clinical factors in medulloblastoma

    Science.gov (United States)

    McCabe, Martin G.; Bäcklund, L. Magnus; Leong, Hui Sun; Ichimura, Koichi; Collins, V. Peter

    2011-01-01

    Current risk stratification schemas for medulloblastoma, based on combinations of clinical variables and histotype, fail to accurately identify particularly good- and poor-risk tumors. Attempts have been made to improve discriminatory power by combining clinical variables with cytogenetic data. We report here a pooled analysis of all previous reports of chromosomal copy number related to survival data in medulloblastoma. We collated data from previous reports that explicitly quoted survival data and chromosomal copy number in medulloblastoma. We analyzed the relative prognostic significance of currently used clinical risk stratifiers and the chromosomal aberrations previously reported to correlate with survival. In the pooled dataset metastatic disease, incomplete tumor resection and severe anaplasia were associated with poor outcome, while young age at presentation was not prognostically significant. Of the chromosomal variables studied, isolated 17p loss and gain of 1q correlated with poor survival. Gain of 17q without associated loss of 17p showed a trend to improved outcome. The most commonly reported alteration, isodicentric chromosome 17, was not prognostically significant. Sequential multivariate models identified isolated 17p loss, isolated 17q gain, and 1q gain as independent prognostic factors. In a historical dataset, we have identified isolated 17p loss as a marker of poor outcome and 17q gain as a novel putative marker of good prognosis. Biological markers of poor-risk and good-risk tumors will be critical in stratifying treatment in future trials. Our findings should be prospectively validated independently in future clinical studies. PMID:21292688

  10. Newly Identified CYP2C93 Is a Functional Enzyme in Rhesus Monkey, but Not in Cynomolgus Monkey

    OpenAIRE

    Uno, Yasuhiro; Uehara, Shotaro; Kohara, Sakae; Iwasaki, Kazuhide; Nagata, Ryoichi; Fukuzaki, Koichiro; Utoh, Masahiro; Murayama, Norie; Yamazaki, Hiroshi

    2011-01-01

    Cynomolgus monkey and rhesus monkey are used in drug metabolism studies due to their evolutionary closeness and physiological resemblance to human. In cynomolgus monkey, we previously identified cytochrome P450 (P450 or CYP) 2C76 that does not have a human ortholog and is partly responsible for species differences in drug metabolism between cynomolgus monkey and human. In this study, we report characterization of CYP2C93 cDNA newly identified in cynomolgus monkey and rhesus monkey. The CYP2C9...

  11. Assessment of the Relationship between Recurrent High-risk Pregnancy and Mothers’ Previous Experience of Having an Infant Admitted to a Neonatal Intensive Care Unit

    Directory of Open Access Journals (Sweden)

    Sedigheh Hantoosh Zadeh

    2015-01-01

    Full Text Available Background & aim:  High-risk pregnancies increase the risk of Intensive Care Unit (ICU and Neonatal Intensive Care Unit (NICU admission in mothers and their newborns. In this study, we aimed to identify the association between the recurrence of high-risk pregnancy and mothers’ previous experience of having an infant admitted to NICU. Methods:We performed a cohort, retrospective study to compare subsequent pregnancy outcomes among 232 control subjects and 200 female cases with a previous experience of having a newborn requiring NICU admission due to intrauterine growth retardation, preeclampsia, preterm birth, premature rupture of membranes, and asphyxia. The information about the prevalence of subsequent high-risk pregnancies was gathered via phone calls. Results: As the results indicated, heparin, progesterone, and aspirin were more frequently administered in the case group during subsequent pregnancies, compared to the control group (P

  12. Automatic electromagnetic valve for previous vacuum

    International Nuclear Information System (INIS)

    Granados, C. E.; Martin, F.

    1959-01-01

    A valve which permits the maintenance of an installation vacuum when electric current fails is described. It also lets the air in the previous vacuum bomb to prevent the oil ascending in the vacuum tubes. (Author)

  13. Infectivity of HBV DNA positive donations identified in look-back studies in Hyogo-Prefecture, Japan.

    Science.gov (United States)

    Bouike, Y; Imoto, S; Mabuchi, O; Kokubunji, A; Kai, S; Okada, M; Taniguchi, R; Momose, S; Uchida, S; Nishio, H

    2011-04-01

    To clarify transfusion incidence of hepatitis B virus (HBV) infected blood negative for mini pool-nucleic acid amplification testing (MP-NAT). Japanese Red Cross (JRC) blood centres screen donated blood to avoid contamination with HBV. However, a low copy number of HBV may be overlooked. In Hyogo-Prefecture, JRC blood centres screened 787 695 donations for HBV from April 2005 to March 2009. Of these, 685 844 were donations from the repeat donors. To detect the donors with HBV, serological tests, MP-NAT and/or individual donation (ID)-NAT were performed. To detect the recipients with transfusion-transmitted HBV infection (TTHBI), serological analysis and/or ID-NAT were performed. In this study, 265 of the 685 844 repeat donations were serologically and/or MP-NAT positive for HBV. Their repository samples from the previous donation were examined in a look-back study; 13 of the 265 repository samples proved ID-NAT positive. Twelve recipients were transfused with HBV-infected blood components derived from 10 of the 13 HBV-infected donors. Only 1 of the 12 recipients was identified as TTHBI case. Seven of the 12 recipients escaped from our follow-up study and 4 recipients were negative for HBV during the observation period. On the basis of the look-back study among the repeat donors in Hyogo-Prefecture, Japan, donations with HBV-infected blood negative for MP-NAT occurred with a frequency of 13 in 685 844 donations (∼1/53 000 donations). However, more than half of the recipients transfused with HBV-infected blood negative for MP-NAT could not be followed up. It is necessary to establish a more cautious follow-up system. © 2010 The Authors. Transfusion Medicine © 2010 British Blood Transfusion Society.

  14. [Meningitis and white matter lesions due to Streptococcus mitis in a previously healthy child].

    Science.gov (United States)

    Yiş, Reyhan; Yüksel, Ciğdem Nükhet; Derundere, Umit; Yiş, Uluç

    2011-10-01

    Streptococcus mitis, an important member of viridans streptococci, is found in the normal flora of the oropharynx, gastrointestinal tract, female genital tract and skin. Although it is of low pathogenicity and virulence, it may cause serious infections in immunocompromised patients. Meningitis caused by S.mitis has been described in patients with previous spinal anesthesia, neurosurgical procedure, malignancy, bacterial endocarditis with neurological complications and alcoholics, but it is rare in patients who are previously healthy. In this report, a rare case of meningoencephalitis caused by S.mitis developed in a previously healthy child has been presented. A previously healthy eight-year-old girl who presented with fever, altered state of consciousness, and headache was hospitalized in intensive care unit with the diagnosis of meningitis. Past history revealed that she was treated with amoxicillin-clavulanate for acute sinusitis ten days before her admission. Whole blood count revealed the followings: hemoglobin 13 g/dl, white blood cell count 18.6 x 109/L (90% neutrophils), platelet count 200 x 109/L and 150 leucocytes were detected on cerebrospinal fluid (CSF) examination. Protein and glucose levels of CSF were 80 mg/dl and 40 mg/dl (concomitant blood glucose 100 mg/dl), respectively. Brain magnetic resonance imaging (MRI) revealed widespread white matter lesions, and alpha-hemolytic streptococci were grown in CSF culture. The isolate was identified as S.mitis with conventional methods, and also confirmed by VITEK2 (bioMerieux, France) and API 20 STREP (bioMerieux, France) systems. Isolate was found susceptible to penicillin, erythromycin, clindamycin, tetracycline, cefotaxime, vancomycin and chloramphenicol. Regarding the etiology, echocardiography revealed no vegetation nor valve pathology, and peripheral blood smear showed no abnormality. Immunoglobulin and complement levels were within normal limits. Ongoing inflammation in maxillary sinuses detected in

  15. Numerical simulation of the shot peening process under previous loading conditions

    International Nuclear Information System (INIS)

    Romero-Ángeles, B; Urriolagoitia-Sosa, G; Torres-San Miguel, C R; Molina-Ballinas, A; Benítez-García, H A; Vargas-Bustos, J A; Urriolagoitia-Calderón, G

    2015-01-01

    This research presents a numerical simulation of the shot peening process and determines the residual stress field induced into a component with a previous loading history. The importance of this analysis is based on the fact that mechanical elements under shot peening are also subjected to manufacturing processes, which convert raw material into finished product. However, material is not provided in a virgin state, it has a previous loading history caused by the manner it is fabricated. This condition could alter some beneficial aspects of the residual stress induced by shot peening and could accelerate the crack nucleation and propagation progression. Studies were performed in beams subjected to strain hardening in tension (5ε y ) before shot peening was applied. Latter results were then compared in a numerical assessment of an induced residual stress field by shot peening carried out in a component (beam) without any previous loading history. In this paper, it is clearly shown the detrimental or beneficial effect that previous loading history can bring to the mechanical component and how it can be controlled to improve the mechanical behavior of the material

  16. Does previous use affect litter box appeal in multi-cat households?

    Science.gov (United States)

    Ellis, J J; McGowan, R T S; Martin, F

    2017-08-01

    It is commonly assumed that cats actively avoid eliminated materials (especially in multi-cat homes), suggesting regular litter box cleaning as the best defense against out-of-box elimination. The relationship between previous use and litter box appeal to familiar subsequent users is currently unknown. The purpose of this study was to investigate the relationship between previous litter box use and the identity of the previous user, type of elimination, odor, and presence of physical/visual obstructions in a multi-cat household scenario. Cats preferred a clean litter box to a dirty one, but the identity of the previous user had no impact on preferences. While the presence of odor from urine and/or feces did not impact litter box preferences, the presence of odorless faux-urine and/or feces did - with the presence of faux-feces being preferred over faux-urine. Results suggest neither malodor nor chemical communication play a role in litter box preferences, and instead emphasize the importance of regular removal of physical/visual obstructions as the key factor in promoting proper litter box use. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  17. Genome-wide association study identifies novel locus for neuroticism and shows polygenic association with Major Depressive Disorder

    Science.gov (United States)

    de Moor, Marleen H.M.; van den Berg, Stéphanie M.; Verweij, Karin J.H.; Krueger, Robert F.; Luciano, Michelle; Vasquez, Alejandro Arias; Matteson, Lindsay K.; Derringer, Jaime; Esko, Tõnu; Amin, Najaf; Gordon, Scott D.; Hansell, Narelle K.; Hart, Amy B.; Seppälä, Ilkka; Huffman, Jennifer E.; Konte, Bettina; Lahti, Jari; Lee, Minyoung; Miller, Mike; Nutile, Teresa; Tanaka, Toshiko; Teumer, Alexander; Viktorin, Alexander; Wedenoja, Juho; Abecasis, Goncalo R.; Adkins, Daniel E.; Agrawal, Arpana; Allik, Jüri; Appel, Katja; Bigdeli, Timothy B.; Busonero, Fabio; Campbell, Harry; Costa, Paul T.; Smith, George Davey; Davies, Gail; de Wit, Harriet; Ding, Jun; Engelhardt, Barbara E.; Eriksson, Johan G.; Fedko, Iryna O.; Ferrucci, Luigi; Franke, Barbara; Giegling, Ina; Grucza, Richard; Hartmann, Annette M.; Heath, Andrew C.; Heinonen, Kati; Henders, Anjali K.; Homuth, Georg; Hottenga, Jouke-Jan; Janzing, Joost; Jokela, Markus; Karlsson, Robert; Kemp, John P.; Kirkpatrick, Matthew G.; Latvala, Antti; Lehtimäki, Terho; Liewald, David C.; Madden, Pamela A.F.; Magri, Chiara; Magnusson, Patrik K.E.; Marten, Jonathan; Maschio, Andrea; Medland, Sarah E.; Mihailov, Evelin; Milaneschi, Yuri; Montgomery, Grant W.; Nauck, Matthias; Ouwens, Klaasjan G.; Palotie, Aarno; Pettersson, Erik; Polasek, Ozren; Qian, Yong; Pulkki-Råback, Laura; Raitakari, Olli T.; Realo, Anu; Rose, Richard J.; Ruggiero, Daniela; Schmidt, Carsten O.; Slutske, Wendy S.; Sorice, Rossella; Starr, John M.; Pourcain, Beate St; Sutin, Angelina R.; Timpson, Nicholas J.; Trochet, Holly; Vermeulen, Sita; Vuoksimaa, Eero; Widen, Elisabeth; Wouda, Jasper; Wright, Margaret J.; Zgaga, Lina; Scotland, Generation; Porteous, David; Minelli, Alessandra; Palmer, Abraham A.; Rujescu, Dan; Ciullo, Marina; Hayward, Caroline; Rudan, Igor; Metspalu, Andres; Kaprio, Jaakko; Deary, Ian J.; Räikkönen, Katri; Wilson, James F.; Keltikangas-Järvinen, Liisa; Bierut, Laura J.; Hettema, John M.; Grabe, Hans J.; van Duijn, Cornelia M.; Evans, David M.; Schlessinger, David; Pedersen, Nancy L.; Terracciano, Antonio; McGue, Matt; Penninx, Brenda W.J.H.; Martin, Nicholas G.; Boomsma, Dorret I.

    2015-01-01

    Importance Neuroticism is a personality trait that is briefly defined by emotional instability. It is a robust genetic risk factor for Major Depressive Disorder (MDD) and other psychiatric disorders. Hence, neuroticism is an important phenotype for psychiatric genetics. The Genetics of Personality Consortium (GPC) has created a resource for genome-wide association analyses of personality traits in over 63,000 participants (including MDD cases). Objective To identify genetic variants associated with neuroticism by performing a meta-analysis of genome-wide association (GWA) results based on 1000Genomes imputation, to evaluate if common genetic variants as assessed by Single Nucleotide Polymorphisms (SNPs) explain variation in neuroticism by estimating SNP-based heritability, and to examine whether SNPs that predict neuroticism also predict MDD. Setting 30 cohorts with genome-wide genotype, personality and MDD data from the GPC. Participants The study included 63,661 participants from 29 discovery cohorts and 9,786 participants from a replication cohort. Participants came from Europe, the United States or Australia. Main outcome measure(s) Neuroticism scores harmonized across all cohorts by Item Response Theory (IRT) analysis, and clinically assessed MDD case-control status. Results A genome-wide significant SNP was found in the MAGI1 gene (rs35855737; P=9.26 × 10−9 in the discovery meta-analysis, and P=2.38 × 10−8 in the meta-analysis of all 30 cohorts). Common genetic variants explain 15% of the variance in neuroticism. Polygenic scores based on the meta-analysis of neuroticism in 27 of the discovery cohorts significantly predicted neuroticism in 2 independent cohorts. Importantly, polygenic scores also predicted MDD in these cohorts. Conclusions and relevance This study identifies a novel locus for neuroticism. The variant is located in a known gene that has been associated with bipolar disorder and schizophrenia in previous studies. In addition, the study

  18. HEART TRANSPLANTATION IN PATIENTS WITH PREVIOUS OPEN HEART SURGERY

    Directory of Open Access Journals (Sweden)

    R. Sh. Saitgareev

    2016-01-01

    Full Text Available Heart Transplantation (HTx to date remains the most effective and radical method of treatment of patients with end-stage heart failure. The defi cit of donor hearts is forcing to resort increasingly to the use of different longterm mechanical circulatory support systems, including as a «bridge» to the follow-up HTx. According to the ISHLT Registry the number of recipients underwent cardiopulmonary bypass surgery increased from 40% in the period from 2004 to 2008 to 49.6% for the period from 2009 to 2015. HTx performed in repeated patients, on the one hand, involves considerable technical diffi culties and high risks; on the other hand, there is often no alternative medical intervention to HTx, and if not dictated by absolute contradictions the denial of the surgery is equivalent to 100% mortality. This review summarizes the results of a number of published studies aimed at understanding the immediate and late results of HTx in patients, previously underwent open heart surgery. The effect of resternotomy during HTx and that of the specifi c features associated with its implementation in recipients previously operated on open heart, and its effects on the immediate and long-term survival were considered in this review. Results of studies analyzing the risk factors for perioperative complications in repeated recipients were also demonstrated. Separately, HTx risks after implantation of prolonged mechanical circulatory support systems were examined. The literature does not allow to clearly defi ning the impact factor of earlier performed open heart surgery on the course of perioperative period and on the prognosis of survival in recipients who underwent HTx. On the other hand, subject to the regular fl ow of HTx and the perioperative period the risks in this clinical situation are justifi ed as a long-term prognosis of recipients previously conducted open heart surgery and are comparable to those of patients who underwent primary HTx. Studies

  19. Genome-wide association study meta-analysis of European and Asian-ancestry samples identifies three novel loci associated with bipolar disorder.

    Science.gov (United States)

    Chen, D T; Jiang, X; Akula, N; Shugart, Y Y; Wendland, J R; Steele, C J M; Kassem, L; Park, J-H; Chatterjee, N; Jamain, S; Cheng, A; Leboyer, M; Muglia, P; Schulze, T G; Cichon, S; Nöthen, M M; Rietschel, M; McMahon, F J; Farmer, A; McGuffin, P; Craig, I; Lewis, C; Hosang, G; Cohen-Woods, S; Vincent, J B; Kennedy, J L; Strauss, J

    2013-02-01

    Meta-analyses of bipolar disorder (BD) genome-wide association studies (GWAS) have identified several genome-wide significant signals in European-ancestry samples, but so far account for little of the inherited risk. We performed a meta-analysis of ∼750,000 high-quality genetic markers on a combined sample of ∼14,000 subjects of European and Asian-ancestry (phase I). The most significant findings were further tested in an extended sample of ∼17,700 cases and controls (phase II). The results suggest novel association findings near the genes TRANK1 (LBA1), LMAN2L and PTGFR. In phase I, the most significant single nucleotide polymorphism (SNP), rs9834970 near TRANK1, was significant at the P=2.4 × 10(-11) level, with no heterogeneity. Supportive evidence for prior association findings near ANK3 and a locus on chromosome 3p21.1 was also observed. The phase II results were similar, although the heterogeneity test became significant for several SNPs. On the basis of these results and other established risk loci, we used the method developed by Park et al. to estimate the number, and the effect size distribution, of BD risk loci that could still be found by GWAS methods. We estimate that >63,000 case-control samples would be needed to identify the ∼105 BD risk loci discoverable by GWAS, and that these will together explain <6% of the inherited risk. These results support previous GWAS findings and identify three new candidate genes for BD. Further studies are needed to replicate these findings and may potentially lead to identification of functional variants. Sample size will remain a limiting factor in the discovery of common alleles associated with BD.

  20. Genome-wide association study to identify common variants associated with brachial circumference: a meta-analysis of 14 cohorts.

    Directory of Open Access Journals (Sweden)

    Vesna Boraska

    Full Text Available Brachial circumference (BC, also known as upper arm or mid arm circumference, can be used as an indicator of muscle mass and fat tissue, which are distributed differently in men and women. Analysis of anthropometric measures of peripheral fat distribution such as BC could help in understanding the complex pathophysiology behind overweight and obesity. The purpose of this study is to identify genetic variants associated with BC through a large-scale genome-wide association scan (GWAS meta-analysis. We used fixed-effects meta-analysis to synthesise summary results across 14 GWAS discovery and 4 replication cohorts comprising overall 22,376 individuals (12,031 women and 10,345 men of European ancestry. Individual analyses were carried out for men, women, and combined across sexes using linear regression and an additive genetic model: adjusted for age and adjusted for age and BMI. We prioritised signals for follow-up in two-stages. We did not detect any signals reaching genome-wide significance. The FTO rs9939609 SNP showed nominal evidence for association (p<0.05 in the age-adjusted strata for men and across both sexes. In this first GWAS meta-analysis for BC to date, we have not identified any genome-wide significant signals and do not observe robust association of previously established obesity loci with BC. Large-scale collaborations will be necessary to achieve higher power to detect loci underlying BC.

  1. Genetic association study identifies a functional CNV in the WWOX gene contributes to the risk of intracranial aneurysms.

    Science.gov (United States)

    Fan, Jin; Sun, Wen; Lin, Min; Yu, Ke; Wang, Jian; Duan, Dan; Zheng, Bo; Yang, Zhenghui; Wang, Qingsong

    2016-03-29

    Intracranial aneurysms (IAs) accounts for 85% of hemorrhagic stroke. Genetic factors have been known to play an important role in the development of IAs. A functional CNV (CNV-67048) of human WW domain-containing oxidoreductase (WWOX), which has been identified as a tumor suppressor gene in multiple cancers, was identified to be associated with gliomas risk previously. Here, we hypothesized that the CNV-67048 could also affect susceptibility of IAs. Based on a two-stage, case- control study with a total of 976 patients of IAs and 1,200 matched healthy controls, we found the effect size for per copy deletion was 1.35 (95% CI = 1.16-1.57; Ptrend = 1.18 × 10-4). Compared with the individuals having no deletion, significantly higher risk of IAs was detected for both subjects carrying 1 copy deletion (OR = 1.24, 95% CI = 1.02-1.52) and subjects carrying 2 copy deletion (OR = 1.77, 95% CI = 1.24-2.53). Real-time PCR was used to confirm the abnormal expression of WWOX in tissues of IA patients and influence of genotypes of CNV-67048. The expression level of WWOX in IA tissues was significantly lower than that in corresponding normal tissues (P = 0.004), and the deletion genotypes of CNV-67048 have lower WWOX mRNA levels in both tumor tissues and border tissues (P 48 in WWOX predispose their carriers to IAs, which might be a genetic biomarker to predict risk of IAs in Chinese.

  2. An administrative data validation study of the accuracy of algorithms for identifying rheumatoid arthritis: the influence of the reference standard on algorithm performance.

    Science.gov (United States)

    Widdifield, Jessica; Bombardier, Claire; Bernatsky, Sasha; Paterson, J Michael; Green, Diane; Young, Jacqueline; Ivers, Noah; Butt, Debra A; Jaakkimainen, R Liisa; Thorne, J Carter; Tu, Karen

    2014-06-23

    We have previously validated administrative data algorithms to identify patients with rheumatoid arthritis (RA) using rheumatology clinic records as the reference standard. Here we reassessed the accuracy of the algorithms using primary care records as the reference standard. We performed a retrospective chart abstraction study using a random sample of 7500 adult patients under the care of 83 family physicians contributing to the Electronic Medical Record Administrative data Linked Database (EMRALD) in Ontario, Canada. Using physician-reported diagnoses as the reference standard, we computed and compared the sensitivity, specificity, and predictive values for over 100 administrative data algorithms for RA case ascertainment. We identified 69 patients with RA for a lifetime RA prevalence of 0.9%. All algorithms had excellent specificity (>97%). However, sensitivity varied (75-90%) among physician billing algorithms. Despite the low prevalence of RA, most algorithms had adequate positive predictive value (PPV; 51-83%). The algorithm of "[1 hospitalization RA diagnosis code] or [3 physician RA diagnosis codes with ≥1 by a specialist over 2 years]" had a sensitivity of 78% (95% CI 69-88), specificity of 100% (95% CI 100-100), PPV of 78% (95% CI 69-88) and NPV of 100% (95% CI 100-100). Administrative data algorithms for detecting RA patients achieved a high degree of accuracy amongst the general population. However, results varied slightly from our previous report, which can be attributed to differences in the reference standards with respect to disease prevalence, spectrum of disease, and type of comparator group.

  3. Large-scale meta-analysis of genome-wide association data identifies six new risk loci for Parkinson's disease

    NARCIS (Netherlands)

    Nalls, Mike A.; Pankratz, Nathan; Lill, Christina M.; Do, Chuong B.; Hernandez, Dena G.; Saad, Mohamad; DeStefano, Anita L.; Kara, Eleanna; Bras, Jose; Sharma, Manu; Schulte, Claudia; Keller, Margaux F.; Arepalli, Sampath; Letson, Christopher; Edsall, Connor; Stefansson, Hreinn; Liu, Xinmin; Pliner, Hannah; Lee, Joseph H.; Cheng, Rong; Ikram, M. Arfan; Ioannidis, John P. A.; Hadjigeorgiou, Georgios M.; Bis, Joshua C.; Martinez, Maria; Perlmutter, Joel S.; Goate, Alison; Marder, Karen; Fiske, Brian; Sutherland, Margaret; Xiromerisiou, Georgia; Myers, Richard H.; Clark, Lorraine N.; Stefansson, Kari; Hardy, John A.; Heutink, Peter; Chen, Honglei; Wood, Nicholas W.; Houlden, Henry; Payami, Haydeh; Brice, Alexis; Scott, William K.; Gasser, Thomas; Bertram, Lars; Eriksson, Nicholas; Foroud, Tatiana; Singleton, Andrew B.; Plagnol, Vincent; Sheerin, Una-Marie; Simón-Sánchez, Javier; Lesage, Suzanne; Sveinbjörnsdóttir, Sigurlaug; Barker, Roger; Ben-Shlomo, Yoav; Berendse, Henk W.; Berg, Daniela; Bhatia, Kailash; de Bie, Rob M. A.; Biffi, Alessandro; Bloem, Bas; Bochdanovits, Zoltan; Bonin, Michael; Bras, Jose M.; Brockmann, Kathrin; Brooks, Janet; Burn, David J.; Charlesworth, Gavin; Chinnery, Patrick F.; Chong, Sean; Clarke, Carl E.; Cookson, Mark R.; Cooper, J. Mark; Corvol, Jean Christophe; Counsell, Carl; Damier, Philippe; Dartigues, Jean-François; Deloukas, Panos; Deuschl, Günther; Dexter, David T.; van Dijk, Karin D.; Dillman, Allissa; Durif, Frank; Dürr, Alexandra; Edkins, Sarah; Evans, Jonathan R.; Foltynie, Thomas; Dong, Jing; Gardner, Michelle; Gibbs, J. Raphael; Gray, Emma; Guerreiro, Rita; Harris, Clare; van Hilten, Jacobus J.; Hofman, Albert; Hollenbeck, Albert; Holton, Janice; Hu, Michele; Huang, Xuemei; Wurster, Isabel; Mätzler, Walter; Hudson, Gavin; Hunt, Sarah E.; Huttenlocher, Johanna; Illig, Thomas; Jónsson, Pálmi V.; Lambert, Jean-Charles; Langford, Cordelia; Lees, Andrew; Lichtner, Peter; Limousin, Patricia; Lopez, Grisel; Lorenz, Delia; McNeill, Alisdair; Moorby, Catriona; Moore, Matthew; Morris, Huw R.; Morrison, Karen E.; Mudanohwo, Ese; O'Sullivan, Sean S.; Pearson, Justin; Pétursson, Hjörvar; Pollak, Pierre; Post, Bart; Potter, Simon; Ravina, Bernard; Revesz, Tamas; Riess, Olaf; Rivadeneira, Fernando; Rizzu, Patrizia; Ryten, Mina; Sawcer, Stephen; Schapira, Anthony; Scheffer, Hans; Shaw, Karen; Shoulson, Ira; Sidransky, Ellen; Smith, Colin; Spencer, Chris C. A.; Stefánsson, Hreinn; Bettella, Francesco; Stockton, Joanna D.; Strange, Amy; Talbot, Kevin; Tanner, Carlie M.; Tashakkori-Ghanbaria, Avazeh; Tison, François; Trabzuni, Daniah; Traynor, Bryan J.; Uitterlinden, André G.; Velseboer, Daan; Vidailhet, Marie; Walker, Robert; van de Warrenburg, Bart; Wickremaratchi, Mirdhu; Williams, Nigel; Williams-Gray, Caroline H.; Winder-Rhodes, Sophie; Stefánsson, Kári; Hardy, John; Factor, S.; Higgins, D.; Evans, S.; Shill, H.; Stacy, M.; Danielson, J.; Marlor, L.; Williamson, K.; Jankovic, J.; Hunter, C.; Simon, D.; Ryan, P.; Scollins, L.; Saunders-Pullman, R.; Boyar, K.; Costan-Toth, C.; Ohmann, E.; Sudarsky, L.; Joubert, C.; Friedman, J.; Chou, K.; Fernandez, H.; Lannon, M.; Galvez-Jimenez, N.; Podichetty, A.; Thompson, K.; Lewitt, P.; Deangelis, M.; O'Brien, C.; Seeberger, L.; Dingmann, C.; Judd, D.; Marder, K.; Fraser, J.; Harris, J.; Bertoni, J.; Peterson, C.; Rezak, M.; Medalle, G.; Chouinard, S.; Panisset, M.; Hall, J.; Poiffaut, H.; Calabrese, V.; Roberge, P.; Wojcieszek, J.; Belden, J.; Jennings, D.; Marek, K.; Mendick, S.; Reich, S.; Dunlop, B.; Jog, M.; Horn, C.; Uitti, R.; Turk, M.; Ajax, T.; Mannetter, J.; Sethi, K.; Carpenter, J.; Dill, B.; Hatch, L.; Ligon, K.; Narayan, S.; Blindauer, K.; Abou-Samra, K.; Petit, J.; Elmer, L.; Aiken, E.; Davis, K.; Schell, C.; Wilson, S.; Velickovic, M.; Koller, W.; Phipps, S.; Feigin, A.; Gordon, M.; Hamann, J.; Licari, E.; Marotta-Kollarus, M.; Shannon, B.; Winnick, R.; Simuni, T.; Videnovic, A.; Kaczmarek, A.; Williams, K.; Wolff, M.; Rao, J.; Cook, M.; Fernandez, M.; Kostyk, S.; Hubble, J.; Campbell, A.; Reider, C.; Seward, A.; Camicioli, R.; Carter, J.; Nutt, J.; Andrews, P.; Morehouse, S.; Stone, C.; Mendis, T.; Grimes, D.; Alcorn-Costa, C.; Gray, P.; Haas, K.; Vendette, J.; Sutton, J.; Hutchinson, B.; Young, J.; Rajput, A.; Klassen, L.; Shirley, T.; Manyam, B.; Simpson, P.; Whetteckey, J.; Wulbrecht, B.; Truong, D.; Pathak, M.; Frei, K.; Luong, N.; Tra, T.; Tran, A.; Vo, J.; Lang, A.; Kleiner- Fisman, G.; Nieves, A.; Johnston, L.; So, J.; Podskalny, G.; Giffin, L.; Atchison, P.; Allen, C.; Martin, W.; Wieler, M.; Suchowersky, O.; Furtado, S.; Klimek, M.; Hermanowicz, N.; Niswonger, S.; Shults, C.; Fontaine, D.; Aminoff, M.; Christine, C.; Diminno, M.; Hevezi, J.; Dalvi, A.; Kang, U.; Richman, J.; Uy, S.; Sahay, A.; Gartner, M.; Schwieterman, D.; Hall, D.; Leehey, M.; Culver, S.; Derian, T.; Demarcaida, T.; Thurlow, S.; Rodnitzky, R.; Dobson, J.; Lyons, K.; Pahwa, R.; Gales, T.; Thomas, S.; Shulman, L.; Weiner, W.; Dustin, K.; Singer, C.; Zelaya, L.; Tuite, P.; Hagen, V.; Rolandelli, S.; Schacherer, R.; Kosowicz, J.; Gordon, P.; Werner, J.; Serrano, C.; Roque, S.; Kurlan, R.; Berry, D.; Gardiner, I.; Hauser, R.; Sanchez-Ramos, J.; Zesiewicz, T.; Delgado, H.; Price, K.; Rodriguez, P.; Wolfrath, S.; Pfeiffer, R.; Davis, L.; Pfeiffer, B.; Dewey, R.; Hayward, B.; Johnson, A.; Meacham, M.; Estes, B.; Walker, F.; Hunt, V.; O'Neill, C.; Racette, B.; Swisher, L.; Dijamco, Cheri; Conley, Emily Drabant; Dorfman, Elizabeth; Tung, Joyce Y.; Hinds, David A.; Mountain, Joanna L.; Wojcicki, Anne; Lew, M.; Klein, C.; Golbe, L.; Growdon, J.; Wooten, G. F.; Watts, R.; Guttman, M.; Goldwurm, S.; Saint-Hilaire, M. H.; Baker, K.; Litvan, I.; Nicholson, G.; Nance, M.; Drasby, E.; Isaacson, S.; Burn, D.; Pramstaller, P.; Al-hinti, J.; Moller, A.; Sherman, S.; Roxburgh, R.; Slevin, J.; Perlmutter, J.; Mark, M. H.; Huggins, N.; Pezzoli, G.; Massood, T.; Itin, I.; Corbett, A.; Chinnery, P.; Ostergaard, K.; Snow, B.; Cambi, F.; Kay, D.; Samii, A.; Agarwal, P.; Roberts, J. W.; Higgins, D. S.; Molho, Eric; Rosen, Ami; Montimurro, J.; Martinez, E.; Griffith, A.; Kusel, V.; Yearout, D.; Zabetian, C.; Clark, L. N.; Liu, X.; Lee, J. H.; Taub, R. Cheng; Louis, E. D.; Cote, L. J.; Waters, C.; Ford, B.; Fahn, S.; Vance, Jeffery M.; Beecham, Gary W.; Martin, Eden R.; Nuytemans, Karen; Pericak-Vance, Margaret A.; Haines, Jonathan L.; DeStefano, Anita; Seshadri, Sudha; Choi, Seung Hoan; Frank, Samuel; Psaty, Bruce M.; Rice, Kenneth; Longstreth, W. T.; Ton, Thanh G. N.; Jain, Samay; van Duijn, Cornelia M.; Verlinden, Vincent J.; Koudstaal, Peter J.; Singleton, Andrew; Cookson, Mark; Hernandez, Dena; Nalls, Michael; Zonderman, Alan; Ferrucci, Luigi; Johnson, Robert; Longo, Dan; O'Brien, Richard; Traynor, Bryan; Troncoso, Juan; van der Brug, Marcel; Zielke, Ronald; Weale, Michael; Ramasamy, Adaikalavan; Dardiotis, Efthimios; Tsimourtou, Vana; Spanaki, Cleanthe; Plaitakis, Andreas; Bozi, Maria; Stefanis, Leonidas; Vassilatis, Dimitris; Koutsis, Georgios; Panas, Marios; Lunnon, Katie; Lupton, Michelle; Powell, John; Parkkinen, Laura; Ansorge, Olaf

    2014-01-01

    We conducted a meta-analysis of Parkinson's disease genome-wide association studies using a common set of 7,893,274 variants across 13,708 cases and 95,282 controls. Twenty-six loci were identified as having genome-wide significant association; these and 6 additional previously reported loci were

  4. New loci associated with birth weight identify genetic links between intrauterine growth and adult height and metabolism

    NARCIS (Netherlands)

    Horikoshi, M.; Yaghootkar, H.; Mook-Kanamori, D.O.; Sovio, U.; Taal, H.R.; Hennig, B.J.; Bradfield, J.P.; St Pourcain, B.; Evans, D.M.; Charoen, P.; Kaakinen, M.; Cousminer, D.L.; Lehtimäki, T.; Kreiner-Møller, E.; Warrington, N.M.; Bustamante, M.; Feenstra, B.; Berry, D.J.; Thiering, E.; Pfab, T.; Barton, S.J.; Shields, B.M.; Kerkhof, M.; Leeuwen, E. M.; Fulford, A.J.; Kutalik, Z.; Zhao, J.H.; van den Hoed, M.; Mahajan, A.; Lindi, V.; Goh, L.K.; Hottenga, J.J.; Wu, Y.; Raitakari, O.T.; Harder, M.N.; Meirhaeghe, A.; Ntalla, I.; Salem, R.M.; Jameson, K.A.; Zhou, K.; Monies, D.M.; Lagou, V.; Kirin, M.; Heikkinen, J.; Adair, L.S.; Alkuraya, F.S.; Al-Odaib, A.; Amouyel, P.; Andersson, E.A.; Bennett, A.J.; Blakemore, A.I.F.; Buxton, J.L.; Dallongeville, J.; Das, S.; de Geus, E.J.C.; Estivill, X.; Flexeder, C.; Froguel, P.; Geller, F.; Godfrey, K.M.; Gottrand, F.; Groves, C.J.; Hansen, T.; Hirschhorn, J.N.; Hofman, A.; Hollegaard, M.V.; Hougaard, D. M.; Hyppönen, E.; Inskip, H.M.; Isaacs, A.; Jørgensen, T.; Kanaka-Gantenbein, C.; Kemp, J.P.; Kiess, W.; Kilpeläinen, T.O.; Klopp, N.; Knight, B.A.; Kuzawa, C.W.; McMahon, G.; Newnham, J.P.; Niinikoski, H.; Oostra, B.A.; Pedersen, L.; Postma, D.S.; Ring, S.M.; Rivadeneira, F.; Robertson, N.R.; Sebert, S.; Simell, O.; Slowinski, T.; Tiesler, C.M.T.; Tönjes, A.; Vaag, A.A.; Viikari, J.S.; Vink, J.M.; Vissing, N.H.; Wareham, N.J.; Willemsen, G.; Witte, D.R.; Zhang, H.; Zhao, J.; Wilson, J.F.; Stumvoll, M.; Prentice, A.M.; Meyer, B.F.; Pearson, E.R.; Boreham, C.A.; Cooper, C.; Gillman, M.W.; Dedoussis, G.V.; Moreno, L.A.; Pedersen, O.; Saarinen, M.; Mohlke, K.L.; Boomsma, D.I.; Saw, S.M.; Lakka, T.A.; Körner, A.; Loos, R.J.; Ong, K.K.; Vollenweider, P.; van Duijn, C.M.; Koppelman, G.H.; Hattersley, A.T.; Holloway, J.W.; Hocher, B.; Heinrich, J.; Power, C.; Melbye, M.; Guxens, M.; Pennell, C.E.; Bønnelykke, K.; Bisgaard, H.; Eriksson, J.G.; Widén, E.; Hakonarson, H.; Uitterlinden, A.G.; Pouta, A.; Lawlor, D.A.; Smith, G.D.; Frayling, T.M.; McCarthy, M.I.; Grant, S.F.; Jaddoe, V.W.; Järvelin, M.R.; Timpson, N.J.; Prokopenko, I.; Freathy, R.M.

    2013-01-01

    Birth weight within the normal range is associated with a variety of adult-onset diseases, but the mechanisms behind these associations are poorly understood. Previous genome-wide association studies of birth weight identified a variant in the ADCY5 gene associated both with birth weight and type 2

  5. Genetic variants associated with subjective well-being, depressive symptoms, and neuroticism identified through genome-wide analyses

    OpenAIRE

    Okbay, Aysu; Baselmans, B.M.L. (Bart M.L.); Neve, Jan-Emmanuel; Turley, Patrick; Nivard, Michel; Fontana, M.A. (Mark Alan); Meddens, S.F.W. (S. Fleur W.); Linnér, R.K. (Richard Karlsson); Rietveld, C.A. (Cornelius A); Derringer, J.; Gratten, Jacob; Lee, James J.; Liu, J.Z. (Jimmy Z); Vlaming, Ronald; SAhluwalia, T. (Tarunveer)

    2016-01-01

    textabstractVery few genetic variants have been associated with depression and neuroticism, likely because of limitations on sample size in previous studies. Subjective well-being, a phenotype that is genetically correlated with both of these traits, has not yet been studied with genome-wide data. We conducted genome-wide association studies of three phenotypes: subjective well-being (n = 298,420), depressive symptoms (n = 161,460), and neuroticism (n = 170,911). We identify 3 variants associ...

  6. The prevalence of previous self-harm amongst self-poisoning patients in Sri Lanka

    DEFF Research Database (Denmark)

    Mohamed, Fahim; Perera, Aravinda; Wijayaweera, Kusal

    2011-01-01

    BACKGROUND: One of the most important components of suicide prevention strategies is to target people who repeat self-harm as they are a high risk group. However, there is some evidence that the incidence of repeat self-harm is lower in Asia than in the West. The objective of this study...... was to investigate the prevalence of previous self-harm among a consecutive series of self-harm patients presenting to hospitals in rural Sri Lanka. METHOD: Six hundred and ninety-eight self-poisoning patients presenting to medical wards at two hospitals in Sri Lanka were interviewed about their previous episodes...... of self-harm. RESULTS: Sixty-one (8.7%, 95% CI 6.7-11%) patients reported at least one previous episode of self-harm [37 (10.7%) male, 24 (6.8%) female]; only 19 (2.7%, 95% CI 1.6-4.2%) patients had made more than one previous attempt. CONCLUSION: The low prevalence of previous self-harm is consistent...

  7. Genetic Characterization of a Novel HIV-1 Circulating Recombinant Form (CRF74_01B) Identified among Intravenous Drug Users in Malaysia: Recombination History and Phylogenetic Linkage with Previously Defined Recombinant Lineages.

    Science.gov (United States)

    Cheong, Hui Ting; Chow, Wei Zhen; Takebe, Yutaka; Chook, Jack Bee; Chan, Kok Gan; Al-Darraji, Haider Abdulrazzaq Abed; Koh, Clayton; Kamarulzaman, Adeeba; Tee, Kok Keng

    2015-01-01

    In many parts of Southeast Asia, the HIV-1 epidemic has been driven by the sharing of needles and equipment among intravenous drug users (IDUs). Over the last few decades, many studies have proven time and again that the diversity of HIV-1 epidemics can often be linked to the route of infection transmission. That said, the diversity and complexity of HIV-1 molecular epidemics in the region have been increasing at an alarming rate, due in part to the high tendency of the viral RNA to recombine. This scenario was exemplified by the discovery of numerous circulating recombinant forms (CRFs), especially in Thailand and Malaysia. In this study, we characterized a novel CRF designated CRF74_01B, which was identified in six epidemiologically unlinked IDUs in Kuala Lumpur, Malaysia. The near-full length genomes were composed of CRF01_AE and subtype B', with eight breakpoints dispersed in the gag-pol and nef regions. Remarkably, this CRF shared four and two recombination hotspots with the previously described CRF33_01B and the less prevalent CRF53_01B, respectively. Genealogy-based Bayesian phylogenetic analysis of CRF74_01B genomic regions showed that it is closely related to both CRF33_01B and CRF53_01B. This observation suggests that CRF74_01B was probably a direct descendent from specific lineages of CRF33_01B, CRF53_01B and subtype B' that could have emerged in the mid-1990s. Additionally, it illustrated the active recombination processes between prevalent HIV-1 subtypes and recombinants in Malaysia. In summary, we report a novel HIV-1 genotype designated CRF74_01B among IDUs in Kuala Lumpur, Malaysia. The characterization of the novel CRF74_01B is of considerable significance towards the understanding of the genetic diversity and population dynamics of HIV-1 circulating in the region.

  8. Genetic Characterization of a Novel HIV-1 Circulating Recombinant Form (CRF74_01B Identified among Intravenous Drug Users in Malaysia: Recombination History and Phylogenetic Linkage with Previously Defined Recombinant Lineages.

    Directory of Open Access Journals (Sweden)

    Hui Ting Cheong

    Full Text Available In many parts of Southeast Asia, the HIV-1 epidemic has been driven by the sharing of needles and equipment among intravenous drug users (IDUs. Over the last few decades, many studies have proven time and again that the diversity of HIV-1 epidemics can often be linked to the route of infection transmission. That said, the diversity and complexity of HIV-1 molecular epidemics in the region have been increasing at an alarming rate, due in part to the high tendency of the viral RNA to recombine. This scenario was exemplified by the discovery of numerous circulating recombinant forms (CRFs, especially in Thailand and Malaysia. In this study, we characterized a novel CRF designated CRF74_01B, which was identified in six epidemiologically unlinked IDUs in Kuala Lumpur, Malaysia. The near-full length genomes were composed of CRF01_AE and subtype B', with eight breakpoints dispersed in the gag-pol and nef regions. Remarkably, this CRF shared four and two recombination hotspots with the previously described CRF33_01B and the less prevalent CRF53_01B, respectively. Genealogy-based Bayesian phylogenetic analysis of CRF74_01B genomic regions showed that it is closely related to both CRF33_01B and CRF53_01B. This observation suggests that CRF74_01B was probably a direct descendent from specific lineages of CRF33_01B, CRF53_01B and subtype B' that could have emerged in the mid-1990s. Additionally, it illustrated the active recombination processes between prevalent HIV-1 subtypes and recombinants in Malaysia. In summary, we report a novel HIV-1 genotype designated CRF74_01B among IDUs in Kuala Lumpur, Malaysia. The characterization of the novel CRF74_01B is of considerable significance towards the understanding of the genetic diversity and population dynamics of HIV-1 circulating in the region.

  9. Sunburn and sun-protective behaviors among adults with and without previous nonmelanoma skin cancer (NMSC): A population-based study.

    Science.gov (United States)

    Fischer, Alexander H; Wang, Timothy S; Yenokyan, Gayane; Kang, Sewon; Chien, Anna L

    2016-08-01

    Individuals with previous nonmelanoma skin cancer (NMSC) are at increased risk for subsequent skin cancer, and should therefore limit ultraviolet exposure. We sought to determine whether individuals with previous NMSC engage in better sun protection than those with no skin cancer history. We pooled self-reported data (2005 and 2010 National Health Interview Surveys) from US non-Hispanic white adults (758 with and 34,161 without previous NMSC). We calculated adjusted prevalence odds ratios (aPOR) and 95% confidence intervals (CI), taking into account the complex survey design. Individuals with previous NMSC versus no history of NMSC had higher rates of frequent use of shade (44.3% vs 27.0%; aPOR 1.41; 95% CI 1.16-1.71), long sleeves (20.5% vs 7.7%; aPOR 1.55; 95% CI 1.21-1.98), a wide-brimmed hat (26.1% vs 10.5%; aPOR 1.52; 95% CI 1.24-1.87), and sunscreen (53.7% vs 33.1%; aPOR 2.11; 95% CI 1.73-2.59), but did not have significantly lower odds of recent sunburn (29.7% vs 40.7%; aPOR 0.95; 95% CI 0.77-1.17). Among those with previous NMSC, recent sunburn was inversely associated with age, sun avoidance, and shade but not sunscreen. Self-reported cross-sectional data and unavailable information quantifying regular sun exposure are limitations. Physicians should emphasize sunburn prevention when counseling patients with previous NMSC, especially younger adults, focusing on shade and sun avoidance over sunscreen. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  10. Effect of Previous Irradiation on Vascular Thrombosis of Microsurgical Anastomosis: A Preclinical Study in Rats

    Science.gov (United States)

    Gallardo-Calero, Irene; López-Fernández, Alba; Romagosa, Cleofe; Vergés, Ramona; Aguirre-Canyadell, Marius; Soldado, Francisco; Velez, Roberto

    2016-01-01

    Background: The objective of the present investigation was to compare the effect of neoadjuvant irradiation on the microvascular anastomosis in cervical bundle using an experimental model in rats. Methods: One hundred forty male Sprague–Dawley rats were allocated into 4 groups: group I, control, arterial microanastomosis; group II, control, venous microanastomosis; group III, arterial microanastomosis with previous irradiation (20 Gy); and group IV, venous microanastomosis with previous irradiation (20 Gy). Clinical parameters, technical values of anastomosis, patency, and histopathological parameters were evaluated. Results: Irradiated groups (III and IV) and vein anastomosis groups (II and IV) showed significantly increased technical difficulties. Group IV showed significantly reduced patency rates (7/35) when compared with the control group (0/35). Radiotherapy significantly decreased the patency rates of the vein (7/35) when compared with the artery (1/35). Groups III and IV showed significantly reduced number of endothelial cells and also showed the presence of intimal thickening and adventitial fibrosis as compared with the control group. Conclusion: Neoadjuvant radiotherapy reduces the viability of the venous anastomosis in a preclinical rat model with a significant increase in the incidence of vein thrombosis. PMID:27975009

  11. Correlates of previous couples’ HIV counseling and testing uptake among married individuals in three HIV prevalence strata in Rakai, Uganda

    Directory of Open Access Journals (Sweden)

    Joseph K. B. Matovu

    2015-06-01

    Full Text Available Background: Studies show that uptake of couples’ HIV counseling and testing (couples’ HCT can be affected by individual, relationship, and socioeconomic factors. However, while couples’ HCT uptake can also be affected by background HIV prevalence and awareness of the existence of couples’ HCT services, this is yet to be documented. We explored the correlates of previous couples’ HCT uptake among married individuals in a rural Ugandan district with differing HIV prevalence levels. Design: This was a cross-sectional study conducted among 2,135 married individuals resident in the three HIV prevalence strata (low HIV prevalence: 9.7–11.2%; middle HIV prevalence: 11.4–16.4%; and high HIV prevalence: 20.5–43% in Rakai district, southwestern Uganda, between November 2013 and February 2014. Data were collected on sociodemographic and behavioral characteristics, including previous receipt of couples’ HCT. HIV testing data were obtained from the Rakai Community Cohort Study. We conducted multivariable logistic regression analysis to identify correlates that are independently associated with previous receipt of couples’ HCT. Data analysis was conducted using STATA (statistical software, version 11.2. Results: Of the 2,135 married individuals enrolled, the majority (n=1,783, 83.5% had been married for five or more years while (n=1,460, 66% were in the first-order of marriage. Ever receipt of HCT was almost universal (n=2,020, 95%; of those ever tested, (n=846, 41.9% reported that they had ever received couples’ HCT. There was no significant difference in previous receipt of couples’ HCT between low (n=309, 43.9%, middle (n=295, 41.7%, and high (n=242, 39.7% HIV prevalence settings (p=0.61. Marital order was not significantly associated with previous receipt of couples’ HCT. However, marital duration [five or more years vis-à-vis 1–2 years: adjusted odds ratio (aOR: 1.06; 95% confidence interval (95% CI: 1.04–1.08] and

  12. A new approach to hazardous materials transportation risk analysis: decision modeling to identify critical variables.

    Science.gov (United States)

    Clark, Renee M; Besterfield-Sacre, Mary E

    2009-03-01

    We take a novel approach to analyzing hazardous materials transportation risk in this research. Previous studies analyzed this risk from an operations research (OR) or quantitative risk assessment (QRA) perspective by minimizing or calculating risk along a transport route. Further, even though the majority of incidents occur when containers are unloaded, the research has not focused on transportation-related activities, including container loading and unloading. In this work, we developed a decision model of a hazardous materials release during unloading using actual data and an exploratory data modeling approach. Previous studies have had a theoretical perspective in terms of identifying and advancing the key variables related to this risk, and there has not been a focus on probability and statistics-based approaches for doing this. Our decision model empirically identifies the critical variables using an exploratory methodology for a large, highly categorical database involving latent class analysis (LCA), loglinear modeling, and Bayesian networking. Our model identified the most influential variables and countermeasures for two consequences of a hazmat incident, dollar loss and release quantity, and is one of the first models to do this. The most influential variables were found to be related to the failure of the container. In addition to analyzing hazmat risk, our methodology can be used to develop data-driven models for strategic decision making in other domains involving risk.

  13. Social network analysis in identifying influential webloggers: A preliminary study

    Science.gov (United States)

    Hasmuni, Noraini; Sulaiman, Nor Intan Saniah; Zaibidi, Nerda Zura

    2014-12-01

    In recent years, second generation of internet-based services such as weblog has become an effective communication tool to publish information on the Web. Weblogs have unique characteristics that deserve users' attention. Some of webloggers have seen weblogs as appropriate medium to initiate and expand business. These webloggers or also known as direct profit-oriented webloggers (DPOWs) communicate and share knowledge with each other through social interaction. However, survivability is the main issue among DPOW. Frequent communication with influential webloggers is one of the way to keep survive as DPOW. This paper aims to understand the network structure and identify influential webloggers within the network. Proper understanding of the network structure can assist us in knowing how the information is exchanged among members and enhance survivability among DPOW. 30 DPOW were involved in this study. Degree centrality and betweenness centrality measurement in Social Network Analysis (SNA) were used to examine the strength relation and identify influential webloggers within the network. Thus, webloggers with the highest value of these measurements are considered as the most influential webloggers in the network.

  14. A cross-sectional study of tuberculosis drug resistance among previously treated patients in a tertiary hospital in Accra, Ghana: public health implications of standardized regimens.

    Science.gov (United States)

    Forson, Audrey; Kwara, Awewura; Kudzawu, Samuel; Omari, Michael; Otu, Jacob; Gehre, Florian; de Jong, Bouke; Antonio, Martin

    2018-04-02

    Mycobacterium tuberculosis drug resistance is a major challenge to the use of standardized regimens for tuberculosis (TB) therapy, especially among previously treated patients. We aimed to investigate the frequency and pattern of drug resistance among previously treated patients with smear-positive pulmonary tuberculosis at the Korle-Bu Teaching Hospital Chest Clinic, Accra. This was a cross-sectional survey of mycobacterial isolates from previously treated patients referred to the Chest Clinic Laboratory between October 2010 and October 2013. The Bactec MGIT 960 system for mycobactrerial culture and drug sensitivity testing (DST) was used for sputum culture of AFB smear-positive patients with relapse, treatment failure, failure of smear conversion, or default. Descriptive statistics were used to summarize patient characteristics, and frequency and patterns of drug resistance. A total of 112 isolates were studied out of 155 from previously treated patients. Twenty contaminated (12.9%) and 23 non-viable isolates (14.8%) were excluded. Of the 112 studied isolates, 53 (47.3%) were pan-sensitive to all first-line drugs tested Any resistance (mono and poly resistance) to isoniazid was found in 44 isolates (39.3%) and any resistance to streptomycin in 43 (38.4%). Thirty-one (27.7%) were MDR-TB. Eleven (35.5%) out of 31 MDR-TB isolates were pre-XDR. MDR-TB isolates were more likely than non-MDR isolates to have streptomycin and ethambutol resistance. The main findings of this study were the high prevalence of MDR-TB and streptomycin resistance among previously treated TB patients, as well as a high prevalence of pre-XDR-TB among the MDR-TB patients, which suggest that first-line and second-line DST is essential to aid the design of effective regimens for these groups of patients in Ghana.

  15. Previous experience of family violence and intimate partner violence in pregnancy

    Directory of Open Access Journals (Sweden)

    Ana Bernarda Ludermir

    2017-09-01

    Full Text Available ABSTRACT OBJECTIVE To estimate differential associations between the exposure to violence in the family of origin and victimization and perpetration of intimate partner violence in pregnancy. METHODS A nested case-control study was carried out within a cohort study with 1,120 pregnant women aged 18–49 years old, who were registered in the Family Health Strategy of the city of Recife, State of Pernambuco, Brazil, between 2005 and 2006. The cases were the 233 women who reported intimate partner violence in pregnancy and the controls were the 499 women who did not report it. Partner violence in pregnancy and previous experiences of violence committed by parents or other family members were assessed with a standardized questionnaire. Multivariate logistic regression analyses were modeled to identify differential associations between the exposure to violence in the family of origin and victimization and perpetration of intimate partner violence in pregnancy. RESULTS Having seen the mother suffer intimate partner violence was associated with physical violence in childhood (OR = 2.62; 95%CI 1.89–3.63 and in adolescence (OR = 1.47; 95%CI 1.01–2.13, sexual violence in childhood (OR = 3.28; 95%CI 1.68–6.38 and intimate partner violence during pregnancy (OR = 1.47; 95% CI 1.01 – 2.12. The intimate partner violence during pregnancy was frequent in women who reported more episodes of physical violence in childhood (OR = 2.08; 95%CI 1.43–3.02 and adolescence (OR = 1.63; 95%CI 1.07–2.47, who suffered sexual violence in childhood (OR = 3.92; 95%CI 1.86–8.27, and who perpetrated violence against the partner (OR = 8.67; 95%CI 4.57–16.45. CONCLUSIONS Experiences of violence committed by parents or other family members emerge as strong risk factors for intimate partner violence in pregnancy. Identifying and understanding protective and risk factors for the emergence of intimate partner violence in pregnancy and its maintenance may help

  16. Exome sequencing identifies three novel candidate genes implicated in intellectual disability.

    Directory of Open Access Journals (Sweden)

    Zehra Agha

    Full Text Available Intellectual disability (ID is a major health problem mostly with an unknown etiology. Recently exome sequencing of individuals with ID identified novel genes implicated in the disease. Therefore the purpose of the present study was to identify the genetic cause of ID in one syndromic and two non-syndromic Pakistani families. Whole exome of three ID probands was sequenced. Missense variations in two plausible novel genes implicated in autosomal recessive ID were identified: lysine (K-specific methyltransferase 2B (KMT2B, zinc finger protein 589 (ZNF589, as well as hedgehog acyltransferase (HHAT with a de novo mutation with autosomal dominant mode of inheritance. The KMT2B recessive variant is the first report of recessive Kleefstra syndrome-like phenotype. Identification of plausible causative mutations for two recessive and a dominant type of ID, in genes not previously implicated in disease, underscores the large genetic heterogeneity of ID. These results also support the viewpoint that large number of ID genes converge on limited number of common networks i.e. ZNF589 belongs to KRAB-domain zinc-finger proteins previously implicated in ID, HHAT is predicted to affect sonic hedgehog, which is involved in several disorders with ID, KMT2B associated with syndromic ID fits the epigenetic module underlying the Kleefstra syndromic spectrum. The association of these novel genes in three different Pakistani ID families highlights the importance of screening these genes in more families with similar phenotypes from different populations to confirm the involvement of these genes in pathogenesis of ID.

  17. Whole genome association study identifies regions of the bovine genome and biological pathways involved in carcass trait performance in Holstein-Friesian cattle.

    Science.gov (United States)

    Doran, Anthony G; Berry, Donagh P; Creevey, Christopher J

    2014-10-01

    Four traits related to carcass performance have been identified as economically important in beef production: carcass weight, carcass fat, carcass conformation of progeny and cull cow carcass weight. Although Holstein-Friesian cattle are primarily utilized for milk production, they are also an important source of meat for beef production and export. Because of this, there is great interest in understanding the underlying genomic structure influencing these traits. Several genome-wide association studies have identified regions of the bovine genome associated with growth or carcass traits, however, little is known about the mechanisms or underlying biological pathways involved. This study aims to detect regions of the bovine genome associated with carcass performance traits (employing a panel of 54,001 SNPs) using measures of genetic merit (as predicted transmitting abilities) for 5,705 Irish Holstein-Friesian animals. Candidate genes and biological pathways were then identified for each trait under investigation. Following adjustment for false discovery (q-value carcass traits using a single SNP regression approach. Using a Bayesian approach, 46 QTL were associated (posterior probability > 0.5) with at least one of the four traits. In total, 557 unique bovine genes, which mapped to 426 human orthologs, were within 500kbs of QTL found associated with a trait using the Bayesian approach. Using this information, 24 significantly over-represented pathways were identified across all traits. The most significantly over-represented biological pathway was the peroxisome proliferator-activated receptor (PPAR) signaling pathway. A large number of genomic regions putatively associated with bovine carcass traits were detected using two different statistical approaches. Notably, several significant associations were detected in close proximity to genes with a known role in animal growth such as glucagon and leptin. Several biological pathways, including PPAR signaling, were

  18. Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

    Science.gov (United States)

    Al-sbou, Mohammed

    2012-06-01

    This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

  19. Genome-wide association study identifies candidate genes for starch content regulation in maize kernels

    Directory of Open Access Journals (Sweden)

    Na Liu

    2016-07-01

    Full Text Available Kernel starch content is an important trait in maize (Zea mays L. as it accounts for 65% to 75% of the dry kernel weight and positively correlates with seed yield. A number of starch synthesis-related genes have been identified in maize in recent years. However, many loci underlying variation in starch content among maize inbred lines still remain to be identified. The current study is a genome-wide association study that used a set of 263 maize inbred lines. In this panel, the average kernel starch content was 66.99%, ranging from 60.60% to 71.58% over the three study years. These inbred lines were genotyped with the SNP50 BeadChip maize array, which is comprised of 56,110 evenly spaced, random SNPs. Population structure was controlled by a mixed linear model (MLM as implemented in the software package TASSEL. After the statistical analyses, four SNPs were identified as significantly associated with starch content (P ≤ 0.0001, among which one each are located on chromosomes 1 and 5 and two are on chromosome 2. Furthermore, 77 candidate genes associated with starch synthesis were found within the 100-kb intervals containing these four QTLs, and four highly associated genes were within 20-kb intervals of the associated SNPs. Among the four genes, Glucose-1-phosphate adenylyltransferase (APS1; Gene ID GRMZM2G163437 is known as an important regulator of kernel starch content. The identified SNPs, QTLs, and candidate genes may not only be readily used for germplasm improvement by marker-assisted selection in breeding, but can also elucidate the genetic basis of starch content. Further studies on these identified candidate genes may help determine the molecular mechanisms regulating kernel starch content in maize and other important cereal crops.

  20. Technical evaluation of methods for identifying chemotherapy-induced febrile neutropenia in healthcare claims databases

    OpenAIRE

    Weycker Derek; Sofrygin Oleg; Seefeld Kim; Deeter Robert G; Legg Jason; Edelsberg John

    2013-01-01

    Abstract Background Healthcare claims databases have been used in several studies to characterize the risk and burden of chemotherapy-induced febrile neutropenia (FN) and effectiveness of colony-stimulating factors against FN. The accuracy of methods previously used to identify FN in such databases has not been formally evaluated. Methods Data comprised linked electronic medical records from Geisinger Health System and healthcare claims data from Geisinger Health Plan. Subjects were classifie...

  1. Functional SNP associated with birth weight in independent populations identified with a permutation step added to GBLUP-GWAS

    Science.gov (United States)

    This study was conducted as an initial assessment of a newly available genotyping assay containing about 34,000 common SNP included on previous SNP chips, and 199,000 sequence variants predicted to affect gene function. Objectives were to identify functional variants associated with birth weight in...

  2. A Quantitative Study Identifying Political Strategies Used by Principals of Dual Language Programs

    Science.gov (United States)

    Girard, Guadalupe

    2017-01-01

    Purpose. The purpose of this quantitative study was to identify the external and internal political strategies used by principals that allow them to successfully navigate the political environment surrounding dual language programs. Methodology. This quantitative study used descriptive research to collect, analyze, and report data that identified…

  3. Structural identifiability of cyclic graphical models of biological networks with latent variables.

    Science.gov (United States)

    Wang, Yulin; Lu, Na; Miao, Hongyu

    2016-06-13

    Graphical models have long been used to describe biological networks for a variety of important tasks such as the determination of key biological parameters, and the structure of graphical model ultimately determines whether such unknown parameters can be unambiguously obtained from experimental observations (i.e., the identifiability problem). Limited by resources or technical capacities, complex biological networks are usually partially observed in experiment, which thus introduces latent variables into the corresponding graphical models. A number of previous studies have tackled the parameter identifiability problem for graphical models such as linear structural equation models (SEMs) with or without latent variables. However, the limited resolution and efficiency of existing approaches necessarily calls for further development of novel structural identifiability analysis algorithms. An efficient structural identifiability analysis algorithm is developed in this study for a broad range of network structures. The proposed method adopts the Wright's path coefficient method to generate identifiability equations in forms of symbolic polynomials, and then converts these symbolic equations to binary matrices (called identifiability matrix). Several matrix operations are introduced for identifiability matrix reduction with system equivalency maintained. Based on the reduced identifiability matrices, the structural identifiability of each parameter is determined. A number of benchmark models are used to verify the validity of the proposed approach. Finally, the network module for influenza A virus replication is employed as a real example to illustrate the application of the proposed approach in practice. The proposed approach can deal with cyclic networks with latent variables. The key advantage is that it intentionally avoids symbolic computation and is thus highly efficient. Also, this method is capable of determining the identifiability of each single parameter and

  4. A novel nonsense mutation in the DMP1 gene identified by a genome-wide association study is responsible for inherited rickets in Corriedale sheep.

    Directory of Open Access Journals (Sweden)

    Xia Zhao

    Full Text Available Inherited rickets of Corriedale sheep is characterized by decreased growth rate, thoracic lordosis and angular limb deformities. Previous outcross and backcross studies implicate inheritance as a simple autosomal recessive disorder. A genome wide association study was conducted using the Illumina OvineSNP50 BeadChip on 20 related sheep comprising 17 affected and 3 carriers. A homozygous region of 125 consecutive single-nucleotide polymorphism (SNP loci was identified in all affected sheep, covering a region of 6 Mb on ovine chromosome 6. Among 35 candidate genes in this region, the dentin matrix protein 1 gene (DMP1 was sequenced to reveal a nonsense mutation 250C/T on exon 6. This mutation introduced a stop codon (R145X and could truncate C-terminal amino acids. Genotyping by PCR-RFLP for this mutation showed all 17 affected sheep were "T T" genotypes; the 3 carriers were "C T"; 24 phenotypically normal related sheep were either "C T" or "C C"; and 46 unrelated normal control sheep from other breeds were all "C C". The other SNPs in DMP1 were not concordant with the disease and can all be ruled out as candidates. Previous research has shown that mutations in the DMP1 gene are responsible for autosomal recessive hypophosphatemic rickets in humans. Dmp1_knockout mice exhibit rickets phenotypes. We believe the R145X mutation to be responsible for the inherited rickets found in Corriedale sheep. A simple diagnostic test can be designed to identify carriers with the defective "T" allele. Affected sheep could be used as animal models for this form of human rickets, and for further investigation of the role of DMP1 in phosphate homeostasis.

  5. A Novel Nonsense Mutation in the DMP1 Gene Identified by a Genome-Wide Association Study Is Responsible for Inherited Rickets in Corriedale Sheep

    Science.gov (United States)

    Blair, Hugh T.; Thompson, Keith G.; Rothschild, Max F.; Garrick, Dorian J.

    2011-01-01

    Inherited rickets of Corriedale sheep is characterized by decreased growth rate, thoracic lordosis and angular limb deformities. Previous outcross and backcross studies implicate inheritance as a simple autosomal recessive disorder. A genome wide association study was conducted using the Illumina OvineSNP50 BeadChip on 20 related sheep comprising 17 affected and 3 carriers. A homozygous region of 125 consecutive single-nucleotide polymorphism (SNP) loci was identified in all affected sheep, covering a region of 6 Mb on ovine chromosome 6. Among 35 candidate genes in this region, the dentin matrix protein 1 gene (DMP1) was sequenced to reveal a nonsense mutation 250C/T on exon 6. This mutation introduced a stop codon (R145X) and could truncate C-terminal amino acids. Genotyping by PCR-RFLP for this mutation showed all 17 affected sheep were “T T” genotypes; the 3 carriers were “C T”; 24 phenotypically normal related sheep were either “C T” or “C C”; and 46 unrelated normal control sheep from other breeds were all “C C”. The other SNPs in DMP1 were not concordant with the disease and can all be ruled out as candidates. Previous research has shown that mutations in the DMP1 gene are responsible for autosomal recessive hypophosphatemic rickets in humans. Dmp1_knockout mice exhibit rickets phenotypes. We believe the R145X mutation to be responsible for the inherited rickets found in Corriedale sheep. A simple diagnostic test can be designed to identify carriers with the defective “T” allele. Affected sheep could be used as animal models for this form of human rickets, and for further investigation of the role of DMP1 in phosphate homeostasis. PMID:21747952

  6. Reoperative sentinel lymph node biopsy after previous mastectomy.

    Science.gov (United States)

    Karam, Amer; Stempel, Michelle; Cody, Hiram S; Port, Elisa R

    2008-10-01

    Sentinel lymph node (SLN) biopsy is the standard of care for axillary staging in breast cancer, but many clinical scenarios questioning the validity of SLN biopsy remain. Here we describe our experience with reoperative-SLN (re-SLN) biopsy after previous mastectomy. Review of the SLN database from September 1996 to December 2007 yielded 20 procedures done in the setting of previous mastectomy. SLN biopsy was performed using radioisotope with or without blue dye injection superior to the mastectomy incision, in the skin flap in all patients. In 17 of 20 patients (85%), re-SLN biopsy was performed for local or regional recurrence after mastectomy. Re-SLN biopsy was successful in 13 of 20 patients (65%) after previous mastectomy. Of the 13 patients, 2 had positive re-SLN, and completion axillary dissection was performed, with 1 having additional positive nodes. In the 11 patients with negative re-SLN, 2 patients underwent completion axillary dissection demonstrating additional negative nodes. One patient with a negative re-SLN experienced chest wall recurrence combined with axillary recurrence 11 months after re-SLN biopsy. All others remained free of local or axillary recurrence. Re-SLN biopsy was unsuccessful in 7 of 20 patients (35%). In three of seven patients, axillary dissection was performed, yielding positive nodes in two of the three. The remaining four of seven patients all had previous modified radical mastectomy, so underwent no additional axillary surgery. In this small series, re-SLN was successful after previous mastectomy, and this procedure may play some role when axillary staging is warranted after mastectomy.

  7. Risk perception and unrecognized type 2 diabetes in women with previous gestational diabetes mellitus.

    Science.gov (United States)

    Malcolm, Janine; Lawson, Margaret L; Gaboury, Isabelle; Keely, Erin

    2009-09-01

    Women with a history of gestational diabetes mellitus (GDM) have a high chance of developing type 2 diabetes mellitus (T2DM) following the index pregnancy, however, little is known of women's perception of this risk. The objectives were to (1) determine women's perception of risk of future development of T2DM following a GDM pregnancy and (2) describe the prevalence of undetected dysglycaemia in a Canadian population. The study was designed as a 9-11 year follow-up study of women previously enrolled in a randomized controlled trial of tight versus minimal intervention for GDM. Women's perception of future risk of diabetes was determined by questionnaire. Fasting lipid profile, height and weight were performed on all participants. Oral glucose tolerance tests were performed on all women without prior history of diabetes mellitus type 2 (DM2). The study was conducted at Ottawa Hospital General Campus and Children's Hospital of Eastern Ontario, in Ottawa, Canada. Eighty-nine of 299 (30%) of the original cohort were recruited. Eighty-eight women completed the questionnaire and 77 women without known diabetes underwent two hour glucose tolerance testing. Twenty-three (30%) felt their risk was no different than other women or did not know, 27 (35%) felt risk was increased a little and 27 (35%) felt risk was increased a lot. Only 52% (40/77) had normal glucose tolerance. Of all, 25/88 (28%) patients had diabetes (11 previously diagnosed and 14 diagnosed within the study). Of those newly diagnosed with DM2, four (29%) were diagnosed by fasting glucose, six (42%) by two hour glucose tolerance test (GTT) alone and four (29%) by both. Twenty-four of the women (27%) had impaired glucose tolerance (IGT). Of those with IGT, 12 (57%) had a fasting food glucose DM2, and all had a waist circumference >88 cm. In conclusion the perception of being at high risk for T2DM did not prevent women from having undetected T2DM. Many factors are likely to contribute to this, including the

  8. Normative study of theme identifiability: Instructions with and without explanation of the false memory effect.

    Science.gov (United States)

    Beato, Maria Soledad; Cadavid, Sara

    2016-12-01

    False-memory illusions have been widely studied using the Deese/Roediger-McDermott paradigm (DRM). In this paradigm, words semantically related to a single nonpresented critical word are studied. In a later memory test, critical words are often falsely recalled and recognized. The present normative study was conducted to measure the theme identifiability of 60 associative word lists in Spanish that include six words (e.g., stove, coat, blanket, scarf, chill, and bonnet) that are simultaneously associated with three critical words (e.g., HEAT, COLD, and WINTER; Beato & Díez, Psicothema, 26, 457-463, 2011). Different levels of backward associative strength were used in the construction of the DRM lists. In addition, we used two types of instructions to obtain theme identifiability. In the without-explanation condition, traditional instructions were used, requesting participants to write the theme list. In the with-explanation condition, the false-memory effect and how the lists were built were explained, and an example of a DRM list and critical words was shown. Participants then had to discover the critical words. The results showed that all lists produced theme identifiability. Moreover, some lists had a higher theme identifiability rate (e.g., 61 % for the critical words LOVE, BOYFRIEND, COUPLE) than others (e.g., 24 % for CITY, PLACE, VILLAGE). After comparing the theme identifiabilities in the different conditions, the results indicated higher theme identifiability when the false-memory effect was explained than without such an explanation. Overall, these new normative data provide a useful tool for those experiments that, for example, aim to analyze the wide differences observed in false memory with DRM lists and the role of theme identifiability.

  9. Surveillance of extreme hyperbilirubinaemia in Denmark. A method to identify the newborn infants

    DEFF Research Database (Denmark)

    Bjerre, J.V.; Petersen, Jes Reinholdt; Ebbesen, F.

    2008-01-01

    birth and the others after having been discharged. The maximum TSB was 485 (450-734) micromol/L (median [range]) and appeared latest amongst those infants admitted from home, but was not different from the maximum TSB of the nondischarged infants. Forty-three infants had symptoms of early-phase acute....... The observed incidence of extreme hyperbilirubinaemia is higher than previously reported in Denmark. This is mainly due to a very sensitive method of identifying the study group Udgivelsesdato: 2008/8...

  10. 77 FR 70176 - Previous Participation Certification

    Science.gov (United States)

    2012-11-23

    ... participants' previous participation in government programs and ensure that the past record is acceptable prior... information is designed to be 100 percent automated and digital submission of all data and certifications is... government programs and ensure that the past record is acceptable prior to granting approval to participate...

  11. Development of an Internet-Administered Cognitive Behavior Therapy Program (ENGAGE) for Parents of Children Previously Treated for Cancer: Participatory Action Research Approach.

    Science.gov (United States)

    Wikman, Anna; Kukkola, Laura; Börjesson, Helene; Cernvall, Martin; Woodford, Joanne; Grönqvist, Helena; von Essen, Louise

    2018-04-18

    Parenting a child through cancer is a distressing experience, and a subgroup of parents report negative long-term psychological consequences years after treatment completion. However, there is a lack of evidence-based psychological interventions for parents who experience distress in relation to a child's cancer disease after end of treatment. One aim of this study was to develop an internet-administered, cognitive behavior therapy-based, psychological, guided, self-help intervention (ENGAGE) for parents of children previously treated for cancer. Another aim was to identify acceptable procedures for future feasibility and efficacy studies testing and evaluating the intervention. Participatory action research methodology was used. The study included face-to-face workshops and related Web-based exercises. A total of 6 parents (4 mothers, 2 fathers) of children previously treated for cancer were involved as parent research partners. Moreover, 2 clinical psychologists were involved as expert research partners. Research partners and research group members worked collaboratively throughout the study. Data were analyzed iteratively using written summaries of the workshops and Web-based exercises parallel to data collection. A 10-week, internet-administered, cognitive behavior therapy-based, psychological, guided, self-help intervention (ENGAGE) was developed in collaboration with parent research partners and expert research partners. The content of the intervention, mode and frequency of e-therapist support, and the individualized approach for feedback were modified based on the research partner input. Shared solutions were reached regarding the type and timing of support from an e-therapist (eg, initial video or telephone call, multiple methods of e-therapist contact), duration and timing of intervention (eg, 10 weeks, 30-min assessments), and the removal of unnecessary support functions (eg, removal of chat and forum functions). Preferences for study procedures in

  12. Utilization of genomic signatures to identify phenotype-specific drugs.

    Directory of Open Access Journals (Sweden)

    Seiichi Mori

    2009-08-01

    Full Text Available Genetic and genomic studies highlight the substantial complexity and heterogeneity of human cancers and emphasize the general lack of therapeutics that can match this complexity. With the goal of expanding opportunities for drug discovery, we describe an approach that makes use of a phenotype-based screen combined with the use of multiple cancer cell lines. In particular, we have used the NCI-60 cancer cell line panel that includes drug sensitivity measures for over 40,000 compounds assayed on 59 independent cells lines. Targets are cancer-relevant phenotypes represented as gene expression signatures that are used to identify cells within the NCI-60 panel reflecting the signature phenotype and then connect to compounds that are selectively active against those cells. As a proof-of-concept, we show that this strategy effectively identifies compounds with selectivity to the RAS or PI3K pathways. We have then extended this strategy to identify compounds that have activity towards cells exhibiting the basal phenotype of breast cancer, a clinically-important breast cancer characterized as ER-, PR-, and Her2- that lacks viable therapeutic options. One of these compounds, Simvastatin, has previously been shown to inhibit breast cancer cell growth in vitro and importantly, has been associated with a reduction in ER-, PR- breast cancer in a clinical study. We suggest that this approach provides a novel strategy towards identification of therapeutic agents based on clinically relevant phenotypes that can augment the conventional strategies of target-based screens.

  13. Effects of previous ovarian surgery for endometriosis on the outcome of assisted reproduction treatment.

    Science.gov (United States)

    Geber, Selmo; Ferreira, Daniela Parreiras; Spyer Prates, Luis Felipe Víctor; Sales, Liana; Sampaio, Marcos

    2002-01-01

    Endometriosis affects 2-50% of women at reproductive age. Surgery is an option for treatment, but there is no convincing evidence that it promotes a significant improvement in fertility. Also, the removal of ovarian endometrioma might lead to a reduction in the follicular reserve and response to stimulation. Therefore, the aim of this study was to evaluate the effect of previous ovarian surgery for endometriosis on the ovarian response in assisted reproduction treatment cycles and its pregnancy outcome. A total of 61 women, with primary infertility and previously having undergone ovarian surgery for endometriosis, who had received 74 IVF/intracytoplasmic sperm injection (ICSI) cycles, were studied (study group). A further 74 patients with primary infertility who underwent 77 IVF/ICSI cycles within#10; the same period of time, at the same clinic and without previous ovarian surgery or endometriosis were studied as a control group. Patients were matched for age and treatment performed. Patients 35 years with previous ovarian surgery needed more ampoules for ovulation induction (P = 0.017) and had fewer follicles and oocytes than women in the control group (P = 0.001). Duration of folliculogenesis was similar in both groups, as was fertilization rate. A total of 10 patients achieved pregnancy in the study group (34.5%) and 14 (48.3%) in the control group. Although a lower pregnancy rate was observed in patients who had undergone previous ovarian surgery, this difference was not statistically significant (P = 0.424). In conclusion, ovarian surgery for the treatment of endometriosis reduces the ovarian outcome in IVF/ICSI cycles in women >35 years old, and might also decrease pregnancy rates. Therefore, for infertile patients, non-surgical treatment might be a better option to avoid reduction of the ovarian response.

  14. NHash: Randomized N-Gram Hashing for Distributed Generation of Validatable Unique Study Identifiers in Multicenter Research.

    Science.gov (United States)

    Zhang, Guo-Qiang; Tao, Shiqiang; Xing, Guangming; Mozes, Jeno; Zonjy, Bilal; Lhatoo, Samden D; Cui, Licong

    2015-11-10

    A unique study identifier serves as a key for linking research data about a study subject without revealing protected health information in the identifier. While sufficient for single-site and limited-scale studies, the use of common unique study identifiers has several drawbacks for large multicenter studies, where thousands of research participants may be recruited from multiple sites. An important property of study identifiers is error tolerance (or validatable), in that inadvertent editing mistakes during their transmission and use will most likely result in invalid study identifiers. This paper introduces a novel method called "Randomized N-gram Hashing (NHash)," for generating unique study identifiers in a distributed and validatable fashion, in multicenter research. NHash has a unique set of properties: (1) it is a pseudonym serving the purpose of linking research data about a study participant for research purposes; (2) it can be generated automatically in a completely distributed fashion with virtually no risk for identifier collision; (3) it incorporates a set of cryptographic hash functions based on N-grams, with a combination of additional encryption techniques such as a shift cipher; (d) it is validatable (error tolerant) in the sense that inadvertent edit errors will mostly result in invalid identifiers. NHash consists of 2 phases. First, an intermediate string using randomized N-gram hashing is generated. This string consists of a collection of N-gram hashes f1, f2, ..., fk. The input for each function fi has 3 components: a random number r, an integer n, and input data m. The result, fi(r, n, m), is an n-gram of m with a starting position s, which is computed as (r mod |m|), where |m| represents the length of m. The output for Step 1 is the concatenation of the sequence f1(r1, n1, m1), f2(r2, n2, m2), ..., fk(rk, nk, mk). In the second phase, the intermediate string generated in Phase 1 is encrypted using techniques such as shift cipher. The result

  15. A systematic literature search to identify performance measure outcomes used in clinical studies of racehorses.

    Science.gov (United States)

    Wylie, C E; Newton, J R

    2018-05-01

    Racing performance is often used as a measurable outcome variable in research studies investigating clinical diagnoses or interventions. However, the use of many different performance measures largely precludes conduct of meaningful comparative studies and, to date, those being used have not been collated. To systematically review the veterinary scientific literature for the use of racing performance as a measurable outcome variable in clinical studies of racehorses, collate and identify those most popular, and identify their advantages and disadvantages. Systematic literature search. The search criteria "((racing AND performance) AND (horses OR equidae))" were adapted for both MEDLINE and CAB Abstracts databases. Data were collected in standardised recording forms for binary, categorical and quantitative measures, and the use of performance indices. In total, 217 studies that described racing performance were identified, contributing 117 different performance measures. No one performance measure was used in all studies, despite 90.3% using more than one variable. Data regarding race starts and earnings were used most commonly, with 88.0% and 54.4% of studies including at least one measure of starts and earnings, respectively. Seventeen variables were used 10 times or more, with the top five comprising: 'return to racing', 'number of starts', 'days to first start', 'earnings per period of time' and 'earnings per start'. The search strategies may not have identified all relevant papers, introducing bias to the review. Performance indices have been developed to improve assessment of interventions; however, they are not widely adopted in the scientific literature. Use of the two most commonly identified measures, whether the horse returned to racing and number of starts over a defined period of time, would best facilitate future systematic reviews and meta-analyses in advance of the development of a gold-standard measure of race performance outcome. © 2017 EVJ Ltd.

  16. Identifying the educational needs of menopausal women: a feasibility study.

    Science.gov (United States)

    Trudeau, Kimberlee J; Ainscough, Jessica L; Trant, Meredith; Starker, Joan; Cousineau, Tara M

    2011-01-01

    The goal of this project was to identify the educational needs of menopausal women and test the feasibility of an online self management program based on social learning theory. The four stages included 1) a needs assessment using a) focus groups with 24 women ages 40 to 55 and b) phone interviews with eight health experts; 2) the use of concept mapping methodology for quantifying qualitative data from stage 1 to identify the core programmatic concepts; 3) development of a demonstration program; and 4) a pilot study with 35 women and 9 health experts to assess knowledge gained and program satisfaction. Results show that women desire more information about normalcy of menopause and symptom management and found the program to meet a need for menopausal education otherwise perceived as unavailable. The women significantly increased their menopausal knowledge after brief exposure (t(34) = 3.64; p = .001). This project provides support for an online health education program for menopausal women and content ideas for inclusion in women's health education curriculum. Copyright © 2011 Jacobs Institute of Women's Health. Published by Elsevier Inc. All rights reserved.

  17. Association analysis identifies ZNF750 regulatory variants in psoriasis

    Directory of Open Access Journals (Sweden)

    Birnbaum Ramon Y

    2011-12-01

    Full Text Available Abstract Background Mutations in the ZNF750 promoter and coding regions have been previously associated with Mendelian forms of psoriasis and psoriasiform dermatitis. ZNF750 encodes a putative zinc finger transcription factor that is highly expressed in keratinocytes and represents a candidate psoriasis gene. Methods We examined whether ZNF750 variants were associated with psoriasis in a large case-control population. We sequenced the promoter and exon regions of ZNF750 in 716 Caucasian psoriasis cases and 397 Caucasian controls. Results We identified a total of 47 variants, including 38 rare variants of which 35 were novel. Association testing identified two ZNF750 haplotypes associated with psoriasis (p ZNF750 promoter and 5' UTR variants displayed a 35-55% reduction of ZNF750 promoter activity, consistent with the promoter activity reduction seen in a Mendelian psoriasis family with a ZNF750 promoter variant. However, the rare promoter and 5' UTR variants identified in this study did not strictly segregate with the psoriasis phenotype within families. Conclusions Two haplotypes of ZNF750 and rare 5' regulatory variants of ZNF750 were found to be associated with psoriasis. These rare 5' regulatory variants, though not causal, might serve as a genetic modifier of psoriasis.

  18. The long-term consequences of previous hyperthyroidism

    DEFF Research Database (Denmark)

    Hjelm Brandt Kristensen, Frans

    2015-01-01

    Thyroid hormones affect every cell in the human body, and the cardiovascular changes associated with increased levels of thyroid hormones are especially well described. As an example, short-term hyperthyroidism has positive chronotropic and inotropic effects on the heart, leading to a hyperdynamic...... with CVD, LD and DM both before and after the diagnosis of hyperthyroidism. Although the design used does not allow a stringent distinction between cause and effect, the findings indicate a possible direct association between hyperthyroidism and these morbidities, or vice versa....... vascular state. While it is biologically plausible that these changes may induce long-term consequences, the insight into morbidity as well as mortality in patients with previous hyperthyroidism is limited. The reasons for this are a combination of inadequately powered studies, varying definitions...

  19. Elucidating novel dysfunctional pathways in Alzheimer's disease by integrating loci identified in genetic and epigenetic studies

    Directory of Open Access Journals (Sweden)

    Adam R. Smith

    2016-06-01

    Full Text Available Alzheimer's disease is a complex neurodegenerative disorder. A large number of genome-wide association studies have been performed, which have been supplemented more recently by the first epigenome-wide association studies, leading to the identification of a number of novel loci altered in disease. Twin studies have shown monozygotic twin discordance for Alzheimer's disease (Gatz et al., 2006, leading to the conclusion that a combination of genetic and epigenetic mechanisms is likely to be involved in disease etiology (Lunnon & Mill, 2013. This review focuses on identifying overlapping pathways between published genome-wide association studies and epigenome-wide association studies, highlighting dysfunctional synaptic, lipid metabolism, plasma membrane/cytoskeleton, mitochondrial, and immune cell activation pathways. Identifying common pathways altered in genetic and epigenetic studies will aid our understanding of disease mechanisms and identify potential novel targets for pharmacological intervention.

  20. [Prevalence of previously diagnosed diabetes mellitus in Mexico.

    Science.gov (United States)

    Rojas-Martínez, Rosalba; Basto-Abreu, Ana; Aguilar-Salinas, Carlos A; Zárate-Rojas, Emiliano; Villalpando, Salvador; Barrientos-Gutiérrez, Tonatiuh

    2018-01-01

    To compare the prevalence of previously diagnosed diabetes in 2016 with previous national surveys and to describe treatment and its complications. Mexico's national surveys Ensa 2000, Ensanut 2006, 2012 and 2016 were used. For 2016, logistic regression models and measures of central tendency and dispersion were obtained. The prevalence of previously diagnosed diabetes in 2016 was 9.4%. The increase of 2.2% relative to 2012 was not significant and only observed in patients older than 60 years. While preventive measures have increased, the access to medical treatment and lifestyle has not changed. The treatment has been modified, with an increase in insulin and decrease in hypoglycaemic agents. Population aging, lack of screening actions and the increase in diabetes complications will lead to an increase on the burden of disease. Policy measures targeting primary and secondary prevention of diabetes are crucial.

  1. Analysis of previous perceptual and motor experience in breaststroke kick learning

    Directory of Open Access Journals (Sweden)

    Ried Bettina

    2015-12-01

    Full Text Available One of the variables that influence motor learning is the learner’s previous experience, which may provide perceptual and motor elements to be transferred to a novel motor skill. For swimming skills, several motor experiences may prove effective. Purpose. The aim was to analyse the influence of previous experience in playing in water, swimming lessons, and music or dance lessons on learning the breaststroke kick. Methods. The study involved 39 Physical Education students possessing basic swimming skills, but not the breaststroke, who performed 400 acquisition trials followed by 50 retention and 50 transfer trials, during which stroke index as well as rhythmic and spatial configuration indices were mapped, and answered a yes/no questionnaire regarding previous experience. Data were analysed by ANOVA (p = 0.05 and the effect size (Cohen’s d ≥0.8 indicating large effect size. Results. The whole sample improved their stroke index and spatial configuration index, but not their rhythmic configuration index. Although differences between groups were not significant, two types of experience showed large practical effects on learning: childhood water playing experience only showed major practically relevant positive effects, and no experience in any of the three fields hampered the learning process. Conclusions. The results point towards diverse impact of previous experience regarding rhythmic activities, swimming lessons, and especially with playing in water during childhood, on learning the breaststroke kick.

  2. Previous Employment and Job Satisfaction Conditions: The Case of Regional Administration

    Science.gov (United States)

    Amalia, Myronaki; Nikolaos, Antonakas

    2009-08-01

    In the present work we study the different dimensions of satisfaction and the way of constitution of satisfaction of an important sample of the employees in the Regional administration of Crete and in their connection with the variable of the previous employment. We found statistically important differences for the components of satisfaction from the life, collaboration in and outside from the department, in the social satisfaction and the variable of the years in the service (labour group with satisfaction than the other previous employment groups. In the other hand the group with many years in the service presents bigger satisfaction than the other groups. Finally, is important to note that the sample present some interesting characteristics.

  3. TAPDANCE: An automated tool to identify and annotate transposon insertion CISs and associations between CISs from next generation sequence data

    Directory of Open Access Journals (Sweden)

    Sarver Aaron L

    2012-06-01

    Full Text Available Abstract Background Next generation sequencing approaches applied to the analyses of transposon insertion junction fragments generated in high throughput forward genetic screens has created the need for clear informatics and statistical approaches to deal with the massive amount of data currently being generated. Previous approaches utilized to 1 map junction fragments within the genome and 2 identify Common Insertion Sites (CISs within the genome are not practical due to the volume of data generated by current sequencing technologies. Previous approaches applied to this problem also required significant manual annotation. Results We describe Transposon Annotation Poisson Distribution Association Network Connectivity Environment (TAPDANCE software, which automates the identification of CISs within transposon junction fragment insertion data. Starting with barcoded sequence data, the software identifies and trims sequences and maps putative genomic sequence to a reference genome using the bowtie short read mapper. Poisson distribution statistics are then applied to assess and rank genomic regions showing significant enrichment for transposon insertion. Novel methods of counting insertions are used to ensure that the results presented have the expected characteristics of informative CISs. A persistent mySQL database is generated and utilized to keep track of sequences, mappings and common insertion sites. Additionally, associations between phenotypes and CISs are also identified using Fisher’s exact test with multiple testing correction. In a case study using previously published data we show that the TAPDANCE software identifies CISs as previously described, prioritizes them based on p-value, allows holistic visualization of the data within genome browser software and identifies relationships present in the structure of the data. Conclusions The TAPDANCE process is fully automated, performs similarly to previous labor intensive approaches

  4. A Study of Scientometric Methods to Identify Emerging Technologies

    Energy Technology Data Exchange (ETDEWEB)

    Abercrombie, Robert K [ORNL; Udoeyop, Akaninyene W [ORNL

    2011-01-01

    This work examines a scientometric model that tracks the emergence of an identified technology from initial discovery (via original scientific and conference literature), through critical discoveries (via original scientific, conference literature and patents), transitioning through Technology Readiness Levels (TRLs) and ultimately on to commercial application. During the period of innovation and technology transfer, the impact of scholarly works, patents and on-line web news sources are identified. As trends develop, currency of citations, collaboration indicators, and on-line news patterns are identified. The combinations of four distinct and separate searchable on-line networked sources (i.e., scholarly publications and citation, worldwide patents, news archives, and on-line mapping networks) are assembled to become one collective network (a dataset for analysis of relations). This established network becomes the basis from which to quickly analyze the temporal flow of activity (searchable events) for the example subject domain we investigated.

  5. A Survey of Patients' Preoperative Need for Information About Postoperative Pain-Effect of Previous Surgery Experience.

    Science.gov (United States)

    Mavridou, Paraskevi; Manataki, Adamantia; Arnaoutoglou, Elena; Damigos, Dimitrios

    2017-10-01

    The aim of this study was to determine the kind of information patients need preoperatively about postoperative pain (POP) and whether this is affected by previous surgery experience. A descriptive study design using preoperative questionnaires. Questionnaires with fixed questions related to POP and its management were distributed preoperatively to consenting, consecutive surgical patients. Patients were divided into two groups: patients with previous surgery experience (group A) and patients without previous surgery experience (group B). Of the patients who participated in the study, 94.2% wanted information about POP and 77.8% of them believe that they will feel calmer if they get the information they need. The patients' biggest concern relates to pain management issues after discharge. Next, in order of preference is information about the analgesics that they need to take. The patients want to be informed primarily with a personal interview (59.4%). Previous surgery experience has no effect on patients' needs for information. Most of the patients want to be informed about the management of the POP after being discharged. It is remarkable that patients who had previous surgery experience need the same information with those who had no previous surgery. Copyright © 2016 American Society of PeriAnesthesia Nurses. Published by Elsevier Inc. All rights reserved.

  6. Meta-analytic framework for sparse K-means to identify disease subtypes in multiple transcriptomic studies.

    Science.gov (United States)

    Huo, Zhiguang; Ding, Ying; Liu, Silvia; Oesterreich, Steffi; Tseng, George

    Disease phenotyping by omics data has become a popular approach that potentially can lead to better personalized treatment. Identifying disease subtypes via unsupervised machine learning is the first step towards this goal. In this paper, we extend a sparse K -means method towards a meta-analytic framework to identify novel disease subtypes when expression profiles of multiple cohorts are available. The lasso regularization and meta-analysis identify a unique set of gene features for subtype characterization. An additional pattern matching reward function guarantees consistent subtype signatures across studies. The method was evaluated by simulations and leukemia and breast cancer data sets. The identified disease subtypes from meta-analysis were characterized with improved accuracy and stability compared to single study analysis. The breast cancer model was applied to an independent METABRIC dataset and generated improved survival difference between subtypes. These results provide a basis for diagnosis and development of targeted treatments for disease subgroups.

  7. Identifying Core Mobile Learning Faculty Competencies Based Integrated Approach: A Delphi Study

    Science.gov (United States)

    Elbarbary, Rafik Said

    2015-01-01

    This study is based on the integrated approach as a concept framework to identify, categorize, and rank a key component of mobile learning core competencies for Egyptian faculty members in higher education. The field investigation framework used four rounds Delphi technique to determine the importance rate of each component of core competencies…

  8. Genome-wide association study identifies three novel loci for type 2 diabetes

    DEFF Research Database (Denmark)

    Hara, Kazuo; Fujita, Hayato; Johnson, Todd A

    2014-01-01

    Although over 60 loci for type 2 diabetes (T2D) have been identified, there still remains a large genetic component to be clarified. To explore unidentified loci for T2D, we performed a genome-wide association study (GWAS) of 6 209 637 single-nucleotide polymorphisms (SNPs), which were directly g...

  9. TCGA study identifies genomic features of cervical cancer

    Science.gov (United States)

    Investigators with The Cancer Genome Atlas (TCGA) Research Network have identified novel genomic and molecular characteristics of cervical cancer that will aid in subclassification of the disease and may help target therapies that are most appropriate for each patient.

  10. Effect of Modifying Intervention Set Size with Acquisition Rate Data among Students Identified with a Learning Disability

    Science.gov (United States)

    Haegele, Katherine; Burns, Matthew K.

    2015-01-01

    The amount of information that students can successfully learn and recall at least 1 day later is called an acquisition rate (AR) and is unique to the individual student. The current study extended previous drill rehearsal research with word recognition by (a) using students identified with a learning disability in reading, (b) assessing set sizes…

  11. Influence of previous experience on resistance training on reliability of one-repetition maximum test.

    Science.gov (United States)

    Ritti-Dias, Raphael Mendes; Avelar, Ademar; Salvador, Emanuel Péricles; Cyrino, Edilson Serpeloni

    2011-05-01

    The 1-repetition maximum test (1RM) has been widely used to assess maximal strength. However, to improve accuracy in assessing maximal strength, several sessions of the 1RM test are recommended. The aim of this study was to analyze the influence of previous resistance training experience on the reliability of 1RM test. Thirty men were assigned to the following 2 groups according to their previous resistance training experience: no previous resistance training experience (NOEXP) and more than 24 months of resistance training experience (EXP). All subjects performed the 1RM tests in bench press and squat in 4 sessions on distinct days. There was a significant session × group effect in bench press (F = 3.09; p reliability of the 1RM test is influenced by the subject's previous experience in resistance training. Subjects without experience in resistance training require more practice and familiarization and show greater increases in maximal strength between sessions than subjects with previous experience in resistance training.

  12. Patterns of presentation of chronic ischemic heart disease with and without previous myocardial infarction

    International Nuclear Information System (INIS)

    Ahmad, R.; Rabbani, A.; Awan, Z.A.

    2009-01-01

    The prevalence of Ischemic Heart Disease (IHD) is on the rise, from increasing lifespan of population and availability of better medical facilities. We studied chronic IHD cases with and without previous myocardial infarction, in Hazara, NWFP, Pakistan to evaluate left ventricular (LV) dysfunction, wall motion abnormalities and complications of IHD. All patients presenting with history of chest pain in Medical 'C' Unit, Ayub Teaching Hospital, Abbottabad from June 2004 to May 2005 were included in the study. Patients with non-cardiac chest pain were excluded from the study. Cases with congenital and rheumatic heart disease, cardiomyopathies, unstable angina and acute MI were excluded. Patients with IHD with or without myocardial infarction (MI) were studied for left ventricular dysfunction (ejection fraction, left atrial size, E/A ratio), wall motion abnormalities and complications of IHD (Mitral regurgitation, Ventricular Septal Defect (VSD), LV aneurysm, LV clot). Clinical and echocardiographic evaluation was done in each case. Out of 183 cases of chronic IHD, 123 patients were without previous MI and 60 had had previous MI. Ejection fraction (EF) was 45%+-15 in the group without MI and 35+-11% in cases with MI. Left Atrium (LA) size was 35+-6 mm and 39+-4 mm in the two groups respectively. LV diastolic dysfunction was seen in 17% in the first and 24% in the second group respectively. Global hypokinesia was seen in 8% and 17% in the 2 groups respectively. Regional Wall Motion Abnormality (RWMA) was observed in 12% in patients without MI and in 58% cases with MI. Mitral regurgitation was seen in 10 and 20% in the 2 groups respectively LV clots, VSD, LV and aneurysm were seen in 8.4, 5, and 6.5% respectively, only in cases with previous MI. LV dysfunction, wall motion abnormalities and mitral regurgitation were more common in IHD cases with previous heart attack. (author)

  13. 75 FR 76056 - FEDERAL REGISTER CITATION OF PREVIOUS ANNOUNCEMENT:

    Science.gov (United States)

    2010-12-07

    ... SECURITIES AND EXCHANGE COMMISSION Sunshine Act Meeting FEDERAL REGISTER CITATION OF PREVIOUS ANNOUNCEMENT: STATUS: Closed meeting. PLACE: 100 F Street, NE., Washington, DC. DATE AND TIME OF PREVIOUSLY ANNOUNCED MEETING: Thursday, December 9, 2010 at 2 p.m. CHANGE IN THE MEETING: Time change. The closed...

  14. Molecular docking and NMR binding studies to identify novel inhibitors of human phosphomevalonate kinase

    Energy Technology Data Exchange (ETDEWEB)

    Boonsri, Pornthip [Chemical Proteomics Facility at Marquette, Department of Chemistry, Marquette University, Milwaukee, WI 53201 (United States); Department of Chemistry, NANOTEC Center of Nanotechnology, National Nanotechnology Center, Faculty of Science, Kasetsart University, Bangkok 10900 (Thailand); Neumann, Terrence S.; Olson, Andrew L.; Cai, Sheng [Chemical Proteomics Facility at Marquette, Department of Chemistry, Marquette University, Milwaukee, WI 53201 (United States); Herdendorf, Timothy J.; Miziorko, Henry M. [Division of Molecular Biology and Biochemistry, School of Biological Sciences, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); Hannongbua, Supa [Department of Chemistry, NANOTEC Center of Nanotechnology, National Nanotechnology Center, Faculty of Science, Kasetsart University, Bangkok 10900 (Thailand); Sem, Daniel S., E-mail: daniel.sem@cuw.edu [Chemical Proteomics Facility at Marquette, Department of Chemistry, Marquette University, Milwaukee, WI 53201 (United States)

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer Natural and synthetic inhibitors of human phosphomevalonate kinase identified. Black-Right-Pointing-Pointer Virtual screening yielded a hit rate of 15%, with inhibitor K{sub d}'s of 10-60 {mu}M. Black-Right-Pointing-Pointer NMR studies indicate significant protein conformational changes upon binding. -- Abstract: Phosphomevalonate kinase (PMK) phosphorylates mevalonate-5-phosphate (M5P) in the mevalonate pathway, which is the sole source of isoprenoids and steroids in humans. We have identified new PMK inhibitors with virtual screening, using autodock. Promising hits were verified and their affinity measured using NMR-based {sup 1}H-{sup 15}N heteronuclear single quantum coherence (HSQC) chemical shift perturbation and fluorescence titrations. Chemical shift changes were monitored, plotted, and fitted to obtain dissociation constants (K{sub d}). Tight binding compounds with K{sub d}'s ranging from 6-60 {mu}M were identified. These compounds tended to have significant polarity and negative charge, similar to the natural substrates (M5P and ATP). HSQC cross peak changes suggest that binding induces a global conformational change, such as domain closure. Compounds identified in this study serve as chemical genetic probes of human PMK, to explore pharmacology of the mevalonate pathway, as well as starting points for further drug development.

  15. VBAC Scoring: Successful vaginal delivery in previous one caesarean section in induced labour

    International Nuclear Information System (INIS)

    Raja, J.F.; Bangash, K.T.; Mahmud, G.

    2013-01-01

    Objective: To develop a scoring system for the prediction of successful vaginal birth after caesarean section, following induction of labour with intra-vaginal E2 gel (Glandin). Methods: The cross-sectional study was conducted from January 2010 to August 2011, at the Pakistan Institute of Medical Sciences in Islamabad. Trial of labour in previous one caesarean section, undergoing induction with intra-vaginal E2 gel, was attempted in 100 women. They were scored according to six variables; maternal age; gestation; indications of previous caesarean; history of vaginal birth either before or after the previous caesarean; Bishop score and body mass index. Multivariate and univariate logistic regression analysis was used to develop the scoring system. Results: Of the total, 67 (67%) women delivered vaginally, while 33 (33%) ended in repeat caesarean delivery. Among the subjects, 55 (55%) women had no history of vaginal delivery either before or after previous caesarean section; 15 (15%) had history of vaginal births both before and after the previous caesarean; while 30 (30%) had vaginal delivery only after the previous caesarean section. Rates of successful vaginal birth after caesarean increased from 38% in women having a score of 0-3 to 58% in patients scoring 4-6. Among those having a score of 7-9 and 10-12, the success rates were 71% and 86% respectively. Conclusion: Increasing scores correlated with the increasing probability of vaginal birth after caesarean undergoing induction of labour. The admission VBAC scoring system is useful in counselling women with previous caesarean for the option of induction of labour or repeat caesarean delivery. (author)

  16. Loci influencing blood pressure identified using a cardiovascular gene-centric array.

    Science.gov (United States)

    Ganesh, Santhi K; Tragante, Vinicius; Guo, Wei; Guo, Yiran; Lanktree, Matthew B; Smith, Erin N; Johnson, Toby; Castillo, Berta Almoguera; Barnard, John; Baumert, Jens; Chang, Yen-Pei Christy; Elbers, Clara C; Farrall, Martin; Fischer, Mary E; Franceschini, Nora; Gaunt, Tom R; Gho, Johannes M I H; Gieger, Christian; Gong, Yan; Isaacs, Aaron; Kleber, Marcus E; Mateo Leach, Irene; McDonough, Caitrin W; Meijs, Matthijs F L; Mellander, Olle; Molony, Cliona M; Nolte, Ilja M; Padmanabhan, Sandosh; Price, Tom S; Rajagopalan, Ramakrishnan; Shaffer, Jonathan; Shah, Sonia; Shen, Haiqing; Soranzo, Nicole; van der Most, Peter J; Van Iperen, Erik P A; Van Setten, Jessica; Van Setten, Jessic A; Vonk, Judith M; Zhang, Li; Beitelshees, Amber L; Berenson, Gerald S; Bhatt, Deepak L; Boer, Jolanda M A; Boerwinkle, Eric; Burkley, Ben; Burt, Amber; Chakravarti, Aravinda; Chen, Wei; Cooper-Dehoff, Rhonda M; Curtis, Sean P; Dreisbach, Albert; Duggan, David; Ehret, Georg B; Fabsitz, Richard R; Fornage, Myriam; Fox, Ervin; Furlong, Clement E; Gansevoort, Ron T; Hofker, Marten H; Hovingh, G Kees; Kirkland, Susan A; Kottke-Marchant, Kandice; Kutlar, Abdullah; Lacroix, Andrea Z; Langaee, Taimour Y; Li, Yun R; Lin, Honghuang; Liu, Kiang; Maiwald, Steffi; Malik, Rainer; Murugesan, Gurunathan; Newton-Cheh, Christopher; O'Connell, Jeffery R; Onland-Moret, N Charlotte; Ouwehand, Willem H; Palmas, Walter; Penninx, Brenda W; Pepine, Carl J; Pettinger, Mary; Polak, Joseph F; Ramachandran, Vasan S; Ranchalis, Jane; Redline, Susan; Ridker, Paul M; Rose, Lynda M; Scharnag, Hubert; Schork, Nicholas J; Shimbo, Daichi; Shuldiner, Alan R; Srinivasan, Sathanur R; Stolk, Ronald P; Taylor, Herman A; Thorand, Barbara; Trip, Mieke D; van Duijn, Cornelia M; Verschuren, W Monique; Wijmenga, Cisca; Winkelmann, Bernhard R; Wyatt, Sharon; Young, J Hunter; Boehm, Bernhard O; Caulfield, Mark J; Chasman, Daniel I; Davidson, Karina W; Doevendans, Pieter A; Fitzgerald, Garret A; Gums, John G; Hakonarson, Hakon; Hillege, Hans L; Illig, Thomas; Jarvik, Gail P; Johnson, Julie A; Kastelein, John J P; Koenig, Wolfgang; März, Winfried; Mitchell, Braxton D; Murray, Sarah S; Oldehinkel, Albertine J; Rader, Daniel J; Reilly, Muredach P; Reiner, Alex P; Schadt, Eric E; Silverstein, Roy L; Snieder, Harold; Stanton, Alice V; Uitterlinden, André G; van der Harst, Pim; van der Schouw, Yvonne T; Samani, Nilesh J; Johnson, Andrew D; Munroe, Patricia B; de Bakker, Paul I W; Zhu, Xiaofeng; Levy, Daniel; Keating, Brendan J; Asselbergs, Folkert W

    2013-04-15

    Blood pressure (BP) is a heritable determinant of risk for cardiovascular disease (CVD). To investigate genetic associations with systolic BP (SBP), diastolic BP (DBP), mean arterial pressure (MAP) and pulse pressure (PP), we genotyped ∼50 000 single-nucleotide polymorphisms (SNPs) that capture variation in ∼2100 candidate genes for cardiovascular phenotypes in 61 619 individuals of European ancestry from cohort studies in the USA and Europe. We identified novel associations between rs347591 and SBP (chromosome 3p25.3, in an intron of HRH1) and between rs2169137 and DBP (chromosome1q32.1 in an intron of MDM4) and between rs2014408 and SBP (chromosome 11p15 in an intron of SOX6), previously reported to be associated with MAP. We also confirmed 10 previously known loci associated with SBP, DBP, MAP or PP (ADRB1, ATP2B1, SH2B3/ATXN2, CSK, CYP17A1, FURIN, HFE, LSP1, MTHFR, SOX6) at array-wide significance (P < 2.4 × 10(-6)). We then replicated these associations in an independent set of 65 886 individuals of European ancestry. The findings from expression QTL (eQTL) analysis showed associations of SNPs in the MDM4 region with MDM4 expression. We did not find any evidence of association of the two novel SNPs in MDM4 and HRH1 with sequelae of high BP including coronary artery disease (CAD), left ventricular hypertrophy (LVH) or stroke. In summary, we identified two novel loci associated with BP and confirmed multiple previously reported associations. Our findings extend our understanding of genes involved in BP regulation, some of which may eventually provide new targets for therapeutic intervention.

  17. Identifying a Small Molecule Blocking Antigen Presentation in Autoimmune Thyroiditis.

    Science.gov (United States)

    Li, Cheuk Wun; Menconi, Francesca; Osman, Roman; Mezei, Mihaly; Jacobson, Eric M; Concepcion, Erlinda; David, Chella S; Kastrinsky, David B; Ohlmeyer, Michael; Tomer, Yaron

    2016-02-19

    We previously showed that an HLA-DR variant containing arginine at position 74 of the DRβ1 chain (DRβ1-Arg74) is the specific HLA class II variant conferring risk for autoimmune thyroid diseases (AITD). We also identified 5 thyroglobulin (Tg) peptides that bound to DRβ1-Arg74. We hypothesized that blocking the binding of these peptides to DRβ1-Arg74 could block the continuous T-cell activation in thyroiditis needed to maintain the autoimmune response to the thyroid. The aim of the current study was to identify small molecules that can block T-cell activation by Tg peptides presented within DRβ1-Arg74 pockets. We screened a large and diverse library of compounds and identified one compound, cepharanthine that was able to block peptide binding to DRβ1-Arg74. We then showed that Tg.2098 is the dominant peptide when inducing experimental autoimmune thyroiditis (EAT) in NOD mice expressing human DRβ1-Arg74. Furthermore, cepharanthine blocked T-cell activation by thyroglobulin peptides, in particular Tg.2098 in mice that were induced with EAT. For the first time we identified a small molecule that can block Tg peptide binding and presentation to T-cells in autoimmune thyroiditis. If confirmed cepharanthine could potentially have a role in treating human AITD. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Previously Identified Deficiencies Not Corrected in the General Fund Enterprise Business System Program

    Science.gov (United States)

    2011-06-15

    Army AAA Report No. A-2009-0226- FFM , “Examination of Federal Financial Management Improvement Act Compliance - Test Validation General Fund Enterprise...Business System Release 1.2,” September 30, 2009 AAA Report No. A-2009-0231- FFM , “General Fund Enterprise Business System - Federal Financial...Management Improvement Act Compliance Examination of Release 1.3 Functionality,” September 30, 2009 AAA Report No. A-2009-0232- FFM , “General Fund

  19. Identifying Dieters Who Will Develop an Eating Disorder: A Prospective, Population-Based Study

    Science.gov (United States)

    Fairburn, Christopher G.; Cooper, Zafra; Doll, Helen A.; Davies, Beverley A.

    2010-01-01

    Objective The aims of the study were to identify the characteristics of the dieters most at risk of subsequently developing an eating disorder and to evaluate the feasibility of using a brief questionnaire to identify such dieters in advance. Method A general population cohort of 2,992 young women who were dieting was identified. On four occasions over the subsequent 2 years, this cohort was sent a questionnaire concerning eating habits and attitudes. Participants whose responses suggested that they had developed an eating disorder were interviewed to establish their true case status. The baseline questionnaires of those who did and did not subsequently develop an eating disorder were compared to identify features that predicted future case status. Results One hundred four of the dieters developed an eating disorder of clinical severity during the 2 years of follow-up. Their baseline questionnaire scores differed in many respects from those who had not developed an eating disorder. Items associated with developing an eating disorder were selected by using three different statistical methods. A simple case-predicting instrument based on one of five items scoring above an optimal cut point had a sensitivity of 71% and a specificity of 72% (overall efficiency of 72%). Conclusions Dieters who will develop an eating disorder within the next 2 years have distinctive features. It is feasible to identify them in advance with reasonable efficiency with a brief questionnaire. This questionnaire could be incorporated into routine health assessments, thereby identifying those at high risk. PMID:16330587

  20. 28 CFR 10.5 - Incorporation of papers previously filed.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Incorporation of papers previously filed... CARRYING ON ACTIVITIES WITHIN THE UNITED STATES Registration Statement § 10.5 Incorporation of papers previously filed. Papers and documents already filed with the Attorney General pursuant to the said act and...

  1. Exploiting intrinsic fluctuations to identify model parameters.

    Science.gov (United States)

    Zimmer, Christoph; Sahle, Sven; Pahle, Jürgen

    2015-04-01

    Parameterisation of kinetic models plays a central role in computational systems biology. Besides the lack of experimental data of high enough quality, some of the biggest challenges here are identification issues. Model parameters can be structurally non-identifiable because of functional relationships. Noise in measured data is usually considered to be a nuisance for parameter estimation. However, it turns out that intrinsic fluctuations in particle numbers can make parameters identifiable that were previously non-identifiable. The authors present a method to identify model parameters that are structurally non-identifiable in a deterministic framework. The method takes time course recordings of biochemical systems in steady state or transient state as input. Often a functional relationship between parameters presents itself by a one-dimensional manifold in parameter space containing parameter sets of optimal goodness. Although the system's behaviour cannot be distinguished on this manifold in a deterministic framework it might be distinguishable in a stochastic modelling framework. Their method exploits this by using an objective function that includes a measure for fluctuations in particle numbers. They show on three example models, immigration-death, gene expression and Epo-EpoReceptor interaction, that this resolves the non-identifiability even in the case of measurement noise with known amplitude. The method is applied to partially observed recordings of biochemical systems with measurement noise. It is simple to implement and it is usually very fast to compute. This optimisation can be realised in a classical or Bayesian fashion.

  2. Identifying Major Dietary Patterns Among the Elderly in Tehran Health Homes

    Directory of Open Access Journals (Sweden)

    Abdollahi

    2015-10-01

    Full Text Available Background Previous studies on diet have primarily focused on individual nutrients or foods. Recently, the analysis of dietary patterns has emerged as a possible approach for examining food consumption. A literature review revealed no studies of dietary patterns in elderly Iranians. Objectives Our objective was to identify the major dietary intake patterns among the elderly in the health homes located in Zone 5 of Tehran city, Iran. Patients and Methods In this cross-sectional study (descriptive, 368 elderly people (≥ 60 years old were randomly selected. Their usual dietary intake during the past year was assessed using a 168-item semiquantitative food frequency questionnaire. Major food patterns were derived using factor analysis after the classification of food items into 26 groups. Results Four major dietary patterns were identified in the studied population: 1 healthy pattern, characterized by a higher intake of vegetables, tomato and tomato sauce, vegetable oil, olive, and fruits; 2 unhealthy pattern, characterized by a higher intake of red meat, fast food, snacks, sugar, honey and jam, soft drinks, and high-fat dairy products; 3. traditional pattern characterized by intake of whole grains, hydrogenated oil and animal fat, beans, salt, and pickles; and 4 protein-rich pattern, characterized by intake of chicken and poultry, fish, grains, and organ meats. These four major dietary patterns explained 16.3%, 7.5%, 6.7%, and 5.7% of the total variance, respectively. Conclusions Four major dietary patterns were identified in the present studied population that can be used to provide tangible dietary advice for the elderly.

  3. SPARQL-enabled identifier conversion with Identifiers.org.

    Science.gov (United States)

    Wimalaratne, Sarala M; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille

    2015-06-01

    On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. © The Author 2015. Published by Oxford University Press.

  4. SPARQL-enabled identifier conversion with Identifiers.org

    Science.gov (United States)

    Wimalaratne, Sarala M.; Bolleman, Jerven; Juty, Nick; Katayama, Toshiaki; Dumontier, Michel; Redaschi, Nicole; Le Novère, Nicolas; Hermjakob, Henning; Laibe, Camille

    2015-01-01

    Motivation: On the semantic web, in life sciences in particular, data is often distributed via multiple resources. Each of these sources is likely to use their own International Resource Identifier for conceptually the same resource or database record. The lack of correspondence between identifiers introduces a barrier when executing federated SPARQL queries across life science data. Results: We introduce a novel SPARQL-based service to enable on-the-fly integration of life science data. This service uses the identifier patterns defined in the Identifiers.org Registry to generate a plurality of identifier variants, which can then be used to match source identifiers with target identifiers. We demonstrate the utility of this identifier integration approach by answering queries across major producers of life science Linked Data. Availability and implementation: The SPARQL-based identifier conversion service is available without restriction at http://identifiers.org/services/sparql. Contact: sarala@ebi.ac.uk PMID:25638809

  5. Pilot study on the use of data mining to identify cochlear implant candidates.

    Science.gov (United States)

    Grisel, Jedidiah J; Schafer, Erin; Lam, Anne; Griffin, Terry

    2018-05-01

    The goal of this pilot study was to determine the clinical utility of data-mining software that screens for cochlear implant (CI) candidacy. The Auditory Implant Initiative developed a software module that screens for CI candidates via integration with a software system (Noah 4) that serves as a depository for hearing test data. To identify candidates, patient audiograms from one practice were exported into the screening module. Candidates were tracked to determine if any eventually underwent implantation. After loading 4836 audiograms from the Noah 4 system, the screening module identified 558 potential CI candidates. After reviewing the data for the potential candidates, 117 were targeted and invited to an educational event. Following the event, a total of six candidates were evaluated, and two were implanted. This objective approach to identifying candidates has the potential to address the gross underutilization of CIs by removing any bias or lack of knowledge regarding the management of severe to profound sensorineural hearing loss with CIs. The screening module was an effective tool for identifying potential CI candidates at one ENT practice. On a larger scale, the screening module has the potential to impact thousands of CI candidates worldwide.

  6. Use of previous maternal health services has a limited role in reattendance for skilled institutional delivery: cross-sectional survey in Northwest Ethiopia

    Directory of Open Access Journals (Sweden)

    Kebede B

    2013-02-01

    Full Text Available Bekana Kebede,1 Abebaw Gebeyehu,2 Gashaw Andargie11Department of Health Services Management, 2Department of Reproductive Health, Institute of Public Health, University of Gondar, EthiopiaBackground: Maternal mortality rates are unacceptably high in Ethiopia. Institutional delivery with skilled care of the mother is one of the interventions proven to reduce the risk of complications that can cause maternal and neonatal mortality. Quality of service given during antenatal visits and childbirth are important measures. The purpose of this study was to investigate the use of skilled institutional delivery and its repeat use during a subsequent pregnancy and to identify any reasons why women avoid institutional delivery.Methods: A community-based cross-sectional study was conducted from March to June 2012 in Chilga Woreda, Northwest Ethiopia. Data were collected from women who gave birth during the year preceding the survey. Information was entered and cleaned using the Statistical Package for Social Sciences. Multivariate and binary logistic regression was used to identify the relative effect of each explanatory variable on the outcome.Results: A total of 402 (84.2% women gave birth at home. Previous experience of skilled institutional delivery had a limited role in subsequent acceptance or use of institutional delivery. Most mothers who had previously had institutional delivery gave birth at home. Although 111 (40.8% women visited the health facility during their pregnancy only because of illness, 184 (38.8% did not know when to visit for antenatal care. In multivariate analysis, lower maternal education, being a rural resident, previous use of institutional delivery, remoteness of the health facility, and multiparity were factors significantly associated with less likelihood of institutional delivery. Number of months pregnant at the time of the first antenatal visit had no role in increasing the likelihood of institutional delivery.Conclusion: The

  7. Identifying fallacious arguments in a qualitative study of antipsychotic prescribing in dementia.

    Science.gov (United States)

    Donyai, Parastou

    2017-10-01

    Dementia can result in cognitive, noncognitive and behavioural symptoms which are difficult to manage. Formal guidelines for the care and management of dementia in the UK state that antipsychotics should only be prescribed where fully justified. This is because inappropriate use, particularly problematic in care-home settings, can produce severe side effects including death. The aim of this study was to explore the use of fallacious arguments in professionals' deliberations about antipsychotic prescribing in dementia in care-home settings. Fallacious arguments have the potential to become unremarkable discourses that construct and validate practices which are counter to guidelines. This qualitative study involved interviews with 28 care-home managers and health professionals involved in caring for patients with dementia. Potentially fallacious arguments were identified using qualitative content analysis and a coding framework constructed from existing explanatory models of fallacious reasoning. Fallacious arguments were identified in a range of explanations and reasons that participants gave for in answer to questions about initiating, reducing doses of and stopping antipsychotics in dementia. The dominant fallacy was false dichotomy. Appeal to popularity, tradition, consequence, emotion, or fear, and the slippery slope argument was also identified. Fallacious arguments were often formulated to present convincing cases whereby prescribing antipsychotics or maintaining existing doses (versus not starting medication or reducing the dose, for example) appeared as the only acceptable decision but this is not always the case. The findings could help health professionals to recognise and mitigate the effect of logic-based errors in decisions about the prescribing of antipsychotics in dementia. © 2016 Royal Pharmaceutical Society.

  8. Regulatory O-GlcNAcylation sites on FoxO1 are yet to be identified

    Energy Technology Data Exchange (ETDEWEB)

    Fardini, Yann [INSERM, U1016, Institut Cochin, Paris (France); CNRS, UMR8104, Paris (France); Université Paris Descartes, Sorbonne Paris Cité, Paris (France); Perez-Cervera, Yobana [Structural and Functional Glycobiology Unit, Lille 1 University, CNRS (UMR 8576), IFR 117, Villeneuve d' Ascq (France); Facultad de Odontología, Universidad Autónoma Benito Juárez de Oaxaca, Oaxaca (Mexico); Camoin, Luc [INSERM, U1068, CRCM, Marseille Protéomique IBiSA, Marseille, F-13009 (France); Institut Paoli-Calmettes Team, Cell Polarity, Cell Signaling and Cancer, Marseille, F-13009 (France); Aix-Marseille Université, F-13284, Marseille (France); CNRS, UMR7258, CRCM, Marseille, F-13009 (France); Pagesy, Patrick [INSERM, U1016, Institut Cochin, Paris (France); CNRS, UMR8104, Paris (France); Université Paris Descartes, Sorbonne Paris Cité, Paris (France); Lefebvre, Tony [Structural and Functional Glycobiology Unit, Lille 1 University, CNRS (UMR 8576), IFR 117, Villeneuve d' Ascq (France); Issad, Tarik, E-mail: tarik.issad@inserm.fr [INSERM, U1016, Institut Cochin, Paris (France); CNRS, UMR8104, Paris (France); Université Paris Descartes, Sorbonne Paris Cité, Paris (France)

    2015-06-26

    O-GlcNAcylation is a reversible post-translational modification that regulates cytosolic and nuclear proteins. We and others previously demonstrated that FoxO1 is O-GlcNAcylated in different cell types, resulting in an increase in its transcriptional activity. Four O-GlcNAcylation sites were identified in human FOXO1 but directed mutagenesis of each site individually had modest (T317) or no effect (S550, T648, S654) on its O-GlcNAcylation status and transcriptional activity. Moreover, the consequences of mutating all four sites had not been investigated. In the present work, we mutated these sites in the mouse Foxo1 and found that mutation of all four sites did not decrease Foxo1 O-GlcNAcylation status and transcriptional activity, and would even tend to increase them. In an attempt to identify other O-GlcNAcylation sites, we immunoprecipitated wild-type O-GlcNAcylated Foxo1 and analysed the tryptic digest peptides by mass spectrometry using High-energy Collisional Dissociation. We identified T646 as a new O-GlcNAcylation site on Foxo1. However, site directed mutagenesis of this site individually or together with all four previously identified residues did not impair Foxo1 O-GlcNAcylation and transcriptional activity. These results suggest that residues important for the control of Foxo1 activity by O-GlcNAcylation still remain to be identified. - Highlights: • We mutate four previously identified O-GlcNAcylation sites on Foxo1. • Unexpectedly, these mutations do not reduce Foxo1 O-GlcNAcylation. • These mutation do not reduce Foxo1 transcriptional activity. • We identify a new O-GlcNAcylation site on Foxo1 by mass spectrometry. • Mutation of this site increases Foxo1 transcriptional activity.

  9. Regulatory O-GlcNAcylation sites on FoxO1 are yet to be identified

    International Nuclear Information System (INIS)

    Fardini, Yann; Perez-Cervera, Yobana; Camoin, Luc; Pagesy, Patrick; Lefebvre, Tony; Issad, Tarik

    2015-01-01

    O-GlcNAcylation is a reversible post-translational modification that regulates cytosolic and nuclear proteins. We and others previously demonstrated that FoxO1 is O-GlcNAcylated in different cell types, resulting in an increase in its transcriptional activity. Four O-GlcNAcylation sites were identified in human FOXO1 but directed mutagenesis of each site individually had modest (T317) or no effect (S550, T648, S654) on its O-GlcNAcylation status and transcriptional activity. Moreover, the consequences of mutating all four sites had not been investigated. In the present work, we mutated these sites in the mouse Foxo1 and found that mutation of all four sites did not decrease Foxo1 O-GlcNAcylation status and transcriptional activity, and would even tend to increase them. In an attempt to identify other O-GlcNAcylation sites, we immunoprecipitated wild-type O-GlcNAcylated Foxo1 and analysed the tryptic digest peptides by mass spectrometry using High-energy Collisional Dissociation. We identified T646 as a new O-GlcNAcylation site on Foxo1. However, site directed mutagenesis of this site individually or together with all four previously identified residues did not impair Foxo1 O-GlcNAcylation and transcriptional activity. These results suggest that residues important for the control of Foxo1 activity by O-GlcNAcylation still remain to be identified. - Highlights: • We mutate four previously identified O-GlcNAcylation sites on Foxo1. • Unexpectedly, these mutations do not reduce Foxo1 O-GlcNAcylation. • These mutation do not reduce Foxo1 transcriptional activity. • We identify a new O-GlcNAcylation site on Foxo1 by mass spectrometry. • Mutation of this site increases Foxo1 transcriptional activity

  10. The validity and reliability of iridology in the diagnosis of previous acute appendicitis as evi-denced by appendectomy

    Directory of Open Access Journals (Sweden)

    L. Frank

    2013-01-01

    Full Text Available Iridology is defined as a photographic science that identifies pathological and functional changes within organs via biomicroscopic iris assessment for aberrant lines, spots, and discolourations. According to iridology, the iris does not reflect changes  during  anaesthesia,  due  to  the  drugs inhibitory  effects  on  nerves  impulses,  and  in cases of organ removal, it reflects the pre-surgical condition.The profession of Homoeopathy is frequently associated with iridology and in a recent survey (2009  investigating  the  perceptions  of  Masters of  Technology  graduates  in  Homoeopathy  of University of Johannesburg, iridology was highly regarded as a potential additional skill requirement for assessing the health status of the patient.This  study  investigated  the  reliability  of iridology  in  the  diagnosis  of  previous  acute appendicitis, as evidenced by appendectomy. A total of 60 participants took part in the study. Thirty of the 60 participants had an appendectomy due to acute appendicitis, and 30 had had no prior history  of  appendicitis.  Each  participant’s  right iris  was  documented  by  photography  with  the use  of  a  non-mydriatic  retinal  camera  that  was reset for photographing the iris. The photographs were then randomized by an external person and no identifying data made available to the three raters.  The  raters  included  the  researcher,  who had little experience in iridology and two highly experienced  practising  iridologists.  Data  was obtained  from  the  analyses  of  the  photographs wherein  the  presence  or  absence  of  lesions (implying acute appendicitis was indicated by the raters. None of the three raters was able to show a significant  success  rate  in  identifying  correctly the  people  with  a  previous  history  of  acute appendicitis and resultant appendectomies

  11. Outcome after arthroscopic labral surgery in patients previously treated with periacetabular osteotomy

    DEFF Research Database (Denmark)

    Hartig-Andreasen, Charlotte; Nielsen, Torsten G; Lund, Bent

    2017-01-01

    To identify factors predicting failure after hip arthroscopy in patients with previous periacetabular osteotomy (PAO) defined as a conversion to total hip replacement (THR) and to evaluate the patient reported outcome scores. Of 55 hips treated with hip arthroscopy after PAO from Aug 2008 to 2012....... Nine hips were converted to a THR. Kaplan-Meier survival rate was 52.8% (95% CI, 10%-83.8%) at 6.5 years follow-up. Statistically significant predictors of failure: joint space width after PAO ...% of the hips. In 42% of the hips cartilage lesions of Becks grade >3 were found. Mean mHHS and HOS were 65.7 and 68.8 respectively at follow-up. A NRS pain score of >3 in rest and during activity were present in respectively, 43% and 62% of the patients. Hip arthroscopy after PAO demonstrated limited clinical...

  12. A Comprehensive Analysis of Common and Rare Variants to Identify Adiposity Loci in Hispanic Americans: The IRAS Family Study (IRASFS.

    Directory of Open Access Journals (Sweden)

    Chuan Gao

    Full Text Available Obesity is growing epidemic affecting 35% of adults in the United States. Previous genome-wide association studies (GWAS have identified numerous loci associated with obesity. However, the majority of studies have been completed in Caucasians focusing on total body measures of adiposity. Here we report the results from genome-wide and exome chip association studies focusing on total body measures of adiposity including body mass index (BMI, percent body fat (PBF and measures of fat deposition including waist circumference (WAIST, waist-hip ratio (WHR, subcutaneous adipose tissue (SAT, and visceral adipose tissue (VAT in Hispanic Americans (nmax = 1263 from the Insulin Resistance Atherosclerosis Family Study (IRASFS. Five SNPs from two novel loci attained genome-wide significance (P<5.00x10-8 in IRASFS. A missense SNP in the isocitrate dehydrogenase 1 gene (IDH1 was associated with WAIST (rs34218846, MAF = 6.8%, PDOM = 1.62x10-8. This protein is postulated to play an important role in fat and cholesterol biosynthesis as demonstrated in cell and knock-out animal models. Four correlated intronic SNPs in the Zinc finger, GRF-type containing 1 gene (ZGRF1; SNP rs1471880, MAF = 48.1%, PDOM = 1.00x10-8 were strongly associated with WHR. The exact biological function of ZGRF1 and the connection with adiposity remains unclear. SNPs with p-values less than 5.00x10-6 from IRASFS were selected for replication. Meta-analysis was computed across seven independent Hispanic-American cohorts (nmax = 4156 and the strongest signal was rs1471880 (PDOM = 8.38x10-6 in ZGRF1 with WAIST. In conclusion, a genome-wide and exome chip association study was conducted that identified two novel loci (IDH1 and ZGRF1 associated with adiposity. While replication efforts were inconclusive, when taken together with the known biology, IDH1 and ZGRF1 warrant further evaluation.

  13. Impulsivity moderates the relationship between previous quit failure and cue-induced craving.

    Science.gov (United States)

    Erblich, Joel; Michalowski, Alexandra

    2015-12-01

    Poor inhibitory control has been shown to be an important predictor of relapse to a number of drugs, including nicotine. Indeed, smokers who exhibit higher levels of impulsivity are thought to have impaired regulation of urges to smoke, and previous research has suggested that impulsivity may moderate cue-induced cigarette cravings. To that end, we conducted a study to evaluate the interplay between failed smoking cessation, cue-induced craving, and impulsivity. Current smokers (n=151) rated their cigarette cravings before and after laboratory to exposure to smoking cues, and completed questionnaires assessing impulsivity and previous failed quit attempts. Findings indicated that shorter duration of previous failed quit attempts was related to higher cue-induced cigarette craving, especially among smokers with higher levels of impulsivity. Results underscore the importance of considering trait impulsivity as a factor in better understanding the management of cue-induced cravings. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. A comparison of statistical methods for identifying out-of-date systematic reviews.

    Directory of Open Access Journals (Sweden)

    Porjai Pattanittum

    Full Text Available BACKGROUND: Systematic reviews (SRs can provide accurate and reliable evidence, typically about the effectiveness of health interventions. Evidence is dynamic, and if SRs are out-of-date this information may not be useful; it may even be harmful. This study aimed to compare five statistical methods to identify out-of-date SRs. METHODS: A retrospective cohort of SRs registered in the Cochrane Pregnancy and Childbirth Group (CPCG, published between 2008 and 2010, were considered for inclusion. For each eligible CPCG review, data were extracted and "3-years previous" meta-analyses were assessed for the need to update, given the data from the most recent 3 years. Each of the five statistical methods was used, with random effects analyses throughout the study. RESULTS: Eighty reviews were included in this study; most were in the area of induction of labour. The numbers of reviews identified as being out-of-date using the Ottawa, recursive cumulative meta-analysis (CMA, and Barrowman methods were 34, 7, and 7 respectively. No reviews were identified as being out-of-date using the simulation-based power method, or the CMA for sufficiency and stability method. The overall agreement among the three discriminating statistical methods was slight (Kappa = 0.14; 95% CI 0.05 to 0.23. The recursive cumulative meta-analysis, Ottawa, and Barrowman methods were practical according to the study criteria. CONCLUSION: Our study shows that three practical statistical methods could be applied to examine the need to update SRs.

  15. Parents of Youth Who Identify as Transgender: An Exploratory Study

    Science.gov (United States)

    Johnson, Danielle; Sikorski, Jonathon; Savage, Todd A.; Woitaszewski, Scott A.

    2014-01-01

    This article explores the experiences, perceptions, support systems, and coping strategies on which parents of youth who identify as transgender rely. Based on data gathered via interviews with parents of youth who identify as transgender and analyzed using the consensual qualitative research method, parental challenges and concerns about their…

  16. Simulation Study on Identifiability of UHE Gamma-ray Air Showers

    International Nuclear Information System (INIS)

    Wada, Y.; Inoue, N.; Miyazawa, K.; Vankov, H.P.

    2008-01-01

    The chemical composition of Ultra-High-Energy (UHE) comic rays is one of unsolved mysteries, and its study will give us fruitful information on the origin and acceleration mechanism of UHE cosmic rays. Especially, a detection of UHE gamma-rays by hybrid experiments, such as AUGER and TA, will be a key to solve these questions. The characteristics of UHE gamma-ray showers have been studied by comparing the lateral and longitudinal structures of shower particles calculated with AIRES and our own simulation code, so far. There are apparent differences in a slope of lateral distribution (η) and a depth of shower maximum (Xmax) between gamma-ray and proton induced showers because UHE gamma-ray showers are affected by the LPM effect and the geomagnetic cascading process in an energy region of >10 19.5 eV. Different features between gamma-ray and proton showers are pointed out from the simulation study and an identifiability of gamma-ray showers from proton ones is also discussed by the method of Neural-Network-Analysis

  17. Simulation Study on Identifiability of UHE Gamma-ray Air Showers

    Energy Technology Data Exchange (ETDEWEB)

    Wada, Y.; Inoue, N.; Miyazawa, K. [Graduate School of Science and Engineering, Saitama University, Saitama 338-8570 (Japan); Vankov, H.P. [Institute for Nuclear Research and Nuclear Energy, Bulgaria Academy, Sofia (Bulgaria)

    2008-01-15

    The chemical composition of Ultra-High-Energy (UHE) comic rays is one of unsolved mysteries, and its study will give us fruitful information on the origin and acceleration mechanism of UHE cosmic rays. Especially, a detection of UHE gamma-rays by hybrid experiments, such as AUGER and TA, will be a key to solve these questions. The characteristics of UHE gamma-ray showers have been studied by comparing the lateral and longitudinal structures of shower particles calculated with AIRES and our own simulation code, so far. There are apparent differences in a slope of lateral distribution ({eta}) and a depth of shower maximum (Xmax) between gamma-ray and proton induced showers because UHE gamma-ray showers are affected by the LPM effect and the geomagnetic cascading process in an energy region of >10{sup 19.5}eV. Different features between gamma-ray and proton showers are pointed out from the simulation study and an identifiability of gamma-ray showers from proton ones is also discussed by the method of Neural-Network-Analysis.

  18. Vitamin D deficiency in medical patients at a central hospital in Malawi: a comparison with TB patients from a previous study.

    Directory of Open Access Journals (Sweden)

    Yamikani Mastala

    Full Text Available OBJECTIVES: To determine the prevalence of vitamin D deficiency (VDD in adult medical, non-tuberculous (non-TB patients. To investigate associations with VDD. To compare the results with a similar study in TB patients at the same hospital. DESIGN: Cross-sectional sample. SETTING: Central hospital in Malawi. PARTICIPANTS: Adult non-TB patients (n = 157, inpatients and outpatients. OUTCOME MEASURES: The primary outcome was the prevalence of VDD. Potentially causal associations sought included nutritional status, in/outpatient status, HIV status, anti-retroviral therapy (ART and, by comparison with a previous study, a diagnosis of tuberculosis (TB. RESULTS: Hypovitaminosis D (≤75 nmol/L occurred in 47.8% (75/157 of patients, 16.6% (26/157 of whom had VDD (≤50 nmol/L. None had severe VDD (≤25 nmol/L. VDD was found in 22.8% (23/101 of in-patients and 5.4% (3/56 of out-patients. In univariable analysis in-patient status, ART use and low dietary vitamin D were significant predictors of VDD. VDD was less prevalent than in previously studied TB patients in the same hospital (68/161 = 42%. In multivariate analysis of the combined data set from both studies, having TB (OR 3.61, 95%CI 2.02-6.43 and being an in-patient (OR 2.70, 95%CI 1.46-5.01 were significant independent predictors of VDD. CONCLUSIONS: About half of adult medical patients without TB have suboptimal vitamin D status, which is more common in in-patients. VDD is much more common in TB patients than non-TB patients, even when other variables are controlled for, suggesting that vitamin D deficiency is associated with TB.

  19. Yeast three-hybrid screen identifies TgBRADIN/GRA24 as a negative regulator of Toxoplasma gondii bradyzoite differentiation.

    Directory of Open Access Journals (Sweden)

    Anahi V Odell

    Full Text Available Differentiation of the protozoan parasite Toxoplasma gondii into its latent bradyzoite stage is a key event in the parasite's life cycle. Compound 2 is an imidazopyridine that was previously shown to inhibit the parasite lytic cycle, in part through inhibition of parasite cGMP-dependent protein kinase. We show here that Compound 2 can also enhance parasite differentiation, and we use yeast three-hybrid analysis to identify TgBRADIN/GRA24 as a parasite protein that interacts directly or indirectly with the compound. Disruption of the TgBRADIN/GRA24 gene leads to enhanced differentiation of the parasite, and the TgBRADIN/GRA24 knockout parasites show decreased susceptibility to the differentiation-enhancing effects of Compound 2. This study represents the first use of yeast three-hybrid analysis to study small-molecule mechanism of action in any pathogenic microorganism, and it identifies a previously unrecognized inhibitor of differentiation in T. gondii. A better understanding of the proteins and mechanisms regulating T. gondii differentiation will enable new approaches to preventing the establishment of chronic infection in this important human pathogen.

  20. High-density genotyping of immune-related loci identifies new SLE risk variants in individuals with Asian ancestry.

    Science.gov (United States)

    Sun, Celi; Molineros, Julio E; Looger, Loren L; Zhou, Xu-Jie; Kim, Kwangwoo; Okada, Yukinori; Ma, Jianyang; Qi, Yuan-Yuan; Kim-Howard, Xana; Motghare, Prasenjeet; Bhattarai, Krishna; Adler, Adam; Bang, So-Young; Lee, Hye-Soon; Kim, Tae-Hwan; Kang, Young Mo; Suh, Chang-Hee; Chung, Won Tae; Park, Yong-Beom; Choe, Jung-Yoon; Shim, Seung Cheol; Kochi, Yuta; Suzuki, Akari; Kubo, Michiaki; Sumida, Takayuki; Yamamoto, Kazuhiko; Lee, Shin-Seok; Kim, Young Jin; Han, Bok-Ghee; Dozmorov, Mikhail; Kaufman, Kenneth M; Wren, Jonathan D; Harley, John B; Shen, Nan; Chua, Kek Heng; Zhang, Hong; Bae, Sang-Cheol; Nath, Swapan K

    2016-03-01

    Systemic lupus erythematosus (SLE) has a strong but incompletely understood genetic architecture. We conducted an association study with replication in 4,478 SLE cases and 12,656 controls from six East Asian cohorts to identify new SLE susceptibility loci and better localize known loci. We identified ten new loci and confirmed 20 known loci with genome-wide significance. Among the new loci, the most significant locus was GTF2IRD1-GTF2I at 7q11.23 (rs73366469, Pmeta = 3.75 × 10(-117), odds ratio (OR) = 2.38), followed by DEF6, IL12B, TCF7, TERT, CD226, PCNXL3, RASGRP1, SYNGR1 and SIGLEC6. We identified the most likely functional variants at each locus by analyzing epigenetic marks and gene expression data. Ten candidate variants are known to alter gene expression in cis or in trans. Enrichment analysis highlights the importance of these loci in B cell and T cell biology. The new loci, together with previously known loci, increase the explained heritability of SLE to 24%. The new loci share functional and ontological characteristics with previously reported loci and are possible drug targets for SLE therapeutics.

  1. Automatic jargon identifier for scientists engaging with the public and science communication educators

    Science.gov (United States)

    Chapnik, Noam; Yosef, Roy; Baram-Tsabari, Ayelet

    2017-01-01

    Scientists are required to communicate science and research not only to other experts in the field, but also to scientists and experts from other fields, as well as to the public and policymakers. One fundamental suggestion when communicating with non-experts is to avoid professional jargon. However, because they are trained to speak with highly specialized language, avoiding jargon is difficult for scientists, and there is no standard to guide scientists in adjusting their messages. In this research project, we present the development and validation of the data produced by an up-to-date, scientist-friendly program for identifying jargon in popular written texts, based on a corpus of over 90 million words published in the BBC site during the years 2012–2015. The validation of results by the jargon identifier, the De-jargonizer, involved three mini studies: (1) comparison and correlation with existing frequency word lists in the literature; (2) a comparison with previous research on spoken language jargon use in TED transcripts of non-science lectures, TED transcripts of science lectures and transcripts of academic science lectures; and (3) a test of 5,000 pairs of published research abstracts and lay reader summaries describing the same article from the journals PLOS Computational Biology and PLOS Genetics. Validation procedures showed that the data classification of the De-jargonizer significantly correlates with existing frequency word lists, replicates similar jargon differences in previous studies on scientific versus general lectures, and identifies significant differences in jargon use between abstracts and lay summaries. As expected, more jargon was found in the academic abstracts than lay summaries; however, the percentage of jargon in the lay summaries exceeded the amount recommended for the public to understand the text. Thus, the De-jargonizer can help scientists identify problematic jargon when communicating science to non-experts, and be implemented

  2. Automatic jargon identifier for scientists engaging with the public and science communication educators.

    Directory of Open Access Journals (Sweden)

    Tzipora Rakedzon

    Full Text Available Scientists are required to communicate science and research not only to other experts in the field, but also to scientists and experts from other fields, as well as to the public and policymakers. One fundamental suggestion when communicating with non-experts is to avoid professional jargon. However, because they are trained to speak with highly specialized language, avoiding jargon is difficult for scientists, and there is no standard to guide scientists in adjusting their messages. In this research project, we present the development and validation of the data produced by an up-to-date, scientist-friendly program for identifying jargon in popular written texts, based on a corpus of over 90 million words published in the BBC site during the years 2012-2015. The validation of results by the jargon identifier, the De-jargonizer, involved three mini studies: (1 comparison and correlation with existing frequency word lists in the literature; (2 a comparison with previous research on spoken language jargon use in TED transcripts of non-science lectures, TED transcripts of science lectures and transcripts of academic science lectures; and (3 a test of 5,000 pairs of published research abstracts and lay reader summaries describing the same article from the journals PLOS Computational Biology and PLOS Genetics. Validation procedures showed that the data classification of the De-jargonizer significantly correlates with existing frequency word lists, replicates similar jargon differences in previous studies on scientific versus general lectures, and identifies significant differences in jargon use between abstracts and lay summaries. As expected, more jargon was found in the academic abstracts than lay summaries; however, the percentage of jargon in the lay summaries exceeded the amount recommended for the public to understand the text. Thus, the De-jargonizer can help scientists identify problematic jargon when communicating science to non-experts, and

  3. Automatic jargon identifier for scientists engaging with the public and science communication educators.

    Science.gov (United States)

    Rakedzon, Tzipora; Segev, Elad; Chapnik, Noam; Yosef, Roy; Baram-Tsabari, Ayelet

    2017-01-01

    Scientists are required to communicate science and research not only to other experts in the field, but also to scientists and experts from other fields, as well as to the public and policymakers. One fundamental suggestion when communicating with non-experts is to avoid professional jargon. However, because they are trained to speak with highly specialized language, avoiding jargon is difficult for scientists, and there is no standard to guide scientists in adjusting their messages. In this research project, we present the development and validation of the data produced by an up-to-date, scientist-friendly program for identifying jargon in popular written texts, based on a corpus of over 90 million words published in the BBC site during the years 2012-2015. The validation of results by the jargon identifier, the De-jargonizer, involved three mini studies: (1) comparison and correlation with existing frequency word lists in the literature; (2) a comparison with previous research on spoken language jargon use in TED transcripts of non-science lectures, TED transcripts of science lectures and transcripts of academic science lectures; and (3) a test of 5,000 pairs of published research abstracts and lay reader summaries describing the same article from the journals PLOS Computational Biology and PLOS Genetics. Validation procedures showed that the data classification of the De-jargonizer significantly correlates with existing frequency word lists, replicates similar jargon differences in previous studies on scientific versus general lectures, and identifies significant differences in jargon use between abstracts and lay summaries. As expected, more jargon was found in the academic abstracts than lay summaries; however, the percentage of jargon in the lay summaries exceeded the amount recommended for the public to understand the text. Thus, the De-jargonizer can help scientists identify problematic jargon when communicating science to non-experts, and be implemented by

  4. How to prevent type 2 diabetes in women with previous gestational diabetes?

    DEFF Research Database (Denmark)

    Pedersen, Anne Louise Winkler; Terkildsen Maindal, Helle; Juul, Lise

    2017-01-01

    OBJECTIVES: Women with previous gestational diabetes (GDM) have a seven times higher risk of developing type 2 diabetes (T2DM) than women without. We aimed to review the evidence of effective behavioural interventions seeking to prevent T2DM in this high-risk group. METHODS: A systematic review...... of RCTs in several databases in March 2016. RESULTS: No specific intervention or intervention components were found superior. The pooled effect on diabetes incidence (four trials) was estimated to: -5.02 per 100 (95% CI: -9.24; -0.80). CONCLUSIONS: This study indicates that intervention is superior...... to no intervention in prevention of T2DM among women with previous GDM....

  5. Fish quality – linking previous infections to the quality of consumers’ fillet

    DEFF Research Database (Denmark)

    The quality of the fish meat is dependent upon a wide range of biological and non-biological factors. In the present study it has been established that previous infections by Vibrio anguillarum in rainbow trout (Oncorhynchus mykiss) influence the quality of the fish meat (fillet) at slaughter more...... than after the fish have recovered from the infection. The texture of the fillet analysed by sensory analysis showed changes, which could be explained by previous tissue damage caused by the infection. These changes indicated formation of scars in affected tissue during the processes of tissue repair......, which gave rise to a more fibrous, tougher and flaky texture of the fillets....

  6. Drought Tolerance in Pinus halepensis Seed Sources As Identified by Distinctive Physiological and Molecular Markers

    OpenAIRE

    Taïbi, Khaled; Campo, Antonio D. del; Vilagrosa Carmona, Alberto; Bellés, José M.; López-Gresa, María Pilar; Pla, Davinia; Calvete, Juan J.; López-Nicolás, José M.; Mulet, José M.

    2017-01-01

    Drought is one of the main constraints determining forest species growth, survival and productivity, and therefore one of the main limitations for reforestation or afforestation. The aim of this study is to characterize the drought response at the physiological and molecular level of different Pinus halepensis (common name Aleppo pine) seed sources, previously characterized in field trials as drought-sensitive or drought-tolerant. This approach aims to identify different traits capable of pre...

  7. Effect of media composition, including gelling agents, on isolation of previously uncultured rumen bacteria.

    Science.gov (United States)

    Nyonyo, T; Shinkai, T; Tajima, A; Mitsumori, M

    2013-01-01

    The aim of this study was to develop novel anaerobic media using gellan gum for the isolation of previously uncultured rumen bacteria. Four anaerobic media, a basal liquid medium (BM) with agar (A-BM), a modified BM (MBM) with agar (A-MBM), an MBM with phytagel (P-MBM) and an MBM with gelrite (G-MBM) were used for the isolation of rumen bacteria and evaluated for the growth of previously uncultured rumen bacteria. Of the 214 isolates composed of 144 OTUs, 103 isolates (83 OTUs) were previously uncultured rumen bacteria. Most of the previously uncultured strains were obtained from A-MBM, G-MBM and P-MBM, but the predominant cultural members, isolated from each medium, differed. A-MBM and G-MBM showed significantly higher numbers of different OTUs derived from isolates than A-BM (P rumen bacteria were isolated from all media used, the ratio of previously uncultured bacteria to total isolates was increased in A-MBM, P-MBM and G-MBM. © 2012 The Society for Applied Microbiology.

  8. Identifiability of large-scale non-linear dynamic network models applied to the ADM1-case study.

    Science.gov (United States)

    Nimmegeers, Philippe; Lauwers, Joost; Telen, Dries; Logist, Filip; Impe, Jan Van

    2017-06-01

    In this work, both the structural and practical identifiability of the Anaerobic Digestion Model no. 1 (ADM1) is investigated, which serves as a relevant case study of large non-linear dynamic network models. The structural identifiability is investigated using the probabilistic algorithm, adapted to deal with the specifics of the case study (i.e., a large-scale non-linear dynamic system of differential and algebraic equations). The practical identifiability is analyzed using a Monte Carlo parameter estimation procedure for a 'non-informative' and 'informative' experiment, which are heuristically designed. The model structure of ADM1 has been modified by replacing parameters by parameter combinations, to provide a generally locally structurally identifiable version of ADM1. This means that in an idealized theoretical situation, the parameters can be estimated accurately. Furthermore, the generally positive structural identifiability results can be explained from the large number of interconnections between the states in the network structure. This interconnectivity, however, is also observed in the parameter estimates, making uncorrelated parameter estimations in practice difficult. Copyright © 2017. Published by Elsevier Inc.

  9. Identifying early indicators in bipolar disorder: a qualitative study.

    Science.gov (United States)

    Benti, Liliane; Manicavasagar, Vijaya; Proudfoot, Judy; Parker, Gordon

    2014-06-01

    The identification of early markers has become a focus for early intervention in bipolar disorder. Using a retrospective, qualitative methodology, the present study compares the early experiences of participants with bipolar disorder to those with unipolar depression up until their first diagnosed episode. The study focuses on differences in early home and school environments as well as putative differences in personality characteristics between the two groups. Finally we a compare and contrast prodromal symptoms in these two populations. Thirty-nine participants, 20 diagnosed with unipolar depression and 19 diagnosed with bipolar disorder, took part in the study. A semi-structured interview was developed to elicit information about participants' experiences prior to their first episode. Participants with bipolar disorder reported disruptive home environments, driven personality features, greater emotion dysregulation and adverse experiences during the school years, whereas participants with depression tended to describe more supportive home environments, and more compliant and introvert personality traits. Retrospective data collection and no corroborative evidence from other family members. No distinction was made between bipolar I and bipolar II disorder nor between melancholic and non-melancholic depression in the sample. Finally the study spanned over a 12-month period which does not allow for the possibility of diagnostic reassignment of some of the bipolar participants to the unipolar condition. These findings indicate that there may be benefits in combining both proximal and distal indicators in identifying a bipolar disorder phenotype which, in turn, may be relevant to the development of early intervention programs for young people with bipolar disorder.

  10. An overview of the fire risk scoping study

    International Nuclear Information System (INIS)

    Nowlen, S.P.; Lambright, J.A.; Nicolette, V.F.; Bohn, M.P.

    1989-01-01

    The Fire Risk Scoping Study was sponsored by the US Nuclear Regulatory Commission and performed at Sandia National Laboratories. The study was initiated as a result of previous USNRC-sponsored fire research efforts that had identified certain fire risk issues that had not been addressed in previously completed commercial nuclear power plant fire risk analyses. The specific objectives of this study were (1) to review and requantify fire risk scenarios from four fire probabilistic risk assessments in light of updated data bases made available as a result of USNRC-sponsored Fire Protection Research Program and updated computer fire modeling capabilities, (2) to identify potentially significant fire risk issues that have not been previously addressed in a fire risk context and to quantify the potential impact of those identified fire risk issues where possible, and (3) to review current fire regulations and plant implementation practices for relevance to the identified unaddressed fire risk issues. 9 refs., 3 tabs

  11. Outcome of secondary high-grade glioma in children previously treated for a malignant condition: A study of the Canadian Pediatric Brain Tumour Consortium

    International Nuclear Information System (INIS)

    Carret, Anne-Sophie; Tabori, Uri; Crooks, Bruce; Hukin, Juliette; Odame, Isaac; Johnston, Donna L.; Keene, Daniel L.; Freeman, Carolyn; Bouffet, Eric

    2006-01-01

    Background and purpose: Reports of secondary high-grade glioma (HGG) in survivors of childhood cancer are scarce. The aim of this study was to review the pattern of diagnosis, the treatment, and outcome of secondary pediatric HGG. Patients and methods: We performed a multi-center retrospective study among the 17 paediatric institutions participating in the Canadian Pediatric Brain Tumour Consortium (CPBTC). Results: We report on 18 patients (14 males, 4 females) treated in childhood for a primary cancer, who subsequently developed a HGG as a second malignancy. All patients had previously received radiation therapy +/- chemotherapy for either acute lymphoblastic leukaemia (n = 9) or solid tumour (n = 9). All HGG occurred within the previous radiation fields. At the last follow-up, 17 patients have died and the median survival time is 9.75 months. Conclusion: Although aggressive treatment seems to provide sustained remissions in some patients, the optimal management is still to be defined. Further documentation of such cases is necessary in order to better understand the pathogenesis, the natural history and the prevention of these tumours

  12. Enriched pathways for major depressive disorder identified from a genome-wide association study.

    Science.gov (United States)

    Kao, Chung-Feng; Jia, Peilin; Zhao, Zhongming; Kuo, Po-Hsiu

    2012-11-01

    Major depressive disorder (MDD) has caused a substantial burden of disease worldwide with moderate heritability. Despite efforts through conducting numerous association studies and now, genome-wide association (GWA) studies, the success of identifying susceptibility loci for MDD has been limited, which is partially attributed to the complex nature of depression pathogenesis. A pathway-based analytic strategy to investigate the joint effects of various genes within specific biological pathways has emerged as a powerful tool for complex traits. The present study aimed to identify enriched pathways for depression using a GWA dataset for MDD. For each gene, we estimated its gene-wise p value using combined and minimum p value, separately. Canonical pathways from the Kyoto Encyclopedia of Genes and Genomes (KEGG) and BioCarta were used. We employed four pathway-based analytic approaches (gene set enrichment analysis, hypergeometric test, sum-square statistic, sum-statistic). We adjusted for multiple testing using Benjamini & Hochberg's method to report significant pathways. We found 17 significantly enriched pathways for depression, which presented low-to-intermediate crosstalk. The top four pathways were long-term depression (p⩽1×10-5), calcium signalling (p⩽6×10-5), arrhythmogenic right ventricular cardiomyopathy (p⩽1.6×10-4) and cell adhesion molecules (p⩽2.2×10-4). In conclusion, our comprehensive pathway analyses identified promising pathways for depression that are related to neurotransmitter and neuronal systems, immune system and inflammatory response, which may be involved in the pathophysiological mechanisms underlying depression. We demonstrated that pathway enrichment analysis is promising to facilitate our understanding of complex traits through a deeper interpretation of GWA data. Application of this comprehensive analytic strategy in upcoming GWA data for depression could validate the findings reported in this study.

  13. Trends of anti-tuberculosis drug resistance pattern in new cases and previously treated cases of extrapulmonary tuberculosis cases in referral hospitals in northern India

    Directory of Open Access Journals (Sweden)

    A K Maurya

    2012-01-01

    Full Text Available Background: Drug-resistant tuberculosis is one of major current challenges to global public health. The transmission of resistant strains is increasing as a burden of multidrug-resistant tuberculosis (MDR-TB patients in extra pulmonary tuberculosis (EPTB cases in India. Aim and Objectives: The aim was to study trends of anti-tuberculosis drug resistance pattern in new cases and previously treated cases of EPTB in referral hospitals in northern India. Study Design and Setting: A prospectively observational study and referral medical institutions in northern India. Materials and Methods: All EPTB specimens were processed for Ziehl Neelsen staining, BACTEC culture and BACTEC NAP test for Mycobacterium tuberculosis complex. All M. tuberculosis complex isolates were performed for radiometric-based drug susceptibility pattern against streptomycin, isoniazid, rifampicin and ethambutol using the 1% proportion method. Results: We found that 165/756 (20.5% isolates were identified as M. tuberculosis complex by the NAP test. We observed that 39.9% were resistant to first-line antitubercular drugs. The resistance rate was higher in previously treated patients: H (30.3%, R (16.3%, E (15.7% and S (16.3%. MDR-TB was observed in 13.4%, but, in new cases, this was 11.4% and 19.1% of the previously treated patients (P<0.05. Conclusion: MDR-TB is gradually increased in EPTB cases and predominant resistance to previous treated cases of EPTB. The molecular drug sensitivity test (DST method can be an early decision for chemotherapy in MDR-TB patients. The International Standards of TB Care need to be used by the RNTCP and professional medical associations as a tool to improve TB care in the country.

  14. Predicting fruit consumption: the role of habits, previous behavior and mediation effects

    NARCIS (Netherlands)

    de Vries, H.; Eggers, S.M.; Lechner, L.; van Osch, L.; van Stralen, M.M.

    2014-01-01

    Background: This study assessed the role of habits and previous behavior in predicting fruit consumption as well as their additional predictive contribution besides socio-demographic and motivational factors. In the literature, habits are proposed as a stable construct that needs to be controlled

  15. A genome-wide association study identifies candidate loci associated to syringomyelia secondary to Chiari-like malformation in Cavalier King Charles Spaniels.

    Science.gov (United States)

    Ancot, Frédéric; Lemay, Philippe; Knowler, Susan P; Kennedy, Karen; Griffiths, Sandra; Cherubini, Giunio Bruto; Sykes, Jane; Mandigers, Paul J J; Rouleau, Guy A; Rusbridge, Clare; Kibar, Zoha

    2018-03-22

    Syringomyelia (SM) is a common condition affecting brachycephalic toy breed dogs and is characterized by the development of fluid-filled cavities within the spinal cord. It is often concurrent with a complex developmental malformation of the skull and craniocervical vertebrae called Chiari-like malformation (CM) characterized by a conformational change and overcrowding of the brain and cervical spinal cord particularly at the craniocervical junction. CM and SM have a polygenic mode of inheritance with variable penetrance. We identified six cranial T1-weighted sagittal MRI measurements that were associated to maximum transverse diameter of the syrinx cavity. Increased syrinx transverse diameter has been correlated previously with increased likelihood of behavioral signs of pain. We next conducted a whole genome association study of these traits in 65 Cavalier King Charles Spaniel (CKCS) dogs (33 controls, 32 with extreme phenotypes). Two loci on CFA22 and CFA26 were found to be significantly associated to two traits associated with a reduced volume and altered orientation of the caudal cranial fossa. Their reconstructed haplotypes defined two associated regions that harbor only two genes: PCDH17 on CFA22 and ZWINT on CFA26. PCDH17 codes for a cell adhesion molecule expressed specifically in the brain and spinal cord. ZWINT plays a role in chromosome segregation and its expression is increased with the onset of neuropathic pain. Targeted genomic sequencing of these regions identified respectively 37 and 339 SNPs with significantly associated P values. Genotyping of tagSNPs selected from these 2 candidate loci in an extended cohort of 461 CKCS (187 unaffected, 274 SM affected) identified 2 SNPs on CFA22 that were significantly associated to SM strengthening the candidacy of this locus in SM development. We identified 2 loci on CFA22 and CFA26 that contained only 2 genes, PCDH17 and ZWINT, significantly associated to two traits associated with syrinx transverse

  16. Barriers to postpartum screening for type 2 diabetes: a qualitative study of women with previous gestational diabetes.

    Science.gov (United States)

    Rafii, Forough; Rahimparvar, Seyedeh Fatemeh Vasegh; Mehrdad, Neda; Keramat, Afsaneh

    2017-01-01

    Risk of developing type 2 diabetes is increased in women with previous gestational diabetes mellitus (GDM). Postpartum glycemic screening is recommended in women with recent GDM. But this screening rate is low and the reasons are unclear. The aim of this study was to explore the experiences of Iranian women with recent GDM on barriers of postpartum screening for diabetes. This qualitative study was conducted in Tehran, Iran in 2016. Semi-structured interview was used for data collection. 22 women with recent GDM were interviewed. These women gave birth in Tehran hospitals at a minimum of 6 months before interview. The missed screening defined as not attending to laboratory for Fasting Blood Sugar and/or Oral Glucose Tolerance Test, 6 week to 6 month after their child birthing. The data was analyzed by content analysis method. Themes and sub-themes that illustrated the barriers to postpartum diabetes screening were: inadequate education (about developing diabetes in the future, implementation of the screening, and glucometer validity in diagnosis of diabetes), perceiving the screening as difficult (feeling comfortable with the glucometer, poor laboratory conditions, issues related to the baby/babies, and financial problems), improper attitudes toward the screening (unwilling to get diagnosed, not giving priority to oneself, having false beliefs) and procrastination (gap to intention and action, self-deception and self-regulation failure). Women with recent GDM reported several barriers for postpartum diabetes screening. This study help to develop the evidence-based interventions for improving this screening rate.

  17. Total hip arthroplasty after a previous pelvic osteotomy: A systematic review and meta-analysis.

    Science.gov (United States)

    Shigemura, T; Yamamoto, Y; Murata, Y; Sato, T; Tsuchiya, R; Wada, Y

    2018-06-01

    There are several reports regarding total hip arthroplasty (THA) after a previous pelvic osteotomy (PO). However, to our knowledge, until now there has been no formal systematic review and meta-analysis published to summarize the clinical results of THA after a previous PO. Therefore, we conducted a systematic review and meta-analysis of results of THA after a previous PO. We focus on these questions as follows: does a previous PO affect the results of subsequent THA, such as clinical outcomes, operative time, operative blood loss, and radiological parameters. Using PubMed, Web of Science, and Cochrane Library, we searched for relevant original papers. The pooling of data was performed using RevMan software (version 5.3, Cochrane Collaboration, Oxford, UK). A p-value50%, significant heterogeneity was assumed and a random-effects model was applied for the meta-analysis. A fixed-effects model was applied in the absence of significant heterogeneity. Eleven studies were included in this meta-analysis. The pooled results indicated that there was no significant difference in postoperative Merle D'Aubigne-Postel score (I 2 =0%, SMD=-0.15, 95% CI: -0.36 to 0.06, p=0.17), postoperative Harris hip score (I 2 =60%, SMD=-0.23, 95% CI: -0.50 to 0.05, p=0.10), operative time (I 2 =86%, SMD=0.37, 95% CI: -0.09 to 0.82, p=0.11), operative blood loss (I 2 =82%, SMD=0.23, 95% CI: -0.17 to 0.63, p=0.25), and cup abduction angle (I 2 =43%, SMD=-0.08, 95% CI: -0.25 to 0.09, p=0.38) between THA with and without a previous PO. However, cup anteversion angle of THA with a previous PO was significantly smaller than that of without a previous PO (I 2 =77%, SMD=-0.63, 95% CI: -1.13 to -0.13, p=0.01). Systematic review and meta-analysis of results of THA after a previous PO was performed. A previous PO did not affect the results of subsequent THA, except for cup anteversion. Because of the low quality evidence currently available, high-quality randomized controlled trials are required

  18. Methanotrophic bacteria in warm geothermal spring sediments identified using stable-isotope probing.

    Science.gov (United States)

    Sharp, Christine E; Martínez-Lorenzo, Azucena; Brady, Allyson L; Grasby, Stephen E; Dunfield, Peter F

    2014-10-01

    We investigated methanotrophic bacteria in sediments of several warm geothermal springs ranging in temperature from 22 to 45 °C. Methane oxidation was measured at potential rates up to 141 μmol CH4 d(-1) g(-1) sediment. Active methanotrophs were identified using (13) CH4 stable-isotope probing (SIP) incubations performed at close to in situ temperatures for each site. Quantitative (q) PCR of pmoA genes identified the position of the heavy ((13) C-labelled) DNA fractions in density gradients, and 16S rRNA gene pyrotag sequencing of the heavy fractions was performed to identify the active methanotrophs. Methanotroph communities identified in heavy fractions of all samples were predominated by species similar (≥ 95% 16S rRNA gene identities) to previously characterized Gammaproteobacteria and Alphaproteobacteria methanotrophs. Among the five hottest samples (45 °C), members of the Gammaproteobacteria genus Methylocaldum dominated in two cases, while three others were dominated by an OTU closely related (96.8% similarity) to the Alphaproteobacteria genus Methylocapsa. These results suggest that diverse methanotroph groups are adapted to warm environments, including the Methylocapsa-Methylocella-Methyloferula group, which has previously only been detected in cooler sites. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  19. Life cycle impact assessment of ammonia production in Algeria: A comparison with previous studies

    Energy Technology Data Exchange (ETDEWEB)

    Makhlouf, Ali, E-mail: almakhsme@gmail.com; Serradj, Tayeb; Cheniti, Hamza

    2015-01-15

    In this paper, a Life Cycle Analysis (LCA) from “cradle to gate” of one anhydrous ton of ammonia with a purity of 99% was achieved. Particularly, the energy and environmental performance of the product (ammonia) were evaluated. The eco-profile of the product and the share of each stage of the Life Cycle on the whole environmental impacts have been evaluated. The flows of material and energy for each phase of the life cycle were counted and the associated environmental problems were identified. Evaluation of the impact was achieved using GEMIS 4.7 software. The primary data collection was executed at the production installations located in Algeria (Annaba locality). The analysis was conducted according to the LCA standards ISO 14040 series. The results show that Cumulative Energy Requirement (CER) is of 51.945 × 10{sup 3} MJ/t of ammonia, which is higher than the global average. Global Warming Potential (GWP) is of 1.44 t CO{sub 2} eq/t of ammonia; this value is lower than the world average. Tropospheric ozone precursor and Acidification are also studied in this article, their values are: 549.3 × 10{sup −6} t NMVOC eq and 259.3 × 10{sup −6} t SO{sub 2} eq respectively.

  20. Life cycle impact assessment of ammonia production in Algeria: A comparison with previous studies

    International Nuclear Information System (INIS)

    Makhlouf, Ali; Serradj, Tayeb; Cheniti, Hamza

    2015-01-01

    In this paper, a Life Cycle Analysis (LCA) from “cradle to gate” of one anhydrous ton of ammonia with a purity of 99% was achieved. Particularly, the energy and environmental performance of the product (ammonia) were evaluated. The eco-profile of the product and the share of each stage of the Life Cycle on the whole environmental impacts have been evaluated. The flows of material and energy for each phase of the life cycle were counted and the associated environmental problems were identified. Evaluation of the impact was achieved using GEMIS 4.7 software. The primary data collection was executed at the production installations located in Algeria (Annaba locality). The analysis was conducted according to the LCA standards ISO 14040 series. The results show that Cumulative Energy Requirement (CER) is of 51.945 × 10 3 MJ/t of ammonia, which is higher than the global average. Global Warming Potential (GWP) is of 1.44 t CO 2 eq/t of ammonia; this value is lower than the world average. Tropospheric ozone precursor and Acidification are also studied in this article, their values are: 549.3 × 10 −6 t NMVOC eq and 259.3 × 10 −6 t SO 2 eq respectively

  1. Influence of previous administration of trans-phenylcyclopropylamine on radioprotective and hypothermic effects of serotonin

    International Nuclear Information System (INIS)

    Misustova, J.; Hosek, B.; Novak, L.; Kautska, J.

    1978-01-01

    The influence of a previous administration of trans-phenylcyclopropylamine (t-PCPA) on radioprotective and hypothermic effects of serotonin was studied in male mice of the H strain, which were given t-PCPA in the dose of 4 mg/kg intraperitoneally 2 or 7 hours before application of serotonin (40 mg/kg, i.p.). The time course of protection was studied for exposures to 800 and 900 R. The results have shown that a previous administration of t-PCPA does not alter the short-time protective effect of serotonin, but that it significantly prolongs the time course of protection. The administration of t-PCPA also affects the starting speed and the duration of the serotonin-induced hypothermic reaction. The established correlation between prolongation of the radioprotective and hypothermic effects of serotonin induced by previous application of t-PCPA supplements the results with the existence of mutual relationship between changes of the energetic exchange and radioresistance of the organism. (author)

  2. Quantitative trait loci (QTL study identifies novel genomic regions associated to Chiari-like malformation in Griffon Bruxellois dogs.

    Directory of Open Access Journals (Sweden)

    Philippe Lemay

    Full Text Available Chiari-like malformation (CM is a developmental abnormality of the craniocervical junction that is common in the Griffon Bruxellois (GB breed with an estimated prevalence of 65%. This disease is characterized by overcrowding of the neural parenchyma at the craniocervical junction and disturbance of cerebrospinal fluid (CSF flow. The most common clinical sign is pain either as a direct consequence of CM or neuropathic pain as a consequence of secondary syringomyelia. The etiology of CM remains unknown but genetic factors play an important role. To investigate the genetic complexity of the disease, a quantitative trait locus (QTL approach was adopted. A total of 14 quantitative skull and atlas measurements were taken and were tested for association to CM. Six traits were found to be associated to CM and were subjected to a whole-genome association study using the Illumina canine high density bead chip in 74 GB dogs (50 affected and 24 controls. Linear and mixed regression analyses identified associated single nucleotide polymorphisms (SNPs on 5 Canis Familiaris Autosomes (CFAs: CFA2, CFA9, CFA12, CFA14 and CFA24. A reconstructed haplotype of 0.53 Mb on CFA2 strongly associated to the height of the cranial fossa (diameter F and an haplotype of 2.5 Mb on CFA14 associated to both the height of the rostral part of the caudal cranial fossa (AE and the height of the brain (FG were significantly associated to CM after 10 000 permutations strengthening their candidacy for this disease (P = 0.0421, P = 0.0094 respectively. The CFA2 QTL harbours the Sall-1 gene which is an excellent candidate since its orthologue in humans is mutated in Townes-Brocks syndrome which has previously been associated to Chiari malformation I. Our study demonstrates the implication of multiple traits in the etiology of CM and has successfully identified two new QTL associated to CM and a potential candidate gene.

  3. Large-Scale Gene-Centric Meta-Analysis across 39 Studies Identifies Type 2 Diabetes Loci

    NARCIS (Netherlands)

    Saxena, Richa; Elbers, Clara C.; Guo, Yiran; Peter, Inga; Gaunt, Tom R.; Mega, Jessica L.; Lanktree, Matthew B.; Tare, Archana; Almoguera Castillo, Berta; Li, Yun R.; Johnson, Toby; Bruinenberg, Marcel; Gilbert-Diamond, Diane; Rajagopalan, Ramakrishnan; Voight, Benjamin F.; Balasubramanyam, Ashok; Barnard, John; Bauer, Florianne; Baumert, Jens; Bhangale, Tushar; Boehm, Bernhard O.; Braund, Peter S.; Burton, Paul R.; Chandrupatla, Hareesh R.; Clarke, Robert; Cooper-DeHoff, Rhonda M.; Crook, Errol D.; Davey-Smith, George; Day, Ian N.; de Boer, Anthonius; de Groot, Mark C. H.; Drenos, Fotios; Ferguson, Jane; Fox, Caroline S.; Furlong, Clement E.; Gibson, Quince; Gieger, Christian; Gilhuijs-Pederson, Lisa A.; Glessner, Joseph T.; Goel, Anuj; Gong, Yan; Grant, Struan F. A.; Kumari, Meena; van der Harst, Pim; van Vliet-Ostaptchouk, Jana V.; Verweij, Niek; Wolffenbuttel, Bruce H. R.; Hofker, Marten H.; Asselbergs, Folkert W.; Wijmenga, Cisca

    2012-01-01

    To identify genetic factors contributing to type 2 diabetes (T2D), we performed large-scale meta-analyses by using a custom similar to 50,000 SNP genotyping array (the ITMAT-Broad-CARe array) with similar to 2000 candidate genes in 39 multiethnic population-based studies, case-control studies, and

  4. [Parathyroid cancer in a patient with previous history of hypernephroma: a clinical case].

    Science.gov (United States)

    Martín Navarro, J; Mendoza, E; Mateos, P; Cereceda, A; Coca, S

    2007-01-01

    We report the clinical case of a 55 year-old male patient, with a previous history of nephrectomy by hypernephroma sixteen years ago, first presenting hypercalcemia and rising of intact parathyroid hormone (iPTH) levels. A localization study revealed an intrathyroid nodule with cystic appearance. After undergoing a hemi-thyroidectomy, the patient is diagnosed with parathyroid carcinoma. This article analyzes previously published cases presenting parathyroidal pathologies associated with hypernephroma. A broader differential diagnosis--including the screening of parathyroidal pathologies should be considered in patients with hypercalcemia and hypernephroma.

  5. A comprehensive molecular study on Coffin-Siris and Nicolaides-Baraitser syndromes identifies a broad molecular and clinical spectrum converging on altered chromatin remodeling.

    Science.gov (United States)

    Wieczorek, Dagmar; Bögershausen, Nina; Beleggia, Filippo; Steiner-Haldenstätt, Sabine; Pohl, Esther; Li, Yun; Milz, Esther; Martin, Marcel; Thiele, Holger; Altmüller, Janine; Alanay, Yasemin; Kayserili, Hülya; Klein-Hitpass, Ludger; Böhringer, Stefan; Wollstein, Andreas; Albrecht, Beate; Boduroglu, Koray; Caliebe, Almuth; Chrzanowska, Krystyna; Cogulu, Ozgur; Cristofoli, Francesca; Czeschik, Johanna Christina; Devriendt, Koenraad; Dotti, Maria Teresa; Elcioglu, Nursel; Gener, Blanca; Goecke, Timm O; Krajewska-Walasek, Malgorzata; Guillén-Navarro, Encarnación; Hayek, Joussef; Houge, Gunnar; Kilic, Esra; Simsek-Kiper, Pelin Özlem; López-González, Vanesa; Kuechler, Alma; Lyonnet, Stanislas; Mari, Francesca; Marozza, Annabella; Mathieu Dramard, Michèle; Mikat, Barbara; Morin, Gilles; Morice-Picard, Fanny; Ozkinay, Ferda; Rauch, Anita; Renieri, Alessandra; Tinschert, Sigrid; Utine, G Eda; Vilain, Catheline; Vivarelli, Rossella; Zweier, Christiane; Nürnberg, Peter; Rahmann, Sven; Vermeesch, Joris; Lüdecke, Hermann-Josef; Zeschnigk, Michael; Wollnik, Bernd

    2013-12-20

    Chromatin remodeling complexes are known to modify chemical marks on histones or to induce conformational changes in the chromatin in order to regulate transcription. De novo dominant mutations in different members of the SWI/SNF chromatin remodeling complex have recently been described in individuals with Coffin-Siris (CSS) and Nicolaides-Baraitser (NCBRS) syndromes. Using a combination of whole-exome sequencing, NGS-based sequencing of 23 SWI/SNF complex genes, and molecular karyotyping in 46 previously undescribed individuals with CSS and NCBRS, we identified a de novo 1-bp deletion (c.677delG, p.Gly226Glufs*53) and a de novo missense mutation (c.914G>T, p.Cys305Phe) in PHF6 in two individuals diagnosed with CSS. PHF6 interacts with the nucleosome remodeling and deacetylation (NuRD) complex implicating dysfunction of a second chromatin remodeling complex in the pathogenesis of CSS-like phenotypes. Altogether, we identified mutations in 60% of the studied individuals (28/46), located in the genes ARID1A, ARID1B, SMARCB1, SMARCE1, SMARCA2, and PHF6. We show that mutations in ARID1B are the main cause of CSS, accounting for 76% of identified mutations. ARID1B and SMARCB1 mutations were also found in individuals with the initial diagnosis of NCBRS. These individuals apparently belong to a small subset who display an intermediate CSS/NCBRS phenotype. Our proposed genotype-phenotype correlations are important for molecular screening strategies.

  6. Immediacy Bias in Emotion Perception: Current Emotions Seem More Intense than Previous Emotions

    Science.gov (United States)

    Van Boven, Leaf; White, Katherine; Huber, Michaela

    2009-01-01

    People tend to perceive immediate emotions as more intense than previous emotions. This "immediacy bias" in emotion perception occurred for exposure to emotional but not neutral stimuli (Study 1), when emotional stimuli were separated by both shorter (2 s; Studies 1 and 2) and longer (20 min; Studies 3, 4, and 5) delays, and for emotional…

  7. A case of invasive Aspergillosis in a patient with no identifiable ...

    African Journals Online (AJOL)

    Invasive fungal infections usually affect patients with immunodeficiencies and very rarely patients with no known or identifiable risk factors. Diagnosis could be delayed in patients without previously known immunodeficiencies due to a low index of suspicion, leading to a delay in treatment and a potential poor outcome.

  8. Feasibility of identifying families for genetic studies of birth defects using the National Health Interview Survey

    Directory of Open Access Journals (Sweden)

    Nolan Vikki G

    2004-05-01

    Full Text Available Abstract Background The purpose of this study was to determine whether the National Health Interview Survey is a useful source to identify informative families for genetic studies of birth defects. Methods The 1994/1995 National Health Interview Survey (NHIS was used to identify households where individuals with two or more birth defects reside. Four groups of households were identified: 1 single non-familial (one individual with one birth defect; 2 single familial (more than one individual with one birth defect; 3 multiple non-familial (one individual with more than one birth defect, and 4 multiple familial (more than one individual with more than one birth defect. The March 2000 U.S. Census on households was used to estimate the total number of households in which there are individuals with birth defects. Results Of a total of 28,094 households and surveyed about birth defects and impairments, 1,083 single non-familial, 55 multiple non-familial, 54 single familial, and 8 multiple familial households were identified. Based on the 2000 U.S. census, it is estimated that there are 4,472,385 households where at least one person has one birth defect in the United States and in 234,846 of them there are at least two affected individuals. Western states had the highest prevalence rates. Conclusions Population-based methods, such as the NHIS, are modestly useful to identify the number and the regions where candidate families for genetic studies of birth defects reside. Clinic based studies and birth defects surveillance systems that collect family history offer better probability of ascertainment.

  9. Central venous stenosis among hemodialysis patients is often not associated with previous central venous catheters.

    Science.gov (United States)

    Kotoda, Atsushi; Akimoto, Tetsu; Kato, Maki; Kanazawa, Hidenori; Nakata, Manabu; Sugase, Taro; Ogura, Manabu; Ito, Chiharu; Sugimoto, Hideharu; Muto, Shigeaki; Kusano, Eiji

    2011-01-01

    It is widely assumed that central venous stenosis (CVS) is most commonly associated with previous central venous catheterization among the chronic hemodialysis (HD) patients. We evaluated the validity of this assumption in this retrospective study. The clinical records from 2,856 consecutive HD patients with vascular access failure during a 5-year period were reviewed, and a total of 26 patients with symptomatic CVS were identified. Combined with radiological findings, their clinical characteristics were examined. Only seven patients had a history of internal jugular dialysis catheterization. Diagnostic multidetector row computed tomography angiography showed that 7 of the 19 patients with no history of catheterization had left innominate vein stenosis due to extrinsic compression between the sternum and arch vessels. These patients had a shorter period from the time of creation of the vascular access to the initial referral (9.2 ± 7.6 months) than the rest of the patients (35.5 ± 18.6 months, p = 0.0017). Our findings suggest that cases without a history of central venous catheterization may not be rare among the HD patients with symptomatic CVS. However, those still need to be confirm by larger prospective studies of overall chronic HD patients with symptomatic CVS.

  10. A high throughput Cre–lox activated viral membrane fusion assay identifies pharmacological inhibitors of HIV entry

    Energy Technology Data Exchange (ETDEWEB)

    Esposito, Anthony M. [Division of Infectious Diseases, Department of Medicine, Icahn School of Medicine at Mount Sinai, Immunology Institute, New York, NY (United States); Cheung, Pamela [Integrated Screening Core, Icahn School of Medicine at Mount Sinai, New York, NY (United States); Swartz, Talia H.; Li, Hongru [Division of Infectious Diseases, Department of Medicine, Icahn School of Medicine at Mount Sinai, Immunology Institute, New York, NY (United States); Tsibane, Tshidi [Department of Microbiology, Icahn School of Medicine at Mount Sinai, New York, NY (United States); Durham, Natasha D. [Division of Infectious Diseases, Department of Medicine, Icahn School of Medicine at Mount Sinai, Immunology Institute, New York, NY (United States); Basler, Christopher F. [Department of Microbiology, Icahn School of Medicine at Mount Sinai, New York, NY (United States); Felsenfeld, Dan P. [Integrated Screening Core, Icahn School of Medicine at Mount Sinai, New York, NY (United States); Chen, Benjamin K., E-mail: benjamin.chen@mssm.edu [Division of Infectious Diseases, Department of Medicine, Icahn School of Medicine at Mount Sinai, Immunology Institute, New York, NY (United States)

    2016-03-15

    Enveloped virus entry occurs when viral and cellular membranes fuse releasing particle contents into the target cell. Human immunodeficiency virus (HIV) entry occurs by cell-free virus or virus transferred between infected and uninfected cells through structures called virological synapses. We developed a high-throughput cell-based assay to identify small molecule inhibitors of cell-free or virological synapse-mediated entry. An HIV clone carrying Cre recombinase as a Gag-internal gene fusion releases active Cre into cells upon viral entry activating a recombinatorial gene switch changing dsRed to GFP-expression. A screen of a 1998 known-biological profile small molecule library identified pharmacological HIV entry inhibitors that block both cell-free and cell-to-cell infection. Many top hits were noted as HIV inhibitors in prior studies, but not previously recognized as entry antagonists. Modest therapeutic indices for simvastatin and nigericin were observed in confirmatory HIV infection assays. This robust assay is adaptable to study HIV and heterologous viral pseudotypes. - Highlights: • Cre recombinase viral fusion assay screens cell-free or cell–cell entry inhibitors. • This Gag-iCre based assay is specific for the entry step of HIV replication. • Screened a library of known pharmacologic compounds for HIV fusion antagonists. • Many top hits were previously noted as HIV inhibitors, but here are classified as entry antagonists. Many top hits were previously noted as HIV inhibitors, but not as entry antagonists. • The assay is compatible with pseudotyping with HIV and heterologous viruses.

  11. A high throughput Cre–lox activated viral membrane fusion assay identifies pharmacological inhibitors of HIV entry

    International Nuclear Information System (INIS)

    Esposito, Anthony M.; Cheung, Pamela; Swartz, Talia H.; Li, Hongru; Tsibane, Tshidi; Durham, Natasha D.; Basler, Christopher F.; Felsenfeld, Dan P.; Chen, Benjamin K.

    2016-01-01

    Enveloped virus entry occurs when viral and cellular membranes fuse releasing particle contents into the target cell. Human immunodeficiency virus (HIV) entry occurs by cell-free virus or virus transferred between infected and uninfected cells through structures called virological synapses. We developed a high-throughput cell-based assay to identify small molecule inhibitors of cell-free or virological synapse-mediated entry. An HIV clone carrying Cre recombinase as a Gag-internal gene fusion releases active Cre into cells upon viral entry activating a recombinatorial gene switch changing dsRed to GFP-expression. A screen of a 1998 known-biological profile small molecule library identified pharmacological HIV entry inhibitors that block both cell-free and cell-to-cell infection. Many top hits were noted as HIV inhibitors in prior studies, but not previously recognized as entry antagonists. Modest therapeutic indices for simvastatin and nigericin were observed in confirmatory HIV infection assays. This robust assay is adaptable to study HIV and heterologous viral pseudotypes. - Highlights: • Cre recombinase viral fusion assay screens cell-free or cell–cell entry inhibitors. • This Gag-iCre based assay is specific for the entry step of HIV replication. • Screened a library of known pharmacologic compounds for HIV fusion antagonists. • Many top hits were previously noted as HIV inhibitors, but here are classified as entry antagonists. Many top hits were previously noted as HIV inhibitors, but not as entry antagonists. • The assay is compatible with pseudotyping with HIV and heterologous viruses.

  12. Exome genotyping arrays to identify rare and low frequency variants associated with epithelial ovarian cancer risk

    DEFF Research Database (Denmark)

    Permuth, Jennifer B; Pirie, Ailith; Ann Chen, Y

    2016-01-01

    Rare and low frequency variants are not well covered in most germline genotyping arrays and are understudied in relation to epithelial ovarian cancer (EOC) risk. To address this gap, we used genotyping arrays targeting rarer protein-coding variation in 8,165 EOC cases and 11,619 controls from...... that is in LD (r(2 )=( )0.90) with a previously identified 'best hit' (rs7651446) mapping to an intron of TIPARP. Suggestive associations (5.0 × 10 (-)  (5 )>( )P≥5.0 ×10 (-)  (7)) were detected for rare and low-frequency variants at 16 novel loci. Four rare missense variants were identified (ACTBL2 rs73757391.......67 × 10 (-)  (4); PSKAT-o = 1.07 × 10 (-)  (5)), reaffirming variant-level analysis. In summary, this large study identified several rare and low-frequency variants and genes that may contribute to EOC susceptibility, albeit with possible small effects. Future studies that integrate epidemiology...

  13. Parkinson's Disease Subtypes Identified from Cluster Analysis of Motor and Non-motor Symptoms.

    Science.gov (United States)

    Mu, Jesse; Chaudhuri, Kallol R; Bielza, Concha; de Pedro-Cuesta, Jesus; Larrañaga, Pedro; Martinez-Martin, Pablo

    2017-01-01

    Parkinson's disease is now considered a complex, multi-peptide, central, and peripheral nervous system disorder with considerable clinical heterogeneity. Non-motor symptoms play a key role in the trajectory of Parkinson's disease, from prodromal premotor to end stages. To understand the clinical heterogeneity of Parkinson's disease, this study used cluster analysis to search for subtypes from a large, multi-center, international, and well-characterized cohort of Parkinson's disease patients across all motor stages, using a combination of cardinal motor features (bradykinesia, rigidity, tremor, axial signs) and, for the first time, specific validated rater-based non-motor symptom scales. Two independent international cohort studies were used: (a) the validation study of the Non-Motor Symptoms Scale ( n = 411) and (b) baseline data from the global Non-Motor International Longitudinal Study ( n = 540). k -means cluster analyses were performed on the non-motor and motor domains (domains clustering) and the 30 individual non-motor symptoms alone (symptoms clustering), and hierarchical agglomerative clustering was performed to group symptoms together. Four clusters are identified from the domains clustering supporting previous studies: mild, non-motor dominant, motor-dominant, and severe. In addition, six new smaller clusters are identified from the symptoms clustering, each characterized by clinically-relevant non-motor symptoms. The clusters identified in this study present statistical confirmation of the increasingly important role of non-motor symptoms (NMS) in Parkinson's disease heterogeneity and take steps toward subtype-specific treatment packages.

  14. Wildlife Loss Estimates and Summary of Previous Mitigation Related to Hydroelectric Projects in Montana, Volume Three, Hungry Horse Project.

    Energy Technology Data Exchange (ETDEWEB)

    Casey, Daniel

    1984-10-01

    This assessment addresses the impacts to the wildlife populations and wildlife habitats due to the Hungry Horse Dam project on the South Fork of the Flathead River and previous mitigation of theses losses. In order to develop and focus mitigation efforts, it was first necessary to estimate wildlife and wildlife hatitat losses attributable to the construction and operation of the project. The purpose of this report was to document the best available information concerning the degree of impacts to target wildlife species. Indirect benefits to wildlife species not listed will be identified during the development of alternative mitigation measures. Wildlife species incurring positive impacts attributable to the project were identified.

  15. 22 CFR 40.93 - Aliens unlawfully present after previous immigration violation.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Aliens unlawfully present after previous... TO BOTH NONIMMIGRANTS AND IMMIGRANTS UNDER THE IMMIGRATION AND NATIONALITY ACT, AS AMENDED Aliens Previously Removed § 40.93 Aliens unlawfully present after previous immigration violation. An alien described...

  16. Large scale association analysis identifies three susceptibility loci for coronary artery disease.

    Directory of Open Access Journals (Sweden)

    Stephanie Saade

    Full Text Available Genome wide association studies (GWAS and their replications that have associated DNA variants with myocardial infarction (MI and/or coronary artery disease (CAD are predominantly based on populations of European or Eastern Asian descent. Replication of the most significantly associated polymorphisms in multiple populations with distinctive genetic backgrounds and lifestyles is crucial to the understanding of the pathophysiology of a multifactorial disease like CAD. We have used our Lebanese cohort to perform a replication study of nine previously identified CAD/MI susceptibility loci (LTA, CDKN2A-CDKN2B, CELSR2-PSRC1-SORT1, CXCL12, MTHFD1L, WDR12, PCSK9, SH2B3, and SLC22A3, and 88 genes in related phenotypes. The study was conducted on 2,002 patients with detailed demographic, clinical characteristics, and cardiac catheterization results. One marker, rs6922269, in MTHFD1L was significantly protective against MI (OR=0.68, p=0.0035, while the variant rs4977574 in CDKN2A-CDKN2B was significantly associated with MI (OR=1.33, p=0.0086. Associations were detected after adjustment for family history of CAD, gender, hypertension, hyperlipidemia, diabetes, and smoking. The parallel study of 88 previously published genes in related phenotypes encompassed 20,225 markers, three quarters of which with imputed genotypes The study was based on our genome-wide genotype data set, with imputation across the whole genome to HapMap II release 22 using HapMap CEU population as a reference. Analysis was conducted on both the genotyped and imputed variants in the 88 regions covering selected genes. This approach replicated HNRNPA3P1-CXCL12 association with CAD and identified new significant associations of CDKAL1, ST6GAL1, and PTPRD with CAD. Our study provides evidence for the importance of the multifactorial aspect of CAD/MI and describes genes predisposing to their etiology.

  17. Identifying management competencies for health care executives: review of a series of Delphi studies.

    Science.gov (United States)

    Hudak, R P; Brooke, P P; Finstuen, K

    2000-01-01

    This analysis reviews a selected body of research that identifies the essential areas of management expertise required of future health care executives. To ensure consistency, six studies are analyzed, utilizing the Delphi technique, to query a broad spectrum of experts in different fields and sites of health care management. The analysis identifies a number of management competencies, i.e., managerial capabilities, which current and aspiring health care executives, in various settings and with differing educational backgrounds, should possess to enhance the probability of their success in current and future positions of responsibility. In addition, this review identifies the skills (technical expertise), knowledge (facts and principles) and abilities (physical, mental or legal power) required to support achievement of these competencies. Leadership and resource management, including cost and finance dimensions, are the highest-rated requisite management competencies. The dominant skills, knowledge and abilities (SKAs) are related to interpersonal skills. The lowest-rated SKAs are related to job-specific, technical skills. Recommendations include the review of this research by formal and continuing education programs to determine the content of their courses and areas for future research. Similarly, current health care executives should assess this research to assist in identifying competency gaps. Lastly, this analysis recommends that the Delphi technique, as a valid and replicable methodology, be applied toward the study of non-executive health care managers, e.g., students, clinicians, mid-level managers and integrated systems administrators, to determine their requisite management competencies and SKAs.

  18. A systematic procedure for identifying and classifying children with dyscalculia among primary school children in India.

    Science.gov (United States)

    Ramaa, S; Gowramma, I P

    2002-01-01

    This paper describes the procedures adopted by two independent studies in India for identifying and classifying children with dyscalculia in primary schools. For determining the presence of dyscalculia both inclusionary and exclusionary criteria were used. When other possible causes of arithmetic failure had been excluded, figures for dyscalculia came out as 5.98% (15 cases out of 251) in one study and 5.54% (78 out of 1408) in the second. It was found in the latter study that 40 out of the 78 (51.27%) also had reading and writing problems. The findings are discussed in the light of previous studies.

  19. Identifying genes that mediate anthracyline toxicity in immune cells

    Directory of Open Access Journals (Sweden)

    Amber eFrick

    2015-04-01

    Full Text Available The role of the immune system in response to chemotherapeutic agents remains elusive. The interpatient variability observed in immune and chemotherapeutic cytotoxic responses is likely, at least in part, due to complex genetic differences. Through the use of a panel of genetically diverse mouse inbred strains, we developed a drug screening platform aimed at identifying genes underlying these chemotherapeutic cytotoxic effects on immune cells. Using genome-wide association studies (GWAS, we identified four genome-wide significant quantitative trait loci (QTL that contributed to the sensitivity of doxorubicin and idarubicin in immune cells. Of particular interest, a locus on chromosome 16 was significantly associated with cell viability following idarubicin administration (p = 5.01x10-8. Within this QTL lies App, which encodes amyloid beta precursor protein. Comparison of dose-response curves verified that T-cells in App knockout mice were more sensitive to idarubicin than those of C57BL/6J control mice (p < 0.05.In conclusion, the cellular screening approach coupled with GWAS led to the identification and subsequent validation of a gene involved in T-cell viability after idarubicin treatment. Previous studies have suggested a role for App in in vitro and in vivo cytotoxicity to anticancer agents; the overexpression of App enhances resistance, while the knockdown of this gene is deleterious to cell viability. Thus, further investigations should include performing mechanistic studies, validating additional genes from the GWAS, including Ppfia1 and Ppfibp1, and ultimately translating the findings to in vivo and human studies.

  20. Protein Correlation Profiles Identify Lipid Droplet Proteins with High Confidence*

    Science.gov (United States)

    Krahmer, Natalie; Hilger, Maximiliane; Kory, Nora; Wilfling, Florian; Stoehr, Gabriele; Mann, Matthias; Farese, Robert V.; Walther, Tobias C.

    2013-01-01

    Lipid droplets (LDs) are important organelles in energy metabolism and lipid storage. Their cores are composed of neutral lipids that form a hydrophobic phase and are surrounded by a phospholipid monolayer that harbors specific proteins. Most well-established LD proteins perform important functions, particularly in cellular lipid metabolism. Morphological studies show LDs in close proximity to and interacting with membrane-bound cellular organelles, including the endoplasmic reticulum, mitochondria, peroxisomes, and endosomes. Because of these close associations, it is difficult to purify LDs to homogeneity. Consequently, the confident identification of bona fide LD proteins via proteomics has been challenging. Here, we report a methodology for LD protein identification based on mass spectrometry and protein correlation profiles. Using LD purification and quantitative, high-resolution mass spectrometry, we identified LD proteins by correlating their purification profiles to those of known LD proteins. Application of the protein correlation profile strategy to LDs isolated from Drosophila S2 cells led to the identification of 111 LD proteins in a cellular LD fraction in which 1481 proteins were detected. LD localization was confirmed in a subset of identified proteins via microscopy of the expressed proteins, thereby validating the approach. Among the identified LD proteins were both well-characterized LD proteins and proteins not previously known to be localized to LDs. Our method provides a high-confidence LD proteome of Drosophila cells and a novel approach that can be applied to identify LD proteins of other cell types and tissues. PMID:23319140

  1. Initial results of CyberKnife treatment for recurrent previously irradiated head and neck cancer

    International Nuclear Information System (INIS)

    Himei, Kengo; Katsui, Kuniaki; Yoshida, Atsushi

    2003-01-01

    The purpose of this study was to evaluate the efficacy of CyberKnife for recurrent previously irradiated head and neck cancer. Thirty-one patients with recurrent previously irradiated head and neck cancer were treated with a CyberKnife from July 1999 to March 2002 at Okayama Kyokuto Hospital were retrospectively studied. The accumulated dose was 28-80 Gy (median 60 Gy). The interval between CyberKnife treatment and previous radiotherapy was 0.4-429.5 months (median 16.3 months). Primary lesions were nasopharynx: 7, maxillary sinus: 6, tongue: 5, ethmoid sinus: 3, and others: 1. The pathology was squamous cell carcinoma: 25, adenoid cystic carcinoma: 4, and others: 2. Symptoms were pain: 8, and nasal bleeding: 2. The prescribed dose was 15.0-40.3 Gy (median 32.3 Gy) as for the marginal dose. The response rate (complete response (CR)+partial response (PR)) and local control rate (CR+PR+no change (NC)) was 74% and 94% respectively. Pain disappeared for 4 cases, relief was obtained for 4 cases and no change for 2 cases and nasal bleeding disappeared for 2 cases for an improvement of symptoms. An adverse effects were observed as mucositis in 5 cases and neck swelling in one case. Prognosis of recurrent previously irradiated head and neck cancer was estimated as poor. Our early experience shows that CyberKnife is expected to be feasible treatment for recurrent previously irradiated head and neck cancer, and for the reduction adverse effects and maintenance of useful quality of life (QOL) for patients. (author)

  2. A cross-species genetic analysis identifies candidate genes for mouse anxiety and human bipolar disorder

    Directory of Open Access Journals (Sweden)

    David G Ashbrook

    2015-07-01

    Full Text Available Bipolar disorder (BD is a significant neuropsychiatric disorder with a lifetime prevalence of ~1%. To identify genetic variants underlying BD genome-wide association studies (GWAS have been carried out. While many variants of small effect associated with BD have been identified few have yet been confirmed, partly because of the low power of GWAS due to multiple comparisons being made. Complementary mapping studies using murine models have identified genetic variants for behavioral traits linked to BD, often with high power, but these identified regions often contain too many genes for clear identification of candidate genes. In the current study we have aligned human BD GWAS results and mouse linkage studies to help define and evaluate candidate genes linked to BD, seeking to use the power of the mouse mapping with the precision of GWAS. We use quantitative trait mapping for open field test and elevated zero maze data in the largest mammalian model system, the BXD recombinant inbred mouse population, to identify genomic regions associated with these BD-like phenotypes. We then investigate these regions in whole genome data from the Psychiatric Genomics Consortium’s bipolar disorder GWAS to identify candidate genes associated with BD. Finally we establish the biological relevance and pathways of these genes in a comprehensive systems genetics analysis.We identify four genes associated with both mouse anxiety and human BD. While TNR is a novel candidate for BD, we can confirm previously suggested associations with CMYA5, MCTP1 and RXRG. A cross-species, systems genetics analysis shows that MCTP1, RXRG and TNR coexpress with genes linked to psychiatric disorders and identify the striatum as a potential site of action. CMYA5, MCTP1, RXRG and TNR are associated with mouse anxiety and human BD. We hypothesize that MCTP1, RXRG and TNR influence intercellular signaling in the striatum.

  3. Two novel antimicrobial defensins from rice identified by gene coexpression network analyses.

    Science.gov (United States)

    Tantong, Supaluk; Pringsulaka, Onanong; Weerawanich, Kamonwan; Meeprasert, Arthitaya; Rungrotmongkol, Thanyada; Sarnthima, Rakrudee; Roytrakul, Sittiruk; Sirikantaramas, Supaart

    2016-10-01

    Defensins form an antimicrobial peptides (AMP) family, and have been widely studied in various plants because of their considerable inhibitory functions. However, their roles in rice (Oryza sativa L.) have not been characterized, even though rice is one of the most important staple crops that is susceptible to damaging infections. Additionally, a previous study identified 598 rice genes encoding cysteine-rich peptides, suggesting there are several uncharacterized AMPs in rice. We performed in silico gene expression and coexpression network analyses of all genes encoding defensin and defensin-like peptides, and determined that OsDEF7 and OsDEF8 are coexpressed with pathogen-responsive genes. Recombinant OsDEF7 and OsDEF8 could form homodimers. They inhibited the growth of the bacteria Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, and Erwinia carotovora subsp. atroseptica with minimum inhibitory concentration (MIC) ranging from 0.6 to 63μg/mL. However, these OsDEFs are weakly active against the phytopathogenic fungi Helminthosporium oryzae and Fusarium oxysporum f.sp. cubense. This study describes a useful method for identifying potential plant AMPs with biological activities. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Genome-wide association study identifies variants in HORMAD2 associated with tonsillectomy

    DEFF Research Database (Denmark)

    Feenstra, Bjarke; Bager, Peter; Liu, Xueping

    2017-01-01

    BACKGROUND: Inflammation of the tonsils is a normal response to infection, but some individuals experience recurrent, severe tonsillitis and massive hypertrophy of the tonsils in which case surgical removal of the tonsils may be considered. OBJECTIVE: To identify common genetic variants associate...... the molecular mechanisms underlying the genetic association involve general lymphoid hyper-reaction throughout the mucosa-associated lymphoid tissue system.......BACKGROUND: Inflammation of the tonsils is a normal response to infection, but some individuals experience recurrent, severe tonsillitis and massive hypertrophy of the tonsils in which case surgical removal of the tonsils may be considered. OBJECTIVE: To identify common genetic variants associated...... with tonsillectomy. METHODS: We used tonsillectomy information from Danish health registers and carried out a genome-wide association study comprising 1464 patients and 12 019 controls of Northwestern European ancestry, with replication in an independent sample set of 1575 patients and 1367 controls. RESULTS...

  5. On Identifying which Intermediate Nodes Should Code in Multicast Networks

    DEFF Research Database (Denmark)

    Pinto, Tiago; Roetter, Daniel Enrique Lucani; Médard, Muriel

    2013-01-01

    the data packets. Previous work has shown that in lossless wireline networks, the performance of tree-packing mechanisms is comparable to network coding, albeit with added complexity at the time of computing the trees. This means that most nodes in the network need not code. Thus, mechanisms that identify...... intermediate nodes that do require coding is instrumental for the efficient operation of coded networks and can have a significant impact in overall energy consumption. We present a distributed, low complexity algorithm that allows every node to identify if it should code and, if so, through what output link...

  6. An Automated Algorithm for Identifying and Tracking Transverse Waves in Solar Images

    Science.gov (United States)

    Weberg, Micah J.; Morton, Richard J.; McLaughlin, James A.

    2018-01-01

    Recent instrumentation has demonstrated that the solar atmosphere supports omnipresent transverse waves, which could play a key role in energizing the solar corona. Large-scale studies are required in order to build up an understanding of the general properties of these transverse waves. To help facilitate this, we present an automated algorithm for identifying and tracking features in solar images and extracting the wave properties of any observed transverse oscillations. We test and calibrate our algorithm using a set of synthetic data, which includes noise and rotational effects. The results indicate an accuracy of 1%–2% for displacement amplitudes and 4%–10% for wave periods and velocity amplitudes. We also apply the algorithm to data from the Atmospheric Imaging Assembly on board the Solar Dynamics Observatory and find good agreement with previous studies. Of note, we find that 35%–41% of the observed plumes exhibit multiple wave signatures, which indicates either the superposition of waves or multiple independent wave packets observed at different times within a single structure. The automated methods described in this paper represent a significant improvement on the speed and quality of direct measurements of transverse waves within the solar atmosphere. This algorithm unlocks a wide range of statistical studies that were previously impractical.

  7. Underestimation of Severity of Previous Whiplash Injuries

    Science.gov (United States)

    Naqui, SZH; Lovell, SJ; Lovell, ME

    2008-01-01

    INTRODUCTION We noted a report that more significant symptoms may be expressed after second whiplash injuries by a suggested cumulative effect, including degeneration. We wondered if patients were underestimating the severity of their earlier injury. PATIENTS AND METHODS We studied recent medicolegal reports, to assess subjects with a second whiplash injury. They had been asked whether their earlier injury was worse, the same or lesser in severity. RESULTS From the study cohort, 101 patients (87%) felt that they had fully recovered from their first injury and 15 (13%) had not. Seventy-six subjects considered their first injury of lesser severity, 24 worse and 16 the same. Of the 24 that felt the violence of their first accident was worse, only 8 had worse symptoms, and 16 felt their symptoms were mainly the same or less than their symptoms from their second injury. Statistical analysis of the data revealed that the proportion of those claiming a difference who said the previous injury was lesser was 76% (95% CI 66–84%). The observed proportion with a lesser injury was considerably higher than the 50% anticipated. CONCLUSIONS We feel that subjects may underestimate the severity of an earlier injury and associated symptoms. Reasons for this may include secondary gain rather than any proposed cumulative effect. PMID:18201501

  8. A Study Identifying Causes of Construction Waste Production and Applying Safety Management on Construction Site

    Directory of Open Access Journals (Sweden)

    Ali Asghar Najafpoor

    2014-09-01

    Full Text Available Background and purpose: In a recent century, the amount of construction waste has increased significantly. Although the building industry has a considerable role in the development of a society, it is regarded as an environmentally destructive. Source reduction is the highest goal in the waste management hierarchy and is in priority. It also has economic benefits by reducing costs associated with transportation, disposal or recycling of wastes. The present study is aimed to identify activities generating the wastes in design, transportation and storage and procurement of building materials. Materials and Methods: This was questionnaire survey. A total of 94 professionals in the construction industry were attended in this study. To determine the validity and reliability of the instrument, content validity method and Cronbach’s alpha coefficient (0.79 were used. Data were analyzed using SPSS for Windows. Frequencies, percentage, mean and standard deviation were determined in this research. Results: The results showed that handling and storage have been chosen as the most causative factor of waste production in construction activity. Improper material storage was identified major factor in producing waste in handling and storage phase. Usage of low-quality material in design stage and material price changes in procurement were recognized as major causes of waste production in these stages. Conclusion: All studied phases in this research were identified as causative factors in producing of waste. Identifying causes of construction waste production will help us decide better how to control this sort of wastes.

  9. Genome-wide association study identifies 74 loci associated with educational attainment

    Science.gov (United States)

    Okbay, Aysu; Beauchamp, Jonathan P.; Fontana, Mark A.; Lee, James J.; Pers, Tune H.; Rietveld, Cornelius A.; Turley, Patrick; Chen, Guo-Bo; Emilsson, Valur; Meddens, S. Fleur W.; Oskarsson, Sven; Pickrell, Joseph K.; Thom, Kevin; Timshel, Pascal; de Vlaming, Ronald; Abdellaoui, Abdel; Ahluwalia, Tarunveer S.; Bacelis, Jonas; Baumbach, Clemens; Bjornsdottir, Gyda; Brandsma, Johannes H.; Concas, Maria Pina; Derringer, Jaime; Furlotte, Nicholas A.; Galesloot, Tessel E.; Girotto, Giorgia; Gupta, Richa; Hall, Leanne M.; Harris, Sarah E.; Hofer, Edith; Horikoshi, Momoko; Huffman, Jennifer E.; Kaasik, Kadri; Kalafati, Ioanna P.; Karlsson, Robert; Kong, Augustine; Lahti, Jari; van der Lee, Sven J.; de Leeuw, Christiaan; Lind, Penelope A.; Lindgren, Karl-Oskar; Liu, Tian; Mangino, Massimo; Marten, Jonathan; Mihailov, Evelin; Miller, Michael B.; van der Most, Peter J.; Oldmeadow, Christopher; Payton, Antony; Pervjakova, Natalia; Peyrot, Wouter J.; Qian, Yong; Raitakari, Olli; Rueedi, Rico; Salvi, Erika; Schmidt, Börge; Schraut, Katharina E.; Shi, Jianxin; Smith, Albert V.; Poot, Raymond A.; Pourcain, Beate; Teumer, Alexander; Thorleifsson, Gudmar; Verweij, Niek; Vuckovic, Dragana; Wellmann, Juergen; Westra, Harm-Jan; Yang, Jingyun; Zhao, Wei; Zhu, Zhihong; Alizadeh, Behrooz Z.; Amin, Najaf; Bakshi, Andrew; Baumeister, Sebastian E.; Biino, Ginevra; Bønnelykke, Klaus; Boyle, Patricia A.; Campbell, Harry; Cappuccio, Francesco P.; Davies, Gail; De Neve, Jan-Emmanuel; Deloukas, Panos; Demuth, Ilja; Ding, Jun; Eibich, Peter; Eisele, Lewin; Eklund, Niina; Evans68, David M.; Faul, Jessica D.; Feitosa, Mary F.; Forstner, Andreas J.; Gandin, Ilaria; Gunnarsson, Bjarni; Halldórsson, Bjarni V.; Harris, Tamara B.; Heath, Andrew C.; Hocking, Lynne J.; Holliday, Elizabeth G.; Homuth, Georg; Horan, Michael A.; Hottenga, Jouke-Jan; de Jager, Philip L.; Joshi, Peter K.; Jugessur, Astanand; Kaakinen, Marika A.; Kähönen, Mika; Kanoni, Stavroula; Keltigangas-Järvinen, Liisa; Kiemeney, Lambertus A.L.M.; Kolcic, Ivana; Koskinen, Seppo; Kraja, Aldi T.; Kroh, Martin; Kutalik, Zoltan; Latvala, Antti; Launer, Lenore J.; Lebreton, Maël P.; Levinson, Douglas F.; Lichtenstein, Paul; Lichtner, Peter; Liewald, David C.M.; Loukola, Anu; Madden, Pamela A.; Mägi, Reedik; Mäki-Opas, Tomi; Marioni, Riccardo E.; Marques-Vidal, Pedro; Meddens, Gerardus A.; McMahon, George; Meisinger, Christa; Meitinger, Thomas; Milaneschi, Yusplitri; Milani, Lili; Montgomery, Grant W.; Myhre, Ronny; Nelson, Christopher P.; Nyholt, Dale R.; Ollier, William E.R.; Palotie, Aarno; Paternoster, Lavinia; Pedersen, Nancy L.; Petrovic, Katja E.; Porteous, David J.; Räikkönen, Katri; Ring, Susan M.; Robino, Antonietta; Rostapshova, Olga; Rudan, Igor; Rustichini, Aldo; Salomaa, Veikko; Sanders, Alan R.; Sarin, Antti-Pekka; Schmidt, Helena; Scott, Rodney J.; Smith, Blair H.; Smith, Jennifer A.; Staessen, Jan A.; Steinhagen-Thiessen, Elisabeth; Strauch, Konstantin; Terracciano, Antonio; Tobin, Martin D.; Ulivi, Sheila; Vaccargiu, Simona; Quaye, Lydia; van Rooij, Frank J.A.; Venturini, Cristina; Vinkhuyzen, Anna A.E.; Völker, Uwe; Völzke, Henry; Vonk, Judith M.; Vozzi, Diego; Waage, Johannes; Ware, Erin B.; Willemsen, Gonneke; Attia, John R.; Bennett, David A.; Berger, Klaus; Bertram, Lars; Bisgaard, Hans; Boomsma, Dorret I.; Borecki, Ingrid B.; Bultmann, Ute; Chabris, Christopher F.; Cucca, Francesco; Cusi, Daniele; Deary, Ian J.; Dedoussis, George V.; van Duijn, Cornelia M.; Eriksson, Johan G.; Franke, Barbara; Franke, Lude; Gasparini, Paolo; Gejman, Pablo V.; Gieger, Christian; Grabe, Hans-Jörgen; Gratten, Jacob; Groenen, Patrick J.F.; Gudnason, Vilmundur; van der Harst, Pim; Hayward, Caroline; Hinds, David A.; Hoffmann, Wolfgang; Hyppönen, Elina; Iacono, William G.; Jacobsson, Bo; Järvelin, Marjo-Riitta; Jöckel, Karl-Heinz; Kaprio, Jaakko; Kardia, Sharon L.R.; Lehtimäki, Terho; Lehrer, Steven F.; Magnusson, Patrik K.E.; Martin, Nicholas G.; McGue, Matt; Metspalu, Andres; Pendleton, Neil; Penninx, Brenda W.J.H.; Perola, Markus; Pirastu, Nicola; Pirastu, Mario; Polasek, Ozren; Posthuma, Danielle; Power, Christine; Province, Michael A.; Samani, Nilesh J.; Schlessinger, David; Schmidt, Reinhold; Sørensen, Thorkild I.A.; Spector, Tim D.; Stefansson, Kari; Thorsteinsdottir, Unnur; Thurik, A. Roy; Timpson, Nicholas J.; Tiemeier, Henning; Tung, Joyce Y.; Uitterlinden, André G.; Vitart, Veronique; Vollenweider, Peter; Weir, David R.; Wilson, James F.; Wright, Alan F.; Conley, Dalton C.; Krueger, Robert F.; Smith, George Davey; Hofman, Albert; Laibson, David I.; Medland, Sarah E.; Meyer, Michelle N.; Yang, Jian; Johannesson, Magnus; Visscher, Peter M.; Esko, Tõnu; Koellinger, Philipp D.; Cesarini, David; Benjamin, Daniel J.

    2016-01-01

    Summary Educational attainment (EA) is strongly influenced by social and other environmental factors, but genetic factors are also estimated to account for at least 20% of the variation across individuals1. We report the results of a genome-wide association study (GWAS) for EA that extends our earlier discovery sample1,2 of 101,069 individuals to 293,723 individuals, and a replication in an independent sample of 111,349 individuals from the UK Biobank. We now identify 74 genome-wide significant loci associated with number of years of schooling completed. Single-nucleotide polymorphisms (SNPs) associated with educational attainment are disproportionately found in genomic regions regulating gene expression in the fetal brain. Candidate genes are preferentially expressed in neural tissue, especially during the prenatal period, and enriched for biological pathways involved in neural development. Our findings demonstrate that, even for a behavioral phenotype that is mostly environmentally determined, a well-powered GWAS identifies replicable associated genetic variants that suggest biologically relevant pathways. Because EA is measured in large numbers of individuals, it will continue to be useful as a proxy phenotype in efforts to characterize the genetic influences of related phenotypes, including cognition and neuropsychiatric disease. PMID:27225129

  10. Molecular analysis of clinical isolates previously diagnosed as Mycobacterium intracellulare reveals incidental findings of "Mycobacterium indicus pranii" genotypes in human lung infection.

    Science.gov (United States)

    Kim, Su-Young; Park, Hye Yun; Jeong, Byeong-Ho; Jeon, Kyeongman; Huh, Hee Jae; Ki, Chang-Seok; Lee, Nam Yong; Han, Seung-Jung; Shin, Sung Jae; Koh, Won-Jung

    2015-09-30

    Mycobacterium intracellulare is a major cause of Mycobacterium avium complex lung disease in many countries. Molecular studies have revealed several new Mycobacteria species that are closely related to M. intracellulare. The aim of this study was to re-identify and characterize clinical isolates from patients previously diagnosed with M. intracellulare lung disease at the molecular level. Mycobacterial isolates from 77 patients, initially diagnosed with M. intracellulare lung disease were re-analyzed by multi-locus sequencing and pattern of insertion sequences. Among the 77 isolates, 74 (96 %) isolates were designated as M. intracellulare based on multigene sequence-based analysis. Interestingly, the three remaining strains (4 %) were re-identified as "Mycobacterium indicus pranii" according to distinct molecular phylogenetic positions in rpoB and hsp65 sequence-based typing. In hsp65 sequevar analysis, code 13 was found in the majority of cases and three unreported codes were identified. In 16S-23S rRNA internal transcribed spacer (ITS) sequevar analysis, all isolates of both species were classified within the Min-A ITS sequevar. Interestingly, four of the M. intracellulare isolates harbored IS1311, a M. avium-specific element. Two of three patients infected with "M. indicus pranii" had persistent positive sputum cultures after antibiotic therapy, indicating the clinical relevance of this study. This analysis highlights the importance of precise identification of clinical isolates genetically close to Mycobacterium species, and suggests that greater attention should be paid to nontuberculous mycobacteria lung disease caused by "M. indicus pranii".

  11. Genome-wide association study identifies variants associated with autoimmune hepatitis type 1.

    Science.gov (United States)

    de Boer, Ynto S; van Gerven, Nicole M F; Zwiers, Antonie; Verwer, Bart J; van Hoek, Bart; van Erpecum, Karel J; Beuers, Ulrich; van Buuren, Henk R; Drenth, Joost P H; den Ouden, Jannie W; Verdonk, Robert C; Koek, Ger H; Brouwer, Johannes T; Guichelaar, Maureen M J; Vrolijk, Jan M; Kraal, Georg; Mulder, Chris J J; van Nieuwkerk, Carin M J; Fischer, Janett; Berg, Thomas; Stickel, Felix; Sarrazin, Christoph; Schramm, Christoph; Lohse, Ansgar W; Weiler-Normann, Christina; Lerch, Markus M; Nauck, Matthias; Völzke, Henry; Homuth, Georg; Bloemena, Elisabeth; Verspaget, Hein W; Kumar, Vinod; Zhernakova, Alexandra; Wijmenga, Cisca; Franke, Lude; Bouma, Gerd

    2014-08-01

    Autoimmune hepatitis (AIH) is an uncommon autoimmune liver disease of unknown etiology. We used a genome-wide approach to identify genetic variants that predispose individuals to AIH. We performed a genome-wide association study of 649 adults in The Netherlands with AIH type 1 and 13,436 controls. Initial associations were further analyzed in an independent replication panel comprising 451 patients with AIH type 1 in Germany and 4103 controls. We also performed an association analysis in the discovery cohort using imputed genotypes of the major histocompatibility complex region. We associated AIH with a variant in the major histocompatibility complex region at rs2187668 (P = 1.5 × 10(-78)). Analysis of this variant in the discovery cohort identified HLA-DRB1*0301 (P = 5.3 × 10(-49)) as a primary susceptibility genotype and HLA-DRB1*0401 (P = 2.8 × 10(-18)) as a secondary susceptibility genotype. We also associated AIH with variants of SH2B3 (rs3184504, 12q24; P = 7.7 × 10(-8)) and CARD10 (rs6000782, 22q13.1; P = 3.0 × 10(-6)). In addition, strong inflation of association signal was found with single-nucleotide polymorphisms associated with other immune-mediated diseases, including primary sclerosing cholangitis and primary biliary cirrhosis, but not with single-nucleotide polymorphisms associated with other genetic traits. In a genome-wide association study, we associated AIH type 1 with variants in the major histocompatibility complex region, and identified variants of SH2B3and CARD10 as likely risk factors. These findings support a complex genetic basis for AIH pathogenesis and indicate that part of the genetic susceptibility overlaps with that for other immune-mediated liver diseases. Copyright © 2014 AGA Institute. Published by Elsevier Inc. All rights reserved.

  12. Homicide and domestic violence. Are there different psychological profiles mediated by previous exerted on the victim?

    OpenAIRE

    Montserrat Yepes; Maria R. Vinas; Inmaculada Armadans; Miguel A. Soria

    2009-01-01

    A sample of 46 men was evaluated with the DAPP (Questionnaire of Domestic Aggressor Psychological Profile). All were inmates convicted for various degrees of violence against their wives in different prisons. The sample was divided into three groups: homicides without previous violence against their wives (H) (n=11), homicides with previous violence (VH) (n=9) and domestic batterers without previous homicide attempts against their partners (B) (n=26). The aim of the study was to analyze the p...

  13. 18 CFR 154.302 - Previously submitted material.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Previously submitted material. 154.302 Section 154.302 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... concurrently with the rate change filing. There must be furnished to the Director, Office of Energy Market...

  14. Prognostic factors in multiple myeloma: definition of risk groups in 410 previously untreated patients: a Grupo Argentino de Tratamiento de la Leucemia Aguda study.

    Science.gov (United States)

    Corrado, C; Santarelli, M T; Pavlovsky, S; Pizzolato, M

    1989-12-01

    Four hundred ten previously untreated multiple myeloma patients entered onto two consecutive Grupo Argentino de Tratamiento de la Leucemia Aguda (GATLA) protocols were analyzed to identify significant prognostic factors influencing survival. The univariate analysis selected the following variables: performance status, renal function, percentage of bone marrow plasma cells at diagnosis, hemoglobin, and age. A multivariate analysis showed that performance status, renal function, percentage of bone marrow plasma cells, hemoglobin, and age were the best predictive variables for survival. A score was assigned to each patient according to these variables, which led to their classification in three groups: good, intermediate, and poor risk, with a probability of survival of 26% and 10% at 96 months, and 5% at 56 months, and median survival of 60, 37, and 14 months, respectively (P = .0000). In our patient population, this model proved to be superior to the Durie-Salmon staging system in defining prognostic risk groups, and separating patients with significantly different risks within each Durie-Salmon stage.

  15. A genome-wide association study of COPD identifies a susceptibility locus on chromosome 19q13

    DEFF Research Database (Denmark)

    Cho, Michael H; Castaldi, Peter J; Wan, Emily S

    2012-01-01

    The genetic risk factors for chronic obstructive pulmonary disease (COPD) are still largely unknown. To date, genome-wide association studies (GWASs) of limited size have identified several novel risk loci for COPD at CHRNA3/CHRNA5/IREB2, HHIP and FAM13A; additional loci may be identified through...

  16. Reflections of distraction in memory: transfer of previous distraction improves recall in younger and older adults.

    Science.gov (United States)

    Thomas, Ruthann C; Hasher, Lynn

    2012-01-01

    Three studies explored whether younger and older adults' free recall performance can benefit from prior exposure to distraction that becomes relevant in a memory task. Participants initially read stories that included distracting text. Later, they studied a list of words for free recall, with half of the list consisting of previously distracting words. When the memory task was indirect in its use of distraction (Study 1), only older adults showed transfer, with better recall of previously distracting compared with new words, which increased their recall to match that of younger adults. However, younger adults showed transfer when cued about the relevance of previous distraction both before studying the words (Study 2) and before recalling the words (Study 3) in the memory test. Results suggest that both younger and older adults encode distraction, but younger adults require explicit cueing to use their knowledge of distraction. In contrast, older adults transfer knowledge of distraction in both explicitly cued and indirect memory tasks. Results are discussed in terms of age differences in inhibition and source-constrained retrieval.

  17. A Flexible-Dose Study of Paliperidone ER in Patients With Nonacute Schizophrenia Previously Treated Unsuccessfully With Oral Olanzapine.

    Science.gov (United States)

    Kotler, Moshe; Dilbaz, Nesrin; Rosa, Fernanda; Paterakis, Periklis; Milanova, Vihra; Smulevich, Anatoly B; Lahaye, Marjolein; Schreiner, Andreas

    2016-01-01

    The goal of this study was to explore the tolerability, safety, and treatment response of switching from oral olanzapine to paliperidone extended release (ER). Adult patients with nonacute schizophrenia who had been treated unsuccessfully with oral olanzapine were switched to flexible doses of paliperidone ER (3 to 12 mg/d). The primary efficacy outcome was a ≥ 20% improvement in Positive and Negative Syndrome Scale (PANSS) total scores from baseline to endpoint for patients who switched medications because of lack of efficacy with olanzapine and noninferiority versus previous olanzapine treatment (mean endpoint change in PANSS total scores vs. baseline of ≤ 5 points) for patients who switched for reasons other than lack of efficacy. Safety and tolerability were assessed by monitoring adverse events, extrapyramidal symptoms, and weight change. Of 396 patients, 65.2% were men, mean age was 40.0 ± 12.0 years, and 75.5% had paranoid schizophrenia. Among the patients whose main reason for switching was lack of efficacy, an improvement in the PANSS total score of ≥ 20% occurred in 57.4% of patients. Noninferiority was confirmed for each subgroup of patients whose main reason for switching was something other than lack of efficacy. Paliperidone ER was generally well tolerated. Extrapyramidal symptoms as measured by total Extrapyramidal Symptom Rating Scale scores showed statistically significant and clinically relevant improvements at endpoint, the average weight decreased by 0.8 ± 5.2 kg at endpoint, and a clinically relevant weight gain of ≥ 7% occurred in 8.0% of patients. Paliperidone ER flexibly-dosed over 6 months was well tolerated and associated with a meaningful clinical response in patients with nonacute schizophrenia who had previously been unsuccessfully treated with oral olanzapine.

  18. NMR-based phytochemical analysis of Vitis vinifera cv Falanghina leaves. Characterization of a previously undescribed biflavonoid with antiproliferative activity.

    Science.gov (United States)

    Tartaglione, Luciana; Gambuti, Angelita; De Cicco, Paola; Ercolano, Giuseppe; Ianaro, Angela; Taglialatela-Scafati, Orazio; Moio, Luigi; Forino, Martino

    2018-03-01

    Vitis vinifera cv Falanghina is an ancient grape variety of Southern Italy. A thorough phytochemical analysis of the Falanghina leaves was conducted to investigate its specialised metabolite content. Along with already known molecules, such as caftaric acid, quercetin-3-O-β-d-glucopyranoside, quercetin-3-O-β-d-glucuronide, kaempferol-3-O-β-d-glucopyranoside and kaempferol-3-O-β-d-glucuronide, a previously undescribed biflavonoid was identified. For this last compound, a moderate bioactivity against metastatic melanoma cells proliferation was discovered. This datum can be of some interest to researchers studying human melanoma. The high content in antioxidant glycosylated flavonoids supports the exploitation of grape vine leaves as an inexpensive source of natural products for the food industry and for both pharmaceutical and nutraceutical companies. Additionally, this study offers important insights into the plant physiology, thus prompting possible technological researches of genetic selection based on the vine adaptation to specific pedo-climatic environments. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Eight previously unidentified mutations found in the OA1 ocular albinism gene

    Directory of Open Access Journals (Sweden)

    Dufier Jean-Louis

    2006-04-01

    Full Text Available Abstract Background Ocular albinism type 1 (OA1 is an X-linked ocular disorder characterized by a severe reduction in visual acuity, nystagmus, hypopigmentation of the retinal pigmented epithelium, foveal hypoplasia, macromelanosomes in pigmented skin and eye cells, and misrouting of the optical tracts. This disease is primarily caused by mutations in the OA1 gene. Methods The ophthalmologic phenotype of the patients and their family members was characterized. We screened for mutations in the OA1 gene by direct sequencing of the nine PCR-amplified exons, and for genomic deletions by PCR-amplification of large DNA fragments. Results We sequenced the nine exons of the OA1 gene in 72 individuals and found ten different mutations in seven unrelated families and three sporadic cases. The ten mutations include an amino acid substitution and a premature stop codon previously reported by our team, and eight previously unidentified mutations: three amino acid substitutions, a duplication, a deletion, an insertion and two splice-site mutations. The use of a novel Taq polymerase enabled us to amplify large genomic fragments covering the OA1 gene. and to detect very likely six distinct large deletions. Furthermore, we were able to confirm that there was no deletion in twenty one patients where no mutation had been found. Conclusion The identified mutations affect highly conserved amino acids, cause frameshifts or alternative splicing, thus affecting folding of the OA1 G protein coupled receptor, interactions of OA1 with its G protein and/or binding with its ligand.

  20. Meta-analysis of genome-wide association data and large-scale replication identifies additional susceptibility loci for type 2 diabetes

    DEFF Research Database (Denmark)

    Zeggini, Eleftheria; Scott, Laura J; Saxena, Richa

    2008-01-01

    analyses had limited power to identify variants with modest effects, we carried out meta-analysis of three T2D GWA scans comprising 10,128 individuals of European descent and approximately 2.2 million SNPs (directly genotyped and imputed), followed by replication testing in an independent sample......Genome-wide association (GWA) studies have identified multiple loci at which common variants modestly but reproducibly influence risk of type 2 diabetes (T2D). Established associations to common and rare variants explain only a small proportion of the heritability of T2D. As previously published...

  1. The relationship of previous training and experience of journal peer reviewers to subsequent review quality.

    Directory of Open Access Journals (Sweden)

    Michael L Callaham

    2007-01-01

    Full Text Available BACKGROUND: Peer review is considered crucial to the selection and publication of quality science, but very little is known about the previous experiences and training that might identify high-quality peer reviewers. The reviewer selection processes of most journals, and thus the qualifications of their reviewers, are ill defined. More objective selection of peer reviewers might improve the journal peer review process and thus the quality of published science. METHODS AND FINDINGS: 306 experienced reviewers (71% of all those associated with a specialty journal completed a survey of past training and experiences postulated to improve peer review skills. Reviewers performed 2,856 reviews of 1,484 separate manuscripts during a four-year study period, all prospectively rated on a standardized quality scale by editors. Multivariable analysis revealed that most variables, including academic rank, formal training in critical appraisal or statistics, or status as principal investigator of a grant, failed to predict performance of higher-quality reviews. The only significant predictors of quality were working in a university-operated hospital versus other teaching environment and relative youth (under ten years of experience after finishing training. Being on an editorial board and doing formal grant (study section review were each predictors for only one of our two comparisons. However, the predictive power of all variables was weak. CONCLUSIONS: Our study confirms that there are no easily identifiable types of formal training or experience that predict reviewer performance. Skill in scientific peer review may be as ill defined and hard to impart as is "common sense." Without a better understanding of those skills, it seems unlikely journals and editors will be successful in systematically improving their selection of reviewers. This inability to predict performance makes it imperative that all but the smallest journals implement routine review ratings

  2. Predicting intraindividual changes in learning strategies: The effects of previous achievement

    OpenAIRE

    Buško, Vesna; Mujagić, Amela

    2013-01-01

    Socio-cognitive models of self-regulated learning (e.g., Pintrich, 2000) emphasize contextualized nature oflearning process, and within-person variation in learning processes, along with between-person variability in selfregulation.Previous studies about contextual nature of learning strategies have mostly focused on the effects ofdifferent contextual factors on interindividual differences in learning strategies utilization. However, less attentionwas given to the question about contextual ef...

  3. Left ventricular asynergy score as an indicator of previous myocardial infarction

    International Nuclear Information System (INIS)

    Backman, C.; Jacobsson, K.A.; Linderholm, H.; Osterman, G.

    1986-01-01

    Sixty-eight patients with coronary heart disease (CHD) i.e. a hisotry of angina of effort and/or previous 'possible infarction' were examined inter alia with ECG and cinecardioangiography. A system of scoring was designed which allowed a semiquantitative estimate of the left ventricular asynergy from cinecardioangiography - the left ventricular motion score (LVMS). The LVMS was associated with the presence of a previous myocardial infarction (MI), as indicated by the history and ECG findings. The ECG changes specific for a previous MI were associated with high LVMS values and unspecific or absent ECG changes with low LVMS values. Decision thresholds for ECG changes and asynergy in diagnosing a previous MI were evaluated by means of a ROC analysis. The accuracy of ECG in detecting a previous MI was slightly higher when asynergy indicated a 'true MI' than when autopsy result did so in a comparable group. Therefore the accuracy of asynergy (LVMS ≥ 1) in detecting a previous MI or myocardial fibrosis in patients with CHD should be at least comparable with that of autopsy (scar > 1 cm). (orig.)

  4. Meta-analysis of 74,046 individuals identifies 11 new susceptibility loci for Alzheimer’s disease

    Science.gov (United States)

    Lambert, Jean-Charles; Ibrahim-Verbaas, Carla A; Harold, Denise; Naj, Adam C; Sims, Rebecca; Bellenguez, Céline; Jun, Gyungah; DeStefano, Anita L; Bis, Joshua C; Beecham, Gary W; Grenier-Boley, Benjamin; Russo, Giancarlo; Thornton-Wells, Tricia A; Jones, Nicola; Smith, Albert V; Chouraki, Vincent; Thomas, Charlene; Ikram, M Arfan; Zelenika, Diana; Vardarajan, Badri N; Kamatani, Yoichiro; Lin, Chiao-Feng; Gerrish, Amy; Schmidt, Helena; Kunkle, Brian; Dunstan, Melanie L; Ruiz, Agustin; Bihoreau, Marie-Thérèse; Choi, Seung-Hoan; Reitz, Christiane; Pasquier, Florence; Hollingworth, Paul; Ramirez, Alfredo; Hanon, Olivier; Fitzpatrick, Annette L; Buxbaum, Joseph D; Campion, Dominique; Crane, Paul K; Baldwin, Clinton; Becker, Tim; Gudnason, Vilmundur; Cruchaga, Carlos; Craig, David; Amin, Najaf; Berr, Claudine; Lopez, Oscar L; De Jager, Philip L; Deramecourt, Vincent; Johnston, Janet A; Evans, Denis; Lovestone, Simon; Letenneur, Luc; Morón, Francisco J; Rubinsztein, David C; Eiriksdottir, Gudny; Sleegers, Kristel; Goate, Alison M; Fiévet, Nathalie; Huentelman, Matthew J; Gill, Michael; Brown, Kristelle; Kamboh, M Ilyas; Keller, Lina; Barberger-Gateau, Pascale; McGuinness, Bernadette; Larson, Eric B; Green, Robert; Myers, Amanda J; Dufouil, Carole; Todd, Stephen; Wallon, David; Love, Seth; Rogaeva, Ekaterina; Gallacher, John; St George-Hyslop, Peter; Clarimon, Jordi; Lleo, Alberto; Bayer, Anthony; Tsuang, Debby W; Yu, Lei; Tsolaki, Magda; Bossù, Paola; Spalletta, Gianfranco; Proitsi, Petroula; Collinge, John; Sorbi, Sandro; Sanchez-Garcia, Florentino; Fox, Nick C; Hardy, John; Deniz Naranjo, Maria Candida; Bosco, Paolo; Clarke, Robert; Brayne, Carol; Galimberti, Daniela; Mancuso, Michelangelo; Matthews, Fiona; Moebus, Susanne; Mecocci, Patrizia; Zompo, Maria Del; Maier, Wolfgang; Hampel, Harald; Pilotto, Alberto; Bullido, Maria; Panza, Francesco; Caffarra, Paolo; Nacmias, Benedetta; Gilbert, John R; Mayhaus, Manuel; Lannfelt, Lars; Hakonarson, Hakon; Pichler, Sabrina; Carrasquillo, Minerva M; Ingelsson, Martin; Beekly, Duane; Alvarez, Victoria; Zou, Fanggeng; Valladares, Otto; Younkin, Steven G; Coto, Eliecer; Hamilton-Nelson, Kara L; Gu, Wei; Razquin, Cristina; Pastor, Pau; Mateo, Ignacio; Owen, Michael J; Faber, Kelley M; Jonsson, Palmi V; Combarros, Onofre; O’Donovan, Michael C; Cantwell, Laura B; Soininen, Hilkka; Blacker, Deborah; Mead, Simon; Mosley, Thomas H; Bennett, David A; Harris, Tamara B; Fratiglioni, Laura; Holmes, Clive; de Bruijn, Renee F A G; Passmore, Peter; Montine, Thomas J; Bettens, Karolien; Rotter, Jerome I; Brice, Alexis; Morgan, Kevin; Foroud, Tatiana M; Kukull, Walter A; Hannequin, Didier; Powell, John F; Nalls, Michael A; Ritchie, Karen; Lunetta, Kathryn L; Kauwe, John S K; Boerwinkle, Eric; Riemenschneider, Matthias; Boada, Mercè; Hiltunen, Mikko; Martin, Eden R; Schmidt, Reinhold; Rujescu, Dan; Wang, Li-san; Dartigues, Jean-François; Mayeux, Richard; Tzourio, Christophe; Hofman, Albert; Nöthen, Markus M; Graff, Caroline; Psaty, Bruce M; Jones, Lesley; Haines, Jonathan L; Holmans, Peter A; Lathrop, Mark; Pericak-Vance, Margaret A; Launer, Lenore J; Farrer, Lindsay A; van Duijn, Cornelia M; Van Broeckhoven, Christine; Moskvina, Valentina; Seshadri, Sudha; Williams, Julie; Schellenberg, Gerard D; Amouyel, Philippe

    2013-01-01

    Eleven susceptibility loci for late-onset Alzheimer’s disease (LOAD) were identified by previous studies; however, a large portion of the genetic risk for this disease remains unexplained. We conducted a large, two-stage meta-analysis of genome-wide association studies (GWAS) in individuals of European ancestry. In stage 1, we used genotyped and imputed data (7,055,881 SNPs) to perform meta-analysis on 4 previously published GWAS data sets consisting of 17,008 Alzheimer’s disease cases and 37,154 controls. In stage 2,11,632 SNPs were genotyped and tested for association in an independent set of 8,572 Alzheimer’s disease cases and 11,312 controls. In addition to the APOE locus (encoding apolipoprotein E), 19 loci reached genome-wide significance (P < 5 × 10−8) in the combined stage 1 and stage 2 analysis, of which 11 are newly associated with Alzheimer’s disease. PMID:24162737

  5. A novel data mining method to identify assay-specific signatures in functional genomic studies

    Directory of Open Access Journals (Sweden)

    Guidarelli Jack W

    2006-08-01

    Full Text Available Abstract Background: The highly dimensional data produced by functional genomic (FG studies makes it difficult to visualize relationships between gene products and experimental conditions (i.e., assays. Although dimensionality reduction methods such as principal component analysis (PCA have been very useful, their application to identify assay-specific signatures has been limited by the lack of appropriate methodologies. This article proposes a new and powerful PCA-based method for the identification of assay-specific gene signatures in FG studies. Results: The proposed method (PM is unique for several reasons. First, it is the only one, to our knowledge, that uses gene contribution, a product of the loading and expression level, to obtain assay signatures. The PM develops and exploits two types of assay-specific contribution plots, which are new to the application of PCA in the FG area. The first type plots the assay-specific gene contribution against the given order of the genes and reveals variations in distribution between assay-specific gene signatures as well as outliers within assay groups indicating the degree of importance of the most dominant genes. The second type plots the contribution of each gene in ascending or descending order against a constantly increasing index. This type of plots reveals assay-specific gene signatures defined by the inflection points in the curve. In addition, sharp regions within the signature define the genes that contribute the most to the signature. We proposed and used the curvature as an appropriate metric to characterize these sharp regions, thus identifying the subset of genes contributing the most to the signature. Finally, the PM uses the full dataset to determine the final gene signature, thus eliminating the chance of gene exclusion by poor screening in earlier steps. The strengths of the PM are demonstrated using a simulation study, and two studies of real DNA microarray data – a study of

  6. Perceived benefits and barriers to leisure-time physical activity during pregnancy in previously inactive and active women.

    Science.gov (United States)

    Da Costa, Deborah; Ireland, Kierla

    2013-01-01

    This study compared perceived benefits and barriers to leisure-time physical activity during pregnancy among women who were insufficiently active or inactive before pregnancy. Eighty-two pregnant women completed questionnaires assessing leisure-time physical activity benefits/barriers, exercise self-efficacy, social support, depressed mood, pre-pregnancy and current physical activity and fatigue. Multivariable regression analyses identified factors associated with exercise benefits/barriers for the two pre-pregnancy leisure-time physical activity groups. Both pre-pregnancy leisure-time physical activity groups reported more benefits than barriers to exercise during pregnancy. Previously inactive women reported fewer perceived benefits and greater perceived barriers to leisure-time physical activity during pregnancy. Higher self-efficacy for exercise during pregnancy was significantly associated with greater benefits of leisure-time physical activity during pregnancy for both groups. Less family support for exercise and lower self-efficacy for exercise were significantly related to greater leisure-time physical activity barriers during pregnancy for previously inactive women. Lower self-efficacy for exercise, higher depressed mood scores, and younger age were associated with greater leisure-time physical activity barriers for active women. Findings suggest that the intensities of perceived leisure-time physical activity benefits and barriers during pregnancy differ for women, depending on their pre-pregnancy leisure-time physical activity status. Consideration of pre-pregnancy leisure-time physical activity status may thus be important when tailoring strategies to overcome barriers to promote initiation and maintenance of physical activity during pregnancy.

  7. Reasoning with Previous Decisions: Beyond the Doctrine of Precedent

    DEFF Research Database (Denmark)

    Komárek, Jan

    2013-01-01

    in different jurisdictions use previous judicial decisions in their argument, we need to move beyond the concept of precedent to a wider notion, which would embrace practices and theories in legal systems outside the Common law tradition. This article presents the concept of ‘reasoning with previous decisions...... law method’, but they are no less rational and intellectually sophisticated. The reason for the rather conceited attitude of some comparatists is in the dominance of the common law paradigm of precedent and the accompanying ‘case law method’. If we want to understand how courts and lawyers......’ as such an alternative and develops its basic models. The article first points out several shortcomings inherent in limiting the inquiry into reasoning with previous decisions by the common law paradigm (1). On the basis of numerous examples provided in section (1), I will present two basic models of reasoning...

  8. Eysenbach, Tuische and Diepgen’s Evaluation of Web Searching for Identifying Unpublished Studies for Systematic Reviews: An Innovative Study Which is Still Relevant Today.

    Directory of Open Access Journals (Sweden)

    Simon Briscoe

    2016-09-01

    Full Text Available A Review of: Eysenbach, G., Tuische, J. & Diepgen, T.L. (2001. Evaluation of the usefulness of Internet searches to identify unpublished clinical trials for systematic reviews. Medical Informatics and the Internet in Medicine, 26(3, 203-218. http://dx.doi.org/10.1080/14639230110075459 Objective – To consider whether web searching is a useful method for identifying unpublished studies for inclusion in systematic reviews. Design – Retrospective web searches using the AltaVista search engine were conducted to identify unpublished studies – specifically, clinical trials – for systematic reviews which did not use a web search engine. Setting – The Department of Clinical Social Medicine, University of Heidelberg, Germany. Subjects – n/a Methods – Pilot testing of 11 web search engines was carried out to determine which could handle complex search queries. Pre-specified search requirements included the ability to handle Boolean and proximity operators, and truncation searching. A total of seven Cochrane systematic reviews were randomly selected from the Cochrane Library Issue 2, 1998, and their bibliographic database search strategies were adapted for the web search engine, AltaVista. Each adaptation combined search terms for the intervention, problem, and study type in the systematic review. Hints to planned, ongoing, or unpublished studies retrieved by the search engine, which were not cited in the systematic reviews, were followed up by visiting websites and contacting authors for further details when required. The authors of the systematic reviews were then contacted and asked to comment on the potential relevance of the identified studies. Main Results – Hints to 14 unpublished and potentially relevant studies, corresponding to 4 of the 7 randomly selected Cochrane systematic reviews, were identified. Out of the 14 studies, 2 were considered irrelevant to the corresponding systematic review by the systematic review authors. The

  9. Genomic analysis identifies masqueraders of full-term cerebral palsy.

    Science.gov (United States)

    Takezawa, Yusuke; Kikuchi, Atsuo; Haginoya, Kazuhiro; Niihori, Tetsuya; Numata-Uematsu, Yurika; Inui, Takehiko; Yamamura-Suzuki, Saeko; Miyabayashi, Takuya; Anzai, Mai; Suzuki-Muromoto, Sato; Okubo, Yukimune; Endo, Wakaba; Togashi, Noriko; Kobayashi, Yasuko; Onuma, Akira; Funayama, Ryo; Shirota, Matsuyuki; Nakayama, Keiko; Aoki, Yoko; Kure, Shigeo

    2018-05-01

    Cerebral palsy is a common, heterogeneous neurodevelopmental disorder that causes movement and postural disabilities. Recent studies have suggested genetic diseases can be misdiagnosed as cerebral palsy. We hypothesized that two simple criteria, that is, full-term births and nonspecific brain MRI findings, are keys to extracting masqueraders among cerebral palsy cases due to the following: (1) preterm infants are susceptible to multiple environmental factors and therefore demonstrate an increased risk of cerebral palsy and (2) brain MRI assessment is essential for excluding environmental causes and other particular disorders. A total of 107 patients-all full-term births-without specific findings on brain MRI were identified among 897 patients diagnosed with cerebral palsy who were followed at our center. DNA samples were available for 17 of the 107 cases for trio whole-exome sequencing and array comparative genomic hybridization. We prioritized variants in genes known to be relevant in neurodevelopmental diseases and evaluated their pathogenicity according to the American College of Medical Genetics guidelines. Pathogenic/likely pathogenic candidate variants were identified in 9 of 17 cases (52.9%) within eight genes: CTNNB1 , CYP2U1 , SPAST , GNAO1 , CACNA1A , AMPD2 , STXBP1 , and SCN2A . Five identified variants had previously been reported. No pathogenic copy number variations were identified. The AMPD2 missense variant and the splice-site variants in CTNNB1 and AMPD2 were validated by in vitro functional experiments. The high rate of detecting causative genetic variants (52.9%) suggests that patients diagnosed with cerebral palsy in full-term births without specific MRI findings may include genetic diseases masquerading as cerebral palsy.

  10. Intelligence, previous convictions and interrogative suggestibility: a path analysis of alleged false-confession cases.

    Science.gov (United States)

    Sharrock, R; Gudjonsson, G H

    1993-05-01

    The main purpose of this study was to investigate the relationship between interrogative suggestibility and previous convictions among 108 defendants in criminal trials, using a path analysis technique. It was hypothesized that previous convictions, which may provide defendants with interrogative experiences, would correlate negatively with 'shift' as measured by the Gudjonsson Suggestibility Scale (Gudjonsson, 1984a), after intelligence and memory had been controlled for. The hypothesis was partially confirmed and the theoretical and practical implications of the findings are discussed.

  11. Distinct Molecular Signature of Murine Fetal Liver and Adult Hematopoietic Stem Cells Identify Novel Regulators of Hematopoietic Stem Cell Function.

    Science.gov (United States)

    Manesia, Javed K; Franch, Monica; Tabas-Madrid, Daniel; Nogales-Cadenas, Ruben; Vanwelden, Thomas; Van Den Bosch, Elisa; Xu, Zhuofei; Pascual-Montano, Alberto; Khurana, Satish; Verfaillie, Catherine M

    2017-04-15

    During ontogeny, fetal liver (FL) acts as a major site for hematopoietic stem cell (HSC) maturation and expansion, whereas HSCs in the adult bone marrow (ABM) are largely quiescent. HSCs in the FL possess faster repopulation capacity as compared with ABM HSCs. However, the molecular mechanism regulating the greater self-renewal potential of FL HSCs has not yet extensively been assessed. Recently, we published RNA sequencing-based gene expression analysis on FL HSCs from 14.5-day mouse embryo (E14.5) in comparison to the ABM HSCs. We reanalyzed these data to identify key transcriptional regulators that play important roles in the expansion of HSCs during development. The comparison of FL E14.5 with ABM HSCs identified more than 1,400 differentially expressed genes. More than 200 genes were shortlisted based on the gene ontology (GO) annotation term "transcription." By morpholino-based knockdown studies in zebrafish, we assessed the function of 18 of these regulators, previously not associated with HSC proliferation. Our studies identified a previously unknown role for tdg, uhrf1, uchl5, and ncoa1 in the emergence of definitive hematopoiesis in zebrafish. In conclusion, we demonstrate that identification of genes involved in transcriptional regulation differentially expressed between expanding FL HSCs and quiescent ABM HSCs, uncovers novel regulators of HSC function.

  12. GTI: a novel algorithm for identifying outlier gene expression profiles from integrated microarray datasets.

    Directory of Open Access Journals (Sweden)

    John Patrick Mpindi

    Full Text Available BACKGROUND: Meta-analysis of gene expression microarray datasets presents significant challenges for statistical analysis. We developed and validated a new bioinformatic method for the identification of genes upregulated in subsets of samples of a given tumour type ('outlier genes', a hallmark of potential oncogenes. METHODOLOGY: A new statistical method (the gene tissue index, GTI was developed by modifying and adapting algorithms originally developed for statistical problems in economics. We compared the potential of the GTI to detect outlier genes in meta-datasets with four previously defined statistical methods, COPA, the OS statistic, the t-test and ORT, using simulated data. We demonstrated that the GTI performed equally well to existing methods in a single study simulation. Next, we evaluated the performance of the GTI in the analysis of combined Affymetrix gene expression data from several published studies covering 392 normal samples of tissue from the central nervous system, 74 astrocytomas, and 353 glioblastomas. According to the results, the GTI was better able than most of the previous methods to identify known oncogenic outlier genes. In addition, the GTI identified 29 novel outlier genes in glioblastomas, including TYMS and CDKN2A. The over-expression of these genes was validated in vivo by immunohistochemical staining data from clinical glioblastoma samples. Immunohistochemical data were available for 65% (19 of 29 of these genes, and 17 of these 19 genes (90% showed a typical outlier staining pattern. Furthermore, raltitrexed, a specific inhibitor of TYMS used in the therapy of tumour types other than glioblastoma, also effectively blocked cell proliferation in glioblastoma cell lines, thus highlighting this outlier gene candidate as a potential therapeutic target. CONCLUSIONS/SIGNIFICANCE: Taken together, these results support the GTI as a novel approach to identify potential oncogene outliers and drug targets. The algorithm is

  13. Adverse obstetric outcomes in women with previous cesarean for dystocia in second stage of labor.

    Science.gov (United States)

    Jastrow, Nicole; Demers, Suzanne; Gauthier, Robert J; Chaillet, Nils; Brassard, Normand; Bujold, Emmanuel

    2013-03-01

    To evaluate obstetric outcomes in women undergoing a trial of labor (TOL) after a previous cesarean for dystocia in second stage of labor. A retrospective cohort study of women with one previous low transverse cesarean undergoing a first TOL was performed. Women with previous cesarean for dystocia in first stage and those with previous dystocia in second stage were compared with those with previous cesarean for nonrecurrent reasons (controls). Multivariable regressions analyses were performed. Of 1655 women, those with previous dystocia in second stage of labor (n = 204) had greater risks than controls (n = 880) to have an operative delivery [odds ratio (OR): 1.5; 95% confidence intervals (CI) 1.1 to 2.2], shoulder dystocia (OR: 2.9; 95% CI 1.1 to 8.0), and uterine rupture in the second stage of labor (OR: 4.9; 95% CI 1.1 to 23), and especially in case of fetal macrosomia (OR: 29.6; 95% CI 4.4 to 202). The median second stage of labor duration before uterine rupture was 2.5 hours (interquartile range: 1.5 to 3.2 hours) in these women. Previous cesarean for dystocia in the second stage of labor is associated with second-stage uterine rupture at next delivery, especially in cases of suspected fetal macrosomia and prolonged second stage of labor. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  14. Identifying and exploiting trait-relevant tissues with multiple functional annotations in genome-wide association studies

    Science.gov (United States)

    Zhang, Shujun

    2018-01-01

    Genome-wide association studies (GWASs) have identified many disease associated loci, the majority of which have unknown biological functions. Understanding the mechanism underlying trait associations requires identifying trait-relevant tissues and investigating associations in a trait-specific fashion. Here, we extend the widely used linear mixed model to incorporate multiple SNP functional annotations from omics studies with GWAS summary statistics to facilitate the identification of trait-relevant tissues, with which to further construct powerful association tests. Specifically, we rely on a generalized estimating equation based algorithm for parameter inference, a mixture modeling framework for trait-tissue relevance classification, and a weighted sequence kernel association test constructed based on the identified trait-relevant tissues for powerful association analysis. We refer to our analytic procedure as the Scalable Multiple Annotation integration for trait-Relevant Tissue identification and usage (SMART). With extensive simulations, we show how our method can make use of multiple complementary annotations to improve the accuracy for identifying trait-relevant tissues. In addition, our procedure allows us to make use of the inferred trait-relevant tissues, for the first time, to construct more powerful SNP set tests. We apply our method for an in-depth analysis of 43 traits from 28 GWASs using tissue-specific annotations in 105 tissues derived from ENCODE and Roadmap. Our results reveal new trait-tissue relevance, pinpoint important annotations that are informative of trait-tissue relationship, and illustrate how we can use the inferred trait-relevant tissues to construct more powerful association tests in the Wellcome trust case control consortium study. PMID:29377896

  15. Identifying and exploiting trait-relevant tissues with multiple functional annotations in genome-wide association studies.

    Directory of Open Access Journals (Sweden)

    Xingjie Hao

    2018-01-01

    Full Text Available Genome-wide association studies (GWASs have identified many disease associated loci, the majority of which have unknown biological functions. Understanding the mechanism underlying trait associations requires identifying trait-relevant tissues and investigating associations in a trait-specific fashion. Here, we extend the widely used linear mixed model to incorporate multiple SNP functional annotations from omics studies with GWAS summary statistics to facilitate the identification of trait-relevant tissues, with which to further construct powerful association tests. Specifically, we rely on a generalized estimating equation based algorithm for parameter inference, a mixture modeling framework for trait-tissue relevance classification, and a weighted sequence kernel association test constructed based on the identified trait-relevant tissues for powerful association analysis. We refer to our analytic procedure as the Scalable Multiple Annotation integration for trait-Relevant Tissue identification and usage (SMART. With extensive simulations, we show how our method can make use of multiple complementary annotations to improve the accuracy for identifying trait-relevant tissues. In addition, our procedure allows us to make use of the inferred trait-relevant tissues, for the first time, to construct more powerful SNP set tests. We apply our method for an in-depth analysis of 43 traits from 28 GWASs using tissue-specific annotations in 105 tissues derived from ENCODE and Roadmap. Our results reveal new trait-tissue relevance, pinpoint important annotations that are informative of trait-tissue relationship, and illustrate how we can use the inferred trait-relevant tissues to construct more powerful association tests in the Wellcome trust case control consortium study.

  16. Classifying previously undefined days from eleven years of aerosol-particle-size distribution data from the SMEAR II station, Hyytiälä, Finland

    Directory of Open Access Journals (Sweden)

    S. Buenrostro Mazon

    2009-01-01

    Full Text Available Studies of secondary aerosol-particle formation depend on identifying days in which new particle formation occurs and, by comparing them to days with no signs of particle formation, identifying the conditions favourable for formation. Continuous aerosol size distribution data has been collected at the SMEAR II station in a boreal forest in Hyytiälä, Finland, since 1996, making it the longest time series of aerosol size distributions available worldwide. In previous studies, the data have been classified as particle-formation event, nonevent, and undefined days, with almost 40% of the dataset classified as undefined. In the present study, eleven years (1996–2006 of undefined days (1630 days were reanalyzed and subdivided into three new classes: failed events (37% of all previously undefined days, ultrafine-mode concentration peaks (34%, and pollution-related concentration peaks (19%. Unclassified days (10% comprised the rest of the previously undefined days. The failed events were further subdivided into tail events (21%, where a tail of a formation event presumed to be advected to Hyytiälä from elsewhere, and quasi events (16% where new particles appeared at sizes 3–10 nm, but showed unclear growth, the mode persisted for less than an hour, or both. The ultrafine concentration peaks days were further subdivided into nucleation-mode peaks (24% and Aitken-mode peaks (10%, depending on the size range where the particles occurred. The mean annual distribution of the failed events has a maximum during summer, whereas the two peak classes have maxima during winter. The summer minimum previously found in the seasonal distribution of event days partially offsets a summer maximum in failed-event days. Daily-mean relative humidity and condensation sink values are useful in discriminating the new classes from each other. Specifically, event days had low values of relative humidity and condensation sink relative to nonevent days. Failed-event days

  17. A step-by-step guide to systematically identify all relevant animal studies

    Science.gov (United States)

    Leenaars, Marlies; Hooijmans, Carlijn R; van Veggel, Nieky; ter Riet, Gerben; Leeflang, Mariska; Hooft, Lotty; van der Wilt, Gert Jan; Tillema, Alice; Ritskes-Hoitinga, Merel

    2012-01-01

    Before starting a new animal experiment, thorough analysis of previously performed experiments is essential from a scientific as well as from an ethical point of view. The method that is most suitable to carry out such a thorough analysis of the literature is a systematic review (SR). An essential first step in an SR is to search and find all potentially relevant studies. It is important to include all available evidence in an SR to minimize bias and reduce hampered interpretation of experimental outcomes. Despite the recent development of search filters to find animal studies in PubMed and EMBASE, searching for all available animal studies remains a challenge. Available guidelines from the clinical field cannot be copied directly to the situation within animal research, and although there are plenty of books and courses on searching the literature, there is no compact guide available to search and find relevant animal studies. Therefore, in order to facilitate a structured, thorough and transparent search for animal studies (in both preclinical and fundamental science), an easy-to-use, step-by-step guide was prepared and optimized using feedback from scientists in the field of animal experimentation. The step-by-step guide will assist scientists in performing a comprehensive literature search and, consequently, improve the scientific quality of the resulting review and prevent unnecessary animal use in the future. PMID:22037056

  18. Genetic Susceptibility to Vitiligo: GWAS Approaches for Identifying Vitiligo Susceptibility Genes and Loci

    Science.gov (United States)

    Shen, Changbing; Gao, Jing; Sheng, Yujun; Dou, Jinfa; Zhou, Fusheng; Zheng, Xiaodong; Ko, Randy; Tang, Xianfa; Zhu, Caihong; Yin, Xianyong; Sun, Liangdan; Cui, Yong; Zhang, Xuejun

    2016-01-01

    Vitiligo is an autoimmune disease with a strong genetic component, characterized by areas of depigmented skin resulting from loss of epidermal melanocytes. Genetic factors are known to play key roles in vitiligo through discoveries in association studies and family studies. Previously, vitiligo susceptibility genes were mainly revealed through linkage analysis and candidate gene studies. Recently, our understanding of the genetic basis of vitiligo has been rapidly advancing through genome-wide association study (GWAS). More than 40 robust susceptible loci have been identified and confirmed to be associated with vitiligo by using GWAS. Most of these associated genes participate in important pathways involved in the pathogenesis of vitiligo. Many susceptible loci with unknown functions in the pathogenesis of vitiligo have also been identified, indicating that additional molecular mechanisms may contribute to the risk of developing vitiligo. In this review, we summarize the key loci that are of genome-wide significance, which have been shown to influence vitiligo risk. These genetic loci may help build the foundation for genetic diagnosis and personalize treatment for patients with vitiligo in the future. However, substantial additional studies, including gene-targeted and functional studies, are required to confirm the causality of the genetic variants and their biological relevance in the development of vitiligo. PMID:26870082

  19. Revisiting Teaching Archetypes: Identifying Dominant Shaping Influences on Student Teacher's Identities

    Science.gov (United States)

    Sugrue, Ciaran

    2004-01-01

    The primary aim of this article is to identify and interrogate the lay theories of contemporary student teachers and to indicate and illustrate the manner in which these "theories" manifest both continuity and change when contrasted with teaching archetypes and previously articulated lay theories of student teachers in the setting. It is…

  20. Proteomic profiling of Plasmodium sporozoite maturation identifies new proteins essential for parasite development and infectivity

    DEFF Research Database (Denmark)

    Lasonder, Edwin; Janse, Chris J; van Gemert, Geert-Jan

    2008-01-01

    Plasmodium falciparum sporozoites that develop and mature inside an Anopheles mosquito initiate a malaria infection in humans. Here we report the first proteomic comparison of different parasite stages from the mosquito -- early and late oocysts containing midgut sporozoites, and the mature...... whose annotation suggest an involvement in sporozoite maturation, motility, infection of the human host and associated metabolic adjustments. Analyses of proteins identified in the P. falciparum sporozoite proteomes by orthologous gene disruption in the rodent malaria parasite, P. berghei, revealed...... three previously uncharacterized Plasmodium proteins that appear to be essential for sporozoite development at distinct points of maturation in the mosquito. This study sheds light on the development and maturation of the malaria parasite in an Anopheles mosquito and also identifies proteins that may...

  1. Functional brain activation differences in stuttering identified with a rapid fMRI sequence

    Science.gov (United States)

    Kraft, Shelly Jo; Choo, Ai Leen; Sharma, Harish; Ambrose, Nicoline G.

    2011-01-01

    The purpose of this study was to investigate whether brain activity related to the presence of stuttering can be identified with rapid functional MRI (fMRI) sequences that involved overt and covert speech processing tasks. The long-term goal is to develop sensitive fMRI approaches with developmentally appropriate tasks to identify deviant speech motor and auditory brain activity in children who stutter closer to the age at which recovery from stuttering is documented. Rapid sequences may be preferred for individuals or populations who do not tolerate long scanning sessions. In this report, we document the application of a picture naming and phoneme monitoring task in three minute fMRI sequences with adults who stutter (AWS). If relevant brain differences are found in AWS with these approaches that conform to previous reports, then these approaches can be extended to younger populations. Pairwise contrasts of brain BOLD activity between AWS and normally fluent adults indicated the AWS showed higher BOLD activity in the right inferior frontal gyrus (IFG), right temporal lobe and sensorimotor cortices during picture naming and and higher activity in the right IFG during phoneme monitoring. The right lateralized pattern of BOLD activity together with higher activity in sensorimotor cortices is consistent with previous reports, which indicates rapid fMRI sequences can be considered for investigating stuttering in younger participants. PMID:22133409

  2. Application of multi-locus analytical methods to identify interacting loci in case-control studies.

    NARCIS (Netherlands)

    Vermeulen, S.; Heijer, M. den; Sham, P.; Knight, J.

    2007-01-01

    To identify interacting loci in genetic epidemiological studies the application of multi-locus methods of analysis is warranted. Several more advanced classification methods have been developed in the past years, including multiple logistic regression, sum statistics, logic regression, and the

  3. Impacts of previous crops on Fusarium foot and root rot, and on yields of durum wheat in North West Tunisia

    Directory of Open Access Journals (Sweden)

    Samia CHEKALI

    2016-07-01

    Full Text Available The impacts of ten previous crop rotations (cereals, legumes and fallow on Fusarium foot and root rot of durum wheat were investigated for three cropping seasons in a trial established in 2004 in Northwest Tunisia. Fungi isolated from the roots and stem bases were identified using morphological and molecular methods, and were primarily Fusarium culmorum and F. pseudograminearum. Under low rainfall conditions, the previous crop affected F. pseudograminearum incidence on durum wheat roots but not F. culmorum. Compared to continuous cropping of durum wheat, barley as a previous crop increased disease incidence more than fivefold, while legumes and fallow tended to reduce incidence.  Barley as a previous crop increased wheat disease severity by 47%, compared to other rotations. Grain yield was negatively correlated with the incidence of F. culmorum infection, both in roots and stem bases, and fitted an exponential model (R2 = -0.61 for roots and -0.77 for stem bases, P<0.0001. Fusarium pseudograminearum was also negatively correlated with yield and fitted an exponential model (R2 = -0.53 on roots and -0.71 on stem bases, P < 0.0001 but was not correlated with severity.

  4. Influenza-associated Encephalitis/Encephalopathy Identified by the Australian Childhood Encephalitis Study 2013-2015.

    Science.gov (United States)

    Britton, Philip N; Dale, Russell C; Blyth, Christopher C; Macartney, Kristine; Crawford, Nigel W; Marshall, Helen; Clark, Julia E; Elliott, Elizabeth J; Webster, Richard I; Cheng, Allen C; Booy, Robert; Jones, Cheryl A

    2017-11-01

    Influenza-associated encephalitis/encephalopathy (IAE) is an important cause of acute encephalitis syndrome in children. IAE includes a series of clinicoradiologic syndromes or acute encephalopathy syndromes that have been infrequently reported outside East Asia. We aimed to describe cases of IAE identified by the Australian Childhood Encephalitis study. Children ≤ 14 years of age with suspected encephalitis were prospectively identified in 5 hospitals in Australia. Demographic, clinical, laboratory, imaging, and outcome at discharge data were reviewed by an expert panel and cases were categorized by using predetermined case definitions. We extracted cases associated with laboratory identification of influenza virus for this analysis; among these cases, specific IAE syndromes were identified where clinical and radiologic features were consistent with descriptions in the published literature. We identified 13 cases of IAE during 3 southern hemisphere influenza seasons at 5 tertiary children's hospitals in Australia; 8 children with specific acute encephalopathy syndromes including: acute necrotizing encephalopathy, acute encephalopathy with biphasic seizures and late diffusion restriction, mild encephalopathy with reversible splenial lesion, and hemiconvulsion-hemiplegia syndrome. Use of influenza-specific antiviral therapy and prior influenza vaccination were infrequent. In contrast, death or significant neurologic morbidity occurred in 7 of the 13 children (54%). The conditions comprising IAE are heterogeneous with varied clinical features, magnetic resonance imaging changes, and outcomes. Overall, outcome of IAE is poor emphasizing the need for optimized prevention, early recognition, and empiric management.

  5. Identifying the most successful dose (MSD) in dose-finding studies in cancer.

    Science.gov (United States)

    Zohar, Sarah; O'Quigley, John

    2006-01-01

    For a dose finding study in cancer, the most successful dose (MSD), among a group of available doses, is that dose at which the overall success rate is the highest. This rate is the product of the rate of seeing non-toxicities together with the rate of tumor response. A successful dose finding trial in this context is one where we manage to identify the MSD in an efficient manner. In practice we may also need to consider algorithms for identifying the MSD which can incorporate certain restrictions, the most common restriction maintaining the estimated toxicity rate alone below some maximum rate. In this case the MSD may correspond to a different level than that for the unconstrained MSD and, in providing a final recommendation, it is important to underline that it is subject to the given constraint. We work with the approach described in O'Quigley et al. [Biometrics 2001; 57(4):1018-1029]. The focus of that work was dose finding in HIV where both information on toxicity and efficacy were almost immediately available. Recent cancer studies are beginning to fall under this same heading where, as before, toxicity can be quickly evaluated and, in addition, we can rely on biological markers or other measures of tumor response. Mindful of the particular context of cancer, our purpose here is to consider the methodology developed by O'Quigley et al. and its practical implementation. We also carry out a study on the doubly under-parameterized model, developed by O'Quigley et al. but not

  6. Incidence of Acneform Lesions in Previously Chemically Damaged Persons-2004

    Directory of Open Access Journals (Sweden)

    N Dabiri

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Chemical gas weapons especially nitrogen mustard which was used in Iraq-Iran war against Iranian troops have several harmful effects on skin. Some other chemical agents also can cause acne form lesions on skin. The purpose of this study was to compare the incidence of acneform in previously chemically damaged soldiers and non chemically damaged persons. Materials & Methods: In this descriptive and analytical study, 180 chemically damaged soldiers, who have been referred to dermatology clinic between 2000 – 2004, and forty non-chemically damaged people, were chosen randomly and examined for acneform lesions. SPSS software was used for statistic analysis of the data. Results: The mean age of the experimental group was 37.5 ± 5.2 and that of the control group was 38.7 ± 5.9 years. The mean percentage of chemical damage in cases was 31 percent and the time after the chemical damage was 15.2 ± 1.1 years. Ninety seven cases (53.9 percent of the subjects and 19 people (47.5 percent of the control group had some degree of acne. No significant correlation was found in incidence, degree of lesions, site of lesions and age of subjects between two groups. No significant correlation was noted between percentage of chemical damage and incidence and degree of lesions in case group. Conclusion: Incidence of acneform lesions among previously chemically injured peoples was not higher than the normal cases.

  7. Effect of exercise versus cognitive behavioural therapy or no intervention on anxiety, depression, fitness and quality of life in adults with previous methamphetamine dependency: a systematic review.

    Science.gov (United States)

    Morris, Linzette; Stander, Jessica; Ebrahim, Wardah; Eksteen, Stephanie; Meaden, Orissa Anna; Ras, Ané; Wessels, Annemarie

    2018-01-16

    Methamphetamine (MA) is a highly addictive psychostimulant used by approximately 52 million people worldwide. Chronic MA abuse leads to detrimental physiological and neurological changes, as well as increases in anxiety and depression, and decreases in overall fitness and quality of life. Exercise has been reported to possibly reverse physiological and neurological damage caused by previous MA use, and to reduce anxiety and depression in this population. The aim of this systematic review was to identify, clinically appraise and synthesise the available evidence for the effectiveness of exercise, compared to cognitive behavioural therapy (CBT), standard care or no intervention, on decreasing anxiety and depression and improving fitness and quality of life in previous MA users. Seven computerised databases were searched from inception to May 2017, namely Scopus, Cochrane Library, PubMed/MEDLINE, PEDro, CINAHL, and ScienceDirect. Search terms included exercise, methamphetamine, fitness measures, depression, anxiety and quality of life. Randomised and non-randomised controlled- or clinical trials and pilot studies, published in English, were considered for inclusion. Methodological quality was critically appraised according to the PEDro scale. Heterogeneity across studies regarding control groups and assessment intervals rendered meta analyses inappropriate for this review and results were thus described narratively using text and tables. Two hundred and fifty-one titles were identified following the initial search, and 14 potentially-relevant titles were selected and the abstracts reviewed. Three studies (two randomised controlled trials and one quasi-experimental pilot) were included, with an average PEDro score of 6.66. Exercise resulted in significantly lower depression and anxiety scores versus CBT (p = 0.001). Balance also significantly improved following exercise versus standard care (p exercise is effective in reducing anxiety and depression and

  8. Can subsyndromal manifestations of major depression be identified in children at risk?

    Science.gov (United States)

    Uchida, M; Fitzgerald, M; Lin, K; Carrellas, N; Woodworth, H; Biederman, J

    2017-02-01

    Children of parents with major depression are at significantly increased risk for developing major depression themselves; however, not all children at genetic risk will develop major depressive disorder (MDD). We investigated the utility of subsyndromal scores on the Child Behavior Checklist (CBCL) Anxiety/Depression scale in identifying children at the highest risk for pediatric MDD from among the pool of children of parents with MDD or bipolar disorder. The sample was derived from two previously conducted longitudinal case-control family studies of psychiatrically and pediatrically referred youth and their families. For this study, probands were stratified based on the presence or absence of a parental mood disorder. Subsyndromal scores on the CBCL Anxiety/Depression scale significantly separated the children at high risk for pediatric MDD from those at low risk in a variety of functional areas, including social and academic functioning. Additionally, children at genetic risk without elevated CBCL Anxiety/Depression scale scores were largely indistinguishable from controls. These results suggest that the CBCL Anxiety/Depression scale can help identify children at highest risk for pediatric MDD. If implemented clinically, this scale would cost-effectively screen children and identify those most in need of early intervention resources to impede the progression of depression. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Executive Functioning and Visuospatial Abilities in Bulimia Nervosa with or without a Previous History of Anorexia Nervosa.

    Science.gov (United States)

    Degortes, Daniela; Tenconi, Elena; Santonastaso, Paolo; Favaro, Angela

    2016-03-01

    The aim of the present study was to investigate executive functioning and visuospatial abilities in patients with bulimia nervosa (BN), with a particular interest in exploring the impact of a previous diagnosis of anorexia nervosa (AN). Several neuropsychological tasks were administered to 89 BN patients (52 with a previous history of AN and 37 without previous AN) and 160 healthy women. A poorer performance on set-shifting measures (Wisconsin Card Sorting Test) was found only in BN patients with a previous history of AN. Decision-making abilities (Iowa Gambling Task) were significantly impaired in the whole sample of BN patients, but difficulties were more pronounced in the subgroup with previous AN. Finally, we did not find any differences in response inhibition and visuospatial abilities between the two samples of BN patients and healthy women. Our findings support the idea that cognitive abilities in patients with BN are more impaired in the presence of a prior history of AN. The clinical and treatment implications of our findings should be explored in future studies. Copyright © 2015 John Wiley & Sons, Ltd and Eating Disorders Association.

  10. Stress thallium-201 myocardial scintigraphy for the detection of individual coronary arterial lesions in patients with and without previous myocardial infarction

    International Nuclear Information System (INIS)

    Rigo, P.; Bailey, I.K.; Griffith, L.S.; Pitt, B.; Wagner, H.N. Jr.; Becker, L.C.

    1981-01-01

    The value of stress thallium-201 scintigraphy for detecting individual coronary arterial stenoses was analyzed in 141 patients with angiographically proved coronary artery disease, 101 with and 40 without a previous myocardial infarction. In patients without infarction, the sensitivity for detecting greater than 50 percent narrowing in the left anterior descending, the right and the left circumflex coronary artery was 66, 53 and 24 percent, respectively. In those with a previous infarction, the sensitivity for demonstrating disease in the artery corresponding to the site of infarction was 100 percent for the left anterior descending, 79 percent for the right and 63 percent for the left circumflex coronary artery. In patients with a prior anterior infarction, concomitant right or left circumflex coronary arterial lesions were detected in only 1 of 12 cases, whereas in those with previous inferior or inferolateral infarction, the sensitivity for left anterior descending coronary artery disease was 69 percent. Because of the reasonably high sensitivity for detecting left anterior descending arterial disease, irrespective of the presence and location of previous infarction, myocardial scintigraphy was useful in identifying multivessel disease in patients with a previous inferior infarction. However, because of its relative insensitivity for right or left circumflex coronary artery disease, scintigraphy proved to be a poor predictor of multivessel disease in patients with a prior anterior infarction and in patients without previous myocardial infarction

  11. Anaerobic carboxydotrophic bacteria in geothermal springs identified using stable isotope probing

    Directory of Open Access Journals (Sweden)

    Allyson Lee Brady

    2015-09-01

    Full Text Available Carbon monoxide (CO is a potential energy and carbon source for thermophilic bacteria in geothermal environments. Geothermal sites ranging in temperature from 45–65°C were investigated for the presence and activity of anaerobic CO-oxidizing bacteria. Anaerobic CO oxidation potentials were measured at up to 48.9 µmoles CO day-1 g (wet weight-1 within 5 selected sites. Active anaerobic carboxydotrophic bacteria were identified using 13CO DNA stable isotope probing (SIP combined with pyrosequencing of 16S rRNA genes amplified from labeled DNA. Bacterial communities identified in heavy DNA fractions were predominated by Firmicutes, which comprised up to 95% of all sequences in 13CO incubations. The predominant bacteria that assimilated 13C derived from CO were closely related (>98% to genera of known carboxydotrophs including Thermincola, Desulfotomaculum, Thermolithobacter and Carboxydocella, although a few species with lower similarity to known bacteria were also found that may represent previously unconfirmed CO-oxidizers. While the distribution was variable, many of the same OTUs were identified across sample sites from different temperature regimes. These results show that bacteria capable of using CO as a carbon source are common in geothermal springs, and that thermophilic carboxydotrophs are probably already quite well known from cultivation studies.

  12. Identifying multidrug resistant tuberculosis transmission hotspots using routinely collected data12

    Science.gov (United States)

    Manjourides, Justin; Lin, Hsien-Ho; Shin, Sonya; Jeffery, Caroline; Contreras, Carmen; Cruz, Janeth Santa; Jave, Oswaldo; Yagui, Martin; Asencios, Luis; Pagano, Marcello; Cohen, Ted

    2012-01-01

    SUMMARY In most countries with large drug resistant tuberculosis epidemics, only those cases that are at highest risk of having MDRTB receive a drug sensitivity test (DST) at the time of diagnosis. Because of this prioritized testing, identification of MDRTB transmission hotspots in communities where TB cases do not receive DST is challenging, as any observed aggregation of MDRTB may reflect systematic differences in how testing is distributed in communities. We introduce a new disease mapping method, which estimates this missing information through probability–weighted locations, to identify geographic areas of increased risk of MDRTB transmission. We apply this method to routinely collected data from two districts in Lima, Peru over three consecutive years. This method identifies an area in the eastern part of Lima where previously untreated cases have increased risk of MDRTB. This may indicate an area of increased transmission of drug resistant disease, a finding that may otherwise have been missed by routine analysis of programmatic data. The risk of MDR among retreatment cases is also highest in these probable transmission hotspots, though a high level of MDR among retreatment cases is present throughout the study area. Identifying potential multidrug resistant tuberculosis (MDRTB) transmission hotspots may allow for targeted investigation and deployment of resources. PMID:22401962

  13. Identifying indicators of illegal behaviour: carnivore killing in human-managed landscapes.

    Science.gov (United States)

    St John, Freya A V; Keane, Aidan M; Edwards-Jones, Gareth; Jones, Lauren; Yarnell, Richard W; Jones, Julia P G

    2012-02-22

    Managing natural resources often depends on influencing people's behaviour, however effectively targeting interventions to discourage environmentally harmful behaviours is challenging because those involved may be unwilling to identify themselves. Non-sensitive indicators of sensitive behaviours are therefore needed. Previous studies have investigated people's attitudes, assuming attitudes reflect behaviour. There has also been interest in using people's estimates of the proportion of their peers involved in sensitive behaviours to identify those involved, since people tend to assume that others behave like themselves. However, there has been little attempt to test the potential of such indicators. We use the randomized response technique (RRT), designed for investigating sensitive behaviours, to estimate the proportion of farmers in north-eastern South Africa killing carnivores, and use a modified logistic regression model to explore relationships between our best estimates of true behaviour (from RRT) and our proposed non-sensitive indicators (including farmers' attitudes, and estimates of peer-behaviour). Farmers' attitudes towards carnivores, question sensitivity and estimates of peers' behaviour, predict the likelihood of farmers killing carnivores. Attitude and estimates of peer-behaviour are useful indicators of involvement in illicit behaviours and may be used to identify groups of people to engage in interventions aimed at changing behaviour.

  14. FEEDING DIFFICULTIES IN PRESCHOOL CHILDREN, PREVIOUS FEEDING PRACTICES, AND NUTRITIONAL STATUS.

    Science.gov (United States)

    Maranhão, Hélcio de Sousa; Aguiar, Renata Cunha de; Lira, Débora Teixeira Jales de; Sales, Mônica Úrsula Figuerêdo; Nóbrega, Nathalia Ávila do Nascimento

    2018-01-01

    To identify the prevalence of feeding difficulties in preschoolers, its association with epidemiological factors and previous eating habits, and repercussion on nutritional status. Cross-sectional study with a questionnaire given to the mothers of 301 children aged 2-6 years enrolled in public and private kindergartens in Natal, Northeast Brazil, conducted in 2014-2015. Feeding difficulty was assessed according to Kerzner's criteria, resulting in the profiles "highly selective intake", "active child with small appetite", "fear of feeding", and "child with psychological disorder or neglected". Association with the following independent variables was analyzed by logistic regression: breastfeeding time, age of cows' milk and complementary feeding introduction, age range, family income, type of school, mothers' profile (responsive or nonresponsive), and body mass index (BMI). Feeding difficulty was found in 37.2% of cases, with predominance of "highly selective intake" (25.4%). It was not associated with infancy feeding practices, family income or type of school. There were no differences between the BMI Z score means for the groups with and without feeding difficulty (1.0±1.5 SD and 1.1±1.4 SD, respectively). The five-to-six age range had more occurrences (OR 1.8; 95%CI 1.1-2.9). Children of responsive mothers were less likely to have feeding difficulties (OR 0.4; 95%CI 0.2-0.8). Feeding difficulties were very frequent. Nutritional status was not impacted by it, and infancy eating habits were not associated with it. Responsive mothers' profile is a protective factor against eating difficulties and reinforces the importance of behavioral factors and mother-child interaction.

  15. Identifying the nontechnical skills required of nurses in general surgical wards.

    Science.gov (United States)

    Marshall, Dianne C; Finlayson, Mary P

    2018-04-01

    To identify the nontechnical skills (NTS) required of nurses in general surgical wards for safe and effective care. As the largest occupational group, nurses are in an ideal position to block the vulnerabilities of patient adverse events in a surgical ward. Previous studies in the surgical environment have identified the NTS required of nurses for safe care in operating rooms; however, these skills have not been identified for nurses in general surgical wards. A nonparticipant observational descriptive design was used. A purposive sample of 15 registered nurses was recruited from four surgical wards and observed for a full shift on a morning, afternoon or night shift. Nonparticipant observations were conducted using field notes to collect data. A coding frame was developed, and an inductive process was used to analyse the data. A taxonomy comprising seven NTS required of nurses in their roles in surgical ward teams emerged from the data analysis. They are communication, leadership and management, planning, decision-making, situation awareness, teamwork and patient advocacy. Patient care provided by general surgical nurses involved the seven identified key NTS. These particular NTS are an important component of safe nursing practice as they underpin the provision of safe and effective care for general surgical patients. Nurses block the trajectory of error by using NTS to address the vulnerabilities in the system that can lead to adverse patient events. Identifying general surgical nurses' NTS enables the development of teaching strategies that target the learning of those skills to achieve successful work outcomes and improve patient safety. © 2018 John Wiley & Sons Ltd.

  16. The efficiency of average linkage hierarchical clustering algorithm associated multi-scale bootstrap resampling in identifying homogeneous precipitation catchments

    Science.gov (United States)

    Chuan, Zun Liang; Ismail, Noriszura; Shinyie, Wendy Ling; Lit Ken, Tan; Fam, Soo-Fen; Senawi, Azlyna; Yusoff, Wan Nur Syahidah Wan

    2018-04-01

    Due to the limited of historical precipitation records, agglomerative hierarchical clustering algorithms widely used to extrapolate information from gauged to ungauged precipitation catchments in yielding a more reliable projection of extreme hydro-meteorological events such as extreme precipitation events. However, identifying the optimum number of homogeneous precipitation catchments accurately based on the dendrogram resulted using agglomerative hierarchical algorithms are very subjective. The main objective of this study is to propose an efficient regionalized algorithm to identify the homogeneous precipitation catchments for non-stationary precipitation time series. The homogeneous precipitation catchments are identified using average linkage hierarchical clustering algorithm associated multi-scale bootstrap resampling, while uncentered correlation coefficient as the similarity measure. The regionalized homogeneous precipitation is consolidated using K-sample Anderson Darling non-parametric test. The analysis result shows the proposed regionalized algorithm performed more better compared to the proposed agglomerative hierarchical clustering algorithm in previous studies.

  17. Endovascular intervention for central venous cannulation in patients with vascular occlusion after previous catheterization.

    Science.gov (United States)

    Pikwer, Andreas; Acosta, Stefan; Kölbel, Tilo; Åkeson, Jonas

    2010-01-01

    This study was designed to assess endovascular intervention for central venous cannulation in patients with vascular occlusion after previous catheterization. Patients referred for endovascular management of central venous occlusion during a 42-month period were identified from a regional endovascular database, providing prospective information on techniques and clinical outcome. Corresponding patient records, angiograms, and radiographic reports were analyzed retrospectively. Sixteen patients aged 48 years (range 0.5-76), including 11 females, were included. All patients but 1 had had multiple central venous catheters with a median total indwelling time of 37 months. Eleven patients cannulated for hemodialysis had had significantly fewer individual catheters inserted compared with 5 patients cannulated for nutritional support (mean 3.6 vs. 10.2, pvenous occlusions. Patients were subjected to recanalization (n=2), recanalization and percutaneous transluminal angioplasty (n=5), or stenting for vena cava superior syndrome (n=1) prior to catheter insertion. The remaining 8 patients were cannulated by avoiding the occluded route. Central venous occlusion occurs particularly in patients under hemodialysis and with a history of multiple central venous catheterizations with large-diameter catheters and/or long total indwelling time periods. Patients with central venous occlusion verified by CT or MRT venography and need for central venous access should be referred for endovascular intervention.

  18. Worsening anatomic outcomes following aflibercept for neovascular age-related macular degeneration in eyes previously well controlled with ranibizumab

    Directory of Open Access Journals (Sweden)

    Nudleman E

    2016-06-01

    Full Text Available Eric Nudleman,1 Jeremy D Wolfe,2,3 Maria A Woodward,4 Yoshihiro Yonekawa,2,3 George A Williams,2,3 Tarek S Hassan2,3 1Department of Ophthalmology, Shiley Eye Center, University of California, San Diego, La Jolla, CA, 2Beaumont Eye Institute, Oakland University William Beaumont School of Medicine, 3Associated Retinal Consultants, Royal Oak, 4Kellogg Eye Center, University of Michigan Medical School, Ann Arbor, MI, USA Purpose: Antivascular endothelial growth factor injection is the mainstay of treating neovascular age-related macular degeneration (AMD. Previous studies have shown that switching treatment from ranibizumab to aflibercept led to an improvement in eyes with recalcitrant activity. Herein, we identify a unique subset of patients whose eyes with neovascular AMD were previously well controlled with ranibizumab injections were then worsened after being switched to aflibercept. Methods: This is a retrospective interventional case series. Eyes with neovascular AMD, previously well controlled with monthly injections of ranibizumab, which then developed worsening of subretinal fluid after being switched to aflibercept were included. Results: A total of 17 eyes were included. All eyes developed increased subretinal fluid when switched from ranibizumab to aflibercept. Fourteen patients were switched back to ranibizumab after a single injection of aflibercept and had subsequent rapid resolution of subretinal fluid. Three patients continued with monthly aflibercept injections for two subsequent months and demonstrated the persistence of the increased subretinal fluid until they were switched back to treatment with ranibizumab at which time the fluid resolved. No eye had persistent decline in visual acuity. Conclusion: Switching from intravitreal ranibizumab to aflibercept in eyes with well-controlled neovascular AMD may result in worsening in a subset of patients and resolves when therapy is switched back to ranibizumab. Keywords: anti

  19. Fresh osteochondral allografts in the knee: comparison of primary transplantation versus transplantation after failure of previous subchondral marrow stimulation.

    Science.gov (United States)

    Gracitelli, Guilherme C; Meric, Gokhan; Briggs, Dustin T; Pulido, Pamela A; McCauley, Julie C; Belloti, João Carlos; Bugbee, William D

    2015-04-01

    In most treatment algorithms, osteochondral allograft (OCA) transplantation is regarded as an alternative salvage procedure when other, previous reparative treatments have failed. To compare the outcomes of a retrospective matched-pair cohort of (1) primary OCA transplantation and (2) OCA transplantation after failure of previous subchondral marrow stimulation. Cohort study; Level of evidence, 3. An OCA database was used to identify 46 knees that had OCA transplantation performed as a primary treatment (group 1) and 46 knees that underwent OCA transplantation after failure of previous subchondral marrow stimulation (group 2). All patients had a minimum of 2 years' follow-up. Patients in each group were matched for age (±5 years), diagnosis (osteochondral lesion, degenerative chondral lesion, traumatic chondral injury), and graft size (small, 10 cm2). The groups had similar body mass indexes, sex distributions, and graft locations (femoral condyle, patella, and trochlea. The number and type of further surgeries after the OCA transplantation were assessed; failure was defined as any reoperation resulting in removal of the graft. Functional outcomes were evaluated by use of the modified Merle d'Aubigné-Postel (18-point) scale, International Knee Documentation Committee (IKDC) subjective knee evaluation form, Knee injury and Osteoarthritis Outcomes Score (KOOS), and the Knee Society function (KS-F) scale. Patient satisfaction, according to a 5-point scale from "extremely satisfied" to "dissatisfied," was recorded at the latest follow-up. Eleven of 46 knees (24%) in group 1 had reoperations, compared with 20 of 46 knees (44%) in group 2 (P = .04). The OCA was classified as a failure in 5 knees (11%) in group 1 and 7 knees (15%) in group 2 (P = .53). At 10 years of follow-up, survivorship of the graft was 87.4% and 86% in groups 1 and 2, respectively. Both groups showed improvement in pain and function on all subjective scores from preoperatively to the latest follow

  20. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  1. Should previous mammograms be digitised in the transition to digital mammography?

    International Nuclear Information System (INIS)

    Taylor-Phillips, S.; Gale, A.G.; Wallis, M.G.

    2009-01-01

    Breast screening specificity is improved if previous mammograms are available, which presents a challenge when converting to digital mammography. Two display options were investigated: mounting previous film mammograms on a multiviewer adjacent to the workstation, or digitising them for soft copy display. Eight qualified screen readers were videotaped undertaking routine screen reading for two 45-min sessions in each scenario. Analysis of gross eye and head movements showed that when digitised, previous mammograms were examined a greater number of times per case (p=0.03), due to a combination of being used in 19% more cases (p=0.04) and where used, looked at a greater number of times (28% increase, p=0.04). Digitising previous mammograms reduced both the average time taken per case by 18% (p=0.04) and the participants' perceptions of workload (p < 0.05). Digitising previous analogue mammograms may be advantageous, in particular in increasing their level of use. (orig.)

  2. Systematic review of the risk of uterine rupture with the use of amnioinfusion after previous cesarean delivery.

    Science.gov (United States)

    Hicks, Paul

    2005-04-01

    Amnioinfusion is commonly used for the intrapartum treatment of women with pregnancy complicated by thick meconium or oligohydramnios with deep variable fetal heart rate decelerations. Its benefit in women with previous cesarean deliveries is less known. Theoretically, rapid increases in intrauterine volume would lead to a higher risk of uterine rupture. Searches of the Cochrane Library from inception to the third quarter of 2001 and MEDLINE, 1966 to November 2001, were performed by using keywords "cesarean" and "amnioinfusion." Search terms were expanded to maximize results. All languages were included. Review articles, editorials, and data previously published in other sites were not analyzed. Four studies were retrieved having unduplicated data describing amnioinfusion in women who were attempting a trial of labor after previous cesarean section. As the studies were of disparate types, meta-analysis was not possible. The use of amnioinfusion in women with previous cesarean delivery who are undergoing a trial of labor may be a safe procedure, but confirmatory large, controlled prospective studies are needed before definitive recommendations can be made.

  3. Chromosome X-wide association study identifies Loci for fasting insulin and height and evidence for incomplete dosage compensation.

    Directory of Open Access Journals (Sweden)

    Taru Tukiainen

    2014-02-01

    Full Text Available The X chromosome (chrX represents one potential source for the "missing heritability" for complex phenotypes, which thus far has remained underanalyzed in genome-wide association studies (GWAS. Here we demonstrate the benefits of including chrX in GWAS by assessing the contribution of 404,862 chrX SNPs to levels of twelve commonly studied cardiometabolic and anthropometric traits in 19,697 Finnish and Swedish individuals with replication data on 5,032 additional Finns. By using a linear mixed model, we estimate that on average 2.6% of the additive genetic variance in these twelve traits is attributable to chrX, this being in proportion to the number of SNPs in the chromosome. In a chrX-wide association analysis, we identify three novel loci: two for height (rs182838724 near FGF16/ATRX/MAGT1, joint P-value = 2.71×10(-9, and rs1751138 near ITM2A, P-value = 3.03×10(-10 and one for fasting insulin (rs139163435 in Xq23, P-value = 5.18×10(-9. Further, we find that effect sizes for variants near ITM2A, a gene implicated in cartilage development, show evidence for a lack of dosage compensation. This observation is further supported by a sex-difference in ITM2A expression in whole blood (P-value = 0.00251, and is also in agreement with a previous report showing ITM2A escapes from X chromosome inactivation (XCI in the majority of women. Hence, our results show one of the first links between phenotypic variation in a population sample and an XCI-escaping locus and pinpoint ITM2A as a potential contributor to the sexual dimorphism in height. In conclusion, our study provides a clear motivation for including chrX in large-scale genetic studies of complex diseases and traits.

  4. Chromosome X-wide association study identifies Loci for fasting insulin and height and evidence for incomplete dosage compensation.

    Science.gov (United States)

    Tukiainen, Taru; Pirinen, Matti; Sarin, Antti-Pekka; Ladenvall, Claes; Kettunen, Johannes; Lehtimäki, Terho; Lokki, Marja-Liisa; Perola, Markus; Sinisalo, Juha; Vlachopoulou, Efthymia; Eriksson, Johan G; Groop, Leif; Jula, Antti; Järvelin, Marjo-Riitta; Raitakari, Olli T; Salomaa, Veikko; Ripatti, Samuli

    2014-02-01

    The X chromosome (chrX) represents one potential source for the "missing heritability" for complex phenotypes, which thus far has remained underanalyzed in genome-wide association studies (GWAS). Here we demonstrate the benefits of including chrX in GWAS by assessing the contribution of 404,862 chrX SNPs to levels of twelve commonly studied cardiometabolic and anthropometric traits in 19,697 Finnish and Swedish individuals with replication data on 5,032 additional Finns. By using a linear mixed model, we estimate that on average 2.6% of the additive genetic variance in these twelve traits is attributable to chrX, this being in proportion to the number of SNPs in the chromosome. In a chrX-wide association analysis, we identify three novel loci: two for height (rs182838724 near FGF16/ATRX/MAGT1, joint P-value = 2.71×10(-9), and rs1751138 near ITM2A, P-value = 3.03×10(-10)) and one for fasting insulin (rs139163435 in Xq23, P-value = 5.18×10(-9)). Further, we find that effect sizes for variants near ITM2A, a gene implicated in cartilage development, show evidence for a lack of dosage compensation. This observation is further supported by a sex-difference in ITM2A expression in whole blood (P-value = 0.00251), and is also in agreement with a previous report showing ITM2A escapes from X chromosome inactivation (XCI) in the majority of women. Hence, our results show one of the first links between phenotypic variation in a population sample and an XCI-escaping locus and pinpoint ITM2A as a potential contributor to the sexual dimorphism in height. In conclusion, our study provides a clear motivation for including chrX in large-scale genetic studies of complex diseases and traits.

  5. Life-history traits in an evergreen Mediterranean oak respond differentially to previous experimental environments

    Directory of Open Access Journals (Sweden)

    J. M. Rey Benayas

    2008-06-01

    Full Text Available Living organisms respond both to current and previous environments, which can have important consequences on population dynamics. However, there is little experimental evidence based on long-term field studies of the effects of previous environments on the performance of individuals. We tested the hypothesis that trees that establish under different environmental conditions perform differently under similar post-establishment conditions. We used the slow-growing, evergreen Mediterranean oak Quercus ilex subsp. rotundifolia as target species. We analyzed the effects of previous environments, competition effects and tradeoffs among life-history traits (survival, growth, and reproduction. We enhanced seedling establishment for three years by reducing abiotic environmental harshness by means of summer irrigation and artificial shading in 12 experimental plots, while four plots remained as controls. Then these treatments were interrupted for ten years. Seedlings under ameliorated environmental conditions survived and grew faster during early establishment. During the post-management period, previous treatments 1 did not have any effect on survival, 2 experienced a slower above-ground growth, 3 decreased root biomass as indicated from reflectivity of Ground Penetration Radar, 4 increased acorn production mostly through a greater canopy volume and 5 increased acorn production effort. The trees exhibited a combination of effects related to acclimation for coping with abiotic stress and effects of intra-specific competition. In accordance with our hypothesis, tree performance overall depended on previous environmental conditions, and the response was different for different life-history traits. We recommend early management because it increased plot cover, shortened the time to attain sexual maturity and increased the amount of acorn production. Plots such as those assessed in this study may act as sources of propagules in deforested

  6. Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

    Science.gov (United States)

    Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

    2007-10-01

    AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

  7. Genome-wide association studies in women of African ancestry identified 3q26.21 as a novel susceptibility locus for oestrogen receptor negative breast cancer.

    Science.gov (United States)

    Huo, Dezheng; Feng, Ye; Haddad, Stephen; Zheng, Yonglan; Yao, Song; Han, Yoo-Jeong; Ogundiran, Temidayo O; Adebamowo, Clement; Ojengbede, Oladosu; Falusi, Adeyinka G; Zheng, Wei; Blot, William; Cai, Qiuyin; Signorello, Lisa; John, Esther M; Bernstein, Leslie; Hu, Jennifer J; Ziegler, Regina G; Nyante, Sarah; Bandera, Elisa V; Ingles, Sue A; Press, Michael F; Deming, Sandra L; Rodriguez-Gil, Jorge L; Nathanson, Katherine L; Domchek, Susan M; Rebbeck, Timothy R; Ruiz-Narváez, Edward A; Sucheston-Campbell, Lara E; Bensen, Jeannette T; Simon, Michael S; Hennis, Anselm; Nemesure, Barbara; Leske, M Cristina; Ambs, Stefan; Chen, Lin S; Qian, Frank; Gamazon, Eric R; Lunetta, Kathryn L; Cox, Nancy J; Chanock, Stephen J; Kolonel, Laurence N; Olshan, Andrew F; Ambrosone, Christine B; Olopade, Olufunmilayo I; Palmer, Julie R; Haiman, Christopher A

    2016-11-01

    Multiple breast cancer loci have been identified in previous genome-wide association studies, but they were mainly conducted in populations of European ancestry. Women of African ancestry are more likely to have young-onset and oestrogen receptor (ER) negative breast cancer for reasons that are unknown and understudied. To identify genetic risk factors for breast cancer in women of African descent, we conducted a meta-analysis of two genome-wide association studies of breast cancer; one study consists of 1,657 cases and 2,029 controls genotyped with Illumina’s HumanOmni2.5 BeadChip and the other study included 3,016 cases and 2,745 controls genotyped using Illumina Human1M-Duo BeadChip. The top 18,376 single nucleotide polymorphisms (SNP) from the meta-analysis were replicated in the third study that consists of 1,984 African Americans cases and 2,939 controls. We found that SNP rs13074711, 26.5 Kb upstream of TNFSF10 at 3q26.21, was significantly associated with risk of oestrogen receptor (ER)-negative breast cancer (odds ratio [OR]=1.29, 95% CI: 1.18-1.40; P = 1.8 × 10 − 8). Functional annotations suggest that the TNFSF10 gene may be involved in breast cancer aetiology, but further functional experiments are needed. In addition, we confirmed SNP rs10069690 was the best indicator for ER-negative breast cancer at 5p15.33 (OR = 1.30; P = 2.4 × 10 − 10) and identified rs12998806 as the best indicator for ER-positive breast cancer at 2q35 (OR = 1.34; P = 2.2 × 10 − 8) for women of African ancestry. These findings demonstrated additional susceptibility alleles for breast cancer can be revealed in diverse populations and have important public health implications in building race/ethnicity-specific risk prediction model for breast cancer.

  8. Usefulness of indirect alcohol biomarkers for predicting recidivism of drunk-driving among previously convicted drunk-driving offenders: results from the recidivism of alcohol-impaired driving (ROAD) study.

    Science.gov (United States)

    Maenhout, Thomas M; Poll, Anneleen; Vermassen, Tijl; De Buyzere, Marc L; Delanghe, Joris R

    2014-01-01

    In several European countries, drivers under the influence (DUI), suspected of chronic alcohol abuse are referred for medical and psychological examination. This study (the ROAD study, or Recidivism Of Alcohol-impaired Driving) investigated the usefulness of indirect alcohol biomarkers for predicting drunk-driving recidivism in previously convicted drunk-driving offenders. The ROAD study is a prospective study (2009-13) that was performed on 517 randomly selected drivers in Belgium. They were convicted for drunk-driving for which their licence was confiscated. The initial post-arrest blood samples were collected and analysed for percentage carbohydrate-deficient transferrin (%CDT), transaminsase activities [alanine amino transferase (ALT), aspartate amino transferase (AST)], gamma-glutamyltransferase (γGT) and red cell mean corpuscular volume (MCV). The observation time for each driver was 3 years and dynamic. A logistic regression analysis revealed that ln(%CDT) (P drunk-driving. The ROAD index (which includes ln(%CDT), ln(γGT), -ln(ALT) and the sex of the driver) was calculated and had a significantly higher area under the receiver operator characteristic curve (0.71) than the individual biomarkers for drunk-driving recidivism. Drivers with a high risk of recidivating (ROAD index ≥ 25%; third tertile) could be distinguished from drivers with an intermediate risk (16% ≤ ROAD index drunk-driving. The association with gamma-glutamyltransferase, alanine amino transferase and the sex of the driver could have additional value for identifying drunk-drivers at intermediate risk of recidivism. Non-specific indirect alcohol markers, such as alanine amino transferase, gamma-glutamyltransferase, aspartate amino transferase and red cell mean corpuscular volume have minimal added value to % carbohydrate-deficient transferrin for distinguishing drunk drivers with a low or high risk of recidivism. © 2013 Society for the Study of Addiction.

  9. Identifying occupational carcinogens: an update from the IARC Monographs.

    Science.gov (United States)

    Loomis, Dana; Guha, Neela; Hall, Amy L; Straif, Kurt

    2018-05-16

    The recognition of occupational carcinogens is important for primary prevention, compensation and surveillance of exposed workers, as well as identifying causes of cancer in the general population. This study updates previously published lists of known occupational carcinogens while providing additional information on cancer type, exposure scenarios and routes, and discussing trends in the identification of carcinogens over time. Data were extracted from International Agency for Research on Cancer (IARC) Monographs covering the years 1971-2017, using specific criteria to ensure occupational relevance and provide high confidence in the causality of observed exposure-disease associations. Selected agents were substances, mixtures or types of radiation classified in IARC Group 1 with 'sufficient evidence of carcinogenicity' in humans from studies of exposed workers and evidence of occupational exposure documented in the pertinent monograph. The number of known occupational carcinogens has increased over time: 47 agents were identified as known occupational carcinogens in 2017 compared with 28 in 2004. These estimates are conservative and likely underestimate the number of carcinogenic agents present in workplaces. Exposure to these agents causes a wide range of cancers; cancers of the lung and other respiratory sites, followed by skin, account for the largest proportion. The dominant routes of exposure are inhalation and dermal contact. Important progress has been made in identifying occupational carcinogens; nevertheless, there is an ongoing need for research on the causes of work-related cancer. Most workplace exposures have not been evaluated for their carcinogenic potential due to inadequate epidemiologic evidence and a paucity of quantitative exposure data. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  10. 14 CFR 121.406 - Credit for previous CRM/DRM training.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Credit for previous CRM/DRM training. 121... previous CRM/DRM training. (a) For flightcrew members, the Administrator may credit CRM training received before March 19, 1998 toward all or part of the initial ground CRM training required by § 121.419. (b...

  11. Rapid mineralisation of the herbicide isoproturon in soil from a previously treated Danish agricultural field.

    Science.gov (United States)

    Sørensen, Sebastian R; Aamand, Jens

    2003-10-01

    Mineralisation of the phenylurea herbicide isoproturon (3-(4-isopropylphenyl)-1,1-dimethylurea) and two of its known metabolites, 3-(4-isopropylphenyl)-1-methylurea (monodesmethyl-isoproturon) and 4-isopropylaniline, was studied in Danish agricultural soils with or without previous exposure to isoproturon. A potential for rapid mineralisation of isoproturon and the two metabolites was present in soils sampled from three plots within an agricultural field previously treated regularly with the herbicide, with 34-45%, 51-58% and 33-36% of the added [phenyl-U-14C]isoproturon, [phenyl-U-14C]monodesmethyl-isoproturon and [phenyl-U-14C]4-isopropylaniline metabolised to [14C]carbon dioxide within 30 days at 20 degrees C. In contrast, such extensive mineralisation of these three compounds was not observed within this period in soils sampled from two other agricultural fields without previous treatment with isoproturon. The mineralisation patterns indicated growth-linked metabolism of the three compounds in the previously exposed soils, and doubling times for [14C]carbon dioxide production ranged from 1.6 to 3.2, 1.0 to 2.1 and 1.3 to 1.7 days for isoproturon, monodesmethyl-isoproturon and 4-isopropylaniline, respectively. The ability to mineralise [phenyl-U-14C]isoproturon to [14C]carbon dioxide was successfully sub-cultured to a fresh mineral medium which provided isoproturon as sole source of carbon and nitrogen. One of the soils sampled from an agricultural field not previously treated with isoproturon showed accelerated mineralisation of [phenyl-U-14C]4-isopropylaniline toward the end of the experiment, with a doubling time for [14C]carbon dioxide production of 7.4days. This study indicates that the occurrence of rapid mineralisation of the phenyl ring of isoproturon to carbon dioxide is related to previous exposure to the herbicide, which suggests that microbial adaptation upon repeated isoproturon use may occur within agricultural fields.

  12. Recurrent TERT promoter mutations identified in a large-scale study of multiple tumor types are associated with increased TERT expression and telomerase activation

    Science.gov (United States)

    Huang, Dong-Sheng; Wang, Zhaohui; He, Xu-Jun; Diplas, Bill H.; Yang, Rui; Killela, Patrick J.; Liang, Junbo; Meng, Qun; Ye, Zai-Yuan; Wang, Wei; Jiang, Xiao-Ting; Xu, Li; He, Xiang-Lei; Zhao, Zhong-Sheng; Xu, Wen-Juan; Wang, Hui-Ju; Ma, Ying-Yu; Xia, Ying-Jie; Li, Li; Zhang, Ru-Xuan; Jin, Tao; Zhao, Zhong-Kuo; Xu, Ji; Yu, Sheng; Wu, Fang; Wang, Si-Zhen; Jiao, Yu-Chen; Yan, Hai; Tao, Hou-Quan

    2015-01-01

    Background Several somatic mutation hotspots were recently identified in the TERT promoter region in human cancers. Large scale studies of these mutations in multiple tumor types are limited, in particular in Asian populations. This study aimed to: analyze TERT promoter mutations in multiple tumor types in a large Chinese patient cohort, investigate novel tumor types and assess the functional significance of the mutations. Methods TERT promoter mutation status was assessed by Sanger sequencing for 13 different tumor types and 799 tumor tissues from Chinese cancer patients. Thymic epithelial tumors, gastrointestinal leiomyoma, and gastric schwannoma were included, for which the TERT promoter has not been previously sequenced. Functional studies included TERT expression by RT-qPCR, telomerase activity by the TRAP assay, and promoter activity by the luciferase reporter assay. Results TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%), and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT promoter mutations were absent in GIST, thymic epithelial tumors, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT promoter mutations highly correlated with upregulated TERT mRNA expression and telomerase activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core promoter. Conclusions TERT promoter mutations are frequent in multiple tumor types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumorigenesis, making them potential therapeutic targets. PMID:25843513

  13. A genome-wide association study identifies CDHR3 as a susceptibility locus for early childhood asthma with severe exacerbations

    DEFF Research Database (Denmark)

    Bønnelykke, Klaus; Sleiman, Patrick; Nielsen, Kasper

    2014-01-01

    Asthma exacerbations are among the most frequent causes of hospitalization during childhood, but the underlying mechanisms are poorly understood. We performed a genome-wide association study of a specific asthma phenotype characterized by recurrent, severe exacerbations occurring between 2 and 6......1RL1, were previously reported as asthma susceptibility loci, but the effect sizes for these loci in our cohort were considerably larger than in the previous genome-wide association studies of asthma. We also obtained strong evidence for a new susceptibility gene, CDHR3 (encoding cadherin......-related family member 3), which is highly expressed in airway epithelium. These results demonstrate the strength of applying specific phenotyping in the search for asthma susceptibility genes....

  14. Identifying interventions to help rural Kenyan mothers cope with food insecurity: results of a focused ethnographic study

    OpenAIRE

    Pelto, Gretel H.; Armar?Klemesu, Margaret

    2016-01-01

    Abstract An ethnographic study was conducted in two areas in southern and western Kenya to identify potential interventions to improve the quality, availability and affordability of foods consumed by infants and young children. A cultural?ecological model of determinants of nutrition identified the sectors of information for data collection related to infant and young child (IYC) diet and feeding?related behaviours, and the focused ethnographic study manual was used to guide the research. The...

  15. A meta-analysis of genome-wide association studies identifies novel variants associated with osteoarthritis of the hip

    DEFF Research Database (Denmark)

    Evangelou, Evangelos; Kerkhof, Hanneke J; Styrkarsdottir, Unnur

    2014-01-01

    Osteoarthritis (OA) is the most common form of arthritis with a clear genetic component. To identify novel loci associated with hip OA we performed a meta-analysis of genome-wide association studies (GWAS) on European subjects.......Osteoarthritis (OA) is the most common form of arthritis with a clear genetic component. To identify novel loci associated with hip OA we performed a meta-analysis of genome-wide association studies (GWAS) on European subjects....

  16. Exome chip meta-analysis identifies novel loci and East Asian-specific coding variants that contribute to lipid levels and coronary artery disease

    DEFF Research Database (Denmark)

    Lu, Xiangfeng; Peloso, Gina M; Liu, Dajiang J

    2017-01-01

    Most genome-wide association studies have been of European individuals, even though most genetic variation in humans is seen only in non-European samples. To search for novel loci associated with blood lipid levels and clarify the mechanism of action at previously identified lipid loci, we used a...

  17. Identifying the influence of gender on motivation and engagement levels in student physiotherapists.

    Science.gov (United States)

    Edgar, Susan

    2015-04-01

    There is an increasing focus in higher education on the role of learner characteristics and their influence on academic performance. Educators are interested in how students engage with learning activities as they progress through the curriculum. A previous study highlighted gender effects in academic performance in student physiotherapists, despite comparable entry scores. The aim of this study was to determine variation in student motivation and engagement, across the four year levels of the physiotherapy program at The University of Notre Dame Australia while considering gender and age. A cross-sectional design was adopted surveying 233 students utilising the Motivation and Engagement Scale - University/College (MES-UC), to review motivational thoughts and behaviours influencing learning. RESULTS identified gender effects with males having on average significantly lower scores for planning, task management and persistence; and higher scores for disengagement from their studies. Females displayed higher average scores for anxiety particularly in their first year and final clinical year. RESULTS were consistent with gender effects noted in academic performance throughout the program for previous student cohorts. The application of the MES-UC early in course would highlight to educators the areas where intervention can be targeted. Early individualized intervention is recommended to address learner characteristics influencing performance.

  18. ICSNPathway: identify candidate causal SNPs and pathways from genome-wide association study by one analytical framework.

    Science.gov (United States)

    Zhang, Kunlin; Chang, Suhua; Cui, Sijia; Guo, Liyuan; Zhang, Liuyan; Wang, Jing

    2011-07-01

    Genome-wide association study (GWAS) is widely utilized to identify genes involved in human complex disease or some other trait. One key challenge for GWAS data interpretation is to identify causal SNPs and provide profound evidence on how they affect the trait. Currently, researches are focusing on identification of candidate causal variants from the most significant SNPs of GWAS, while there is lack of support on biological mechanisms as represented by pathways. Although pathway-based analysis (PBA) has been designed to identify disease-related pathways by analyzing the full list of SNPs from GWAS, it does not emphasize on interpreting causal SNPs. To our knowledge, so far there is no web server available to solve the challenge for GWAS data interpretation within one analytical framework. ICSNPathway is developed to identify candidate causal SNPs and their corresponding candidate causal pathways from GWAS by integrating linkage disequilibrium (LD) analysis, functional SNP annotation and PBA. ICSNPathway provides a feasible solution to bridge the gap between GWAS and disease mechanism study by generating hypothesis of SNP → gene → pathway(s). The ICSNPathway server is freely available at http://icsnpathway.psych.ac.cn/.

  19. Common integration sites of published datasets identified using a graph-based framework

    Directory of Open Access Journals (Sweden)

    Alessandro Vasciaveo

    2016-01-01

    Full Text Available With next-generation sequencing, the genomic data available for the characterization of integration sites (IS has dramatically increased. At present, in a single experiment, several thousand viral integration genome targets can be investigated to define genomic hot spots. In a previous article, we renovated a formal CIS analysis based on a rigid fixed window demarcation into a more stretchy definition grounded on graphs. Here, we present a selection of supporting data related to the graph-based framework (GBF from our previous article, in which a collection of common integration sites (CIS was identified on six published datasets. In this work, we will focus on two datasets, ISRTCGD and ISHIV, which have been previously discussed. Moreover, we show in more detail the workflow design that originates the datasets.

  20. Value and reliability of findings from previous epidemiologic studies in the assessment of radiation-related cancer risks. Pt. 3

    International Nuclear Information System (INIS)

    Frasch, G.; Martignoni, K.

    1990-01-01

    The theories put forward here are predominantly based on pooled data from previous studies in a number of cohorts made up by mostly non-average individuals. These studies were carried out by various researchers and differed in procedures and aims. Factors of major importance to the validity and reliability of the conclusions drawn from this study are pointed out. In one chapter some light is thrown on factors known to bear a relation to the incidence of radiation-induced cancer of the breast, even though at present this can only very vaguely be described on a quantitative basis. These factors include fractionated dose regimens, pregnancies and parturitions, menarche, menopause, synergisms as well as secondary cancer of the breast. The available body of evidence suggests that exposure of each of 1 million women to a dose of 10 mGy (rad) can be linked with approx. 3 additional cases of mammary cancer reported on an average per year after the latency period. The fact that there is some statistical scatter around this value is chiefly attributable to age-related causes at the beginning of exposure. Differences in ethnic and cultural characteristics between the populations investigated appeared to be less important here. (orig./MG) [de

  1. A pupal transcriptomic screen identifies Ral as a target of store-operated calcium entry in Drosophila neurons

    OpenAIRE

    Richhariya, Shlesha; Jayakumar, Siddharth; Abruzzi, Katharine; Rosbash, Michael; Hasan, Gaiti

    2017-01-01

    Transcriptional regulation by Store-operated Calcium Entry (SOCE) is well studied in non-excitable cells. However, the role of SOCE has been poorly documented in neuronal cells with more complicated calcium dynamics. Previous reports demonstrated a requirement for SOCE in neurons that regulate Drosophila flight bouts. We refine this requirement temporally to the early pupal stage and use RNA-sequencing to identify SOCE mediated gene expression changes in the developing Drosophila pupal nervou...

  2. Identification of balanced chromosomal rearrangements previously unknown among participants in the 1000 Genomes Project: implications for interpretation of structural variation in genomes and the future of clinical cytogenetics.

    Science.gov (United States)

    Dong, Zirui; Wang, Huilin; Chen, Haixiao; Jiang, Hui; Yuan, Jianying; Yang, Zhenjun; Wang, Wen-Jing; Xu, Fengping; Guo, Xiaosen; Cao, Ye; Zhu, Zhenzhen; Geng, Chunyu; Cheung, Wan Chee; Kwok, Yvonne K; Yang, Huanming; Leung, Tak Yeung; Morton, Cynthia C; Cheung, Sau Wai; Choy, Kwong Wai

    2017-11-02

    PurposeRecent studies demonstrate that whole-genome sequencing enables detection of cryptic rearrangements in apparently balanced chromosomal rearrangements (also known as balanced chromosomal abnormalities, BCAs) previously identified by conventional cytogenetic methods. We aimed to assess our analytical tool for detecting BCAs in the 1000 Genomes Project without knowing which bands were affected.MethodsThe 1000 Genomes Project provides an unprecedented integrated map of structural variants in phenotypically normal subjects, but there is no information on potential inclusion of subjects with apparent BCAs akin to those traditionally detected in diagnostic cytogenetics laboratories. We applied our analytical tool to 1,166 genomes from the 1000 Genomes Project with sufficient physical coverage (8.25-fold).ResultsWith this approach, we detected four reciprocal balanced translocations and four inversions, ranging in size from 57.9 kb to 13.3 Mb, all of which were confirmed by cytogenetic methods and polymerase chain reaction studies. One of these DNAs has a subtle translocation that is not readily identified by chromosome analysis because of the similarity of the banding patterns and size of exchanged segments, and another results in disruption of all transcripts of an OMIM gene.ConclusionOur study demonstrates the extension of utilizing low-pass whole-genome sequencing for unbiased detection of BCAs including translocations and inversions previously unknown in the 1000 Genomes Project.GENETICS in MEDICINE advance online publication, 2 November 2017; doi:10.1038/gim.2017.170.

  3. Maternal condition and previous reproduction interact to affect offspring sex in a wild mammal.

    Science.gov (United States)

    Douhard, Mathieu; Festa-Bianchet, Marco; Pelletier, Fanie

    2016-08-01

    Trivers and Willard proposed that offspring sex ratio should vary with maternal condition when condition, meant as maternal capacity to care, has different fitness consequences for sons and daughters. In polygynous and dimorphic species, mothers in good condition should preferentially produce sons, whereas mothers in poor condition should produce more daughters. Despite its logical appeal, support for this hypothesis has been inconsistent. Sex-ratio variation may be influenced by additional factors, such as environmental conditions and previous reproduction, which are often ignored in empirical studies. We analysed 39 years of data on bighorn sheep (Ovis canadensis) that fit all the assumptions of the Trivers-Willard hypothesis. Production of sons increased with maternal condition only for mothers that weaned a son the previous year. This relationship likely reflects a mother's ability to bear the higher reproductive costs of sons. The interaction between maternal condition and previous weaning success on the probability of producing a son was independent of the positive effect of paternal reproductive success. Maternal and paternal effects accounted for similar proportions of the variance in offspring sex. Maternal reproductive history should be considered in addition to current condition in studies of sex allocation. © 2016 The Author(s).

  4. Shortest-path network analysis is a useful approach toward identifying genetic determinants of longevity.

    Directory of Open Access Journals (Sweden)

    J R Managbanag

    Full Text Available BACKGROUND: Identification of genes that modulate longevity is a major focus of aging-related research and an area of intense public interest. In addition to facilitating an improved understanding of the basic mechanisms of aging, such genes represent potential targets for therapeutic intervention in multiple age-associated diseases, including cancer, heart disease, diabetes, and neurodegenerative disorders. To date, however, targeted efforts at identifying longevity-associated genes have been limited by a lack of predictive power, and useful algorithms for candidate gene-identification have also been lacking. METHODOLOGY/PRINCIPAL FINDINGS: We have utilized a shortest-path network analysis to identify novel genes that modulate longevity in Saccharomyces cerevisiae. Based on a set of previously reported genes associated with increased life span, we applied a shortest-path network algorithm to a pre-existing protein-protein interaction dataset in order to construct a shortest-path longevity network. To validate this network, the replicative aging potential of 88 single-gene deletion strains corresponding to predicted components of the shortest-path longevity network was determined. Here we report that the single-gene deletion strains identified by our shortest-path longevity analysis are significantly enriched for mutations conferring either increased or decreased replicative life span, relative to a randomly selected set of 564 single-gene deletion strains or to the current data set available for the entire haploid deletion collection. Further, we report the identification of previously unknown longevity genes, several of which function in a conserved longevity pathway believed to mediate life span extension in response to dietary restriction. CONCLUSIONS/SIGNIFICANCE: This work demonstrates that shortest-path network analysis is a useful approach toward identifying genetic determinants of longevity and represents the first application of

  5. Bomb-Pulse Chlorine-36 At The Proposed Yucca Mountain Repository Horizon: An Investigation Of Previous Conflicting Results And Collection Of New Data

    International Nuclear Information System (INIS)

    J. Cizdziel

    2006-01-01

    Previous studies by scientists at Los Alamos National Laboratory (LANL) found elevated ratios of chlorine-36 to total chloride ( 36 Cl/Cl) in samples of rock collected from the Exploratory Studies Facility (ESF) and the Enhanced Characterization of the Repository Block (ECRB) at Yucca Mountain as the tunnels were excavated. The data were interpreted as an indication that fluids containing 'bomb-pulse' 36 Cl reached the repository horizon in the ∼50 years since the peak period of above-ground nuclear testing. Moreover, the data support the concept that so-called fast pathways for infiltration not only exist but are active, possibly through a combination of porous media, faults and/or other geologic features. Due to the significance of 36 Cl data to conceptual models of unsaturated zone flow and transport, the United States Geological Survey (USGS) was requested by the Department of Energy (DOE) to design and implement a study to validate the LANL findings. The USGS chose to drill new boreholes at select locations across zones where bomb-pulse ratios had previously been identified. The drill cores were analyzed at Lawrence Livermore National Laboratory (LLNL) for 36 Cl/Cl using both active and passive leaches, with the USGS/LLNL concluding that the active leach extracted too much rock-Cl and the passive leach did not show bomb-pulse ratios. Because consensus was not reached between the USGS/LLNL and LANL on several fundamental points, including the conceptual strategy for sampling, interpretation and use of tritium ( 3 H) data, and the importance and interpretation of blanks, in addition to the presence or absence of bomb-pulse 36 Cl, an evaluation by an independent entity, the University of Nevada, Las Vegas (UNLV), using new samples was initiated. This report is the result of that study. The overall objectives of the UNLV study were to investigate the source or sources of the conflicting results from the previous validation study, and to obtain additional data to

  6. A Delphi study to identify the core components of nurse to nurse handoff.

    Science.gov (United States)

    O'Rourke, Jennifer; Abraham, Joanna; Riesenberg, Lee Ann; Matson, Jeff; Lopez, Karen Dunn

    2018-03-08

    The aim of this study was to identify the core components of nurse-nurse handoffs. Patient handoffs involve a process of passing information, responsibility and control from one caregiver to the next during care transitions. Around the globe, ineffective handoffs have serious consequences resulting in wrong treatments, delays in diagnosis, longer stays, medication errors, patient falls and patient deaths. To date, the core components of nurse-nurse handoff have not been identified. This lack of identification is a significant gap in moving towards a standardized approach for nurse-nurse handoff. Mixed methods design using the Delphi technique. From May 2016 - October 2016, using a series of iterative steps, a panel of handoff experts gave feedback on the nurse-nurse handoff core components and the content in each component to be passed from one nurse to the next during a typical unit-based shift handoff. Consensus was defined as 80% agreement or higher. After three rounds of participant review, 17 handoff experts with backgrounds in clinical nursing practice, academia and handoff research came to consensus on the core components of handoff: patient summary, action plan and nurse-nurse synthesis. This is the first study to identify the core components of nurse-nurse handoff. Subsequent testing of the core components will involve evaluating the handoff approach in a simulated and then actual patient care environment. Our long-term goal is to improve patient safety outcomes by validating an evidence-based handoff framework and handoff curriculum for pre-licensure nursing programmes that strengthen the quality of their handoff communication as they enter clinical practice. © 2018 John Wiley & Sons Ltd.

  7. A genome-wide association study of atopic dermatitis identifies loci with overlapping effects on asthma and psoriasis.

    Science.gov (United States)

    Weidinger, Stephan; Willis-Owen, Saffron A G; Kamatani, Yoichiro; Baurecht, Hansjörg; Morar, Nilesh; Liang, Liming; Edser, Pauline; Street, Teresa; Rodriguez, Elke; O'Regan, Grainne M; Beattie, Paula; Fölster-Holst, Regina; Franke, Andre; Novak, Natalija; Fahy, Caoimhe M; Winge, Mårten C G; Kabesch, Michael; Illig, Thomas; Heath, Simon; Söderhäll, Cilla; Melén, Erik; Pershagen, Göran; Kere, Juha; Bradley, Maria; Lieden, Agne; Nordenskjold, Magnus; Harper, John I; McLean, W H Irwin; Brown, Sara J; Cookson, William O C; Lathrop, G Mark; Irvine, Alan D; Moffatt, Miriam F

    2013-12-01

    Atopic dermatitis (AD) is the most common dermatological disease of childhood. Many children with AD have asthma and AD shares regions of genetic linkage with psoriasis, another chronic inflammatory skin disease. We present here a genome-wide association study (GWAS) of childhood-onset AD in 1563 European cases with known asthma status and 4054 European controls. Using Illumina genotyping followed by imputation, we generated 268 034 consensus genotypes and in excess of 2 million single nucleotide polymorphisms (SNPs) for analysis. Association signals were assessed for replication in a second panel of 2286 European cases and 3160 European controls. Four loci achieved genome-wide significance for AD and replicated consistently across all cohorts. These included the epidermal differentiation complex (EDC) on chromosome 1, the genomic region proximal to LRRC32 on chromosome 11, the RAD50/IL13 locus on chromosome 5 and the major histocompatibility complex (MHC) on chromosome 6; reflecting action of classical HLA alleles. We observed variation in the contribution towards co-morbid asthma for these regions of association. We further explored the genetic relationship between AD, asthma and psoriasis by examining previously identified susceptibility SNPs for these diseases. We found considerable overlap between AD and psoriasis together with variable coincidence between allergic rhinitis (AR) and asthma. Our results indicate that the pathogenesis of AD incorporates immune and epidermal barrier defects with combinations of specific and overlapping effects at individual loci.

  8. Using the SAPAS to identify risk for personality disorders among psychiatric outpatients in India: A feasibility study.

    Science.gov (United States)

    Innocent, Simeon; Podder, Priyanka; Ram, Jai Ranjan; Barnicot, Kirsten; Sen, Piyal

    2018-02-01

    Personality disorders (PDs) are common among psychiatric outpatients and are associated with increased morbidity and worse treatment outcomes. Epidemiological research conducted among this population in Asian countries is limited, reflecting a significant gap in the current literature. One barrier to this research is the lack of appropriate screening tools. The current research assessed the feasibility of using the SAPAS (Standardized Assessment of Personality-Abbreviated Scale) screening tool to identify individuals at high risk of PD in an Indian psychiatric outpatient population and provides an initial estimate of PD prevalence by using a validated diagnostic interview, the ICD-10 International Personality Disorder Examination. The findings suggest that whilst use of the SAPAS was feasible, acceptable to patients and led to clinically useful findings, when using the recommended cut-off score of 4, the SAPAS largely overdiagnoses the risk for PD in psychiatric outpatients in India (positive predictive value = 26.3%). The estimated prevalence of personality disorder in the sample was 11.1%, based on administering the International Personality Disorder Examination diagnostic interview to high-risk patients scoring 4 and above on the SAPAS, which is higher than previous estimates for this population and still likely to be an underestimation. Future studies should translate the measure into Bengali and evaluate its sensitivity and specificity at different cut-off points in order to optimize its use in Indian populations. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  9. Increased risk of default among previously treated tuberculosis cases in the Western Cape Province, South Africa.

    Science.gov (United States)

    Marx, F M; Dunbar, R; Hesseling, A C; Enarson, D A; Fielding, K; Beyers, N

    2012-08-01

    To investigate, in two urban communities with high tuberculosis (TB) incidence and high rates of TB recurrence, whether a history of previous TB treatment is associated with treatment default. Retrospective cohort study of TB cases with an episode of treatment recorded in the clinic-based treatment registers between 2002 and 2007. Probabilistic record linkage was used to ascertain treatment history of TB cases back to 1996. Based on the outcome of their most recent previous treatment episode, previously treated cases were compared to new cases regarding their risk of treatment default. Previous treatment success (adjusted odds ratio [aOR] 1.79; 95%CI 1.17-2.73), previous default (aOR 6.18, 95%CI 3.68-10.36) and previous failure (aOR 9.72, 95%CI 3.07-30.78) were each independently associated with treatment default (P default were male sex (P = 0.003) and age 19-39 years (P risk of treatment default, even after previous successful treatment. This finding is of particular importance in a setting where recurrent TB is very common. Adherence to treatment should be ensured in new and retreatment cases to increase cure rates and reduce transmission of TB in the community.

  10. Influence of Previous Knowledge in Torrance Tests of Creative Thinking

    Directory of Open Access Journals (Sweden)

    María Aranguren

    2015-07-01

    Full Text Available The aim of this work is to analyze the influence of study field, expertise and recreational activities participation in Torrance Tests of Creative Thinking (TTCT, 1974 performance. Several hypotheses were postulated to explore the possible effects of previous knowledge in TTCT verbal and TTCT figural university students’ outcomes. Participants in this study included 418 students from five study fields: Psychology;Philosophy and Literature, Music; Engineering; and Journalism and Advertising (Communication Sciences. Results found in this research seem to indicate that there in none influence of the study field, expertise and recreational activities participation in neither of the TTCT tests. Instead, the findings seem to suggest some kind of interaction between certain skills needed to succeed in specific studies fields and performance on creativity tests, such as the TTCT. These results imply that TTCT is a useful and valid instrument to measure creativity and that some cognitive process involved in innovative thinking can be promoted using different intervention programs in schools and universities regardless the students study field.

  11. Impact of Previous Pharmacy Work Experience on Pharmacy School Academic Performance

    Science.gov (United States)

    Mar, Ellena; T-L Tang, Terrill; Sasaki-Hill, Debra; Kuperberg, James R.; Knapp, Katherine

    2010-01-01

    Objectives To determine whether students' previous pharmacy-related work experience was associated with their pharmacy school performance (academic and clinical). Methods The following measures of student academic performance were examined: pharmacy grade point average (GPA), scores on cumulative high-stakes examinations, and advanced pharmacy practice experience (APPE) grades. The quantity and type of pharmacy-related work experience each student performed prior to matriculation was solicited through a student survey instrument. Survey responses were correlated with academic measures, and demographic-based stratified analyses were conducted. Results No significant difference in academic or clinical performance between those students with prior pharmacy experience and those without was identified. Subanalyses by work setting, position type, and substantial pharmacy work experience did not reveal any association with student performance. A relationship was found, however, between age and work experience, ie, older students tended to have more work experience than younger students. Conclusions Prior pharmacy work experience did not affect students' overall academic or clinical performance in pharmacy school. The lack of significant findings may have been due to the inherent practice limitations of nonpharmacist positions, changes in pharmacy education, and the limitations of survey responses. PMID:20498735

  12. Impact of previous pharmacy work experience on pharmacy school academic performance.

    Science.gov (United States)

    Mar, Ellena; Barnett, Mitchell J; T-L Tang, Terrill; Sasaki-Hill, Debra; Kuperberg, James R; Knapp, Katherine

    2010-04-12

    To determine whether students' previous pharmacy-related work experience was associated with their pharmacy school performance (academic and clinical). The following measures of student academic performance were examined: pharmacy grade point average (GPA), scores on cumulative high-stakes examinations, and advanced pharmacy practice experience (APPE) grades. The quantity and type of pharmacy-related work experience each student performed prior to matriculation was solicited through a student survey instrument. Survey responses were correlated with academic measures, and demographic-based stratified analyses were conducted. No significant difference in academic or clinical performance between those students with prior pharmacy experience and those without was identified. Subanalyses by work setting, position type, and substantial pharmacy work experience did not reveal any association with student performance. A relationship was found, however, between age and work experience, ie, older students tended to have more work experience than younger students. Prior pharmacy work experience did not affect students' overall academic or clinical performance in pharmacy school. The lack of significant findings may have been due to the inherent practice limitations of nonpharmacist positions, changes in pharmacy education, and the limitations of survey responses.

  13. Mentoring to develop research selfefficacy, with particular reference to previously disadvantaged individuals

    OpenAIRE

    S. Schulze

    2010-01-01

    The development of inexperienced researchers is crucial. In response to the lack of research self-efficacy of many previously disadvantaged individuals, the article examines how mentoring can enhance the research self-efficacy of mentees. The study is grounded in the self-efficacy theory (SET) – an aspect of the social cognitive theory (SCT). Insights were gained from an in-depth study of SCT, SET and mentoring, and from a completed mentoring project. This led to the formulation of three basi...

  14. Outcomes after radical prostatectomy in men receiving previous pelvic radiation for non-prostate malignancies.

    Science.gov (United States)

    Masterson, Timothy A; Wedmid, Alexei; Sandhu, Jaspreet S; Eastham, James A

    2009-08-01

    To report the perioperative and functional outcomes of nine patients treated at our institution who had radical prostatectomy (RP) after previous pelvic radiotherapy (RT) for non-prostate malignancies. From 1993 to 2007, nine patients had RP after external beam RT for testicular seminoma (six), anorectal cancer (two) and colon cancer (one). Clinical information was obtained from a prospective prostate cancer database. RP was completed with no identifiable injury to adjacent structures in all nine patients. Four patients had significant pelvic fibrosis, and three required bilateral neurovascular bundle (NVB) resection. The NVB was preserved in the remaining six patients, four with good preoperative erectile function. However, no patient recovered erectile function after RP at a median (range) follow-up of 75 (12-172) months. Of seven men continent before RP, four required one or fewer pads daily and three were completely dry, achieving complete urinary control at a median (range) time of 7.5 (2-20) months. Two patients developed an anastomotic stricture, one being associated with concomitant ureteric stricture. RP after pelvic RT for non-prostate malignancies was not associated with increased intraoperative morbidity. However, rates of anastomotic stricture, erectile dysfunction and urinary incontinence appeared to be higher than those reported after RP in men with no previous RT, and comparable with those seen in the salvage RP setting.

  15. Comparative transcriptomics of the nematode gut identifies global shifts in feeding mode and pathogen susceptibility.

    Science.gov (United States)

    Lightfoot, James W; Chauhan, Veeren M; Aylott, Jonathan W; Rödelsperger, Christian

    2016-03-05

    The nematode Pristionchus pacificus has been established as a model for comparative studies using the well known Caenorhabditis elegans as a reference. Despite their relatedness, previous studies have revealed highly divergent development and a number of morphological differences including the lack of a pharyngal structure, the grinder, used to physically lyse the ingested bacteria in C. elegans. To complement current knowledge about developmental and ecological differences with a better understanding of their feeding modes, we have sequenced the intestinal transcriptomes of both nematodes. In total, we found 464 intestine-enriched genes in P. pacificus and 724 in C. elegans, of which the majority (66%) has been identified by previous studies. Interestingly, only 15 genes could be identified with shared intestinal enrichment in both species, of which three genes are Hedgehog signaling molecules supporting a highly conserved role of this pathway for intestinal development across all metazoa. At the level of gene families, we find similar divergent trends with only five families displaying significant intestinal enrichment in both species. We compared our data with transcriptomic responses to various pathogens. Strikingly, C. elegans intestine-enriched genes showed highly significant overlaps with pathogen response genes whereas this was not the case for P. pacificus, indicating shifts in pathogen susceptibility that might be explained by altered feeding modes. Our study reveals first insights into the evolution of feeding systems and the associated changes in intestinal gene expression that might have facilitated nematodes of the P. pacificus lineage to colonize new environments. These findings deepen our understanding about how morphological and genomic diversity is created during the course of evolution.

  16. Prevalence of pain in the head, back and feet in refugees previously exposed to torture: a ten-year follow-up study

    DEFF Research Database (Denmark)

    Olsen, Dorthe Reff; Montgomery, Edith; Bøjholm, Søren

    2007-01-01

    AIM: To estimate change over 10 years concerning the prevalence of pain in the head, back and feet, among previously tortured refugees settled in Denmark, and to compare associations between methods of torture and prevalent pain at baseline and at 10-year follow-up. METHODS: 139 refugees previous...... associated with the type and bodily focus of the torture. This presents a considerable challenge to future evidence-based development of effective treatment programs....

  17. Association between GWAS-identified lung adenocarcinoma susceptibility loci and EGFR mutations in never-smoking Asian women, and comparison with findings from Western populations

    NARCIS (Netherlands)

    Seow, Wei Jie; Matsuo, Keitaro; Hsiung, Chao Agnes; Shiraishi, Kouya; Song, Minsun; Kim, Hee Nam; Wong, Maria Pik; Hong, Yun-Chul; Hosgood, H. Dean; Wang, Zhaoming; Chang, I-Shou; Wang, Jiu-Cun; Chatterjee, Nilanjan; Tucker, Margaret; Wei, Hu; Mitsudomi, Tetsuya; Zheng, Wei; Kim, Jin Hee; Zhou, Baosen; Caporaso, Neil E; Albanes, Demetrius; Shin, Min-Ho; Chung, Lap Ping; An, She-Juan; Wang, Ping; Zheng, Hong; Yatabe, Yasushi; Zhang, Xu-Chao; Kim, Young Tae; Shu, Xiao Ou; Kim, Young-Chul; Bassig, Bryan A.; Chang, Jiang; Ho, James Chung Man; Ji, Bu Tian; Kubo, Michiaki; Daigo, Yataro; Ito, Hidemi; Momozawa, Yukihide; Ashikawa, Kyota; Kamatani, Yoichiro; Honda, Takayuki; Sakamoto, Hiromi; Kunitoh, Hideo; Tsuta, Koji; Watanabe, Shun-Ichi; Nokihara, Hiroshi; Miyagi, Yohei; Nakayama, Haruhiko; Matsumoto, Shingo; Tsuboi, Masahiro; Goto, Koichi; Yin, Zhihua; Shi, Jianxin; Takahashi, Atsushi; Goto, Akiteru; Minamiya, Yoshihiro; Shimizu, Kimihiro; Tanaka, Kazumi; Wu, Tangchun; Wei, Fusheng; Wong, Jason Y Y; Matsuda, Fumihiko; Su, Jian; Kim, Yeul Hong; Oh, In-Jae; Song, Fengju; Lee, Victor Ho Fun; Su, Wu-Chou; Chen, Yuh-Min; Chang, Gee-Chen; Chen, Kuan-Yu; Huang, Ming-Shyan; Yang, Pan-Chyr; Lin, Hsien-Chih; Xiang, Yong-Bing; Seow, Adeline; Park, Jae Yong; Kweon, Sun-Seog; Chen, Chien-Jen; Li, Haixin; Gao, Yu Tang; Wu, Chen; Qian, Biyun; Lu, Daru; Liu, Jianjun; Jeon, Hyo-Sung; Hsiao, Chin-Fu; Sung, Jae Sook; Tsai, Ying-Huang; Jung, Yoo Jin; Guo, Huan; Hu, Zhibin; Wang, Wen-Chang; Chung, Charles C.; Lawrence, Charles; Burdett, Laurie; Yeager, Meredith; Jacobs, Kevin B.; Hutchinson, Amy; Berndt, Sonja I.; He, Xingzhou; Wu, Wei; Wang, Junwen; Li, Yuqing; Choi, Jin Eun; Park, Kyong Hwa; Sung, Sook Whan; Liu, Li; Kang, Chang Hyun; Hu, Lingmin; Chen, Chung-Hsing; Yang, Tsung-Ying; Xu, Jun; Guan, Peng; Tan, Wen; Wang, Chih-Liang; Sihoe, Alan Dart Loon; Chen, Ying; Choi, Yi Young; Hung, Jen-Yu; Kim, Jun Suk; Yoon, Ho-Il; Cai, Qiuyin; Lin, Chien-Chung; Park, In Kyu; Xu, Ping; Dong, Jing; Kim, Christopher; He, Qincheng; Perng, Reury-Perng; Chen, Chih-Yi; Vermeulen, Roel; Wu, Junjie; Lim, Wei-Yen; Chen, Kun-Chieh; Chan, John K C; Chu, Minjie; Li, Yao-Jen; Li, Jihua; Chen, Hongyan; Yu, Chong-Jen; Jin, Li; Lo, Yen-Li; Chen, Ying-Hsiang; Fraumeni, Joseph F.; Liu, Jie; Yamaji, Taiki; Yang, Yang; Hicks, Belynda; Wyatt, Kathleen; Li, Shengchao A; Dai, Juncheng; Ma, Hongxia; Jin, Guangfu; Song, Bao; Wang, Zhehai; Cheng, Sensen; Li, Xuelian; Ren, Yangwu; Cui, Ping; Iwasaki, Motoki; Shimazu, Taichi; Tsugane, Shoichiro; Zhu, Junjie; Jiang, Gening; Fei, Ke; Wu, Guoping; Chien, Li-Hsin; Chen, Hui-Ling; Su, Yu-Chun; Tsai, Fang-Yu; Chen, Yi-Song; Yu, Jinming; Stevens, Victoria L; Laird-Offringa, Ite A; Marconett, Crystal N; Lin, Dongxin; Chen, Kexin; Wu, Yi-Long; Landi, Maria Teresa; Shen, Hongbing; Rothman, Nathaniel; Kohno, Takashi; Chanock, Stephen J.; Lan, Qing

    2017-01-01

    To evaluate associations by EGFR mutation status for lung adenocarcinoma risk among never-smoking Asian women, we conducted a meta-analysis of 11 loci previously identified in genome-wide association studies (GWAS). Genotyping in an additional 10,780 never-smoking cases and 10,938 never-smoking

  18. Previous bacterial infection affects textural quality parameters of heat-treated fillets from rainbow trout (Oncorhynchus mykiss)

    DEFF Research Database (Denmark)

    Ingerslev, Hans-Christian; Hyldig, Grethe; Przybylska, Dominika Alicja

    2012-01-01

    Sensory quality of fish meat is influenced by many parameters prior to slaughter. In the present study, it was examined if previous infections or damages in the muscle tissue influence product quality parameters in fish. Fillets from rainbow trout (Oncorhynchus mykiss) reared in seawater....... This article was the first to describe a correlation between previous infections in fish and changes in sensory-quality parameters. PRACTICAL APPLICATIONS. This work contributes with knowledge about sensory-quality parameters of fish meat after recovery from infections and physical-tissue damage. Because...... the results demonstrate an influence on the texture from previous disease, the practical potentials of the results are valuable for the aquaculture industry. In order to minimize the effects of previous diseases on the sensory quality regarding the texture, these fishes should be processed as cold...

  19. Previous induced abortion among young women seeking abortion-related care in Kenya: a cross-sectional analysis.

    Science.gov (United States)

    Kabiru, Caroline W; Ushie, Boniface A; Mutua, Michael M; Izugbara, Chimaraoke O

    2016-05-14

    Unsafe abortion is a leading cause of death among young women aged 10-24 years in sub-Saharan Africa. Although having multiple induced abortions may exacerbate the risk for poor health outcomes, there has been minimal research on young women in this region who have multiple induced abortions. The objective of this study was therefore to assess the prevalence and correlates of reporting a previous induced abortion among young females aged 12-24 years seeking abortion-related care in Kenya. We used data on 1,378 young women aged 12-24 years who presented for abortion-related care in 246 health facilities in a nationwide survey conducted in 2012. Socio-demographic characteristics, reproductive and clinical histories, and physical examination assessment data were collected from women during a one-month data collection period using an abortion case capture form. Nine percent (n = 98) of young women reported a previous induced abortion prior to the index pregnancy for which they were receiving care. Statistically significant differences by previous history of induced abortion were observed for area of residence, religion and occupation at bivariate level. Urban dwellers and unemployed/other young women were more likely to report a previous induced abortion. A greater proportion of young women reporting a previous induced abortion stated that they were using a contraceptive method at the time of the index pregnancy (47 %) compared with those reporting no previous induced abortion (23 %). Not surprisingly, a greater proportion of young women reporting a previous induced abortion (82 %) reported their index pregnancy as unintended (not wanted at all or mistimed) compared with women reporting no previous induced abortion (64 %). Our study results show that about one in every ten young women seeking abortion-related care in Kenya reports a previous induced abortion. Comprehensive post-abortion care services targeting young women are needed. In particular, post

  20. Identifying avian sources of faecal contamination using sterol analysis.

    Science.gov (United States)

    Devane, Megan L; Wood, David; Chappell, Andrew; Robson, Beth; Webster-Brown, Jenny; Gilpin, Brent J

    2015-10-01

    Discrimination of the source of faecal pollution in water bodies is an important step in the assessment and mitigation of public health risk. One tool for faecal source tracking is the analysis of faecal sterols which are present in faeces of animals in a range of distinctive ratios. Published ratios are able to discriminate between human and herbivore mammal faecal inputs but are of less value for identifying pollution from wildfowl, which can be a common cause of elevated bacterial indicators in rivers and streams. In this study, the sterol profiles of 50 avian-derived faecal specimens (seagulls, ducks and chickens) were examined alongside those of 57 ruminant faeces and previously published sterol profiles of human wastewater, chicken effluent and animal meatwork effluent. Two novel sterol ratios were identified as specific to avian faecal scats, which, when incorporated into a decision tree with human and herbivore mammal indicative ratios, were able to identify sterols from avian-polluted waterways. For samples where the sterol profile was not consistent with herbivore mammal or human pollution, avian pollution is indicated when the ratio of 24-ethylcholestanol/(24-ethylcholestanol + 24-ethylcoprostanol + 24-ethylepicoprostanol) is ≥0.4 (avian ratio 1) and the ratio of cholestanol/(cholestanol + coprostanol + epicoprostanol) is ≥0.5 (avian ratio 2). When avian pollution is indicated, further confirmation by targeted PCR specific markers can be employed if greater confidence in the pollution source is required. A 66% concordance between sterol ratios and current avian PCR markers was achieved when 56 water samples from polluted waterways were analysed.