WorldWideScience

Sample records for prevents nonproductive base-pairing

  1. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  2. 29 CFR 778.318 - Productive and nonproductive hours of work.

    Science.gov (United States)

    2010-07-01

    ... Special Problems Effect of Failure to Count Or Pay for Certain Working Hours § 778.318 Productive and... Act; such nonproductive working hours must be counted and paid for. (b) Compensation payable for... which such nonproductive hours are properly counted as working time but no special hourly rate is...

  3. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

  4. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  5. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  6. Non-Production Benefits of Education: Crime, Health, and Good Citizenship. NBER Working Paper No. 16722

    Science.gov (United States)

    Lochner, Lance

    2011-01-01

    A growing body of work suggests that education offers a wide-range of benefits that extend beyond increases in labor market productivity. Improvements in education can lower crime, improve health, and increase voting and democratic participation. This chapter reviews recent developments on these "non-production" benefits of education with an…

  7. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

    2005-01-01

    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  8. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

    Science.gov (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

    2005-05-04

    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  9. Theoretical study of GC+/GC base pair derivatives

    International Nuclear Information System (INIS)

    Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu

    2005-01-01

    The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives

  10. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  11. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

    Science.gov (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

    2009-03-18

    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  12. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  13. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü

    2017-11-01

    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  14. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

    2005-01-01

    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  15. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  16. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  17. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  18. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    International Nuclear Information System (INIS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

    2015-01-01

    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

  19. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

    Science.gov (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

    2015-01-01

    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  20. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  1. The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Leszczynski, J.

    2001-01-01

    Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

  2. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

    2016-01-01

    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  3. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  4. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

    Science.gov (United States)

    Brovarets', O O

    2013-01-01

    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  6. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  7. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  8. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  9. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

    Science.gov (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

    2015-02-10

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  10. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

    Science.gov (United States)

    2016-01-01

    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  11. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  12. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  13. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  14. Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

    OpenAIRE

    Lang, Gregory I.; Murray, Andrew W.

    2008-01-01

    Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

  15. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

    Science.gov (United States)

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  16. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

    Science.gov (United States)

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

    2014-01-01

    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  17. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

    Science.gov (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

    2011-03-14

    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  18. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  20. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-08

    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  1. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    Science.gov (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  2. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi

    2015-01-01

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  3. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

    Science.gov (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

    2018-05-01

    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  4. Lignin from hydrothermally pretreated grass biomass retards enzymatic cellulose degradation by acting as a physical barrier rather than by inducing nonproductive adsorption of enzymes

    DEFF Research Database (Denmark)

    Djajadi, Demi T.; Jensen, Mads M.; Oliveira, Marlene

    2018-01-01

    Lignin is known to hinder efficient enzymatic conversion of lignocellulose in biorefining processes. In particular, nonproductive adsorption of cellulases onto lignin is considered a key mechanism to explain how lignin retards enzymatic cellulose conversion in extended reactions. Lignin-rich resi...

  5. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

    2002-01-01

    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  6. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

    2011-01-01

    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  7. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

    2008-01-01

    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  8. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2005-01-01

    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  9. Triple helical DNA in a duplex context and base pair opening

    Science.gov (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  10. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

    2012-01-01

    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  11. Accurate interaction energies of base pairing and base stacking. The final chapter

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Jurečka, Petr; Hobza, Pavel

    2005-01-01

    Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

  12. Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

    2000-01-01

    Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

  13. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

    2006-01-01

    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  14. Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

    2012-01-01

    Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

  15. SIMULATION AS AN APPROPRIATE WAY OF VERIFYING THE EFFICIENCY OF PRODUCTION VARIANTS IN THE DESIGN OF PRODUCTION AND NON-PRODUCTION SYSTEMS

    Directory of Open Access Journals (Sweden)

    Marek Kliment

    2014-12-01

    Full Text Available The paper deals with simulation and her forms of use in designing of production and non-production systems. Points to the possibility of using software can help in planning and subsequently in other phase of the lifecycle production and products. Article informs about some of the advantages of this type of software and his options. Sets out some theoretical knowledge of simulation and in the practical part presents some frequently used simulation software.

  16. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

    2012-01-01

    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  17. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

    Science.gov (United States)

    Chakraborty, Debayan; Wales, David J

    2018-01-04

    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  18. Watson-Crick base pairing controls excited-state decay in natural DNA.

    Science.gov (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

    2014-10-13

    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. A rule of seven in Watson-Crick base-pairing of mismatched sequences.

    Science.gov (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

    2012-05-13

    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  20. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    Science.gov (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  2. Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls

    OpenAIRE

    Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David

    2015-01-01

    International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

  3. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  4. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

    2008-01-01

    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  5. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  6. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  7. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  8. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  9. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  10. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

    2006-01-01

    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  11. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

    Science.gov (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

    2004-03-01

    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  12. Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

    Science.gov (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

    2008-11-15

    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  13. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

    OpenAIRE

    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

    2008-01-01

    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  14. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

    Science.gov (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

    2010-08-25

    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  15. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

    OpenAIRE

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  16. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  17. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2012-01-01

    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  18. Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

    Science.gov (United States)

    Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

    2018-02-19

    It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

  19. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

    Science.gov (United States)

    Ishida, Riyoko; Iwahashi, Hideo

    2018-03-01

    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  20. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    International Nuclear Information System (INIS)

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

    1995-01-01

    For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

  1. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

    Science.gov (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

    2013-10-01

    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Base pairing and structural insights into the 5-formylcytosine in RNA duplex

    Science.gov (United States)

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

    2016-01-01

    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  3. Lignin from hydrothermally pretreated grass biomass retards enzymatic cellulose degradation by acting as a physical barrier rather than by inducing nonproductive adsorption of enzymes.

    Science.gov (United States)

    Djajadi, Demi T; Jensen, Mads M; Oliveira, Marlene; Jensen, Anders; Thygesen, Lisbeth G; Pinelo, Manuel; Glasius, Marianne; Jørgensen, Henning; Meyer, Anne S

    2018-01-01

    Lignin is known to hinder efficient enzymatic conversion of lignocellulose in biorefining processes. In particular, nonproductive adsorption of cellulases onto lignin is considered a key mechanism to explain how lignin retards enzymatic cellulose conversion in extended reactions. Lignin-rich residues (LRRs) were prepared via extensive enzymatic cellulose degradation of corn stover ( Zea mays subsp. mays L.), Miscanthus  ×  giganteus stalks (MS) and wheat straw ( Triticum aestivum L.) (WS) samples that each had been hydrothermally pretreated at three severity factors (log R 0 ) of 3.65, 3.83 and 3.97. The LRRs had different residual carbohydrate levels-the highest in MS; the lowest in WS. The residual carbohydrate was not traceable at the surface of the LRRs particles by ATR-FTIR analysis. The chemical properties of the lignin in the LRRs varied across the three types of biomass, but monolignols composition was not affected by the severity factor. When pure cellulose was added to a mixture of LRRs and a commercial cellulolytic enzyme preparation, the rate and extent of glucose release were unaffected by the presence of LRRs regardless of biomass type and severity factor, despite adsorption of the enzymes to the LRRs. Since the surface of the LRRs particles were covered by lignin, the data suggest that the retardation of enzymatic cellulose degradation during extended reaction on lignocellulosic substrates is due to physical blockage of the access of enzymes to the cellulose caused by the gradual accumulation of lignin at the surface of the biomass particles rather than by nonproductive enzyme adsorption. The study suggests that lignin from hydrothermally pretreated grass biomass retards enzymatic cellulose degradation by acting as a physical barrier blocking the access of enzymes to cellulose rather than by inducing retardation through nonproductive adsorption of enzymes.

  4. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  5. NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

    International Nuclear Information System (INIS)

    Li, Ying; Wilson, W.D.; Zon, G.

    1991-01-01

    1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

  6. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

    2010-01-01

    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  7. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    Science.gov (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  8. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  9. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

    Science.gov (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

    2017-02-01

    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  10. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit

    2018-01-02

    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  11. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

    Science.gov (United States)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

    2018-02-01

    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  12. Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

    Directory of Open Access Journals (Sweden)

    Ol'ha O. Brovarets'

    2018-02-01

    Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

  13. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2015-01-01

    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  14. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  15. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  16. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Directory of Open Access Journals (Sweden)

    Aleksandra Delplanque

    Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

  17. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Science.gov (United States)

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek

    2015-01-01

    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  18. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles.

    Science.gov (United States)

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal

    2016-07-14

    Ice nanoparticles (H2O)N, N ≈ 450 generated in a molecular beam experiment pick up individual gas phase molecules of 2-hydroxypyridine and 2-pyridone (HP) evaporated in a pickup cell at temperatures between 298 and 343 K. The mass spectra of the doped nanoparticles show evidence for generation of clusters of adsorbed molecules (HP)n up to n = 8. The clusters are ionized either by 70 eV electrons or by two photons at 315 nm (3.94 eV). The two ionization methods yield different spectra, and their comparison provides an insight into the neutral cluster composition, ionization and intracluster ion-molecule reactions, and cluster fragmentation. Quite a few molecules were reported not to coagulate on ice nanoparticles previously. The (HP)n cluster generation on ice nanoparticles represents the first evidence for coagulating of molecules and cluster formation on free ice nanoparticles. For comparison, we investigate the coagulation of HP molecules picked up on large clusters ArN, N ≈ 205, and also (HP)n clusters generated in supersonic expansions with Ar buffer gas. This comparison points to a propensity for the (HP)2 dimer generation on ice nanoparticles. This shows the feasibility of base pairing for model of biological molecules on free ice nanoparticles. This result is important for hypotheses of the biomolecule synthesis on ice grains in the space. We support our findings by theoretical calculations that show, among others, the HP dimer structures on water clusters.

  19. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  20. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    International Nuclear Information System (INIS)

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

    2010-01-01

    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  1. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  2. Interactions between Cellulolytic Enzymes with Native, Autohydrolysis, and Technical Lignins and the Effect of a Polysorbate Amphiphile in Reducing Nonproductive Binding.

    Science.gov (United States)

    Fritz, Consuelo; Ferrer, Ana; Salas, Carlos; Jameel, Hasan; Rojas, Orlando J

    2015-12-14

    Understanding enzyme-substrate interactions is critical in designing strategies for bioconversion of lignocellulosic biomass. In this study we monitored molecular events, in situ and in real time, including the adsorption and desorption of cellulolytic enzymes on lignins and cellulose, by using quartz crystal microgravimetry and surface plasmon resonance. The effect of a nonionic surface active molecule was also elucidated. Three lignin substrates relevant to the sugar platform in biorefinery efforts were considered, namely, hardwood autohydrolysis cellulolytic (HWAH), hardwood native cellulolytic (MPCEL), and nonwood native cellulolytic (WSCEL) lignin. In addition, Kraft lignins derived from softwoods (SWK) and hardwoods (HWK) were used as references. The results indicated a high affinity between the lignins with both, monocomponent and multicomponent enzymes. More importantly, the addition of nonionic surfactants at concentrations above their critical micelle concentration reduced remarkably (by over 90%) the nonproductive interactions between the cellulolytic enzymes and the lignins. This effect was hypothesized to be a consequence of the balance of hydrophobic and hydrogen bonding interactions. Moreover, the reduction of surface roughness and increased wettability of lignin surfaces upon surfactant treatment contributed to a lower affinity with the enzymes. Conformational changes of cellulases were observed upon their adsorption on lignin carrying preadsorbed surfactant. Weak electrostatic interactions were determined in aqueous media at pH between 4.8 and 5.5 for the native cellulolytic lignins (MPCEL and WSCEL), whereby a ∼20% reduction in the enzyme affinity was observed. This was mainly explained by electrostatic interactions (osmotic pressure effects) between charged lignins and cellulases. Noteworthy, adsorption of nonionic surfactants onto cellulose, in the form cellulose nanofibrils, did not affect its hydrolytic conversion. Overall, our results

  3. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2013-01-01

    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  4. A 3-base pair deletion, c.9711_9713del, in DMD results in intellectual disability without muscular dystrophy

    NARCIS (Netherlands)

    Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.

    2014-01-01

    We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,

  5. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  6. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

    1994-01-01

    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  7. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

    International Nuclear Information System (INIS)

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

    2017-01-01

    Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

  8. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

    Science.gov (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming

    2012-11-21

    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  9. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

    Science.gov (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2015-11-02

    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

    Science.gov (United States)

    Xia, Shuangluo; Konigsberg, William H

    2014-04-01

    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  11. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

    Science.gov (United States)

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

    2013-07-16

    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  12. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    International Nuclear Information System (INIS)

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-01-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

  13. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  14. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

    Science.gov (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

    2015-12-01

    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

    Science.gov (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

    2014-02-24

    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  18. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

    2015-01-01

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  19. Prevention

    DEFF Research Database (Denmark)

    Halken, S; Høst, A

    2001-01-01

    , breastfeeding should be encouraged for 4-6 months. In high-risk infants a documented extensively hydrolysed formula is recommended if exclusive breastfeeding is not possible for the first 4 months of life. There is no evidence for preventive dietary intervention neither during pregnancy nor lactation...... populations. These theories remain to be documented in proper, controlled and prospective studies. Breastfeeding and the late introduction of solid foods (>4 months) is associated with a reduced risk of food allergy, atopic dermatitis, and recurrent wheezing and asthma in early childhood. In all infants....... Preventive dietary restrictions after the age of 4-6 months are not scientifically documented....

  20. UV-inactivation of Epstein-Barr virus: differences in early antigen expression in two different non-productive cell lines and influence of caffeine

    International Nuclear Information System (INIS)

    Suchankova, A.; Vonka, V.

    1978-01-01

    Two non-productive Epstein-Barr (EB) virus genome-carrying lymphoblastoid cell lines, namely Raji and NC37, were used for studying the effect of UV irradiation on the ability of P3HR-1 EB virus to induce early antigen (EA) formation. In NC37 cells infected with UV-irradiated virus the formation of EA was delayed; thus the slope of inactivation curve based on the early (24 hr) reading was steeper than that based on the late (72 hr) reading. This was not observed in Raji cells. Caffeine did not influence the percentage of EA positive cells in cultures infected with untreated virus; however, the drug exhibited a marked inhibitory effect on EA production after infection with UV-irradiated virus. The sensitivity to caffeine decreased more rapidly with time after infection of Raji than of NC37 cells, suggesting a higher degree of readiness of the host cell repair system in the former than in the latter cells. The caffeine effect was merely directed against the synthesis of R (restricted) component of EA; its influence on the D (diffuse) component formation was negligible. (author)

  1. Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

    Science.gov (United States)

    Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

    1984-06-19

    The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  3. Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

    Directory of Open Access Journals (Sweden)

    Sergei Kuchin

    2011-03-01

    Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

  4. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

    Science.gov (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

    2010-08-18

    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  5. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    Energy Technology Data Exchange (ETDEWEB)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

    2016-02-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  6. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    International Nuclear Information System (INIS)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

    2016-01-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

  7. Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

    International Nuclear Information System (INIS)

    Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.

    2003-01-01

    Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

  8. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

    Science.gov (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

    2015-04-01

    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

  9. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

    Science.gov (United States)

    Brovarets', O O; Hovorun, D M

    2010-01-01

    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  10. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    Science.gov (United States)

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  11. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  12. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

    Science.gov (United States)

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

    2011-01-01

    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  13. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu

    2012-08-01

    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  14. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    Science.gov (United States)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  15. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

    Science.gov (United States)

    Mondal Roy, Sutapa

    2018-08-01

    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

    Science.gov (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

    2010-07-29

    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

  17. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

    Science.gov (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

    2007-05-17

    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  18. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    Science.gov (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  19. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

    Science.gov (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

    2017-11-02

    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  1. NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

    Science.gov (United States)

    Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

    1998-01-01

    This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

  2. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

    Science.gov (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  4. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. A Novel Mechanism of High-Level, Broad-Spectrum Antibiotic Resistance Caused by a Single Base Pair Change in Neisseria gonorrhoeae

    Science.gov (United States)

    2011-09-20

    respect, Eisenstein and Sparling noted that a single base pair deletion in the inverted repeat in the mtrR promoter, a mutation which also confers high...Regulation of the MtrC-MtrD-MtrE efflux-pump system modulates the in vivo fitness of Neisseria gonorrhoeae. J. Infect. Dis. 196:1804 –1812. 21. Eisenstein BI

  6. High-Resolution Nuclear Magnetic Resonance Determination of Transfer RNA Tertiary Base Pairs in Solution. 2. Species Containing a Large Variable Loop

    NARCIS (Netherlands)

    HURD, RE; ROBILLARD, GT; REID, BR

    1977-01-01

    The number of base pairs in the solution structure of several class III D3VN tRNA species from E. coli has been determined by analyzing the number of low-field (-15 to -11 ppm) proton resonances in their nuclear magnetic resonance spectra at 360 MHz. Contrary to previous reports indicating the

  7. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    Science.gov (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Structures, physicochemical properties, and applications of T-Hg-II-T, C-Ag-I-C, and other metallo-base-pairs

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.

    2015-01-01

    Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015

  9. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    Science.gov (United States)

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

    2016-01-01

    Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  11. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    Science.gov (United States)

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  12. Deficient incorporation of spike protein into virions contributes to the lack of infectivity following establishment of a persistent, non-productive infection in oligodendroglial cell culture by murine coronavirus

    International Nuclear Information System (INIS)

    Liu Yin; Herbst, Werner; Cao Jianzhong; Zhang Xuming

    2011-01-01

    Infection of mouse oligodendrocytes with a recombinant mouse hepatitis virus (MHV) expressing a green fluorescence protein facilitated specific selection of virus-infected cells and subsequent establishment of persistence. Interestingly, while viral genomic RNAs persisted in infected cells over 14 subsequent passages with concomitant synthesis of viral subgenomic mRNAs and structural proteins, no infectious virus was isolated beyond passage 2. Further biochemical and electron microscopic analyses revealed that virions, while assembled, contained little spike in the envelope, indicating that lack of infectivity during persistence was likely due to deficiency in spike incorporation. This type of non-lytic, non-productive persistence in oligodendrocytes is unique among animal viruses and resembles MHV persistence previously observed in the mouse central nervous system. Thus, establishment of such a culture system that can recapitulate the in vivo phenomenon will provide a powerful approach for elucidating the mechanisms of coronavirus persistence in glial cells at the cellular and molecular levels.

  13. Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

    Science.gov (United States)

    Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

    2012-09-12

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

  14. Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

    Science.gov (United States)

    Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

    2012-01-01

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

  15. The base pairing RNA Spot 42 participates in a multi-output feedforward loop to help enact catabolite repression in Escherichia coli

    Science.gov (United States)

    Beisel, Chase L.; Storz, Gisela

    2011-01-01

    SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161

  16. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

    Science.gov (United States)

    Guo, Xiurong; Seela, Frank

    2017-09-04

    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Systematic exploration of a class of hydrophobic unnatural base pairs yields multiple new candidates for the expansion of the genetic alphabet

    Czech Academy of Sciences Publication Activity Database

    Dhami, K.; Malyshev, D. A.; Ordoukhanian, P.; Kubelka, Tomáš; Hocek, Michal; Romesberg, F. E.

    2014-01-01

    Roč. 42, č. 16 (2014), s. 10235-10244 ISSN 0305-1048 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : unnatural base pairs * DNA * dTPT3-dNaM Subject RIV: CE - Biochemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/16/10235

  18. The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair.

    Science.gov (United States)

    Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

    2017-05-01

    Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  19. Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

  20. Development of a novel method to determine the concentration of heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

    Science.gov (United States)

    Kozasa, Tetsuo; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Torigoe, Hidetaka

    2009-01-01

    We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel sensor to determine the concentration of each of Hg(II) and Ag(I) cation. The sensor is composed of a dye-labelled T-rich or C-rich DNA oligonucleotide, F2T6W2D: 5'-Fam-T(2)CT(2)CT(2)C(4)T(2)GT(2)GT(2)-Dabcyl-3' or F2C6W2D: 5'-Fam-C(2)TC(2)TC(2)T(4)C(2)AC(2)AC(2)-Dabcyl-3', where 6-carboxyfluorescein (Fam) is a fluorophore and Dabcyl is a quencher. The addition of Hg(II) cation decreased the intensity of Fam emission of F2T6W2D at 520 nm in a concentration-dependent manner. Also, the addition of Ag(I) cation decreased the intensity of Fam emission of F2C6W2D at 520 nm in a concentration-dependent manner. We conclude that, using the novel sensor developed in this study, the concentration of each of Hg(II) and Ag(I) cation can be determined from the intensity of Fam emission at 520 nm.

  1. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    Energy Technology Data Exchange (ETDEWEB)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

    2016-04-19

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

  2. Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

    Science.gov (United States)

    Romero, Eduardo E; Hernandez, Florencio E

    2018-01-03

    Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

  3. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

    Science.gov (United States)

    Bende, Attila; Muntean, Cristina M

    2014-03-01

    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  4. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

    2002-01-01

    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  6. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  7. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  8. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    Science.gov (United States)

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  9. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    Science.gov (United States)

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  10. Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

    KAUST Repository

    Basset, Jean-Marie

    2016-06-09

    The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

  11. Determination of h2JNN and h1JHN coupling constants across Watson-Crick base pairs in the Antennapedia homeodomain-DNA complex using TROSY

    International Nuclear Information System (INIS)

    Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt

    2000-01-01

    This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds

  12. Interactions between Al₁₂X (X = Al, C, N and P) nanoparticles and DNA nucleobases/base pairs: implications for nanotoxicity.

    Science.gov (United States)

    Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang

    2012-02-01

    The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.

  13. Physical mapping of a 330 X 10(3)-base-pair region of the Myxococcus xanthus chromosome that is preferentially labeled during spore germination

    International Nuclear Information System (INIS)

    Komano, T.; Inouye, S.; Inouye, M.

    1985-01-01

    Myxococcus xanthus was pulse-labeled with [ 3 H]thymidine immediately after germination of dimethyl sulfoxide-induced spores. The restriction enzyme digests of the total chromosomal DNA from the pulse- labeled cells were analyzed by one-dimensional as well as two- dimensional agarose gel electrophoresis. Four PstI fragments preferentially labeled at a very early stage of germination were cloned into the unique PstI site of pBR322. By using these clones as probes, a restriction enzyme map was established covering approximately 6% of the total M. xanthus genome (330 X 10(3) base pairs). The distribution of the specific activities of the restriction fragments pulse-labeled after germination suggests a bidirectional mode of DNA replication from a fixed origin

  14. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study.

    Science.gov (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta

    2017-08-01

    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  15. Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

    Science.gov (United States)

    Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

    2005-01-01

    Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

  16. Theoretical study on the structure, stability, and electronic properties of the guanine-Zn-cytosine base pair in M-DNA

    International Nuclear Information System (INIS)

    Fuentes-Cabrera, Miguel A.; Sumpter, Bobby G.; Sponer, Judit; Sponer, Jiri; Petit, Leon; Wells, Jack C.

    2007-01-01

    M-DNA is a type of metalated DNA that forms at high pH and in the presence of Zn, Ni, and Co, with the metals placed in between each base pair, as in G-Zn-C. Experiments have found that M-DNA could be a promising candidate for a variety of nanotechnological applications, as it is speculated that the metal d-states enhance the conductivity, but controversy still clouds these findings. In this paper, we carry out a comprehensive ab initio study of eight G-Zn-C models in the gas phase to help discern the structure and electronic properties of Zn-DNA. Specifically, we study whether a model prefers to be planar and has electronic properties that correlate with Zn-DNA having a metallic-like conductivity. Out of all the studied models, there is only one which preserves its planarity upon full geometry optimization. Nevertheless, starting from this model, one can deduce a parallel Zn-DNA architecture only. This duplex would contain the imino proton, in contrast to what has been proposed experimentally. Among the nonplanar models, there is one that requires less than 8 kcal/mol to flatten (both in gas and solvent conditions), and we propose that it is a plausible model for building an antiparallel duplex. In this duplex, the imino proton would be replaced by Zn, in accordance with experimental models. Neither planar nor nonplanar models have electronic properties that correlate with Zn-DNA having a metallic-like conductivity due to Zn d-states. To understand whether density functional theory (DFT) can describe appropriately the electronic properties of M-DNAs, we have investigated the electronic properties of G-Co-C base pairs. We have found that when self-interaction corrections (SIC) are not included the HOMO state contains Co d-levels, whereas these levels are moved below the HOMO state when SIC are considered. This result indicates that caution should be exercised when studying the electronic properties of M-DNAs with functionals that do not account for strong

  17. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine–cytosine base pair: Ring-polymer and classical molecular dynamics simulations

    Energy Technology Data Exchange (ETDEWEB)

    Minoshima, Yusuke; Seki, Yusuke [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Takayanagi, Toshiyuki, E-mail: tako@mail.saitama-u.ac.jp [Department of Chemistry, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama City, Saitama 338-8570 (Japan); Shiga, Motoyuki [Center for Computational Science and E-Systems, Japan Atomic Energy Agency, 148-4, Kashiwanoha Campus, 178-4 Wakashiba, Kashiwa, Chiba 277-0871 (Japan)

    2016-06-15

    Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  18. A Single Base Pair Mutation Encoding a Premature Stop Codon in the MIS type II receptor is Responsible for Canine Persistent Müllerian Duct Syndrome

    Science.gov (United States)

    Wu, Xiufeng; Wan, Shengqin; Pujar, Shashikant; Haskins, Mark E.; Schlafer, Donald H.; Lee, Mary M.; Meyers-Wallen, Vicki N.

    2008-01-01

    Müllerian Inhibiting Substance (MIS), a secreted glycoprotein in the Transforming Growth Factor-beta (TGF-beta) family of growth factors, mediates regression of the Müllerian ducts during embryonic sex differentiation in males. In Persistent Müllerian Duct Syndrome (PMDS), rather than undergoing involution, the Müllerian ducts persist in males, giving rise to the uterus, Fallopian tubes, and upper vagina. Genetic defects in MIS or its receptor (MISRII) have been identified in patients with PMDS. The phenotype in the canine model of PMDS derived from the miniature schnauzer breed is strikingly similar to that of human patients. In this model, PMDS is inherited as a sex-limited autosomal recessive trait. Previous studies indicated that a defect in the MIS receptor or its downstream signaling pathway was likely to be causative of the canine syndrome. In this study the canine PMDS phenotype and clinical sequelae are described in detail. Affected and unaffected members of this pedigree are genotyped, identifying a single base pair substitution in MISRII that introduces a stop codon in exon 3. The homozygous mutation terminates translation at 80 amino acids, eliminating much of the extracellular domain and the entire transmembrane and intracellular signaling domains. Findings in this model may enable insights to be garnered from correlation of detailed clinical descriptions with molecular defects, which are not otherwise possible in the human syndrome. PMID:18723470

  19. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    International Nuclear Information System (INIS)

    Bricault, Christine A.; Perry, Keith L.

    2013-01-01

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility

  20. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    Science.gov (United States)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-01-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

  1. TALEN-mediated single-base-pair editing identification of an intergenic mutation upstream of BUB1B as causative of PCS (MVA) syndrome

    Science.gov (United States)

    Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya

    2014-01-01

    Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301

  2. Effects of temperature and isotopic substitution on electron attachment dynamics of guanine–cytosine base pair: Ring-polymer and classical molecular dynamics simulations

    International Nuclear Information System (INIS)

    Minoshima, Yusuke; Seki, Yusuke; Takayanagi, Toshiyuki; Shiga, Motoyuki

    2016-01-01

    Highlights: • Dynamics of excess electron attachment to guanine–cytosine base pair. • Ring-polymer and classical molecular dynamics simulations are performed. • Temperature and isotope substitution effects are investigated. - Abstract: The dynamical process of electron attachment to a guanine–cytosine pair in the normal (h-GC) and deuterated (d-GC) forms has been studied theoretically by semiclassical ring-polymer molecular dynamics (RPMD) simulations using the empirical valence bond model. The initially formed dipole-bound anion is converted rapidly to the valence-bound anion within about 0.1 ps in both h-GC and d-GC. However, the subsequent proton transfer in h-GC occurs with a rate five times greater than the deuteron transfer in d-GC. The change of rates with isotopic substitution and temperature variation in the RPMD simulations are quantitatively and qualitatively different from those in the classical molecular dynamics (MD) simulations, demonstrating the importance of nuclear quantum effects on the dynamics of this system.

  3. The Importance of Electron Correlation on Stacking Interaction of Adenine-Thymine Base-Pair Step in B-DNA: A Quantum Monte Carlo Study.

    Science.gov (United States)

    Hongo, Kenta; Cuong, Nguyen Thanh; Maezono, Ryo

    2013-02-12

    We report fixed-node diffusion Monte Carlo (DMC) calculations of stacking interaction energy between two adenine(A)-thymine(T) base pairs in B-DNA (AA:TT), for which reference data are available, obtained from a complete basis set estimate of CCSD(T) (coupled-cluster with singles, doubles, and perturbative triples). We consider four sets of nodal surfaces obtained from self-consistent field calculations and examine how the different nodal surfaces affect the DMC potential energy curves of the AA:TT molecule and the resulting stacking energies. We find that the DMC potential energy curves using the different nodes look similar to each other as a whole. We also benchmark the performance of various quantum chemistry methods, including Hartree-Fock (HF) theory, second-order Møller-Plesset perturbation theory (MP2), and density functional theory (DFT). The DMC and recently developed DFT results of the stacking energy reasonably agree with the reference, while the HF, MP2, and conventional DFT methods give unsatisfactory results.

  4. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    Energy Technology Data Exchange (ETDEWEB)

    Bricault, Christine A. [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States); Perry, Keith L., E-mail: KLP3@cornell.edu [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States)

    2013-06-05

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.

  5. A single base-pair change in 2009 H1N1 hemagglutinin increases human receptor affinity and leads to efficient airborne viral transmission in ferrets.

    Directory of Open Access Journals (Sweden)

    Akila Jayaraman

    2011-03-01

    Full Text Available The 2009 H1N1 influenza A virus continues to circulate among the human population as the predominant H1N1 subtype. Epidemiological studies and airborne transmission studies using the ferret model have shown that the transmission efficiency of 2009 H1N1 viruses is lower than that of previous seasonal strains and the 1918 pandemic H1N1 strain. We recently correlated this reduced transmission efficiency to the lower binding affinity of the 2009 H1N1 hemagglutinin (HA to α2→6 sialylated glycan receptors (human receptors. Here we report that a single point mutation (Ile219→Lys; a base pair change in the glycan receptor-binding site (RBS of a representative 2009 H1N1 influenza A virus, A/California/04/09 or CA04/09, quantitatively increases its human receptor-binding affinity. The increased human receptor-affinity is in the same range as that of the HA from highly transmissible seasonal and 1918 pandemic H1N1 viruses. Moreover, a 2009 H1N1 virus carrying this mutation in the RBS (generated using reverse genetics transmits efficiently in ferrets by respiratory droplets thereby reestablishing our previously observed correlation between human receptor-binding affinity and transmission efficiency. These findings are significant in the context of monitoring the evolution of the currently circulating 2009 H1N1 viruses.

  6. Cyclic AMP regulation of the human glycoprotein hormone α-subunit gene is mediated by an 18-base-pair element

    International Nuclear Information System (INIS)

    Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.

    1987-01-01

    cAMP regulates transcription of the gene encoding the α-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the α-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the α-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the α-subunit gene

  7. Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

    2012-01-01

    P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

  8. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  9. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni; Riplinger, Christoph; Minenkov, Yury; Cavallo, Luigi; Auer, Alexander A.; Neese, Frank

    2017-01-01

    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  10. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni

    2017-06-12

    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  11. A one base pair deletion in the canine ATP13A2 gene causes exon skipping and late-onset neuronal ceroid lipofuscinosis in the Tibetan terrier.

    Directory of Open Access Journals (Sweden)

    Anne Wöhlke

    2011-10-01

    Full Text Available Neuronal ceroid lipofuscinosis (NCL is a progressive neurodegenerative disease characterized by brain and retinal atrophy and the intracellular accumulation of autofluorescent lysosomal storage bodies resembling lipofuscin in neurons and other cells. Tibetan terriers show a late-onset lethal form of NCL manifesting first visible signs at 5-7 years of age. Genome-wide association analyses for 12 Tibetan-terrier-NCL-cases and 7 Tibetan-terrier controls using the 127K canine Affymetrix SNP chip and mixed model analysis mapped NCL to dog chromosome (CFA 2 at 83.71-84.72 Mb. Multipoint linkage and association analyses in 376 Tibetan terriers confirmed this genomic region on CFA2. A mutation analysis for 14 positional candidate genes in two NCL-cases and one control revealed a strongly associated single nucleotide polymorphism (SNP in the MAPK PM20/PM21 gene and a perfectly with NCL associated single base pair deletion (c.1620delG within exon 16 of the ATP13A2 gene. The c.1620delG mutation in ATP13A2 causes skipping of exon 16 presumably due to a broken exonic splicing enhancer motif. As a result of this mutation, ATP13A2 lacks 69 amino acids. All known 24 NCL cases were homozygous for this deletion and all obligate 35 NCL-carriers were heterozygous. In a sample of 144 dogs from eleven other breeds, the c.1620delG mutation could not be found. Knowledge of the causative mutation for late-onset NCL in Tibetan terrier allows genetic testing of these dogs to avoid matings of carrier animals. ATP13A2 mutations have been described in familial Parkinson syndrome (PARK9. Tibetan terriers with these mutations provide a valuable model for a PARK9-linked disease and possibly for manganese toxicity in synucleinopathies.

  12. Influence of nucleotide modifications at the C2' position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA.

    Science.gov (United States)

    Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle

    2017-09-29

    Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  14. Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

    Science.gov (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M

    2014-01-01

    The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

  15. Identification of the base-pairing requirements for repression of hctA translation by the small RNA IhtA leads to the discovery of a new mRNA target in Chlamydia trachomatis.

    Directory of Open Access Journals (Sweden)

    Nicole A Grieshaber

    Full Text Available The non-coding small RNA, IhtA expressed by the obligate intracellular human pathogen Chlamydia trachomatis modulates the translation of HctA, a key protein involved in replicative to infectious cell type differentiation. Using a combination of bioinformatics and mutagenesis we sought to identify the base pairing requirement for functional repression of HctA protein expression, with an eye to applying our findings towards the identification of additional targets. IhtA is predicted to fold into a three stem:loop structure. We found that loop 1 occludes the initiation codon of hctA, while loop 2 and 3 are not required for function. This 7 nucleotide region forms G/C rich interactions surrounding the AUG of hctA. Two additional genes in the chlamydial genome, CTL0322 and CTL0097, contained some elements of the hctA:IhtA recognition sequence. The mRNA of both CTL0322and CTL0097 interacted with IhtA in vitro as measured by biolayer interferometry. However, using a CheZ reporter expression system, IhtA only inhibited the translation of CTL0322. The proposed IhtA recognition site in the CTL0322 message contains significant G/C base pairing on either side of the initiation codon while CTL0097 only contains G/C base pairing 3' to the AUG initiation codon. These data suggest that as the functional interacting region is only 6-7nt in length that full translation repression is dependent on the degree of G/C base pairing. Additionally our results indicate that IhtA may regulate multiple mRNAs involved in the chlamydial infectious cycle.

  16. DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

    Science.gov (United States)

    Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

    2014-04-01

    The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

  17. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

    1988-01-01

    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  18. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  19. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  20. Recent developments in the DOE Waste Minimization Pollution Prevention Program

    International Nuclear Information System (INIS)

    Hancock, J.K.

    1993-01-01

    The U.S. Department of Energy (DOE) is involved in a wide variety of research and development, remediation, and production activities at more than 100 sites throughout the United States. The wastes generated cover a diverse spectrum of sanitary, hazardous, and radioactive waste streams, including typical office environments, power generation facilities, laboratories, remediation sites, production facilities, and defense facilities. The DOE's initial waste minimization activities pre-date the Pollution Prevention Act of 1990 and focused on the defense program. Little emphasis was placed on nonproduction activities. In 1991 the Office of Waste Management Operations developed the Waste Minimization Division with the intention of coordinating and expanding the waste minimization pollution prevention approach to the entire complex. The diverse nature of DOE activities has led to several unique problems in addressing the needs of waste minimization and pollution prevention. The first problem is developing a program that addresses the geographical and institutional hurdles that exist; the second is developing a monitoring and reporting mechanism that one can use to assess the overall performance of the program

  1. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  3. Rapid detection of the H275Y oseltamivir resistance mutation in influenza A/H1N1 2009 by single base pair RT-PCR and high-resolution melting.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We aimed to design a real-time reverse-transcriptase-PCR (rRT-PCR, high-resolution melting (HRM assay to detect the H275Y mutation that confers oseltamivir resistance in influenza A/H1N1 2009 viruses.A novel strategy of amplifying a single base pair, the relevant SNP at position 823 of the neuraminidase gene, was chosen to maintain specificity of the assay. Wildtype and mutant virus were differentiated when using known reference samples of cell-cultured virus. However, when dilutions of these reference samples were assayed, amplification of non-specific primer-dimer was evident and affected the overall melting temperature (T(m of the amplified products. Due to primer-dimer appearance at >30 cycles we found that if the cycle threshold (C(T for a dilution was >30, the HRM assay did not consistently discriminate mutant from wildtype. Where the C(T was 32.98 would have an H275Y assay C(T>30. Analysis of the TaqMan C(T values for 609 consecutive clinical samples predicted that 207 (34% of the samples would result in an HRM assay C(T>30 and therefore not be amenable to the HRM assay.The use of single base pair PCR and HRM can be useful for specifically interrogating SNPs. When applied to H1N1 09, the constraints this placed on primer design resulted in amplification of primer-dimer products. The impact primer-dimer had on HRM curves was adjusted for by plotting T(m against C(T. Although less sensitive than TaqMan assays, the HRM assay can rapidly, and at low cost, screen samples with moderate viral concentrations.

  4. Kinetics for exchange of imino protons in the d(C-G-C-G-A-A-T-T-C-G-C-G) double helix and in two similar helices that contain a G . T base pair, d(C-G-T-G-A-A-T-T-C-G-C-G), and an extra adenine, d(C-G-C-A-G-A-A-T-T-C-G-C-G).

    Science.gov (United States)

    Pardi, A; Morden, K M; Patel, D J; Tinoco, I

    1982-12-07

    The relaxation lifetimes of imino protons from individual base pairs were measured in (I) a perfect helix, d(C-G-C-G-A-A-T-T-C-G-C-G), (II) this helix with a G . C base pair replaced with a G . T base pair, d(C-G-T-G-A-A-T-T-C-G-C-G), and (III) the perfect helix with an extra adenine base in a mismatch, d(C-G-C-A-G-A-A-T-T-C-G-C-G). The lifetimes were measured by saturation recovery proton nuclear magnetic resonance experiments performed on the imino protons of these duplexes. The measured lifetimes of the imino protons were shown to correspond to chemical exchange lifetimes at higher temperatures and spin-lattice relaxation times at lower temperatures. Comparison of the lifetimes in these duplexes showed that the destabilizing effect of the G . T base pair in II affected the opening rate of only the nearest-neighbor base pairs. For helix III, the extra adenine affected the opening rates of all the base pairs in the helix and thus was a larger perturbation for opening of the base pairs than the G . T base pair. The temperature dependence of the exchange rates of the imino proton in the perfect helix gives values of 14-15 kcal/mol for activation energies of A . T imino protons. These relaxation rates were shown to correspond to exchange involving individual base pair opening in this helix, which means that one base-paired imino proton can exchange independent of the others. For the other two helices that contain perturbations, much larger activation energies for exchange of the imino protons were found, indicating that a cooperative transition involving exchange of at least several base pairs was the exchange mechanism of the imino protons. The effects of a perturbation in a helix on the exchange rates and the mechanisms for exchange of imino protons from oligonucleotide helices are discussed.

  5. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  6. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  7. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

    Science.gov (United States)

    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

    2009-11-23

    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  8. Effect of the sulphur atom on geometry and spectra of the biomolecule 2-thiouracil and in the WC base pair 2-thiouridine-adenosine. Influence of water in the first hydration shell.

    Science.gov (United States)

    Alcolea Palafox, M; Rastogi, V K; Singh, S P

    2018-04-01

    The effect of the sulphur atom on 2-thiouracil (2TU) and 2-thiouridine molecules, as compared with uracil and uridine molecules, respectively, was carried out in several environments. The predicted IR spectrum of 2TU in the isolated state was compared with that obtained for uracil molecule and with those reported experimentally in matrix isolation. Its crystal unit cell in the solid state was simulated through a tetramer form using DFT methods for the first time. The calculated Raman spectrum was compared to the experimental ones in the solid state. A linear scaling procedure was used for this task. The first hydration shell was simulated by explicit number of water molecules surrounding 2TU up to 30 and was compared with that obtained in uracil molecule. Water molecules 'distributed' around 2TU was preferred over that 'clustering', because it can better reproduce the hydration and their effects on different parameters of the molecular structure of 2TU and uracil. The total atomic charges and several calculated thermodynamic parameters were discussed. The effect of the sulphur atom on the Watson-Crick (WC) and reverse WC base pair uridine-adenosine was estimated, and the CP corrected interaction energies were calculated. 2-thiouridine has a weaker WC pair than that with uridine, although its slight higher dipole moment (μ) facilitates the interaction with the water molecules. Several helical parameters were determined.

  9. Salmonella Prevention

    Science.gov (United States)

    ... and in vegetable and fruit harvesting and packing operations may help prevent salmonellosis caused by contaminated foods. Better education of food industry workers in basic food safety and restaurant inspection procedures may prevent cross-contamination and other ...

  10. Prevention: Exercise

    Medline Plus

    Full Text Available ... Steroid Injections Lumbar Zygapophysical (Facet) Joint Injections PREVENTION Lifestyle Choices 10 Tips for a Healthy Back Smoking Weight Patient Safety Exercise Strengthening Strengthen ...

  11. Preventative Maintenance.

    Science.gov (United States)

    Migliorino, James

    Boards of education must be convinced that spending money up front for preventive maintenance will, in the long run, save districts' tax dollars. A good program of preventive maintenance can minimize disruption of service; reduce repair costs, energy consumption, and overtime; improve labor productivity and system equipment reliability; handle…

  12. Preventive analgesia

    DEFF Research Database (Denmark)

    Dahl, Jørgen B; Kehlet, Henrik

    2011-01-01

    This paper will discuss the concepts of pre-emptive and preventive analgesia in acute and persistent postsurgical pain, based on the most recent experimental and clinical literature, with a special focus on injury-induced central sensitization and the development from acute to chronic pain. Recent...... of preventive analgesia for persistent postoperative pain are promising. However, clinicians must be aware of the demands for improved design of their clinical studies in order to get more conclusive answers regarding the different avenues for intervention. Summary: The concept of preventive analgesia is still...

  13. Prevention: Exercise

    Medline Plus

    Full Text Available ... Tips for a Healthy Back Smoking Weight Patient Safety Exercise Strengthening Strengthen Your Core! Stretching/Flexibility Aerobic ... Strength Training for the Elderly Other Back Pack Safety Pregnancy and Back Pain Preventing Osteoporosis Back Pain ...

  14. Preventing Rejection

    Science.gov (United States)

    ... After the transplant Preventing rejection Post-transplant medications Types of immunosuppressants Switching immunosuppressants Side effects Other medications Generic and brand name drugs Post-transplant tests Infections and immunity Lifestyle changes Health concerns Back to work or ...

  15. Prevent Cyberbullying

    Science.gov (United States)

    ... Tips for Teachers Report Cyberbullying Print Share Prevent Cyberbullying Be Aware of What Your Kids are Doing ... Signs a Child is Being Cyberbullied or is Cyberbullying Others Many of the warning signs that cyberbullying ...

  16. Preventing Suicide

    Science.gov (United States)

    ... protective factors listed below: Skills in problem solving, conflict resolution, and nonviolent ways of handling disputes Effective ... 2017 Page last updated: August 9, 2017 Content source: National Center for Injury Prevention and Control, Division ...

  17. Prevention: Exercise

    Medline Plus

    Full Text Available ... A SPECIALIST Prevention Strengthening Exercise Committee Exercise Committee Core Strengthening Many popular forms of exercise focus on ... acute pain, you should stop doing it. Transverse Core Strengthening This strengthens the muscles that cross from ...

  18. Prevention: Exercise

    Medline Plus

    Full Text Available ... Training for the Elderly Other Back Pack Safety Pregnancy and Back Pain Preventing Osteoporosis Back Pain Basics ... increases your back pain after five repetitions, or causes acute pain, you should stop doing it. Transverse ...

  19. Preventing accidents

    Science.gov (United States)

    2005-08-01

    As the most effective strategy for improving safety is to prevent accidents from occurring at all, the Volpe Center applies a broad range of research techniques and capabilities to determine causes and consequences of accidents and to identify, asses...

  20. Prevention: Exercise

    Medline Plus

    Full Text Available ... 10 Tips for a Healthy Back Smoking Weight Patient Safety Exercise Strengthening Strengthen Your Core! Stretching/Flexibility ... Pain Preventing Osteoporosis Back Pain Basics Book RESOURCES Patient Information Feature Articles Patient Q&A Success Stories ...

  1. Prevention: Exercise

    Medline Plus

    Full Text Available ... Preventing Osteoporosis Back Pain Basics Book RESOURCES Patient Information Feature Articles Patient Q&A Success Stories Definitions Anatomy of the Spine Definitions A-Z Spine Specialists Videos 9 ...

  2. HIV Prevention

    Centers for Disease Control (CDC) Podcasts

    2012-02-01

    Dr. Kevin Fenton, Director of CDC’s National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention, talks about steps people can take to protect their health from HIV.  Created: 2/1/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 2/1/2012.

  3. Cancer prevention.

    Science.gov (United States)

    Tubiana, M

    1999-01-01

    Over 70% of human cancers are associated with lifestyle and about half of cancer deaths could be prevented by relatively simple individual actions: no smoking, moderate consumption of alcohol, increased consumption of fruit and vegetables, avoidance of sunbathing, obesity and a too high consumption of saturated lipids. Most of these efforts would also markedly decrease the incidence of cardiovascular and respiratory diseases. However, the concept of prevention is currently neither well accepted nor understood by the medical community and the general public. It is often felt that it restricts freedom, imposes a choice between pleasure and duty, and that passing judgement on lifestyle is a form of intolerance. The case of tobacco illustrates the difficulties encountered by prevention, notably among adolescents. The fight against smoking requires information, a societal approach (ban on advertising, increase in price), and a reduction of the example given by adult smoking (parents, peers, teachers, physicians, TV presenters, movie stars, have a great influence on adolescents), while tobacco cessation programs must be promoted. The various approaches should be integrated into a global program of health prevention, including health education at school from 5 to 12 years of age. The efficacy of each of the global program's components should be evaluated. Misconceptions such as overestimation of the impact of pollution on health should also be corrected. Health is created and experienced by people within the setting of their daily lives, in particular during childhood. Prevention is the responsibility of individual members of the community but also of the community as a whole.

  4. Prevent Pneumonia

    Centers for Disease Control (CDC) Podcasts

    2015-08-06

    CDC’s Matthew Westercamp explains what pneumonia is, its symptoms, and how to prevent it.  Created: 8/6/2015 by National Center for Immunization and Respiratory Diseases (NCIRD), Division of Bacterial Diseases (DBD), Respiratory Diseases Branch (RDB).   Date Released: 8/6/2015.

  5. Prevention: Exercise

    Medline Plus

    Full Text Available ... Information Feature Articles Patient Q&A Success Stories Definitions Anatomy of the Spine Definitions A-Z Spine Specialists Videos 9 for Spine Epidural Steroid Injections Exercise: The Backbone of Spine Treatment Spondylolisthesis BLOG FIND A SPECIALIST Prevention ...

  6. Suicide Prevention

    Science.gov (United States)

    ... corresponding to World Suicide Prevention Day, to celebrate life, hope, and reasons to live. SAMHSA is committed to ... members, and helping people navigate the struggles of life to find a sustainable sense of hope, meaning, and purpose. For information about how you ...

  7. Bullying Prevention

    Science.gov (United States)

    Kemp, Patrice

    2016-01-01

    The focus of the milestone project is to focus on bridging the gap of bullying and classroom instruction methods. There has to be a defined expectations and level of accountability that has to be defined when supporting and implementing a plan linked to bullying prevention. All individuals involved in the student's learning have to be aware of…

  8. Allergy prevention.

    Science.gov (United States)

    Muche-Borowski, Cathleen; Kopp, Matthias; Reese, Imke; Sitter, Helmut; Werfel, Thomas; Schäfer, Torsten

    2010-09-01

    The further increase of allergies in industrialized countries demands evidence-based measures of primary prevention. The recommendations as published in the guideline of 2004 were updated and consented on the basis of a systematic literature search. Evidence from the period February 2003-May 2008 was searched in the electronic databases Cochrane and MEDLINE as well as in reference lists of recent reviews and by contacting experts. The retrieved citations were screened for relevance first by title and abstract and in a second step as full paper. Levels of evidence were assigned to each included study and the methodological quality of the studies was assessed as high or low. Finally the revised recommendations were formally consented (nominal group process) by representatives of relevant societies and organizations including a self-help group. Of originally 4556 hits, 217 studies (4 Cochrane Reviews, 14 meta-analyses, 19 randomized controlled trials, 135 cohort and 45 case-control studies) were included and critically appraised. Grossly unchanged remained the recommendations on avoiding environmental tobacco smoke, breast-feeding over 4 months (alternatively hypoallergenic formulas for children at risk), avoiding a mold-promoting indoor climate, vaccination according to current recommendations, and avoidance of furry pets (especially cats) in children at risk. The recommendation on reducing the house dust mite allergen exposure as a measure of primary prevention was omitted and the impact of a delayed introduction of supplementary food was reduced. New recommendations were adopted concerning fish consumption (during pregnancy / breast-feeding and as supplementary food in the first year), avoidance of overweight, and reducing the exposure to indoor and outdoor air pollutants. The revision of this guideline on a profound evidence basis led to (1) a confirmation of existing recommendations, (2) substantial revisions, and (3) new recommendations. Thereby it is possible

  9. NMR studies of echinomycin bisintercalation complexes with d(A1-C2-G3-T4) and d(T1-C2-G3-A4) duplexes in aqueous solution: sequence-dependent formation of Hoogsteen A1 x T4 and Watson-Crick T1 x A4 base pairs flanking the bisintercalation site

    International Nuclear Information System (INIS)

    Gao, X.; Patel, D.J.

    1988-01-01

    The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution

  10. A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards‡

    Science.gov (United States)

    Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

    2009-01-01

    Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246

  11. Rotating preventers

    International Nuclear Information System (INIS)

    Tangedahl, M.J.; Stone, C.R.

    1992-01-01

    This paper reports that recent changes in the oil and gas industry and ongoing developments in horizontal and underbalanced drilling necessitated development of a better rotating head. A new device called the rotating blowout preventer (RBOP) was developed by Seal-Tech. It is designed to replace the conventional rotating control head on top of BOP stacks and allows drilling operations to continue even on live (underbalanced) wells. Its low wear characteristics and high working pressure (1,500 psi) allow drilling rig crews to drill safely in slightly underbalanced conditions or handle severe well control problems during the time required to actuate other BOPs in the stack. Drilling with a RBOP allows wellbores to be completely closed in tat the drill floor rather than open as with conventional BOPs

  12. Sunburn: Treatment and Prevention

    Science.gov (United States)

    ... Healthy Living Healthy Living Healthy Living Nutrition Fitness Sports Oral Health Emotional Wellness Growing Healthy Sleep Safety & Prevention Safety & Prevention Safety and Prevention Immunizations ...

  13. Diabetes Prevention Program (DPP)

    Science.gov (United States)

    ... Recruiting Patients & Families Consortia, Networks & Centers Reports & Planning Diabetes Prevention Program (DPP) The NIDDK-sponsored Diabetes Prevention ... Diabetes Prevention Program for those who are eligible. Diabetes Prevention Program (DPP) DPP Goal The DPP looked ...

  14. Cholera Prevention and Control

    Science.gov (United States)

    ... name=”commit” type=”submit” value=”Submit” /> Prevention & Control Recommend on Facebook Tweet Share Compartir Prevention of ... of cholera and other diarrheal disease prevention. Prevention & Control Topics Ending Cholera: The Global Roadmap to 2030 ...

  15. Polio and Prevention

    Science.gov (United States)

    ... Essays Photo Collections Videos Polio Today → Polio + Prevention Polio + Prevention Polio and prevention Polio is a crippling ... for poliovirus within 48 hours of onset. Bulbar polio More extensive paralysis, involving the trunk and muscles ...

  16. Prevent Child Abuse America

    Science.gov (United States)

    ... the Week Parenting Tip of the Week – Preventing Child Sexual Abuse Parenting Tip of the Week Parenting Tip of the Week – Talking to Teens about Healthy Relationships ... of child abuse prevention through our Pinwheels for Prevention campaign. ...

  17. National Suicide Prevention Lifeline

    Science.gov (United States)

    ... Initiatives Best Practices Our Network Media Resources National Suicide Prevention Lifeline We can all help prevent suicide. The ... Call The Lifeline Everyone Plays A Role In Suicide Prevention Here are some helpful links: GET HELP NOW ...

  18. Prevention Research Matters

    Centers for Disease Control (CDC) Podcasts

    Prevention Research Matters is a series of one-on-one interviews with researchers from 26 university prevention research centers across the country. Their work focuses on preventing and controlling chronic diseases like obesity, cancer, and heart disease.

  19. Scabies: Prevention and Control

    Science.gov (United States)

    ... Information Scabies FAQs Workplace FAQs Epidemiology & Risk Factors Biology Disease Diagnosis Treatment Prevention & Control Resources for Health Professionals Medications Institutional Settings Prevention ...

  20. Hybridization and sequencing of nucleic acids using base pair mismatches

    Science.gov (United States)

    Fodor, Stephen P. A.; Lipshutz, Robert J.; Huang, Xiaohua

    2001-01-01

    Devices and techniques for hybridization of nucleic acids and for determining the sequence of nucleic acids. Arrays of nucleic acids are formed by techniques, preferably high resolution, light-directed techniques. Positions of hybridization of a target nucleic acid are determined by, e.g., epifluorescence microscopy. Devices and techniques are proposed to determine the sequence of a target nucleic acid more efficiently and more quickly through such synthesis and detection techniques.

  1. Nanoscale protein diffusion by STED-based pair correlation analysis.

    Directory of Open Access Journals (Sweden)

    Paolo Bianchini

    Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.

  2. Envisaging quantum transport phenomenon in a muddled base pair ...

    Indian Academy of Sciences (India)

    RAJAN VOHRA

    2018-03-27

    Mar 27, 2018 ... effect of mispairs G(anti)·A(syn) and G(anti)·A(anti) on electron transport by replacing ... used by us with two-probe system consisting of three parts: right, left ... The ballistic transport results if probability of transmitting electrons ...

  3. Maximizing profit per unit time in cointegration based pairs trading

    OpenAIRE

    Tutal, Duygu

    2014-01-01

    Ankara : The Department of Industrial Engineering and The Graduate School of Engineering and Science of Bilkent University, 2014. Thesis (Master's) -- Bilkent University, 2014. Includes bibliographical references leaves 57-59 Tutal, Duygu Master's

  4. Reflections on preventive medicine.

    Science.gov (United States)

    Miettinen, Olli S

    2014-10-01

    Having thought much about medicine in my career-long effort to understand it and the research for its advancement, I have come to views rather different form the now-prevailing ones in respect to what preventive medicine is about; what epidemiology is in relation to preventive medicine; what distinguishes preventive medicine in preventive healthcare at large; the relation of preventive medicine to public health; the concept of health promotion; and also the core principles of preventive medicine. All of these views I set forth in this article, for the readers' critical reflection. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Traditional preventive treatment options

    DEFF Research Database (Denmark)

    Longbottom, C; Ekstrand, K; Zero, D

    2009-01-01

    Preventive treatment options can be divided into primary, secondary and tertiary prevention techniques, which can involve patient- or professionally applied methods. These include: oral hygiene (instruction), pit and fissure sealants ('temporary' or 'permanent'), fluoride applications (patient...... options....

  6. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... L Sarah Harrison, OT Anne Bryden, OT The Role of the Social Worker after Spinal Cord Injury ... do to prevent pressure sores? play_arrow What role does diet and hydration play in preventing pressure ...

  7. Colorectal Cancer Prevention

    Science.gov (United States)

    ... Genetics of Colorectal Cancer Colorectal Cancer Screening Research Colorectal Cancer Prevention (PDQ®)–Patient Version What is prevention? Go ... to keep cancer from starting. General Information About Colorectal Cancer Key Points Colorectal cancer is a disease in ...

  8. Cancer treatment - preventing infection

    Science.gov (United States)

    ... Radiation - preventing infection; Bone marrow transplant - preventing infection; Cancer treatment - immunosuppression ... this is a short-lived side effect of cancer treatment. Your provider may give you medicines to help ...

  9. Research Areas: Prevention

    Science.gov (United States)

    NCI’s prevention research has a broad focus, from identifying environmental and lifestyle factors that influence cancer risk to studying the biology of how cancer develops and studying ways to disseminate prevention interventions.

  10. Preventing Type 2 Diabetes

    Science.gov (United States)

    ... Sexual, & Bladder Problems Clinical Trials Preventing Type 2 Diabetes Perhaps you have learned that you have a ... I lower my chances of developing type 2 diabetes? Research such as the Diabetes Prevention Program shows ...

  11. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to Home ...

  12. Prevention of gravitational collapse

    International Nuclear Information System (INIS)

    Moffat, J.W.; Taylor, J.G.

    1981-01-01

    We apply a new theory of gravitation to the question of gravitational collapse to show that collapse is prevented in this theory under very reasonable conditions. This result also extends to prevent ultimate collapse of the Universe. (orig.)

  13. Marine Pollution Prevention Act

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Marine Pollution Prevention Act of 2008 implements the International Convention for the Prevention of Pollution from Ships, including related Protocols (MARPOL)...

  14. Risk Factors and Prevention

    Science.gov (United States)

    ... Resources Risk Factors & Prevention Back to Patient Resources Risk Factors & Prevention Even people who look healthy and ... Blood Pressure , high cholesterol, diabetes, and thyroid disease. Risk Factors For Arrhythmias and Heart Disease The following ...

  15. Preventing Weight Gain

    Science.gov (United States)

    ... Local Programs Related Topics Diabetes Nutrition Preventing Weight Gain Language: English (US) Español (Spanish) Recommend on Facebook ... cancer. Choosing an Eating Plan to Prevent Weight Gain So, how do you choose a healthful eating ...

  16. Breast Cancer Prevention

    Science.gov (United States)

    ... of Breast & Gynecologic Cancers Breast Cancer Screening Research Breast Cancer Prevention (PDQ®)–Patient Version What is prevention? Go ... from starting. Risk-reducing surgery . General Information About Breast Cancer Key Points Breast cancer is a disease in ...

  17. Settings for Suicide Prevention

    Science.gov (United States)

    ... Suicide Populations Racial/Ethnic Groups Older Adults Adolescents LGBT Military/Veterans Men Effective Prevention Comprehensive Approach Identify ... Based Prevention Settings American Indian/Alaska Native Settings Schools Colleges and Universities Primary Care Emergency Departments Behavioral ...

  18. Prevent Cervical Cancer

    Science.gov (United States)

    ... professional printing [PDF-1.5MB] Cancer Home “Prevent Cervical Cancer” Infographic Language: English Español (Spanish) Recommend on Facebook Tweet Share Compartir Prevent Cervical Cancer with the Right Test at the Right Time ...

  19. Fall Prevention: Simple Tips to Prevent Falls

    Science.gov (United States)

    ... a gentle exercise that involves slow and graceful dance-like movements. Such activities reduce the risk of ... healthy-lifestyle/healthy-aging/in-depth/fall-prevention/art-20047358 . Mayo Clinic Footer Legal Conditions and Terms ...

  20. Cancer risks and prevention

    International Nuclear Information System (INIS)

    Vessey, M.P.; Gray, M.

    1985-01-01

    A series of essays in honour of Sir Richard Doll is presented. Chapters cover the preventability of cancer, geography, smoking, diet, occupation, radiation, infections and immune impairment, exogenous and endogenous hormones, other drugs, prevention through legislation and by education and cancer risks and prevention in the Third World. The chapter on radiation has been indexed separately. (UK)

  1. Statewide Suicide Prevention Council

    Science.gov (United States)

    State Employees Statewide Suicide Prevention Council DHSS State of Alaska Home Divisions and Agencies National Suicide Prevention Lifeline Alaska Community Mental Health Centers National Survivors of Suicide Meetings Presentations 2010 Alaska Statewide Suicide Prevention Summit: Mending the Net Connect with us on

  2. Prevention IS Care

    Centers for Disease Control (CDC) Podcasts

    2009-03-26

    This podcast provides an overview of the Prevention IS Care campaign, which provides HIV prevention tools for medical care providers to use on a daily basis with patients who are living with HIV.  Created: 3/26/2009 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/26/2009.

  3. [Prevention of mental disorders].

    Science.gov (United States)

    Riedel-Heller, Steffi; Gühne, Uta

    2013-12-01

    Investment in prevention is a major public health requirement. Mental disorders are common and are associated with severe consequences. They are a major target for prevention. Based on vulnerabilitiy-stress-models the theoretical background for prevention in mental disorders is outlined. Effective strategies for children, adolescents, adults and individuals in old age do exist. Results regarding the prevention of depres-sion and psychoses are outlined and risk groups which require current actions are determined. Current activities towards a national prevention strategy in Germany are discussed. © Georg Thieme Verlag KG Stuttgart · New York.

  4. Prevention Of Stroke

    Directory of Open Access Journals (Sweden)

    Nagaraja D

    2005-01-01

    Full Text Available Stroke is an important cause for neurological morbidity and mortality. Prevention of ischemic stroke involves identification and prevention of risk factors and optimal use of pharmacotherapy. Risk factors have been classified as modifiable and non-modifiable; control of modifiable factors should prevent stroke occurrence. Stroke prevention has been described at three levels: primary, secondary and tertiary. Prolonged hypertension increases an individual′s risk for developing fatal or nonfatal stroke by three times and its control has been shown to prevent stroke. Diabetes mellitus is an important cause for microangiopathy and predisposes to stroke. Statin trials have shown significant reduction in stroke in those who were treated with statins. Stroke risk can be reduced by avoiding tobacco use, control of obesity and avoiding sedentary life style. Anti platelet medications are effective for secondary prevention of stroke. Educating society regarding modifiable risk factors and optimal use of pharmacotherapy form the cornerstone for the prevention of stroke.

  5. Prevention of suicide

    Directory of Open Access Journals (Sweden)

    Rajiv Gupta

    2017-01-01

    Full Text Available Suicide is a major public health problem in India, probably even bigger than in the West. Suicidal behavior is the best conceptualized as a multifaceted complex problem involving social factors and mental illnesses. Broadly, there are two approaches to suicide prevention; population preventive strategies and high-risk preventive strategies. Population preventive strategies include reducing availability of means for suicide, education of primary care physicians, influencing media portrayal of suicidal behavior, education of the public, telephone helplines, and addressing economic issues associated with suicidal behavior. High-risk preventive strategy includes identifying individuals with high risk of committing suicide, intensively treating mental illness if present, and providing psychosocial support. Thus, prevention requires a multipronged effort with collaboration from various sectors including mental health professionals, social justice department, and macroeconomic policy makers.

  6. Prevent Infections During Chemotherapy

    Centers for Disease Control (CDC) Podcasts

    2011-10-24

    This podcast discusses the importance of preventing infections in cancer patients who are undergoing chemotherapy. Dr. Lisa Richardson, CDC oncologist, talks about a new Web site for cancer patients and their caregivers.  Created: 10/24/2011 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP), Division of Cancer Prevention and Control (DCPC).   Date Released: 10/24/2011.

  7. CSI cardiac prevent 2015

    OpenAIRE

    S Ramakrishnan; Manisha Kaushik

    2015-01-01

    The CSI Cardiac Prevent 2015 was held at Hotel Taj Palace, New Delhi, on September 25-27, 2015. The major challenge was to create interest among cardiologists and physicians on preventive cardiology, a neglected area. The theme of the conference was "Innovations in Heart Disease Prevention.′′ This conference included "CSI at WHF Roadmap Workshop, Inauguration Ceremony, scientific program, plenary sessions, Nursing/Dietician track, Industry Exhibition, Social Events," Great India blood pressur...

  8. Prevention of Prosthetic Dentistry

    Directory of Open Access Journals (Sweden)

    Eremin O.V.

    2011-03-01

    Full Text Available Prevention in prosthetic dentistry is not just a regular oral hygiene and the prevention of caries in the early stages of its development. The initial goal of orthopedic and dental should be the ability to convey to the patient's sense of pros-thetics that proteziruya one saved more. An example is included prosthetic dental arch defects with bridges or single artificial crowns on implants that will prevent movement of teeth and the continuity of the dentition

  9. Prevention, not just treatment.

    Science.gov (United States)

    Connors, G L; Hilling, L

    1998-03-01

    A tragic burden of disease, disability, and death has resulted from smoking. The role of pulmonary rehabilitation is not only in treatment and rehabilitation of lung disease but in the prevention of lung disease. The skills of the pulmonary rehabilitation specialist should be used in the earlier detection and prevention of lung disease through primary and secondary prevention. The spirometer must gain acceptance in the medical community as the early tool to evaluate lung health, not the chest radiograph or the stethoscope. The lung age formula and sputum pap smears are just a few of the evaluation tools used to detect and motivate susceptible individuals. Prevention is the key to enhancing lung health.

  10. Crime-prevention

    DEFF Research Database (Denmark)

    Brønsted, Lone

    In Denmark, crime prevention is embedded in state professional practices in kindergartens, schools and youth clubs. These welfare institutions are conceived as safe places that safeguard children and young people through inclusive learning environments, warm and empathic relationships between......-sectional cooperation called “SSP”. SSP is a locally anchored cooperation of the school (S), the social services (S) and the police (P) and its aim is to create a coordinated system of prevention, e.g., to prevent crime or school drop outs. In continuation of this, crime preventive work is understood as a practice...

  11. Work hazard prevention plans

    International Nuclear Information System (INIS)

    Albertos Campos, F.

    2009-01-01

    The prevention of industrial risks is a constantly evolving discipline that has changed considerable in the last 25 years. The Cofrentes Nuclear Power Plants has always been operated with a clear policy favoring prevention by supporting the principle of its integration, i. e., that the hierarchical functional organization of the company make sure that industrial risk prevention is effective and that health and safety standards are met. The historical evolution of occupational safety in the Cofrentes Nuclear Power Plant shows a a clear trend towards improvement and is the results of many years of hard work and effort by the plants own and contractor personnel in the field of industrial risk prevention. (Author)

  12. Speech disorder prevention

    Directory of Open Access Journals (Sweden)

    Miladis Fornaris-Méndez

    2017-04-01

    Full Text Available Language therapy has trafficked from a medical focus until a preventive focus. However, difficulties are evidenced in the development of this last task, because he is devoted bigger space to the correction of the disorders of the language. Because the speech disorders is the dysfunction with more frequently appearance, acquires special importance the preventive work that is developed to avoid its appearance. Speech education since early age of the childhood makes work easier for prevent the appearance of speech disorders in the children. The present work has as objective to offer different activities for the prevention of the speech disorders.

  13. Toxoplasmosis: Prevention and Control

    Science.gov (United States)

    ... Toxoplasmosis FAQs Toxoplasmosis & Pregnancy FAQs Epidemiology & Risk Factors Biology Disease Diagnosis Treatment Prevention & Control Resources for Health Professionals Publications Printable Resources Additional ...

  14. HIV Risk and Prevention

    Science.gov (United States)

    ... Prevention VIH En Español Get Tested Find an HIV testing site near you. Enter ZIP code or city Follow HIV/AIDS CDC HIV CDC HIV/AIDS See RSS | ... Email Updates on HIV Syndicated Content Website Feedback HIV Risk and Prevention Recommend on Facebook Tweet Share ...

  15. Can I Prevent Acne?

    Science.gov (United States)

    ... for Educators Search English Español Can I Prevent Acne? KidsHealth / For Teens / Can I Prevent Acne? Print en español ¿Puedo prevenir el acné? What Causes Acne? Contrary to what you may have heard, acne ...

  16. [Prevention of psychosocial risks].

    Science.gov (United States)

    Dalle, Édouard; Trichard-Salembier, Alexandra; Sobaszek, Annie

    2018-02-01

    The theme of psychosocial risks remains in the workplace. It is therefore essential that all members of a company are made aware of the terminology and specific prevention actions in this field. Distinguishing between the manifestations of these risks and their causes and consequences helps to improve prevention. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  17. Prevention of Graves' ophthalmopathy.

    Science.gov (United States)

    Bartalena, Luigi

    2012-06-01

    Smoking is the most important risk factor for the occurrence/progression of Graves' ophthalmopathy (GO), as well as for its lower/slower response to immunosuppression. Accordingly, refrain from smoking should be urged, both as primary prevention (removal of risk factors in Graves' patients without GO), secondary prevention (early detection and treatment of asymptomatic/very mild GO) and tertiary prevention (reduction of complications/disability of overt GO). A 6-month course of 200 μg/day sodium selenite can prevent progression of mild GO to more severe GO and is, therefore, a form of secondary prevention and, probably, primary prevention. Correction of thyroid dysfunction and stable maintenance of euthyroidism are important preventive measures. The optimal treatment for hyperthyroidism in patients with GO is uncertain, because evidence demonstrating the superiority of antithyroid drugs over thyroid ablation (radioiodine, thyroidectomy, or both) is lacking. If radioiodine is used, low-dose steroid prophylaxis is recommended, particularly in smokers, to prevent radioiodine-associated GO progression. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Prevent Cervical Cancer!

    Centers for Disease Control (CDC) Podcasts

    2015-01-08

    Cervical cancer can be prevented. Listen as two friends—one a doctor—talk about screening tests and early detection. Learn what test you might need.  Created: 1/8/2015 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 1/8/2015.

  19. Poison Prevention Program

    Science.gov (United States)

    Office of Substance Misuse and Addiction Prevention Finance & Management Services Health Care , Technology: For more info about the national Poison Help program and to request materials visit: http Seniors & Disabilities Services Substance Misuse and Addiction Prevention State of Alaska myAlaska My

  20. Prevention of preterm birth.

    LENUS (Irish Health Repository)

    Flood, Karen

    2012-02-01

    Preterm birth (delivery before 37 completed weeks of gestation) is common and rates are increasing. In the past, medical efforts focused on ameliorating the consequences of prematurity rather than preventing its occurrence. This approach resulted in improved neonatal outcomes, but it remains costly in terms of both the suffering of infants and their families and the economic burden on society. Increased understanding of the pathophysiology of preterm labor has altered the approach to this problem, with increased focus on preventive strategies. Primary prevention is a limited strategy which involves public education, smoking cessation, improved nutritional status and avoidance of late preterm births. Secondary prevention focuses on recurrent preterm birth which is the most recognisable risk factor. Widely accepted strategies include cervical cerclage, progesterone and dedicated clinics. However, more research is needed to explore the role of antibiotics and anti-inflammatory treatments in the prevention of this complex problem.

  1. Measuring waste prevention.

    Science.gov (United States)

    Zorpas, Antonis A; Lasaridi, Katia

    2013-05-01

    The Waste Framework Directive (WFD-2008/98/EC) has set clear waste prevention procedures, including reporting, reviewing, monitoring and evaluating. Based on the WFD, the European Commission and will offer support to Member States on how to develop waste prevention programmes through guidelines and information sharing on best practices. Monitoring and evaluating waste prevention activities are critical, as they constitute the main tools to enable policy makers, at the national and local level, to build their strategic plans and ensure that waste prevention initiatives are effective and deliver behaviour change. However, how one can measure something that is not there, remains an important and unresolved research question. The paper reviews and attempts to evaluate the methods that are being used for measuring waste prevention and the impact of relevant implemented activities at the household level, as the available data is still limited. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Rigidity of Nominal Wages of Non-Production Workers in Industrial Sector

    Directory of Open Access Journals (Sweden)

    Bambang Sulistiyono

    2016-06-01

    Full Text Available Excess supply of labor leads to low the levels of nominal wages received by workers. The amount of minimum wage rate exceeds the market wage rate. The determination of minimum wage is a factor manifested in the institutional and regulatory Provincial Minimum Wage or a District Minimum Wage. Unfortunately, it has made nominal wages  difficult to drop below the minimum wage level. High or low level of nominal wages are associated with worker productivity. Further, nominal wages are rigid to go down. If they have increased, they can not be dropped in the future even though the company's performance is declined. Knowing that condition, in designing the remuneration system, an employer should pay attention to the rigidity of nominal wages, so that when  company's performance declines, the company will not be interfered because of the wages burden.  Furthermore, unions and government should consider the rigidity impact of nominal wages that go down. Thus, when macroeconomic conditions deteriorate and company's performance drops, the company will not go bankrupt due to high labor costs. If the company goes bankrupt, the workers will loose their jobs as a result of employment termination, while the government will face the unemployment problem. 

  3. A 29-Year-Old Man With Nonproductive Cough, Exertional Dyspnea, and Chest Discomfort.

    Science.gov (United States)

    Halpenny, Darragh; Suh, James; Garofano, Suzette; Alpert, Jeffrey

    2015-09-01

    A 29-year-old man presented with a 5-month history of worsening dry cough, exertional dyspnea, chest tightness, and palpitations. He had been treated by his primary care physician with trials of guaifenesin/codeine, azithromycin, albuterol, and omeprazole without improvement. He denied wheezing, fever, sweats, anorexia, joint pain, swelling, or rash. He had no past medical history. He denied a history of tobacco smoking or IV drug use. He kept no pets, worked as a manager in an office environment, and had no history of occupational inhalational exposure. He reported using aerosolized insect spray to eradicate bed bugs in his house shortly before the cough began but did not report any acute symptoms when using the spray.

  4. Optimizing Fire Department Operations Through Work Schedule Analysis, Alternative Staffing, and Nonproductive Time Reduction

    Science.gov (United States)

    2014-09-01

    and disadvantages ; for example, although the majority of fire departments in the United States abide by the 24/48- schedule, this schedule also leads...costs. The local bargaining group also falls into these criteria. The local bargaining unit must be agreeable to the policy changes. They cannot... agreeable to the local bargaining group particularly when it is addressed in an article of the current bargaining agreement. Additionally, the local

  5. Lignosulfonate-mediated cellulase adsorption: enhanced enzymatic saccharification of lignocellulose through weakening nonproductive binding to lignin

    Science.gov (United States)

    Zhaojiang Wang; JY Zhu; Yingjuan Fu; Menghua Qin; Zhiyong Shao; Jungang Jiang; Fang Yang

    2013-01-01

    Thermochemical pretreatment of lignocellulose is crucial to bioconversion in the fields of biorefinery and biofuels. However, the enzyme inhibitors in pretreatment hydrolysate make solid substrate washing and hydrolysate detoxification indispensable prior to enzymatic hydrolysis. Sulfite pretreatment to overcome recalcitrance of lignocelluloses (SPORL) is a relatively...

  6. A comparison of productive and non-productive green water-use ...

    African Journals Online (AJOL)

    productive (canopy and litter interception and soil evaporation) fluxes. There is a widespread perception within South Africa that indigenous tree species, in contrast to commercial forestry genera/species, are water-wise and should thus be planted ...

  7. Novel preventive treatment options

    DEFF Research Database (Denmark)

    Longbottom, C; Ekstrand, K; Zero, D

    2009-01-01

    A number of novel preventive treatment options which, as with traditional methods, can be differentiated into 3 categories of prevention (primary, secondary and tertiary), have been and are being currently investigated. Those reviewed are either commercially available or appear relatively close...... of these techniques show considerable promise and dentists should be aware of these developments and follow their progress, the evidence for each of these novel preventive treatment options is currently insufficient to make widespread recommendations. Changes in dental practice should be explored to see how oral...

  8. Prevention of Eye Injuries

    OpenAIRE

    Pashby, Tom

    1981-01-01

    In Canada 30,000 people are registered as blind; in one third of these, blindness might have been avoided. Prevention is the key to reducing the number of eye injuries and blind eyes. The role of the family physician in early identification of treatable conditions and in the education of patients is discussed, but responsibility for prevention belongs to all physicians. The success of prevention is seen in the great reduction in eye injuries in industry and sports since eye protectors have be...

  9. Obesity Prevention and Screening.

    Science.gov (United States)

    Mackey, Eleanor R; Olson, Alexandra; DiFazio, Marc; Cassidy, Omni

    2016-03-01

    Obesity is widespread, associated with several physical and psychosocial comorbidities, and is difficult to treat. Prevention of obesity across the lifespan is critical to improving the health of individuals and society. Screening and prevention efforts in primary care are an important step in addressing the obesity epidemic. Each period of human development is associated with unique risks, challenges, and opportunities for prevention and intervention. Screening tools for overweight/obesity, although imperfect, are quick and easy to administer. Screening should be conducted at every primary care visit and tracked longitudinally. Screening tools and cutoffs for overweight and obesity vary by age group. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. CSI cardiac prevent 2015

    Directory of Open Access Journals (Sweden)

    S Ramakrishnan

    2015-01-01

    Full Text Available The CSI Cardiac Prevent 2015 was held at Hotel Taj Palace, New Delhi, on September 25-27, 2015. The major challenge was to create interest among cardiologists and physicians on preventive cardiology, a neglected area. The theme of the conference was "Innovations in Heart Disease Prevention.′′ This conference included "CSI at WHF Roadmap Workshop, Inauguration Ceremony, scientific program, plenary sessions, Nursing/Dietician track, Industry Exhibition, Social Events," Great India blood pressure Survey, and CSI Smart Heart App. A total of 848 delegates/faculties attended this conference against a total of 1140 people registered for the meeting.

  11. Measuring pollution prevention

    International Nuclear Information System (INIS)

    Stephan, D.G.; Bridges, J.S.

    1992-01-01

    To assess progress in pollution prevention, estimates or measurements of the amounts of pollution actually prevented have to be made. Such estimates or measurements tell us how far we have come and, possibly, how much farther there is to go in utilizing pollution prevention as a tool for improving environmental quality. They can, theoretically, be used to assess progress on a scale ranging from the individual facility or even the individual process or activity generation wastes to scale as large as a geographical area such as a county, a state or even the United States as a whole. 3 refs

  12. Help prevent hospital errors

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000618.htm Help prevent hospital errors To use the sharing features ... in the hospital. If You Are Having Surgery, Help Keep Yourself Safe Go to a hospital you ...

  13. Institutional Preventive Stress Management.

    Science.gov (United States)

    Quick, James C.

    1987-01-01

    Stress is an inevitable characteristic of academic life, but colleges and universities can introduce stress management activities at the organizational level to avert excessive tension. Preventive actions are described, including flexible work schedules and social supports. (Author/MSE)

  14. Preventing Diabetes Problems

    Science.gov (United States)

    ... Problems Diabetes, Sexual, & Bladder Problems Clinical Trials Preventing Diabetes Problems View or Print All Sections Heart Disease & ... to help control symptoms and restore intimacy. Depression & Diabetes Depression is common among people with a chronic, ...

  15. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores ... sores? What is a Spinal Cord Injury? SCI Medical Experts People Living With SCI Personal Experiences By ...

  16. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... hours? play_arrow What's the best way to do daily skin inspections? play_arrow What are the ... for someone with a spinal cord injury to do to prevent pressure sores? play_arrow Why is ...

  17. Dental Sealants Prevent Cavities

    Science.gov (United States)

    ... Digital Press Kit Read the MMWR Science Clips Dental Sealants Prevent Cavities Effective protection for children Language: ... more use of sealants and reimbursement of services. Dental care providers can Apply sealants to children at ...

  18. Preventing Learned Helplessness.

    Science.gov (United States)

    Hoy, Cheri

    1986-01-01

    To prevent learned helplessness in learning disabled students, teachers can share responsibilities with the students, train students to reinforce themselves for effort and self control, and introduce opportunities for changing counterproductive attitudes. (CL)

  19. Preventing Pressure Sores

    Science.gov (United States)

    ... and how can it be increased? play_arrow What do family members and caregivers need to know about pressure sores? play_arrow What do family members and caregivers need to do to prevent pressure sores? play_ ...

  20. Can Vaginitis Be Prevented?

    Science.gov (United States)

    ... examples of safe sex. 1 Centers for Disease Control and Prevention. (2010). Self-study STD module—vaginitis . ... Halvorson New Chief of Gynecologic Health and Disease Branch Division of Epidemiology, Statistics, ...

  1. Preventing food allergy

    DEFF Research Database (Denmark)

    de Silva, Debra; Panesar, Sukhmeet S; Thusu, Sundeep

    2013-01-01

    The European Academy of Allergy and Clinical Immunology is developing guidelines about how to prevent and manage food allergy. As part of the guidelines development process, a systematic review is planned to examine published research about the prevention of food allergy. This systematic review...... is one of seven inter-linked evidence syntheses that are being undertaken in order to provide a state-of-the-art synopsis of the current evidence base in relation to epidemiology, prevention, diagnosis and clinical management, and impact on quality of life, which will be used to inform clinical...... recommendations. The aim of this systematic review will be to assess the effectiveness of approaches for the primary prevention of food allergy....

  2. Naval Preventive Diplomacy

    National Research Council Canada - National Science Library

    Cassel, Joseph

    2001-01-01

    Naval power, as part of a U.S. preventive diplomacy effort, can be flexibly mixed with political, economic, and informational power to intervene early in places of incipient crisis or before mass violence...

  3. Prevention of cisplatin nephrotoxicity

    Directory of Open Access Journals (Sweden)

    Hayati Fatemeh

    2016-01-01

    Full Text Available Cisplatin has a well-established role in the treatment of broad spectrum of malignancies; however its use is limited because of cisplatin-induced nephrotoxicity (CIN which can be progressive in more than 50% of cases. The most important risk factors for CIN include higher doses of cisplatin, previous cisplatin chemotherapy, underlying kidney damage and concurrent treatment with other potential nephrotoxin agents, such as aminoglycosides, nonsteroidal anti-inflammatory agents, or iodinated contrast media. Different strategies have been offered to diminish or prevent nephrotoxicity of cisplatin. The standard approach for prevention of CIN is the administration of lower doses of cisplatin in combination with full intravenous hydration prior and after cisplatin administration. Cisplatin-induced oxidative stress in the kidney may be prevented by natural antioxidant compounds. The results of this review show that many strategies for prevention of CIN exist, however, attention to the administration of these agent for CIN is necessary.

  4. Disaster prevention surveillance system

    International Nuclear Information System (INIS)

    Nara, Satoru; Kamiya, Eisei

    2001-01-01

    Fuji Electric Co., Ltd. has supplied many management systems to nuclear reactor institution. 'The nuclear countermeasures-against-calamities special-measures' was enforced. A nuclear entrepreneur has devised the measure about expansion prevention and restoration of a calamity while it endeavors after prevention of generating of a nuclear calamity. Our company have supplied the 'disaster prevention surveillance system' to the Japan Atomic Energy Research Institute Tokai Research Establishment aiming at strengthening of the monitoring function at the time (after the accident) of the accident used as one of the above-mentioned measures. A 'disaster prevention surveillance system' can share the information on the accident spot in an on-site command place, an activity headquarters, and support organizations, when the serious accident happens. This system is composed of various sensors (temperature, pressure and radiation), cameras, computers and network. (author)

  5. Prevent Infections During Chemotherapy

    Centers for Disease Control (CDC) Podcasts

    This podcast discusses the importance of preventing infections in cancer patients who are undergoing chemotherapy. Dr. Lisa Richardson, CDC oncologist, talks about a new Web site for cancer patients and their caregivers.

  6. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores Adult Injuries Spinal Cord Injury 101 David ...

  7. United to prevent emergencies

    International Nuclear Information System (INIS)

    Carta Petrolera

    2001-01-01

    The paper is about the national plan of contingencies, as tool of coordination inter-institutional that has allowed strengthening the actions of prevention and attention of spills of hydrocarbons and chemical substances in Colombia

  8. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from ... Rosenberg, PsyD Understanding SCI Rehabilitation Donald Peck Leslie, MD Adjusting to Social Life in a Wheelchair Lisa ...

  9. Youth Suicide Prevention Programs

    Science.gov (United States)

    Kalafat, John

    2006-01-01

    Youth suicide prevention programs are described that promote the identification and referral of at-risk youth, address risk factors, and promote protective factors. Emphasis is on programs that are both effective and sustainable in applied settings.

  10. Lead Poisoning Prevention Tips

    Science.gov (United States)

    ... or removed safely. How are children exposed to lead? Lead-based paint and lead contaminated dust are ... What can be done to prevent exposure to lead? It is important to determine the construction year ...

  11. Prevent Back Pain

    Science.gov (United States)

    ... If you have an injury, health condition, or disability, ask your doctor or nurse which types of exercise are best for you. Get tips on staying active with a disability . Next section Prevent Injuries Previous section Am I ...

  12. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... play_arrow What do family members and caregivers need to know about pressure sores? play_arrow What do family members and caregivers need to do to prevent pressure sores? play_arrow ...

  13. Home Improvements Prevent Falls

    Science.gov (United States)

    ... turn JavaScript on. Feature: Falls and Older Adults Home Improvements Prevent Falls Past Issues / Winter 2014 Table ... and ensure your safety. "Safe-ty-fy" Your Home Some Questions for Your Provider Will my medicines ...

  14. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... increased? play_arrow What do family members and caregivers need to know about pressure sores? play_arrow What do family members and caregivers need to do to prevent pressure sores? play_ ...

  15. Preventing Knee Injuries

    Science.gov (United States)

    ... Our Newsletter Donate Blog Skip breadcrumb navigation Preventing Knee Injuries Knee injuries in children and adolescent athletes ... this PDF Share this page: WHAT ARE COMMON KNEE INJURIES? Pain Syndromes One of the most common ...

  16. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Living with SCI Personal Experiences by Topic Resources Peer Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores Adult Injuries Spinal Cord Injury 101 David ...

  17. Sexual Violence Prevention

    Science.gov (United States)

    ... Submit What's this? Submit Button Past Emails Sexual Violence Prevention Recommend on Facebook Tweet Share Compartir April ... stop sexual violence before it begins. Understanding Sexual Violence Sexual violence is any sexual activity where consent ...

  18. Preventing High Blood Pressure

    Science.gov (United States)

    ... Heart Disease Cholesterol Salt Million Hearts® WISEWOMAN Preventing High Blood Pressure: Healthy Living Habits Recommend on Facebook Tweet Share ... meal and snack options can help you avoid high blood pressure and its complications. Be sure to eat plenty ...

  19. Prevention of malignant neoplasms

    OpenAIRE

    D. G. Zaridze; D. M. Maksimovich

    2017-01-01

    Research in causation of cancer is an important part of cancer research in general and is an essential prerequisite for cancer prevention. The effective primary prevention is not visible without evidence based knowledge in the causation of cancer in humans.There is sufficient evidence that certain life style and environment factors cause cancer in humans. These factors include: smoking and other types of tobacco consumption, overweight and obesity, lack of physical activity, diet rich in proc...

  20. Early prevention of obesity

    OpenAIRE

    Claudio Maffeis

    2014-01-01

    Childhood obesity is the metabolic disorder with the highest prevalence in both children and adults. Urgency to treat and prevent childhood obesity is based on the clear evidence that obesity tends to track from childhood to adulthood, is associated to morbidity also in childhood and to long-term mortality. Early life, i.e., intrauterine life and the first two years, is a sensitive window for prevention. Anatomical and functional maturation of the hypothalamic structures devoted to regulating...

  1. Industrial pollution prevention handbook

    International Nuclear Information System (INIS)

    Freeman, H.M.

    1995-01-01

    This book presents the techniques, technologies, regulations, and strategies that define pollution prevention. The subject is addressed from many perspectives by prominent experts. In many ways pollution prevention, rather than being a specialty field itself, is actually a convergence of fields drawing upon knowledge in a wide variety of more typical fields of expertise. Individual chapters have been processed separately for inclusion in the appropriate data bases

  2. [Can falls be prevented?].

    Science.gov (United States)

    Dubousset, Jean

    2014-06-01

    Most recommendations and measures intended to prevent falls focus on the elderly (see HAS guideline of April 2009) but, in our opinion, this isfar too late: prevention must begin much earlier, not only by identifying persons at risk, but also by providing personalized lifestyle advice adapted to each individual's biomechanical, somatic, neurological and biological characteristics. The first preventive measure is to identify a possible deterioration of balance, starting with a physical examination at the age of 45 and repeated regularly throughout life. Extrinsic preventive measures focusing on the domestic and external environments are clearly necessary. But what is most important is to detect and, if necessary, correct any degradation of intrinsic (intracorporeal or somatic) factors starting at the age of 45 years; these include vision, vestibular function and balance, proprioception, and psychological and neurological status. Chronic illnesses and their treatments must also be taken into account: treatment must be limited to indispensable drugs; sedative psychotropics must be avoided if possible; and polymedication must be tightly controlled, as it is a major risk factor for falls. Prevention also requires a diet sufficiently rich in protein, calcium and vitamin D3 (to prevent osteoporosis), and regular daily exercise adapted to the individual, if possible associated with a simultaneous cognitive task. The last key point is the absolute need for thorough functional rehabilitation after any accidental or medical trauma, regardless of age, with the aim of restoring functional status to that existing prior to the accident.

  3. Preventive Migraine Treatment

    Science.gov (United States)

    Silberstein, Stephen D.

    2015-01-01

    Purpose of Review: This article reviews the evidence base for the preventive treatment of migraine. Recent Findings: Evidence-based guidelines for the preventive treatment of migraine have recently been published by the American Academy of Neurology (AAN) and the Canadian Headache Society (CHS), providing valuable guidance for clinicians. Strong evidence exists to support the use of metoprolol, timolol, propranolol, divalproex sodium, sodium valproate, and topiramate for migraine prevention, according to the AAN. Based on best available evidence, adverse event profile, and expert consensus, topiramate, propranolol, nadolol, metoprolol, amitriptyline, gabapentin, candesartan, Petasites (butterbur), riboflavin, coenzyme Q10, and magnesium citrate received a strong recommendation for use from the CHS. Summary: Migraine preventive drug treatments are underutilized in clinical practice. Principles of preventive treatment are important to improve compliance, minimize side effects, and improve patient outcomes. Choice of preventive treatment of migraine should be based on the presence of comorbid and coexistent illness, patient preference, reproductive potential and planning, and best available evidence. PMID:26252585

  4. Exploring the antioxidant property of bioflavonoid quercetin in preventing DNA glycation: A calorimetric and spectroscopic study

    International Nuclear Information System (INIS)

    Sengupta, Bidisa; Uematsu, Takashi; Jacobsson, Per; Swenson, Jan

    2006-01-01

    Reducing sugars for example glucose, fructose, etc., and their phosphate derivatives non-enzymatically glycate biological macromolecules (e.g., proteins, DNA and lipids) and is related to the production of free radicals. Here we present a novel study, using differential scanning calorimetry (DSC) along with UV/Vis absorption and photon correlation spectroscopy (PCS), on normal and glycated human placenta DNA and have explored the antioxidant property of the naturally occurring polyhydroxy flavone quercetin (3,3',4',5,7-pentahydroxyflavone) in preventing the glycation. The decrease in the absorption intensity of DNA in presence of sugars clearly indicates the existence of sugar molecules between the two bases of a base pair in the duplex DNA molecule. Variations were perceptible in the PCS relaxation profiles of normal and glycated DNA. The melting temperature of placenta DNA was decreased when glycated suggesting a decrease in the structural stability of the double-stranded glycated DNA. Our DSC and PCS data showed, for the first time, that the dramatic changes in the structural properties of glycated DNA can be prevented to a significant extent by adding quercetin. This study provides valuable insights regarding the structure, function, and dynamics of normal and glycated DNA molecules, underlying the manifestation of free radical mediated diseases, and their prevention using therapeutically active naturally occurring flavonoid quercetin

  5. Preventing Child Abuse and Neglect

    Science.gov (United States)

    ... Wellness Courts Cultural Competence Diverse Populations and Communities Domestic Violence Human Trafficking Laws & Policies Service Array Statistics ... Home Topics Preventing Child Abuse & Neglect Preventing Child Abuse & Neglect Resources on child abuse prevention, protecting children ...

  6. Grant Programs for Pollution Prevention

    Science.gov (United States)

    The Office of Pollution Prevention and Toxics is responsible for overseeing several grant programs for tribes and states which promote pollution prevention through source reduction and resource conservation.

  7. [Preventive strategies for dementia].

    Science.gov (United States)

    Müller, Patrick; Schmicker, Marlen; Müller, Notger G

    2017-05-01

    In the context of the demographically induced increase in the prevalence of dementia and the simultaneous lack of causal pharmacological therapies, preventive approaches are gaining in importance. By reducing risk factors and with measures which induce neuroplasticity successful aging can be supported. This article summarizes the current developments in preventing dementia by modification of life style factors. The main focus lies on the impact of cognitive and physical activity on neuroprotection. A promising approach combines both activities within a dance training program. Further studies that meet the demanding criteria of a randomized clinical trial are urgently needed.

  8. Building in Prevention

    DEFF Research Database (Denmark)

    Troelsen, Jens

    2013-01-01

    this chapter devotes its focus primarily on the small bumps on the road by initially discussing how physical structural prevention can be an appropriate strategy not only to bring about behavioural change in the population as a whole but also to reduce the negative consequences of a stigmatising health...... preventive work might be changed to direct focus onto a greater extent on establishing frameworks for people to master their own lives instead of one-sided initiatives, which leave the individual with a sense of guilt at their own illness....

  9. Preventing Errors in Laterality

    OpenAIRE

    Landau, Elliot; Hirschorn, David; Koutras, Iakovos; Malek, Alexander; Demissie, Seleshie

    2014-01-01

    An error in laterality is the reporting of a finding that is present on the right side as on the left or vice versa. While different medical and surgical specialties have implemented protocols to help prevent such errors, very few studies have been published that describe these errors in radiology reports and ways to prevent them. We devised a system that allows the radiologist to view reports in a separate window, displayed in a simple font and with all terms of laterality highlighted in sep...

  10. Preventing Melanoma PSA (:60)

    Centers for Disease Control (CDC) Podcasts

    2015-06-02

    This 60 second public service announcement is based on the June 2015 CDC Vital Signs report. Skin cancer is the most common form of cancer in the U.S. In 2011, there were more than 65,000 cases of melanoma, the most deadly form of skin cancer. Learn how everyone can help prevent skin cancer.  Created: 6/2/2015 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 6/2/2015.

  11. Nanomaterials in preventive dentistry

    Science.gov (United States)

    Hannig, Matthias; Hannig, Christian

    2010-08-01

    The prevention of tooth decay and the treatment of lesions and cavities are ongoing challenges in dentistry. In recent years, biomimetic approaches have been used to develop nanomaterials for inclusion in a variety of oral health-care products. Examples include liquids and pastes that contain nano-apatites for biofilm management at the tooth surface, and products that contain nanomaterials for the remineralization of early submicrometre-sized enamel lesions. However, the treatment of larger visible cavities with nanomaterials is still at the research stage. Here, we review progress in the development of nanomaterials for different applications in preventive dentistry and research, including clinical trials.

  12. Aspirin for Primary Prevention.

    Science.gov (United States)

    Richman, Ilana B; Owens, Douglas K

    2017-07-01

    Aspirin reduces the risk of nonfatal myocardial infarction and stroke, and the risk of colorectal cancer. Aspirin increases the risk of gastrointestinal and intracranial bleeding. The best available evidence supports initiating aspirin in select populations. In 2016, the US Preventive Services Task Force recommended initiating aspirin for the primary prevention of both cardiovascular disease and colorectal cancer among adults ages 50 to 59 who are at increased risk for cardiovascular disease. Adults 60 to 69 who are at increased cardiovascular disease risk may also benefit. There remains considerable uncertainty about whether younger and older patients may benefit. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Prevention in practice

    DEFF Research Database (Denmark)

    Birch, Stephen; Bridgman, Colette; Brocklehurst, Paul

    2015-01-01

    could be identified early enough to facilitate prevention, what evidence based therapies and treatments were available and how, given the collective evidence, could these be introduced in general dental practice within different reimbursement models. CONCLUSIONS: While examples of best practice were...... provided from both social care and insurance models it was clear that further work was required on both provider and payer side to ensure that evidence based prevention was both implemented properly but also reimbursed sufficiently. It is clear that savings can be made but these must not be overstated...

  14. HOW TO PREVENT FRAUD?

    Directory of Open Access Journals (Sweden)

    Ionela – Corina Chersan

    2009-09-01

    Full Text Available Fraud can range from minor employee theft and unproductive behavior tomisappropriation of assets and fraudulent financial reporting. The risk of fraud can be reduced through a combination of prevention and detection measures. Moreover, prevention and deterrence measures are much less costly than the time and expense required for fraud detection and investigation. The information presented in this document generally is applicable to entities of all sizes. However, the degree to which certain programs and controls are applied in smaller, less-complex entities and the formality of theirapplication are likely to differ from larger organizations.

  15. Prevention of hand eczema

    DEFF Research Database (Denmark)

    Fisker, Maja H; Ebbehøj, Niels E; Vejlstrup, Søren Grove

    2018-01-01

    Objective Occupational hand eczema has adverse health and socioeconomic impacts for the afflicted individuals and society. Prevention and treatment strategies are needed. This study aimed to assess the effectiveness of an educational intervention on sickness absence, quality of life and severity...... of hand eczema. Methods PREVEX (PreVention of EXema) is an individually randomized, parallel-group superiority trial investigating the pros and cons of one-time, 2-hour, group-based education in skin-protective behavior versus treatment as usual among patients with newly notified occupational hand eczema...

  16. Preventing falls and fractures.

    Science.gov (United States)

    Ulfarsson, J; Robinson, B E

    1994-11-01

    One of four persons over age 65 in the community falls; those over age 75 in institutions fall more frequently. Falls, a complex phenomena suggesting present disease and predicting future disability, are caused by interactions between the environment and dynamic balance which is determined by the quality of sensory input, central processing, and motor responses. Clinical factors which predispose to falling often produce observable disturbances in gait and balance, making observation critical in assessment. Acute illness and drug therapy produce particularly preventable falls. Therapeutic exercise and environmental modification for safety are the clinical interventions most likely to successfully prevent fall-related injury.

  17. Gender-Based Violence Prevention. Issues in Prevention

    Science.gov (United States)

    Higher Education Center for Alcohol, Drug Abuse, and Violence Prevention, 2012

    2012-01-01

    This issue of "Issues in Prevention" focuses on gender-based violence prevention. This issue contains the following articles: (1) Preventing Gender-Based Violence: An Overview (Linda Langford); (2) Q&A With Amelia Cobb; (3) Denim Day at HBCUs; (4) Dear Colleague Letter; (5) ED Grants for Violence Prevention; and (6) Higher Education Center…

  18. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... arrow What's the best way to do daily skin inspections? play_arrow What are the most important ... to prevent pressure sores? play_arrow What is “skin tolerance” and how can it be increased? play_ ...

  19. Prevention of relapsing backache

    Directory of Open Access Journals (Sweden)

    Raspe, Heiner

    2006-05-01

    Full Text Available Background: The condition of non-specific back pain is characterized by high prevalence, non satisfactory therapeutic options and severe socioeconomic consequences. Therefore prevention seems an attractive option to downsize the problem. However, the construction of effective preventive measures is complicated by the obscure aetiology of the condition, the multidimensionality of risk and prognostic factors (bio psychosocial model! and the variability of its natural as well as clinical course. This led to the development of a wide variety of preventive measures: e. g. exercise programs, educational measures (including back school, ergonomic modification of the work environment, mechanical supports (e. g. back belts as well as multidisciplinary interventions. For two reasons the workplace seems to be a suitable setting for prevention. First, because a number of strong risk factors are associated with working conditions and second, because it allows addressing a large proportion of the adult population. Against this background the assessment at hand sets out to answer the following questions: What is the amount and methodological quality of the available scientific literature on the effectiveness of back pain prevention in the workplace environment? What are effective measures for the prevention of back pain and its consequences in the workplace environment and how effective are they? Is back pain prevention in the workplace environment cost-effective? Is there a need for more research? As primary outcomes for effectiveness the assessment will focus on time lost from work and the frequency and duration of episodes with back pain. The preventive measures assessed belong to the following categories: exercise programs, educational and information measures, multidimensional interventions, back belts, lifting teams and ergonomic interventions. Methods: The assessment is based on a systematic review of the published literature according to the

  20. Cervical Cancer Prevention

    Science.gov (United States)

    ... factors for some types of cancer, but only smoking can be avoided. Regular exercise and a healthy diet may be protective factors ... may help prevent certain cancers. Risk factors include smoking, being ... enough exercise. Increasing protective factors such as quitting smoking and ...

  1. Skin Cancer Prevention

    Science.gov (United States)

    ... factors for some types of cancer, but only smoking can be avoided. Regular exercise and a healthy diet may be protective factors ... may help prevent certain cancers. Risk factors include smoking, being ... enough exercise. Increasing protective factors such as quitting smoking and ...

  2. Endometrial Cancer Prevention

    Science.gov (United States)

    ... factors for some types of cancer, but only smoking can be avoided. Regular exercise and a healthy diet may be protective factors ... may help prevent certain cancers. Risk factors include smoking, being ... enough exercise. Increasing protective factors such as quitting smoking and ...

  3. Liver (Hepatocellular) Cancer Prevention

    Science.gov (United States)

    ... factors for some types of cancer, but only smoking can be avoided. Regular exercise and a healthy diet may be protective factors ... may help prevent certain cancers. Risk factors include smoking, being ... enough exercise. Increasing protective factors such as quitting smoking and ...

  4. Esophageal Cancer Prevention

    Science.gov (United States)

    ... factors for some types of cancer, but only smoking can be avoided. Regular exercise and a healthy diet may be protective factors ... may help prevent certain cancers. Risk factors include smoking, being ... enough exercise. Increasing protective factors such as quitting smoking and ...

  5. Oral Cancer Prevention

    Science.gov (United States)

    ... factors for some types of cancer, but only smoking can be avoided. Regular exercise and a healthy diet may be protective factors ... may help prevent certain cancers. Risk factors include smoking, being ... enough exercise. Increasing protective factors such as quitting smoking and ...

  6. Prostate Cancer Prevention

    Science.gov (United States)

    ... factors for some types of cancer, but only smoking can be avoided. Regular exercise and a healthy diet may be protective factors ... may help prevent certain cancers. Risk factors include smoking, being ... enough exercise. Increasing protective factors such as quitting smoking and ...

  7. Injury Prevention Research

    Centers for Disease Control (CDC) Podcasts

    2009-09-01

    Research provides the knowledge that we need to understand what is possible, what is not, and the best way to proceed in our intervention efforts.  Created: 9/1/2009 by National Center for Injury Prevention and Control (NCIPC).   Date Released: 9/1/2009.

  8. Bullying Prevention for Kids

    Centers for Disease Control (CDC) Podcasts

    2012-01-19

    This podcast discusses what victims of bullying may experience and provides recommendations for coping with it.  Created: 1/19/2012 by National Center for Injury Prevention and Control (NCIPC).   Date Released: 1/19/2012.

  9. Preventing Skin Cancer

    Centers for Disease Control (CDC) Podcasts

    2016-05-18

    A man and a woman talk about how they’ve learned to protect their skin from the sun over the years. .  Created: 5/18/2016 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/18/2016.

  10. Police and Suicide Prevention.

    Science.gov (United States)

    Marzano, Lisa; Smith, Mark; Long, Matthew; Kisby, Charlotte; Hawton, Keith

    2016-05-01

    Police officers are frequently the first responders to individuals in crisis, but generally receive little training for this role. We developed and evaluated training in suicide awareness and prevention for frontline rail police in the UK. To investigate the impact of training on officers' suicide prevention attitudes, confidence, and knowledge. Fifty-three participants completed a brief questionnaire before and after undertaking training. In addition, two focus groups were conducted with 10 officers to explore in greater depth their views and experiences of the training program and the perceived impact on practice. Baseline levels of suicide prevention attitudes, confidence, and knowledge were mixed but mostly positive and improved significantly after training. Such improvements were seemingly maintained over time, but there was insufficient power to test this statistically. Feedback on the course was generally excellent, notwithstanding some criticisms and suggestions for improvement. Training in suicide prevention appears to have been well received and to have had a beneficial impact on officers' attitudes, confidence, and knowledge. Further research is needed to assess its longer-term effects on police attitudes, skills, and interactions with suicidal individuals, and to establish its relative effectiveness in the context of multilevel interventions.

  11. [Improving suicide prevention].

    Science.gov (United States)

    Debout, Michel

    2017-04-01

    Suicidal thoughts precede a suicide attempt. Knowing the people who are exposed to such thoughts enables prevention to be improved. The results of a study of the general population show that one in five French people claim to have already seriously considered committing suicide. This represents a particularly concerning public health issue. Copyright © 2017. Published by Elsevier Masson SAS.

  12. Why Prevention? Why Now?

    Science.gov (United States)

    Tabachnick, Joan

    2013-01-01

    In 1995, the American Medical Association declared sexual abuse a "silent, violent epidemic." Since that declaration, there has been a growing acceptance and awareness of the need for a broader public health approach to preventing sexual violence. However, it is only recently that individuals and organizations are beginning to look at…

  13. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... and how can it be increased? play_arrow What do family members and caregivers need to know about pressure sores? play_arrow What do family members and caregivers need to do to prevent pressure sores? play_ ...

  14. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... the most important thing to do to prevent pressure sores? What is a Spinal Cord Injury? SCI Medical Experts People Living With SCI Personal Experiences By Topic Resources Blog Peer Counseling About Media Donate Contact Us Terms of ...

  15. Responsible Hospitality. Prevention Updates

    Science.gov (United States)

    Colthurst, Tom

    2004-01-01

    Responsible Hospitality (RH)--also called Responsible Beverage Service (RBS)--encompasses a variety of strategies for reducing risks associated with the sale and service of alcoholic beverages. RH programs have three goals: (1) to prevent illegal alcohol service to minors; (2) to reduce the likelihood of drinkers becoming intoxicated; and (3) to…

  16. To Prevent Misbehavior

    OpenAIRE

    Telep, Valya Goodwin, 1955-

    2009-01-01

    This series of lessons was prepared for parents like you - parents who want to do a better job of disciplining their children. The lessons were especially written for parents of preschool children, ages two to six, but some of the discipline methods are appropriate for older children, too. This lesson focuses on preventing misbehavior.

  17. Injury prevention in football

    African Journals Online (AJOL)

    other sports,[1,2] and youth football players are no exception to this. ... at risk of sports injury because of high levels of exposure at a time of major physiological change.[4] The ..... As part of injury prevention, adequate injury management and.

  18. Preventing infections when visiting

    Science.gov (United States)

    ... need.) When you visit a patient in the hospital, keep your hands away from your face. Cough or sneeze into a tissue or into the crease of your elbow, not into the air. References Calfee DP. Prevention and control of health care-associated infections. In: Goldman L, Schafer AI, eds. Goldman-Cecil ...

  19. Preventing the White Death

    DEFF Research Database (Denmark)

    Hansen, Casper Worm; Jensen, Peter S.; Madsen, Peter

    2017-01-01

    Tuberculosis (TB) is a leading cause of death worldwide and, while treatable by antibiotics since the 1940s, drug resistant strains have emerged. This paper estimates the effects of the establishment of a pre-antibiotic era public health institution, known as a TB dispensary, designed to prevent...

  20. Travel health prevention.

    Science.gov (United States)

    Korzeniewski, Krzysztof

    All around the world there has been a rapid growth in the number of international travels. According to the World Tourism Organisation the number of international tourist arrivals reached 1,235 billion in 2016 and continues to grow at a high rate. This has been much due to the development of air transport (including low-cost airlines), increasingly common economic migration, a growing number of travellers visiting friends and relatives, and an increase in medical tourism. With tropical destinations becoming increasingly popular among travellers, doctors have seen a rising number of patients who seek medical advice on health risks prevalent in hot countries and health prevention measures to be taken in tropical destinations, especially where sanitation is poor. The risk for developing a medical condition while staying abroad depends on a variety of factors, including the traveller's general health condition, health prevention measures taken before or during travel (vaccinations, antimalarial chemoprophylaxis, health precautions during air, road and sea travel, proper acclimatisation, prevention of heat injuries, protection against local flora and fauna, personal hygiene, water, food and feeding hygiene), as well as the prevalence of health risk factors in a given location. Health prevention is a precondition for safe travel and maintaining good physical health; in the era of a rapid growth in international tourism it has become of key importance for all travellers.

  1. Statins and Cancer Prevention

    Science.gov (United States)

    ... opposed to the use of another type of lipid-lowering drug, fibrates). [Statins and the risk of colorectal cancer. Poynter, JN., et al. New England Journal of Medicine , May 26, 2005, (352:2184–92]. Is NCI supporting research with statins to prevent other types of cancer? ...

  2. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... cushion? play_arrow What’s important to know about positioning in bed to prevent pressure sores? play_arrow ... Disabilities Photography by Rona Talcott Website by Mobile Marketing LLC Understanding Spinal Cord Injury About Us Expert ...

  3. Preventing Melanoma PSA (:60)

    Centers for Disease Control (CDC) Podcasts

    This 60 second public service announcement is based on the June 2015 CDC Vital Signs report. Skin cancer is the most common form of cancer in the U.S. In 2011, there were more than 65,000 cases of melanoma, the most deadly form of skin cancer. Learn how everyone can help prevent skin cancer.

  4. Preventing School Violence

    Science.gov (United States)

    Rulloda, Rudolfo Barcena

    2011-01-01

    School violence has mushroomed into a devastating epidemic and is deteriorating the basic foundation of education. In this article, the author will present several teaching strategies for preventing school violence from becoming an arduous enigma within the classroom and school environments, and focus on assessment and reflection in order to…

  5. Youth Suicide Prevention.

    Science.gov (United States)

    Gould, Madelyn S.; Kramer, Rachel A.

    2001-01-01

    Reviews research literature on youth suicide that has emerged during the past two decades and examines the possibility of linking this research to the practice of suicide prevention. Such research could be used to develop and evaluate appropriate crisis centers and hotlines as well as school-based suicide awareness curriculum programs. Table…

  6. Prevention of COPD exacerbations

    DEFF Research Database (Denmark)

    Vestbo, Jørgen; Lange, Peter

    2015-01-01

    Exacerbations have significant impact on the morbidity and mortality of patients with chronic obstructive pulmonary disease. Most guidelines emphasise prevention of exacerbations by treatment with long-acting bronchodilators and/or anti-inflammatory drugs. Whereas most of this treatment is eviden...

  7. Neonatal Pressure Ulcer Prevention.

    Science.gov (United States)

    Scheans, Patricia

    2015-01-01

    The incidence of pressure ulcers in acutely ill infants and children ranges up to 27 percent in intensive care units, with a range of 16-19 percent in NICUs. Anatomic, physiologic, and developmental factors place ill and preterm newborns at risk for skin breakdown. Two case studies illustrate these factors, and best practices for pressure ulcer prevention are described.

  8. Prevention of nuclear war

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    Removing the threat of a nuclear war-as the General Assembly formally stated in the Final Document of its first special session devoted to disarmament, in 1978-is considered to be the task of the present day. In that Document, the General Assembly sought to establish principles, guidelines and procedures for preventing nuclear war. It declared that to that end, it was imperative to remove the threat of nuclear weapons, to halt and reverse the nuclear-arms race until the total elimination of nuclear weapons and their delivery systems had been achieved (see chapter iv), and to prevent the proliferation of nuclear weapons (see chapter VII). At the same time, it called for other measures designed to prevent the outbreak of nuclear war and to lessen the danger of the treat or use of nuclear weapons. The Assembly's clear call for action was dictated by the awareness that there was no insuperable barrier dividing peace from war and that, unless nations brought the spiralling nuclear-arms race to an end, the day might come when nuclear weapons would actually be used, with catastrophic consequences. In adopting the Final Document, the international community achieved, for the first time, a consensus on an international disarmament strategy having as its immediate goal the elimination of the danger of a nuclear war and the implementation of measures to halt and reverse the arms race. The General Assembly, at its second special session on disarmament, in 1982, reaffirmed the validity of the 1978 Final Document. This paper reports that nuclear issues and in particular the prevention of nuclear war remain, however, major concerns of all States. Undoubtedly, all nations have a vital interest in the negotiation of effective measures for her prevention of nuclear war, since nuclear weapons pose a unique threat to human survival. If nuclear war were to occur, its consequences would be global, not simple regional

  9. Preventive Detention: A Necessity

    Directory of Open Access Journals (Sweden)

    Jaya Mishra

    2017-08-01

    Full Text Available State, ever since, its emergence, has been concerned with the maintenance of law and order and protecting people from external aggression and internal threats, thereby, ensuring safety and security to its inhabitants. The authority to maintain law and order empowers the state to use coercive power. It also emanates from various laws that are enacted from time to time. More often than not, coercive laws are self-contradictory because on the one hand they guarantee rights to people and on the other hand, they take away the right of a person or persons. Therefore, it is not wrong to say that modern states are repository of contradictions and India is no exception. There are several undemocratic provisions in the Indian Constitution; preventive detention is one of them. It seeks to detain a person to prevent him/her from indulging in any activity which is likely to pose a threat to the security of the State. In Britain and America this provision was used during World War II while, in India it can be used even in peacetime. This provision has been extensively used against the political dissidents during the post-colonial period. Justice Mahajan of the Supreme Court of India has held that ‘preventive detention laws are repugnant to democratic constitution and they cannot be found to exist in any of the democratic countries of the world’. The question that one can ask at this juncture is that why did the Government of ‘independent’ India retain preventive detention laws? And further, framed new ones. This research contribution examines the circumstances which compelled the Government to frame ‘preventive detention’ laws, and its use during national emergency and peace time.

  10. Osteoradionecrosis: Causes and prevention

    International Nuclear Information System (INIS)

    Friedman, R.B.

    1990-01-01

    Osteoradionecrosis (ORN) is one of the most serious complications arising from head and neck radiation therapy. Current research has shown that ORN represents nonhealing, dead bone and is not a state of infection. ORN is the result of functional and structural bony changes that may not be expressed for months or years. ORN may occur spontaneously or in response to wounding. Predisposing factors include absorbed radiation dose, fractionation, delivery modality, and dental status. Timing of dental extractions and other factors have also been shown to affect incidence. ORN may be reduced through early intraoral evaluation, treatment, and adequate healing time prior to beginning RT. Hyperbaric oxygen (HBO) therapy has been beneficial in the prevention and treatment of ORN. It is of paramount importance for the medical community to recognize the factors that may reduce ORN incidence, endorse oral care protocols, and acknowledge the value of HBO therapy in the prevention and treatment of this disease. 60 references

  11. Crime prevention and Education

    DEFF Research Database (Denmark)

    Brønsted, Lone Bæk

    , street worker, social workers) by focusing on how welfare workers form, reform and transform interventions, and thereby instigate the structure of welfare work with social effects. Finally, the paper aims to examine how an inter-professional meeting outside the school environment produces understandings...... of such a preventive work aiming at creating trustful relations between the school and the children and focusing on children’s democracy understandings, experienced discrimination and peer pressure. Furthermore, the school are to activate children’s reflections on existential questions and their empathy with others...... a statutory duty for schools to have due regard to the need to prevent people from being drawn into terrorism. The school and education in general are seen as safe spaces. Notions like “safe space” and school as a “protection factor” reflect an educational discourse that reflect discoursive changes...

  12. Preventing Financial Crime

    DEFF Research Database (Denmark)

    Boll, Karen

    This paper investigates the Swedish tax authority’s (Skatteverkets) compliance initiative called Preventing Financial Crime. In Sweden tax evasion related to organised moon-lighting is defined as a major risk to the revenue collection and to the legitimacy of Skatteverket. The traditional approach...... on this, the paper shows that the Swedish tax officials seek to motivate large construction contractors and municipalities to take preventive measures in relation to their sub-contractors to avoid and abate tax evasion. The paper shows the challenges in engaging and involving these external stakeholders...... has implications for how tax authorities (and other state authorities) reform their coercive regulation. If they decide to pursue a voluntary based approach where the actions of external partners play a central role, then the analysis helps to show some of the implied challenges and potentials....

  13. Let's prevent diabetes

    DEFF Research Database (Denmark)

    Gray, Laura J.; Khunti, Kamlesh; Williams, Sian

    2012-01-01

    Background: The prevention of type 2 diabetes is a globally recognised health care priority, but there is a lack of rigorous research investigating optimal methods of translating diabetes prevention programmes, based on the promotion of a healthy lifestyle, into routine primary care. The aim...... of the study is to establish whether a pragmatic structured education programme targeting lifestyle and behaviour change in conjunction with motivational maintenance via the telephone can reduce the incidence of type 2 diabetes in people with impaired glucose regulation (a composite of impaired glucose...... of type 2 diabetes. Secondary outcomes include changes in HbA1c, blood glucose levels, cardiovascular risk, the presence of the Metabolic Syndrome and the cost-effectiveness of the intervention.Methods: The study consists of screening and intervention phases within 44 general practices coordinated from...

  14. Preventive Radiation Protection Act

    International Nuclear Information System (INIS)

    Roewer, H.

    1988-01-01

    The commentary is intended to contribute to protection of the population by a practice-oriented discussion and explanation of questions arising in connection with the Preventive Radiation Protection Act. Leaving aside discussions about abandonment of nuclear power, or criticism from any legal point of view, the commentary adopts the practical approach that accepts, and tries to help implementing, the act as it is. It is a guide for readers who are not experts in the law and gives a line of orientation by means of explanations and sometimes by citations from other acts (in footnotes). The commentary also presents the EURATOM Directive No. 3954/87 dated 22 December 1987, the EC Directive No. 3955/87 dated 22 December 1987, and the EC Directive No. 1983/88 dated 5 July 1988. A tabular survey shows the system of duties and competences defined by the Preventive Radiation Protection Act. (RST) [de

  15. The Prevention of Thalassemia

    Science.gov (United States)

    Cao, Antonio; Kan, Yuet Wai

    2013-01-01

    The thalassemias are among the most common inherited diseases worldwide, affecting individuals originating from the Mediterranean area, Middle East, Transcaucasia, Central Asia, Indian subcontinent, and Southeast Asia. As the diseases require long-term care, prevention of the homozygous state constitutes a major armament in the management. This article discusses the major prevention programs that are set up in many countries in Europe, Asia, and Australia, often drawing from the experience in Sardinia. These comprehensive programs involve carrier detections, molecular diagnostics, genetic counseling, and prenatal diagnosis. Variability of clinical severity can be attributable to interactions with α-thalassemia and mutations that increase fetal productions. Special methods taht are currently quite expensive and not widely applicable are preimplantation and preconception diagnosis. The recent successful studies of fetal DNA in maternal plasma may allow future prenatal diagnosis that is noninvasive for the fetus. PMID:23378598

  16. Teleophthalmology in preventive medicine

    CERN Document Server

    Michelson, Georg

    2014-01-01

    This book provides an up-to-date overview of the clinical applications, methods, and technologies of teleophthalmology within the field of preventive medicine. The ability of novel methods to detect the initial signs of neurodegenerative diseases on the basis of alterations in the retina is reviewed, and detailed attention is paid to the role of teleophthalmology in screening for vision-threatening diseases such as diabetic retinopathy, glaucoma, and age-related macular degeneration. A major part of the book is devoted to novel imaging methods and the latest information technologies, including advanced mobile communication and Web 2.0 applications in teleophthalmology. In addition, the initial projects of an interdisciplinary cooperation in preventive medicine are described. All of the authors are experienced in the scientific and practical aspects of teleophthalmology, including e-learning, and have produced a book that will meet the needs of all medical care providers interested in using teleophthalmology.

  17. Culturally Relevant Cyberbullying Prevention

    OpenAIRE

    Phillips, Gregory John

    2017-01-01

    In this action research study, I, along with a student intervention committee of 14 members, developed a cyberbullying intervention for a large urban high school on the west coast. This high school contained a predominantly African American student population. I aimed to discover culturally relevant cyberbullying prevention strategies for African American students. The intervention committee selected video safety messages featuring African American actors as the most culturally relevant cyber...

  18. Prevention of criticality accidents

    International Nuclear Information System (INIS)

    Canavese, S.I.

    1982-01-01

    These notes used in the postgraduate course on Radiological Protection and Nuclear Safety discuss macro-and microscopic nuclear constants for fissile materials systems. Critical systems: their definition; criteria to analyze the critical state; determination of the critical size; analysis of practical problems about prevention of criticality. Safety of isolated units and of sets of units. Application of standards. Conception of facilities from the criticality control view point. (author) [es

  19. Prevention in insurance markets

    OpenAIRE

    Marie-Cécile FAGART; Bidénam KAMBIA-CHOPIN

    2006-01-01

    This paper considers a competitive insurance market under moral hazard and adverse selection, in which preventive efforts and self-protection costs are unobservable by insurance companies. Under reasonable assumptions, the conclusions of Rothschild and Stiglitz (1976) are preserved in our context even if it involves moral hazard. The riskier agents in equilibrium, who would also be the riskier agents under perfect information, receive their moral hazard contract. For other agents, adverse sel...

  20. Optimal preventive bank supervision

    OpenAIRE

    Belhaj, Mohamed; Klimenko, Nataliya

    2012-01-01

    Early regulator interventions into problem banks is one of the key suggestions of Basel Committee on Banking Supervision. However, no guidance is given on their design. To fill this gap, we outline an incentive-based preventive supervision strategy that eliminates bad asset management in banks. Two supervision techniques are combined: temporary regulatory administration and random audits. Our design ensures good management without excessive supervision costs, through a gradual adjustment of...

  1. Osteoradionecrosis prevention myths

    International Nuclear Information System (INIS)

    Wahl, Michael J.

    2006-01-01

    Purpose: To critically analyze controversial osteoradionecrosis (ORN) prevention techniques, including preradiation extractions of healthy or restorable teeth and the use of prophylactic antibiotics or hyperbaric oxygen (HBO) treatments for preradiation and postradiation extractions. Methods: The author reviewed ORN studies found on PubMed and in other article references, including studies on overall ORN incidence and pre- and postradiation incidence, with and without prophylactic HBO or antibiotics. Results: Owing in part to more efficient radiation techniques, the incidence of ORN has been declining in radiation patients over the last 2 decades, but the prevention of ORN remains controversial. A review of the available literature does not support the preradiation extraction of restorable or healthy teeth. There is also insufficient evidence to support the use of prophylactic HBO treatments or prophylactic antibiotics before extractions or other oral surgical procedures in radiation patients. Conclusions: To prevent ORN, irradiated dental patients should maintain a high level of oral health. A preradiation referral for a dental evaluation and close collaboration by a multidisciplinary team can be invaluable for radiation patients. As with most other dental patients, restorable and healthy teeth should be retained in irradiated patients. The use of prophylactic HBO or antibiotics should be reconsidered for preradiation and postradiation extractions

  2. Prevention of malignant neoplasms

    Directory of Open Access Journals (Sweden)

    D. G. Zaridze

    2017-01-01

    Full Text Available Research in causation of cancer is an important part of cancer research in general and is an essential prerequisite for cancer prevention. The effective primary prevention is not visible without evidence based knowledge in the causation of cancer in humans.There is sufficient evidence that certain life style and environment factors cause cancer in humans. These factors include: smoking and other types of tobacco consumption, overweight and obesity, lack of physical activity, diet rich in processed meat and poor in vegetables and fruits, certain types of viral and bacterial infection, ultraviolet radiation, ionizing radiation, ambient air pollution, carcinogens at workplace, exogenous hormones.Cancer mortality is decreasing in majority of developed countries, including Russia. This mortality trend is mostly due to decrease in incidence and death rates of lung and other smoking related cancers and is caused by decline in smoking prevalence and change in tar content of cigarette smoke.In Russia trend in mortality from all cancers is as well determined by decrease in incidence and mortality from gastric cancer, which is due to decline in prevalence of Helicobacter pylori infection and improvement of diet, increase in consumption of fruits and vegetables. Thus the decline in cancer mortality is mostly the result of primary prevention which is the most effective avenue of cancer control. 

  3. [Prevention of pressure ulcers].

    Science.gov (United States)

    Negishi, Kenichi

    2009-12-01

    Even though they have not been diagnosed with a recognized disease, many people have or are at risk of contracting debilitating conditions. They can be referred to as being in the "ill-health zone." For example, many bedridden elderly develop pressure ulcers. The prevention and treatment of pressure ulcers should focus on two main factors: the role of pressure in the development of circulatory disorders; and increased dermal pH. In preventing the development of circulatory disorders resulting in pressure ulcers, using an air or polyurethane mattress is helpful. However, changing the mattress has little effect if the position of the bedridden person is not also changed regularly. To avoid an increase in dermal pH, caregivers should apply moisture-repellent cream and/or oil to the sacral region after careful cleansing. It is important that such preventive measures and treatment be performed daily, and caregivers should be educated on this need and subsequently monitored. Pharmacists have a role in caring for those in the ill-health zone.

  4. Guidelines for prevention in psychology.

    Science.gov (United States)

    2014-04-01

    The effectiveness of prevention to enhance human functioning and reduce psychological distress has been demonstrated. From infancy through adulthood, access to preventive services and interventions is important to improve the quality of life and human functioning and reduce illness and premature death. The importance of prevention is consistent with the Patient Protection and Affordable Care Act of 2010. Even with the increased focus on prevention, psychology training programs rarely require specific courses on prevention. In particular, conceptualizations about best practices in prevention, particularly at the environmental level, are lacking. Therefore, psychologists engaged in prevention can benefit from a set of guidelines that address and inform prevention practices. Accordingly, the Guidelines for Prevention in Psychology are intended to "inform psychologists, the public, and other interested parties regarding desirable professional practices" in prevention. The Prevention Guidelines are recommended based on their potential benefits to the public and the professional practice of psychology. They support prevention as an important area of practice, research, and training for psychologists. The Guidelines give increased attention to prevention within APA, encouraging psychologists to become involved with preventive activities relevant to their area of practice. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

  5. [AIDS prevention in Germany].

    Science.gov (United States)

    Pott, E

    2007-04-01

    In 1987 the national AIDS prevention campaign "Gib AIDS keine Chance" (Don't give AIDS a chance) was started in Germany. After a very difficult and controversial political debate about a probably successful response to AIDS, in the end a political decision was made in favour of the implementation of a long term "social learning strategy". Thus, since then the Bundeszentrale für gesundheitliche Aufklärung (Federal Centre for Health Education, BZgA) has been running the campaign on behalf of the Federal Ministry of Health. The result of this prevention program is a low rate of infections. In Germany there were 2600 newly diagnosed infections in 2005: 59 % in homosexual men, 16 % by heterosexual contacts, 17 % in people from high prevalence countries and 7 % in i.v. drug users. In comparison to the international situation Germany has a relatively low HIV-prevalence even nowadays. However, Germany has also been confronted with an increasing number of newly diagnosed infections in the last few years. When the prevention program was started it was very important to build new structures for a successful implementation of the campaign. That meant for instance to build up an effective infrastructure for cooperation between the governmental and the nongovernmental sector, including organising the coordinated action among the partners at the federal, regional and local levels. Likewise, international networking was of great importance. A key element, relevant for the success of the campaign was the close cooperation at the federal level between the BZgA and the Deutsche AIDS Hilfe (German AIDS Help, DAH), to combine the highreach intervention in low-prevalence populations with intensive interventions for high prevalence groups. An effective national AIDS prevention campaign must reach the whole population; inform the public about the main risks of infection, about methods of protection and about what is not infectious. Moreover groups with a higher level of risk of

  6. Early prevention of obesity

    Directory of Open Access Journals (Sweden)

    Claudio Maffeis

    2014-06-01

    Full Text Available Childhood obesity is the metabolic disorder with the highest prevalence in both children and adults. Urgency to treat and prevent childhood obesity is based on the clear evidence that obesity tends to track from childhood to adulthood, is associated to morbidity also in childhood and to long-term mortality. Early life, i.e., intrauterine life and the first two years, is a sensitive window for prevention. Anatomical and functional maturation of the hypothalamic structures devoted to regulating energy intake and expenditure and body size mainly occurs in the first 1,000 days of life. Therefore, factors affecting the foetal exposition to maternal metabolic environment and early postnatal nutrition are crucial in modulating the definition of the metabolic programming processes in the brain. Maternal diseases, mainly malnutrition for defect or excess, obesity and diabetes, placental disorders and dysfunctions, maternal use of alcohol and drugs, smoking, affect long term metabolic programming of the foetus with lifelong consequences. Similarly, early nutrition contributes to complete the long-term metabolic regulating framework initiated in the uterus. Breastfeeding, adequate weaning, attention to portion size and diet composition are potential tools for reducing the obesity risk later in childhood. Longitudinal randomized controlled studies are needed for exploring the efficacy of obesity prevention strategies initiated after conception.Proceedings of the 10th International Workshop on Neonatology · Cagliari (Italy · October 22nd-25th, 2014 · The last ten years, the next ten years in Neonatology Guest Editors: Vassilios Fanos, Michele Mussap, Gavino Faa, Apostolos Papageorgiou

  7. Preventive measures for emergencies?

    International Nuclear Information System (INIS)

    Calliess, J.

    1990-01-01

    The meeting discussed the new provisions for civil defense on account of the amended Disaster Control Act which had been recently adopted by the Lower House of Parliament. In 6 working groups it was discussed how appropriate and sensible the attempt is to make provisions for civil defence in order to protect the population, and how adequate legislative measures are in the face of true threat and var scenarios. Ethical aspects and aspects of international law were considered, as well as the role of public health and free charitable institutions concering preventive measures in emergencies. (orig. HSCH) [de

  8. Medical Services: Preventive Medicine

    Science.gov (United States)

    1990-10-15

    those at risk. Isoniazid (INH)administered orally is normally used for preventive therapy (300 mg daily for adults and 10 to 14 mg/kg body weight not to...netting, and insecticide aerosols; by taking approved chemoprophylaxis; and by wearing the uniform properly. d. Enteric disease by using iodine tablets ...National stock number: 6850–00–985–7166 Description: Water purification tablet , iodine, 50’s Unit/Issue: BT Allowance: 400 Authority: CTA 8–100 Notes: 1

  9. Prevention of acute malnutrition

    DEFF Research Database (Denmark)

    de Pee, Saskia; Grais, Rebecca; Fenn, Bridget

    2015-01-01

    of cash or food, enables households to better meet the food, health, and other needs of household members and may increase resilience; water, sanitation, and hygiene (WASH) and health interventions help prevent and address illness and hence reduce wasting risk. The contributions of specific interventions...... "best possible" treatment, can provide evidence about what works, to what extent, at what cost, and under which circumstances. Programs should address the most important causes in given contexts, be feasible to implement at scale, and assess implementation, coverage, and outcomes....

  10. Accident prevention programme

    International Nuclear Information System (INIS)

    1978-01-01

    This study by the Steel Industry Safety and Health Commission was made within the context of the application by undertakings of the principles of accident and disease prevention previously adopted by the said Commission. It puts forward recommendations for the effective and gradual implementation of a programme of action on occupational health and safety in the various departments of an undertaking and in the undertaking as a whole. The methods proposed in this study are likely to be of interest to all undertakings in the metallurgical industry and other industrial sectors

  11. Preventing medical device recalls

    CERN Document Server

    Raheja, Dev

    2014-01-01

    Introduction to Medical Device RequirementsIntroductionThe ChallengesSources of ErrorsUnderstanding the Science of Safety     Overview of FDA Quality System Regulation     Overview of Risk Management Standard ISO 14971     Overview of FDA Device Approval Process     Overview of Regulatory Requirements for Clinical TrialsSummaryReferencesPreventing Recalls during Specification WritingIntroductionConduct Requirements Analysis to Identify Missing RequirementsSpecifications for Safety, Durability, and

  12. Selenium for preventing cancer

    Directory of Open Access Journals (Sweden)

    Gabriele Dennert

    Full Text Available BACKGROUND: Selenium is a trace element essential to humans. Higher selenium exposure and selenium supplements have been suggested to protect against several types of cancers. OBJECTIVE: Two research questions were addressed in this review: What is the evidence for: 1. an aetiological relationship between selenium exposure and cancer risk in women and men?; 2. the efficacy of selenium supplementation for cancer prevention in women and men? SEARCH STRATEGY: We searched electronic databases and bibliographies of reviews and included publications. SELECTION CRITERIA: We included prospective observational studies to answer research question (a and randomised controlled trials (RCTs to answer research question (b. DATA COLLECTION AND ANALYSIS: We conducted random effects meta-analyses of epidemiological data when five or more studies were retrieved for a specific outcome. We made a narrative summary of data from RCTs. MAIN RESULTS: We included 49 prospective observational studies and six RCTs. In epidemiologic data, we found a reduced cancer incidence (summary odds ratio, OR, 0.69; 95% confidence interval, CI, 0.53 to 0.91 and mortality (OR 0.55, 95% CI 0.36 to 0.83 with higher selenium exposure. Cancer risk was more pronouncedly reduced in men (incidence: OR 0.66, 95% CI 0.42 to 1.05 than in women (incidence: OR 0.90, 95% CI 0.45 to 1.77. These findings have potential limitations due to study design, quality and heterogeneity of the data, which complicated the interpretation of the summary statistics. The RCTs found no protective efficacy of selenium yeast supplementation against non-melanoma skin cancer or L-selenomethionine supplementation against prostate cancer. Study results for the prevention of liver cancer with selenium supplements were inconsistent and studies had an unclear risk of bias. The results of the Nutritional Prevention of Cancer Trial (NPCT and SELECT raised concerns about possible harmful effects of selenium supplements. AUTHORS

  13. Stroke Prevention & Treatment: Diet & Nutrition

    Science.gov (United States)

    ... Prevention & Treatment: Diet & Nutrition Stroke Prevention & Treatment: Diet & Nutrition A healthy diet can reduce your risk for ... Treatment How does a stroke affect eating and nutrition? Stroke can devastate a person's nutritional health because ...

  14. Head Lice: Prevention and Control

    Science.gov (United States)

    ... and General Public. Contact Us Parasites Home Prevention & Control Language: English (US) Español (Spanish) Recommend on Facebook ... that can be taken to help prevent and control the spread of head lice: Avoid head-to- ...

  15. Body Lice Prevention and Control

    Science.gov (United States)

    ... and General Public. Contact Us Parasites Home Prevention & Control Recommend on Facebook Tweet Share Compartir Body lice ... that can be taken to help prevent and control the spread of body lice: Bathe regularly and ...

  16. Immunoglobulins for preventing hepatitis A

    DEFF Research Database (Denmark)

    Liu, Jian Ping; Nikolova, Dimitrinka; Fei, Yutong

    2009-01-01

    Hepatitis A (infectious hepatitis) is a common epidemic disease. Immunoglobulins for passive immunisation are used as prevention.......Hepatitis A (infectious hepatitis) is a common epidemic disease. Immunoglobulins for passive immunisation are used as prevention....

  17. The Science of Cancer Prevention

    Science.gov (United States)

    The science of cancer prevention is described by Dr. Barnett S. Kramer, M.D., M.P.H., director of the Division of Cancer Prevention, National Cancer Institute (NCI). The Division of Cancer Prevention administers a broad spectrum of research that spans basic pre-clinical, laboratory research, supportive and palliative care research, early detection, and randomized controlled clinical trials. The Division also supports the Cancer Prevention Fellowship Program and is devoted to the balanced communication of scientific results.

  18. Eating Disorders: Prevention through Education.

    Science.gov (United States)

    Nagel, K. L.; Jones, Karen H.

    1993-01-01

    School prevention programs for teenage eating disorders should emphasize nutrition education (knowledge, attitudes, behavior) and living skills (self-concept, coping). Secondary prevention involves identifying early warning signs and places for referral; tertiary prevention creates a supportive school environment for recoverers with teachers as…

  19. Evaluation Methods for Prevention Education.

    Science.gov (United States)

    Blue, Amy V.; Barnette, J. Jackson; Ferguson, Kristi J.; Garr, David R.

    2000-01-01

    Discusses the importance of assessing medical students' competence in prevention knowledge, skills, and attitudes. Provides general guidance for programs interested in evaluating their prevention instructional efforts, and gives specific examples of possible methods for evaluating prevention education. Stresses the need to tailor assessment…

  20. INITIAL ALLERGY PREVENTION IN CHILDREN

    Directory of Open Access Journals (Sweden)

    A.N. Pampura

    2009-01-01

    Full Text Available Allergy prevention is an urgent pediatric issue. Food allergy spread among infants amounts to 6–8%. This review highlights the modern viewpoints on diet prevention of this pathology among children, including by means of the hypoallergic nutritional formulas.Key words: food allergy, prevention, allergies, prebiotics, children.

  1. Can prevention eliminate caries?

    Science.gov (United States)

    O'Mullane, D

    1995-07-01

    There are four main factors involved in the carious process: at-risk tooth structure, plaque flora, fermentable carbohydrates, and time. Based on our knowledge of the carious process, four main preventive strategies have been developed over the years, namely, fluorides, fissure sealing, dietary choice, and plaque control. Fluorides are having a major impact on smooth-surface caries; hence, strategies combining fluorides and fissure sealing are very effective. However, use of fissure sealing is still problematic. Changing dietary practices with a view to reducing dental caries seems to be having little impact on a global scale. Plaque control, as practiced routinely by the majority of people, is not sufficient to result in caries reductions. Deprivation and poverty are strongly associated with high caries levels. Although the preventive strategies currently available are likely to result in lower caries levels for many, for logistical reasons and because of factors associated with deprivation and poverty, caries is likely to remain a major public health problem in most communities for the foreseeable future.

  2. Cholera - management and prevention.

    Science.gov (United States)

    Davies, Hannah G; Bowman, Conor; Luby, Stephen P

    2017-06-01

    Cholera is an acute secretory diarrhoeal infection caused by the bacterium Vibrio cholerae. It is likely to have originated in the Indian sub-continent; however, it spread to cause six worldwide pandemics between 1817-1923. The ongoing seventh worldwide pandemic of cholera began in 1961. The intensity, duration and severity of cholera epidemics have been increasing, signaling the need for more effective control and prevention measures. The response to the cholera pandemics of the 19th century led to the development of safe and effective sanitation and water systems which have effectively removed the risk of cholera in many settings. However, such systems are not in place to protect billions of people worldwide. Although some progress has been made in expanding access to water in recent years, achieving optimal infrastructure will, in the most optimistic scenario, take decades. Climate change, extreme weather events and rapid urbanisation suggests that alternatives to the current paradigm of providing large centralised water and sanitation systems should be considered, including smaller decentralised systems. The aim of this review paper is to provide an overview of current knowledge regarding management of cholera with a focus on prevention measures including vaccination and water and sanitation interventions. © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  3. Exercise Prevents Mental Illness

    Science.gov (United States)

    Purnomo, K. I.; Doewes, M.; Giri, M. K. W.; Setiawan, K. H.; Wibowo, I. P. A.

    2017-03-01

    Multiple current studies show that neuroinflammation may contribute to mental illness such as depression, anxiety, and mood disorder. Chronic inflammation in peripheral tissues is indicated by the increase of inflammatory marker like cytokine IL-6, TNF-α, and IL-1β. Pro-inflammatory cytokine in peripheral tissues can reach brain tissues and activate microglia and it causes neuroinflammation. Psychological stress may led peripheral and central inflammation. Activated microglia will produce pro-inflammatory cytokine, ROS, RNS, and tryptophan catabolizes. This neuroinflammation can promote metabolism changes of any neurotransmitter, such as serotonin, dopamine, and glutamate that will influence neurocircuit in the brain including basal ganglia and anterior cingulated cortex. It leads to mental illness. Exercise give contribution to reduce tissue inflammation. When muscle is contracting in an exercise, muscle will produce the secretion of cytokine like IL-6, IL-1ra, and IL-10. It will react as anti-inflammation and influence macrophage, T cell, monosit, protein Toll-Like Receptor (TLR), and then reduce neuroinflammation, characterised by the decrease of pro-inflammatory cytokine and prevent the activation of microglia in the brain. The objective of the present study is to review scientific articles in the literature related to the contribution of exercise to prevent and ease mental illness.

  4. Prevention of hepatitis B

    Directory of Open Access Journals (Sweden)

    Marta Estera Kowalska

    2017-07-01

    Full Text Available Hepatitis B (Hepatitis B is a hepatitis B virus (HBV -based liver disease. This virus has an affinity for liver cells, it can cause both acute and chronic viral infections of varying severity. The consequences of chronic HBV infection can be cirrhosis and liver cancer. In Poland in 1989 a preventive program was implemented to reduce HBV infection. Universal vaccinations have been introduced to reduce the prevalence of Type B hepatitis B from 40.3 / 100,000 in 1989 to 7/100 in 2000. In the last 20 years in Poland there has been huge progress in the prevention and suppression of HBV infections. Decrease in the incidence of hepatitis B is mainly the result of the introduction of compulsory vaccination and improving hygiene procedures and improve sanitation aimed at aborting the pathways of the virus. However, still a large part of society is not immune on HBV infection acting potential group of the risk of infection. In addition, in the era of a growing group of followers. movements of the anti vaccine it is necessary to continue to promote knowledge of HBV and the efficacy and safety of vaccination.

  5. Obesity prevention in children.

    Science.gov (United States)

    Moreno, Luis A; Bel-Serrat, Silvia; Santaliestra-Pasías, Alba M; Rodríguez, Gerardo

    2013-01-01

    The prevalence of childhood overweight and obesity continues to be unacceptably high and of public health concern in Europe. During childhood and adolescence, environmental factors are the main drivers of obesity development. Obesity is caused by a chronic energy imbalance involving both dietary intake and physical activity patterns. Several risk factors are influencing obesity development, even starting in the prenatal period. From birth, along life, mainly diet and physical activity/inactivity are the most important drivers on top of genetic susceptibility. The first years of life can therefore be crucial to start preventive interventions that can have an impact on lifestyle and on later overweight and obesity. Schools are an attractive and popular setting for implementing interventions for children. Interventions including a community component are considered to be the most effective. Obesity control will require policy interventions to improve the environments that promote poor dietary intake and physical inactivity rather than individually focused interventions. More solid institutional and health policies are needed together with more effective interventions to obtain evident changes for the prevention of excess adiposity among children. Copyright © 2013 S. Karger AG, Basel.

  6. Initiatives for proliferation prevention

    International Nuclear Information System (INIS)

    1997-04-01

    Preventing the proliferation of weapons of mass destruction is a central part of US national security policy. A principal instrument of the Department of Energy's (DOE's) program for securing weapons of mass destruction technology and expertise and removing incentives for scientists, engineers and technicians in the newly independent states (NIS) of the former Soviet Union to go to rogue countries or assist terrorist groups is the Initiatives for Proliferation Prevention (IPP). IPP was initiated pursuant to the 1994 Foreign Operations Appropriations Act. IPP is a nonproliferation program with a commercialization strategy. IPP seeks to enhance US national security and to achieve nonproliferation objectives by engaging scientists, engineers and technicians from former NIS weapons institutes; redirecting their activities in cooperatively-developed, commercially viable non-weapons related projects. These projects lead to commercial and economic benefits for both the NIS and the US IPP projects are funded in Russian, Ukraine, Kazakhstan and Belarus. This booklet offers an overview of the IPP program as well as a sampling of some of the projects which are currently underway

  7. Pressure Ulcer Prevention

    Science.gov (United States)

    2009-01-01

    Executive Summary In April 2008, the Medical Advisory Secretariat began an evidence-based review of the literature concerning pressure ulcers. Please visit the Medical Advisory Secretariat Web site, http://www.health.gov.on.ca/english/providers/program/mas/tech/tech_mn.html to review these titles that are currently available within the Pressure Ulcers series. Pressure ulcer prevention: an evidence based analysis The cost-effectiveness of prevention strategies for pressure ulcers in long-term care homes in Ontario: projections of the Ontario Pressure Ulcer Model (field evaluation) Management of chronic pressure ulcers: an evidence-based analysis (anticipated pubicstion date - mid-2009) Purpose A pressure ulcer, also known as a pressure sore, decubitus ulcer, or bedsore, is defined as a localized injury to the skin/and or underlying tissue occurring most often over a bony prominence and caused by pressure, shear, or friction, alone or in combination. (1) Those at risk for developing pressure ulcers include the elderly and critically ill as well as persons with neurological impairments and those who suffer conditions associated with immobility. Pressure ulcers are graded or staged with a 4-point classification system denoting severity. Stage I represents the beginnings of a pressure ulcer and stage IV, the severest grade, consists of full thickness tissue loss with exposed bone, tendon, and or muscle. (1) In a 2004 survey of Canadian health care settings, Woodbury and Houghton (2) estimated that the prevalence of pressure ulcers at a stage 1 or greater in Ontario ranged between 13.1% and 53% with nonacute health care settings having the highest prevalence rate (Table 1). Executive Summary Table 1: Prevalence of Pressure Ulcers* Setting Canadian Prevalence,% (95% CI) Ontario Prevalence,Range % (n) Acute care 25 (23.8–26.3) 23.9–29.7 (3418) Nonacute care† 30 (29.3–31.4) 30.0–53.3 (1165) Community care 15 (13.4–16.8) 13.2 (91) Mixed health care‡ 22 (20.9

  8. Xylitol and caries prevention.

    Science.gov (United States)

    Duane, Brett

    2015-06-01

    Cochrane Oral Health Group Trials Register, the Cochrane Central Register of Controlled Trials (CENTRAL), Medline, Embase, CINAHL, Web of Science Conference Proceedings, Proquest Dissertations and Theses, US National Institutes of Health Trials Register (http://clinicaltrials.gov) and the WHO Clinical Trials Registry Platform for ongoing trials. No language or year restrictions were used. Randomised controlled trials assessing the effects of xylitol products on dental caries in children and adults. Two review authors independently screened the results of the electronic searches, extracted data and assessed the risk of bias of the included studies. Authors were contacted where possible for missing data or clarification where feasible. For continuous outcomes, means and standard deviations were used to obtain the mean difference and 95% confidence interval (CI). Continuous data was used to calculate prevented fractions (PF) and 95% CIs to summarise the percentage reduction in caries. For dichotomous outcomes, reported risk ratios (RR) and 95% CIs were used. As there were fewer than four studies included in the meta-analysis, a fixed effect model was used. Ten studies were included with a total of 5903 participants. One study was assessed as being at low risk of bias, two were assessed as unclear risk of bias with seven at high risk of bias. Over 2.5–3 years, low quality evidence demonstrated that with 4216 children analysed, a fluoride toothpaste with 10% xylitol (exact dosage unsure) reduced caries by 13% when compared to a fluoride only toothpaste. (PF −0.13, 95% CI −0.18 to −0.08. Remaining evidence of the use of xylitol in children has risk of bias and uncertainty of effect and was therefore insufficient to determine a benefit from xylitol. Four studies reported that there were no adverse effects from any of the interventions. Two studies reported similar rates of adverse effects between study arms. The remaining studies either mentioned adverse effects

  9. Primary Prevention With Statins

    DEFF Research Database (Denmark)

    Mortensen, Martin B; Afzal, Shoaib; Nordestgaard, Børge G

    2015-01-01

    BACKGROUND: Guidelines recommend initiating primary prevention for atherosclerotic cardiovascular disease (ASCVD) with statins based on absolute ASCVD risk assessment. Recently, alternative trial-based and hybrid approaches were suggested for statin treatment eligibility. OBJECTIVES: This study...... the population studied, 42% were eligible for statin therapy according to the 2013 American College of Cardiology/American Heart Association (ACC/AHA) risk assessment and cholesterol treatment guidelines approach, versus 56% with the trial-based approach and 21% with the hybrid approach. Among these statin......-eligible subjects, the ASCVD event rate per 1,000 person-years was 9.8, 6.8, and 11.2, respectively. The ACC/AHA-recommended absolute risk score was well calibrated around the 7.5% 10-year ASCVD risk treatment threshold and discriminated better than the trial-based or hybrid approaches. Compared with the ACC...

  10. Protective and preventative measures

    International Nuclear Information System (INIS)

    Freedman, P. N

    2002-01-01

    Health care workers who come in contact with blood and other body fluids in their working environment risk being exposed to blood borne diseases such as human immunodeficiency virus (HIV), hepatitis B and C. An anti-hepatitis B vaccine is available as well as hepatitis B immunoglobulin but no vaccine is available against hepatitis C and HIV. The best way to protect against exposure to blood and body fluids is to use 'Universal Precautions' which encourage safe working methods. If an exposure does take place it should be regarded as an urgent medical problem and every facility should have a management policy to deal with this problem. The source patient's rights must also be protected. The preventative and protective measures available to health care workers as well as practical suggestions to carry out in the event of an exposure are discussed (Au)

  11. Preventing Juvenile Delinquency

    Directory of Open Access Journals (Sweden)

    Carolina dos Reis

    2016-04-01

    Full Text Available This article aims to problematize discourses about protection and care that have surrounded compulsory hospitalization by evidencing its use as a control and punishment mechanism that increases the social vulnerability of young drug users. For such, we analyze lawsuits involving juveniles who were consigned to psychiatric institutions for drug addiction treatment as a protection measure in the state of Rio Grande do Sul, in Brazil. The analysis of the materials has evidenced discourses that have circumscribed young drug users and constructed this population as potentially dangerous subjects as well as a population category at risk. In this sense, we point out how compulsory hospitalization has emerged out of the lawsuits as a tool for prevention of juvenile delinquency.

  12. Prevention of pancreatic cancer

    Directory of Open Access Journals (Sweden)

    Stefan Kuroczycki-Saniutycz

    2017-02-01

    Full Text Available Pancreatic ductal adenocarcinoma (PDA accounts for 95% of all pancreatic cancers. About 230,000 PDA cases are diagnosed worldwide each year. PDA has the lowest five-year survival rate as compared to others cancers. PDA in Poland is the fifth leading cause of death after lung, stomach, colon and breast cancer. In our paper we have analysed the newest epidemiological research, some of it controversial, to establish the best practical solution for pancreatic cancer prevention in the healthy population as well as treatment for patients already diagnosed with pancreatic cancer. We found that PDA occurs quite frequently but is usually diagnosed too late, at its advanced stage. Screening for PDA is not very well defined except in subgroups of high-risk individuals with genetic disorders or with chronic pancreatitis. We present convincing, probable, and suggestive risk factors associated with pancreatic cancer, many of which are modifiable and should be introduced and implemented in our society.

  13. A preventive maintenance lubricant

    Energy Technology Data Exchange (ETDEWEB)

    Chapaykina, S A; Ol' kov, P L; Pertsev, A N; Rodzevillo, I T; Rogacheva, O I; Zinov' yev, A P

    1980-02-15

    A method is disclosed to lower the adherence of materials by reducing the viscosity of a preventive maintenance lubricant against adhesion of moist, freeflowing materials, containing extract of selective cleaning of oil fractions and asphalt. Gas oil of catalytic cracking is added having a boiling point of 190-300 degrees, with the following ratio of components (%): selective cleaning extract, 43-50; asphalt, 14-16; and gas oil of catalytic cracking, the remainder, Treating a surface with the proposed lubricant lowers the specific resistance to shift of rock compared with the prototype (g/cm/sup 2/): sand (moisture content, 18%) from 3.82 to 1.55; and clay (moisture content 16%), from 5.41 to 3.51.

  14. Preventing Informal Urban Development

    DEFF Research Database (Denmark)

    Enemark, Stig; McLaren, Robin

    2008-01-01

    . This is directly linked to citizen participation in the process of land use control. Decentralisation should aim to combine responsibility for decision making with accountability for financial, social, and environmental consequences. Decentralisation requires access to appropriate quality of land information......, addresses the main issue of how to prevent informal urban development, especially through the use of adequate and sustainable means of land use control and good governance. Three key means are addressed: Decentralisation: There is a need to separate central policy/regulation making and local decision making...... in the decision making process? Legislation in itself is not enough. A cultural change within society may need to be encouraged. Again, access to participation requires access to land information. Comprehensive planning at local level supported by citizen participation should also enable establishment proper...

  15. The structure of metallo-DNA with consecutive thymine-Hg-II-thymine base pairs explains positive entropy for the metallo base pair formation

    Czech Academy of Sciences Publication Activity Database

    Yamaguchi, H.; Šebera, Jakub; Kondo, J.; Oda, S.; Komuro, T.; Kawamura, T.; Dairaku, T.; Kondo, Y.; Okamoto, I.; Ono, A.; Burda, J. V.; Kojima, C.; Sychrovský, Vladimír; Tanaka, Y.

    2014-01-01

    Roč. 42, č. 6 (2014), s. 4094-4099 ISSN 0305-1048 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : NMR structures * mercury * metalation * metal- DNA binding * DFT Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/6/4094.full

  16. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    Czech Academy of Sciences Publication Activity Database

    Lavery, R.; Zakrzewska, K.; Beveridge, D.; Bishop, T. C.; Case, D. A.; Cheatham III, T. E.; Dixit, S.; Jayaram, B.; Lankaš, Filip; Laughton, Ch.; Maddocks, J. H.; Michon, A.; Osman, R.; Orozco, M.; Pérez, A.; Singh, T.; Špačková, Naďa; Šponer, Jiří

    Roč. 38, č. 1 ( 2010 ), s. 299-313 ISSN 0305-1048 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA ČR GA203/09/1476; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : B-DNA * molecular dynamics * sequence dependet structure and dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 7.836, year: 2010

  17. Politics of prevention: The emergence of prevention science.

    Science.gov (United States)

    Roumeliotis, Filip

    2015-08-01

    This article critically examines the political dimension of prevention science by asking how it constructs the problems for which prevention is seen as the solution and how it enables the monitoring and control of these problems. It also seeks to examine how prevention science has established a sphere for legitimate political deliberation and which kinds of statements are accepted as legitimate within this sphere. The material consists of 14 publications describing and discussing the goals, concepts, promises and problems of prevention science. The analysis covers the period from 1993 to 2012. The analysis shows that prevention science has established a narrow definition of "prevention", including only interventions aimed at the reduction of risks for clinical disorders. In publications from the U.S. National Institute of Drug Abuse, the principles of prevention science have enabled a commitment to a zero-tolerance policy on drugs. The drug using subject has been constructed as a rational choice actor lacking in skills in exerting self-control in regard to drug use. Prevention science has also enabled the monitoring and control of expertise, risk groups and individuals through specific forms of data gathering. Through the juxtaposition of the concepts of "objectivity" and "morality", prevention science has constituted a principle of delineation, disqualifying statements not adhering to the principles of prevention science from the political field, rendering ethical and conflictual dimensions of problem representations invisible. The valorisation of scientific accounts of drugs has acted to naturalise specific political ideals. It simultaneously marginalises the public from the public policy process, giving precedence to experts who are able to provide information that policy-makers are demanding. Alternative accounts, such as those based on marginalisation, poverty or discrimination are silenced within prevention science. Copyright © 2015 Elsevier B.V. All rights

  18. Optimizing preventive maintenance

    International Nuclear Information System (INIS)

    DiCola, F.E.

    1988-01-01

    The traditional approach to preventive maintenance (PM) is based on adherence to manufacturers's requirements and recommended frequencies. When equipment fails, either new procedures are established or the frequency is increased. This leads to an increase in the number of PM activities, overloading not only maintenance resources, but support as well. There is no correlation between more PM and an increase in equipment reliability. More PM may actually induce failures. Reliability-centered maintenance, a new concept in utility maintenance, is based on identifying system/subsystem functions, failures, and dominant failure modes to develop or revise PM tasks. The activities described in this paper are based on actual implementation of this concept on an ongoing project to upgrade the PM program at one of the largest electric utilities in the country. Optimum PM activities are those that, when implemented, will minimize factors that c cause equipment to fail. One technique described illustrates how equipment performance, failure modes, and causes can be related to minimize the occurrence of failures. Operating history and service life of a component are key factors in determining the most effective PM activities, provided that the factors are related to failure modes and causes

  19. PREVENTION OF OCCUPATIONAL ACCIDENTS

    Directory of Open Access Journals (Sweden)

    Jovica Jovanovic

    2004-01-01

    Full Text Available Medical services, physicians and nurses play an essential role in the plant safety program through primary treatment of injured workers and by helping to identify workplace hazards. The physician and nurse should participate in the worksite investigations to identify specific hazard or stresses potentially causing the occupational accidents and injuries and in planning the subsequent hazard control program. Physicians and nurses must work closely and cooperatively with supervisors to ensure the prompt reporting and treatment of all work related health and safety problems. Occupational accidents, work related injuries and fatalities result from multiple causes, affect different segments of the working population, and occur in a myriad of occupations and industrial settings. Multiple factors and risks contribute to traumatic injuries, such as hazardous exposures, workplace and process design, work organization and environment, economics, and other social factors. With such a diversity of theories, it will not be difficult to understand that there does not exist one single theory that is considered right or correct and is universally accepted. These theories are nonetheless necessary, but not sufficient, for developing a frame of reference for understanding accident occurrences. Prevention strategies are also varied, and multiple strategies may be applicable to many settings, including engineering controls, protective equipment and technologies, management commitment to and investment in safety, regulatory controls, and education and training. Research needs are thus broad, and the development and application of interventions involve many disciplines and organizations.

  20. Selenium for preventing cancer

    Science.gov (United States)

    Vinceti, Marco; Dennert, Gabriele; Crespi, Catherine M; Zwahlen, Marcel; Brinkman, Maree; Zeegers, Maurice PA; Horneber, Markus; D'Amico, Roberto; Del Giovane, Cinzia

    2015-01-01

    Background This review is an update of the first Cochrane publication on selenium for preventing cancer (Dennert 2011). Selenium is a metalloid with both nutritional and toxicological properties. Higher selenium exposure and selenium supplements have been suggested to protect against several types of cancers. Objectives Two research questions were addressed in this review: What is the evidence for: an aetiological relation between selenium exposure and cancer risk in humans? andthe efficacy of selenium supplementation for cancer prevention in humans? Search methods We conducted electronic searches of the Cochrane Central Register of Controlled Trials (CENTRAL, 2013, Issue 1), MEDLINE (Ovid, 1966 to February 2013 week 1), EMBASE (1980 to 2013 week 6), CancerLit (February 2004) and CCMed (February 2011). As MEDLINE now includes the journals indexed in CancerLit, no further searches were conducted in this database after 2004. Selection criteria We included prospective observational studies (cohort studies including sub-cohort controlled studies and nested case-control studies) and randomised controlled trials (RCTs) with healthy adult participants (18 years of age and older). Data collection and analysis For observational studies, we conducted random effects meta-analyses when five or more studies were retrieved for a specific outcome. For RCTs, we performed random effects meta-analyses when two or more studies were available. The risk of bias in observational studies was assessed using forms adapted from the Newcastle-Ottawa Quality Assessment Scale for cohort and case-control studies; the criteria specified in the Cochrane Handbook for Systematic Reviews of Interventions were used to evaluate the risk of bias in RCTs. Main results We included 55 prospective observational studies (including more than 1,100,000 participants) and eight RCTs (with a total of 44,743 participants). For the observational studies, we found lower cancer incidence (summary odds ratio (OR) 0

  1. 14. Breast cancer prevention.

    Science.gov (United States)

    Salih, A K; Fentiman, I S

    2002-05-01

    Increased risk of breast cancer may result from potentially modifiable causes such as endogenous hormone levels, obesity, HRT, and non-lactation, or non-modifiable factors including genetic susceptibility and increasing age. The Gail model, based on known factors, may be useful for estimating lifetime risk in some individuals, but those risk factors that are easier to modify may have a limited impact on the totality of breast cancer. Tamoxifen prevention still remains contentious, with a significant reduction in risk of breast cancer in women given tamoxifen in the NSABP P1 study but no effect in the Italian and Royal Marsden trials. Raloxifene, tested in the MORE trial, reduced the incidence of breast cancer by 65% but this was restricted to oestrogen receptor positive tumours. Lifestyle factors such as diet, obesity, exercise and age at first full term pregnancy and number of pregnancies have a mild to moderate impact on risk, so may have little effect on the incidence of breast cancer. Reduction of alcohol intake could lead to a modest reduction in the risk of breast cancer but possibly adversely affect other diseases. Fat reduction and GnRH analogue reduce mammographic density but have not yet been shown to affect risk. For women with BRCA1/2 mutation, options include unproven surveillance and prophylactic mastectomy with an unquantified risk reduction. Interesting new candidates for chemoprevention include aromatase inhibitors, new generation SERMs, demethylating agents, non-selective COX inhibitors, tyrosine kinase inhibitors and polyamine synthetic inhibitors.

  2. Prevention of breast cancer.

    Science.gov (United States)

    Olver, Ian N

    2016-11-21

    Modifiable lifestyle factors may reduce the risk of developing breast cancer. Obesity is associated particularly with post-menopausal breast cancer. Diet is important, and exercise equivalent to running for up to 8 hours each week reduces the risk of breast cancer, both in its own right and through reducing obesity. Alcohol consumption may be responsible for 5.8% of breast cancers in Australia and it is recommended to reduce this to two standard drinks per day. Drinking alcohol and smoking increases the risk for breast cancer and, therefore, it is important to quit tobacco smoking. Prolonged use of combined oestrogen and progesterone hormone replacement therapy and oral contraceptives may increase breast cancer risk and this must be factored into individual decisions about their use. Ionising radiation, either from diagnostic or therapeutic radiation or through occupational exposure, is associated with a high incidence of breast cancer and exposure may be reduced in some cases. Tamoxifen chemoprevention may reduce the incidence of oestrogen receptor positive cancer in 51% of women with high risk of breast cancer. Uncommon but serious side effects include thromboembolism and uterine cancer. Raloxifene, which can also reduce osteoporosis, can be used in post-menopausal women and is not associated with the development of uterine cancer. Surgical prophylaxis with bilateral mastectomy and salpingo-oophorectomy can reduce the risk of breast cancer in patients carrying BRCA1 or BRCA2 mutations. For preventive treatments, mammographic screening can identify other women at high risk.

  3. Prevention of nuclear war

    Energy Technology Data Exchange (ETDEWEB)

    Lifton, R.J.

    1980-10-01

    Physicians are exercising their responsibility as healers in their efforts to prevent nuclear war. Death for Hiroshima survivors was experienced in four stages: the immediate impact of destruction, the acute impact of radiation, delayed radiation effects, and later identification as an atomic bomb survivor. Each phase had its physical and psychological impacts and negates Hiroshima as a model for rational behavior despite those who claim survival is possible for those who are prepared. The psychic effects of modern nuclear, chemical, and germ warfare need to be challenged with a symbolization of life and immortality. Studies of psychological reactions to the terror children felt during practice air-raid drills indicate that the fears can be surpressed and re-emerge in adult life as a linking of death with collective annihilation. Other themes which emerge are feelings of impermanence, craziness, identification with the bomb, and a double existence. Psychic numbing and the religion of nuclearism cause dangerous conflicts with the anxieties caused by increasing awareness of death. (DCK)

  4. Prevention of nuclear war

    International Nuclear Information System (INIS)

    Lifton, R.J.

    1980-01-01

    Physicians are exercising their responsibility as healers in their efforts to prevent nuclear war. Death for Hiroshima survivors was experienced in four stages: the immediate impact of destruction, the acute impact of radiation, delayed radiation effects, and later identification as an atomic bomb survivor. Each phase had its physical and psychological impacts and negates Hiroshima as a model for rational behavior despite those who claim survival is possible for those who are prepared. The psychic effects of modern nuclear, chemical, and germ warfare need to be challenged with a symbolization of life and immortality. Studies of psychological reactions to the terror children felt during practice air-raid drills indicate that the fears can be surpressed and re-emerge in adult life as a linking of death with collective annihilation. Other themes which emerge are feelings of impermanence, craziness, identification with the bomb, and a double existence. Psychic numbing and the religion of nuclearism cause dangerous conflicts with the anxieties caused by increasing awareness of death

  5. Trying to prevent abortion.

    Science.gov (United States)

    Bromham, D R; Oloto, E J

    1997-06-01

    It is known that, since antiquity, women confronted with an unwanted pregnancy have used abortion as a means of resolving their dilemma. Although undoubtedly widely used in all historical ages, abortion has come to be regarded as an event preferably avoided because of the impact on the women concerned as well as considerations for fetal life. Policies to reduce numbers and rates of abortion must acknowledge certain observations. Criminalization does not prevent abortion but increases maternal risks. A society's 'openness' in discussing sexual matters inversely correlates with abortion rates. Correlation between contraceptive use and abortion is also inverse but relates most closely to the efficacy of contraceptive methods used. 'Revolution' in the range of contraceptive methods used will have an equivalent impact on abortion rates. Secondary or emergency contraceptive methods have a considerable role to play in the reduction of abortion numbers. Good sex (and 'relationships') education programs may delay sexual debut, increase contraceptive usage and be associated with reduced abortion. Finally, interaction between socioeconomic factors and the choice between abortion and ongoing pregnancy are complex. Abortion is not necessarily chosen by those least able to support a child financially.

  6. Municipal water pollution prevention program

    International Nuclear Information System (INIS)

    1991-03-01

    EPA believes that the most effective and equitable means of assuring viability of this infrastructure is through environmentally preferred pollution prevention approaches especially through application of Municipal Water Pollution Prevention (MWPP). These approaches may enhance worker safety, improve the usability of sludge, increase the ability for local community expansion, and reduce operation and compliance costs. State-based municipal pollution prevention programs focus attention on a series of actions to prevent pollution in advance rather than taking more expensive corrective actions. MWPP encourages resource conservation to reduce water and energy use, appropriate pricing, toxicity reductions at the source, BOD reductions, recycling, proper treatment of wastes, and beneficial uses of sludge

  7. Pollution prevention: A regulatory update

    International Nuclear Information System (INIS)

    Walzer, A.E.; Maynard, J.W.

    1993-01-01

    Pollution prevention is the emphasis of the 1990s environmental philosophy. This new environmental era was ushered in when President Bush signed the Pollution Prevention Act in October 1990. This law, with its accompanying philosophy, was in response to the realization that end-of-the-pipe treatment, which frequently changed the media in which a pollutant or waste was discharged, was inadequate to protect the environment and human health. Pollution prevention advocates source reduction, where material substitutions and engineering solutions are sought to reduce the volume and toxicity of waste and pollutants. This proactive approach reduces environmental impacts such as those of former waste sites which have produced environmental legacies that will cost billions of dollars and take decades to remediate. This paper describes pollution prevention philosophy and summarizes regulatory pollution prevention requirements. It describes current regulatory trends in the area of pollution prevention, including voluntary programs and enforcement actions. The Pollution Prevention Act of 1990 is described, and pollution prevention initiatives embodied in other laws, including the Clean Air Act, the Clean Water Act, the Emergency Planning and Community Right-To-Know Act, the Resource Conservation and Recovery Act, and the Toxic Substances Control Act, are discussed. A historical overview of waste minimization initiatives within the Department of Energy is given, and other pollution prevention initiatives that affect federal facilities, such as Executive Order 12780, which mandates recycling and the procurement of recycled materials, are also outlined

  8. Fungal Diseases: Ringworm Risk & Prevention

    Science.gov (United States)

    ... Testing Treatment & Outcomes Health Professionals Statistics More Resources Candidiasis Candida infections of the mouth, throat, and esophagus Vaginal candidiasis Invasive candidiasis Definition Symptoms Risk & Prevention Sources Diagnosis ...

  9. Nutrition and Cancer Prevention Research Practicum | Division of Cancer Prevention

    Science.gov (United States)

    The Nutritional Science Research Group in the Division of Cancer Prevention at the National Cancer Institute, National Institutes of Health and the Department of Nutrition at the Clinical Center, National Institutes of Health are offering a one week educational opportunity in "Nutrition and Cancer Prevention Research" for individuals with a sustained commitment to nutrition

  10. Postpartum haemorrhage: prevention.

    Science.gov (United States)

    Chelmow, David

    2011-04-04

    Loss of more than 500 mL of blood following childbirth is usually caused by failure of the uterus to contract fully after delivery of the placenta, and occurs in over 10% of deliveries, with a 1% mortality rate worldwide. Other causes of postpartum haemorrhage include retained placental tissue, lacerations to the genital tract, and coagulation disorders. Uterine atony is more likely in women who have had a general anaesthetic or oxytocin, an over-distended uterus, a prolonged or precipitous labour, or who are of high parity. We conducted a systematic review and aimed to answer the following clinical questions: What are the effects of non-drug interventions and of drug interventions to prevent primary postpartum haemorrhage? We searched: Medline, Embase, The Cochrane Library, and other important databases up to March 2010 (Clinical Evidence reviews are updated periodically; please check our website for the most up-to-date version of this review). We included harms alerts from relevant organisations such as the US Food and Drug Administration (FDA) and the UK Medicines and Healthcare products Regulatory Agency (MHRA). We found 40 systematic reviews, RCTs, or observational studies that met our inclusion criteria. We performed a GRADE evaluation of the quality of evidence for interventions. In this systematic review we present information relating to the effectiveness and safety of the following interventions: active management of the third stage of labour, carboprost injection, controlled cord traction, ergot compounds (ergometrine/methylergotamine), immediate breastfeeding, misoprostol (oral, rectal, sublingual, or vaginal), oxytocin, oxytocin plus ergometrine combinations, prostaglandin E2 compounds, and uterine massage.

  11. Selenium for preventing cancer.

    Science.gov (United States)

    Vinceti, Marco; Filippini, Tommaso; Del Giovane, Cinzia; Dennert, Gabriele; Zwahlen, Marcel; Brinkman, Maree; Zeegers, Maurice Pa; Horneber, Markus; D'Amico, Roberto; Crespi, Catherine M

    2018-01-29

    This review is the third update of the Cochrane review "Selenium for preventing cancer". Selenium is a naturally occurring element with both nutritional and toxicological properties. Higher selenium exposure and selenium supplements have been suggested to protect against several types of cancer. To gather and present evidence needed to address two research questions:1. What is the aetiological relationship between selenium exposure and cancer risk in humans?2. Describe the efficacy of selenium supplementation for cancer prevention in humans. We updated electronic searches of the Cochrane Central Register of Controlled Trials (CENTRAL; 2017, Issue 2), MEDLINE (Ovid, 2013 to January 2017, week 4), and Embase (2013 to 2017, week 6), as well as searches of clinical trial registries. We included randomised controlled trials (RCTs) and longitudinal observational studies that enrolled adult participants. We performed random-effects (RE) meta-analyses when two or more RCTs were available for a specific outcome. We conducted RE meta-analyses when five or more observational studies were available for a specific outcome. We assessed risk of bias in RCTs and in observational studies using Cochrane's risk assessment tool and the Newcastle-Ottawa Scale, respectively. We considered in the primary analysis data pooled from RCTs with low risk of bias. We assessed the certainty of evidence by using the GRADE approach. We included 83 studies in this updated review: two additional RCTs (10 in total) and a few additional trial reports for previously included studies. RCTs involved 27,232 participants allocated to either selenium supplements or placebo. For analyses of RCTs with low risk of bias, the summary risk ratio (RR) for any cancer incidence was 1.01 (95% confidence interval (CI) 0.93 to 1.10; 3 studies, 19,475 participants; high-certainty evidence). The RR for estimated cancer mortality was 1.02 (95% CI 0.80 to 1.30; 1 study, 17,444 participants). For the most frequently

  12. [Psychotic parricide. Prevention].

    Science.gov (United States)

    Cornic, F; Olié, J-P

    2006-01-01

    Parricide is a rare event. In France, statistics indicate that it accounts for 2 to 3% of all homicides. It also represents an appreciable part (up to 30%) of homicides committed by psychotic subjects. Many studies suggest a strong positive correlation between criminality and characterized mental illness. The correlation is better when there is a diagnosis of schizophrenia, an alcohol or drugs consumption and a past personal history of violence. Parricide is a crime mainly committed by males. The most frequent form of parricide is patricide committed by sons. However, considering only psychotic parricides, the number of mothers killed seems is equal or higher to the number of fathers killed. The typical profile of an adult committing parricide could be described as follows: a young single unemployed male, living with his victim, suffering from schizophrenia with comorbidity of alcohol or drug abuse and consumption, who stops his medication, and having a past history of medicolegal behaviours. The parricide act can be divided into three stages; first, the contention of the emergence of parricide ideas; second, the violence and brutality of the act; third, following a transient appeasement suicidal thoughts or attempts are frequently observed. Preventing parricides and homicides committed by psychotic subjects is a great challenge. Only a few studies aim to a better understanding of the underlying motivations of such criminals. According to theses studies, we can point out several warning signals. Psychiatrist should particularly increase their vigilance to persecutive delusions, history of a long lasting illness with history of violence during acute stages, threats against family or friends, suicidal thoughts, failures of help requests and attempt to escape.

  13. Malaria: prevention in travellers.

    Science.gov (United States)

    Croft, Ashley M

    2010-07-12

    Malaria transmission occurs most frequently in environments with humidity greater than 60% and ambient temperature of 25 °C to 30 °C. Risks increase with longer visits and depend on activity. Infection can follow a single mosquito bite. Incubation is usually 10 to 14 days but can be up to 18 months depending on the strain of parasite. We conducted a systematic review and aimed to answer the following clinical questions: What are the effects of non-drug preventive interventions in non-pregnant adult travellers? What are the effects of drug prophylaxis in non-pregnant adult travellers? What are the effects of antimalaria vaccines in adult and child travellers? What are the effects of antimalaria interventions in child travellers, pregnant travellers, and in airline pilots? We searched: Medline, Embase, The Cochrane Library, and other important databases up to November 2009 (Clinical Evidence reviews are updated periodically, please check our website for the most up-to-date version of this review). We included harms alerts from relevant organisations such as the US Food and Drug Administration (FDA) and the UK Medicines and Healthcare products Regulatory Agency (MHRA). We found 79 systematic reviews, RCTs, or observational studies that met our inclusion criteria. We performed a GRADE evaluation of the quality of evidence for interventions. In this systematic review we present information relating to the effectiveness and safety of the following interventions: aerosol insecticides, amodiaquine, air conditioning and electric fans, atovaquone-proguanil, biological control measures, chloroquine (alone or with proguanil), diethyltoluamide (DEET), dietary supplementation, doxycycline, electronic mosquito repellents, full-length and light-coloured clothing, insecticide-treated clothing/nets, mefloquine, mosquito coils and vapourising mats, primaquine, pyrimethamine-dapsone, pyrimethamine-sulfadoxine, smoke, topical (skin-applied) insect repellents, and vaccines.

  14. [Boxing: traumatology and prevention].

    Science.gov (United States)

    Cabanis, Emmanuel-Alain; Iba-Zizen, Marie-Thérèse; Perez, Georges; Senegas, Xavier; Furgoni, Julien; Pineau, Jean-Claude; Louquet, Jean-Louis; Henrion, Roger

    2010-10-01

    In 1986, a surgeon who, as an amateur boxer himself was concerned with boxers' health, approached a pioneering Parisian neuroimaging unit. Thus began a study in close cooperation with the French Boxing Federation, spanning 25 years. In a first series of 52 volunteer boxers (13 amateurs and 39 professionals), during which MRI gradually replaced computed tomography, ten risk factors were identified, which notably included boxing style: only one of 40 "stylists" with a good boxing technique had cortical atrophy (4.5 %), compared to 15 % of "sloggers". Changes to the French Boxing Federation rules placed the accent on medical prevention. The second series, of 247 boxers (81 amateurs and 266 professionals), showed a clear improvement, as lesions were suspected in 14 individuals, of which only 4 (1.35 %) were probably due to boxing. The third and fourth series were part of a protocol called "Brain-Boxing-Ageing", which included 76 boxers (11 having suffered KOs) and 120 MRI scans, with reproducible CT and MRI acquisitions (9 sequences with 1.5 T then 3 T, and CT). MRI anomalies secondary to boxing were found in 11 % of amateurs and 38 % of professionals (atrophy, high vascular T2 signal areas, 2 cases of post-KO subdural bleeding). CT revealed sinus damage in 13 % of the amateurs and 19 % of the professionals. The risk of acute and chronic facial and brain damage was underline, along with detailed precautionary measures (organization of bouts, role of the referee and ringside doctor, and application of French Boxing Federation rules).

  15. PREVENTIVE MAINTENANCE. HONEYWELL PLANNING GUIDE.

    Science.gov (United States)

    Honeywell, Inc., Minneapolis, Minn.

    THIS HONEYWELL PAMPHLET DISCUSSES SOME ASPECTS OF PREVENTIVE MAINTENANCE OF AUTOMATIC CONTROLS, HEATING, VENTILATING, AND AIR CONDITIONING, AND COMPARES IN-PLANT WITH CONTRACT SERVICE, CONCLUDING THAT CONTRACT SERVICE IS PREFERABLE AND DESCRIBING A NUMBER OF MAINTENANCE PLANS WHICH THEY FURNISH. PREVENTIVE MAINTENANCE PROVIDES--(1) MORE EFFICIENT…

  16. Pollution Prevention/Waste Minimization

    International Nuclear Information System (INIS)

    Fowler, Kimberly M.; Hyman, Marvin H.

    2002-01-01

    This chapter offers pollution prevention techniques for design, industrial process, maintenance, and environmental remediation activities. It provides examples of waste reduction, tools for identifying pollution prevention opportunities, and ways of calculating the payback or return on investment associated with the opportunities

  17. Primary Prevention of Eating Disorders.

    Science.gov (United States)

    Shisslak, Catherine M.; And Others

    1987-01-01

    Summarizes current understanding of anorexia nervosa and bulimia (clinical symptoms and outcome, prevalence and risk factors), offering suggestions for the primary prevention of these disorders at the individual, family, and community levels, and emphasizing prevention in the schools. (Author/KS)

  18. Educating Students in Preventive Counseling.

    Science.gov (United States)

    Conyne, Robert K.

    1997-01-01

    Provides a comprehensive set of competencies for counselors doing primary prevention. Describes 10 expanded clusters of skills (primary prevention perspective, personal attributes and behaviors, ethics, marketing, multiculturalism, group facilitation, organization and setting dynamics, trends and political dynamics, and research and evaluation)…

  19. Fall Prevention Hits Stumbling Blocks.

    Science.gov (United States)

    Huff, Charlotte

    2018-03-01

    Implementation of efforts to screen older people for fall risk-and to intervene before falls occur-have been scattershot at best. Ongoing studies of fall prevention called STRIDE (Strategies to Reduce Injuries and Develop Confidence in Elders) might change that. The studies look at whether clinicians can implement a fall-prevention program across rural, urban, and suburban treatment settings.

  20. Expert incentives: cure versus prevention

    NARCIS (Netherlands)

    de Jaegher, K.

    This paper distinguishes between two scenarios for the expert-client encounter. In the cure scenario, the client does not know whether a loss can be recovered. In the prevention scenario, the client faces a threat but does not know whether this threat is real enough to justify preventive action. The

  1. Major Depression Can Be Prevented

    Science.gov (United States)

    Munoz, Ricardo F.; Beardslee, William R.; Leykin, Yan

    2012-01-01

    The 2009 Institute of Medicine report on prevention of mental, emotional, and behavioral disorders (National Research Council & Institute of Medicine, 2009b) presented evidence that major depression can be prevented. In this article, we highlight the implications of the report for public policy and research. Randomized controlled trials have shown…

  2. Get Real about Diabetes Prevention

    Centers for Disease Control (CDC) Podcasts

    2007-11-01

    This podcast delivers a diabetes prevention message promoting small steps that can lead to big rewards.  Created: 11/1/2007 by National Diabetes Education Program (NDEP), a joint program of the Centers for Disease Control and Prevention and the National Institutes of Health.   Date Released: 11/15/2007.

  3. Disaster: Prevention, Preparedness and Action.

    Science.gov (United States)

    Buchanan, Sally

    1981-01-01

    Discission of threat of disaster to library archival materials focuses on prevention (building maintenance, materials storage, fire prevention), preparedness (preplanning, procedures for handling emergencies, finances of recovery operation), and action (instructions for handling damaged materials). Current library activities in disaster planning…

  4. Family Wellness, Not HIV Prevention

    Science.gov (United States)

    Swendeman, Dallas; Flannery, Diane

    2010-01-01

    HIV exceptionalism (and disease-specific programs generally) garner both unbalanced funding and the most talented personnel, distorting local health priorities. In support of HIV exceptionalism, the successful mobilization of significant global health sector resources was not possible prior to HIV. Both sides of the debate have merits; rather than perpetuating polarization, we suggest that sustained improvements in global health require creating a prevention infrastructure to meet multiple health challenges experienced by local communities. We propose four fundamental shifts in HIV and disease prevention: (1) horizontally integrating prevention at one site locally, with priorities tailored to local health challenges and managed by local community leaders; (2) using a family wellness metaphor for services, not disease prevention; (3) implementing evidence-based prevention programs (EBPP) based on common principles, factors, and processes, rather than replication of specific programs; and (4) utilizing the expertise of private enterprise to re-design EBPP into highly attractive, engaging, and accessible experiences. PMID:19148744

  5. Can atopic dermatitis be prevented?

    Science.gov (United States)

    Gómez-de la Fuente, E

    2015-05-01

    Atopic dermatitis has become a health problem in our setting due to its rising prevalence, impact on quality of life, associated costs, and role in the progression to other atopic diseases. Furthermore, atopic dermatitis has no definitive cure and therefore preventive measures are important. In this article, we review the latest advances in both primary prevention (reduction of the incidence of atopic dermatitis) and secondary prevention (reduction of associated morbidity and reduction of the atopic march). We analyze the different preventive strategies available, including modification of the immune system through microbial exposure, induction of immune tolerance through antigen exposure, and restoration of skin barrier function to halt the atopic march. Dermatologists need to be familiar with these strategies in order to apply them where necessary and to accurately inform patients and their relatives to prevent misguided or inappropriate actions. Copyright © 2014 Elsevier España, S.L.U. and AEDV. All rights reserved.

  6. Allergy and asthma prevention 2014

    DEFF Research Database (Denmark)

    Nieto, Antonio; Wahn, Ulrich; Bufe, Albrecht

    2014-01-01

    Asthma and allergic diseases have become one of the epidemics of the 21st century in developed countries. Much of the success of other areas of medicine, such as infectious diseases, lies on preventive measures. Thus, much effort is also being placed lately in the prevention of asthma and allergy....... This manuscript reviews the current evidence, divided into four areas of activity. Interventions modifying environmental exposure to allergens have provided inconsistent results, with multifaceted interventions being more effective in the prevention of asthma. Regarding nutrition, the use of hydrolyzed formulas...... that antiviral vaccines could be useful in the future. Allergen-specific immunotherapy is effective for the treatment of allergic patients with symptoms; the study of its value for primary and secondary prevention of asthma and allergy is in its very preliminary phases. The lack of success in the prevention...

  7. Preventive psychiatry in clinical practice

    Directory of Open Access Journals (Sweden)

    Mamta Sood

    2017-01-01

    Full Text Available In the last two and a half decades, there have been series of global burden of disease studies which have highlighted significant disability attributable to mental and behavioral disorders with a huge treatment gap. Integration of the preventive strategies in the clinical practice has the potential to reduce the disability due to mental illnesses. The patients come to the clinic with an intention to get treated and investigated for the symptoms they have. At this point, they may also be amenable to the advice related to prevention. Therefore, the clinical encounter can be seen as an opportunity to implement preventive strategies. Preventive efforts in clinical practice must be guided by knowledge about the epidemiological data related to specific mental illnesses and about the evidence-based preventive strategies available for specific mental illnesses. These should be directed toward all those persons (patients, caregivers accompanying and at home, teachers, employers, etc. who are present and also toward those who are not present during the clinical encounter and must be age, gender, and culture sensitive. Sociodemographic characteristics of a person seeking relief from a problem in the clinical encounter help in directing the preventive efforts. The preventive efforts are also driven by the fact that the patient has the first episode or established or treatment refractory mental illness and the short or long duration of illness. For prevention-minded clinical practice, it helps to have a template so that the assessments and interventions relevant for prevention can be carried out as per that scheme; it also helps in orienting the practicing mental health professionals. While making various assessments, making a list of the likely issues to be addressed by preventive efforts during clinical encounter ( first and subsequent is also helpful.

  8. CONTEMPORARY PRINCIPLES OF SUICIDE PREVENTION.

    Science.gov (United States)

    Ljusic, Dragana; Ravanic, Dragan; Filipovic Danic, Snezana; Soldatovic, Ivan; Cvetkovic, Jovana; Stojanovic Tasic, Mirjana

    2016-11-01

    Suicide remains a significant public health problem worldwide. This study is aimed at analyzing and presenting contemporary methods in suicide prevention in the world as well as at identifying specific risk groups and risk factors in order to explain their importance. in suicide prevention. The literature search covered electronic databases PubMed, Web of Science and Scopus. In order to select the relevant articles, the authors searched for the combination of key-words which included the following medical subject heading terms (suicide or suicide ideation or attempted) and (prevention or risk factors) and (man or elders or mental disorders). Data analysis covered meta-analyses, systematic reviews and original scientific papers with different characteristics of suicide preventions, risk factors and risk groups. Worldwide evidence-based interventions for suicide prevention are divided in universal, selective and indicated interventions. Restricted approach to various methods of committing suicide as well as pharmacotherapy contributes to a lower suicide rate. Suicide risk factors can be categorized as proximal and distal. The following groups are at highest risk of committing suicide: males. older persons and persons with registered psychiatric disorders. There is a lot of evidence that suicide is preventable. It is known that only 28 coun tries in the world have national suicide prevention strategies and Serbia is not one of them.

  9. New horizons in fall prevention.

    Science.gov (United States)

    Lord, Stephen R; Close, Jacqueline C T

    2018-04-25

    Falls pose a major threat to the well-being and quality of life of older people. Falls can result in fractures and other injuries, disability and fear and can trigger a decline in physical function and loss of autonomy. This article synthesises recent published findings on fall risk and mobility assessments and fall prevention interventions and considers how this field of research may evolve in the future. Fall risk topics include the utility of remote monitoring using wearable sensors and recent work investigating brain activation and gait adaptability. New approaches for exercise for fall prevention including dual-task training, cognitive-motor training with exergames and reactive step training are discussed. Additional fall prevention strategies considered include the prevention of falls in older people with dementia and Parkinson's disease, drugs for fall prevention and safe flooring for preventing fall-related injuries. The review discusses how these new initiatives and technologies have potential for effective fall prevention and improved quality of life. It concludes by emphasising the need for a continued focus on translation of evidence into practice including robust effectiveness evaluations of so that resources can be appropriately targeted into the future.

  10. Injury Prevention in Youth Sports.

    Science.gov (United States)

    Stracciolini, Andrea; Sugimoto, Dai; Howell, David R

    2017-03-01

    Children and adolescents are now participating in competitive sports at younger ages and with increasing intensity. As a result, increasing numbers of young athletes are presenting to pediatricians for care of sports-related injuries and advice about prevention. Understanding and identifying modifiable risk factors for injury in the young athletic population is a critical first step in injury prevention. Risk factors vary by sport, age, and sex. This article reviews the most common risk factors for injury and the evidence to support proposed strategies for prevention. [Pediatr Ann. 2017;46(3):e99-e105.]. Copyright 2017, SLACK Incorporated.

  11. [Strategies for cardiovascular disease prevention].

    Science.gov (United States)

    Gabus, Vincent; Wuerzner, Grégoire; Saubade, Mathieu; Favre, Lucie; Jacot Sadowski, Isabelle; Nanchen, David

    2018-02-28

    Atherosclerosis is a disease which develops very gradually over decades. Under the influence of modifiable cardiovascular risk factors, such as blood pressure, LDL-cholesterol level, smoking or lifestyle, clinical symptoms of atherosclerosis manifest more or less early in life. When cardiovascular risk factors accumulate, the risk of having a cardiovascular event increases and the benefits of prevention measures are greater. This article summarizes existing strategies for controlling modifiable cardiovascular risk factors in primary prevention. The physician can rely on an interprofessional network of cardiovascular prevention. Managing risk factors while respecting the autonomy and priorities of the patient will bring the greatest benefit.

  12. Pollution prevention and air quality

    International Nuclear Information System (INIS)

    Fuentes Hector; Tsihrintzis Vassilios

    1997-01-01

    Pollution prevention (P2) results from the combined effect of the public opinion, a new environmental value system, government regulation, but above all, the search for an economic development within the context of environmental protection. The reasons for prevention are fundamental: profit from a new economic frontier; reduced potential for civil and criminal liability; and the effective and economic protection of the environment. This paper addresses, among other relevant issues, the following topics: justification and objective of pollution prevention; strategy and methodology for its implementation; examples of successes and tools; benefits and barriers and some recommendation

  13. Noise and Hearing Loss Prevention

    Science.gov (United States)

    ... message, please visit this page: About CDC.gov . NOISE AND HEARING LOSS PREVENTION Language: English (US) Español ( ... when hazardous noise levels cannot be adequately reduced. Noise and Hearing Loss on the NIOSH Science Blog ...

  14. [Prevention of schizophrenia: a review].

    Science.gov (United States)

    Balhara, Yatan Pal Singh

    2013-01-01

    Research over the years has introduced multiple interventions for schizophrenia. Notwithstanding the nature of intervention pharmacological or psychological a complete cure for the condition remains a much-desired, yet unachieved goal. What is required is an exploration of alternative intervention strategies for treating schizophrenia a preventive approach is such an option. The chronic nature of schizophrenia and its associated disabilities have a tremendously negative affect the quality of life of patients, their families, and communities. Among the preferred approaches to reducing the negative consequences associated with the disorder is the prevention of its emergence. This review aimed to present the available data on the prevention of schizophrenia data that suggest some pharmacological and non-pharmacological interventions have a potential role in the prevention of schizophrenia. Nonetheless, the findings are restricted to a few sites and are at best preliminary; as such, the findings must be replicated in new studies that include large samples and different settings.

  15. Clinical Cancer Genetics and Prevention

    Science.gov (United States)

    Olufunmilayo F. Olopade MD, FACP, Professor of Medicine and Human Genetics and Director of the Cancer Risk Clinic Department of Medicine, BSD Section of Hematology/Oncology University of Chicago, presented "Clinical Cancer Genetics and Prevention".

  16. Treating and Preventing Sports Hernias

    Science.gov (United States)

    ... Close ‹ Back to Healthy Living Treating and Preventing Sports Hernias If you play ice hockey, tennis or ... for the most commonly misdiagnosed groin pain—a sports hernia. A sports hernia often results from overuse ...

  17. Preventing Breast Cancer: Making Progress

    Science.gov (United States)

    ... Navigation Bar Home Current Issue Past Issues Preventing Breast Cancer: Making Progress Past Issues / Fall 2006 Table of ... 000 women will have been diagnosed with invasive breast cancer, and nearly 41,000 women will die from ...

  18. Preventing Infections in Cancer Patients

    Science.gov (United States)

    ... Protect: Know the Signs and Symptoms of Infection Neutropenia and Risk for Infection Health Care Providers Educational Materials Cancer and Flu How to Prevent Flu from Spreading Flu Symptoms Information for Families and Caregivers Flu Treatment for Cancer Patients and ...

  19. Tips to Prevent Mosquito Bites

    Science.gov (United States)

    ... discourage mosquitoes, ticks and other biting insects from landing on you. Here are tips for other preventive ... CDC Mosquito Control Methods - NPIC Exit Top of Page Contact Us to ask a question, provide feedback, ...

  20. Preventing Burns in Your Home

    Science.gov (United States)

    ... clothing when you handle chemicals. Store chemicals, including gasoline, out of the reach of children. To prevent ... mild burn? What is the treatment for smoke inhalation? Resources American Red Cross, Home Fire Safety Centers ...

  1. Preventing Interpersonal Violence in Europe

    Directory of Open Access Journals (Sweden)

    Dinesh Sethi

    2014-06-01

    CONCLUSION: Community surveys can play an important role to better understand the scale and risk factors of different types of interpersonal violence. Readers are called upon to support a coordinated public health response to prevent this societal and health threat.

  2. Prevention: What You Can Do

    Science.gov (United States)

    ... Nutrition Obesity Physical Activity Stroke Prevention: What You Can Do Recommend on Facebook Tweet Share Compartir Live ... healthy diet. Choosing healthful meal and snack options can help you avoid heart disease and its complications. ...

  3. Preventing hepatitis B or C

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/patientinstructions/000401.htm Preventing hepatitis B or C To use the sharing features on this page, please enable JavaScript. Hepatitis B and hepatitis C infections cause irritation and ...

  4. The science of violence prevention

    OpenAIRE

    2015-01-01

    Twenty years after Rodrigo Guerrero-Velasco treated violence like a disease, using epidemiology to find the causes, his approach to violence prevention has been taken up across the Americas. He talks to Alyssa Greenhouse.

  5. The Justice of Preventive War

    National Research Council Canada - National Science Library

    Stephenson, Henry

    2004-01-01

    In response to the 9/11 attacks and continuing threats of mass-casualty terrorism, the United States has adopted a new security strategy that emphasizes anticipatory actions, including preventive war...

  6. Reducing Stress through Preventive Management.

    Science.gov (United States)

    Quick, James C.; Quick, Jonathan D.

    1979-01-01

    Two levels of prevention can be used to counter the key stressors of personnel at work; the first deals with organizational techniques and the second with individual techniques such as systematic desensitization, biofeedback, or aerobic exercise. (Author)

  7. Lessons from obesity prevention for the prevention of mental disorders: the primordial prevention approach.

    Science.gov (United States)

    Hayward, Joshua; Jacka, Felice N; Waters, Elizabeth; Allender, Steven

    2014-09-10

    Emerging evidence supports a relationship between risk factors for obesity and the genesis of the common mental disorders, depression and anxiety. This suggests common mental disorders should be considered as a form of non-communicable disease, preventable through the modification of lifestyle behaviours, particularly diet and physical activity. Obesity prevention research since the 1970's represents a considerable body of knowledge regarding strategies to modify diet and physical activity and so there may be clear lessons from obesity prevention that apply to the prevention of mental disorders. For obesity, as for common mental disorders, adolescence represents a key period of vulnerability. In this paper we briefly discuss relationships between modifiable lifestyle risk factors and mental health, lifestyle risk factor interventions in obesity prevention research, the current state of mental health prevention, and the implications of current applications of systems thinking in obesity prevention research for lifestyle interventions. We propose a potential focus for future mental health promotion interventions and emphasise the importance of lessons available from other lifestyle modification intervention programmes.

  8. Phlebitis: treatment, care and prevention.

    Science.gov (United States)

    Higginson, Ray; Parry, Andrew

    Peripheral venous catheter-associated phlebitis is caused by inflammation to the vein at a cannula access site. It can have a mechanical, chemical or infectious cause. Good practice when inserting a cannula, including appropriate choice of device and site, can help to prevent phlebitis. Good infection control techniques are also vital in preventing the condition. There are two phlebitis scoring systems, which should be used in routine practice to identify and treat early signs of the Peripheral venous cannulation

  9. Skin contamination - prevention and decontaminating

    International Nuclear Information System (INIS)

    Henning, K.

    2001-01-01

    A detailed examination is made of the structure of human skin. Measures were drawn up to prevent skin contamination in nuclear installations as well as contaminated skin was decontaminated from the personnel. By systematically applying these measures a significant level of success was achieved in preventing contamination in nuclear installations. Cases where more far-reaching chemical methods had to be used were kept to a minimum. (R.P.)

  10. Exemestane in the prevention setting

    OpenAIRE

    Litton, Jennifer Keating; Bevers, Therese B.; Arun, Banu K.

    2012-01-01

    Aromatase inhibitors are well-established therapies in the neoadjuvant, adjuvant and metastatic settings for breast cancer. In adjuvant trials, this class of drugs has shown preventative properties by decreasing the rate of contralateral breast cancer. Recently, the National Cancer Institute of Canada Clinical Trials Group MAP.3 study evaluated exemestane as a breast cancer prevention agent for women with specified higher risks of developing breast cancer. We review the history of exemestane ...

  11. Bullying Prevention for the Public

    Centers for Disease Control (CDC) Podcasts

    2012-01-19

    This is the first podcast of a series to discuss the severity of bullying and provide resources for prevention efforts. CDC shares the most recent statistics and trends, provides valuable tips to implement in communities, and teaches individuals how to take action against bullying.  Created: 1/19/2012 by National Center for Injury Prevention and Control (NCIPC).   Date Released: 1/19/2012.

  12. Prevention of Infection in Pregnancy

    Directory of Open Access Journals (Sweden)

    William J. Ledger

    1997-01-01

    Full Text Available We believe the prevention of infection-related adverse pregnancy outcome is the most important focus for obstetricians today. An emphasis upon immunization of susceptible women, prevention of transmissible disease by modification of patient behavior, and identification and treatment of silent infections should become standards of practice. This will require educational initiatives for physicians and their patients as well as continued clinical trials to determine costs and effectiveness.

  13. Preventing Falls in Older Persons.

    Science.gov (United States)

    Moncada, Lainie Van Voast; Mire, L Glen

    2017-08-15

    The American Geriatrics Society and British Geriatrics Society recommend that all adults older than 65 years be screened annually for a history of falls or balance impairment. The U.S. Preventive Services Task Force and American Academy of Family Physicians recommend exercise or physical therapy and vitamin D supplementation to prevent falls in community-dwelling older adults who are at increased risk of falls. Although the U.S. Preventive Services Task Force and American Academy of Family Physicians do not recommend routine multifactorial intervention to prevent falls in all community-dwelling older adults, they state that it may be appropriate in individual cases. The Centers for Disease Control and Prevention developed an algorithm to aid in the implementation of the American Geriatrics Society/British Geriatrics Society guideline. The algorithm suggests assessment and multifactorial intervention for those who have had two or more falls or one fall-related injury. Multifactorial interventions should include exercise, particularly balance, strength, and gait training; vitamin D supplementation with or without calcium; management of medications, especially psychoactive medications; home environment modification; and management of postural hypotension, vision problems, foot problems, and footwear. These interventions effectively decrease falls in the community, hospital, and nursing home settings. Fall prevention is reimbursed as part of the Medicare Annual Wellness Visit.

  14. Challenges in pressure ulcer prevention.

    Science.gov (United States)

    Dealey, Carol; Brindle, C Tod; Black, Joyce; Alves, Paulo; Santamaria, Nick; Call, Evan; Clark, Michael

    2015-06-01

    Although this article is a stand-alone article, it sets the scene for later articles in this issue. Pressure ulcers are considered to be a largely preventable problem, and yet despite extensive training and the expenditure of a large amount of resources, they persist. This article reviews the current understanding of pressure ulcer aetiology: pressure, shear and microclimate. Individual risk factors for pressure ulceration also need to be understood in order to determine the level of risk of an individual. Such an assessment is essential to determine appropriate prevention strategies. The main prevention strategies in terms of reducing pressure and shear and managing microclimate are studied in this article. The problem of pressure ulceration related to medical devices is also considered as most of the standard prevention strategies are not effective in preventing this type of damage. Finally, the possibility of using dressings as an additional preventive strategy is raised along with the question: is there enough evidence to support their use? © 2013 The Authors. International Wound Journal © 2013 Medicalhelplines.com Inc and John Wiley & Sons Ltd.

  15. Nutritional epigenomics: a portal to disease prevention.

    Science.gov (United States)

    Choi, Sang-Woon; Claycombe, Kate J; Martinez, J Alfredo; Friso, Simonetta; Schalinske, Kevin L

    2013-09-01

    Epigenetics can be defined as inheritable and reversible phenomena that affect gene expression without altering the underlying base pair sequence. Epigenomics is the study of genome-wide epigenetic modifications. Because gene expression changes are critical in both normal development and disease progression, epigenetics is widely applicable to many aspects of biological research. The influences of nutrients and bioactive food components on epigenetic phenomena such as DNA methylation and various types of histone modifications have been extensively investigated. Because an individual's epigenetic patterns are established during early gestation and are changed and personalized by environmental factors during our lifetime, epigenetic mechanisms are quite important in the development of transgenerational and adult obesity as well as in the development of diabetes mellitus. Aging and cancer demonstrate profound genome-wide DNA methylation changes, suggesting that nutrition may affect the aging process and cancer development through epigenetic mechanisms.

  16. Generation and characterization of an anti-delta like ligand-4 Nanobody to induce non-productive angiogenesis.

    Science.gov (United States)

    Baharlou, Rasoul; Tajik, Nader; Habibi-Anbouhi, Mahdi; Shokrgozar, Mohammad Ali; Zarnani, Amir-Hassan; Shahhosseini, Fatemeh; Behdani, Mahdi

    2018-03-01

    Antibody-based targeting of angiogenesis is a key approach for cancer treatment. Delta-like ligand 4 (DLL4) plays a pivotal role in tumor neovascular development and angiogenesis during tumor progression. It forecasts the prognosis of human malignancies and blocking its signaling can help to inhibit neovascularization and tumor metastasis. Nanobodies are the smallest antigen-binding domains of heavy chain antibodies in camelidae. The aim of this study was to develop a Nanobody against DLL4 and apply binding and functional approaches to target it. In this work, a Nanobody library against human recombinant DLL4 was developed. After panning, the periplasmic-extract (PE) of individual colonies were screened through ELISA. The interactions between Nanobody and DLL4 were assessed using immunohistochemistry and FACS. The functional assessment was carried out via tube formation assay. We selected a Nanobody (3Nb3) with a high binding signal to DLL4, associated with a binding affinity of 3.6 nM. It was demonstrated that 3Nb3 binds to native DLL4 on the surface of MKN cells and gastric carcinoma tissue, and also inhibits the maturation of capillary-like structures in HUVECs. The results were indicative of the potential of Nanobody for DLL4 identification and can broaden the scope for development of cancer diagnosis and treatment techniques. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Nonproductive human immunodeficiency virus type 1 infection of human fetal astrocytes: independence from CD4 and major chemokine receptors.

    Science.gov (United States)

    Sabri, F; Tresoldi, E; Di Stefano, M; Polo, S; Monaco, M C; Verani, A; Fiore, J R; Lusso, P; Major, E; Chiodi, F; Scarlatti, G

    1999-11-25

    Human immunodeficiency virus type 1 (HIV-1) infection of the brain is associated with neurological manifestations both in adults and in children. The primary target for HIV-1 infection in the brain is the microglia, but astrocytes can also be infected. We tested 26 primary HIV-1 isolates for their capacity to infect human fetal astrocytes in culture. Eight of these isolates, independent of their biological phenotype and chemokine receptor usage, were able to infect astrocytes. Although no sustained viral replication could be demonstrated, the virus was recovered by coculture with receptive cells such as macrophages or on stimulation with interleukin-1beta. To gain knowledge into the molecular events that regulate attachment and penetration of HIV-1 in astrocytes, we investigated the expression of several chemokine receptors. Fluorocytometry and calcium-mobilization assay did not provide evidence of expression of any of the major HIV-1 coreceptors, including CXCR4, CCR5, CCR3, and CCR2b, as well as the CD4 molecule on the cell surface of human fetal astrocytes. However, mRNA transcripts for CXCR4, CCR5, Bonzo/STRL33/TYMSTR, and APJ were detected by RT-PCR. Furthermore, infection of astrocytes by HIV-1 isolates with different chemokine receptor usage was not inhibited by the chemokines SDF-1beta, RANTES, MIP-1beta, or MCP-1 or by antibodies directed against the third variable region or the CD4 binding site of gp120. These data show that astrocytes can be infected by primary HIV-1 isolates via a mechanism independent of CD4 or major chemokine receptors. Furthermore, astrocytes are potential carriers of latent HIV-1 and on activation may be implicated in spreading the infection to other neighbouring cells, such as microglia or macrophages. Copyright 1999 Academic Press.

  18. Update on child abuse prevention.

    Science.gov (United States)

    Krugman, Scott D; Lane, Wendy G; Walsh, Christina M

    2007-12-01

    Child abuse remains a significant problem in the United States with 2.9 million reports and 825 000 indicated cases in 2005. This report will highlight recent efforts toward child abuse prevention, focusing on home visiting programs, abusive head trauma primary prevention, parent training programs, sexual abuse prevention, and the effectiveness of laws banning corporal punishment. Most home visitation programs have demonstrated a lack of effectiveness in recent randomized trials. One exception is the Nurse Family Partnership, which remains the most effective and longest enduring intervention for high-risk families. Child sexual abuse prevention programs and parent training programs need further evaluation with more rigorous methodology and outcome measures. Providing universal parent education about coping with crying infants appears to be effective in lowering the incidence of abusive head trauma. Although advocated for, further study will determine the effectiveness of laws banning corporal punishment or mandating abusive head trauma education to parents of newborns. Pediatricians play an important role in the prevention of child maltreatment. Their knowledge of the effectiveness of different programs can help guide parents toward appropriate services.

  19. Nutritional approach to preeclampsia prevention.

    Science.gov (United States)

    Achamrah, Najate; Ditisheim, Agnès

    2018-05-01

    Although not fully understood, the physiopathology of preeclampsia is thought to involve an abnormal placentation, diffuse endothelial cell dysfunction and increased systemic inflammation. As micronutrients play a key role in placental endothelial function, oxidative stress and expression of angiogenic factors, periconceptional micronutrient supplementation has been proposed to reduce the risk of preeclampsia. However, recent studies reported conflicting results. Calcium intake (>1 g/day) may reduce the risk of preeclampsia in women with low-calcium diet. Data from recently updated Cochrane reviews did not support routine supplementation of vitamins C, E or D for either the prevention or treatment of preeclampsia. Evidences are also poor to support zinc or folic acid supplementation for preeclampsia prevention. Dark chocolate, flavonoid-rich food, and long-chain polyunsaturated fatty acids might also be candidates for prevention of preeclampsia. Through antioxidant, anti-inflammatory or vasoactive proprieties, micronutrients are good candidates for preeclampsia prevention. Calcium supplementation is recommended to prevent preeclampsia in women with low-calcium intake. Despite positive clinical and in-vitro data, strong evidence to support periconceptional supplementation of other micronutrients for preeclampsia risk-reduction is still lacking. Further studies are also needed to evaluate the benefit of nutritional supplementation such as chocolate and long-chain polyunsaturated fatty acids.

  20. The Money Laundering Prevention System

    Directory of Open Access Journals (Sweden)

    Sonja Cindori

    2007-03-01

    Full Text Available The paper presents the money laundering and terrorist financing prevention system in Croatia. The basic concepts are defined, the principles and fundamentals of international regulations analysed, and the regulatory system in Croatia covered by statute and money laundering prevention Regulations is presented, in conjunction with a description of the organisation, remit and international actions of the Money Laundering Prevention Office.The infiltration of dirty money is a crucial problem from national economies. The purchase of shares, of real estate, the establishment of dirty investment funds and the use of the banking system for the embedding of such resources is a danger to the credibility of a whole country, and in particular to the security of the financial and banking system. Croatia has adopted statutory measures aimed at the effective detection and prevention of suspicious financial transactions, in other words the prevention of money laundering.Launderers constantly find new ways, make use of new non-financial channels and expand their activities to real estate, artworks and insurance. Hence it is necessary to keep up with European approaches and recommendations, to strive for further improvement of the laws and the modernisation of the system, and to adopt new regulations harmonised with international standards, particularly with Directive 2005/60/EC.

  1. Prevention strategies in child maltreatment.

    Science.gov (United States)

    Scribano, Philip V

    2010-10-01

    Child maltreatment remains a prevalent problem for which notable best practices such as home visitation can be effective; however, most eligible families do not receive these beneficial services. Additionally, there are other promising prevention interventions to effectively address child maltreatment. This review focuses on the recent advances and strategies for child maltreatment prevention. Although home visiting does not have a single clearly defined methodology of providing service to children and families, the general supportive framework to improve maternal, child, and family factors makes this intervention the most widely studied and accepted prevention strategy. However, there has been limited effectiveness for most models. The Nurse-Family Partnership (NFP) has provided consistently positive results by targeting families with many risk factors by using highly trained professionals when implementing a research-based intervention. A promising public health approach to parent training (Triple P) may reduce maltreatment and out-of-home placement. Parent-child interaction therapy (PCIT), while a treatment model, is becoming an increasingly important approach to child maltreatment prevention. There may be an opportunity to reduce child maltreatment by enhancing care in the pediatric medical home setting. Effective child maltreatment prevention efforts exist; however, not all programs provide the same effectiveness, or target the same maltreatment issues. Pediatricians are in a key position to offer support to families in their own practice, as well as to direct families to the appropriate resources available.

  2. Prevention vs. treatment: what's the right balance?

    National Research Council Canada - National Science Library

    Faust, Halley S; Menzel, Paul T

    2012-01-01

    .... This book explores this observation by examining the actual spending on prevention, the history of health policies and structural features that affect prevention's apparent relative lack of emphasis...

  3. Fiscal Year 2015 Pollution Prevention Grant Summaries

    Science.gov (United States)

    The Office of Pollution Prevention and Toxics is responsible for overseeing several grant programs for tribes and states which promote pollution prevention through source reduction and resource conservation.

  4. Fiscal Year 2014 Pollution Prevention Grant Summaries

    Science.gov (United States)

    The Office of Pollution Prevention and Toxics is responsible for overseeing several grant programs for tribes and states which promote pollution prevention through source reduction and resource conservation.

  5. Preventing pollution from plutonium processing

    International Nuclear Information System (INIS)

    Pillay, K.K.S.

    1993-01-01

    The plutonium processing facility at Los Alamos has adopted the strategic goal of becoming a facility that processes plutonium in a way that produces only environmentally benign waste streams. Pollution prevention through source reduction and environmentally sound recycling are being pursued. General approaches to waste reductions are administrative controls, modification of process technologies, and additional waste polishing. Recycling of waste materials, such as spent acids and salts, are technical possibilities and are being pursued to accomplish additional waste reduction. Liquid waste stream polishing to remove final traces of plutonium and hazardous chemical constituents is accomplished through (a) process modifications, (b) use of alternative chemicals and sorbents for residue removal, (c) acid recycling, and (d) judicious use of a variety of waste polishing technologies. Technologies that show promise in waste minimization and pollution prevention are identified. Working toward this goal of pollution prevention is a worthwhile endeavor, not only for Los Alamos, but for the Nuclear Complex of the future

  6. Primary Prevention of Cardiovascular Disease

    Directory of Open Access Journals (Sweden)

    Danny J. Eapen, MD

    2016-09-01

    Full Text Available Cardiovascular disease (CVD is the leading cause of death worldwide. This article focuses on current guidelines for the primary prevention of CVD and addresses management of key risk factors. Dietary modification, weight loss, exercise, and tobacco use cessation are specific areas where focused efforts can successfully reduce CVD risk on both an individual and a societal level. Specific areas requiring management include dyslipidemia, hypertension, physical activity, diabetes, aspirin use, and alcohol intake. These preventive efforts have major public health implications. As the global population continues to grow, health care expenditures will also rise, with the potential to eventually overwhelm the health care system. Therefore it is imperative to apply our collective efforts on CVD prevention to improve the cardiovascular health of individuals, communities, and nations.

  7. Preventing pollution from plutonium processing

    International Nuclear Information System (INIS)

    Pillay, K.K.S.

    1995-01-01

    The plutonium processing facility at Los Alamos has adopted the strategic goal of becoming a facility that processes plutonium in a way that produces only environmentally benign waste streams. Pollution prevention through source reduction and environmentally sound recycling are being pursued. General approaches to waste reductions are administrative controls, modification of process technologies, and additional waste polishing. Recycling of waste materials, such as spent acids and salts, are technical possibilities and are being pursued to accomplish additional waste reduction. Liquid waste stream polishing to remove final traces of plutonium and hazardous chemical constituents is accomplished through process modifications, use of alternative chemicals and sorbents for residue removal, acid recycling, and judicious use of a variety of waste polishing technologies. Technologies that show promise in waste minimization and pollution prevention are identified. Working toward this goal of pollution prevention is a worthwhile endeavor , not only for Los Alamos, but for the Nuclear Complex of the future. (author) 12 refs.; 2 figs

  8. Prediabetes and Lifestyle Modification: Time to Prevent a Preventable Disease

    Science.gov (United States)

    Tuso, Phillip

    2014-01-01

    More than 100 million Americans have prediabetes or diabetes. Prediabetes is a condition in which individuals have blood glucose levels higher than normal but not high enough to be classified as diabetes. People with prediabetes have an increased risk of Type 2 diabetes. An estimated 34% of adults have prediabetes. Prediabetes is now recognized as a reversible condition that increases an individual’s risk for development of diabetes. Lifestyle risk factors for prediabetes include overweight and physical inactivity. Increasing awareness and risk stratification of individuals with prediabetes may help physicians understand potential interventions that may help decrease the percentage of patients in their panels in whom diabetes develops. If untreated, 37% of the individuals with prediabetes may have diabetes in 4 years. Lifestyle intervention may decrease the percentage of prediabetic patients in whom diabetes develops to 20%. Long-term data also suggest that lifestyle intervention may decrease the risk of prediabetes progressing to diabetes for as long as 10 years. To prevent 1 case of diabetes during a 3-year period, 6.9 persons would have to participate in the lifestyle intervention program. In addition, recent data suggest that the difference in direct and indirect costs to care for a patient with prediabetes vs a patient with diabetes may be as much as $7000 per year. Investment in a diabetes prevention program now may have a substantial return on investment in the future and help prevent a preventable disease. PMID:25102521

  9. Prevention of Nosocomial Respiratory Infections

    Directory of Open Access Journals (Sweden)

    N. A. Karpun

    2007-01-01

    Full Text Available Objective: to evaluate the efficiency of an extended package of preventive measures on the incidence of nosocomial respiratory infections in surgical patients at an intensive care unit (ICU. Subjects and methods. The study included 809 patients aged 35 to 80 years. A study group comprised 494 patients in whom an extended package of preventive measures was implemented during 7 months (March-September. A control group consisted of 315 patients treated in 2004 in the same period of time (March-September. The groups were stratified by age, gender, underlying diseases, and APACHE-2 and SOFA scores. The extended package of anti-infectious measures involved a high air purification in ICUs («Flow-M» technology, routine use of ventilatory filters, closed aspiration systems with a built-in antibacterial filter under artificial ventilation for over 2 days. Results. The proposed technologies could reduce the frequency of tracheobronchitis and ventilator-associated pneumonias in the groups of patients at high risk for nosocomial infections substantially (by more than twice. Conclusion. The findings have led to the conclusion that the extended package of preventive measures is effective in preventing respiratory infections in ICU patients. Of special note is the proper prevention of upper airway contamination with pathogenic microorganisms, by employing the closed aspiration systems with a built-in antibacterial filter. The routine use of high-tech consumables in the intensive care of surgical patients causes a considerable decrease in the incidence of nosocomial pneumonia, ventilator-associated pneumonia, and purulent tracheobronchitis and a reduction in the number of microbiological studies. Key words: ventilator-associated pneumonia, prevention of nosocomial infections, closed aspiration system.

  10. Prevention of unintentional childhood injury.

    Science.gov (United States)

    Theurer, Wesley M; Bhavsar, Amit K

    2013-04-01

    Unintentional injury accounts for 40 percent of childhood deaths annually, most commonly from motor vehicle crashes. The proper use of child restraints is the most effective strategy to prevent injury or death. Motor vehicle restraint guidelines have recently been revised to an age-based system that delays the progression in type of restraint for most children. Strategies to prevent suffocation in children include using appropriate bedding, positioning babies on their backs to sleep, and removing items from the sleep and play environment that could potentially entrap or entangle the child. Fencing that isolates a swimming pool from the yard and surrounding area and "touch" adult supervision (i.e., an adult is in the water and able to reach and grab a child) have been shown to be most effective in preventing drownings. Swimming lessons are recommended for children older than four years. Poison prevention programs have been shown to improve prevention behavior among caregivers, but may not decrease poisoning incidence. Syrup of ipecac is not recommended. Smoke detector maintenance, a home escape plan, and educating children about how to respond during a fire emergency are effective strategies for preventing fire injuries or death. Fall injuries may be reduced by not using walkers for infants and toddlers or bunk beds for children six years and younger. Consistent helmet use while bicycling reduces head and brain injuries. Although direct counseling by physicians appears to improve some parental safety behaviors, its effect on reducing childhood injuries is uncertain. Community-based interventions can be effective in high-risk populations.

  11. Primary prevention of adolescent pregnancy.

    Science.gov (United States)

    Schinke, S P; Blythe, B J; Gilchrist, L D; Burt, G A

    1981-01-01

    Teenage pregnancy is associated with many health, emotional and socioeconomic problems including higher rates of anemia, labor complications, mortality, legal and social struggles and hhigher divorce rates. Professional social workers need strategies to help teenagers avoid early, unwanted pregnancy. This paper offers promising experential and research backing for a primary prevention group work strategy for all adolescents. Social and health programs overlook educational, cognitive anc interpersonal factors biasing youths' ability to comprehend and regulate contraception. Primary prevention to assist adolescents in thinking analytically about their sexual behavior must stress problem solving and decision-making as well as facts about human reproduction and birth control. To implement decisions, youths also need interpersonal communication skills. Small groups are ideal for delivering cognitive-behavioral primary prevention. This approach is based on the premise that youths become pregnant not because of a lack of relevant information, but because they lack cognitive and behavioral skills necessary to use information. Group work involving role-playing helps develop communication skills. Results from 2 field studies describe short-term and longitudinal benefits of the prevention strategy. Professionals can reach significant numbers of youth in this way. By treating sexual issues and the risk of pregnancy as normal in adolescence, social workers can introduce information and pertinent skills to all teenagers. No one is singled out as deviant and the group format enables young people to discuss taboo topics, discovering what the norms are and gradually learning how to deal with peers, family members, techers and others. Adolescents in primary prevention groups gained knowledge, cognitive skills and communication acumen. Improved attitudes toward family planning, increased regular contraception and less unsafe sex resulted from this cognitive-behavioral approach

  12. FOOD ALLERGY PREVENTION IN INFANCY

    Directory of Open Access Journals (Sweden)

    S.G. Makarova

    2006-01-01

    Full Text Available The article deals with new data about food tolerance induction among the children, belonging to the high risk groups disposed to atopy. Authors show the role of gut microflora in formation of child immune system, effect of breast feeding on activation of local immune response, growth stimulation of bifid bacteria and lactic acid bacilli. The present work gives the randomized research findings, which confirm the effectiveness of prolonged breast feeding, use of highly or partially hydrolyzed mixtures and timely introduction of supplemental feeding in food allergy prevention.Key words: prevention, food allergy, children, breast feeding, hypo allergic mixtures, milk protein hydrolysates, supplemental feeding, gut microflora, probiotics.

  13. [Prevention of the refeeding syndrome].

    Science.gov (United States)

    Martínez Núñez, Maria E; Hernández Muniesa, B

    2010-01-01

    The refeeding syndrome can be defined as the metabolic alterations developed by the rapid nutrition repletion (oral, enteral as well as parenteral feeding) of severaly malnourished patients. Refeeding syndrome is a potentially fatal clinical condition and it is often underdiagnosed on non-specialized nutrition units. The most important key for its prevention is to identify patients at high risk for developing refeeding syndrome, before nutrition repletion. The present case describes the steps to prevent the refeeding syndrome as well as the clinical recommendations to restart nutrition support.

  14. Preventing urinary incontinence in women.

    Science.gov (United States)

    Newman, Diane K; Cardozo, Linda; Sievert, Karl-Dietrich

    2013-10-01

    This review examines the evidence to date, analyzes specific risk factors and assesses the ability to prevent urinary incontinence in women, while providing clinical recommendations. More extraordinary risk factors such as ethnicity and race, mixed and fecal incontinence, iatrogenic and neurogenic factors should be discussed in a follow-up report. Studies have revealed that certain factors place women at risk for developing urinary incontinence, including age, obesity, diabetes, pregnancy and delivery, high-impact physical exercise factors and estrogen deficiency. Healthcare providers should screen women who are at risk for developing urinary incontinence and institute specific interventions, specifically behavioral and even rehabilitative techniques, to prevent this prevalent and distressing condition.

  15. Recognizing and Preventing Whooping Cough

    Centers for Disease Control (CDC) Podcasts

    2015-01-22

    This podcast provides information about the symptoms of whooping cough and how vaccines can help prevent this serious disease for people of all ages. It is especially important for those who will have close contact with a baby to be up to date with their whooping cough vaccine.  Created: 1/22/2015 by National Center for Immunization and Respiratory Diseases (NCIRD), Division of Bacterial Diseases (DBD), Meningitis and Vaccine Preventable Diseases Branch (MVPDB).   Date Released: 1/22/2015.

  16. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit; Autiero, Ida; Oliva, Romina; Cavallo, Luigi

    2018-01-01

    the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM

  17. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  18. Charge transport in DNA oligonucleotides with various base-pairing patterns

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Todorciuc, Tatiana; Král, Karel; Němec, Hynek; Bunček, M.; Šebera, Jakub; Záliš, Stanislav; Vokáčová, Zuzana; Sychrovský, Vladimír; Bednárová, Lucie; Mojzeš, P.; Schneider, Bohdan

    2010-01-01

    Roč. 114, č. 15 (2010), 5196–5205 ISSN 1520-6106 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA ČR GA202/07/0643; GA AV ČR IAA400550701; GA AV ČR KAN200100801; GA AV ČR KAN100400702; GA ČR GA202/09/0193 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z40400503; CEZ:AV0Z40550506; CEZ:AV0Z50520701 Keywords : DNA * charge transport * Scanning Tunneling Microscopy Subject RIV: CC - Organic Chemistry Impact factor: 3.603, year: 2010

  19. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    Science.gov (United States)

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  20. Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.

    Science.gov (United States)

    Zenk, John; Tuntivate, Chanon; Schulman, Rebecca

    2016-03-16

    We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).