WorldWideScience

Sample records for prevents nonproductive base-pairing

  1. Method for sequencing DNA base pairs

    Science.gov (United States)

    Sessler, Andrew M.; Dawson, John

    1993-01-01

    The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.

  2. Base pairing in RNA structures: A computational analysis of ...

    Indian Academy of Sciences (India)

    WINTEC

    PDB files using RASMOL18 software. Hydrogen atoms were added to these base pairs using MOLDEN19 software. The sugar portions attached to base pairs in. RNA structures were removed, and C1′ atoms were respectively replaced by hydrogen atoms during model building. The change in base pair geometry on re-.

  3. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  4. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  5. Base pairing in RNA structures: A computational analysis of ...

    Indian Academy of Sciences (India)

    The base pairing patterns in RNA structures are more versatile and completely different as compared to DNA. We present here results of ab-initio studies of structures and interaction energies of eight selected RNA base pairs reported in literature. Interaction energies, including BSSE correction, of hydrogen added crystal ...

  6. Base pairing in RNA structures: A computational analysis

    Indian Academy of Sciences (India)

    The base pairing patterns in RNA structures are more versatile and completely different as compared to DNA. We present here results of ab-initio studies of structures and interaction energies of eight selected RNA base pairs reported in literature. Interaction energies, including BSSE correction, of hydrogen added crystal ...

  7. Photochemical selectivity in guanine–cytosine base-pair structures

    Science.gov (United States)

    Abo-Riziq, Ali; Grace, Louis; Nir, Eyal; Kabelac, Martin; Hobza, Pavel; de Vries, Mattanjah S.

    2005-01-01

    Prebiotic chemistry presumably took place before formation of an oxygen-rich atmosphere and thus under conditions of intense short wavelength UV irradiation. Therefore, the UV photochemical stability of the molecular building blocks of life may have been an important selective factor in determining the eventual chemical makeup of critical biomolecules. To investigate the role of UV irradiation in base-pairing we have studied guanine (G) and cytosine (C) base pairs in the absence of the RNA backbone. We distinguished base-pair structures by IR–UV hole-burning spectroscopy as well as by high-level correlated ab initio calculations. The Watson–Crick structure exhibits broad UV absorption, in stark contrast to other GC structures and other base-pair structures. This broad absorption may be explained by a rapid internal conversion that makes this specific base pair arrangement uniquely photochemically stable. PMID:15618394

  8. 16alpha-Bromoepiandrosterone (HE2000) limits non-productive inflammation and stimulates immunity in lungs.

    NARCIS (Netherlands)

    Nicoletti, F.; Conrad, D.; Wang, A.; Pieters, R.|info:eu-repo/dai/nl/35112148X; Mangano, K.; van Heeckeren, A.; White, S.K.; Frincke, J.; Reading, C.L.; Auci, D.L.; Stickney, D.

    2009-01-01

    16alpha-Bromoepiandrosterone (HE2000) is a synthetic steroid that limits non-productive inflammation, enhances protective immunity and improves survival in clinical studies of patients with human immunodeficiency virus (HIV), malaria and tuberculosis infections. We now show that HE2000 decreased

  9. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

    Science.gov (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

    2011-01-01

    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  10. Cowpox virus inhibits human dendritic cell immune function by nonlethal, nonproductive infection

    International Nuclear Information System (INIS)

    Hansen, Spencer J.; Rushton, John; Dekonenko, Alexander; Chand, Hitendra S.; Olson, Gwyneth K.; Hutt, Julie A.; Pickup, David; Lyons, C. Rick; Lipscomb, Mary F.

    2011-01-01

    Orthopoxviruses encode multiple proteins that modulate host immune responses. We determined whether cowpox virus (CPXV), a representative orthopoxvirus, modulated innate and acquired immune functions of human primary myeloid DCs and plasmacytoid DCs and monocyte-derived DCs (MDDCs). A CPXV infection of DCs at a multiplicity of infection of 10 was nonproductive, altered cellular morphology, and failed to reduce cell viability. A CPXV infection of DCs did not stimulate cytokine or chemokine secretion directly, but suppressed toll-like receptor (TLR) agonist-induced cytokine secretion and a DC-stimulated mixed leukocyte reaction (MLR). LPS-stimulated NF-κB nuclear translocation and host cytokine gene transcription were suppressed in CPXV-infected MDDCs. Early viral immunomodulatory genes were upregulated in MDDCs, consistent with early DC immunosuppression via synthesis of intracellular viral proteins. We conclude that a nonproductive CPXV infection suppressed DC immune function by synthesizing early intracellular viral proteins that suppressed DC signaling pathways.

  11. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  12. Understanding the kinetic mechanism of RNA single base pair formation.

    Science.gov (United States)

    Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie

    2016-01-05

    RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model.

  13. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü

    2017-11-01

    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  14. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

    2005-01-01

    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  15. Efficacy and tolerability of levodropropizine and dropropizine in children with non-productive cough.

    Science.gov (United States)

    Banderali, G; Riva, E; Fiocchi, A; Cordaro, C I; Giovannini, M

    1995-01-01

    The antitussive efficacy and tolerability of dropropizine and of its enantiomer levodropropizine were evaluated in children with non-productive cough; 258 were evaluable for tolerability and 254 for efficacy. Patients randomly received either 1 mg/kg dropropizine or 2 mg/kg levodropropizine orally, three times daily for 3 days. There were statistically significant decreases in the frequency of coughing spells and nocturnal awakenings after both levodropropizine and dropropizine treatments (P Levodropropizine is as effective as an antitussive as dropropizine, but appears to carry a lower risk of daytime somnolence.

  16. Efficacy and safety of levodropropizine and dihydrocodeine on nonproductive cough in primary and metastatic lung cancer.

    Science.gov (United States)

    Luporini, G; Barni, S; Marchi, E; Daffonchio, L

    1998-07-01

    Nonproductive cough is a frequent and distressing symptom in patients with lung cancer, and it is not even relieved by palliative chemotherapy. A double-blind, randomized clinical trial regarding the treatment of nonproductive cough was performed in 140 adults with primary lung cancer or metastatic cancer of the lungs. The therapeutic efficacy and the tolerability of a 7-day treatment with levodropropizine drops (75 mg t.i.d.) were evaluated in comparison with dihydrocodeine drops (10 mg t.i.d.; 7 days). Efficacy was assessed on the basis of cough severity scores, number of night awakenings due to cough, and overall estimate of antitussive efficacy. Tolerability was evaluated by laboratory results, vital signs and any adverse event occurring during the clinical trial, including presence or absence of somnolence. Subjective cough severity was significantly reduced during treatment with either levodropropizine and dihydrocodeine, the antitussive effect and its time-profile being similar for both drugs. Also, according to the investigator's evaluation, both levodropropizine and dihydrocodeine produced a significant decrease in cough severity. Concurrently with the relief of cough, the number of night awakenings was decreased significantly by both drugs, with no difference between the two treatments. No change in laboratory test values was considered clinically relevant, and vital signs were not clinically affected. The number of patients reporting adverse events was similar in the levodropropizine (n=6) and dihydrocodeine (n=4) group. However, the percentage of patients experiencing somnolence in the group receiving levodropropizine (8%) was significantly lower as compared with that of the dihydrocodeine group (22%). These results confirm the antitussive effectiveness of levodropropizine and suggest a more favourable benefit/risk profile when compared to dihydrocodeine.

  17. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  18. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  19. Probing the nature of hydrogen bonds in DNA base pairs.

    Science.gov (United States)

    Mo, Yirong

    2006-07-01

    Energy decomposition analyses based on the block-localized wave-function (BLW-ED) method are conducted to explore the nature of the hydrogen bonds in DNA base pairs in terms of deformation, Heitler-London, polarization, electron-transfer and dispersion-energy terms, where the Heitler-London energy term is composed of electrostatic and Pauli-exchange interactions. A modest electron-transfer effect is found in the Watson-Crick adenine-thymine (AT), guanine-cytosine (GC) and Hoogsteen adenine-thymine (H-AT) pairs, confirming the weak covalence in the hydrogen bonds. The electrostatic attraction and polarization effects account for most of the binding energies, particularly in the GC pair. Both theoretical and experimental data show that the GC pair has a binding energy (-25.4 kcal mol(-1) at the MP2/6-31G** level) twice that of the AT (-12.4 kcal mol(-1)) and H-AT (-12.8 kcal mol(-1)) pairs, compared with three conventional N-H...O(N) hydrogen bonds in the GC pair and two in the AT or H-AT pair. Although the remarkably strong binding between the guanine and cytosine bases benefits from the opposite orientations of the dipole moments in these two bases assisted by the pi-electron delocalization from the amine groups to the carbonyl groups, model calculations demonstrate that pi-resonance has very limited influence on the covalence of the hydrogen bonds. Thus, the often adopted terminology "resonance-assisted hydrogen bonding (RHAB)" may be replaced with "resonance-assisted binding" which highlights the electrostatic rather than electron-transfer nature of the enhanced stabilization, as hydrogen bonds are usually regarded as weak covalent bonds.

  20. Calculation of the Stabilization Energies of Oxidatively Damaged Guanine Base Pairs with Guanine

    Directory of Open Access Journals (Sweden)

    Hiroshi Miyazawa

    2012-06-01

    Full Text Available DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H-oxazolone (Oz, guanidinohydantoin (Gh/iminoallantoin (Ia and spiro-imino-dihydantoin (Sp are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  1. 1H NMR determination of base-pair lifetimes in oligonucleotides containing single base mismatches.

    Science.gov (United States)

    Bhattacharya, Pratip K; Cha, Julie; Barton, Jacqueline K

    2002-11-01

    Proton nuclear magnetic resonance (NMR) spectroscopy is employed to characterize the kinetics of base-pair opening in a series of 9mer duplexes containing different single base mismatches. The imino protons from the different mismatched, as well as fully matched, duplexes are assigned from the imino-imino region in the WATERGATE NOESY spectra. The exchange kinetics of the imino protons are measured from selective longitudinal relaxation times. In the limit of infinite exchange catalyst concentration, the exchange times of the mismatch imino protons extrapolate to much shorter lifetimes than are commonly observed for an isolated GC base pair. Different mismatches exhibit different orders of base-pair lifetimes, e.g. a TT mismatch has a shorter base-pair lifetime than a GG mismatch. The effect of the mismatch was observed up to a distance of two neighboring base pairs. This indicates that disruption in the duplex caused by the mismatch is quite localized. The overall order of base-pair lifetimes in the selected sequence context of the base pair is GC > GG > AA > CC > AT > TT. Interestingly, the fully matched AT base pair has a shorter base-pair lifetime relative to many of the mismatches. Thus, in any given base pair, the exchange lifetime can exhibit a strong dependence on sequence context. These findings may be relevant to the way mismatch recognition is accomplished by proteins and small molecules.

  2. Efficacy and tolerability of levodropropizine in adult patients with non-productive cough. Comparison with dextromethorphan.

    Science.gov (United States)

    Catena, E; Daffonchio, L

    1997-01-01

    The results of a double-blind, randomized clinical trial involving 209 adult patients of either sex with moderate non-productive cough are reported. The therapeutic efficacy and the tolerability of levodropropizine syrup (60 mg t.i.d. for 5 days) was evaluated in comparison with dextromethorphan syrup (15 mg t.i.d. for 5 days). Efficacy was assessed by the number of coughing spells in a 6h period, the cough frequency classes, the cough intensity and the night awakenings due to cough. Tolerability was evaluated by laboratory results, vital signs and any adverse event occurred during the clinical trial, including presence or absence of somnolence. Independently from the underlying pathology and from the degree of baseline cough severity, the number of coughing spells was significantly (P levodropropizine and dextromethorphan already after the 2nd day of treatment, the effect and its time of onset being similar for both drugs. Cough intensity was significantly (P levodropropizine than with dextromethorphan. Concurrently with the relief of cough, the number of night awakenings was decreased remarkably and significantly (P levodropropizine displaying an improvement significantly higher (P levodropropizine (3.6%) group. Overall, somnolence was reported for a low percentage of patients with both drugs, with the percentage of patients experiencing this side effect being one half in the group treated with levodropropizine (4.6%) as compared with dextromethorphan (10.4%). These results confirm the antitussive effectiveness of levodropropizine and point out a more favourable benefit/risk profile when compared to dextromethorphan.

  3. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

    1989-01-01

    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  4. Structures and stabilities of small DNA dumbbells with Watson-Crick and Hoogsteen base pairs.

    Science.gov (United States)

    Escaja, Nuria; Gómez-Pinto, Irene; Rico, Manuel; Pedroso, Enrique; González, Carlos

    2003-07-07

    The structures and stabilities of cyclic DNA octamers of different sequences have been studied by NMR and CD spectroscopy and by restrained molecular dynamics. At low oligonucleotide concentrations, some of these molecules form stable monomeric structures consisting of a short stem of two base pairs connected by two mini-loops of two residues. To our knowledge, these dumbbell-like structures are the smallest observed to date. The relative stabilities of these cyclic dumbbells have been established by studying their melting transitions. Dumbbells made up purely of GC stems are more stable than those consisting purely of AT base pairs. The order of the base pairs closing the loops also has an important effect on the stabilities of these structures. The NMR data indicate that there are significant differences between the solution structures of dumbbells with G-C base pairs in the stem compared to those with A-T base pairs. In the case of dumbbells with G-C base pairs, the residues in the stem form a short segment of a BDNA helix stabilized by two Watson-Crick base pairs. In contrast, in the case of d, the stem is formed by two A-T base pairs with the glycosidic angles of the adenine bases in a syn conformation, most probably forming Hoogsteen base pairs. Although the conformations of the loop residues are not very well defined, the thymine residues at the first position of the loop are observed to fold back into the minor groove of the stem.

  5. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn

    2011-01-01

    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  6. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

    Science.gov (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

    2018-03-26

    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Structural landscape of base pairs containing post-transcriptional modifications in RNA.

    Science.gov (United States)

    Seelam, Preethi P; Sharma, Purshotam; Mitra, Abhijit

    2017-06-01

    Base pairs involving post-transcriptionally modified nucleobases are believed to play important roles in a wide variety of functional RNAs. Here we present our attempts toward understanding the structural and functional role of naturally occurring modified base pairs using a combination of X-ray crystal structure database analysis, sequence analysis, and advanced quantum chemical methods. Our bioinformatics analysis reveals that despite their presence in all major secondary structural elements, modified base pairs are most prevalent in tRNA crystal structures and most commonly involve guanine or uridine modifications. Further, analysis of tRNA sequences reveals additional examples of modified base pairs at structurally conserved tRNA regions and highlights the conservation patterns of these base pairs in three domains of life. Comparison of structures and binding energies of modified base pairs with their unmodified counterparts, using quantum chemical methods, allowed us to classify the base modifications in terms of the nature of their electronic structure effects on base-pairing. Analysis of specific structural contexts of modified base pairs in RNA crystal structures revealed several interesting scenarios, including those at the tRNA:rRNA interface, antibiotic-binding sites on the ribosome, and the three-way junctions within tRNA. These scenarios, when analyzed in the context of available experimental data, allowed us to correlate the occurrence and strength of modified base pairs with their specific functional roles. Overall, our study highlights the structural importance of modified base pairs in RNA and points toward the need for greater appreciation of the role of modified bases and their interactions, in the context of many biological processes involving RNA. © 2017 Seelam et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  8. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    Science.gov (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  9. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

    2005-01-01

    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson -Crick/Sugar Edge Subject RIV: BO - Biophysics

  10. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  11. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  12. Detection of base pair mismatches in duplex DNA and RNA oligonucleotides using electrospray mass spectrometry

    Science.gov (United States)

    Griffey, Richard H.; Greig, Michael J.

    1997-05-01

    The identify and location of base pair mismatches in non- covalent DNA:RNA duplexes are established using MS and MS-MS on a quadruple ion trap with electrospray ionization (ESI). MS-MS experiments on a 14mer duplex (D) with a single C:A base pair mismatch using lower activation energy results in selective cleavage of the mismatched A nucleobase, even in the presence of the wild-type duplex. The location of the mismatch base pair can be discerned via presence of the wild-type duplex. The location of the mismatch base pair can be discerned via selection of the (D-5H)5- ion and fragmentation of the backbone at that location in a n additional MS-MS experiment. Selective fragmentation is observed for C in a C-C mismatched base pair, which is very difficult to detect using chemical cleavage or E. coli mismatch binding protein. In an RNA:DNA duplex with a single base pair mismatch, the DNA base is removed without fragmentation of the RNA strand, greatly simplifying the interpretation of the resulting MS spectrum. A method is presented for detecting two DNA strands, for example a point mutation which generates an oncogenic phenotype, and the wild-type message. The results suggest that ESI-MS-MS may provide a rapid and selective method to identify and locate genetic mutations without the need for chemical degradation or protein binding followed by gel electrophoresis.

  13. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

    Science.gov (United States)

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

    2013-01-01

    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  14. Cytosine-Cytosine Base-Pair Mismatch and Chirality in Nucleotide Supramolecular Coordination Complexes.

    Science.gov (United States)

    Qiu, Qi-Ming; Zhou, Pei; Gu, Leilei; Hao, Liang; Liu, Minghua; Li, Hui

    2017-05-29

    The base-pair sequences are the foundation for the biological processes of DNA or RNA, and base-pair mismatch is very important to reveal genetic diseases and DNA rearrangements. However, the lack of well-defined structural information about base-pair mismatch is obstructing the investigation of this issue. The challenge is to crystallize the materials containing the base-pair mismatch. Engineering the small-molecule mimics or model is an effective strategy to solve this issue. Here, six cytidine-5'-monophosphate (CMP) and 2'-deoxycytidine-5'-monophosphate (dCMP) coordination polymers were reported containing cytosine-cytosine base-pair mismatch (i-motif), and their single-crystal structures and chiralities were studied. The precise control over the formation of the i-motif was demonstrated, in which the regulating of supramolecular interactions was achieved based on molecular design. In addition, the chiralities of these coordination polymers were investigated according to their crystal structures and solution- and solid-state circular dichroism spectroscopy. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit

    2015-06-27

    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  16. Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

    Science.gov (United States)

    Vercoutere, Wenonah; DeGuzman, Veronica

    2003-01-01

    The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

  17. The nearest neighbor and next nearest neighbor effects on the thermodynamic and kinetic properties of RNA base pair

    Science.gov (United States)

    Wang, Yujie; Wang, Zhen; Wang, Yanli; Liu, Taigang; Zhang, Wenbing

    2018-01-01

    The thermodynamic and kinetic parameters of an RNA base pair with different nearest and next nearest neighbors were obtained through long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The results indicate that thermodynamic parameters of GC base pair are dependent on the nearest neighbor base pair, and the next nearest neighbor base pair has little effect, which validated the nearest-neighbor model. The closing and opening rates of the GC base pair also showed nearest neighbor dependences. At certain temperature, the closing and opening rates of the GC pair with nearest neighbor AU is larger than that with the nearest neighbor GC, and the next nearest neighbor plays little role. The free energy landscape of the GC base pair with the nearest neighbor GC is rougher than that with nearest neighbor AU.

  18. Lignin from hydrothermally pretreated grass biomass retards enzymatic cellulose degradation by acting as a physical barrier rather than by inducing nonproductive adsorption of enzymes

    DEFF Research Database (Denmark)

    Djajadi, Demi T.; Jensen, Mads M.; Oliveira, Marlene

    2018-01-01

    Lignin is known to hinder efficient enzymatic conversion of lignocellulose in biorefining processes. In particular, nonproductive adsorption of cellulases onto lignin is considered a key mechanism to explain how lignin retards enzymatic cellulose conversion in extended reactions. Lignin-rich resi...

  19. Theoretical study of the scalar coupling constants across the noncovalent contacts in RNA base pairs: The cis- and trans-Watson-Crick/sugar edge base pair family

    Czech Academy of Sciences Publication Activity Database

    Vokáčová, Zuzana; Šponer, Jiří; Šponer, Judit E.; Sychrovský, Vladimír

    2007-01-01

    Roč. 111, č. 36 (2007), s. 10813-10824 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA203/05/0388; GA ČR(CZ) GA203/06/0420; GA AV ČR(CZ) IAA400550701; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : RNA base pairs * NMR spin-spin coupling constant * theoretical calculations Subject RIV: BO - Biophysics Impact factor: 4.086, year: 2007

  20. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... [Dixit SB, Mezei M and Beveridge DL 2012 Studies of base pair sequence effects on DNA salvation based on all-atom molecular dynamics simulations. J. Biosci. 37 399–421] DOI 10.1007/s12038-012-9223-5. 1. Introduction. Solvation plays an integral role in stabilizing the structure of the DNA molecule in ...

  1. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

    2002-01-01

    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  2. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... base pair sequence, both via direct interactions and indirectly via sequence preferences for ... Supplementary materials pertaining to this article are available on the Journal of Biosciences Website at http://www.ias.ac.in/jbiosci/ ..... trapped for fairly long times by current routine simulation lengths (~10 ns) but ...

  3. Density functional MO calculation for stacked DNA base-pairs with backbones.

    Science.gov (United States)

    Kurita, N; Kobayashi, K

    2000-05-01

    In order to elucidate the effect of the sugar and phosphate backbones on the stable structure and electronic properties of stacked DNA base-pairs, we performed ab initio molecular orbital (MO) calculations based on the density functional theory and Slater-type basis set. As a model cluster for stacked base-pairs, we employed three isomers for the dimer unit of stacked guanine-cytosine pairs composed with backbones as well as base-pairs. These structures were fully optimized and their electronic properties were self-consistently investigated. By including the backbones, the difference in total energy among the isomers was largely enhanced, while the trend in relative stability was not changed. The effect of backbones on the electronic properties is remarkable: the MOs with the character of the PO4 parts of backbones appear just below the highest-occupied MO. This result indicates that the PO4 parts might play a rule as a reaction site in chemical processes concerning DNA. Therefore, we conclude that the DNA backbones are indispensable for investigating the stability and electronic properties of the stacked DNA base-pairs.

  4. Optimization of the pyridyl nucleobase scaffold for polymerase recognition and unnatural base pair replication

    Czech Academy of Sciences Publication Activity Database

    Hari, Y.; Hwang, G. T.; Leconte, A. M.; Joubert, Nicolas; Hocek, Michal; Romesberg, F. E.

    2008-01-01

    Roč. 9, č. 17 (2008), s. 2796-2799 ISSN 1439-4227 R&D Projects: GA MŠk LC512 Grant - others:NIH(US) GM60005 Institutional research plan: CEZ:AV0Z40550506 Keywords : pyridines * C-nucleosides * base-pairs * DNA polymerase * replication Subject RIV: CC - Organic Chemistry Impact factor: 3.322, year: 2008

  5. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    Science.gov (United States)

    (O’ Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  6. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

    Science.gov (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

    2017-11-03

    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Single-Base Pair Genome Editing in Human Cells by Using Site-Specific Endonucleases

    Directory of Open Access Journals (Sweden)

    Hiroshi Ochiai

    2015-09-01

    Full Text Available Genome-wide association studies have identified numerous single-nucleotide polymorphisms (SNPs associated with human diseases or phenotypes. However, causal relationships between most SNPs and the associated disease have not been established, owing to technical challenges such as unavailability of suitable cell lines. Recently, efficient editing of a single base pair in the genome was achieved using programmable site-specific nucleases. This technique enables experimental confirmation of the causality between SNPs and disease, and is potentially valuable in clinical applications. In this review, I introduce the molecular basis and describe examples of single-base pair editing in human cells. I also discuss the challenges associated with the technique, as well as possible solutions.

  8. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

    2015-01-01

    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens th...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  9. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

    2008-01-01

    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  10. Computational reprogramming of homing endonuclease specificity at multiple adjacent base pairs.

    Science.gov (United States)

    Ashworth, Justin; Taylor, Gregory K; Havranek, James J; Quadri, S Arshiya; Stoddard, Barry L; Baker, David

    2010-09-01

    Site-specific homing endonucleases are capable of inducing gene conversion via homologous recombination. Reprogramming their cleavage specificities allows the targeting of specific biological sites for gene correction or conversion. We used computational protein design to alter the cleavage specificity of I-MsoI for three contiguous base pair substitutions, resulting in an endonuclease whose activity and specificity for its new site rival that of wild-type I-MsoI for the original site. Concerted design for all simultaneous substitutions was more successful than a modular approach against individual substitutions, highlighting the importance of context-dependent redesign and optimization of protein-DNA interactions. We then used computational design based on the crystal structure of the designed complex, which revealed significant unanticipated shifts in DNA conformation, to create an endonuclease that specifically cleaves a site with four contiguous base pair substitutions. Our results demonstrate that specificity switches for multiple concerted base pair substitutions can be computationally designed, and that iteration between design and structure determination provides a route to large scale reprogramming of specificity.

  11. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  12. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  13. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai

    2012-03-01

    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  14. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

    Science.gov (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

    2012-11-01

    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  15. Clinical validation of efficacy and safety of herbal cough formulation "Honitus syrup" for symptomatic relief of acute non-productive cough and throat irritation.

    Science.gov (United States)

    Gupta, Arun; Gaikwad, Vaijayanti; Kumar, Satyendra; Srivastava, Ruchi; Sastry, Jln

    2016-01-01

    Acute cough represents the most common illness evaluated in the outpatient settings. Available remedies for its management are generally allopathic combinations of antihistamines and decongestants that achieve antitussive activity, but often with unpleasant side effects prompting the need to explore safer and effective options. Honitus is an Ayurvedic proprietary herbal cough syrup with benefits of honey, intended to provide relief in acute nonproductive cough and throat irritation without causing drowsiness. This study investigated the safety and efficacy of Honitus in reducing acute nonproductive cough and throat irritation in comparison to a standard marketed allopathic cough syrup intended for use in similar conditions. This was a randomized double-blind study conducted in 105 individuals who received orally 2 tsp (10 ml) of either Honitus or marketed cough syrup (MCS) four times a day for 3 days. Response to treatment was evaluated from baseline to the end of treatment period on the basis of changes in day and night frequencies of cough, throat irritation and development of adverse events (AEs). Honitus was found safe and effective in reducing symptoms of acute nonproductive cough, throat irritation, and comparable to MCS in reducing day and night frequencies of cough, the time to relief from cough and throat irritation and the Physician's Global Assessment of cough. Honitus showed comparably better results than MCS on throat irritation, the duration of relief from cough and throat irritation without causing drowsiness. No AEs related to study or study products were reported. Honitus Syrup is safe and effective in reducing the symptoms of acute nonproductive cough and throat irritation without causing drowsiness.

  16. SIMULATION AS AN APPROPRIATE WAY OF VERIFYING THE EFFICIENCY OF PRODUCTION VARIANTS IN THE DESIGN OF PRODUCTION AND NON-PRODUCTION SYSTEMS

    Directory of Open Access Journals (Sweden)

    Marek Kliment

    2014-12-01

    Full Text Available The paper deals with simulation and her forms of use in designing of production and non-production systems. Points to the possibility of using software can help in planning and subsequently in other phase of the lifecycle production and products. Article informs about some of the advantages of this type of software and his options. Sets out some theoretical knowledge of simulation and in the practical part presents some frequently used simulation software.

  17. Occupational exposure to chemical and biological agents in the nonproduction departments of pulp, paper, and paper product mills: an international study.

    Science.gov (United States)

    Teschke, K; Ahrens, W; Andersen, A; Boffetta, P; Fincham, S; Finkelstein, M; Henneberger, P; Kauppinen, T; Kogevinas, M; Korhonen, K; Liss, G; Liukkonnen, T; Osvoll, P; Savela, A; Szadkowska-Stanczyk, I; Westberg, H; Widerkiewicz, K

    1999-01-01

    As part of an international epidemiological study of workers in the pulp and paper industry, previously unpublished exposure measurements were assembled in a database. This article describes 7293 measurements in nonproduction departments from 147 mills in 11 countries. The greatest variety of agents was measured in the maintenance, construction, and cleaning department, where high exposures to asbestos, chromium [VI] compounds, copper, mercury in urine, nitrogen dioxide, ozone, styrene, sulfur dioxide, trichloroethylene, and welding fumes were observed. Measurements in the storage, yard, loading, and shipping department indicated high exposures to asbestos, carbon monoxide, fungal spores, nitrogen oxides, sulfur dioxide, and total dust. The steam and power generation department had high exposures to methyl mercaptan, silica, and total dust. Measurements in process and effluent water treatment, laboratory and research, engineering, and office, administration, and cafeteria areas had few elevated exposures. Throughout the nonproduction departments, measurements of pulp-production chemicals such as chlorine and sulfur compounds tended to be low, with many below detection limits. There were some problems with the available data; in particular, detection limits were often not specified, and the data tended to be clustered in such a way that sources of exposure variability could not be distinguished. Despite these problems, the data provide new insight into the exposures of nonproduction pulp and paper industry personnel.

  18. Understanding the Nonproductive Enzyme Adsorption and Physicochemical Properties of Residual Lignins in Moso Bamboo Pretreated with Sulfuric Acid and Kraft Pulping.

    Science.gov (United States)

    Huang, Caoxing; He, Juan; Min, Douyong; Lai, Chenhuan; Yong, Qiang

    2016-12-01

    In this work, to elucidate why the acid-pretreated bamboo shows disappointingly low enzymatic digestibility comparing to the alkali-pretreated bamboo, residual lignins in acid-pretreated and kraft pulped bamboo were isolated and analyzed by adsorption isotherm to evaluate their extents of nonproductive enzyme adsorption. Meanwhile, physicochemical properties of the isolated lignins were analyzed and a relationship was established with non-productive adsorption. Results showed that the adsorption affinity and binding strength of cellulase on acid-pretreated bamboo lignin (MWLa) was significantly higher than that on residual lignin in pulped bamboo (MWLp). The maximum adsorption capacity of cellulase on MWLp was 129.49 mg/g lignin, which was lower than that on MWLa (160.25 mg/g lignin). When isolated lignins were added into the Avicel hydrolysis solution, the inhibitory effect on enzymatic hydrolysis efficiency of MWLa was found to be considerably stronger than that with MWLp. The cellulase adsorption on isolated lignins was correlated positively with hydrophobicity, phenolic hydroxyl group, and degree of condensation but negatively with surface charges and aliphatic hydroxyl group. These results suggest that the higher nonproductive cellulase adsorption and physicochemical properties of residual lignin in acid-pretreated bamboo may be responsible for its disappointingly low enzymatic digestibility.

  19. RNA Base Pairing Determines the Conformations of RNA Inside Spherical Viruses

    Science.gov (United States)

    Erdemci-Tandogan, Gonca; Orland, Henri; Zandi, Roya

    2017-11-01

    Many simple RNA viruses enclose their genetic material by a protein shell called the capsid. While the capsid structures are well characterized for most viruses, the structure of RNA inside the shells and the factors contributing to it remain poorly understood. We study the impact of base pairing on the conformations of RNA and find that it undergoes a swollen coil to globule continuous transition as a function of the strength of the pairing interaction. We also observe a first order transition and kink profile as a function of RNA length. All these transitions could explain the different RNA profiles observed inside viral shells.

  20. Theoretical study of metal ion binding in modified and natural cytosine-cytosine base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Sugiyama, K.; Ono, A.; Mulder, J.; Bickelhaupt, F. M.; Tanaka, Y.; Sychrovský, Vladimír; Guerra, C. F.

    2013-01-01

    Roč. 20, č. 1 (2013), s. 39-39 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /11./. 14.03.2013-16.03.2013, Nové Hrady] R&D Projects: GA ČR GAP205/10/0228; GA ČR(CZ) GAP304/10/1951; GA TA ČR TA01011165 Institutional support: RVO:61388963 Keywords : DFT * NMR * base pair * metal-mediated Subject RIV: CF - Physical ; Theoretical Chemistry

  1. Acid-Base Pairs in Lewis Acidic Zeolites Promote Direct Aldol Reactions by Soft Enolization.

    Science.gov (United States)

    Lewis, Jennifer D; Van de Vyver, Stijn; Román-Leshkov, Yuriy

    2015-08-17

    Hf-, Sn-, and Zr-Beta zeolites catalyze the cross-aldol condensation of aromatic aldehydes with acetone under mild reaction conditions with near quantitative yields. NMR studies with isotopically labeled molecules confirm that acid-base pairs in the Si-O-M framework ensemble promote soft enolization through α-proton abstraction. The Lewis acidic zeolites maintain activity in the presence of water and, unlike traditional base catalysts, in acidic solutions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

    OpenAIRE

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  3. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit

    2013-10-10

    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  4. Effects of osmolytes and macromolecular crowders on stable GAAA tetraloops and their preference for a CG closing base pair

    Directory of Open Access Journals (Sweden)

    Kaethe N. Leonard

    2018-02-01

    Full Text Available Osmolytes and macromolecular crowders have the potential to influence the stability of secondary structure motifs and alter preferences for conserved nucleic acid sequences in vivo. To further understand the cellular function of RNA we observed the effects of a model osmolyte, polyethylene glycol (PEG 200, and a model macromolecular crowding agent, PEG 8000, on the GAAA tetraloop motif. GAAA tetraloops are conserved, stable tetraloops, and are critical participants in RNA tertiary structure. They also have a thermodynamic preference for a CG closing base pair. The thermal denaturation of model hairpins containing GAAA loops was monitored using UV-Vis spectroscopy in the presence and absence of PEG 200 or PEG 8000. Both of the cosolutes tested influenced the thermodynamic preference for a CG base pair by destabilizing the loop with a CG closing base pair relative to the loop with a GC closing base pair. This result also extended to a related DNA triloop, which provides further evidence that the interactions between the loop and closing base pair are identical for the d(GCA triloop and the GAAA tetraloop. Our results suggest that in the presence of model PEG molecules, loops with a GC closing base pair may retain some preferential interactions with the cosolutes that are lost in the presence of the CG closing base pair. These results reveal that relatively small structural changes could influence how neutral cosolutes tune the stability and function of secondary structure motifs in vivo.

  5. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

    2012-01-01

    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  6. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

    Science.gov (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

    2013-10-01

    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Eukaryotic TPP riboswitch regulation of alternative splicing involving long-distance base pairing.

    Science.gov (United States)

    Li, Sanshu; Breaker, Ronald R

    2013-03-01

    Thiamin pyrophosphate (TPP) riboswitches are found in organisms from all three domains of life. Examples in bacteria commonly repress gene expression by terminating transcription or by blocking ribosome binding, whereas most eukaryotic TPP riboswitches are predicted to regulate gene expression by modulating RNA splicing. Given the widespread distribution of eukaryotic TPP riboswitches and the diversity of their locations in precursor messenger RNAs (pre-mRNAs), we sought to examine the mechanism of alternative splicing regulation by a fungal TPP riboswitch from Neurospora crassa, which is mostly located in a large intron separating protein-coding exons. Our data reveal that this riboswitch uses a long-distance (∼530-nt separation) base-pairing interaction to regulate alternative splicing. Specifically, a portion of the TPP-binding aptamer can form a base-paired structure with a conserved sequence element (α) located near a 5' splice site, which greatly increases use of this 5' splice site and promotes gene expression. Comparative sequence analyses indicate that many fungal species carry a TPP riboswitch with similar intron architecture, and therefore the homologous genes in these fungi are likely to use the same mechanism. Our findings expand the scope of genetic control mechanisms relying on long-range RNA interactions to include riboswitches.

  8. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  9. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    Energy Technology Data Exchange (ETDEWEB)

    Palmero, F [ETS IngenierIa Informatica, Universidad de Sevilla, Avda Reina Mercedes s/n, 41012-Sevilla (Spain); Archilla, J F R [ETS IngenierIa Informatica, Universidad de Sevilla, Avda Reina Mercedes s/n, 41012-Sevilla (Spain); Hennig, D [Freie Universitaet Berlin, Fachbereich Physik, Arnimallee 14, 14195-Berlin (Germany); Romero, F R [Facultad de FIsica, Universidad de Sevilla, Avda Reina Mercedes s/n, 41012-Sevilla (Spain)

    2004-02-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder.

  10. A mutate-and-map strategy accurately infers the base pairs of a 35-nucleotide model RNA

    Science.gov (United States)

    Kladwang, Wipapat; Cordero, Pablo; Das, Rhiju

    2011-01-01

    We present a rapid experimental strategy for inferring base pairs in structured RNAs via an information-rich extension of classic chemical mapping approaches. The mutate-and-map method, previously applied to a DNA/RNA helix, systematically searches for single mutations that enhance the chemical accessibility of base-pairing partners distant in sequence. To test this strategy for structured RNAs, we have carried out mutate-and-map measurements for a 35-nt hairpin, called the MedLoop RNA, embedded within an 80-nt sequence. We demonstrate the synthesis of all 105 single mutants of the MedLoop RNA sequence and present high-throughput DMS, CMCT, and SHAPE modification measurements for this library at single-nucleotide resolution. The resulting two-dimensional data reveal visually clear, punctate features corresponding to RNA base pair interactions as well as more complex features; these signals can be qualitatively rationalized by comparison to secondary structure predictions. Finally, we present an automated, sequence-blind analysis that permits the confident identification of nine of the 10 MedLoop RNA base pairs at single-nucleotide resolution, while discriminating against all 1460 false-positive base pairs. These results establish the accuracy and information content of the mutate-and-map strategy and support its feasibility for rapidly characterizing the base-pairing patterns of larger and more complex RNA systems. PMID:21239468

  11. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

    2010-01-01

    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  12. A single base-pair deletion in the WFS1 gene causes Wolfram syndrome.

    Science.gov (United States)

    Pitt, Katherine; James, Chela; Kochar, Inderpal S; Kapoor, Akshay; Jain, Shilpi; Hussain, Khalid; Bennett, Kate

    2011-01-01

    Wolfram syndrome is a progressive neurodegenerative disorder also known as DIDMOAD (diabetes insipidus, diabetes mellitus, optic atrophy and deafness). The majority of cases are caused by mutations in the WFS1 gene. WFS1 is located at 4p16.1 and encodes wolframin, a transmembrane endoplasmic reticulum (ER) protein involved in the negative regulation of ER stress signalling. To date, over 120 WFS1 mutations have been described. In this study, we report a consanguineous family with three siblings affected by Wolfram syndrome. A homozygous single base pair deletion (c.877delC, L293fsX303) was found in the WFS1 gene in all three affected siblings.

  13. Identification of DNA lesions using a third base pair for amplification and nanopore sequencing

    Science.gov (United States)

    Riedl, Jan; Ding, Yun; Fleming, Aaron M.; Burrows, Cynthia J.

    2015-01-01

    Damage to the genome is implicated in the progression of cancer and stress-induced diseases. DNA lesions exist in low levels, and cannot be amplified by standard PCR because they are frequently strong blocks to polymerases. Here, we describe a method for PCR amplification of lesion-containing DNA in which the site and identity could be marked, copied and sequenced. Critical for this method is installation of either the dNaM or d5SICS nucleotides at the lesion site after processing via the base excision repair process. These marker nucleotides constitute an unnatural base pair, allowing large quantities of marked DNA to be made by PCR amplification. Sanger sequencing confirms the potential for this method to locate lesions by marking, amplifying and sequencing a lesion in the KRAS gene. Detection using the α-hemolysin nanopore is also developed to analyse the markers in individual DNA strands with the potential to identify multiple lesions per strand. PMID:26542210

  14. Base-pairing versatility determines wobble sites in tRNA anticodons of vertebrate mitogenomes.

    Directory of Open Access Journals (Sweden)

    Miguel M Fonseca

    Full Text Available BACKGROUND: Vertebrate mitochondrial genomes typically have one transfer RNA (tRNA for each synonymous codon family. This limited anticodon repertoire implies that each tRNA anticodon needs to wobble (establish a non-Watson-Crick base pairing between two nucleotides in RNA molecules to recognize one or more synonymous codons. Different hypotheses have been proposed to explain the factors that determine the nucleotide composition of wobble sites in vertebrate mitochondrial tRNA anticodons. Until now, the two major postulates--the "codon-anticodon adaptation hypothesis" and the "wobble versatility hypothesis"--have not been formally tested in vertebrate mitochondria because both make the same predictions regarding the composition of anticodon wobble sites. The same is true for the more recent "wobble cost hypothesis". PRINCIPAL FINDINGS: In this study we have analyzed the occurrence of synonymous codons and tRNA anticodon wobble sites in 1553 complete vertebrate mitochondrial genomes, focusing on three fish species with mtDNA codon usage bias reversal (L-strand is GT-rich. These mitogenomes constitute an excellent opportunity to study the evolution of the wobble nucleotide composition of tRNA anticodons because due to the reversal the predictions for the anticodon wobble sites differ between the existing hypotheses. We observed that none of the wobble sites of tRNA anticodons in these unusual mitochondrial genomes coevolved to match the new overall codon usage bias, suggesting that nucleotides at the wobble sites of tRNA anticodons in vertebrate mitochondrial genomes are determined by wobble versatility. CONCLUSIONS/SIGNIFICANCE: Our results suggest that, at wobble sites of tRNA anticodons in vertebrate mitogenomes, selection favors the most versatile nucleotide in terms of wobble base-pairing stability and that wobble site composition is not influenced by codon usage. These results are in agreement with the "wobble versatility hypothesis".

  15. Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

    Science.gov (United States)

    Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

    2012-01-01

    The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

  16. Characterization of the trans Watson-Crick GU base pair located in the catalytic core of the antigenomic HDV ribozyme.

    Directory of Open Access Journals (Sweden)

    Dominique Lévesque

    Full Text Available The HDV ribozyme's folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U(23 and G(28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U(23 and G(28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction.

  17. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit

    2018-01-02

    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  18. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    Energy Technology Data Exchange (ETDEWEB)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart [Biodesign Institute, Arizona State University, Tempe, AZ 85287 (United States); Young, Michael [Department of Physics, Arizona State University, Tempe, AZ 85287 (United States)], E-mail: Stuart.Lindsay@asu.edu

    2009-05-06

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  19. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  20. The Simplified Aircraft-Based Paired Approach With the ALAS Alerting Algorithm

    Science.gov (United States)

    Perry, Raleigh B.; Madden, Michael M.; Torres-Pomales, Wilfredo; Butler, Ricky W.

    2013-01-01

    This paper presents the results of an investigation of a proposed concept for closely spaced parallel runways called the Simplified Aircraft-based Paired Approach (SAPA). This procedure depends upon a new alerting algorithm called the Adjacent Landing Alerting System (ALAS). This study used both low fidelity and high fidelity simulations to validate the SAPA procedure and test the performance of the new alerting algorithm. The low fidelity simulation enabled a determination of minimum approach distance for the worst case over millions of scenarios. The high fidelity simulation enabled an accurate determination of timings and minimum approach distance in the presence of realistic trajectories, communication latencies, and total system error for 108 test cases. The SAPA procedure and the ALAS alerting algorithm were applied to the 750-ft parallel spacing (e.g., SFO 28L/28R) approach problem. With the SAPA procedure as defined in this paper, this study concludes that a 750-ft application does not appear to be feasible, but preliminary results for 1000-ft parallel runways look promising.

  1. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.

    Science.gov (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam

    2017-11-02

    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  2. New insights into Hoogsteen base pairs in DNA duplexes from a structure-based survey.

    Science.gov (United States)

    Zhou, Huiqing; Hintze, Bradley J; Kimsey, Isaac J; Sathyamoorthy, Bharathwaj; Yang, Shan; Richardson, Jane S; Al-Hashimi, Hashim M

    2015-04-20

    Hoogsteen (HG) base pairs (bps) provide an alternative pairing geometry to Watson-Crick (WC) bps and can play unique functional roles in duplex DNA. Here, we use structural features unique to HG bps (syn purine base, HG hydrogen bonds and constricted C1'-C1' distance across the bp) to search for HG bps in X-ray structures of DNA duplexes in the Protein Data Bank. The survey identifies 106 A•T and 34 G•C HG bps in DNA duplexes, many of which are undocumented in the literature. It also uncovers HG-like bps with syn purines lacking HG hydrogen bonds or constricted C1'-C1' distances that are analogous to conformations that have been proposed to populate the WC-to-HG transition pathway. The survey reveals HG preferences similar to those observed for transient HG bps in solution by nuclear magnetic resonance, including stronger preferences for A•T versus G•C bps, TA versus GG steps, and also suggests enrichment at terminal ends with a preference for 5'-purine. HG bps induce small local perturbations in neighboring bps and, surprisingly, a small but significant degree of DNA bending (∼14°) directed toward the major groove. The survey provides insights into the preferences and structural consequences of HG bps in duplex DNA. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Glyoxals as in vivo RNA structural probes of guanine base-pairing.

    Science.gov (United States)

    Mitchell, David; Ritchey, Laura E; Park, Hongmarn; Babitzke, Paul; Assmann, Sarah M; Bevilacqua, Philip C

    2018-01-01

    Elucidation of the folded structures that RNA forms in vivo is vital to understanding its functions. Chemical reagents that modify the Watson-Crick (WC) face of unprotected nucleobases are particularly useful in structure elucidation. Dimethyl sulfate penetrates cell membranes and informs on RNA base-pairing and secondary structure but only modifies the WC face of adenines and cytosines. We present glyoxal, methylglyoxal, and phenylglyoxal as potent in vivo reagents that target the WC face of guanines as well as cytosines and adenines. Tests on rice ( Oryza sativa) 5.8S rRNA in vitro read out by reverse transcription and gel electrophoresis demonstrate specific modification of almost all guanines in a time- and pH-dependent manner. Subsequent in vivo tests on rice, a eukaryote, and Bacillus subtilis and Escherichia coli , Gram-positive and Gram-negative bacteria, respectively, showed that all three reagents enter living cells without prior membrane permeabilization or pH adjustment of the surrounding media and specifically modify solvent-exposed guanine, cytosine, and adenine residues. © 2018 Mitchell et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  4. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae)

    Science.gov (United States)

    Bardella, Vanessa Bellini; Pita, Sebastián; Vanzela, André Luis Laforga; Galvão, Cleber; Panzera, Francisco

    2016-01-01

    The subfamily Triatominae (Hemiptera, Reduviidae) includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae. PMID:27759763

  5. Heterochromatin base pair composition and diversification in holocentric chromosomes of kissing bugs (Hemiptera, Reduviidae

    Directory of Open Access Journals (Sweden)

    Vanessa Bellini Bardella

    Full Text Available The subfamily Triatominae (Hemiptera, Reduviidae includes 150 species of blood-sucking insects, vectors of Chagas disease or American trypanosomiasis. Karyotypic information reveals a striking stability in the number of autosomes. However, this group shows substantial variability in genome size, the amount and distribution of C-heterochromatin, and the chromosome positions of 45S rDNA clusters. Here, we analysed the karyotypes of 41 species from six different genera with C-fluorescence banding in order to evaluate the base-pair richness of heterochromatic regions. Our results show a high heterogeneity in the fluorescent staining of the heterochromatin in both autosomes and sex chromosomes, never reported before within an insect subfamily with holocentric chromosomes. This technique allows a clear discrimination of the heterochromatic regions classified as similar by C-banding, constituting a new chromosome marker with taxonomic and evolutionary significance. The diverse fluorescent patterns are likely due to the amplification of different repeated sequences, reflecting an unusual dynamic rearrangement in the genomes of this subfamily. Further, we discuss the evolution of these repeated sequences in both autosomes and sex chromosomes in species of Triatominae.

  6. Genome Filtering Using Methylation- Sensitive Restriction Enzymes with Six Base Pair Recognition Sites

    Directory of Open Access Journals (Sweden)

    John P. Fellers

    2008-11-01

    Full Text Available The large fraction of repetitive DNA in many plant genomes has complicated all aspects of DNA sequencing and assembly, and thus techniques that enrich for genes and low-copy sequences have been employed to isolate gene space. Methyl-sensitive restriction enzymes, with six base pair recognition sites, were evaluated on genomic DNA of the bread wheat ‘Chinese Spring’ as a different approach to enrich for genes. I, I, I, and II were used to digest wheat genomic DNA and fragments ranging from 400 bp to 2.0 kb were cloned and unidirectionally sequenced. All four enzymes provided some level of enrichment for gene space; however, II and I reduced the number of clones with repeat elements to just 16.2 and 19.1%, respectively. II and I were also effective in enrichment in corn and tobacco. Corn libraries made with II and I had 58.7 and 71.2%, respectively, of the clones with significant expressed sequence tag (EST alignments, while tobacco libraries made with the same enzymes had 51.7 and 65.3%, respectively. With the development of ultra-throughput sequencing technologies, this technique provides an opportunity to rapidly and efficiently obtain sequencing from gene-rich regions.

  7. Single-Molecule Measurements of Synthesis by DNA Polymerase with Base-Pair Resolution

    Science.gov (United States)

    Christian, Thomas; Romano, Louis; Rueda, David

    2010-03-01

    The catalytic mechanism of DNA polymerases involves multiple steps that precede and follow the transfer of a nucleotide to the 3'-hydroxyl of the growing DNA chain. Here we report a single-molecule approach to monitor the movement of E. coli DNA polymerase I (Klenow fragment) on a DNA template during DNA synthesis with single base-pair resolution. As each nucleotide is incorporated, the single-molecule F"orster resonance energy transfer intensity drops in discrete steps to values consistent with single nucleotide incorporations. Purines and pyrimidines are incorporated with comparable rates. A mismatched primer-template junction exhibits dynamics consistent with the primer moving into the exonuclease domain, which was used to determine the fraction of primer-termini bound to the exonuclease and polymerase sites. Most interestingly, we observe a structural change following the incorporation of a correctly paired nucleotide, consistent with transient movement of the polymerase past the pre-insertion site or a conformational change in the polymerase. This may represent a previously unobserved step in the mechanism of DNA synthesis that could be part of the proofreading process.

  8. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  9. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  10. Lignin from hydrothermally pretreated grass biomass retards enzymatic cellulose degradation by acting as a physical barrier rather than by inducing nonproductive adsorption of enzymes

    DEFF Research Database (Denmark)

    Djajadi, Demi T.; Jensen, Mads M.; Oliveira, Marlene

    2018-01-01

    Lignin is known to hinder efficient enzymatic conversion of lignocellulose in biorefining processes. In particular, nonproductive adsorption of cellulases onto lignin is considered a key mechanism to explain how lignin retards enzymatic cellulose conversion in extended reactions. Lignin.......97. The LRRs had different residual carbohydrate levels-the highest in MS; the lowest in WS. The residual carbohydrate was not traceable at the surface of the LRRs particles by ATR-FTIR analysis. The chemical properties of the lignin in the LRRs varied across the three types of biomass, but monolignols...... of the enzymes to the LRRs. Since the surface of the LRRs particles were covered by lignin, the data suggest that the retardation of enzymatic cellulose degradation during extended reaction on lignocellulosic substrates is due to physical blockage of the access of enzymes to the cellulose caused by the gradual...

  11. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

    1994-01-01

    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  12. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

    Science.gov (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

    2007-02-07

    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  13. Prevention

    Science.gov (United States)

    ... Error processing SSI file About Heart Disease & Stroke Prevention Heart disease and stroke are an epidemic in ... secondhand smoke. Barriers to Effective Heart Disease & Stroke Prevention Many people with key risk factors for heart ...

  14. Effects of restrained sampling space and nonplanar amino groups on free-energy predictions for RNA with imino and sheared tandem GA base pairs flanked by GC, CG, iGiC or iCiG base pairs

    Czech Academy of Sciences Publication Activity Database

    Yildirim, I.; Stern, H.A.; Šponer, Jiří; Špačková, Naďa; Turner, D.H.

    2009-01-01

    Roč. 5, č. 8 (2009), s. 2088-2100 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA MŠk(CZ) LC06030 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : base pairs * NMR * amber force field Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  15. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit

    2015-09-17

    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  16. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Prevention

    Science.gov (United States)

    ... Contact Aging & Health A to Z Find a Geriatrics Healthcare Professional Medications & Older Adults Making Your Wishes ... Prevention Hearing Loss Heart Attack High Blood Pressure Nutrition Osteoporosis Shingles Skin Cancer Related News Quitting Smoking, ...

  18. UV-inactivation of Epstein-Barr virus: differences in early antigen expression in two different non-productive cell lines and influence of caffeine

    International Nuclear Information System (INIS)

    Suchankova, A.; Vonka, V.

    1978-01-01

    Two non-productive Epstein-Barr (EB) virus genome-carrying lymphoblastoid cell lines, namely Raji and NC37, were used for studying the effect of UV irradiation on the ability of P3HR-1 EB virus to induce early antigen (EA) formation. In NC37 cells infected with UV-irradiated virus the formation of EA was delayed; thus the slope of inactivation curve based on the early (24 hr) reading was steeper than that based on the late (72 hr) reading. This was not observed in Raji cells. Caffeine did not influence the percentage of EA positive cells in cultures infected with untreated virus; however, the drug exhibited a marked inhibitory effect on EA production after infection with UV-irradiated virus. The sensitivity to caffeine decreased more rapidly with time after infection of Raji than of NC37 cells, suggesting a higher degree of readiness of the host cell repair system in the former than in the latter cells. The caffeine effect was merely directed against the synthesis of R (restricted) component of EA; its influence on the D (diffuse) component formation was negligible. (author)

  19. Prevention

    DEFF Research Database (Denmark)

    Halken, S; Høst, A

    2001-01-01

    , breastfeeding should be encouraged for 4-6 months. In high-risk infants a documented extensively hydrolysed formula is recommended if exclusive breastfeeding is not possible for the first 4 months of life. There is no evidence for preventive dietary intervention neither during pregnancy nor lactation...... populations. These theories remain to be documented in proper, controlled and prospective studies. Breastfeeding and the late introduction of solid foods (>4 months) is associated with a reduced risk of food allergy, atopic dermatitis, and recurrent wheezing and asthma in early childhood. In all infants....... Preventive dietary restrictions after the age of 4-6 months are not scientifically documented....

  20. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  1. Trans Hoogsteen/sugar edge base pairing in RNA. Structures, energies, and stabilities from quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Mládek, Arnošt; Sharma, P.; Mitra, A.; Bhattacharyya, D.; Šponer, Jiří; Šponer, Judit E.

    2009-01-01

    Roč. 113, č. 6 (2009), s. 1743-1755 ISSN 1520-6106 R&D Projects: GA AV ČR(CZ) IAA400550701; GA AV ČR(CZ) IAA400040802; GA AV ČR(CZ) 1QS500040581; GA MŠk(CZ) LC06030 Grant - others:GA MŠk(CZ) LC512 Program:LC Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : quantum chemical calculations * base pairing * RNA Subject RIV: BO - Biophysics Impact factor: 3.471, year: 2009

  2. Silver-Mediated Base Pairs in DNA Incorporating Purines, 7-Deazapurines, and 8-Aza-7-deazapurines: Impact of Reduced Nucleobase Binding Sites and an Altered Glycosylation Position.

    Science.gov (United States)

    Zhao, Hang; Leonard, Peter; Guo, Xiurong; Yang, Haozhe; Seela, Frank

    2017-04-24

    Formation of silver-mediated DNA was studied with oligonucleotides incorporating 8-aza-7-deazapurine, 7-deazapurine, and purine nucleosides. The investigation was performed on non-self-complementary duplexes with one or two modifications and self-complementary duplexes with an alternating dA-dT motif. Homo base pairs as well as base pair mismatches of dA analogues with dC and Watson-Crick pairs with dT were studied by stoichiometric silver ion titration and T m measurements. N 8 -Glycosylated 8-aza-7-deazaadenine forms silver-ion-mediated base pairs capturing two silver ions (low silver content) whereas regularly glycosylated 8-aza-7-deazapurine, 7-deazapurine (c 7 A d ), and dA do not form comparable structures. Stable silver-mediated "dA-dC" base pair mismatches were detected for all nucleosides. Two silver ions per base pair are bound by 8-aza-7-deazapurine whereas c 7 A d binds only one silver ion. The situation is different when the equivalents of silver ions were increased to the number of total base pairs. Surprisingly, in 12-mer duplexes as well as in related 25-mer duplexes every base pair consumed one silver ion. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    International Nuclear Information System (INIS)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

    2016-01-01

    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

  4. Robust silver-mediated imidazolo-dC base pairs in metal DNA: dinuclear silver bridges with exceptional stability in double helices with parallel and antiparallel strand orientation.

    Science.gov (United States)

    Jana, Sunit Kumar; Guo, Xiurong; Mei, Hui; Seela, Frank

    2015-12-18

    A new unprecedented metal-mediated base pair was designed that stabilizes reverse Watson-Crick DNA (parallel strand orientation, ps) as well as canonical Watson-Crick DNA (antiparallel strand orientation, aps). This base pair contains two imidazolo-dC units decorated with furan residues. Tm measurements and spectroscopic studies reveal that each silver-mediated furano-imidazolo-dC forms exceptionally stable duplexes with ps and aps chain orientation. This stability increase by a silver-mediated base pair is the highest reported so far for ps and aps DNA helices.

  5. Base pairing and miscoding properties of 1,N(6)-ethenoadenine- and 3,N(4)-ethenocytosine-containing RNA oligonucleotides.

    Science.gov (United States)

    Calabretta, Alessandro; Leumann, Christian J

    2013-03-19

    Two RNA phosphoramidites containing the bases 1,N(6)-ethenoadenine (εA) and 3,N(4)-ethenocytosine (εC) were synthesized. These building blocks were incorporated into two 12-mer oligoribonucleotides for evaluation of the base pairing properties of these base lesions by UV melting curve (Tm) and circular dichroism measurements. The Tm data of the resulting duplexes with the etheno modifications opposing all natural bases showed a substantial destabilization compared to the corresponding natural duplexes, confirming their inability to form base pairs. The coding properties of these lesions were further investigated by introducing them into 31-mer oligonucleotides and assessing their ability to serve as templates in primer extension reactions with HIV, AMV, and MMLV reverse transcriptases (RT). Primer extension reactions showed complete arrest of the incorporation process using MMLV RT and AMV RT, while HIV RT preferentially incorporates dAMP opposite εA and dAMP as well as dTMP opposite εC. The properties of these RNA lesions are discussed in the context of its putative biological role.

  6. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.

    1987-01-01

    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  7. Spliceosomal small nuclear RNAs of Tetrahymena thermophila and some possible snRNA-snRNA base-pairing interactions

    DEFF Research Database (Denmark)

    Orum, H; Nielsen, Henrik; Engberg, J

    1991-01-01

    organisms. Furthermore, secondary structures closely similar to phylogenetically proven models can be inferred from the T. thermophila data. Analysis of the snRNA sequences identifies three potential snRNA-snRNA base-pairing interactions, all of which are consistent with available phylogenetic data. Two......We have identified and characterized the full set of spliceosomal small nuclear RNAs (snRNAs; U1, U2, U4, U5 and U6) from the ciliated protozoan Tetrahymena thermophila. With the exception of U4 snRNA, the sizes of the T. thermophila snRNAs are closely similar to their metazoan homologues. The T....... thermophila snRNAs all have unique 5' ends, which start with an adenine residue. In contrast, with the exception of U6, their 3' ends show some size heterogeneity. The primary sequences of the T. thermophila snRNAs contain the sequence motifs shown, or proposed, to be of functional importance in other...

  8. A novel 3670-base pair mitochondrial DNA deletion resulting in multi-systemic manifestations in a child.

    Science.gov (United States)

    Liu, Hsin-Ming; Tsai, Li-Ping; Chien, Yin-Hsiu; Wu, Jia-Feng; Weng, Wen-Chin; Peng, Shinn-Forng; Wu, En-Ting; Huang, Pei-Hsin; Lee, Wang-Tso; Tsai, I-Jun; Hwu, Wuh-Liang; Lee, Ni-Chung

    2012-08-01

    Mitochondrial DNA (mtDNA) deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility) that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297) was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected. Copyright © 2012. Published by Elsevier B.V.

  9. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu

    2012-08-01

    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  10. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  11. Investigation of Nascent Base Pair and Polymerase Behavior in the Presence of Mismatches in DNA Polymerase I Using Molecular Dynamics.

    Science.gov (United States)

    Yeager, Andrew; Humphries, Kathryn; Farmer, Ellen; Cline, Gene; Miller, Bill R

    2018-02-26

    Optimizing DNA polymerases for a broad range of tasks requires an understanding of the factors influencing polymerase fidelity, but many details of polymerase behavior remain unknown, especially in the presence of mismatched nascent base pairs. Using molecular dynamics, the large fragment of Bacillus stearothermophilus DNA polymerase I is simulated in the presence of all 16 possible standard nucleoside triphosphate-template (dNTP-dN) pairs, including four Watson-Crick pairs and 12 mismatches. The precatalytic steps of nucleotide addition from nucleotide insertion to immediately preceding catalysis are explored using three starting structures representing different stages of nucleotide addition. From these simulations, interactions between dNTPs and the DNA-protein complex formed by the polymerase are elucidated. Patterns of large-scale conformational shifts, classification of nucleotide pairs based on composition, and investigation of the roles of residues interacting with dNTPs are completed on 50+ μs of simulation. The role of molecular dynamics in studies of polymerase behavior is discussed.

  12. Base pairing interaction between 5'- and 3'-UTRs controls icaR mRNA translation in Staphylococcus aureus.

    Science.gov (United States)

    Ruiz de los Mozos, Igor; Vergara-Irigaray, Marta; Segura, Victor; Villanueva, Maite; Bitarte, Nerea; Saramago, Margarida; Domingues, Susana; Arraiano, Cecilia M; Fechter, Pierre; Romby, Pascale; Valle, Jaione; Solano, Cristina; Lasa, Iñigo; Toledo-Arana, Alejandro

    2013-01-01

    The presence of regulatory sequences in the 3' untranslated region (3'-UTR) of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3'-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3'-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3'-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3'-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3'-UTR and the Shine-Dalgarno (SD) region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG) within icaR 3'-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3'-UTR with the 5'-UTR of the same mRNA.

  13. Base pairing interaction between 5'- and 3'-UTRs controls icaR mRNA translation in Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Igor Ruiz de los Mozos

    Full Text Available The presence of regulatory sequences in the 3' untranslated region (3'-UTR of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3'-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3'-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3'-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3'-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3'-UTR and the Shine-Dalgarno (SD region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG within icaR 3'-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3'-UTR with the 5'-UTR of the same mRNA.

  14. Modulation of Interparticle Distance in Discrete Gold Nanoparticle Dimers and Trimers by DNA Single-Base Pairing.

    Science.gov (United States)

    Akiyama, Yoshitsugu; Shikagawa, Hiroto; Kanayama, Naoki; Takarada, Tohru; Maeda, Mizuo

    2015-07-01

    Self-assembled structures of metallic nanoparticles with dynamically changeable interparticle distance hold promise for the regulation of collective physical properties. This paper describes gold nanoparticle dimers and trimers that exhibit spontaneous and reversible changes in interparticle distance. To exploit this property, a gold nanoparticle is modified with precisely one long DNA strand and approximately five short DNA strands. The long DNA serves to align the nanoparticles on a template DNA via hybridization, while the short DNAs function to induce the interparticle distance changes. The obtained dimer and trimer are characterized with gel electrophoresis, dynamic light scattering measurements, and transmission electron microscopy (TEM). When the complementary short DNA is added to form the fully matched duplexes on the particle surface in the presence of MgCl2 , spontaneous reduction of the interparticle distance is observed with TEM and cryo-electron microscopy. By contrast, when the terminal-mismatched DNA is added, no structural change occurs under the same conditions. Therefore, the single base pairing/unpairing at the outermost surface of the nanoparticle impacts the interparticle distance. This unique feature could be applied to the regulation of structures and properties of various DNA-functionalized nanoparticle assemblies. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Whole genome sequencing reveals a 7 base-pair deletion in DMD exon 42 in a dog with muscular dystrophy.

    Science.gov (United States)

    Nghiem, Peter P; Bello, Luca; Balog-Alvarez, Cindy; López, Sara Mata; Bettis, Amanda; Barnett, Heather; Hernandez, Briana; Schatzberg, Scott J; Piercy, Richard J; Kornegay, Joe N

    2017-04-01

    Dystrophin is a key cytoskeletal protein coded by the Duchenne muscular dystrophy (DMD) gene located on the X-chromosome. Truncating mutations in the DMD gene cause loss of dystrophin and the classical DMD clinical syndrome. Spontaneous DMD gene mutations and associated phenotypes occur in several other species. The mdx mouse model and the golden retriever muscular dystrophy (GRMD) canine model have been used extensively to study DMD disease pathogenesis and show efficacy and side effects of putative treatments. Certain DMD gene mutations in high-risk, the so-called hot spot areas can be particularly helpful in modeling molecular therapies. Identification of specific mutations has been greatly enhanced by new genomic methods. Whole genome, next generation sequencing (WGS) has been recently used to define DMD patient mutations, but has not been used in dystrophic dogs. A dystrophin-deficient Cavalier King Charles Spaniel (CKCS) dog was evaluated at the functional, histopathological, biochemical, and molecular level. The affected dog's phenotype was compared to the previously reported canine dystrophinopathies. WGS was then used to detect a 7 base pair deletion in DMD exon 42 (c.6051-6057delTCTCAAT mRNA), predicting a frameshift in gene transcription and truncation of dystrophin protein translation. The deletion was confirmed with conventional PCR and Sanger sequencing. This mutation is in a secondary DMD gene hotspot area distinct from the one identified earlier at the 5' donor splice site of intron 50 in the CKCS breed.

  16. Isolation breeds naivety: island living robs Australian varanid lizards of toad-toxin immunity via four-base-pair mutation.

    Science.gov (United States)

    Ujvari, Beata; Mun, Hee-chang; Conigrave, Arthur D; Bray, Alessandra; Osterkamp, Jens; Halling, Petter; Madsen, Thomas

    2013-01-01

    Since their introduction to the toad-free Australian continent cane toads (Bufo marinus) have caused a dramatic increase in naïve varanid mortality when these large lizards attempt to feed on this toxic amphibian. In contrast Asian-African varanids, which have coevolved with toads, are resistant to toad toxin. Toad toxins, such as Bufalin target the H1-H2 domain of the α(1) subunit of the sodium-potassium-ATPase enzyme. Sequencing of this domain revealed identical nucleotide sequences in four Asian as well as in three African varanids, and identical sequences in all 11 Australian varanids. However, compared to the Asian-African varanids, the Australian varanids showed four-base-pair substitutions, resulting in the alteration in three of the 12 amino acids representing the H1-H2 domain. The phenotypic effect of the substitutions was investigated in human embryonic kidney (HEK) 293 cells stably transfected with the Australian and the Asian-African H1-H2 domains. The transfections resulted in an approximate 3000-fold reduction in resistance to Bufalin in the Australian HEK293 cells compared to the Asian-African HEK293 cells, demonstrating the critical role of this minor mutation in providing Bufalin resistance. Our study hence presents a clear link between genotype and phenotype, a critical step in understanding the evolution of phenotypic diversity. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

  17. Demonstration of polarization sensitivity of emulsion-based pair conversion telescope for cosmic gamma-ray polarimetry

    Energy Technology Data Exchange (ETDEWEB)

    Ozaki, Keita, E-mail: ozaki@radix.h.kobe-u.ac.jp [Kobe University, 3-11, Tsurukabuto, Nada-ku, Kobe 657-8501 (Japan); Takahashi, Satoru, E-mail: satoru@radix.h.kobe-u.ac.jp [Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8602 (Japan); Aoki, Shigeki; Kamada, Keiki; Kaneyama, Taichi; Nakagawa, Ryo; Rokujo, Hiroki [Kobe University, 3-11, Tsurukabuto, Nada-ku, Kobe 657-8501 (Japan)

    2016-10-11

    Linear polarization of high-energy gamma-rays (10MeV–100 GeV) can be detected by measuring the azimuthal angle of electron–positron pairs and observing the modulation of the azimuthal distribution. To demonstrate the gamma-ray polarization sensitivity of emulsion, we conducted a test using a polarized gamma-ray beam (0.8–2.4 GeV) at SPring-8/LEPS. Emulsion tracks were reconstructed using scanning data, and gamma-ray events were selected automatically. Using an optical microscope, out of the 2381 gamma-ray conversions that were observed, 1372 remained after event selection, on the azimuthal angle distribution of which we measured the modulation. From the distribution of the azimuthal angles of the selected events, a modulation factor of 0.21+0.11−0.09 was measured, from which the detection of a non-zero modulation was established with a significance of 3.06σ. This attractive polarimeter will be applied to the GRAINE project, a balloon-borne experiment that observes 10–100 GeV cosmic gamma-rays with an emulsion-based pair conversion telescope.

  18. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. 19-base pair deletion polymorphism of the dihydrofolate reductase (DHFR gene: maternal risk of Down syndrome and folate metabolism

    Directory of Open Access Journals (Sweden)

    Cristiani Cortez Mendes

    Full Text Available CONTEXT AND OBJECTIVE: Polymorphisms in genes involved in folate metabolism may modulate the maternal risk of Down syndrome (DS. This study evaluated the influence of a 19-base pair (bp deletion polymorphism in intron-1 of the dihydrofolate reductase (DHFR gene on the maternal risk of DS, and investigated the association between this polymorphism and variations in the concentrations of serum folate and plasma homocysteine (Hcy and plasma methylmalonic acid (MMA. DESIGN AND SETTING: Analytical cross-sectional study carried out at Faculdade de Medicina de São José do Rio Preto (Famerp. METHODS: 105 mothers of individuals with free trisomy of chromosome 21, and 184 control mothers were evaluated. Molecular analysis on the polymorphism was performed using the polymerase chain reaction (PCR through differences in the sizes of fragments. Folate was quantified by means of chemiluminescence, and Hcy and MMA by means of liquid chromatography and sequential mass spectrometry. RESULTS: There was no difference between the groups in relation to allele and genotype frequencies (P = 0.44; P = 0.69, respectively. The folate, Hcy and MMA concentrations did not differ significantly between the groups, in relation to genotypes (P > 0.05. CONCLUSIONS: The 19-bp deletion polymorphism of DHFR gene was not a maternal risk factor for DS and was not related to variations in the concentrations of serum folate and plasma Hcy and MMA in the study population.

  20. The –SH Protection Method for Determining Accurate Kd Values for Enzyme-Coenzyme Complexes of NAD+-Dependent Glutamate Dehydrogenase and Engineered Mutants: Evidence for Nonproductive NADPH Complexes

    Directory of Open Access Journals (Sweden)

    Joanna Griffin

    2010-01-01

    Full Text Available Inactivation rates have been measured for clostridial glutamate dehydrogenase and several engineered mutants at various DTNB concentrations. Analysis of rate constants allowed determination of Kd for each non-covalent enzyme-DTNB complex and the rate constant for reaction to form the inactive enzyme-thionitrobenzoate adduct. Both parameters are sensitive to the mutations F238S, P262S, the double mutation F238S/P262S, and D263K, all in the coenzyme binding site. Study of the effects of NAD+, NADH and NADPH at various concentrations in protecting against inactivation by 200 μM DTNB allowed determination of Kd values for binding of these coenzymes to each protein, yielding surprising results. The mutations were originally devised to lessen discrimination against the disfavoured coenzyme NADP(H, and activity measurements showed this was achieved. However, the Kd determinations indicated that, although Kd values for NAD+ and NADH were increased considerably, Kd for NADPH was increased even more than for NADH, so that discrimination against binding of NADPH was not decreased. This apparent contradiction can only be explained if NADPH has a nonproductive binding mode that is not weakened by the mutations, and a catalytically productive mode that, though strengthened, is masked by the nonproductive binding. Awareness of the latter is important in planning further mutagenesis.

  1. G.T wobble base-pairing in Z-DNA at 1.0 A atomic resolution: the crystal structure of d(CGCGTG).

    OpenAIRE

    Ho, P S; Frederick, C A; Quigley, G J; van der Marel, G A; van Boom, J H; Wang, A H; Rich, A

    1985-01-01

    The DNA oligomer d(CGCGTG) crystallizes as a Z-DNA double helix containing two guanine-thymine base pair mismatches of the wobble type. The crystal diffracts to 1 A resolution and the structure has been solved and refined. At this resolution, a large amount of information is revealed about the organization of the water molecules in the lattice generally and more specifically around the wobble base pairs. By comparing this structure with the analogous high resolution structure of d(CGCGCG) we ...

  2. Long-read ChIA-PET for base-pair-resolution mapping of haplotype-specific chromatin interactions.

    Science.gov (United States)

    Li, Xingwang; Luo, Oscar Junhong; Wang, Ping; Zheng, Meizhen; Wang, Danjuan; Piecuch, Emaly; Zhu, Jacqueline Jufen; Tian, Simon Zhongyuan; Tang, Zhonghui; Li, Guoliang; Ruan, Yijun

    2017-05-01

    Chromatin interaction analysis by paired-end tag sequencing (ChIA-PET) is a robust method for capturing genome-wide chromatin interactions. Unlike other 3C-based methods, it includes a chromatin immunoprecipitation (ChIP) step that enriches for interactions mediated by specific target proteins. This unique feature allows ChIA-PET to provide the functional specificity and higher resolution needed to detect chromatin interactions, which chromosome conformation capture (3C)/Hi-C approaches have not achieved. The original ChIA-PET protocol generates short paired-end tags (2 × 20 base pairs (bp)) to detect two genomic loci that are far apart on linear chromosomes but are in spatial proximity in the folded genome. We have improved the original approach by developing long-read ChIA-PET, in which the length of the paired-end tags is increased (up to 2 × 250 bp). The longer PET reads not only improve the tag-mapping efficiency but also increase the probability of covering phased single-nucleotide polymorphisms (SNPs), which allows haplotype-specific chromatin interactions to be identified. Here, we provide the detailed protocol for long-read ChIA-PET that includes cell fixation and lysis, chromatin fragmentation by sonication, ChIP, proximity ligation with a bridge linker, Tn5 tagmentation, PCR amplification and high-throughput sequencing. For a well-trained molecular biologist, it typically takes 6 d from cell harvesting to the completion of library construction, up to a further 36 h for DNA sequencing and <20 h for processing of raw sequencing reads.

  3. Mechanism of thermal renaturation and hybridization of nucleic acids: Kramers' process and universality in Watson-Crick base pairing.

    Science.gov (United States)

    Sikorav, Jean-Louis; Orland, Henri; Braslau, Alan

    2009-03-26

    Renaturation and hybridization reactions lead to the pairing of complementary single-stranded nucleic acids. We present here a theoretical investigation of the mechanism of these reactions in vitro under thermal conditions (dilute solutions of single-stranded chains, in the presence of molar concentrations of monovalent salts and at elevated temperatures). The mechanism follows a Kramers' process, whereby the complementary chains overcome a potential barrier through Brownian motion. The barrier originates from a single rate-limiting nucleation event in which the first complementary base pairs are formed. The reaction then proceeds through a fast growth of the double helix. For the DNA of bacteriophages T7, T4, and phiX174, as well as for Escherichia coli DNA, the bimolecular rate k2 of the reaction increases as a power law of the average degree of polymerization of the reacting single-strands: k2 is proportional to alpha. This relationship holds for 100 < or = 50,000 with an experimentally determined exponent alpha = 0.51 +/- 0.01. The length dependence results from a thermodynamic excluded-volume effect. The reacting single-stranded chains are predicted to be in universal good solvent conditions, and the scaling law is determined by the relevant equilibrium monomer contact probability. The value theoretically predicted for the exponent is alpha = 1 - nutheta2, where nu is Flory's swelling exponent (nu approximately equal 0.588), and theta2 is a critical exponent introduced by des Cloizeaux (theta2 approximately equal 0.82), yielding alpha = 0.52 +/- 0.01, in agreement with the experimental results.

  4. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

    Science.gov (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

    2017-10-06

    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.

    Science.gov (United States)

    Lee, Dong-Kye; Switzer, Christopher

    2016-02-15

    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. The influence of substituents and the environment on the NMR shielding constants of supramolecular complexes based on A-T and A-U base pairs

    NARCIS (Netherlands)

    Castro, Abril C.; Swart, Marcel; Guerra, Célia Fonseca

    2017-01-01

    In the present study, we have theoretically analyzed supramolecular complexes based on the Watson-Crick A-T and A-U base pairs using dispersion-corrected density functional theory (DFT). Hydrogen atoms H8 and/or H6 in the natural adenine and thymine/uracil bases were replaced, respectively, by

  7. Non-Watson-Crick base pairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E

    Czech Academy of Sciences Publication Activity Database

    Réblová, K.; Špačková, Naďa; Koča, J.; Leontis, N. B.; Šponer, Jiří

    2003-01-01

    Roč. 20, č. 6 (2003), s. 986 ISSN 0739-1102. [Albany 2003: Conversation 13. 17.06.2003-21.06.2003, Albany] Institutional research plan: CEZ:AV0Z5004920 Keywords : non- Watson -Crick base pairs * Loop E * RNA Subject RIV: BO - Biophysics

  8. The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

    2016-01-01

    Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  9. Structures, physicochemical properties, and applications of T-Hg-II-T, C-Ag-I-C, and other metallo-base-pairs

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.

    2015-01-01

    Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015

  10. Understanding the role of base stacking in nucleic acids. MD and QM analysis of tandem GA base pairs in RNA duplexes

    Czech Academy of Sciences Publication Activity Database

    Morgado, C.A.; Svozil, D.; Turner, D.H.; Šponer, Jiří

    2012-01-01

    Roč. 14, č. 36 (2012), s. 12580-12591 ISSN 1463-9076 R&D Projects: GA ČR(CZ) GBP305/12/G034 Institutional research plan: CEZ:AV0Z50040702 Keywords : GA base pairs * base stacking * RNA duplexes Subject RIV: BO - Biophysics Impact factor: 3.829, year: 2012

  11. Deficient incorporation of spike protein into virions contributes to the lack of infectivity following establishment of a persistent, non-productive infection in oligodendroglial cell culture by murine coronavirus

    International Nuclear Information System (INIS)

    Liu Yin; Herbst, Werner; Cao Jianzhong; Zhang Xuming

    2011-01-01

    Infection of mouse oligodendrocytes with a recombinant mouse hepatitis virus (MHV) expressing a green fluorescence protein facilitated specific selection of virus-infected cells and subsequent establishment of persistence. Interestingly, while viral genomic RNAs persisted in infected cells over 14 subsequent passages with concomitant synthesis of viral subgenomic mRNAs and structural proteins, no infectious virus was isolated beyond passage 2. Further biochemical and electron microscopic analyses revealed that virions, while assembled, contained little spike in the envelope, indicating that lack of infectivity during persistence was likely due to deficiency in spike incorporation. This type of non-lytic, non-productive persistence in oligodendrocytes is unique among animal viruses and resembles MHV persistence previously observed in the mouse central nervous system. Thus, establishment of such a culture system that can recapitulate the in vivo phenomenon will provide a powerful approach for elucidating the mechanisms of coronavirus persistence in glial cells at the cellular and molecular levels.

  12. Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

    Science.gov (United States)

    Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

    2012-09-12

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

  13. Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

    Science.gov (United States)

    Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

    2012-01-01

    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

  14. The base-pairing RNA spot 42 participates in a multioutput feedforward loop to help enact catabolite repression in Escherichia coli.

    Science.gov (United States)

    Beisel, Chase L; Storz, Gisela

    2011-02-04

    Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base-pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse nonpreferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multioutput feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base-pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair.

    Science.gov (United States)

    Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

    2017-05-01

    Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  16. On the role of the cis Hoogsteen:sugar-edge family of base pairs in platforms and triplets-quantum chemical insights into RNA structural biology

    Czech Academy of Sciences Publication Activity Database

    Sharma, P.; Šponer, Judit E.; Šponer, Jiří; Sharma, S.; Bhattacharyya, D.; Mitra, A.

    2010-01-01

    Roč. 114, č. 9 (2010), s. 3307-3320 ISSN 1520-6106 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairs * cis Hoogsteen/Sugar edge Subject RIV: BO - Biophysics Impact factor: 3.603, year: 2010

  17. Systematic exploration of a class of hydrophobic unnatural base pairs yields multiple new candidates for the expansion of the genetic alphabet

    Czech Academy of Sciences Publication Activity Database

    Dhami, K.; Malyshev, D. A.; Ordoukhanian, P.; Kubelka, Tomáš; Hocek, Michal; Romesberg, F. E.

    2014-01-01

    Roč. 42, č. 16 (2014), s. 10235-10244 ISSN 0305-1048 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : unnatural base pairs * DNA * dTPT3-dNaM Subject RIV: CE - Biochemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/16/10235

  18. DNA recognition by the SwaI restriction endonuclease involves unusual distortion of an 8 base pair A:T-rich target.

    Science.gov (United States)

    Shen, Betty W; Heiter, Daniel F; Lunnen, Keith D; Wilson, Geoffrey G; Stoddard, Barry L

    2017-02-17

    R.SwaI, a Type IIP restriction endonuclease, recognizes a palindromic eight base pair (bp) symmetric sequence, 5΄-ATTTAAAT-3΄, and cleaves that target at its center to generate blunt-ended DNA fragments. Here, we report three crystal structures of SwaI: unbound enzyme, a DNA-bound complex with calcium ions; and a DNA-bound, fully cleaved complex with magnesium ions. We compare these structures to two structurally similar ‘PD-D/ExK’ restriction endonucleases (EcoRV and HincII) that also generate blunt-ended products, and to a structurally distinct enzyme (the HNH endonuclease PacI) that also recognizes an 8-bp target site consisting solely of A:T base pairs. Binding by SwaI induces an extreme bend in the target sequence accompanied by un-pairing and re-ordering of its central A:T base pairs. This result is reminiscent of a more dramatic target deformation previously described for PacI, implying that long A:T-rich target sites might display structural or dynamic behaviors that play a significant role in endonuclease recognition and cleavage.

  19. Theoretical study on absorption and emission spectra of size-expanded Janus-type AT nucleobases and effect of base pairing.

    Science.gov (United States)

    Liu, Hongxia; Song, Qixia; Liu, Jianhua; Li, Yan; Wang, Haijun

    2014-01-01

    Fluorescent nucleoside analogues have attracted much attention in studying the structure and dynamics of nucleic acids in recent years. In the present work, we design benzo- and naphtha-expanded Janus AT base analogues, using DFT, TDDFT, and CIS methods to investigate the structural and optical properties of the Janus AT base analogues (termed as J-AT, xJ-AT, yyJ-AT, BF, xBF and yyBF), and also consider the effect of base pairing. The results show that the Janus AT base analogues can pair with T and A simultaneously to form stable H-bonded WC base pairs. The ground state structure of J-AT is similar to BF, the size expansion is 2.42Å for the x-Janus AT bases and 4.86Å for the yy-Janus AT bases. The excited state geometries of J-AT and BF change dramatically, while the other bases are similar to the ground state geometries. The lowest excited singlet transitions of the Janus AT base analogues are predicted to be of ππ(*) character and mainly dominated by the configuration HOMO-LUMO. The maximum absorption wavelengths of size expansion Janus AT base analogues are greatly red shifted compared with J-AT (or BF). BF, xBF and yyJ-AT have larger oscillator strengths than J-AT, xJ-AT and yyBF. The emission wavelengths of the Janus AT base analogues also exhibit red shifts from x-Janus AT bases to yy-Janus AT bases. However, the emission wavelengths of J-AT and BF change greatly, which are coincident with the structures observed in the excited state geometries. With regard to the WC base pairs, the B3LYP functional reveals that the lowest energy transitions of some base pairs are charge transfer excitation, while the other base pairs are local excitation. The CAM-B3LYP functional predicts that all the lowest transitions are localized on the Janus AT bases, and show good agreement with the results of the M062X functional. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Key Roles of Lewis Acid-base Pairs on ZnxZryOz in Direct Ethanol/Acetone to Isobutene Conversion

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Junming; Baylon, Rebecca A.; Liu, Changjun; Mei, Donghai; Martin, Kevin J.; Venkitasubramanian, Padmesh; Wang, Yong

    2016-01-20

    The effects of surface acidity on the cascade ethanol-to-isobutene conversion were studied using ZnxZryOz catalysts. The ethanol-to-isobutene reaction was found to be limited by the secondary reaction of the key intermediate, acetone, namely the acetone-to-isobutene reaction. Although the catalysts with coexisting Brønsted acidity could catalyze the rate-limiting acetone-to-isobutene reaction, the presence of Brønsted acidity is also detrimental. First, secondary isobutene isomerization is favored, producing a mixture of butene isomers. Second, undesired polymerization and coke formation prevail, leading to rapid catalyst deactivation. Most importantly, both steady-state and kinetic reaction studies as well as FTIR analysis of adsorbed acetone-d6 and D2O unambiguously showed that a highly active and selective nature of balanced Lewis acid-base pairs was masked by the coexisting Brønsted acidity in the aldolization and self-deoxygenation of acetone to isobutene. As a result, ZnxZryOz catalysts with only Lewis acid-base pairs were discovered, on which nearly a theoretical selectivity to isobutene (~88.9%) was successfully achieved, which has never been reported before. Moreover, the absence of Brønsted acidity in such ZnxZryOz catalysts also eliminates the side isobutene isomerization and undesired polymerization/coke reactions, resulting in the production of high purity isobutene with significantly improved catalyst stability (< 2% activity loss after 200 h time-on-stream). This work not only demonstrates a balanced Lewis acid-base pair for the highly active and selective cascade ethanol-to-isobutene reaction, but also sheds light on the rational design of selective and robust acid-base catalyst for C-C coupling via aldolization reaction.

  1. Gemcitabine, Pyrrologemcitabine, and 2'-Fluoro-2'-Deoxycytidines: Synthesis, Physical Properties, and Impact of Sugar Fluorination on Silver Ion Mediated Base Pairing.

    Science.gov (United States)

    Guo, Xiurong; Leonard, Peter; Ingale, Sachin A; Seela, Frank

    2017-12-14

    The stability of silver-mediated "dC-dC" base pairs relies not only on the structure of the nucleobase, but is also sensitive to structural modification of the sugar moiety. 2'-Fluorinated 2'-deoxycytidines with fluorine atoms in the arabino (up) and ribo (down) configuration as well as with geminal fluorine substitution (anticancer drug gemcitabine) and the novel fluorescent phenylpyrrolo-gemcitabine ( ph PyrGem) have been synthesized. All the nucleosides display the recognition face of naturally occurring 2'-deoxycytidine. The nucleosides were converted into phosphoramidites and incorporated into 12-mer oligonucleotides by solid-phase synthesis. The addition of silver ions to DNA duplexes with a fluorine-modified "dC-dC" pair near the central position led to significant duplex stabilization. The increase in stability was higher for duplexes with fluorinated sugar residues than for those with an unchanged 2'-deoxyribose moiety. Similar observations were made for "dC-dT" pairs and to a minor extent for "dC-dA" pairs. The increase in silver ion mediated base-pair stability was reversed by annulation of a pyrrole ring to the cytosine moiety, as shown for 2'-fluorinated ph PyrGem in comparison with phenylpyrrolo-dC ( ph PyrdC). This phenomenon results from stereoelectronic effects induced by fluoro substitution, which are transmitted from the sugar moiety to the silver ion mediated base pairs. The extent of the effect depends on the number of fluorine substituents, their configuration, and the structure of the nucleobase. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

    Science.gov (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

    2017-03-29

    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  3. Pms2 and uracil-DNA glycosylases act jointly in the mismatch repair pathway to generate Ig gene mutations at A-T base pairs.

    Science.gov (United States)

    Girelli Zubani, Giulia; Zivojnovic, Marija; De Smet, Annie; Albagli-Curiel, Olivier; Huetz, François; Weill, Jean-Claude; Reynaud, Claude-Agnès; Storck, Sébastien

    2017-04-03

    During somatic hypermutation (SHM) of immunoglobulin genes, uracils introduced by activation-induced cytidine deaminase are processed by uracil-DNA glycosylase (UNG) and mismatch repair (MMR) pathways to generate mutations at G-C and A-T base pairs, respectively. Paradoxically, the MMR-nicking complex Pms2/Mlh1 is apparently dispensable for A-T mutagenesis. Thus, how detection of U:G mismatches is translated into the single-strand nick required for error-prone synthesis is an open question. One model proposed that UNG could cooperate with MMR by excising a second uracil in the vicinity of the U:G mismatch, but it failed to explain the low impact of UNG inactivation on A-T mutagenesis. In this study, we show that uracils generated in the G1 phase in B cells can generate equal proportions of A-T and G-C mutations, which suggests that UNG and MMR can operate within the same time frame during SHM. Furthermore, we show that Ung -/- Pms2 -/- mice display a 50% reduction in mutations at A-T base pairs and that most remaining mutations at A-T bases depend on two additional uracil glycosylases, thymine-DNA glycosylase and SMUG1. These results demonstrate that Pms2/Mlh1 and multiple uracil glycosylases act jointly, each one with a distinct strand bias, to enlarge the immunoglobulin gene mutation spectrum from G-C to A-T bases. © 2017 Girelli Zubani et al.

  4. Key Roles of Lewis Acid-Base Pairs on ZnxZryOz in Direct Ethanol/Acetone to Isobutene Conversion.

    Science.gov (United States)

    Sun, Junming; Baylon, Rebecca A L; Liu, Changjun; Mei, Donghai; Martin, Kevin J; Venkitasubramanian, Padmesh; Wang, Yong

    2016-01-20

    The effects of surface acidity on the cascade ethanol-to-isobutene conversion were studied using ZnxZryOz catalysts. The ethanol-to-isobutene reaction was found to be limited by the secondary reaction of the key intermediate, acetone, namely the acetone-to-isobutene reaction. Although the catalysts with coexisting Brønsted acidity could catalyze the rate-limiting acetone-to-isobutene reaction, the presence of Brønsted acidity is also detrimental. First, secondary isobutene isomerization is favored, producing a mixture of butene isomers. Second, undesired polymerization and coke formation prevail, leading to rapid catalyst deactivation. Most importantly, both steady-state and kinetic reaction studies as well as FTIR analysis of adsorbed acetone-d6 and D2O unambiguously showed that a highly active and selective nature of balanced Lewis acid-base pairs was masked by the coexisting Brønsted acidity in the aldolization and self-deoxygenation of acetone to isobutene. As a result, ZnxZryOz catalysts with only Lewis acid-base pairs were discovered, on which nearly a theoretical selectivity to isobutene (∼ 88.9%) was successfully achieved, which has never been reported before. Moreover, the absence of Brønsted acidity in such ZnxZryOz catalysts also eliminates the side isobutene isomerization and undesired polymerization/coke reactions, resulting in the production of high purity isobutene with significantly improved catalyst stability (catalyst for C-C coupling via aldolization reaction.

  5. A single base pair in the right terminal domain of tomato planta macho viroid is a virulence determinant factor on tomato.

    Science.gov (United States)

    Li, Rugang; Padmanabhan, Chellappan; Ling, Kai-Shu

    2017-01-01

    Tomato planta macho viroid (TPMVd), including isolates previously designated as Mexican papita viroid (MPVd), causes serious disease on tomatoes in North America. Two predominant variants, sharing 93.8% sequence identity, incited distinct severe (MPVd-S) or mild (MPVd-M) symptoms on tomato. To identify virulence determinant factor, a series of chimeric infectious clones were generated using synthetic DNA approach to progressively replace each structural domain between the two variants. In bioassays on tomato 'Rutgers', three chimeras containing Terminal Left and Pathogenicity (MPVd-H1), Central (MPVd-H2), or Variable (MPVd-H3) of MPVd-S, incited mild to intermediate symptoms. However, a chimera containing Terminal Right (T R ) of MPVd-S (MPVd-H4) incited severe symptoms. Only one base-pair mutation in the T R domain between MPVd-M ( 176 U:A 185 ) and MPVd-S ( 174 G:C 183 ) was identified. A reciprocal mutant (MPVd-H5) rendered the chimeric viroid mild on tomato. This single base-pair in the T R domain was determined as the virulence determinant factor for TPMVd. Published by Elsevier Inc.

  6. Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

    KAUST Repository

    Basset, Jean-Marie

    2016-06-09

    The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

  7. Physical mapping of a 330 X 10(3)-base-pair region of the Myxococcus xanthus chromosome that is preferentially labeled during spore germination

    International Nuclear Information System (INIS)

    Komano, T.; Inouye, S.; Inouye, M.

    1985-01-01

    Myxococcus xanthus was pulse-labeled with [ 3 H]thymidine immediately after germination of dimethyl sulfoxide-induced spores. The restriction enzyme digests of the total chromosomal DNA from the pulse- labeled cells were analyzed by one-dimensional as well as two- dimensional agarose gel electrophoresis. Four PstI fragments preferentially labeled at a very early stage of germination were cloned into the unique PstI site of pBR322. By using these clones as probes, a restriction enzyme map was established covering approximately 6% of the total M. xanthus genome (330 X 10(3) base pairs). The distribution of the specific activities of the restriction fragments pulse-labeled after germination suggests a bidirectional mode of DNA replication from a fixed origin

  8. Novel single base-pair deletion in exon 1 of XK gene leading to McLeod syndrome with chorea, muscle wasting, peripheral neuropathy, acanthocytosis and haemolysis.

    Science.gov (United States)

    Wiethoff, Sarah; Xiromerisiou, Georgia; Bettencourt, Conceição; Kioumi, Anna; Tsiptsios, Iakovos; Tychalas, Athanasios; Evaggelia, Markousi; George, Kaltsounis; Makris, Vasileios; Hardy, John; Houlden, Henry

    2014-04-15

    We present a 70-year-old male patient of Greek origin with choreatic movements of the tongue and face, lower limb muscle weakness, peripheral neuropathy, elevated creatinephosphokinase (CPK), acanthocytosis and haemolysis in the absence of Kell RBC antigens with an additional Factor IX-deficiency. Genetic testing for mutations in the three exons of the XK gene revealed a previously unreported hemizygous single base-pair frameshift deletion at exon 1 (c.229delC, p.Leu80fs). In conclusion, we hereby describe a rare phenotype of a patient with McLeod syndrome which was discovered coincidentally during routine blood group testing and consecutively genetically confirmed. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  9. Interactions between Al₁₂X (X = Al, C, N and P) nanoparticles and DNA nucleobases/base pairs: implications for nanotoxicity.

    Science.gov (United States)

    Jin, Peng; Chen, Yongsheng; Zhang, Shengbai B; Chen, Zhongfang

    2012-02-01

    The interactions between neutral Al(12)X(I ( h )) (X = Al, C, N and P) nanoparticles and DNA nucleobases, namely adenine (A), thymine (T), guanine (G) and cytosine (C), as well as the Watson-Crick base pairs (BPs) AT and GC, were investigated by means of density functional theory computations. The Al(12)X clusters can tightly bind to DNA bases and BPs to form stable complexes with negative binding Gibbs free energies at room temperature, and considerable charge transfers occur between the bases/BPs and the Al(12)X clusters. These strong interactions, which are also expected for larger Al nanoparticles, may have potentially adverse impacts on the structure and stability of DNA and thus cause its dysfunction.

  10. Multicomponent Molecular Puzzles for Photofunction Design: Emission Color Variation in Lewis Acid-Base Pair Crystals Coupled with Guest-to-Host Charge Transfer Excitation.

    Science.gov (United States)

    Ono, Toshikazu; Sugimoto, Manabu; Hisaeda, Yoshio

    2015-08-05

    Simple yet ubiquitous multimolecular assembly systems with color-tunable emissions are realized by cooperative electron donor-acceptor interactions, such as the boron-nitrogen (B-N) dative bond as a Lewis acid-base pair and charge transfer (CT) interactions. These are ternary-component systems consisting of a naphthalenediimide derivative (NDI), tris(pentafluorophenyl)borane (TPFB), and aromatic molecules (guest) with an NDI:TPFB:guest ratio of 1:2:2. The crystal shows guest-dependent color-tunable emissions such as deep blue to orange when a guest molecule of benzene is replaced with other π-conjugated systems. A good correlation between the emission wavelength and ionization potential of the guest and electronic structure calculations indicated that the emission is due to the CT transition from the guest to the NDI. The present study suggests that a rational solution of multcomponent molecular puzzles would be useful for obtaining novel photofunctional solid-state systems.

  11. 5-Methylation of Cytosine in CG:CG Base-Pair Steps: A Physicochemical Mechanism for the Epigenetic Control of DNA Nanomechanics

    Science.gov (United States)

    Yusufaly, Tahir; Olson, Wilma; Li, Yun

    2014-03-01

    Van der Waals density functional theory is integrated with analysis of a non-redundant set of protein-DNA crystal structures from the Nucleic Acid Database to study the stacking energetics of CG:CG base-pair steps, specifically the role of cytosine 5-methylation. Principal component analysis of the steps reveals the dominant collective motions to correspond to a tensile ``opening'' mode and two shear ``sliding'' and ``tearing'' modes in the orthogonal plane. The stacking interactions of the methyl groups are observed to globally inhibit CG:CG step overtwisting while simultaneously softening the modes locally via potential energy modulations that create metastable states. The results have implications for the epigenetic control of DNA mechanics.

  12. The Political Dimensions of Nonproduct Advertising.

    Science.gov (United States)

    Meadow, Robert G.

    1981-01-01

    Develops a typology of corporate advocacy advertising and examines why corporations have begun to present their political perspective directly to mass audiences. Categorizes corporate advocacy ads as public interest, participation, patriotic, free enterprise, controversy, equal time, image, informative, advertorial, and recruitment. (PD)

  13. Theoretical study on the structure, stability, and electronic properties of the guanine-Zn-cytosine base pair in M-DNA

    International Nuclear Information System (INIS)

    Fuentes-Cabrera, Miguel A.; Sumpter, Bobby G.; Sponer, Judit; Sponer, Jiri; Petit, Leon; Wells, Jack C.

    2007-01-01

    M-DNA is a type of metalated DNA that forms at high pH and in the presence of Zn, Ni, and Co, with the metals placed in between each base pair, as in G-Zn-C. Experiments have found that M-DNA could be a promising candidate for a variety of nanotechnological applications, as it is speculated that the metal d-states enhance the conductivity, but controversy still clouds these findings. In this paper, we carry out a comprehensive ab initio study of eight G-Zn-C models in the gas phase to help discern the structure and electronic properties of Zn-DNA. Specifically, we study whether a model prefers to be planar and has electronic properties that correlate with Zn-DNA having a metallic-like conductivity. Out of all the studied models, there is only one which preserves its planarity upon full geometry optimization. Nevertheless, starting from this model, one can deduce a parallel Zn-DNA architecture only. This duplex would contain the imino proton, in contrast to what has been proposed experimentally. Among the nonplanar models, there is one that requires less than 8 kcal/mol to flatten (both in gas and solvent conditions), and we propose that it is a plausible model for building an antiparallel duplex. In this duplex, the imino proton would be replaced by Zn, in accordance with experimental models. Neither planar nor nonplanar models have electronic properties that correlate with Zn-DNA having a metallic-like conductivity due to Zn d-states. To understand whether density functional theory (DFT) can describe appropriately the electronic properties of M-DNAs, we have investigated the electronic properties of G-Co-C base pairs. We have found that when self-interaction corrections (SIC) are not included the HOMO state contains Co d-levels, whereas these levels are moved below the HOMO state when SIC are considered. This result indicates that caution should be exercised when studying the electronic properties of M-DNAs with functionals that do not account for strong

  14. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    Energy Technology Data Exchange (ETDEWEB)

    Bricault, Christine A. [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States); Perry, Keith L., E-mail: KLP3@cornell.edu [Department of Plant Pathology and Plant-Microbe Biology, 334 Plant Science Building, Cornell University, Ithaca, NY 14850 (United States)

    2013-06-05

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility.

  15. Alteration of intersubunit acid–base pair interactions at the quasi-threefold axis of symmetry of Cucumber mosaic virus disrupts aphid vector transmission

    International Nuclear Information System (INIS)

    Bricault, Christine A.; Perry, Keith L.

    2013-01-01

    In the atomic model of Cucumber mosaic virus (CMV), six amino acid residues form stabilizing salt bridges between subunits of the asymmetric unit at the quasi-threefold axis of symmetry. To evaluate the effects of these positions on virion stability and aphid vector transmissibility, six charged amino acid residues were individually mutated to alanine. All of the six engineered viruses were viable and exhibited near wild type levels of virion stability in the presence of urea. Aphid vector transmissibility was nearly or completely eliminated in the case of four of the mutants; two mutants demonstrated intermediate aphid transmissibility. For the majority of the engineered mutants, second-site mutations were observed following aphid transmission and/or mechanical passaging, and one restored transmission rates to that of the wild type. CMV capsids tolerate disruption of acid–base pairing interactions at the quasi-threefold axis of symmetry, but these interactions are essential for maintaining aphid vector transmissibility. - Highlights: ► Amino acids between structural subunits of Cucumber mosaic virus affect vector transmission. ► Mutant structural stability was retained, while aphid vector transmissibility was disrupted. ► Spontaneous, second-site mutations restored aphid vector transmissibility

  16. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

    Science.gov (United States)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

    2014-09-01

    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology.

  17. Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

    2012-01-01

    P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

  18. Base Pairing Interaction between 5′- and 3′-UTRs Controls icaR mRNA Translation in Staphylococcus aureus

    Science.gov (United States)

    Ruiz de los Mozos, Igor; Vergara-Irigaray, Marta; Segura, Victor; Villanueva, Maite; Bitarte, Nerea; Saramago, Margarida; Domingues, Susana; Arraiano, Cecilia M.; Fechter, Pierre; Romby, Pascale; Valle, Jaione; Solano, Cristina; Lasa, Iñigo; Toledo-Arana, Alejandro

    2013-01-01

    The presence of regulatory sequences in the 3′ untranslated region (3′-UTR) of eukaryotic mRNAs controlling RNA stability and translation efficiency is widely recognized. In contrast, the relevance of 3′-UTRs in bacterial mRNA functionality has been disregarded. Here, we report evidences showing that around one-third of the mapped mRNAs of the major human pathogen Staphylococcus aureus carry 3′-UTRs longer than 100-nt and thus, potential regulatory functions. We selected the long 3′-UTR of icaR, which codes for the repressor of the main exopolysaccharidic compound of the S. aureus biofilm matrix, to evaluate the role that 3′-UTRs may play in controlling mRNA expression. We showed that base pairing between the 3′-UTR and the Shine-Dalgarno (SD) region of icaR mRNA interferes with the translation initiation complex and generates a double-stranded substrate for RNase III. Deletion or substitution of the motif (UCCCCUG) within icaR 3′-UTR was sufficient to abolish this interaction and resulted in the accumulation of IcaR repressor and inhibition of biofilm development. Our findings provide a singular example of a new potential post-transcriptional regulatory mechanism to modulate bacterial gene expression through the interaction of a 3′-UTR with the 5′-UTR of the same mRNA. PMID:24367275

  19. A single base-pair change in 2009 H1N1 hemagglutinin increases human receptor affinity and leads to efficient airborne viral transmission in ferrets.

    Directory of Open Access Journals (Sweden)

    Akila Jayaraman

    2011-03-01

    Full Text Available The 2009 H1N1 influenza A virus continues to circulate among the human population as the predominant H1N1 subtype. Epidemiological studies and airborne transmission studies using the ferret model have shown that the transmission efficiency of 2009 H1N1 viruses is lower than that of previous seasonal strains and the 1918 pandemic H1N1 strain. We recently correlated this reduced transmission efficiency to the lower binding affinity of the 2009 H1N1 hemagglutinin (HA to α2→6 sialylated glycan receptors (human receptors. Here we report that a single point mutation (Ile219→Lys; a base pair change in the glycan receptor-binding site (RBS of a representative 2009 H1N1 influenza A virus, A/California/04/09 or CA04/09, quantitatively increases its human receptor-binding affinity. The increased human receptor-affinity is in the same range as that of the HA from highly transmissible seasonal and 1918 pandemic H1N1 viruses. Moreover, a 2009 H1N1 virus carrying this mutation in the RBS (generated using reverse genetics transmits efficiently in ferrets by respiratory droplets thereby reestablishing our previously observed correlation between human receptor-binding affinity and transmission efficiency. These findings are significant in the context of monitoring the evolution of the currently circulating 2009 H1N1 viruses.

  20. Solution structure of the DNA decamer duplex containing a 3′-T·T base pair of the cis–syn cyclobutane pyrimidine dimer: implication for the mutagenic property of the cis–syn dimer

    OpenAIRE

    Lee, Joon-Hwa; Choi, Yun-Jeong; Choi, Byong-Seok

    2000-01-01

    The cis–syn dimer is the major DNA photoproduct produced by UV irradiation. In order to determine the origin of the mutagenic property of the cis–syn dimer, we used NMR restraints and molecular dynamics to determine the solution structure of a DNA decamer duplex containing a wobble pair between the 3′-T of the cis–syn dimer and the opposite T residue (CS/TA duplex). The solution structure of the CS/TA duplex revealed that the 3′-T·T base pair of the cis–syn dimer had base pair geometry that w...

  1. Analysis and Simulation of the Simplified Aircraft-Based Paired Approach Concept With the ALAS Alerting Algorithm in Conjunction With Echelon and Offset Strategies

    Science.gov (United States)

    Torres-Pomales, Wilfredo; Madden, Michael M.; Butler, Rickey W.; Perry, Raleigh B.

    2014-01-01

    This report presents analytical and simulation results of an investigation into proposed operational concepts for closely spaced parallel runways, including the Simplified Aircraft-based Paired Approach (SAPA) with alerting and an escape maneuver, MITRE?s echelon spacing and no escape maneuver, and a hybrid concept aimed at lowering the visibility minima. We found that the SAPA procedure can be used at 950 ft separations or higher with next-generation avionics and that 1150 ft separations or higher is feasible with current-rule compliant ADS-B OUT. An additional 50 ft reduction in runway separation for the SAPA procedure is possible if different glideslopes are used. For the echelon concept we determined that current generation aircraft cannot conduct paired approaches on parallel paths using echelon spacing on runways less than 1400 ft apart and next-generation aircraft will not be able to conduct paired approach on runways less than 1050 ft apart. The hybrid concept added alerting and an escape maneuver starting 1 NM from the threshold when flying the echelon concept. This combination was found to be effective, but the probability of a collision can be seriously impacted if the turn component of the escape maneuver has to be disengaged near the ground (e.g. 300 ft or below) due to airport buildings and surrounding terrain. We also found that stabilizing the approach path in the straight-in segment was only possible if the merge point was at least 1.5 to 2 NM from the threshold unless the total system error can be sufficiently constrained on the offset path and final turn.

  2. A one base pair deletion in the canine ATP13A2 gene causes exon skipping and late-onset neuronal ceroid lipofuscinosis in the Tibetan terrier.

    Directory of Open Access Journals (Sweden)

    Anne Wöhlke

    2011-10-01

    Full Text Available Neuronal ceroid lipofuscinosis (NCL is a progressive neurodegenerative disease characterized by brain and retinal atrophy and the intracellular accumulation of autofluorescent lysosomal storage bodies resembling lipofuscin in neurons and other cells. Tibetan terriers show a late-onset lethal form of NCL manifesting first visible signs at 5-7 years of age. Genome-wide association analyses for 12 Tibetan-terrier-NCL-cases and 7 Tibetan-terrier controls using the 127K canine Affymetrix SNP chip and mixed model analysis mapped NCL to dog chromosome (CFA 2 at 83.71-84.72 Mb. Multipoint linkage and association analyses in 376 Tibetan terriers confirmed this genomic region on CFA2. A mutation analysis for 14 positional candidate genes in two NCL-cases and one control revealed a strongly associated single nucleotide polymorphism (SNP in the MAPK PM20/PM21 gene and a perfectly with NCL associated single base pair deletion (c.1620delG within exon 16 of the ATP13A2 gene. The c.1620delG mutation in ATP13A2 causes skipping of exon 16 presumably due to a broken exonic splicing enhancer motif. As a result of this mutation, ATP13A2 lacks 69 amino acids. All known 24 NCL cases were homozygous for this deletion and all obligate 35 NCL-carriers were heterozygous. In a sample of 144 dogs from eleven other breeds, the c.1620delG mutation could not be found. Knowledge of the causative mutation for late-onset NCL in Tibetan terrier allows genetic testing of these dogs to avoid matings of carrier animals. ATP13A2 mutations have been described in familial Parkinson syndrome (PARK9. Tibetan terriers with these mutations provide a valuable model for a PARK9-linked disease and possibly for manganese toxicity in synucleinopathies.

  3. Treating sub-valence correlation effects in domain based pair natural orbital coupled cluster calculations: an out-of-the-box approach

    KAUST Repository

    Bistoni, Giovanni

    2017-06-12

    The validity of the main approximations used in canonical and domain based pair natural orbital coupled cluster methods (CCSD(T) and DLPNO-CCSD(T), respectively) in standard chemical applications is discussed. In particular, we investigate the dependence of the results on the number of electrons included in the correlation treatment in frozen-core (FC) calculations and on the main threshold governing the accuracy of DLPNO all-electron (AE) calculations. Initially, scalar relativistic orbital energies for the ground state of the atoms from Li to Rn in the periodic table are calculated. An energy criterion is applied for determining the orbitals that can be excluded from the correlation treatment in FC coupled cluster calculations without significant loss of accuracy. The heterolytic dissociation energy (HDE) of a series of metal compounds (LiF, NaF, AlF3, CaF2, CuF, GaF3, YF3, AgF, InF3, HfF4 and AuF) is calculated at the canonical CCSD(T) level, and the dependence of the results on the number of correlated electrons is investigated. Although for many of the studied reactions sub-valence correlation effects contribute significantly to the HDE, the use of an energy criterion permits a conservative definition of the size of the core, allowing FC calculations to be performed in a black-box fashion while retaining chemical accuracy. A comparison of the CCSD and the DLPNO-CCSD methods in describing the core-core, core-valence and valence-valence components of the correlation energy is given. It is found that more conservative thresholds must be used for electron pairs containing at least one core electron in order to achieve high accuracy in AE DLPNO-CCSD calculations relative to FC calculations. With the new settings, the DLPNO-CCSD method reproduces canonical CCSD results in both AE and FC calculations with the same accuracy.

  4. A novel mechanism of high-level, broad-spectrum antibiotic resistance caused by a single base pair change in Neisseria gonorrhoeae.

    Science.gov (United States)

    Ohneck, Elizabeth A; Zalucki, Yaramah M; Johnson, Paul J T; Dhulipala, Vijaya; Golparian, Daniel; Unemo, Magnus; Jerse, Ann E; Shafer, William M

    2011-01-01

    aid in the development of new antimicrobial therapies and genetic methods for antimicrobial resistance testing. This study was undertaken to characterize a novel mechanism of antibiotic resistance regulation in N. gonorrhoeae. Here we show that a single base pair mutation generates a second, stronger promoter for mtrCDE transcription that acts independently of the known efflux system regulators and results in high-level antimicrobial resistance.

  5. Evidence for Hoogsteen GC Base Pairs in the Proton-Induced Transition from Right-Handed to Left-Handed Poly(dG-dC) . Poly(dG-dC)

    NARCIS (Netherlands)

    Segers-Nolten, Gezina M.J.; Sijtsema, N.M.; Otto, Cornelis

    1997-01-01

    The structure of double-helical poly(dG-dC)·poly(dG-dC) is investigated at various pH values with Raman spectroscopy, absorption spectroscopy, and circular dichroism. A comparison is made between the B-form with Watson−Crick base pairing at 1 mM [Na+] and pH 7.2, the Z-form with Watson−Crick base

  6. A Conformational Shift in the Dissociated Cholera Toxin A1 Subunit Prevents Reassembly of the Cholera Holotoxin

    Directory of Open Access Journals (Sweden)

    Michael Taylor

    2015-07-01

    Full Text Available Cholera toxin (CT consists of a catalytic A1 subunit, an A2 linker, and a homopentameric cell-binding B subunit. The intact holotoxin moves by vesicle carriers from the cell surface to the endoplasmic reticulum (ER where CTA1 is released from the rest of the toxin. The dissociated CTA1 subunit then shifts to an unfolded conformation, which triggers its export to the cytosol by a process involving the quality control system of ER-associated degradation (ERAD. We hypothesized that the unfolding of dissociated CTA1 would prevent its non-productive reassociation with CTA2/CTB5. To test this prediction, we monitored the real-time reassociation of CTA1 with CTA2/CTB5 by surface plasmon resonance. Folded but not disordered CTA1 could interact with CTA2/CTB5 to form a stable, functional holotoxin. Our data, thus, identified another role for the intrinsic instability of the isolated CTA1 polypeptide in host-toxin interactions: in addition to activating the ERAD translocation mechanism, the spontaneous unfolding of free CTA1 at 37 °C prevents the non-productive reassembly of a CT holotoxin in the ER.

  7. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

    1988-01-01

    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  8. The influence of N-7 guanine modifications on the strength of Watson-Crick base pairing and guanine N-1 acidity: Comparison of gas-phase and condensed-phase trends

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.

    2003-01-01

    Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson -Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003

  9. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Recent developments in the DOE Waste Minimization Pollution Prevention Program

    International Nuclear Information System (INIS)

    Hancock, J.K.

    1993-01-01

    The U.S. Department of Energy (DOE) is involved in a wide variety of research and development, remediation, and production activities at more than 100 sites throughout the United States. The wastes generated cover a diverse spectrum of sanitary, hazardous, and radioactive waste streams, including typical office environments, power generation facilities, laboratories, remediation sites, production facilities, and defense facilities. The DOE's initial waste minimization activities pre-date the Pollution Prevention Act of 1990 and focused on the defense program. Little emphasis was placed on nonproduction activities. In 1991 the Office of Waste Management Operations developed the Waste Minimization Division with the intention of coordinating and expanding the waste minimization pollution prevention approach to the entire complex. The diverse nature of DOE activities has led to several unique problems in addressing the needs of waste minimization and pollution prevention. The first problem is developing a program that addresses the geographical and institutional hurdles that exist; the second is developing a monitoring and reporting mechanism that one can use to assess the overall performance of the program

  11. Choking Prevention

    Science.gov (United States)

    ... Healthy Living Healthy Living Healthy Living Nutrition Fitness Sports Oral Health Emotional Wellness Growing Healthy Sleep Safety & Prevention Safety & Prevention Safety and Prevention Immunizations At Home ...

  12. FT-IR and FT-Raman spectra of 5-chlorocytosine: Solid state simulation and tautomerism. Effect of the chlorine substitution in the Watson-Crick base pair 5-chlorodeoxycytidine-deoxyguanosine

    Science.gov (United States)

    Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.

    2018-01-01

    The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.

  13. Kinetics for exchange of imino protons in the d(C-G-C-G-A-A-T-T-C-G-C-G) double helix and in two similar helices that contain a G . T base pair, d(C-G-T-G-A-A-T-T-C-G-C-G), and an extra adenine, d(C-G-C-A-G-A-A-T-T-C-G-C-G).

    Science.gov (United States)

    Pardi, A; Morden, K M; Patel, D J; Tinoco, I

    1982-12-07

    The relaxation lifetimes of imino protons from individual base pairs were measured in (I) a perfect helix, d(C-G-C-G-A-A-T-T-C-G-C-G), (II) this helix with a G . C base pair replaced with a G . T base pair, d(C-G-T-G-A-A-T-T-C-G-C-G), and (III) the perfect helix with an extra adenine base in a mismatch, d(C-G-C-A-G-A-A-T-T-C-G-C-G). The lifetimes were measured by saturation recovery proton nuclear magnetic resonance experiments performed on the imino protons of these duplexes. The measured lifetimes of the imino protons were shown to correspond to chemical exchange lifetimes at higher temperatures and spin-lattice relaxation times at lower temperatures. Comparison of the lifetimes in these duplexes showed that the destabilizing effect of the G . T base pair in II affected the opening rate of only the nearest-neighbor base pairs. For helix III, the extra adenine affected the opening rates of all the base pairs in the helix and thus was a larger perturbation for opening of the base pairs than the G . T base pair. The temperature dependence of the exchange rates of the imino proton in the perfect helix gives values of 14-15 kcal/mol for activation energies of A . T imino protons. These relaxation rates were shown to correspond to exchange involving individual base pair opening in this helix, which means that one base-paired imino proton can exchange independent of the others. For the other two helices that contain perturbations, much larger activation energies for exchange of the imino protons were found, indicating that a cooperative transition involving exchange of at least several base pairs was the exchange mechanism of the imino protons. The effects of a perturbation in a helix on the exchange rates and the mechanisms for exchange of imino protons from oligonucleotide helices are discussed.

  14. Rape prevention

    Science.gov (United States)

    Date rape - prevention; Sexual assault - prevention ... Centers for Disease Control and Prevention website. Sexual assault and abuse and STDs. In: 2015 sexually transmitted diseases treatment guidelines 2015. www.cdc.gov/std/tg2015/sexual- ...

  15. Dengue Prevention

    Science.gov (United States)

    ... Address What's this? Submit What's this? Submit Button Prevention Recommend on Facebook Tweet Share Compartir This photograph ... medications to treat a dengue infection. This makes prevention the most important step, and prevention means avoiding ...

  16. Plague Prevention

    Science.gov (United States)

    ... Healthcare Professionals Clinicians Public Health Officials Veterinarians Prevention History of Plague Resources FAQ Prevention Recommend on Facebook Tweet Share Compartir Reduce rodent habitat around your ...

  17. Effect of the sulphur atom on geometry and spectra of the biomolecule 2-thiouracil and in the WC base pair 2-thiouridine-adenosine. Influence of water in the first hydration shell.

    Science.gov (United States)

    Alcolea Palafox, M; Rastogi, V K; Singh, S P

    2018-04-01

    The effect of the sulphur atom on 2-thiouracil (2TU) and 2-thiouridine molecules, as compared with uracil and uridine molecules, respectively, was carried out in several environments. The predicted IR spectrum of 2TU in the isolated state was compared with that obtained for uracil molecule and with those reported experimentally in matrix isolation. Its crystal unit cell in the solid state was simulated through a tetramer form using DFT methods for the first time. The calculated Raman spectrum was compared to the experimental ones in the solid state. A linear scaling procedure was used for this task. The first hydration shell was simulated by explicit number of water molecules surrounding 2TU up to 30 and was compared with that obtained in uracil molecule. Water molecules 'distributed' around 2TU was preferred over that 'clustering', because it can better reproduce the hydration and their effects on different parameters of the molecular structure of 2TU and uracil. The total atomic charges and several calculated thermodynamic parameters were discussed. The effect of the sulphur atom on the Watson-Crick (WC) and reverse WC base pair uridine-adenosine was estimated, and the CP corrected interaction energies were calculated. 2-thiouridine has a weaker WC pair than that with uridine, although its slight higher dipole moment (μ) facilitates the interaction with the water molecules. Several helical parameters were determined.

  18. Abnormal secretion and function of recombinant human factor VII as the result of modification to a calcium binding site caused by a 15-base pair insertion in the F7 gene.

    Science.gov (United States)

    Peyvandi, F; Carew, J A; Perry, D J; Hunault, M; Khanduri, U; Perkins, S J; Mannucci, P M; Bauer, K A

    2001-02-15

    A case of a novel mutation in the F7 gene that results in factor VII coagulant activity (VII:c) of less than 1% and VII antigen (VII:Ag) levels of 10% is presented. DNA analysis revealed a homozygous 15-base pair (bp) in-frame insertion-type mutation at nucleotide 10554. This insertion consisted of a duplication of residues leucine (L)213 to aspartic acid (D)217 (leucine, serine, glutamic acid, histidine, and aspartic acid), probably arising by slipped mispairing between 2 copies of a direct repeat (GCGAGCACGAC) separated by 4 bp. Molecular graphic analyses showed that the insertion is located at the surface of the catalytic domain in an exposed loop stabilized by extensive salt-bridge and hydrogen bond formation at which the calcium binding site is located. The mutation probably interferes with protein folding during VII biosynthesis and/or diminishes functional activity through the loss of calcium binding. In vitro expression studies demonstrated that the levels of VII:Ag in lysates of cells transfected with wild type VII (VIIWT) were equivalent to those with mutant type VII (VIIMT), but the level of secreted VIIMT was 5% to 10% that of VIIWT. Pulse chase studies demonstrated that VIIMT did not accumulate intracellularly, and studies with inhibitors of protein degradation showed that recombinant VIIMT was partially degraded in the pre-Golgi compartment. Accordingly, only small amounts of VIIMT with undetectable procoagulant activity were secreted into conditioned media. These results demonstrate that a combination of secretion and functional defects is the mechanism whereby this insertion causes VII deficiency.

  19. Maternal homozygocity for a 14 base pair insertion in exon 8 of the HLA-G gene and carriage of HLA class II alleles restricting HY immunity predispose to unexplained secondary recurrent miscarriage and low birth weight in children born to these patients

    DEFF Research Database (Denmark)

    Christiansen, Ole B; Kolte, Astrid M; Dahl, Mette

    2012-01-01

    Homozygous carriage of a 14 base pair (bp) insertion in exon 8 of the HLA-G gene may be associated with low levels of soluble HLA-G and recurrent miscarriage (RM). We investigated the G14bp insertion(ins)/deletion(del) polymorphism in 339 women with unexplained RM and 125 control women. In all...

  20. Preventing Addiction.

    Science.gov (United States)

    Moore, Susan Fordney

    The purpose of this paper is to provide the beginning counselor with an overview of prevention concepts. Prevention is a relatively new emphasis in community efforts to stem the rising costs of substance abuse and other high-risk behaviors. The paper discusses agent, host, and environmental prevention models and how they relate to causal theories…

  1. Prevention: Exercise

    Medline Plus

    Full Text Available ... Steroid Injections Lumbar Zygapophysical (Facet) Joint Injections PREVENTION Lifestyle Choices 10 Tips for a Healthy Back Smoking Weight Patient Safety Exercise Strengthening Strengthen ...

  2. Prevention: Exercise

    Medline Plus

    Full Text Available ... Injections PREVENTION Lifestyle Choices 10 Tips for a Healthy Back Smoking Weight Patient Safety Exercise Strengthening Strengthen Your Core! Stretching/Flexibility Aerobic Exercise ...

  3. Prevention: Exercise

    Medline Plus

    Full Text Available ... Watchful Waiting and Education Injection Treatments for Spinal Pain Epidural Steroid Injections Lumbar Zygapophysical (Facet) Joint Injections PREVENTION Lifestyle Choices 10 ...

  4. Poison Prevention

    Science.gov (United States)

    ... Prevention Listen Español Text Size Email Print Share Poison Prevention Page Content Article Body Post the Poison Help number 1-800-222-1222 on the ... or empty container of a toxic substance, call Poison Help immediately. More than a million American children ...

  5. Studies of DNA dumbbells. VI. Analysis of optical melting curves of dumbbells with a sixteen-base pair duplex stem and end-loops of variable size and sequence.

    Science.gov (United States)

    Paner, T M; Riccelli, P V; Owczarzy, R; Benight, A S

    1996-12-01

    Optical melting curves of 22 DNA dumbbells with the 16-base pair duplex sequence 5'-G-C-A-T-C-A-T-C-G-A-T-G-A-T-G-C-3' linked on both ends by single-strand loops of A, or C, sequences (iota = 2, 3, 4, 6, 8, 10, 14). T sequences (iota = 2, 3, 4, 6, 8, 10), and G iota sequences (iota = 2, 4) were measured in phosphate buffered solvents containing 30, 70, and 120 mM Na+. For dumbbells with loops comprised of at least three nucleotides, stability is inversely proportional to end-loop size. Dumbbells with loops comprised of only two nucleotide bases generally have lower stabilities than dumbbells with three base nucleotide loops. Experimental melting curves were analyzed in terms of the numerically exact (multistate) statistical thermodynamic model of DNA dumbbell melting previously described (T. M. paner, M. Amaratunga & A. S. Benight (1992), Biopolymers 32, 881). Theoretically calculated melting curves were fitted to experimental curves by simultaneously adjusting model parameters representing statistical weights of intramolecular hairpin loop and single-strand circle states. The systematically determined empirical parameters provided evaluations of the energetics of hairpin loop formation as a function of loop size, sequence, and salt environment. Values of the free energies of hairpin loop formation delta Gloop(n > iota) and single-strand circles, delta Gcir(N) as a function of end-loop size, tau = 2-14, circle size, N = 32 + 2 iota, and loop sequence were obtained. These quantities were found to depend on end-loop size but not loop sequence. Their empirically determined values also varied with solvent ionic strength. Analytical expressions for the partition function Q(T) of the dumbbells were evaluated using the empirically evaluated best-fit loop parameters. From Q(T), the melting transition enthalpy delta H, entropy delta S, and free energy delta G, were evaluated for the dumbbells as a function of end-loop size, sequence, and [Na+]. Since the multistate analysis

  6. Preventive analgesia

    DEFF Research Database (Denmark)

    Dahl, Jørgen B; Kehlet, Henrik

    2011-01-01

    This paper will discuss the concepts of pre-emptive and preventive analgesia in acute and persistent postsurgical pain, based on the most recent experimental and clinical literature, with a special focus on injury-induced central sensitization and the development from acute to chronic pain. Recent...... of preventive analgesia for persistent postoperative pain are promising. However, clinicians must be aware of the demands for improved design of their clinical studies in order to get more conclusive answers regarding the different avenues for intervention. Summary: The concept of preventive analgesia is still...

  7. Prevention: Exercise

    Medline Plus

    Full Text Available ... Exercise Strength Training for the Elderly Other Back Pack Safety Pregnancy and Back Pain Preventing Osteoporosis Back ... in very slightly. Hold a ball directly in front of you. Keep your abdominal muscles tight and ...

  8. Prevention: Exercise

    Medline Plus

    Full Text Available ... Tips for a Healthy Back Smoking Weight Patient Safety Exercise Strengthening Strengthen Your Core! Stretching/Flexibility Aerobic ... Strength Training for the Elderly Other Back Pack Safety Pregnancy and Back Pain Preventing Osteoporosis Back Pain ...

  9. Prevent Shingles

    Science.gov (United States)

    ... Submit What's this? Submit Button Past Emails Prevent Shingles Language: English (US) Español (Spanish) Recommend on Facebook ... that can result in vision loss. Older Adults & Shingles As you get older, you are more likely ...

  10. Prevention: Exercise

    Medline Plus

    Full Text Available ... Epidural Steroid Injections Lumbar Zygapophysical (Facet) Joint Injections PREVENTION Lifestyle Choices 10 Tips for a Healthy Back Smoking Weight Patient Safety Exercise Strengthening Strengthen Your Core! ...

  11. Prevention: Exercise

    Medline Plus

    Full Text Available ... and Education Injection Treatments for Spinal Pain Epidural Steroid Injections Lumbar Zygapophysical (Facet) Joint Injections PREVENTION Lifestyle ... Z Spine Specialists Videos 9 for Spine Epidural Steroid Injections Exercise: The Backbone of Spine Treatment Spondylolisthesis ...

  12. Prevention: Exercise

    Medline Plus

    Full Text Available ... A SPECIALIST Prevention Strengthening Exercise Committee Exercise Committee Core Strengthening Many popular forms of exercise focus on ... acute pain, you should stop doing it. Transverse Core Strengthening This strengthens the muscles that cross from ...

  13. Prevention: Exercise

    Medline Plus

    Full Text Available ... Lumbar Zygapophysical (Facet) Joint Injections PREVENTION Lifestyle Choices 10 Tips for a Healthy Back Smoking Weight Patient ... the floor; rotate from side to side. Repeat 10 times. Check with your physician; if you are ...

  14. Prevention: Exercise

    Medline Plus

    Full Text Available ... Pregnancy and Back Pain Preventing Osteoporosis Back Pain Basics Book RESOURCES Patient ... popular forms of exercise focus on core strengthening, or building the muscles that provide support for your body. Pilates, yoga and martial arts ...

  15. HIV Prevention

    Centers for Disease Control (CDC) Podcasts

    2012-02-01

    Dr. Kevin Fenton, Director of CDC’s National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention, talks about steps people can take to protect their health from HIV.  Created: 2/1/2012 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 2/1/2012.

  16. Bullying Prevention

    Science.gov (United States)

    Kemp, Patrice

    2016-01-01

    The focus of the milestone project is to focus on bridging the gap of bullying and classroom instruction methods. There has to be a defined expectations and level of accountability that has to be defined when supporting and implementing a plan linked to bullying prevention. All individuals involved in the student's learning have to be aware of…

  17. Prevention: Exercise

    Medline Plus

    Full Text Available ... Strengthen Your Core! Stretching/Flexibility Aerobic Exercise Cervical Exercise Strength Training for the Elderly Other Back Pack Safety Pregnancy and Back Pain Preventing Osteoporosis Back Pain Basics Book RESOURCES ... The Backbone of Spine Treatment Spondylolisthesis BLOG FIND ...

  18. Prevent Pneumonia

    Centers for Disease Control (CDC) Podcasts

    2015-08-06

    CDC’s Matthew Westercamp explains what pneumonia is, its symptoms, and how to prevent it.  Created: 8/6/2015 by National Center for Immunization and Respiratory Diseases (NCIRD), Division of Bacterial Diseases (DBD), Respiratory Diseases Branch (RDB).   Date Released: 8/6/2015.

  19. HIV Prevention

    Science.gov (United States)

    ... Abroad Treatment Basic Statistics Get Tested Find an HIV testing site near you. Enter ZIP code or city Follow HIV/AIDS CDC HIV CDC HIV/AIDS See RSS | ... Collapse All Is abstinence the only 100% effective HIV prevention option? Yes. Abstinence means not having oral, ...

  20. Prevention: Exercise

    Medline Plus

    Full Text Available ... Information Feature Articles Patient Q&A Success Stories Definitions Anatomy of the Spine Definitions A-Z Spine Specialists Videos 9 for Spine Epidural Steroid Injections Exercise: The Backbone of Spine Treatment Spondylolisthesis BLOG FIND A SPECIALIST Prevention ...

  1. Allergy prevention.

    Science.gov (United States)

    Muche-Borowski, Cathleen; Kopp, Matthias; Reese, Imke; Sitter, Helmut; Werfel, Thomas; Schäfer, Torsten

    2010-09-01

    The further increase of allergies in industrialized countries demands evidence-based measures of primary prevention. The recommendations as published in the guideline of 2004 were updated and consented on the basis of a systematic literature search. Evidence from the period February 2003-May 2008 was searched in the electronic databases Cochrane and MEDLINE as well as in reference lists of recent reviews and by contacting experts. The retrieved citations were screened for relevance first by title and abstract and in a second step as full paper. Levels of evidence were assigned to each included study and the methodological quality of the studies was assessed as high or low. Finally the revised recommendations were formally consented (nominal group process) by representatives of relevant societies and organizations including a self-help group. Of originally 4556 hits, 217 studies (4 Cochrane Reviews, 14 meta-analyses, 19 randomized controlled trials, 135 cohort and 45 case-control studies) were included and critically appraised. Grossly unchanged remained the recommendations on avoiding environmental tobacco smoke, breast-feeding over 4 months (alternatively hypoallergenic formulas for children at risk), avoiding a mold-promoting indoor climate, vaccination according to current recommendations, and avoidance of furry pets (especially cats) in children at risk. The recommendation on reducing the house dust mite allergen exposure as a measure of primary prevention was omitted and the impact of a delayed introduction of supplementary food was reduced. New recommendations were adopted concerning fish consumption (during pregnancy / breast-feeding and as supplementary food in the first year), avoidance of overweight, and reducing the exposure to indoor and outdoor air pollutants. The revision of this guideline on a profound evidence basis led to (1) a confirmation of existing recommendations, (2) substantial revisions, and (3) new recommendations. Thereby it is possible

  2. Rotating preventers

    International Nuclear Information System (INIS)

    Tangedahl, M.J.; Stone, C.R.

    1992-01-01

    This paper reports that recent changes in the oil and gas industry and ongoing developments in horizontal and underbalanced drilling necessitated development of a better rotating head. A new device called the rotating blowout preventer (RBOP) was developed by Seal-Tech. It is designed to replace the conventional rotating control head on top of BOP stacks and allows drilling operations to continue even on live (underbalanced) wells. Its low wear characteristics and high working pressure (1,500 psi) allow drilling rig crews to drill safely in slightly underbalanced conditions or handle severe well control problems during the time required to actuate other BOPs in the stack. Drilling with a RBOP allows wellbores to be completely closed in tat the drill floor rather than open as with conventional BOPs

  3. Treating and Preventing Burns

    Science.gov (United States)

    ... Healthy Living Healthy Living Healthy Living Nutrition Fitness Sports Oral Health Emotional Wellness Growing Healthy Sleep Safety & Prevention Safety & Prevention Safety and Prevention Immunizations At Home ...

  4. Relapse prevention.

    Science.gov (United States)

    Hall, S M; Wasserman, D A; Havassy, B E

    1991-01-01

    Although knowledge about relapse prevention is still at an early stage, the extant data highlight the importance of several constructs. 1. Motivation for abstinence remains central. The construct itself is often clouded because of its association with mystical notions such as willpower and self-control. We know that manipulation of environmental events can increase motivation. These interventions are effective, however, only as long as the contingencies are in effect. We need to develop and evaluate strategies for transferring contingency management to the natural environment, that is, to institutions and groups that can perpetuate them for the long term. Also, clarification of the kinds of abstinence goals needed to prevent relapse is important. 2. Coping skills have been studied by several investigators, but research on these, except for job-finding skills, is not encouraging. The skills usually taught may be too basic. Skills training oriented to complex targets, such as building nondrug-using networks, may be useful and should be further explored. 3. Social support is clearly important, yet we do not know how best to use it to promote abstinence. The little research available suggests that both familial and nonfamilial systems should be mobilized. We need to define abstinence-promoting supportive behaviors, identify and engage important support systems in treatment, and help patients expand their nondrug-using contacts. 4. Negative affect may be causally related to relapse. We need to continue efforts to identify dysphoric patients and develop interventions to ameliorate dysphoria concurrent with drug abuse treatment (cf. Zweben and Smith 1989). 5. Drug cue reactivity and extinction to drug cues have been demonstrated in the laboratory. What is needed in this promising line of research are (1) investigation of cues and cue-reactivity phenomena in the natural environment or in conditions closely mimicking that environment and (2) extinction methods that transfer

  5. Polio and Prevention

    Science.gov (United States)

    ... Photo Collections Videos Polio Today → Polio + Prevention Polio + Prevention Polio and prevention Polio is a crippling and ... a child for life. Learn more about polio + prevention The Virus The Vaccines The Communities Related resources ...

  6. Diabetes Prevention Program (DPP)

    Science.gov (United States)

    ... Recruiting Patients & Families Consortia, Networks & Centers Reports & Planning Diabetes Prevention Program (DPP) The NIDDK-sponsored Diabetes Prevention ... Diabetes Prevention Program for those who are eligible. Diabetes Prevention Program (DPP) DPP Goal The DPP looked ...

  7. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...

  8. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    et al 2000) and the 50S (Ban et al 2000) ribosome fragments and more recently that of the complete ribosome (Yusupov et al 2001) have already highlighted the significance of the structural expression of RNAs in the folded form. This has also prompted several initiatives for structure-function annotations of RNA sequence ...

  9. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    In keeping with this general trend, all the systems with only one hydrogen bond between the bases, on relaxed optimization, show huge RMS deviation and lead to significant improvements in their interaction energies. As expected, the hydrogen bonding patterns in their relaxed geometries are also very different from their ...

  10. Principles of RNA base pairing: Structures and energies of the trans Watson-Crick/sugar edge base pairs

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Špačková, Naďa; Leszczynski, Jerzy

    2005-01-01

    Roč. 109, č. 22 (2005), s. 11399-11410 ISSN 1520-6106 R&D Projects: GA ČR(CZ) GA203/05/0009 Institutional research plan: CEZ:AV0Z50040507 Keywords : molecular dynamics * large ribosomal sub-unit * quantum chemical analysis Subject RIV: BO - Biophysics Impact factor: 4.033, year: 2005

  11. Stomach (Gastric) Cancer Prevention

    Science.gov (United States)

    ... likely as white men to die from stomach cancer. Stomach Cancer Prevention Key Points Avoiding risk factors and increasing ... factors and increasing protective factors may help prevent stomach cancer. Avoiding cancer risk factors may help prevent certain ...

  12. "AN OUNCE OF PREVENTION..."

    Science.gov (United States)

    HASELKORN, FLORENCE

    PREVENTION AS FUNCTION, VALUE ISSUE, CONCEPTUAL SHORTCOMING, AND PRACTICE IS DISCUSSED AND RELATED TO EDUCATIONAL TASK. PREVENTION AS FUNCTION IS GENERATED BY OUR VALUE PREMISES. IN SEEKING TO PREVENT SOME FORMS OF SOCIAL DYSFUNCTION, WE MAY BE PERPETUATING OTHERS. THE CONCEPT OF PREVENTION IS AMBIGUOUS. CRUCIAL CONCEPTUAL ISSUES INCLUDE THE…

  13. [Prevention of dementia].

    Science.gov (United States)

    Urakami, Katsuya

    2016-03-01

    The dementia prevention consists of three steps, primary prevention of dementia is to prevent from normal and mild cognitive impairment to dementia, secondary prevention is early detection and early treatment of dementia, and tertiary prevention is three stages of progress prevention of dementia. Primary prevention of dementia had been considered impossible until recently, but potential scientific evidence has been shown recently. The fact that 4.62 million people are person with dementia and 400 million people are person with mild cognitive impairment are considered to be urgent problem and we must intend to perform dementia prevention from primary to tertiary prevention thoroughly. We perform dementia screening using touch panel type computer and we recommend person with mild cognitive impairment to join dementia prevention classroom. Therefore, we can prevent progression from mild cognitive impairment to dementia (primary prevention). Early diagnosis and introduction to the specialized medical institution are needed if you find early stage of dementia and treat early (secondary prevention). To prevent progression by the appropriate drug treatment and care for dementia is required (tertiary prevention).

  14. Jet lag prevention

    Science.gov (United States)

    ... medlineplus.gov/ency/patientinstructions/000719.htm Jet lag prevention To use the sharing features on this page, ... Headache Irritability Stomach upset Sore muscles Tips for Prevention Before your trip: Get plenty of rest, eat ...

  15. Research Areas: Prevention

    Science.gov (United States)

    NCI’s prevention research has a broad focus, from identifying environmental and lifestyle factors that influence cancer risk to studying the biology of how cancer develops and studying ways to disseminate prevention interventions.

  16. Marine Pollution Prevention Act

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Marine Pollution Prevention Act of 2008 implements the International Convention for the Prevention of Pollution from Ships, including related Protocols (MARPOL)...

  17. Preventing Type 2 Diabetes

    Science.gov (United States)

    ... Sexual & Urologic Problems Clinical Trials Preventing Type 2 Diabetes Perhaps you have learned that you have a ... I lower my chances of developing type 2 diabetes? Research such as the Diabetes Prevention Program shows ...

  18. Preventing Diabetes Problems

    Science.gov (United States)

    ... Problems Diabetes & Sexual & Urologic Problems Clinical Trials Preventing Diabetes Problems View or Print All Sections Heart Disease & ... prevent or delay sexual and urologic problems. Depression & Diabetes Depression is common among people with a chronic, ...

  19. Statins and Cancer Prevention

    Science.gov (United States)

    ... cell membrane integrity, cell signaling, protein synthesis, and cell cycle progression, all of which are potential areas of intervention to arrest the cancer process. What are the ... at the NCI Division of Cancer Prevention Web site at http://prevention. ...

  20. Preventing food poisoning

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/007441.htm Preventing food poisoning To use the sharing features on this page, please enable JavaScript. To prevent food poisoning , take the following steps when preparing food: Carefully ...

  1. Breast Cancer Prevention

    Science.gov (United States)

    ... of Breast & Gynecologic Cancers Breast Cancer Screening Research Breast Cancer Prevention (PDQ®)–Patient Version What is prevention? Go ... from starting. Risk-reducing surgery . General Information About Breast Cancer Key Points Breast cancer is a disease in ...

  2. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Peer Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing ...

  3. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  4. Traditional preventive treatment options

    DEFF Research Database (Denmark)

    Longbottom, C; Ekstrand, K; Zero, D

    2009-01-01

    Preventive treatment options can be divided into primary, secondary and tertiary prevention techniques, which can involve patient- or professionally applied methods. These include: oral hygiene (instruction), pit and fissure sealants ('temporary' or 'permanent'), fluoride applications (patient...... options....

  5. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... L Sarah Harrison, OT Anne Bryden, OT The Role of the Social Worker after Spinal Cord Injury ... do to prevent pressure sores? play_arrow What role does diet and hydration play in preventing pressure ...

  6. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... to prevent pressure sores? play_arrow What is “skin tolerance” and how can it be ... play_arrow What role does diet and hydration play in preventing pressure sores among ...

  7. National Suicide Prevention Lifeline

    Science.gov (United States)

    ... Our Crisis Centers Stories of Hope and Recovery Mental Health & Suicide Prevention Glossary Get Involved Participate Our Crisis Centers Social Media Hub Promote National Suicide Prevention Month Providers & Professionals ...

  8. Prevention of gravitational collapse

    International Nuclear Information System (INIS)

    Moffat, J.W.; Taylor, J.G.

    1981-01-01

    We apply a new theory of gravitation to the question of gravitational collapse to show that collapse is prevented in this theory under very reasonable conditions. This result also extends to prevent ultimate collapse of the Universe. (orig.)

  9. Accident prevention in radiotherapy.

    Science.gov (United States)

    Holmberg, O

    2007-04-01

    In order to prevent accidents in radiotherapy, it is important to learn from accidents that have occurred previously. Lessons learned from a number of accidents are summarised and underlying patterns are looked for in this paper. Accidents can be prevented by applying several safety layers of preventive actions. Categories of these preventive actions are discussed together with specific actions belonging to each category of safety layer.

  10. Accident prevention in radiotherapy

    OpenAIRE

    Holmberg, O

    2007-01-01

    In order to prevent accidents in radiotherapy, it is important to learn from accidents that have occurred previously. Lessons learned from a number of accidents are summarised and underlying patterns are looked for in this paper. Accidents can be prevented by applying several safety layers of preventive actions. Categories of these preventive actions are discussed together with specific actions belonging to each category of safety layer.

  11. Prevention of periodontal diseases.

    Science.gov (United States)

    Dentino, Andrew R; Kassab, Moawia M; Renner, Erica J

    2005-07-01

    The ultimate goal of periodontal disease prevention is to maintain the dentition over a lifetime in a state of health, comfort, and function in an aesthetically pleasing presentation. This article focuses on primary and secondary periodontal disease prevention as they relate to gingivitis and periodontitis. Risk assessment, mechanical plaque control, chemical plaque control, current clinical recommendations for optimal prevention, and future preventive strategies are discussed.

  12. Fall Prevention: Simple Tips to Prevent Falls

    Science.gov (United States)

    ... bars for the shower or tub A sturdy plastic seat for the shower or tub — plus a ... healthy-lifestyle/healthy-aging/in-depth/fall-prevention/art-20047358 . Mayo Clinic Footer Legal Conditions and Terms ...

  13. Chickenpox Prevention and Treatment

    Science.gov (United States)

    ... Multimedia Related Links Medline Plus Healthfinder.gov Shingles Prevention & Treatment Language: English Español (Spanish) Recommend on Facebook ... Prescribed by Your Doctor Español: Prevención y tratamiento Prevention The best way to prevent chickenpox is to ...

  14. Prevention IS Care

    Centers for Disease Control (CDC) Podcasts

    2009-03-26

    This podcast provides an overview of the Prevention IS Care campaign, which provides HIV prevention tools for medical care providers to use on a daily basis with patients who are living with HIV.  Created: 3/26/2009 by National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention (NCHHSTP).   Date Released: 3/26/2009.

  15. Strategies to prevent loneliness

    NARCIS (Netherlands)

    de Jong Gierveld, J.; Fokkema, T.; Sha'ked, A.; Rokach, A.

    2015-01-01

    Prevention is better than cure’. This also applies to loneliness experiences: preventing people from loneliness is better than helping them to reduce their feelings of loneliness through interventions. In this chapter, we argue the necessity of loneliness prevention strategies for handling future

  16. Prevention of Food Poisoning.

    Science.gov (United States)

    Army Quartermaster School, Ft. Lee, VA.

    The programed text provides a single lesson, four-hour, correspondence subcourse on the prevention of food poisoning. It covers the following areas: a definition of food poisoning; chemical food poisoning; biological food poisoning; causes and prevention of trichinosis; six factors controlling bacteria growth; bacterial infection; prevention of…

  17. Cancer risks and prevention

    International Nuclear Information System (INIS)

    Vessey, M.P.; Gray, M.

    1985-01-01

    A series of essays in honour of Sir Richard Doll is presented. Chapters cover the preventability of cancer, geography, smoking, diet, occupation, radiation, infections and immune impairment, exogenous and endogenous hormones, other drugs, prevention through legislation and by education and cancer risks and prevention in the Third World. The chapter on radiation has been indexed separately. (UK)

  18. Sunburn: Treatment and Prevention

    Science.gov (United States)

    ... 12 mos.) Toddler 1-3yrs. Preschool 3-5yrs Grade School 5-12yrs. Teen 12-18yrs. Young Adult 18-21yrs. Healthy Living Healthy Living Healthy Living Nutrition Fitness Sports Oral Health Emotional Wellness Growing Healthy Sleep Safety & Prevention Safety & Prevention Safety and Prevention Immunizations ...

  19. [Prevention of eating disorders].

    Science.gov (United States)

    Papežová, Hana

    2017-01-01

    The quality of the prevention of eating disorders represents in several last decades frequently discussed issue in the context of rapidly changing socio-economic conditions, a significant increase of influence of the media, new technologies and knowledge of risk factors. Primary prevention aims to reduce the risk of developing eating disorders, but secondary and tertiary prevention play the important role as well. Effective and coordinated prevention is still missing. Our experience of international cooperation of the last 20 years led to the development and evaluation of prevention programs. We are describing their fast development and ongoing programs following the new trends recommended by WHO.

  20. Prevention Of Stroke

    Directory of Open Access Journals (Sweden)

    Nagaraja D

    2005-01-01

    Full Text Available Stroke is an important cause for neurological morbidity and mortality. Prevention of ischemic stroke involves identification and prevention of risk factors and optimal use of pharmacotherapy. Risk factors have been classified as modifiable and non-modifiable; control of modifiable factors should prevent stroke occurrence. Stroke prevention has been described at three levels: primary, secondary and tertiary. Prolonged hypertension increases an individual′s risk for developing fatal or nonfatal stroke by three times and its control has been shown to prevent stroke. Diabetes mellitus is an important cause for microangiopathy and predisposes to stroke. Statin trials have shown significant reduction in stroke in those who were treated with statins. Stroke risk can be reduced by avoiding tobacco use, control of obesity and avoiding sedentary life style. Anti platelet medications are effective for secondary prevention of stroke. Educating society regarding modifiable risk factors and optimal use of pharmacotherapy form the cornerstone for the prevention of stroke.

  1. The folding energy landscape of apoflavodoxin is rugged. hydrogen exchange reveals non-productive misfolded intermediates.

    NARCIS (Netherlands)

    Bollen, Y.J.M.; Kamphuis, M.B.; Mierlo, van C.P.M.

    2006-01-01

    Many native proteins occasionally form partially unfolded forms (PUFs), which can be detected by hydrogen/deuterium exchange and NMR spectroscopy. Knowledge about these metastable states is required to better understand the onset of folding-related diseases. So far, not much is known about where

  2. The folding energy landscape of apoflavodoxin is rugged: Hydrogen exchange reveals nonproductive misfolded intermediates.

    NARCIS (Netherlands)

    Bollen, Y.J.M.; Kamphuis, M.B.; Van Mierlo, C.P.M.

    2006-01-01

    Many native proteins occasionally form partially unfolded forms (PUFs), which can be detected by hydrogen/deuterium exchange and NMR spectroscopy. Knowledge about these metastable states is required to better understand the onset of folding-related diseases. So far, not much is known about where

  3. Rigidity of Nominal Wages of Non-Production Workers in Industrial Sector

    Directory of Open Access Journals (Sweden)

    Bambang Sulistiyono

    2016-06-01

    Full Text Available Excess supply of labor leads to low the levels of nominal wages received by workers. The amount of minimum wage rate exceeds the market wage rate. The determination of minimum wage is a factor manifested in the institutional and regulatory Provincial Minimum Wage or a District Minimum Wage. Unfortunately, it has made nominal wages  difficult to drop below the minimum wage level. High or low level of nominal wages are associated with worker productivity. Further, nominal wages are rigid to go down. If they have increased, they can not be dropped in the future even though the company's performance is declined. Knowing that condition, in designing the remuneration system, an employer should pay attention to the rigidity of nominal wages, so that when  company's performance declines, the company will not be interfered because of the wages burden.  Furthermore, unions and government should consider the rigidity impact of nominal wages that go down. Thus, when macroeconomic conditions deteriorate and company's performance drops, the company will not go bankrupt due to high labor costs. If the company goes bankrupt, the workers will loose their jobs as a result of employment termination, while the government will face the unemployment problem. 

  4. Levocloperastine in the treatment of chronic nonproductive cough: comparative efficacy versus standard antitussive agents.

    Science.gov (United States)

    Aliprandi, P; Castelli, C; Bernorio, S; Dell'Abate, E; Carrara, M

    2004-01-01

    The medical and social impact of cough is substantial. Current antitussive agents at effective doses have adverse events such as drowsiness, nausea and constipation that limit their use. There is also recent evidence that standard antitussive agents, such as codeine, may not reduce cough during upper respiratory infections. Therefore, there is a need for more effective and better-tolerated agents. The efficacy of levocloperastine, a novel antitussive, which acts both centrally on the cough center and on peripheral receptors in the tracheobronchial tree in treating chronic cough, was compared with that of other standard antitussive agents (codeine, levodropropizine and DL-cloperastine) in six open clinical trials. The studies enrolled patients of all ages with cough associated with various respiratory disorders including bronchitis, asthma, pneumonia and chronic obstructive pulmonary disease. Levocloperastine significantly improved cough symptoms (intensity and frequency of cough) in all trials, and improvements were observed after the first day of treatment. In children, levocloperastine reduced nighttime awakenings and irritability, and in adults it was effective in treating cough induced by angiotensin-converting enzyme inhibitors. When compared with other antitussive agents, levocloperastine had improved or comparable efficacy, with a more rapid onset of action. Importantly, no evidence of central adverse events was recorded with levocloperastine, whereas drowsiness was reported by a significant number of patients receiving codeine. Levocloperastine is an effective antitussive agent for the treatment of cough in patients of all ages. It has a more rapid onset of action than standard agents with an improved tolerability profile.

  5. Optimizing Fire Department Operations Through Work Schedule Analysis, Alternative Staffing, and Nonproductive Time Reduction

    Science.gov (United States)

    2014-09-01

    fatigue attributed to work-related stressors .19 On the other hand, research has shown that the 48/96 schedule exacerbates sleep deprivation issues...health and wellness initiatives, brown-out, fire department funding, peak-usage staffing, four-person staffing, schedule modification, sleep deprivation ...to a significant sleep deprivation risk that impacts the employee’s ability to function at peak levels.7 The 10/14-hour schedule produces better

  6. 29 CFR 778.223 - Pay for non-productive hours distinguished.

    Science.gov (United States)

    2010-07-01

    ...”, traveling on the employer's business or to and from workplaces, and in meal periods and rest periods are... paid as compensation for performing a duty involved in the employee's job and is not of a type...

  7. A comparison of productive and non-productive green water-use ...

    African Journals Online (AJOL)

    productive (canopy and litter interception and soil evaporation) fluxes. There is a widespread perception within South Africa that indigenous tree species, in contrast to commercial forestry genera/species, are water-wise and should thus be planted ...

  8. Lignosulfonate-mediated cellulase adsorption: enhanced enzymatic saccharification of lignocellulose through weakening nonproductive binding to lignin

    Science.gov (United States)

    Zhaojiang Wang; JY Zhu; Yingjuan Fu; Menghua Qin; Zhiyong Shao; Jungang Jiang; Fang Yang

    2013-01-01

    Thermochemical pretreatment of lignocellulose is crucial to bioconversion in the fields of biorefinery and biofuels. However, the enzyme inhibitors in pretreatment hydrolysate make solid substrate washing and hydrolysate detoxification indispensable prior to enzymatic hydrolysis. Sulfite pretreatment to overcome recalcitrance of lignocelluloses (SPORL) is a relatively...

  9. Prevention of suicide

    Directory of Open Access Journals (Sweden)

    Rajiv Gupta

    2017-01-01

    Full Text Available Suicide is a major public health problem in India, probably even bigger than in the West. Suicidal behavior is the best conceptualized as a multifaceted complex problem involving social factors and mental illnesses. Broadly, there are two approaches to suicide prevention; population preventive strategies and high-risk preventive strategies. Population preventive strategies include reducing availability of means for suicide, education of primary care physicians, influencing media portrayal of suicidal behavior, education of the public, telephone helplines, and addressing economic issues associated with suicidal behavior. High-risk preventive strategy includes identifying individuals with high risk of committing suicide, intensively treating mental illness if present, and providing psychosocial support. Thus, prevention requires a multipronged effort with collaboration from various sectors including mental health professionals, social justice department, and macroeconomic policy makers.

  10. Traditional preventive treatment options

    DEFF Research Database (Denmark)

    Longbottom, C; Ekstrand, K; Zero, D

    2009-01-01

    conventional operative care, and since controlling the caries process prior to first restoration is the key to breaking the repair cycle and improving care for patients, future research should address the shortcomings in the current level of supporting evidence for the various traditional preventive treatment......Preventive treatment options can be divided into primary, secondary and tertiary prevention techniques, which can involve patient- or professionally applied methods. These include: oral hygiene (instruction), pit and fissure sealants ('temporary' or 'permanent'), fluoride applications (patient...

  11. Prevention of Prosthetic Dentistry

    Directory of Open Access Journals (Sweden)

    Eremin O.V.

    2011-03-01

    Full Text Available Prevention in prosthetic dentistry is not just a regular oral hygiene and the prevention of caries in the early stages of its development. The initial goal of orthopedic and dental should be the ability to convey to the patient's sense of pros-thetics that proteziruya one saved more. An example is included prosthetic dental arch defects with bridges or single artificial crowns on implants that will prevent movement of teeth and the continuity of the dentition

  12. Prevent Infections During Chemotherapy

    Centers for Disease Control (CDC) Podcasts

    2011-10-24

    This podcast discusses the importance of preventing infections in cancer patients who are undergoing chemotherapy. Dr. Lisa Richardson, CDC oncologist, talks about a new Web site for cancer patients and their caregivers.  Created: 10/24/2011 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP), Division of Cancer Prevention and Control (DCPC).   Date Released: 10/24/2011.

  13. Preventing food allergy

    DEFF Research Database (Denmark)

    de Silva, Debra; Panesar, Sukhmeet S; Thusu, Sundeep

    2013-01-01

    The European Academy of Allergy and Clinical Immunology is developing guidelines about how to prevent and manage food allergy. As part of the guidelines development process, a systematic review is planned to examine published research about the prevention of food allergy. This systematic review...... recommendations. The aim of this systematic review will be to assess the effectiveness of approaches for the primary prevention of food allergy....

  14. Speech disorder prevention

    Directory of Open Access Journals (Sweden)

    Miladis Fornaris-Méndez

    2017-04-01

    Full Text Available Language therapy has trafficked from a medical focus until a preventive focus. However, difficulties are evidenced in the development of this last task, because he is devoted bigger space to the correction of the disorders of the language. Because the speech disorders is the dysfunction with more frequently appearance, acquires special importance the preventive work that is developed to avoid its appearance. Speech education since early age of the childhood makes work easier for prevent the appearance of speech disorders in the children. The present work has as objective to offer different activities for the prevention of the speech disorders.

  15. Work hazard prevention plans

    International Nuclear Information System (INIS)

    Albertos Campos, F.

    2009-01-01

    The prevention of industrial risks is a constantly evolving discipline that has changed considerable in the last 25 years. The Cofrentes Nuclear Power Plants has always been operated with a clear policy favoring prevention by supporting the principle of its integration, i. e., that the hierarchical functional organization of the company make sure that industrial risk prevention is effective and that health and safety standards are met. The historical evolution of occupational safety in the Cofrentes Nuclear Power Plant shows a a clear trend towards improvement and is the results of many years of hard work and effort by the plants own and contractor personnel in the field of industrial risk prevention. (Author)

  16. Fungus Infections: Preventing Recurrence

    Science.gov (United States)

    ... Favorite Name: Category: Share: Yes No, Keep Private Fungus Infections: Preventing Recurrence Share | Doctors have excellent treatments for skin fungus infections that occur on the feet, nails, groin, ...

  17. Prevention at Community Colleges. Prevention Update

    Science.gov (United States)

    Higher Education Center for Alcohol, Drug Abuse, and Violence Prevention, 2012

    2012-01-01

    According to "Community College Student Alcohol Use: Developing Context-Specific Evidence and Prevention Approaches," community colleges have traditionally had a threefold mission that includes preparing students for transfer to four-year colleges, developmental education, and workforce preparation. The researchers point out that the demographic…

  18. Preventing Eye Injuries

    Science.gov (United States)

    ... Stories Español Eye Health / Eye Health A-Z Eye Injuries Sections Preventing Eye Injuries Recognizing and Treating ... Infographic Five Steps to Safer Champagne Celebrations Preventing Eye Injuries Leer en Español: Lesiones de los ojos ...

  19. Injury prevention in football

    African Journals Online (AJOL)

    and cool downs before and after training and matches, respectively. As part of injury prevention, adequate injury management and rehabilitation are essential; especially in the prevention of re-injury. Unfortunately, youth football is often disadvantaged with inadequate or unavailable sports medicine personnel and treatment ...

  20. HIV Risk and Prevention

    Science.gov (United States)

    ... Prevention VIH En Español Get Tested Find an HIV testing site near you. Enter ZIP code or city Follow HIV/AIDS CDC HIV CDC HIV/AIDS See RSS | ... Email Updates on HIV Syndicated Content Website Feedback HIV Risk and Prevention Recommend on Facebook Tweet Share ...

  1. Preventative Medicine today

    Directory of Open Access Journals (Sweden)

    José Antonio Maluf de Carvalho

    2005-03-01

    Full Text Available The great majority of chronic diseases can be prevented byreducing risks, understood as factors that increase the probabilityof a specific disease or condition, such as hypertension,hypercholesterolemia, inadequate diet, smoking habit, obesity andsedentarism. These aspects are evaluated in this article as wellas prevention and screening methods.

  2. [Prevention of psychosocial risks].

    Science.gov (United States)

    Dalle, Édouard; Trichard-Salembier, Alexandra; Sobaszek, Annie

    2018-02-01

    The theme of psychosocial risks remains in the workplace. It is therefore essential that all members of a company are made aware of the terminology and specific prevention actions in this field. Distinguishing between the manifestations of these risks and their causes and consequences helps to improve prevention. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  3. Prevention de la Poliomyelite

    Directory of Open Access Journals (Sweden)

    M. Baltazard

    1962-01-01

    Full Text Available In Iran, the prevention of poliomyelitis is practically limited to vaccinatton This paper, however, gives a detailed account of the preventive measures attempting to check the spread of the infection and of those aiming at the reduction of the frequency of the paralytic manifestation

  4. Cancer Prevention Overview (PDQ)

    Science.gov (United States)

    ... have been shown to reduce the risk of breast cancer in women at high risk. SERMS may cause side effects , such as hot flashes , so they are not often used for prevention of cancer. See the PDQ summary on Breast Cancer Prevention for more information. Finasteride has been ...

  5. Prevent Cervical Cancer!

    Centers for Disease Control (CDC) Podcasts

    2015-01-08

    Cervical cancer can be prevented. Listen as two friends—one a doctor—talk about screening tests and early detection. Learn what test you might need.  Created: 1/8/2015 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 1/8/2015.

  6. Prevention of Preeclampsia

    Directory of Open Access Journals (Sweden)

    Sammya Bezerra Maia e Holanda Moura

    2012-01-01

    Full Text Available Preeclampsia (PE affects around 2–5% of pregnant women. It is a major cause of maternal and perinatal morbidity and mortality. In an attempt to prevent preeclampsia, many strategies based on antenatal care, change in lifestyle, nutritional supplementation, and drugs have been studied. The aim of this paper is to review recent evidence about primary and secondary prevention of preeclampsia.

  7. Prevention of Preeclampsia

    OpenAIRE

    Bezerra Maia e Holanda Moura, Sammya; Marques Lopes, Laudelino; Murthi, Padma; da Silva Costa, Fabricio

    2012-01-01

    Preeclampsia (PE) affects around 2–5% of pregnant women. It is a major cause of maternal and perinatal morbidity and mortality. In an attempt to prevent preeclampsia, many strategies based on antenatal care, change in lifestyle, nutritional supplementation, and drugs have been studied. The aim of this paper is to review recent evidence about primary and secondary prevention of preeclampsia.

  8. Can I Prevent Acne?

    Science.gov (United States)

    ... for Educators Search English Español Can I Prevent Acne? KidsHealth / For Teens / Can I Prevent Acne? Print en español ¿Puedo prevenir el acné? What Causes Acne? Contrary to what you may have heard, acne ...

  9. Prevention of preterm birth.

    LENUS (Irish Health Repository)

    Flood, Karen

    2012-02-01

    Preterm birth (delivery before 37 completed weeks of gestation) is common and rates are increasing. In the past, medical efforts focused on ameliorating the consequences of prematurity rather than preventing its occurrence. This approach resulted in improved neonatal outcomes, but it remains costly in terms of both the suffering of infants and their families and the economic burden on society. Increased understanding of the pathophysiology of preterm labor has altered the approach to this problem, with increased focus on preventive strategies. Primary prevention is a limited strategy which involves public education, smoking cessation, improved nutritional status and avoidance of late preterm births. Secondary prevention focuses on recurrent preterm birth which is the most recognisable risk factor. Widely accepted strategies include cervical cerclage, progesterone and dedicated clinics. However, more research is needed to explore the role of antibiotics and anti-inflammatory treatments in the prevention of this complex problem.

  10. Preventing eating disorders.

    Science.gov (United States)

    Shaw, Heather; Stice, Eric; Becker, Carolyn Black

    2009-01-01

    This article reviews eating disorder (ED) prevention programs, highlighting features that define successful programs and particularly promising interventions, and how they might be further refined. The field of ED prevention has advanced considerably both theoretically and methodologically compared with the earlier ED prevention programs, which were largely psychoeducational and met with limited success. Recent meta-analytic findings show that more than half (51%) of ED prevention interventions reduced ED risk factors and more than a quarter (29%) reduced current or future eating pathology (EP). A couple of brief programs have been shown to reduce the risk for future onset of EP and obesity. Selected interactive, multisession programs offered to participants older than 15 years, delivered by professional interventionists and including body acceptance or dissonance-induction content, produced larger effects. Understanding and applying these results can help inform the design of more effective prevention programs in the future.

  11. Prevention in practice

    DEFF Research Database (Denmark)

    Birch, Stephen; Bridgman, Colette; Brocklehurst, Paul

    2015-01-01

    for the conference, collected materials from scribes during the conference and additional resources collated in advance of the meeting, authors agreed on the summary document. RESULTS: The Prevention in Practice conference aimed to collate information about which diseases could be prevented in practice, how diseases...... could be identified early enough to facilitate prevention, what evidence based therapies and treatments were available and how, given the collective evidence, could these be introduced in general dental practice within different reimbursement models. CONCLUSIONS: While examples of best practice were...

  12. CSI cardiac prevent 2015

    Directory of Open Access Journals (Sweden)

    S Ramakrishnan

    2015-01-01

    Full Text Available The CSI Cardiac Prevent 2015 was held at Hotel Taj Palace, New Delhi, on September 25-27, 2015. The major challenge was to create interest among cardiologists and physicians on preventive cardiology, a neglected area. The theme of the conference was "Innovations in Heart Disease Prevention.′′ This conference included "CSI at WHF Roadmap Workshop, Inauguration Ceremony, scientific program, plenary sessions, Nursing/Dietician track, Industry Exhibition, Social Events," Great India blood pressure Survey, and CSI Smart Heart App. A total of 848 delegates/faculties attended this conference against a total of 1140 people registered for the meeting.

  13. Obesity Prevention and Screening.

    Science.gov (United States)

    Mackey, Eleanor R; Olson, Alexandra; DiFazio, Marc; Cassidy, Omni

    2016-03-01

    Obesity is widespread, associated with several physical and psychosocial comorbidities, and is difficult to treat. Prevention of obesity across the lifespan is critical to improving the health of individuals and society. Screening and prevention efforts in primary care are an important step in addressing the obesity epidemic. Each period of human development is associated with unique risks, challenges, and opportunities for prevention and intervention. Screening tools for overweight/obesity, although imperfect, are quick and easy to administer. Screening should be conducted at every primary care visit and tracked longitudinally. Screening tools and cutoffs for overweight and obesity vary by age group. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Prevention of Eye Injuries

    OpenAIRE

    Pashby, Tom

    1981-01-01

    In Canada 30,000 people are registered as blind; in one third of these, blindness might have been avoided. Prevention is the key to reducing the number of eye injuries and blind eyes. The role of the family physician in early identification of treatable conditions and in the education of patients is discussed, but responsibility for prevention belongs to all physicians. The success of prevention is seen in the great reduction in eye injuries in industry and sports since eye protectors have be...

  15. Measuring pollution prevention

    International Nuclear Information System (INIS)

    Stephan, D.G.; Bridges, J.S.

    1992-01-01

    To assess progress in pollution prevention, estimates or measurements of the amounts of pollution actually prevented have to be made. Such estimates or measurements tell us how far we have come and, possibly, how much farther there is to go in utilizing pollution prevention as a tool for improving environmental quality. They can, theoretically, be used to assess progress on a scale ranging from the individual facility or even the individual process or activity generation wastes to scale as large as a geographical area such as a county, a state or even the United States as a whole. 3 refs

  16. Novel preventive treatment options

    DEFF Research Database (Denmark)

    Longbottom, C; Ekstrand, K; Zero, D

    2009-01-01

    A number of novel preventive treatment options which, as with traditional methods, can be differentiated into 3 categories of prevention (primary, secondary and tertiary), have been and are being currently investigated. Those reviewed are either commercially available or appear relatively close...... of these techniques show considerable promise and dentists should be aware of these developments and follow their progress, the evidence for each of these novel preventive treatment options is currently insufficient to make widespread recommendations. Changes in dental practice should be explored to see how oral...

  17. Can Vaginitis Be Prevented?

    Science.gov (United States)

    ... examples of safe sex. 1 Centers for Disease Control and Prevention. (2010). Self-study STD module—vaginitis . ... Halvorson New Chief of Gynecologic Health and Disease Branch Division of Epidemiology, Statistics, ...

  18. Dental Sealants Prevent Cavities

    Science.gov (United States)

    ... FAQs CDC SEALS Software CDC State Strategies: Preventing Tooth Decay CDC Oral Health Data Other Sites MedlinePlus – Child Dental Health MedlinePlus – Tooth Decay American Dental Association – Evidence-based clinical practice guideline ...

  19. Prevent Back Pain

    Science.gov (United States)

    ... and prevent back pain: Do back-strengthening and stretching exercises at least 2 or 3 times a week. ... risk of back pain. Do back-strengthening and stretching exercises [PDF - 244 KB] at least 2 or 3 ...

  20. Preventing Knee Injuries

    Science.gov (United States)

    ... Blog Skip breadcrumb navigation Preventing Knee Injuries Knee injuries in children and adolescent athletes may be the result of ... occur in childhood sports, but with any knee injury in a growing child there is a possibility of a fracture related ...

  1. Home Improvements Prevent Falls

    Science.gov (United States)

    ... turn JavaScript on. Feature: Falls and Older Adults Home Improvements Prevent Falls Past Issues / Winter 2014 Table ... and ensure your safety. "Safe-ty-fy" Your Home Some Questions for Your Provider Will my medicines ...

  2. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... increased? play_arrow What do family members and caregivers need to know about pressure sores? play_arrow What do family members and caregivers need to do to prevent pressure sores? play_ ...

  3. Prostate Cancer Prevention

    Science.gov (United States)

    ... prostate cancer A man whose father, brother, or son has had prostate cancer has a higher-than- ... known if these drugs lower the risk of death from prostate cancer. The Prostate Cancer Prevention Trial ( ...

  4. Prevention of cisplatin nephrotoxicity

    Directory of Open Access Journals (Sweden)

    Hayati Fatemeh

    2016-01-01

    Full Text Available Cisplatin has a well-established role in the treatment of broad spectrum of malignancies; however its use is limited because of cisplatin-induced nephrotoxicity (CIN which can be progressive in more than 50% of cases. The most important risk factors for CIN include higher doses of cisplatin, previous cisplatin chemotherapy, underlying kidney damage and concurrent treatment with other potential nephrotoxin agents, such as aminoglycosides, nonsteroidal anti-inflammatory agents, or iodinated contrast media. Different strategies have been offered to diminish or prevent nephrotoxicity of cisplatin. The standard approach for prevention of CIN is the administration of lower doses of cisplatin in combination with full intravenous hydration prior and after cisplatin administration. Cisplatin-induced oxidative stress in the kidney may be prevented by natural antioxidant compounds. The results of this review show that many strategies for prevention of CIN exist, however, attention to the administration of these agent for CIN is necessary.

  5. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores Adult Injuries ... LLC Understanding Spinal Cord Injury About Us Expert Videos Contact Us Personal Experience Videos Blog Videos By ...

  6. Preventing Financial Crime

    DEFF Research Database (Denmark)

    Boll, Karen

    This paper investigates the Swedish tax authority’s (Skatteverkets) compliance initiative called Preventing Financial Crime. In Sweden tax evasion related to organised moon-lighting is defined as a major risk to the revenue collection and to the legitimacy of Skatteverket. The traditional approach...... to abating such tax evasion has been reformed and a new mix-method approach adopted. This approach combines a proactive strategy—Preventing Financial Crime—with a reactive inspection strategy. During one a month of intensive fieldwork in Sweden, I studied the daily work in Preventing Financial Crime. Based...... on this, the paper shows that the Swedish tax officials seek to motivate large construction contractors and municipalities to take preventive measures in relation to their sub-contractors to avoid and abate tax evasion. The paper shows the challenges in engaging and involving these external stakeholders...

  7. Oral Cancer Prevention

    Science.gov (United States)

    ... Cancer Diagnosis Prevention Screening & Early Detection Treatment Cancer & Public Health Cancer Health Disparities Childhood Cancer Clinical Trials Global Health Key Initiatives Cancer Moonshot Genomic Data Commons National Clinical Trials ...

  8. Esophageal Cancer Prevention

    Science.gov (United States)

    ... Cancer Diagnosis Prevention Screening & Early Detection Treatment Cancer & Public Health Cancer Health Disparities Childhood Cancer Clinical Trials Global Health Key Initiatives Cancer Moonshot Genomic Data Commons National Clinical Trials ...

  9. Child Maltreatment Prevention

    Science.gov (United States)

    ... Study Prevent Shaken Baby Syndrome Suggested Practices for Journalists Reporting on Child Abuse and Neglect [PDF 2. ... input class="button submit" name="commit" type="submit" value="Submit" /> Related Links Saving Lives & Protecting People ...

  10. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores ... sores? What is a Spinal Cord Injury? SCI Medical Experts People Living With SCI Personal Experiences By ...

  11. Prevent Child Abuse America

    Science.gov (United States)

    ... call the police . Crisis and support contacts For Child Abuse Reporting Numbers in your State please visit: Child ... suspected child abuse and neglect. Parent Resources Prevent Child Abuse America (800) CHILDREN A resource for tips, referrals, ...

  12. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from ... Rosenberg, PsyD Understanding SCI Rehabilitation Donald Peck Leslie, MD Adjusting to Social Life in a Wheelchair Lisa ...

  13. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... hours? play_arrow What's the best way to do daily skin inspections? play_arrow What are the ... for someone with a spinal cord injury to do to prevent pressure sores? play_arrow Why is ...

  14. Wildfire Prevention Strategies.

    Science.gov (United States)

    National Wildlife Coordinating Group, Boise, ID.

    This document provides information and guidance on wildfire prevention strategies. Chapters include: (1) "Introduction"; (2) "How to Use this Guide"; (3) "Fire Cause Classification"; (4) "Relative Effectiveness"; (5) "Degree of Difficulty"; (6) "Intervention Techniques"; (7)…

  15. Preventing Deep Vein Thrombosis

    Science.gov (United States)

    ... you may wear special elastic stockings or inflatable boots. These devices squeeze the muscles to help keep ... Special stockings that compress the legs below the knee may help prevent blood clots from forming. However, ...

  16. Preventing High Blood Pressure

    Science.gov (United States)

    ... Heart Disease Cholesterol Salt Million Hearts® WISEWOMAN Preventing High Blood Pressure: Healthy Living Habits Recommend on Facebook Tweet Share ... meal and snack options can help you avoid high blood pressure and its complications. Be sure to eat plenty ...

  17. Disaster prevention surveillance system

    International Nuclear Information System (INIS)

    Nara, Satoru; Kamiya, Eisei

    2001-01-01

    Fuji Electric Co., Ltd. has supplied many management systems to nuclear reactor institution. 'The nuclear countermeasures-against-calamities special-measures' was enforced. A nuclear entrepreneur has devised the measure about expansion prevention and restoration of a calamity while it endeavors after prevention of generating of a nuclear calamity. Our company have supplied the 'disaster prevention surveillance system' to the Japan Atomic Energy Research Institute Tokai Research Establishment aiming at strengthening of the monitoring function at the time (after the accident) of the accident used as one of the above-mentioned measures. A 'disaster prevention surveillance system' can share the information on the accident spot in an on-site command place, an activity headquarters, and support organizations, when the serious accident happens. This system is composed of various sensors (temperature, pressure and radiation), cameras, computers and network. (author)

  18. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Living with SCI Personal Experiences by Topic Resources Peer Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores Adult Injuries Spinal Cord Injury 101 David ...

  19. Prevention of malignant neoplasms

    OpenAIRE

    D. G. Zaridze; D. M. Maksimovich

    2017-01-01

    Research in causation of cancer is an important part of cancer research in general and is an essential prerequisite for cancer prevention. The effective primary prevention is not visible without evidence based knowledge in the causation of cancer in humans.There is sufficient evidence that certain life style and environment factors cause cancer in humans. These factors include: smoking and other types of tobacco consumption, overweight and obesity, lack of physical activity, diet rich in proc...

  20. HPV Prevention series

    OpenAIRE

    de Sanjosé Silvia

    2012-01-01

    Abstract Human Papilloma Virus (HPV) is a major leading cause of Human Cancer. Through the HPV Prevention series we would like to highlight the quality and the breadth of the research being carried out on the Control and Prevention of HPV and HPV related disease. This series aims to bring together a diverse range of HPV related specialties featuring research that has as ultimate goal insights into HPV related disease reduction. Articles within a wide range of topics such as natural history st...

  1. Prevention of hepatocellular carcinoma.

    Science.gov (United States)

    Kew, Michael C

    2010-01-01

    Because of its frequency and grave prognosis, preventing hepatocellular carcinoma is an urgent priority. Prevention should be possible because environmental carcinogens-chronic hepatitis B and C virus infections, dietary exposure to aflatoxins, and iron overload-cause the great majority of these tumors. Chronic hepatitis B virus infection accounts for 55% of global hepatocellular carcinomas and 80% of those in the high-incidence Asia Pacific and sub-Saharan African regions. In these regions the infection that becomes chronic is predominantly acquired very early in life. A safe and effective vaccine against this virus is available and its universal inclusion in the immunization of infants has already resulted in a marked reduction of chronic infection and a 70% decrease in the occurrence of hepatocellular carcinoma in those immunized. Chronic hepatitis C virus infection is the major cause of hepatocellular carcinoma in industrialized countries. The infection is mainly acquired in adulthood and, until a vaccine becomes available, prevention will consist mainly of identifying, counselling, and treating chronically infected individuals, preventing spread of the virus by the use of safe injection practices (particularly in intravenous drug abusers), and screening all donated blood for the presence of the virus. 4.5 billion of the world.s population are exposed to dietary aflatoxins. Prevention involves treating susceptible crops to prevent fungal contamination, and handling the foodstuffs in such a way as to prevent contamination during storage. Iron overload in hereditary hemochromatosis can be prevented by repeated venesection and in African dietary iron overload by fermenting the home-brewed beer in iron-free containers.

  2. Exploring the antioxidant property of bioflavonoid quercetin in preventing DNA glycation: A calorimetric and spectroscopic study

    International Nuclear Information System (INIS)

    Sengupta, Bidisa; Uematsu, Takashi; Jacobsson, Per; Swenson, Jan

    2006-01-01

    Reducing sugars for example glucose, fructose, etc., and their phosphate derivatives non-enzymatically glycate biological macromolecules (e.g., proteins, DNA and lipids) and is related to the production of free radicals. Here we present a novel study, using differential scanning calorimetry (DSC) along with UV/Vis absorption and photon correlation spectroscopy (PCS), on normal and glycated human placenta DNA and have explored the antioxidant property of the naturally occurring polyhydroxy flavone quercetin (3,3',4',5,7-pentahydroxyflavone) in preventing the glycation. The decrease in the absorption intensity of DNA in presence of sugars clearly indicates the existence of sugar molecules between the two bases of a base pair in the duplex DNA molecule. Variations were perceptible in the PCS relaxation profiles of normal and glycated DNA. The melting temperature of placenta DNA was decreased when glycated suggesting a decrease in the structural stability of the double-stranded glycated DNA. Our DSC and PCS data showed, for the first time, that the dramatic changes in the structural properties of glycated DNA can be prevented to a significant extent by adding quercetin. This study provides valuable insights regarding the structure, function, and dynamics of normal and glycated DNA molecules, underlying the manifestation of free radical mediated diseases, and their prevention using therapeutically active naturally occurring flavonoid quercetin

  3. Preventive Migraine Treatment

    Science.gov (United States)

    Silberstein, Stephen D.

    2015-01-01

    Purpose of Review: This article reviews the evidence base for the preventive treatment of migraine. Recent Findings: Evidence-based guidelines for the preventive treatment of migraine have recently been published by the American Academy of Neurology (AAN) and the Canadian Headache Society (CHS), providing valuable guidance for clinicians. Strong evidence exists to support the use of metoprolol, timolol, propranolol, divalproex sodium, sodium valproate, and topiramate for migraine prevention, according to the AAN. Based on best available evidence, adverse event profile, and expert consensus, topiramate, propranolol, nadolol, metoprolol, amitriptyline, gabapentin, candesartan, Petasites (butterbur), riboflavin, coenzyme Q10, and magnesium citrate received a strong recommendation for use from the CHS. Summary: Migraine preventive drug treatments are underutilized in clinical practice. Principles of preventive treatment are important to improve compliance, minimize side effects, and improve patient outcomes. Choice of preventive treatment of migraine should be based on the presence of comorbid and coexistent illness, patient preference, reproductive potential and planning, and best available evidence. PMID:26252585

  4. Stroke prevention: an update.

    Science.gov (United States)

    Bousser, Marie-Germaine

    2012-03-01

    Stroke is a personal, familial, and social disaster. It is the third cause of death worldwide, the first cause of acquired disability, the second cause of dementia, and its cost is astronomic. The burden of stroke is likely to increase given the aging of the population and the growing incidence of many vascular risk factors. Prevention of stroke includes--as for all other diseases--a "mass approach" aiming at decreasing the risk at the society level and an individual approach, aiming at reducing the risk in a given subject. The mass approach is primarily based on the identification and treatment of vascular risk factors and, if possible, in the implementation of protective factors. These measures are the basis of primary prevention but most of them have now been shown to be also effective in secondary prevention. The individual approach combines a vascular risk factor modification and various treatments addressing the specific subtypes of stroke, such as antiplatelet drugs for the prevention of cerebral infarction in large and small artery diseases of the brain, carotid endarterectomy or stenting for tight carotid artery stenosis, and oral anticoagulants for the prevention of cardiac emboli. There is a growing awareness of the huge evidence-to-practice gap that exists in stroke prevention largely due to socio-economic factors. Recent approaches include low cost intervention packages to reduce blood pressure and cheap "polypills" combining in a single tablet aspirin and several drugs to lower blood pressure and cholesterol. Polypill intake should however not lead to abandon the healthy life-style measures which remain the mainstay of stroke prevention.

  5. Challenges in preventive psychiatry

    Directory of Open Access Journals (Sweden)

    Pratap Sharan

    2017-01-01

    Full Text Available Prevention of mental disorders offers opportunities for decreasing enormous health, economic, and social burden attributable to them. Substantial evidence exist showing effectiveness of prevention strategies in reducing risk factors, strengthening protective factors, and decreasing psychiatric symptoms and disability. The government and various stakeholders should work toward developing policies on national and regional levels for the prevention of mental disorders and integrate them with various public policies. Research should be focused on enhancing the evidence base for these interventions. It should also cover additional domains such as quantification of the burden of disease associated with particular risk factors, the interaction between lifestyle behaviors and mental health, and integrating mental health outcome measures in large community-based interventions for noncommunicable diseases. Special efforts should be made in devising alternative strategies to deliver these programs in low-resource settings. Integrating the research from the field of neurosciences with prevention strategies can augment the effort in this direction. One of the important challenges is to design programs that are either indigenously developed or culturally adapted. Mental health professionals have to play an important and multiple roles to make prevention of mental and behavioral disorders a reality.

  6. Diabetes mellitus prevention.

    Science.gov (United States)

    Allende-Vigo, Myriam Zaydee

    2015-01-01

    The aim of this study was to review lifestyle modification interventions and pharmacological clinical studies designed to prevent diabetes and provide evidence-based recommendations for the prevention of Diabetes Mellitus. A review of relevant literature compiled via a literature search (PUBMED) of English-language publications between 1997 and 2010 was conducted. It is found that people at increased risk of developing type 2 diabetes mellitus can halt the development of the disease. Lifestyle modification intervention with reduction of 5%-10% of excess body weight and increase in moderate physical activity by 150 min/wk has consistently proven to reduce the appearance of diabetes in different at-risk populations. Pharmacologic interventions have also demonstrated the prevention of the appearance of diabetes in persons at risk. Bariatric surgery has decreased the appearance of diabetes patients in a select group of individuals. The progression from prediabetes to diabetes mellitus can be prevented. Lifestyle modification intervention changes with weight loss and increased physical activity are currently recommended for the prevention of diabetes.

  7. Vitamin D and Cancer Prevention

    Science.gov (United States)

    ... Cancer Genetics Services Directory Cancer Prevention Overview Research Vitamin D and Cancer Prevention On This Page What is vitamin D? Why are cancer researchers studying a possible connection ...

  8. Prevention of COPD exacerbations

    DEFF Research Database (Denmark)

    Vestbo, Jørgen; Lange, Peter

    2015-01-01

    Exacerbations have significant impact on the morbidity and mortality of patients with chronic obstructive pulmonary disease. Most guidelines emphasise prevention of exacerbations by treatment with long-acting bronchodilators and/or anti-inflammatory drugs. Whereas most of this treatment is evidence......-based, it is clear that patients differ regarding the nature of exacerbations and are likely to benefit differently from different types of treatment. In this short review, we wish to highlight this, suggest a first step in differentiating pharmacological exacerbation prevention and call for more studies...... in this area. Finally, we wish to highlight that there are perhaps easier ways of achieving similar success in exacerbation prevention using nonpharmacological tools....

  9. Prevention of food allergy

    DEFF Research Database (Denmark)

    Halken, S

    1997-01-01

    incidence of food allergy, especially cow's milk protein allergy/intolerance (CMPA/CMPI), in the first 4 years of life. As no studies have been conducted pertaining to the preventive effect of avoidance of milk and other foods after the age of 4-6 months, recommendation of preventive elimination diets......Development of a food allergy appears to depend on both genetic factors and exposure-especially in early infancy-to food proteins. In prospective studies, the effect of dietary allergy prevention programmes has only been demonstrated in high-risk infants, i.e. infants with at least one first degree...... relative with documented atopic disease. High-risk infants feeding exclusively on breast milk and/or extensively hydrolysed formula (eHF) combined with avoidance of cow's milk proteins and solid foods during at least the first 4 months of life are found to have a significant reduction in the cumulative...

  10. Prevention of acute malnutrition

    DEFF Research Database (Denmark)

    de Pee, Saskia; Grais, Rebecca; Fenn, Bridget

    2015-01-01

    Acute malnutrition is associated with increased morbidity and mortality risk. When episodes are prolonged or frequent, acute malnutrition is also associated with poor growth and development, which contributes to stunting Nutrition-specific and nutrition-sensitive strategies to prevent...... seasons or emergencies, or increased incidence of illness, such as diarrhea or measles, additional efforts are required to prevent and treat wasting. Special nutritious foods directly meet the increased nutrient requirements of children at risk for wasting; assistance to vulnerable households, in the form...... of cash or food, enables households to better meet the food, health, and other needs of household members and may increase resilience; water, sanitation, and hygiene (WASH) and health interventions help prevent and address illness and hence reduce wasting risk. The contributions of specific interventions...

  11. Prevention of food allergy

    DEFF Research Database (Denmark)

    Halken, S

    1997-01-01

    Development of a food allergy appears to depend on both genetic factors and exposure-especially in early infancy-to food proteins. In prospective studies, the effect of dietary allergy prevention programmes has only been demonstrated in high-risk infants, i.e. infants with at least one first degree...... incidence of food allergy, especially cow's milk protein allergy/intolerance (CMPA/CMPI), in the first 4 years of life. As no studies have been conducted pertaining to the preventive effect of avoidance of milk and other foods after the age of 4-6 months, recommendation of preventive elimination diets...... relative with documented atopic disease. High-risk infants feeding exclusively on breast milk and/or extensively hydrolysed formula (eHF) combined with avoidance of cow's milk proteins and solid foods during at least the first 4 months of life are found to have a significant reduction in the cumulative...

  12. Prevention of hand eczema

    DEFF Research Database (Denmark)

    Fisker, Maja H; Ebbehøj, Niels E; Vejlstrup, Søren Grove

    2018-01-01

    Objective Occupational hand eczema has adverse health and socioeconomic impacts for the afflicted individuals and society. Prevention and treatment strategies are needed. This study aimed to assess the effectiveness of an educational intervention on sickness absence, quality of life and severity...... of hand eczema. Methods PREVEX (PreVention of EXema) is an individually randomized, parallel-group superiority trial investigating the pros and cons of one-time, 2-hour, group-based education in skin-protective behavior versus treatment as usual among patients with newly notified occupational hand eczema...

  13. Preventing falls and fractures.

    Science.gov (United States)

    Ulfarsson, J; Robinson, B E

    1994-11-01

    One of four persons over age 65 in the community falls; those over age 75 in institutions fall more frequently. Falls, a complex phenomena suggesting present disease and predicting future disability, are caused by interactions between the environment and dynamic balance which is determined by the quality of sensory input, central processing, and motor responses. Clinical factors which predispose to falling often produce observable disturbances in gait and balance, making observation critical in assessment. Acute illness and drug therapy produce particularly preventable falls. Therapeutic exercise and environmental modification for safety are the clinical interventions most likely to successfully prevent fall-related injury.

  14. Preventing Errors in Laterality

    OpenAIRE

    Landau, Elliot; Hirschorn, David; Koutras, Iakovos; Malek, Alexander; Demissie, Seleshie

    2014-01-01

    An error in laterality is the reporting of a finding that is present on the right side as on the left or vice versa. While different medical and surgical specialties have implemented protocols to help prevent such errors, very few studies have been published that describe these errors in radiology reports and ways to prevent them. We devised a system that allows the radiologist to view reports in a separate window, displayed in a simple font and with all terms of laterality highlighted in sep...

  15. [Preventive strategies for dementia].

    Science.gov (United States)

    Müller, Patrick; Schmicker, Marlen; Müller, Notger G

    2017-05-01

    In the context of the demographically induced increase in the prevalence of dementia and the simultaneous lack of causal pharmacological therapies, preventive approaches are gaining in importance. By reducing risk factors and with measures which induce neuroplasticity successful aging can be supported. This article summarizes the current developments in preventing dementia by modification of life style factors. The main focus lies on the impact of cognitive and physical activity on neuroprotection. A promising approach combines both activities within a dance training program. Further studies that meet the demanding criteria of a randomized clinical trial are urgently needed.

  16. HOW TO PREVENT FRAUD?

    Directory of Open Access Journals (Sweden)

    Ionela – Corina Chersan

    2009-09-01

    Full Text Available Fraud can range from minor employee theft and unproductive behavior tomisappropriation of assets and fraudulent financial reporting. The risk of fraud can be reduced through a combination of prevention and detection measures. Moreover, prevention and deterrence measures are much less costly than the time and expense required for fraud detection and investigation. The information presented in this document generally is applicable to entities of all sizes. However, the degree to which certain programs and controls are applied in smaller, less-complex entities and the formality of theirapplication are likely to differ from larger organizations.

  17. Preventing Melanoma PSA (:60)

    Centers for Disease Control (CDC) Podcasts

    2015-06-02

    This 60 second public service announcement is based on the June 2015 CDC Vital Signs report. Skin cancer is the most common form of cancer in the U.S. In 2011, there were more than 65,000 cases of melanoma, the most deadly form of skin cancer. Learn how everyone can help prevent skin cancer.  Created: 6/2/2015 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 6/2/2015.

  18. Building in Prevention

    DEFF Research Database (Denmark)

    Troelsen, Jens

    2013-01-01

    Health interventions can be seen as initiatives that seek to prevent the emergence and development of impaired public health. Initiatives made in the area of prophylaxis can be experienced as anything from direct invasions of personal freedom to small traffic bumps on the roads. In this spectrum...... preventive work might be changed to direct focus onto a greater extent on establishing frameworks for people to master their own lives instead of one-sided initiatives, which leave the individual with a sense of guilt at their own illness....

  19. Aspirin for Primary Prevention.

    Science.gov (United States)

    Richman, Ilana B; Owens, Douglas K

    2017-07-01

    Aspirin reduces the risk of nonfatal myocardial infarction and stroke, and the risk of colorectal cancer. Aspirin increases the risk of gastrointestinal and intracranial bleeding. The best available evidence supports initiating aspirin in select populations. In 2016, the US Preventive Services Task Force recommended initiating aspirin for the primary prevention of both cardiovascular disease and colorectal cancer among adults ages 50 to 59 who are at increased risk for cardiovascular disease. Adults 60 to 69 who are at increased cardiovascular disease risk may also benefit. There remains considerable uncertainty about whether younger and older patients may benefit. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Gender-Based Violence Prevention. Issues in Prevention

    Science.gov (United States)

    Higher Education Center for Alcohol, Drug Abuse, and Violence Prevention, 2012

    2012-01-01

    This issue of "Issues in Prevention" focuses on gender-based violence prevention. This issue contains the following articles: (1) Preventing Gender-Based Violence: An Overview (Linda Langford); (2) Q&A With Amelia Cobb; (3) Denim Day at HBCUs; (4) Dear Colleague Letter; (5) ED Grants for Violence Prevention; and (6) Higher Education Center…

  1. Vaccination and the prevention problem.

    Science.gov (United States)

    Dawson, Angus

    2004-11-01

    This paper seeks to critically review a traditional objection to preventive medicine (which I call here the 'prevention problem'). The prevention problem is a concern about the supposedly inequitable distribution of benefits and risks of harm resulting from preventive medicine's focus on population-based interventions. This objection is potentially applicable to preventive vaccination programmes and could be used to argue that such programmes are unethical. I explore the structure of the prevention problem by focusing upon two different types of vaccination (therapeutic vaccination and preventive vaccination). I argue that the 'prevention problem' cannot be fairly applied to the case of preventive vaccination because such programmes do not just focus upon benefits at the level of populations (as is claimed by the prevention problem). Most such preventive vaccination programmes explicitly seek to create and maintain herd protection. I argue that herd protection is an important public good which is a benefit shared by all individuals in the relevant population. This fact can then be used to block the 'prevention problem' argument in relation to preventive vaccination programmes. I conclude by suggesting that whilst the future development and use of therapeutic vaccines does raise some interesting ethical issues, any ethical objections to prophylactic vaccination on the basis of the 'prevention problem' will not be overcome through the substitution of therapeutic vaccines for preventive vaccines; indeed, the 'prevention problem' fails on its own terms in relation to preventive vaccination programmes.

  2. To Prevent Misbehavior

    OpenAIRE

    Telep, Valya Goodwin, 1955-

    2009-01-01

    This series of lessons was prepared for parents like you - parents who want to do a better job of disciplining their children. The lessons were especially written for parents of preschool children, ages two to six, but some of the discipline methods are appropriate for older children, too. This lesson focuses on preventing misbehavior.

  3. Prevention of postoperative ileus

    DEFF Research Database (Denmark)

    Holte, Kathrine; Kehlet, H

    2002-01-01

    mediators. We update evidence on the advances in the prevention and treatment on PI. As single interventions, continuous thoracic epidural analgesia with local anesthetics and minimally invasive surgery are the most efficient interventions in the reduction of PI. The effects of pharmacological agents have...

  4. Preventing School Violence

    Science.gov (United States)

    Rulloda, Rudolfo Barcena

    2011-01-01

    School violence has mushroomed into a devastating epidemic and is deteriorating the basic foundation of education. In this article, the author will present several teaching strategies for preventing school violence from becoming an arduous enigma within the classroom and school environments, and focus on assessment and reflection in order to…

  5. Preventing Adolescent Suicide.

    Science.gov (United States)

    Capuzzi, David

    The adolescent at risk for suicidal preoccupation and behavior has become an increasing concern for schools and communities. This paper presents some of the causes of teen suicide, things adults should know about adolescent suicide prevention, and what can be done to help such youth. The transition to adolescence is a complex time when many values…

  6. Preventive medicine in 2030.

    Science.gov (United States)

    Freudenberg, Nicholas

    2012-12-01

    This invited commentary imagines two futures for preventive medicine and public health in the Year 2030. Using satire, the commentary describes one future in which large corporations control public health and another where a robust public sector plays the leading role. Copyright © 2012. Published by Elsevier Inc.

  7. Eating Disorder Prevention Programming.

    Science.gov (United States)

    Sapia, Jennifer L.

    This paper provides information for school psychologists regarding the necessity and benefits of school-based prevention programming for students at risk for developing eating disorders (i.e., females). School-based programming is a cost-effective means of reaching the largest number of individuals at once and identifying those individuals…

  8. Police and Suicide Prevention.

    Science.gov (United States)

    Marzano, Lisa; Smith, Mark; Long, Matthew; Kisby, Charlotte; Hawton, Keith

    2016-05-01

    Police officers are frequently the first responders to individuals in crisis, but generally receive little training for this role. We developed and evaluated training in suicide awareness and prevention for frontline rail police in the UK. To investigate the impact of training on officers' suicide prevention attitudes, confidence, and knowledge. Fifty-three participants completed a brief questionnaire before and after undertaking training. In addition, two focus groups were conducted with 10 officers to explore in greater depth their views and experiences of the training program and the perceived impact on practice. Baseline levels of suicide prevention attitudes, confidence, and knowledge were mixed but mostly positive and improved significantly after training. Such improvements were seemingly maintained over time, but there was insufficient power to test this statistically. Feedback on the course was generally excellent, notwithstanding some criticisms and suggestions for improvement. Training in suicide prevention appears to have been well received and to have had a beneficial impact on officers' attitudes, confidence, and knowledge. Further research is needed to assess its longer-term effects on police attitudes, skills, and interactions with suicidal individuals, and to establish its relative effectiveness in the context of multilevel interventions.

  9. [Improving suicide prevention].

    Science.gov (United States)

    Debout, Michel

    2017-04-01

    Suicidal thoughts precede a suicide attempt. Knowing the people who are exposed to such thoughts enables prevention to be improved. The results of a study of the general population show that one in five French people claim to have already seriously considered committing suicide. This represents a particularly concerning public health issue. Copyright © 2017. Published by Elsevier Masson SAS.

  10. Responsible Hospitality. Prevention Updates

    Science.gov (United States)

    Colthurst, Tom

    2004-01-01

    Responsible Hospitality (RH)--also called Responsible Beverage Service (RBS)--encompasses a variety of strategies for reducing risks associated with the sale and service of alcoholic beverages. RH programs have three goals: (1) to prevent illegal alcohol service to minors; (2) to reduce the likelihood of drinkers becoming intoxicated; and (3) to…

  11. Preventable amputations in Ethiopia

    African Journals Online (AJOL)

    Sew. Mi. 6. Discussion. Gas gangre. Total. This study thus confirms that at the present time about a half of the limbs being amputated at our. Hospital (and probably throughout Ethiopia) could have been saved, or prevented by relatively simple means. These include reducing the number of road traffic accident casualties by ...

  12. Bullying Prevention for Kids

    Centers for Disease Control (CDC) Podcasts

    2012-01-19

    This podcast discusses what victims of bullying may experience and provides recommendations for coping with it.  Created: 1/19/2012 by National Center for Injury Prevention and Control (NCIPC).   Date Released: 1/19/2012.

  13. Teenage Pregnancy Prevention.

    Science.gov (United States)

    Peters, Sheila; And Others

    1991-01-01

    Peer counselors and staff members describe the "I Have a Future" Program at Meharry Medical College in Nashville (Tennessee). This program focuses on pregnancy prevention by providing education, health care, and increased life options; social skills training; an entrepreneurial program; and separate classes for African-American youth.…

  14. Wound Care: Preventing Infection

    Science.gov (United States)

    ... or wearing your Immediate Post-op or preliminary prosthesis; keep it elevated whenever possible. The limb should be raised above the level of your heart to prevent swelling. Take care of your whole self – body, mind, and spirit. Eat well and drink plenty ...

  15. Student Leadership. Prevention Updates

    Science.gov (United States)

    Langford, Linda; DeJong, William

    2010-01-01

    Campus-based efforts to reduce alcohol and other drug abuse and violence (AODV) will be more successful if they involve a wide range of stakeholders--including students--who can contribute to the program's design, implementation, and evaluation. Students provide a unique perspective on AODV prevention, and they can also bring a certain authority…

  16. Preventing Skin Cancer

    Centers for Disease Control (CDC) Podcasts

    2016-05-18

    A man and a woman talk about how they’ve learned to protect their skin from the sun over the years. .  Created: 5/18/2016 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/18/2016.

  17. Injury Prevention Research

    Centers for Disease Control (CDC) Podcasts

    2009-09-01

    Research provides the knowledge that we need to understand what is possible, what is not, and the best way to proceed in our intervention efforts.  Created: 9/1/2009 by National Center for Injury Prevention and Control (NCIPC).   Date Released: 9/1/2009.

  18. Prevention of relapsing backache

    Directory of Open Access Journals (Sweden)

    Raspe, Heiner

    2006-05-01

    Full Text Available Background: The condition of non-specific back pain is characterized by high prevalence, non satisfactory therapeutic options and severe socioeconomic consequences. Therefore prevention seems an attractive option to downsize the problem. However, the construction of effective preventive measures is complicated by the obscure aetiology of the condition, the multidimensionality of risk and prognostic factors (bio psychosocial model! and the variability of its natural as well as clinical course. This led to the development of a wide variety of preventive measures: e. g. exercise programs, educational measures (including back school, ergonomic modification of the work environment, mechanical supports (e. g. back belts as well as multidisciplinary interventions. For two reasons the workplace seems to be a suitable setting for prevention. First, because a number of strong risk factors are associated with working conditions and second, because it allows addressing a large proportion of the adult population. Against this background the assessment at hand sets out to answer the following questions: What is the amount and methodological quality of the available scientific literature on the effectiveness of back pain prevention in the workplace environment? What are effective measures for the prevention of back pain and its consequences in the workplace environment and how effective are they? Is back pain prevention in the workplace environment cost-effective? Is there a need for more research? As primary outcomes for effectiveness the assessment will focus on time lost from work and the frequency and duration of episodes with back pain. The preventive measures assessed belong to the following categories: exercise programs, educational and information measures, multidimensional interventions, back belts, lifting teams and ergonomic interventions. Methods: The assessment is based on a systematic review of the published literature according to the

  19. [Prevention of preeclampsia - review].

    Science.gov (United States)

    Vlk, R; Matěcha, J; Drochýtek, V

    2015-06-01

    Preeclampsia is a serious condition that affects about five percent of pregnant women. The disorder itself or related complications are responsible for a significant percentage of maternal and fetal morbidity, even in developed countries. Although our understanding of etiology is still limited, the possibility of detecting and evaluating certain angiogenic factors by the end of the first trimester gives food for thought about prospects for preeclampsia prevention. Secondary prevention is currently based mostly on the effort to pharmacologically affect the spiral artery transformation and development of the abnormal placental microcirculation which lead to clinical symptoms of preeclampsia. The preventive treatment options are narrow. Greatest effect was noted with acetylsalicylic acid medication in the at-risk population. The dose of 75-150 mg per day is considered optimal. The treatment should start before the 16th gestational week; later initiation of therapy is associated with considerably smaller effect. The incidence of the early-onset preeclampsia (preventive treatment affects the late-onset preeclampsia only minimally. Calcium supplementation is effective only in women with low calcium intake. Question for the future as well as subject of several studies is a clinical significance of low molecular weight heparin and sildenafil.

  20. Travel health prevention.

    Science.gov (United States)

    Korzeniewski, Krzysztof

    All around the world there has been a rapid growth in the number of international travels. According to the World Tourism Organisation the number of international tourist arrivals reached 1,235 billion in 2016 and continues to grow at a high rate. This has been much due to the development of air transport (including low-cost airlines), increasingly common economic migration, a growing number of travellers visiting friends and relatives, and an increase in medical tourism. With tropical destinations becoming increasingly popular among travellers, doctors have seen a rising number of patients who seek medical advice on health risks prevalent in hot countries and health prevention measures to be taken in tropical destinations, especially where sanitation is poor. The risk for developing a medical condition while staying abroad depends on a variety of factors, including the traveller's general health condition, health prevention measures taken before or during travel (vaccinations, antimalarial chemoprophylaxis, health precautions during air, road and sea travel, proper acclimatisation, prevention of heat injuries, protection against local flora and fauna, personal hygiene, water, food and feeding hygiene), as well as the prevalence of health risk factors in a given location. Health prevention is a precondition for safe travel and maintaining good physical health; in the era of a rapid growth in international tourism it has become of key importance for all travellers.

  1. Scabies: Prevention and Control

    Science.gov (United States)

    ... prevent possible reexposure and reinfestation. Bedding and clothing worn or used next to the skin anytime during the 3 days before treatment should be machine washed and dried using the hot water and hot dryer cycles or be dry-cleaned. ...

  2. Ounce of Prevention.

    Science.gov (United States)

    Cleary, Frank J.; Bell, Nathan

    1990-01-01

    Binghampton (New York) Schools begin their dropout prevention efforts even before children are born--as early as the third trimester of pregnancy. One intervention program is PACT (Parents and Children Together), which helps parents become better "first teachers." The program's success derives from parents' effectiveness as teachers and…

  3. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... OTR/L Sarah Harrison, OT Anne Bryden, OT The Role of the Social Worker after Spinal Cord Injury Patti Rogers, ... do to prevent pressure sores? play_arrow What role does diet and hydration play in ... play_arrow What are the six stages of a pressure sore and how ...

  4. Prevention of nuclear war

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    Removing the threat of a nuclear war-as the General Assembly formally stated in the Final Document of its first special session devoted to disarmament, in 1978-is considered to be the task of the present day. In that Document, the General Assembly sought to establish principles, guidelines and procedures for preventing nuclear war. It declared that to that end, it was imperative to remove the threat of nuclear weapons, to halt and reverse the nuclear-arms race until the total elimination of nuclear weapons and their delivery systems had been achieved (see chapter iv), and to prevent the proliferation of nuclear weapons (see chapter VII). At the same time, it called for other measures designed to prevent the outbreak of nuclear war and to lessen the danger of the treat or use of nuclear weapons. The Assembly's clear call for action was dictated by the awareness that there was no insuperable barrier dividing peace from war and that, unless nations brought the spiralling nuclear-arms race to an end, the day might come when nuclear weapons would actually be used, with catastrophic consequences. In adopting the Final Document, the international community achieved, for the first time, a consensus on an international disarmament strategy having as its immediate goal the elimination of the danger of a nuclear war and the implementation of measures to halt and reverse the arms race. The General Assembly, at its second special session on disarmament, in 1982, reaffirmed the validity of the 1978 Final Document. This paper reports that nuclear issues and in particular the prevention of nuclear war remain, however, major concerns of all States. Undoubtedly, all nations have a vital interest in the negotiation of effective measures for her prevention of nuclear war, since nuclear weapons pose a unique threat to human survival. If nuclear war were to occur, its consequences would be global, not simple regional

  5. Let's prevent diabetes

    DEFF Research Database (Denmark)

    Gray, Laura J.; Khunti, Kamlesh; Williams, Sian

    2012-01-01

    Background: The prevention of type 2 diabetes is a globally recognised health care priority, but there is a lack of rigorous research investigating optimal methods of translating diabetes prevention programmes, based on the promotion of a healthy lifestyle, into routine primary care. The aim...... of the study is to establish whether a pragmatic structured education programme targeting lifestyle and behaviour change in conjunction with motivational maintenance via the telephone can reduce the incidence of type 2 diabetes in people with impaired glucose regulation (a composite of impaired glucose...... of type 2 diabetes. Secondary outcomes include changes in HbA1c, blood glucose levels, cardiovascular risk, the presence of the Metabolic Syndrome and the cost-effectiveness of the intervention.Methods: The study consists of screening and intervention phases within 44 general practices coordinated from...

  6. [Anxiety prevention among schoolchildren].

    Science.gov (United States)

    Essau, C A; Conradt, J; Ederer, E M

    2004-09-01

    The FRIENDS programme is a prevention and early intervention programme, which teaches children strategies to cope with anxiety and challenging situations. This paper examines the social validity of the German version of the FRIENDS programme using data from a large-scale study on the prevention of anxiety disorders in schoolchildren, which is funded by the Dr. Karl-Wilder Stiftung. In this paper, data of 208 schoolchildren (aged 9 to 12 years) are used. Results show that the children and their parents were highly satisfied with the FRIENDS programme. Childrens attendance and completion of their homework assignments were very high. Both the children and their parents rated relaxation exercises and thinking helpful thoughts as being more useful for the children than other skills. Treatment acceptability correlated significantly with the childrens clinical outcome. The implications of our findings for future research are discussed.

  7. Preventive Radiation Protection Act

    International Nuclear Information System (INIS)

    Roewer, H.

    1988-01-01

    The commentary is intended to contribute to protection of the population by a practice-oriented discussion and explanation of questions arising in connection with the Preventive Radiation Protection Act. Leaving aside discussions about abandonment of nuclear power, or criticism from any legal point of view, the commentary adopts the practical approach that accepts, and tries to help implementing, the act as it is. It is a guide for readers who are not experts in the law and gives a line of orientation by means of explanations and sometimes by citations from other acts (in footnotes). The commentary also presents the EURATOM Directive No. 3954/87 dated 22 December 1987, the EC Directive No. 3955/87 dated 22 December 1987, and the EC Directive No. 1983/88 dated 5 July 1988. A tabular survey shows the system of duties and competences defined by the Preventive Radiation Protection Act. (RST) [de

  8. [Prevention of diabetic foot].

    Science.gov (United States)

    Metelko, Zeljko; Brkljacić Crkvencić, Neva

    2013-10-01

    Diabetic foot (DF) is the most common chronic complication, which depends mostly on the duration and successful treatment of diabetes mellitus. Based on epidemiological studies, it is estimated that 25% of persons with diabetes mellitus (PwDM) will develop the problems with DF during lifetime, while 5% do 15% will be treated for foot or leg amputation. The treatment is prolonged and expensive, while the results are uncertain. The changes in DF are influenced by different factors usually connected with the duration and regulation of diabetes mellitus. The first problems with DF are the result of misbalance between nutritional, defensive and reparatory mechanisms on the one hand and the intensity of damaging factors against DF on the other hand. Diabetes mellitus is a state of chronic hyperglycemia, consisting of changes in carbohydrate, protein and fat metabolism. As a consequence of the long duration of diabetes mellitus, late complications can develop. Foot is in its structure very complex, combined with many large and small bones connected with ligaments, directed by many small and large muscles, interconnected with many small and large blood vessels and nerves. Every of these structures can be changed by nutritional, defensive and reparatory mechanisms with consequential DE Primary prevention of DF includes all measures involved in appropriate maintenance of nutrition, defense and reparatory mechanisms.First, it is necessary to identify the high-risk population for DF, in particular for macrovascular, microvascular and neural complications. The high-risk population of PwDM should be identified during regular examination and appropriate education should be performed. In this group, it is necessary to include more frequent and intensified empowerment for lifestyle changes, appropriate diet, regular exercise (including frequent breaks for short exercise during sedentary work), regular self control of body weight, quit smoking, and appropriate treatment of glycemia

  9. Prevention of preeclampsia.

    Science.gov (United States)

    Grotegut, Chad A

    2016-12-01

    Preeclampsia is a common complication of pregnancy that is associated with an increased risk of maternal and neonatal morbidity and mortality. Currently, delivery is the only cure for preeclampsia; therefore, effective prevention and treatment options for this condition are sorely needed. In the current issue of the JCI, Mirzakhani et al. report the findings of the Vitamin D Antenatal Asthma Reduction Trial (VDAART), a well-conducted large, randomized, double-blind, placebo-controlled trial of vitamin D supplementation for the prevention of preeclampsia. Though vitamin D supplementation had no effect on the risk of preeclampsia, reduced maternal serum vitamin D levels did correlate with preeclampsia risk. Mirzakhani and colleagues identified a number of gene pathways that are differentially regulated among women with low serum vitamin D levels who develop preeclampsia. These results indicate that further research on the role of vitamin D in preeclampsia is warranted.

  10. The Prevention of Thalassemia

    Science.gov (United States)

    Cao, Antonio; Kan, Yuet Wai

    2013-01-01

    The thalassemias are among the most common inherited diseases worldwide, affecting individuals originating from the Mediterranean area, Middle East, Transcaucasia, Central Asia, Indian subcontinent, and Southeast Asia. As the diseases require long-term care, prevention of the homozygous state constitutes a major armament in the management. This article discusses the major prevention programs that are set up in many countries in Europe, Asia, and Australia, often drawing from the experience in Sardinia. These comprehensive programs involve carrier detections, molecular diagnostics, genetic counseling, and prenatal diagnosis. Variability of clinical severity can be attributable to interactions with α-thalassemia and mutations that increase fetal productions. Special methods taht are currently quite expensive and not widely applicable are preimplantation and preconception diagnosis. The recent successful studies of fetal DNA in maternal plasma may allow future prenatal diagnosis that is noninvasive for the fetus. PMID:23378598

  11. Teleophthalmology in preventive medicine

    CERN Document Server

    Michelson, Georg

    2014-01-01

    This book provides an up-to-date overview of the clinical applications, methods, and technologies of teleophthalmology within the field of preventive medicine. The ability of novel methods to detect the initial signs of neurodegenerative diseases on the basis of alterations in the retina is reviewed, and detailed attention is paid to the role of teleophthalmology in screening for vision-threatening diseases such as diabetic retinopathy, glaucoma, and age-related macular degeneration. A major part of the book is devoted to novel imaging methods and the latest information technologies, including advanced mobile communication and Web 2.0 applications in teleophthalmology. In addition, the initial projects of an interdisciplinary cooperation in preventive medicine are described. All of the authors are experienced in the scientific and practical aspects of teleophthalmology, including e-learning, and have produced a book that will meet the needs of all medical care providers interested in using teleophthalmology.

  12. Cancer prevention by phytochemicals.

    Science.gov (United States)

    Nishino, Hoyoku; Murakoshi, Michiaki; Mou, Xiao Yang; Wada, Saeri; Masuda, Mitsuharu; Ohsaka, Yasuhito; Satomi, Yoshiko; Jinno, Kenji

    2005-01-01

    Information has been accumulated indicating that diets rich in vegetables and fruits can reduce the risk of a number of chronic diseases, including cancer, cardiovascular disease, diabetes and age-related macular degeneration. Phytochemicals (various factors in plant foods), such as carotenoids, antioxidative vitamins, phenolic compounds, terpenoids, steroids, indoles and fibers, have been considered responsible for the risk reduction. Among them, a mixture of natural carotenoids has been studied extensively and proven to show beneficial effects on human cancer prevention.

  13. Models for effective prevention.

    Science.gov (United States)

    Perry, C L; Kelder, S H

    1992-07-01

    The social influence models do provide some optimism for primary prevention efforts. Prevention programs appear most effective when 1) the target behavior of the intervention has received increasing societal disapproval (such as cigarette smoking), 2) multiple years of behavioral health education are planned, and 3) community-wide involvement or mass media complement a school-based peer-led program (45,46). Short-term programs and those involving alcohol use have had less favorable outcomes. Future research in primary prevention should address concerns of high-risk groups and high-risk countries, such as lower income populations in the United States or countries that have large adolescent homeless populations. The utilization of adolescent leaders for program dissemination might be particularly critical in these settings. A second major and global concern should focus upon alcohol use and alcohol-related problems. In many communities adolescent alcohol use is normative and even adult supported. Thus, young people are getting quite inconsistent messages on alcohol from their schools, from TV, from peers, and from parents. This inconsistency may translate into many tragic and avoidable deaths for young people. Clearly, in the area of alcohol-related problems, community-wide involvement may be necessary. A third direction for prevention research should involve issues of norms, access, and enforcement including policy interventions, such as involve the availability of cigarette vending machines or the ease of under-age buying or levels of taxation. These methods affect adolescents more acutely since their financial resources, for the most part, are more limited. These policy level methods also signify to adolescents what adults consider appropriate.(ABSTRACT TRUNCATED AT 250 WORDS)

  14. Culturally Relevant Cyberbullying Prevention

    OpenAIRE

    Phillips, Gregory John

    2017-01-01

    In this action research study, I, along with a student intervention committee of 14 members, developed a cyberbullying intervention for a large urban high school on the west coast. This high school contained a predominantly African American student population. I aimed to discover culturally relevant cyberbullying prevention strategies for African American students. The intervention committee selected video safety messages featuring African American actors as the most culturally relevant cyber...

  15. Prevention of criticality accidents

    International Nuclear Information System (INIS)

    Canavese, S.I.

    1982-01-01

    These notes used in the postgraduate course on Radiological Protection and Nuclear Safety discuss macro-and microscopic nuclear constants for fissile materials systems. Critical systems: their definition; criteria to analyze the critical state; determination of the critical size; analysis of practical problems about prevention of criticality. Safety of isolated units and of sets of units. Application of standards. Conception of facilities from the criticality control view point. (author) [es

  16. Prevention of malignant neoplasms

    Directory of Open Access Journals (Sweden)

    D. G. Zaridze

    2017-01-01

    Full Text Available Research in causation of cancer is an important part of cancer research in general and is an essential prerequisite for cancer prevention. The effective primary prevention is not visible without evidence based knowledge in the causation of cancer in humans.There is sufficient evidence that certain life style and environment factors cause cancer in humans. These factors include: smoking and other types of tobacco consumption, overweight and obesity, lack of physical activity, diet rich in processed meat and poor in vegetables and fruits, certain types of viral and bacterial infection, ultraviolet radiation, ionizing radiation, ambient air pollution, carcinogens at workplace, exogenous hormones.Cancer mortality is decreasing in majority of developed countries, including Russia. This mortality trend is mostly due to decrease in incidence and death rates of lung and other smoking related cancers and is caused by decline in smoking prevalence and change in tar content of cigarette smoke.In Russia trend in mortality from all cancers is as well determined by decrease in incidence and mortality from gastric cancer, which is due to decline in prevalence of Helicobacter pylori infection and improvement of diet, increase in consumption of fruits and vegetables. Thus the decline in cancer mortality is mostly the result of primary prevention which is the most effective avenue of cancer control. 

  17. The prevention of dementia.

    Science.gov (United States)

    Peters, Ruth

    2009-05-01

    Dementia is prevalent in older adults and the population is ageing. Many factors have been associated with dementia and anything that may aid the prevention of dementia is of importance. The literature in this area was evaluated and information relating to the various factors that may impact upon the prevention of dementia is presented below. Factors that have been associated with a possible increased risk of developing dementia include high blood pressure, (at least in midlife), high body mass index, smoking and possibly diabetes although the evidence is mixed. There is currently no clear evidence with regard to cholesterol and metabolic syndrome although both may be implicated. Having education and maintaining a Mediterranean diet, including vegetable, fruit and fish intake, have been linked to a lower incidence of dementia as has low to moderate alcohol intake. Although care must be taken with the latter given the different characteristics of the studies reporting on alcohol and dementia. It may be that risk and protective factors vary with age, however, in the absence of prophylactic treatment it seems likely that the maintenance of a healthy lifestyle may represent the best option with regard to the prevention of dementia. (c) 2008 John Wiley & Sons, Ltd.

  18. Osteoradionecrosis prevention myths

    International Nuclear Information System (INIS)

    Wahl, Michael J.

    2006-01-01

    Purpose: To critically analyze controversial osteoradionecrosis (ORN) prevention techniques, including preradiation extractions of healthy or restorable teeth and the use of prophylactic antibiotics or hyperbaric oxygen (HBO) treatments for preradiation and postradiation extractions. Methods: The author reviewed ORN studies found on PubMed and in other article references, including studies on overall ORN incidence and pre- and postradiation incidence, with and without prophylactic HBO or antibiotics. Results: Owing in part to more efficient radiation techniques, the incidence of ORN has been declining in radiation patients over the last 2 decades, but the prevention of ORN remains controversial. A review of the available literature does not support the preradiation extraction of restorable or healthy teeth. There is also insufficient evidence to support the use of prophylactic HBO treatments or prophylactic antibiotics before extractions or other oral surgical procedures in radiation patients. Conclusions: To prevent ORN, irradiated dental patients should maintain a high level of oral health. A preradiation referral for a dental evaluation and close collaboration by a multidisciplinary team can be invaluable for radiation patients. As with most other dental patients, restorable and healthy teeth should be retained in irradiated patients. The use of prophylactic HBO or antibiotics should be reconsidered for preradiation and postradiation extractions

  19. Guidelines for prevention in psychology.

    Science.gov (United States)

    2014-04-01

    The effectiveness of prevention to enhance human functioning and reduce psychological distress has been demonstrated. From infancy through adulthood, access to preventive services and interventions is important to improve the quality of life and human functioning and reduce illness and premature death. The importance of prevention is consistent with the Patient Protection and Affordable Care Act of 2010. Even with the increased focus on prevention, psychology training programs rarely require specific courses on prevention. In particular, conceptualizations about best practices in prevention, particularly at the environmental level, are lacking. Therefore, psychologists engaged in prevention can benefit from a set of guidelines that address and inform prevention practices. Accordingly, the Guidelines for Prevention in Psychology are intended to "inform psychologists, the public, and other interested parties regarding desirable professional practices" in prevention. The Prevention Guidelines are recommended based on their potential benefits to the public and the professional practice of psychology. They support prevention as an important area of practice, research, and training for psychologists. The Guidelines give increased attention to prevention within APA, encouraging psychologists to become involved with preventive activities relevant to their area of practice. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

  20. Preventing congenital toxoplasmosis.

    Science.gov (United States)

    Lopez, A; Dietz, V J; Wilson, M; Navin, T R; Jones, J L

    2000-03-31

    Toxoplasmosis is caused by infection with the protozoan parasite Toxoplasma gondii. Acute infections in pregnant women can be transmitted to the fetus and cause severe illness (e.g., mental retardation, blindness, and epilepsy). An estimated 400-4,000 cases of congenital toxoplasmosis occur each year in the United States. Of the 750 deaths attributed to toxoplasmosis each year, 375 (50%) are believed to be caused by eating contaminated meat, making toxoplasmosis the third leading cause of foodborne deaths in this country. Toxoplasma can be transmitted to humans by three principal routes: a) ingestion of raw or inadequately cooked infected meat; b) ingestion of oocysts, an environmentally resistant form of the organism that cats pass in their feces, with exposure of humans occurring through exposure to cat litter or soil (e.g., from gardening or unwashed fruits or vegetables); and c) a newly infected pregnant woman passing the infection to her unborn fetus. RECOMMENDATIONSFOR PREVENTION: Toxoplasma infection can be prevented in large part by a) cooking meat to a safe temperature (i.e., one sufficient to kill Toxoplasma); b) peeling or thoroughly washing fruits and vegetables before eating; c) cleaning cooking surfaces and utensils afterthey have contacted raw meat, poultry, seafood, or unwashed fruits or vegetables; d) pregnant women avoiding changing cat litter or, if no one else is available to change the cat litter, using gloves, then washing hands thoroughly; and e) not feeding raw or undercooked meat to cats and keeping cats inside to prevent acquisition of Toxoplasma by eating infected prey. Priorities for research were discussed at a national workshop sponsored by CDC in September 1998 and include a) improving estimates of the burden of toxoplasmosis, b) improving diagnostic tests to determine when a person becomes infected with Toxoplasma, and c) determining the applicability of national screening programs. Many cases of congenital toxoplasmosis can be

  1. Development of Preventive Measures to Prevent School Absenteeism in Twente

    NARCIS (Netherlands)

    Van Liere, Annette; Ritzen, Henk; Brand-Gruwel, Saskia

    2011-01-01

    Van Liere, A., Ritzen, H., & Brand-Gruwel, S. (2011, August). Development of Preventive Measures to Prevent School Absenteeism in Twente. Paper presented at 14th Biennial Conference for Research on Learning and Instruction of EARLI, Exeter, England.

  2. Community Colleges--Prevention Challenges. Issues in Prevention

    Science.gov (United States)

    Higher Education Center for Alcohol, Drug Abuse, and Violence Prevention, 2012

    2012-01-01

    This issue of "Issues in Prevention" focuses on prevention challenges facing community colleges. This issue contains the following articles: (1) Prevention at Community Colleges; (2) Q&A With William Auvenshine; (3) Chancellor's Initiative at the University of Wisconsin-Stout; (4) Alcohol Marketing in the Digital Age; and (5) Higher Education…

  3. Role of Enforcement in Prevention. Issues in Prevention

    Science.gov (United States)

    Higher Education Center for Alcohol, Drug Abuse, and Violence Prevention, 2012

    2012-01-01

    This issue of "Issues in Prevention" focuses on the role of enforcement in prevention. This issue contains the following articles: (1) What the Evidence Tells Us about the Role of Enforcement in Prevention; (2) Campus Briefs; (3) Q&A with Charles Cychosz; and (4) Higher Education Center Resources.

  4. [AIDS prevention in Germany].

    Science.gov (United States)

    Pott, E

    2007-04-01

    In 1987 the national AIDS prevention campaign "Gib AIDS keine Chance" (Don't give AIDS a chance) was started in Germany. After a very difficult and controversial political debate about a probably successful response to AIDS, in the end a political decision was made in favour of the implementation of a long term "social learning strategy". Thus, since then the Bundeszentrale für gesundheitliche Aufklärung (Federal Centre for Health Education, BZgA) has been running the campaign on behalf of the Federal Ministry of Health. The result of this prevention program is a low rate of infections. In Germany there were 2600 newly diagnosed infections in 2005: 59 % in homosexual men, 16 % by heterosexual contacts, 17 % in people from high prevalence countries and 7 % in i.v. drug users. In comparison to the international situation Germany has a relatively low HIV-prevalence even nowadays. However, Germany has also been confronted with an increasing number of newly diagnosed infections in the last few years. When the prevention program was started it was very important to build new structures for a successful implementation of the campaign. That meant for instance to build up an effective infrastructure for cooperation between the governmental and the nongovernmental sector, including organising the coordinated action among the partners at the federal, regional and local levels. Likewise, international networking was of great importance. A key element, relevant for the success of the campaign was the close cooperation at the federal level between the BZgA and the Deutsche AIDS Hilfe (German AIDS Help, DAH), to combine the highreach intervention in low-prevalence populations with intensive interventions for high prevalence groups. An effective national AIDS prevention campaign must reach the whole population; inform the public about the main risks of infection, about methods of protection and about what is not infectious. Moreover groups with a higher level of risk of

  5. Cruciferous Vegetables and Cancer Prevention

    Science.gov (United States)

    ... Chronic Inflammation Common Cancer Myths and Misconceptions Diet Hormones Immunosuppression Infectious Agents Obesity Radiation Sunlight Tobacco Genetics NCI Cancer Genetics Services Directory Cancer Prevention Overview Research Cruciferous Vegetables and Cancer Prevention On This Page What are ...

  6. Preventing Hantavirus Pulmonary Syndrome (HPS)

    Science.gov (United States)

    ... to Yosemite FAQ: Non-U.S. Visitors to Yosemite History of HPS Related Links Prevent Rodent Infestations Cleaning Up After Rodents Diseases From Rodent Prevention Recommend on Facebook Tweet Share Compartir Eliminate or minimize contact with ...

  7. Immunoglobulins for preventing hepatitis A

    DEFF Research Database (Denmark)

    Liu, Jian Ping; Nikolova, Dimitrinka; Fei, Yutong

    2009-01-01

    Hepatitis A (infectious hepatitis) is a common epidemic disease. Immunoglobulins for passive immunisation are used as prevention.......Hepatitis A (infectious hepatitis) is a common epidemic disease. Immunoglobulins for passive immunisation are used as prevention....

  8. Preventing and diagnosing dementia.

    Science.gov (United States)

    Keenan, Bernie; Jenkins, Catharine; Ginesi, Laura

    While dementia is an umbrella term for a range of degenerative brain disorders, many share similar presentations. Nurses are ideally placed to identify those at risk and empower them to access treatment and plan and prepare for their future needs--as such, they need up-to-date knowledge of the signs and symptoms of the different types of dementia to identify risk factors and make an informed diagnosis. This article, the third in a four-part series on dementia, examines the risk factors, signs, symptoms and diagnosis of dementia, as well as outlining lifestyle factors such as diet and exercise that may help to prevent the development of the condition.

  9. Global Hearing Loss Prevention.

    Science.gov (United States)

    Brown, Clifford Scott; Emmett, Susan D; Robler, Samantha Kleindienst; Tucci, Debara L

    2018-03-07

    Hearing loss is the fourth leading contributor to years lived with a disability worldwide. Most recent estimates indicate that one-half of a billion people suffer from disabling hearing loss worldwide. The social and economic burden is significant. When attributing monetary value to years lived with disability owing to hearing loss, there is greater than $US750 billion lost each year globally. There are numerous contributors to hearing loss, including congenital, infectious, noise exposure, age-related, traumatic, and immune-mediated causes. Understanding the pathophysiology of these factors allows for the development of preventative and treatment strategies specific to the underlying cause. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Preventing medical device recalls

    CERN Document Server

    Raheja, Dev

    2014-01-01

    Introduction to Medical Device RequirementsIntroductionThe ChallengesSources of ErrorsUnderstanding the Science of Safety     Overview of FDA Quality System Regulation     Overview of Risk Management Standard ISO 14971     Overview of FDA Device Approval Process     Overview of Regulatory Requirements for Clinical TrialsSummaryReferencesPreventing Recalls during Specification WritingIntroductionConduct Requirements Analysis to Identify Missing RequirementsSpecifications for Safety, Durability, and

  11. Selenium for preventing cancer

    Directory of Open Access Journals (Sweden)

    Gabriele Dennert

    Full Text Available BACKGROUND: Selenium is a trace element essential to humans. Higher selenium exposure and selenium supplements have been suggested to protect against several types of cancers. OBJECTIVE: Two research questions were addressed in this review: What is the evidence for: 1. an aetiological relationship between selenium exposure and cancer risk in women and men?; 2. the efficacy of selenium supplementation for cancer prevention in women and men? SEARCH STRATEGY: We searched electronic databases and bibliographies of reviews and included publications. SELECTION CRITERIA: We included prospective observational studies to answer research question (a and randomised controlled trials (RCTs to answer research question (b. DATA COLLECTION AND ANALYSIS: We conducted random effects meta-analyses of epidemiological data when five or more studies were retrieved for a specific outcome. We made a narrative summary of data from RCTs. MAIN RESULTS: We included 49 prospective observational studies and six RCTs. In epidemiologic data, we found a reduced cancer incidence (summary odds ratio, OR, 0.69; 95% confidence interval, CI, 0.53 to 0.91 and mortality (OR 0.55, 95% CI 0.36 to 0.83 with higher selenium exposure. Cancer risk was more pronouncedly reduced in men (incidence: OR 0.66, 95% CI 0.42 to 1.05 than in women (incidence: OR 0.90, 95% CI 0.45 to 1.77. These findings have potential limitations due to study design, quality and heterogeneity of the data, which complicated the interpretation of the summary statistics. The RCTs found no protective efficacy of selenium yeast supplementation against non-melanoma skin cancer or L-selenomethionine supplementation against prostate cancer. Study results for the prevention of liver cancer with selenium supplements were inconsistent and studies had an unclear risk of bias. The results of the Nutritional Prevention of Cancer Trial (NPCT and SELECT raised concerns about possible harmful effects of selenium supplements. AUTHORS

  12. Novel preventive treatment options

    DEFF Research Database (Denmark)

    Longbottom, C; Ekstrand, K; Zero, D

    2009-01-01

    to that point. These include: approximal sealants; fluoride applications, including slow-release devices; measures to help remineralize demineralized tissue, including 3 different methods of delivering amorphous calcium phosphate; measures to help modify the biofilm to reduce the cariogenic challenge, including...... of these techniques show considerable promise and dentists should be aware of these developments and follow their progress, the evidence for each of these novel preventive treatment options is currently insufficient to make widespread recommendations. Changes in dental practice should be explored to see how oral...

  13. Preventing the White Death

    DEFF Research Database (Denmark)

    Hansen, Casper Worm; Jensen, Peter S.; Madsen, Peter

    2017-01-01

    Tuberculosis (TB) is a leading cause of death worldwide and, while treatable by antibiotics since the 1940s, drug resistant strains have emerged. This paper estimates the effects of the establishment of a pre-antibiotic era public health institution, known as a TB dispensary, designed to prevent...... of the dispensaries on productivity as measured by annual income per taxpayer at the city level, digitized from historical tax-assessment records. Overall, the evidence highlights the provision of personalized information on infectious diseases as a cost-effective cause of the historical mortality decline....

  14. New perspective on injury prevention

    DEFF Research Database (Denmark)

    Ramskov, Daniel

    Scientific literature underpinning prevention of injuries in sport continues to grow. Preventive measures proven effective in experimental research is however, challenged by implementation issues and understanding contextual factors. A designed-based research approach treat the problem of context...... and involves a relationship between researchers and implementers. Perceiving research as a continuum, design-based research could complement experimental research. The adaption by athletes, coaches and physical therapists of designed preventive interventions is a prerequisite of successful injury prevention....

  15. The Science of Cancer Prevention

    Science.gov (United States)

    The science of cancer prevention is described by Dr. Barnett S. Kramer, M.D., M.P.H., director of the Division of Cancer Prevention, National Cancer Institute (NCI). The Division of Cancer Prevention administers a broad spectrum of research that spans basic pre-clinical, laboratory research, supportive and palliative care research, early detection, and randomized controlled clinical trials. The Division also supports the Cancer Prevention Fellowship Program and is devoted to the balanced communication of scientific results.

  16. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    Czech Academy of Sciences Publication Activity Database

    Lavery, R.; Zakrzewska, K.; Beveridge, D.; Bishop, T. C.; Case, D. A.; Cheatham III, T. E.; Dixit, S.; Jayaram, B.; Lankaš, Filip; Laughton, Ch.; Maddocks, J. H.; Michon, A.; Osman, R.; Orozco, M.; Pérez, A.; Singh, T.; Špačková, Naďa; Šponer, Jiří

    2010-01-01

    Roč. 38, č. 1 (2010), s. 299-313 ISSN 0305-1048 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) IAA400040802; GA ČR GA203/09/1476; GA MŠk LC512 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : B-DNA * molecular dynamics * sequence dependet structure and dynamics Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 7.836, year: 2010

  17. Non-Watson-Crick base pairing in RNA. Quantum chemical analysis of the cis Watson-Crick/sugar edge base pair family

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Špačková, Naďa; Kulhánek, Petr; Leszczynski, Jerzy; Šponer, Jiří

    2005-01-01

    Roč. 109, č. 10 (2005), s. 2292-2301 ISSN 1089-5639 R&D Projects: GA ČR(CZ) GA203/05/0009 Institutional research plan: CEZ:AV0Z50040507 Keywords : large ribosomal sub-unit * non-empirical ab initio * interacting edges Subject RIV: BO - Biophysics Impact factor: 2.898, year: 2005

  18. Theoretical Study of the Scalar Coupling Constants across the Noncovalent Contacts in RNA Base Pairs: The cis- and trans-Watson-Crick/Sugar Edge Base Pair Family

    Czech Academy of Sciences Publication Activity Database

    Vokáčová, Zuzana; Šponer, Jiří; Šponer, Judit E.; Sychrovský, Vladimír

    2007-01-01

    Roč. 111, č. 36 (2007), s. 10813-10824 ISSN 1520-6106 R&D Projects: GA ČR GA203/05/0388; GA ČR GA203/06/0420; GA AV ČR IAA400550701; GA MŠk(CZ) LC06030 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507 Keywords : NMR * hydrogen bond * RNA Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.086, year: 2007

  19. The structure of metallo-DNA with consecutive thymine-Hg-II-thymine base pairs explains positive entropy for the metallo base pair formation

    Czech Academy of Sciences Publication Activity Database

    Yamaguchi, H.; Šebera, Jakub; Kondo, J.; Oda, S.; Komuro, T.; Kawamura, T.; Dairaku, T.; Kondo, Y.; Okamoto, I.; Ono, A.; Burda, J. V.; Kojima, C.; Sychrovský, Vladimír; Tanaka, Y.

    2014-01-01

    Roč. 42, č. 6 (2014), s. 4094-4099 ISSN 0305-1048 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : NMR structures * mercury * metalation * metal-DNA binding * DFT Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 9.112, year: 2014 http://nar.oxfordjournals.org/content/42/6/4094.full

  20. Evaluation Methods for Prevention Education.

    Science.gov (United States)

    Blue, Amy V.; Barnette, J. Jackson; Ferguson, Kristi J.; Garr, David R.

    2000-01-01

    Discusses the importance of assessing medical students' competence in prevention knowledge, skills, and attitudes. Provides general guidance for programs interested in evaluating their prevention instructional efforts, and gives specific examples of possible methods for evaluating prevention education. Stresses the need to tailor assessment…

  1. INITIAL ALLERGY PREVENTION IN CHILDREN

    Directory of Open Access Journals (Sweden)

    A.N. Pampura

    2009-01-01

    Full Text Available Allergy prevention is an urgent pediatric issue. Food allergy spread among infants amounts to 6–8%. This review highlights the modern viewpoints on diet prevention of this pathology among children, including by means of the hypoallergic nutritional formulas.Key words: food allergy, prevention, allergies, prebiotics, children.

  2. Toward suicide prevention.

    Science.gov (United States)

    Rao, V A

    1999-10-01

    Suicide is an important mode of death. There are many psychiatrically ill patients in therapy running different degree of suicide risk. The risk of death by suicide is with almost all psychiatric illnesses, but it is found more with depressive disease, schizophrenia and personality disorder. Many studies have reported higher incidences of suicide attempts and suicide among alcoholics, which is often precipitated by family crises. Drug problems, low threshold for tolerance of day to day frustration, unemployement and poor parenting are major causes for youth suicide.There is biological evidence of suicidal behaviour. Fall in the level of serotonin and 5-HIAA in the CSF and in hind brain is found in subjects dying from suicide. Researchers have found decreased melatonin level in depression and suicide attempters. Long term therapy with antidepressants (Tricyclics), mood stabilizers (lithium and valproate) and new SSRIs prevent relapses and lessen suicide. It was concluded that general hospital doctors are in position of reducing suicide rates. Education of physician in detection of depression and suicide prevention will result in decline in number of suicides. The important measures include limiting the ability of methods of self-harm, antidepressants, paracetamol and insecticides.

  3. Lipids in preventive dentistry.

    Science.gov (United States)

    Kensche, A; Reich, M; Kümmerer, K; Hannig, M; Hannig, C

    2013-04-01

    There is still a great demand for the improvement of oral prophylaxis methods. One repeatedly described approach is rinsing with edible oils. The aim of the present review paper was to analyze the role of lipids in bioadhesion and preventive dentistry. Despite limited sound scientific data, extensive literature search was performed to illustrate possible effects of lipids in the oral cavity. It is to be assumed that lipophilic components modulate the process of bioadhesion to the oral hard tissues as well as the composition and ultrastructure of the initial oral biofilm or the pellicle, respectively. Thereby, lipids could add hydrophobic characteristics to the tooth surface hampering bacterial colonization and eventually decreasing caries susceptibility. Also, a lipid-enriched pellicle might be more resistant in case of acid exposure and could therefore reduce the erosive mineral loss. Furthermore, anti-inflammatory effects on the oral soft tissues were described. However, there is only limited evidence for these beneficial impacts. Neither the lipid composition of saliva and pellicle nor the interactions of lipids with the initial oral biofilm and the pellicle layer have been investigated adequately until now. Edible oils might qualify as mild supplements to conventional strategies for the prevention of caries, erosion, and periodontal diseases but further research is necessary. Against the background of current scientific and empirical knowledge, edible oils might be used as oral hygiene supplements but a decisive benefit for the oral health status is questionable.

  4. Exercise Prevents Mental Illness

    Science.gov (United States)

    Purnomo, K. I.; Doewes, M.; Giri, M. K. W.; Setiawan, K. H.; Wibowo, I. P. A.

    2017-03-01

    Multiple current studies show that neuroinflammation may contribute to mental illness such as depression, anxiety, and mood disorder. Chronic inflammation in peripheral tissues is indicated by the increase of inflammatory marker like cytokine IL-6, TNF-α, and IL-1β. Pro-inflammatory cytokine in peripheral tissues can reach brain tissues and activate microglia and it causes neuroinflammation. Psychological stress may led peripheral and central inflammation. Activated microglia will produce pro-inflammatory cytokine, ROS, RNS, and tryptophan catabolizes. This neuroinflammation can promote metabolism changes of any neurotransmitter, such as serotonin, dopamine, and glutamate that will influence neurocircuit in the brain including basal ganglia and anterior cingulated cortex. It leads to mental illness. Exercise give contribution to reduce tissue inflammation. When muscle is contracting in an exercise, muscle will produce the secretion of cytokine like IL-6, IL-1ra, and IL-10. It will react as anti-inflammation and influence macrophage, T cell, monosit, protein Toll-Like Receptor (TLR), and then reduce neuroinflammation, characterised by the decrease of pro-inflammatory cytokine and prevent the activation of microglia in the brain. The objective of the present study is to review scientific articles in the literature related to the contribution of exercise to prevent and ease mental illness.

  5. Initiatives for proliferation prevention

    International Nuclear Information System (INIS)

    1997-04-01

    Preventing the proliferation of weapons of mass destruction is a central part of US national security policy. A principal instrument of the Department of Energy's (DOE's) program for securing weapons of mass destruction technology and expertise and removing incentives for scientists, engineers and technicians in the newly independent states (NIS) of the former Soviet Union to go to rogue countries or assist terrorist groups is the Initiatives for Proliferation Prevention (IPP). IPP was initiated pursuant to the 1994 Foreign Operations Appropriations Act. IPP is a nonproliferation program with a commercialization strategy. IPP seeks to enhance US national security and to achieve nonproliferation objectives by engaging scientists, engineers and technicians from former NIS weapons institutes; redirecting their activities in cooperatively-developed, commercially viable non-weapons related projects. These projects lead to commercial and economic benefits for both the NIS and the US IPP projects are funded in Russian, Ukraine, Kazakhstan and Belarus. This booklet offers an overview of the IPP program as well as a sampling of some of the projects which are currently underway

  6. Cholera - management and prevention.

    Science.gov (United States)

    Davies, Hannah G; Bowman, Conor; Luby, Stephen P

    2017-06-01

    Cholera is an acute secretory diarrhoeal infection caused by the bacterium Vibrio cholerae. It is likely to have originated in the Indian sub-continent; however, it spread to cause six worldwide pandemics between 1817-1923. The ongoing seventh worldwide pandemic of cholera began in 1961. The intensity, duration and severity of cholera epidemics have been increasing, signaling the need for more effective control and prevention measures. The response to the cholera pandemics of the 19th century led to the development of safe and effective sanitation and water systems which have effectively removed the risk of cholera in many settings. However, such systems are not in place to protect billions of people worldwide. Although some progress has been made in expanding access to water in recent years, achieving optimal infrastructure will, in the most optimistic scenario, take decades. Climate change, extreme weather events and rapid urbanisation suggests that alternatives to the current paradigm of providing large centralised water and sanitation systems should be considered, including smaller decentralised systems. The aim of this review paper is to provide an overview of current knowledge regarding management of cholera with a focus on prevention measures including vaccination and water and sanitation interventions. © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  7. Pressure ulcer prevention.

    Science.gov (United States)

    Edlich, Richard F; Winters, Kathryne L; Woodard, Charles R; Buschbacher, Ralph M; Long, William B; Gebhart, Jocelynn H; Ma, Eva K

    2004-01-01

    The purpose of this collective review is to outline the predisposing factors in the development of pressure ulcers and to identify a pressure ulcer prevention program. The most frequent sites for pressure ulcers are areas of skin overlying bony prominences. There are four critical factors contributing to the development of pressure ulcers: pressure, shearing forces, friction, and moisture. Pressure is now viewed as the single most important etiologic factor in pressure ulcer formation. Prolonged immobilization, sensory deficit, circulatory disturbances, and poor nutrition have been identified as important risk factors in the development of pressure ulcer formation. Among the clinical assessment scales available, only two, the Braden Scale and Norton Scale, have been tested extensively for reliability and/or validity. The most commonly used risk assessment tools for pressure ulcer formation are computerized pressure monitoring and measurement of laser Doppler skin blood flow. Pressure ulcers can predispose the patient to a variety of complications that include bacteremia, osteomyelitis, squamous cell carcinoma, and sinus tracts. The three components of pressure ulcer prevention that must be considered in any patient include management of incontinence, nutritional support, and pressure relief. The pressure relief program must be individualized for non-weight-bearing individuals as well as those that can bear weight. For those that can not bear weight and passively stand, the RENAISSANCE Mattress Replacement System is recommended for the immobile patient who lies supine on the bed, the stretcher, or operating room table. This alternating pressure system is unique because it has three separate cells that are not interconnected. It is specifically designed so that deflation of each individual cell will reach a ZERO PRESSURE during each alternating pressure cycle. The superiority of this system has been documented by comprehensive clinical studies in which this system

  8. Pressure Ulcer Prevention

    Science.gov (United States)

    2009-01-01

    Executive Summary In April 2008, the Medical Advisory Secretariat began an evidence-based review of the literature concerning pressure ulcers. Please visit the Medical Advisory Secretariat Web site, http://www.health.gov.on.ca/english/providers/program/mas/tech/tech_mn.html to review these titles that are currently available within the Pressure Ulcers series. Pressure ulcer prevention: an evidence based analysis The cost-effectiveness of prevention strategies for pressure ulcers in long-term care homes in Ontario: projections of the Ontario Pressure Ulcer Model (field evaluation) Management of chronic pressure ulcers: an evidence-based analysis (anticipated pubicstion date - mid-2009) Purpose A pressure ulcer, also known as a pressure sore, decubitus ulcer, or bedsore, is defined as a localized injury to the skin/and or underlying tissue occurring most often over a bony prominence and caused by pressure, shear, or friction, alone or in combination. (1) Those at risk for developing pressure ulcers include the elderly and critically ill as well as persons with neurological impairments and those who suffer conditions associated with immobility. Pressure ulcers are graded or staged with a 4-point classification system denoting severity. Stage I represents the beginnings of a pressure ulcer and stage IV, the severest grade, consists of full thickness tissue loss with exposed bone, tendon, and or muscle. (1) In a 2004 survey of Canadian health care settings, Woodbury and Houghton (2) estimated that the prevalence of pressure ulcers at a stage 1 or greater in Ontario ranged between 13.1% and 53% with nonacute health care settings having the highest prevalence rate (Table 1). Executive Summary Table 1: Prevalence of Pressure Ulcers* Setting Canadian Prevalence,% (95% CI) Ontario Prevalence,Range % (n) Acute care 25 (23.8–26.3) 23.9–29.7 (3418) Nonacute care† 30 (29.3–31.4) 30.0–53.3 (1165) Community care 15 (13.4–16.8) 13.2 (91) Mixed health care‡ 22 (20.9

  9. Xylitol and caries prevention.

    Science.gov (United States)

    Duane, Brett

    2015-06-01

    Cochrane Oral Health Group Trials Register, the Cochrane Central Register of Controlled Trials (CENTRAL), Medline, Embase, CINAHL, Web of Science Conference Proceedings, Proquest Dissertations and Theses, US National Institutes of Health Trials Register (http://clinicaltrials.gov) and the WHO Clinical Trials Registry Platform for ongoing trials. No language or year restrictions were used. Randomised controlled trials assessing the effects of xylitol products on dental caries in children and adults. Two review authors independently screened the results of the electronic searches, extracted data and assessed the risk of bias of the included studies. Authors were contacted where possible for missing data or clarification where feasible. For continuous outcomes, means and standard deviations were used to obtain the mean difference and 95% confidence interval (CI). Continuous data was used to calculate prevented fractions (PF) and 95% CIs to summarise the percentage reduction in caries. For dichotomous outcomes, reported risk ratios (RR) and 95% CIs were used. As there were fewer than four studies included in the meta-analysis, a fixed effect model was used. Ten studies were included with a total of 5903 participants. One study was assessed as being at low risk of bias, two were assessed as unclear risk of bias with seven at high risk of bias. Over 2.5–3 years, low quality evidence demonstrated that with 4216 children analysed, a fluoride toothpaste with 10% xylitol (exact dosage unsure) reduced caries by 13% when compared to a fluoride only toothpaste. (PF −0.13, 95% CI −0.18 to −0.08. Remaining evidence of the use of xylitol in children has risk of bias and uncertainty of effect and was therefore insufficient to determine a benefit from xylitol. Four studies reported that there were no adverse effects from any of the interventions. Two studies reported similar rates of adverse effects between study arms. The remaining studies either mentioned adverse effects

  10. Preventing undernutrition in Cambodia

    DEFF Research Database (Denmark)

    Skau, Jutta Kloppenborg Heick

    The first 1000 days (from conception to 24 months) of a child’s life are critical for long-term mental and physical development. This period is clearly marked as the optimal period of preventing malnutrition and named the “window of opportunity”. The first phase of complementary feeding (about 6......-12 months) is the most critical. This is the transitional phase when solid foods gradually start to replace breast milk. The typical diet of complementary food in low-income countries is dominated by a single starch-rich staple, with little vegetables and fruits and few or no animal source foods (ASF...... technique. Linear regression was used to assess the association of sex, breastfeeding, stunting and wasting as correlates of fat-free mass index (FFMI), fat mass index (FMI) and body mass index (BMI). This study showed that boys had a higher FFMI at 6 and 15 months of age. Stunted infants aged 6 months had...

  11. Primary Prevention With Statins

    DEFF Research Database (Denmark)

    Mortensen, Martin B; Afzal, Shoaib; Nordestgaard, Børge G

    2015-01-01

    BACKGROUND: Guidelines recommend initiating primary prevention for atherosclerotic cardiovascular disease (ASCVD) with statins based on absolute ASCVD risk assessment. Recently, alternative trial-based and hybrid approaches were suggested for statin treatment eligibility. OBJECTIVES: This study...... the population studied, 42% were eligible for statin therapy according to the 2013 American College of Cardiology/American Heart Association (ACC/AHA) risk assessment and cholesterol treatment guidelines approach, versus 56% with the trial-based approach and 21% with the hybrid approach. Among these statin......-eligible subjects, the ASCVD event rate per 1,000 person-years was 9.8, 6.8, and 11.2, respectively. The ACC/AHA-recommended absolute risk score was well calibrated around the 7.5% 10-year ASCVD risk treatment threshold and discriminated better than the trial-based or hybrid approaches. Compared with the ACC...

  12. Preventing Informal Urban Development

    DEFF Research Database (Denmark)

    Enemark, Stig; McLaren, Robin

    2008-01-01

    . This is directly linked to citizen participation in the process of land use control. Decentralisation should aim to combine responsibility for decision making with accountability for financial, social, and environmental consequences. Decentralisation requires access to appropriate quality of land information......, addresses the main issue of how to prevent informal urban development, especially through the use of adequate and sustainable means of land use control and good governance. Three key means are addressed: Decentralisation: There is a need to separate central policy/regulation making and local decision making......The issue of informal development was discussed in details at the joint FIG Com 3 and UNECE/WPLA workshop in Sounio, Greece, March 2007. Emphasis was given to the scale of the problem in Southern and Eastern Europe and to means of legalising such informal urban development. This paper, instead...

  13. [Cellulite - causes, prevention, treatment ].

    Science.gov (United States)

    Janda, Katarzyna; Tomikowska, Anna

    2014-01-01

    Cellulite is a multifactorial etiology ailment. It changes the skin topography by the formation of the skin surface's appearance, changes described as "orange peel". This prob- lem concerns 85-98% of women, and for them it is one of the most intolerable aesthetic imperfections. In the past few years the interest of scientists in this problem has clearly increased. Several theories on the pathophysiology of cel- lulite have been produced A number of different thera- peutic regimens have been developed using modern tech- nology. However, despite the many treatment options for cellulite, it is extremely important that patients should be aware that only multidirectional treatment can bring sat- isfactory results. The aim of this review was to describe the causes of cellulite, and its prevention and treatment.

  14. Crime prevention and Education

    DEFF Research Database (Denmark)

    Brønsted, Lone Bæk

    of such a preventive work aiming at creating trustful relations between the school and the children and focusing on children’s democracy understandings, experienced discrimination and peer pressure. Furthermore, the school are to activate children’s reflections on existential questions and their empathy with others...... social and cultural categorizations that marks what is legitimate and illegitimate behavior (Øland 2007, 2012; Bourdieu and Passeron 2006). The school as an institution plays a significant role in these studies and include studies of working class boys meeting with the school's middle and upper class...... standards (Willis 1977) and bilingual pupils' meeting with 'Danishness' through the teachers’ Danish middle class values (Gilliam 2009). The studies mark the school as an actor in societal social and cultural conflicts and are all concerned with differentiation and marginalization processes. Therefore...

  15. Health promotion, primary prevention and secondary prevention in general practice

    OpenAIRE

    Karl, Tatjana

    2013-01-01

    The WHO´s aims regarding healthcare for the European region are mainly based on health promotion and preventive as well as supporting health education. The Ottawa Charta declares health promotion as a process to provide all people with a higher degree of self-determination regarding their health and thereby enabling them to increase it. General practitioners are of major importance regarding the medical area of behaviour oriented prevention by promoting health and acting preventive. ...

  16. Preventing Child Sexual Abuse Early

    Directory of Open Access Journals (Sweden)

    Wenjing Zhang

    2015-02-01

    Full Text Available This study is aimed to examine preschool teachers’ knowledge of, attitudes about, and training related to child sexual abuse (CSA prevention in Beijing, China. Two hundred and forty-five preschool teachers were administered the 16-item questionnaire that contained questions on CSA prevention knowledge, attitudes, and teacher training. Results showed that Chinese preschool teachers had limited knowledge on CSA prevention (M = 4.86, SD = 2.12. Less than 5% of the teachers ever attended CSA prevention training programs. Preschool teachers’ training on CSA prevention was the significant factor for their knowledge and attitudes. To help protect children against sexual abuse, there is an urgent need to develop appropriate prevention training programs for preschool teachers in China.

  17. Politics of prevention: The emergence of prevention science.

    Science.gov (United States)

    Roumeliotis, Filip

    2015-08-01

    This article critically examines the political dimension of prevention science by asking how it constructs the problems for which prevention is seen as the solution and how it enables the monitoring and control of these problems. It also seeks to examine how prevention science has established a sphere for legitimate political deliberation and which kinds of statements are accepted as legitimate within this sphere. The material consists of 14 publications describing and discussing the goals, concepts, promises and problems of prevention science. The analysis covers the period from 1993 to 2012. The analysis shows that prevention science has established a narrow definition of "prevention", including only interventions aimed at the reduction of risks for clinical disorders. In publications from the U.S. National Institute of Drug Abuse, the principles of prevention science have enabled a commitment to a zero-tolerance policy on drugs. The drug using subject has been constructed as a rational choice actor lacking in skills in exerting self-control in regard to drug use. Prevention science has also enabled the monitoring and control of expertise, risk groups and individuals through specific forms of data gathering. Through the juxtaposition of the concepts of "objectivity" and "morality", prevention science has constituted a principle of delineation, disqualifying statements not adhering to the principles of prevention science from the political field, rendering ethical and conflictual dimensions of problem representations invisible. The valorisation of scientific accounts of drugs has acted to naturalise specific political ideals. It simultaneously marginalises the public from the public policy process, giving precedence to experts who are able to provide information that policy-makers are demanding. Alternative accounts, such as those based on marginalisation, poverty or discrimination are silenced within prevention science. Copyright © 2015 Elsevier B.V. All rights

  18. PREVENTION OF OCCUPATIONAL ACCIDENTS

    Directory of Open Access Journals (Sweden)

    Jovica Jovanovic

    2004-01-01

    Full Text Available Medical services, physicians and nurses play an essential role in the plant safety program through primary treatment of injured workers and by helping to identify workplace hazards. The physician and nurse should participate in the worksite investigations to identify specific hazard or stresses potentially causing the occupational accidents and injuries and in planning the subsequent hazard control program. Physicians and nurses must work closely and cooperatively with supervisors to ensure the prompt reporting and treatment of all work related health and safety problems. Occupational accidents, work related injuries and fatalities result from multiple causes, affect different segments of the working population, and occur in a myriad of occupations and industrial settings. Multiple factors and risks contribute to traumatic injuries, such as hazardous exposures, workplace and process design, work organization and environment, economics, and other social factors. With such a diversity of theories, it will not be difficult to understand that there does not exist one single theory that is considered right or correct and is universally accepted. These theories are nonetheless necessary, but not sufficient, for developing a frame of reference for understanding accident occurrences. Prevention strategies are also varied, and multiple strategies may be applicable to many settings, including engineering controls, protective equipment and technologies, management commitment to and investment in safety, regulatory controls, and education and training. Research needs are thus broad, and the development and application of interventions involve many disciplines and organizations.

  19. Selenium for preventing cancer

    Science.gov (United States)

    Vinceti, Marco; Dennert, Gabriele; Crespi, Catherine M; Zwahlen, Marcel; Brinkman, Maree; Zeegers, Maurice PA; Horneber, Markus; D'Amico, Roberto; Del Giovane, Cinzia

    2015-01-01

    Background This review is an update of the first Cochrane publication on selenium for preventing cancer (Dennert 2011). Selenium is a metalloid with both nutritional and toxicological properties. Higher selenium exposure and selenium supplements have been suggested to protect against several types of cancers. Objectives Two research questions were addressed in this review: What is the evidence for: an aetiological relation between selenium exposure and cancer risk in humans? andthe efficacy of selenium supplementation for cancer prevention in humans? Search methods We conducted electronic searches of the Cochrane Central Register of Controlled Trials (CENTRAL, 2013, Issue 1), MEDLINE (Ovid, 1966 to February 2013 week 1), EMBASE (1980 to 2013 week 6), CancerLit (February 2004) and CCMed (February 2011). As MEDLINE now includes the journals indexed in CancerLit, no further searches were conducted in this database after 2004. Selection criteria We included prospective observational studies (cohort studies including sub-cohort controlled studies and nested case-control studies) and randomised controlled trials (RCTs) with healthy adult participants (18 years of age and older). Data collection and analysis For observational studies, we conducted random effects meta-analyses when five or more studies were retrieved for a specific outcome. For RCTs, we performed random effects meta-analyses when two or more studies were available. The risk of bias in observational studies was assessed using forms adapted from the Newcastle-Ottawa Quality Assessment Scale for cohort and case-control studies; the criteria specified in the Cochrane Handbook for Systematic Reviews of Interventions were used to evaluate the risk of bias in RCTs. Main results We included 55 prospective observational studies (including more than 1,100,000 participants) and eight RCTs (with a total of 44,743 participants). For the observational studies, we found lower cancer incidence (summary odds ratio (OR) 0

  20. Prevention of nuclear war

    International Nuclear Information System (INIS)

    Lifton, R.J.

    1980-01-01

    Physicians are exercising their responsibility as healers in their efforts to prevent nuclear war. Death for Hiroshima survivors was experienced in four stages: the immediate impact of destruction, the acute impact of radiation, delayed radiation effects, and later identification as an atomic bomb survivor. Each phase had its physical and psychological impacts and negates Hiroshima as a model for rational behavior despite those who claim survival is possible for those who are prepared. The psychic effects of modern nuclear, chemical, and germ warfare need to be challenged with a symbolization of life and immortality. Studies of psychological reactions to the terror children felt during practice air-raid drills indicate that the fears can be surpressed and re-emerge in adult life as a linking of death with collective annihilation. Other themes which emerge are feelings of impermanence, craziness, identification with the bomb, and a double existence. Psychic numbing and the religion of nuclearism cause dangerous conflicts with the anxieties caused by increasing awareness of death

  1. Trying to prevent abortion.

    Science.gov (United States)

    Bromham, D R; Oloto, E J

    1997-06-01

    It is known that, since antiquity, women confronted with an unwanted pregnancy have used abortion as a means of resolving their dilemma. Although undoubtedly widely used in all historical ages, abortion has come to be regarded as an event preferably avoided because of the impact on the women concerned as well as considerations for fetal life. Policies to reduce numbers and rates of abortion must acknowledge certain observations. Criminalization does not prevent abortion but increases maternal risks. A society's 'openness' in discussing sexual matters inversely correlates with abortion rates. Correlation between contraceptive use and abortion is also inverse but relates most closely to the efficacy of contraceptive methods used. 'Revolution' in the range of contraceptive methods used will have an equivalent impact on abortion rates. Secondary or emergency contraceptive methods have a considerable role to play in the reduction of abortion numbers. Good sex (and 'relationships') education programs may delay sexual debut, increase contraceptive usage and be associated with reduced abortion. Finally, interaction between socioeconomic factors and the choice between abortion and ongoing pregnancy are complex. Abortion is not necessarily chosen by those least able to support a child financially.

  2. Workplace harassment prevention in Finland

    OpenAIRE

    Lorek, Angelika

    2015-01-01

    The proposed research concerns the engagement of companies operating in Finland in prevention of workplace harassment. The main target of the thesis is to understand the importance of the prevention of workplace harassment in the work environment. Research analyses what measures companies take in order to prevent workplace harassment and how is it monitored. As a primary research, interview findings of four Finnish companies (“Company X”, DHL Finland, ISS Palvelut and Management Institute...

  3. Pollution prevention: A regulatory update

    International Nuclear Information System (INIS)

    Walzer, A.E.; Maynard, J.W.

    1993-01-01

    Pollution prevention is the emphasis of the 1990s environmental philosophy. This new environmental era was ushered in when President Bush signed the Pollution Prevention Act in October 1990. This law, with its accompanying philosophy, was in response to the realization that end-of-the-pipe treatment, which frequently changed the media in which a pollutant or waste was discharged, was inadequate to protect the environment and human health. Pollution prevention advocates source reduction, where material substitutions and engineering solutions are sought to reduce the volume and toxicity of waste and pollutants. This proactive approach reduces environmental impacts such as those of former waste sites which have produced environmental legacies that will cost billions of dollars and take decades to remediate. This paper describes pollution prevention philosophy and summarizes regulatory pollution prevention requirements. It describes current regulatory trends in the area of pollution prevention, including voluntary programs and enforcement actions. The Pollution Prevention Act of 1990 is described, and pollution prevention initiatives embodied in other laws, including the Clean Air Act, the Clean Water Act, the Emergency Planning and Community Right-To-Know Act, the Resource Conservation and Recovery Act, and the Toxic Substances Control Act, are discussed. A historical overview of waste minimization initiatives within the Department of Energy is given, and other pollution prevention initiatives that affect federal facilities, such as Executive Order 12780, which mandates recycling and the procurement of recycled materials, are also outlined

  4. Municipal water pollution prevention program

    International Nuclear Information System (INIS)

    1991-03-01

    EPA believes that the most effective and equitable means of assuring viability of this infrastructure is through environmentally preferred pollution prevention approaches especially through application of Municipal Water Pollution Prevention (MWPP). These approaches may enhance worker safety, improve the usability of sludge, increase the ability for local community expansion, and reduce operation and compliance costs. State-based municipal pollution prevention programs focus attention on a series of actions to prevent pollution in advance rather than taking more expensive corrective actions. MWPP encourages resource conservation to reduce water and energy use, appropriate pricing, toxicity reductions at the source, BOD reductions, recycling, proper treatment of wastes, and beneficial uses of sludge

  5. Nutrition and Cancer Prevention Research Practicum | Division of Cancer Prevention

    Science.gov (United States)

    The Nutritional Science Research Group in the Division of Cancer Prevention at the National Cancer Institute, National Institutes of Health and the Department of Nutrition at the Clinical Center, National Institutes of Health are offering a one week educational opportunity in "Nutrition and Cancer Prevention Research" for individuals with a sustained commitment to nutrition

  6. Prevention of Methamphetamine Abuse: Can Existing Evidence Inform Community Prevention?

    Science.gov (United States)

    Birckmayer, Johanna; Fisher, Deborah A.; Holder, Harold D.; Yacoubian, George S.

    2008-01-01

    Little research exists on effective strategies to prevent methamphetamine production, distribution, sales, use, and harm. As a result, prevention practitioners (especially at the local level) have little guidance in selecting potentially effective strategies. This article presents a general causal model of methamphetamine use and harms that…

  7. Crucial elements in suicide prevention strategies

    DEFF Research Database (Denmark)

    Nordentoft, Merete

    2011-01-01

    Ways of conceptualizing suicide prevention are reviewed briefly, and the preventive model: Universal, Selected, and Indicated prevention (USI) is chosen as the structure for the literature review, and the discussion. Universal preventive interventions are directed toward entire population; select...

  8. Selenium for preventing cancer.

    Science.gov (United States)

    Vinceti, Marco; Filippini, Tommaso; Del Giovane, Cinzia; Dennert, Gabriele; Zwahlen, Marcel; Brinkman, Maree; Zeegers, Maurice Pa; Horneber, Markus; D'Amico, Roberto; Crespi, Catherine M

    2018-01-29

    This review is the third update of the Cochrane review "Selenium for preventing cancer". Selenium is a naturally occurring element with both nutritional and toxicological properties. Higher selenium exposure and selenium supplements have been suggested to protect against several types of cancer. To gather and present evidence needed to address two research questions:1. What is the aetiological relationship between selenium exposure and cancer risk in humans?2. Describe the efficacy of selenium supplementation for cancer prevention in humans. We updated electronic searches of the Cochrane Central Register of Controlled Trials (CENTRAL; 2017, Issue 2), MEDLINE (Ovid, 2013 to January 2017, week 4), and Embase (2013 to 2017, week 6), as well as searches of clinical trial registries. We included randomised controlled trials (RCTs) and longitudinal observational studies that enrolled adult participants. We performed random-effects (RE) meta-analyses when two or more RCTs were available for a specific outcome. We conducted RE meta-analyses when five or more observational studies were available for a specific outcome. We assessed risk of bias in RCTs and in observational studies using Cochrane's risk assessment tool and the Newcastle-Ottawa Scale, respectively. We considered in the primary analysis data pooled from RCTs with low risk of bias. We assessed the certainty of evidence by using the GRADE approach. We included 83 studies in this updated review: two additional RCTs (10 in total) and a few additional trial reports for previously included studies. RCTs involved 27,232 participants allocated to either selenium supplements or placebo. For analyses of RCTs with low risk of bias, the summary risk ratio (RR) for any cancer incidence was 1.01 (95% confidence interval (CI) 0.93 to 1.10; 3 studies, 19,475 participants; high-certainty evidence). The RR for estimated cancer mortality was 1.02 (95% CI 0.80 to 1.30; 1 study, 17,444 participants). For the most frequently

  9. Postpartum haemorrhage: prevention.

    Science.gov (United States)

    Chelmow, David

    2011-04-04

    Loss of more than 500 mL of blood following childbirth is usually caused by failure of the uterus to contract fully after delivery of the placenta, and occurs in over 10% of deliveries, with a 1% mortality rate worldwide. Other causes of postpartum haemorrhage include retained placental tissue, lacerations to the genital tract, and coagulation disorders. Uterine atony is more likely in women who have had a general anaesthetic or oxytocin, an over-distended uterus, a prolonged or precipitous labour, or who are of high parity. We conducted a systematic review and aimed to answer the following clinical questions: What are the effects of non-drug interventions and of drug interventions to prevent primary postpartum haemorrhage? We searched: Medline, Embase, The Cochrane Library, and other important databases up to March 2010 (Clinical Evidence reviews are updated periodically; please check our website for the most up-to-date version of this review). We included harms alerts from relevant organisations such as the US Food and Drug Administration (FDA) and the UK Medicines and Healthcare products Regulatory Agency (MHRA). We found 40 systematic reviews, RCTs, or observational studies that met our inclusion criteria. We performed a GRADE evaluation of the quality of evidence for interventions. In this systematic review we present information relating to the effectiveness and safety of the following interventions: active management of the third stage of labour, carboprost injection, controlled cord traction, ergot compounds (ergometrine/methylergotamine), immediate breastfeeding, misoprostol (oral, rectal, sublingual, or vaginal), oxytocin, oxytocin plus ergometrine combinations, prostaglandin E2 compounds, and uterine massage.

  10. Drug Education & Prevention. Chapter 9.

    Science.gov (United States)

    Acampora, Alfonso P., Ed.; Nebelkopf, Ethan, Ed.

    This document contains seven papers from the ninth World Conference of Therapeutic Communities (TCs) that deal with drug education and prevention. Papers include: (1) "State of the Art of Drug Prevention Programs: A Five Year Retrospective of School Curricula" (Natalie Silverstein, et al.); (2) "TCs: Education for Wholeness"…

  11. Get Real about Diabetes Prevention

    Centers for Disease Control (CDC) Podcasts

    2007-11-01

    This podcast delivers a diabetes prevention message promoting small steps that can lead to big rewards.  Created: 11/1/2007 by National Diabetes Education Program (NDEP), a joint program of the Centers for Disease Control and Prevention and the National Institutes of Health.   Date Released: 11/15/2007.

  12. Disaster: Prevention, Preparedness and Action.

    Science.gov (United States)

    Buchanan, Sally

    1981-01-01

    Discission of threat of disaster to library archival materials focuses on prevention (building maintenance, materials storage, fire prevention), preparedness (preplanning, procedures for handling emergencies, finances of recovery operation), and action (instructions for handling damaged materials). Current library activities in disaster planning…

  13. Can atopic dermatitis be prevented?

    Science.gov (United States)

    Gómez-de la Fuente, E

    2015-05-01

    Atopic dermatitis has become a health problem in our setting due to its rising prevalence, impact on quality of life, associated costs, and role in the progression to other atopic diseases. Furthermore, atopic dermatitis has no definitive cure and therefore preventive measures are important. In this article, we review the latest advances in both primary prevention (reduction of the incidence of atopic dermatitis) and secondary prevention (reduction of associated morbidity and reduction of the atopic march). We analyze the different preventive strategies available, including modification of the immune system through microbial exposure, induction of immune tolerance through antigen exposure, and restoration of skin barrier function to halt the atopic march. Dermatologists need to be familiar with these strategies in order to apply them where necessary and to accurately inform patients and their relatives to prevent misguided or inappropriate actions. Copyright © 2014 Elsevier España, S.L.U. and AEDV. All rights reserved.

  14. Pharmacological prevention of relapse.

    Science.gov (United States)

    Lader, M

    1998-07-01

    Relapse is the "return of a disease after partial recovery", and is a major feature of schizophrenia disorder. It can be defined in terms of need for change in treatment, including rehospitalization or crisis intervention, the re-emergence of florid psychotic features, or gross social decompensation. Relapse is best viewed as continuum of severity rather than as discrete "attacks". Factors influencing relapse include major life events and the family constellation. Antipsychotic drugs protect against the latter but not the former, and relapse may be mediated by non-specific arousal mechanisms. The efficacy of drug treatment in postponing rather than preventing relapse is well established. The interval between relapses is prolonged at least two-fold, but in the long run most patients relapse. Unwanted effects of antipsychotic drugs can be a burden to patients, impairing quality of life. In particular, movement disorders and subjective dysphoria may be marked, as may compliance. Of these EPS, tardive dyskinesia is the most serious on long term use. Non-EPS long term effects include weight gain and endocrine changes. Depot medication has advantages over oral medication in the more ill, less compliant patients. Side effects may, however, be more marked. The greatest pain is in improved compliance but the regular supervision of the patient is also helpful. Pharmacokinetic issues are poorly understood. High and mega-dose strategies have been advocated. High doses may be needed in some patients, but megadoses are rarely justified and may be hazardous. Low dose and intermittent therapy have been evaluated but are not as successful as hoped. Some less ill patients may benefit. These schedules depend on the identification of prodromata of relapse which is not always easy, nor are relapses necessarily preceded by prodromata. Newer drugs are being developed rapidly in the search for a safer clozapine, the only antipsychotic with definitely enhanced efficacy. Other drugs which

  15. Managing purchasing of non-product related (NPR) goods and services - On horizontal frictions and vertical ignorance

    NARCIS (Netherlands)

    de Boer, L.; Sitar-Pop, C.E.

    2001-01-01

    This paper investigates the current practice with regard to the involvement of the purchasing department(s) in NPR purchasing. First we review the literature about NPR purchasing, and especially the major benefits and challenges of involving purchasing department in NPR purchasing. Furthermore the

  16. Generation and characterization of an anti-delta like ligand-4 Nanobody to induce non-productive angiogenesis.

    Science.gov (United States)

    Baharlou, Rasoul; Tajik, Nader; Habibi-Anbouhi, Mahdi; Shokrgozar, Mohammad Ali; Zarnani, Amir-Hassan; Shahhosseini, Fatemeh; Behdani, Mahdi

    2018-03-01

    Antibody-based targeting of angiogenesis is a key approach for cancer treatment. Delta-like ligand 4 (DLL4) plays a pivotal role in tumor neovascular development and angiogenesis during tumor progression. It forecasts the prognosis of human malignancies and blocking its signaling can help to inhibit neovascularization and tumor metastasis. Nanobodies are the smallest antigen-binding domains of heavy chain antibodies in camelidae. The aim of this study was to develop a Nanobody against DLL4 and apply binding and functional approaches to target it. In this work, a Nanobody library against human recombinant DLL4 was developed. After panning, the periplasmic-extract (PE) of individual colonies were screened through ELISA. The interactions between Nanobody and DLL4 were assessed using immunohistochemistry and FACS. The functional assessment was carried out via tube formation assay. We selected a Nanobody (3Nb3) with a high binding signal to DLL4, associated with a binding affinity of 3.6 nM. It was demonstrated that 3Nb3 binds to native DLL4 on the surface of MKN cells and gastric carcinoma tissue, and also inhibits the maturation of capillary-like structures in HUVECs. The results were indicative of the potential of Nanobody for DLL4 identification and can broaden the scope for development of cancer diagnosis and treatment techniques. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Fraud prevention in paying portal

    Science.gov (United States)

    Sandhu, P. S.; Senthilkumar, N. C.

    2017-11-01

    The purpose of presenting this paper is to give the idea to prevent the fraud in finance paying portals as fraud is increasing on daily basis and mostly in financial sector. So through this paper we are trying to prevent the fraud. This paper will give you the working algorithm through which you can able to prevent the fraud. Algorithm will work according to the spending amount of the user, which means that use will get categories into one of the low, medium, high or very high category.

  18. [Prevention of pressure ulcer (bedsore)].

    Science.gov (United States)

    Sedmak, Dijana; Vrhovec, Marina; Huljev, Dubravko

    2013-10-01

    Although progress in many fields of science, medicine and technology is evident, we are still witnessing the appearance of bedsores and its consequences. However, in the last fifty years there has been considerable progress in the understanding of its causes, prevention and treatment. Prevention and treatment of pressure ulcers are complicated by the many misconceptions. However, with due knowledge of the process of healing of acute and chronic wounds and of the pathophysiological processes, in many cases chronic wounds, like pressure ulcers, can now be prevented and cured, and thus reduce the cost of treatment, as well as the mortality rate.

  19. Injury Prevention in Youth Sports.

    Science.gov (United States)

    Stracciolini, Andrea; Sugimoto, Dai; Howell, David R

    2017-03-01

    Children and adolescents are now participating in competitive sports at younger ages and with increasing intensity. As a result, increasing numbers of young athletes are presenting to pediatricians for care of sports-related injuries and advice about prevention. Understanding and identifying modifiable risk factors for injury in the young athletic population is a critical first step in injury prevention. Risk factors vary by sport, age, and sex. This article reviews the most common risk factors for injury and the evidence to support proposed strategies for prevention. [Pediatr Ann. 2017;46(3):e99-e105.]. Copyright 2017, SLACK Incorporated.

  20. Pollution prevention and air quality

    International Nuclear Information System (INIS)

    Fuentes Hector; Tsihrintzis Vassilios

    1997-01-01

    Pollution prevention (P2) results from the combined effect of the public opinion, a new environmental value system, government regulation, but above all, the search for an economic development within the context of environmental protection. The reasons for prevention are fundamental: profit from a new economic frontier; reduced potential for civil and criminal liability; and the effective and economic protection of the environment. This paper addresses, among other relevant issues, the following topics: justification and objective of pollution prevention; strategy and methodology for its implementation; examples of successes and tools; benefits and barriers and some recommendation

  1. Exercises to help prevent falls

    Science.gov (United States)

    ... slowly and easily. DO NOT hold your breath. Balance Exercises You can do some balance exercises during ... fall prevention in the elderly: what about agility? Sports Med . 2016;46:143-149. PMID: 26395115 www. ...

  2. Glossary of Suicide Prevention Terms

    Science.gov (United States)

    ... public through various media such as radio, television, advertisements, newspapers, magazines, and billboards. Public Health Approach – the ... used for an injury that is unplanned; in many settings these are termed accidental injuries. Universal preventive ...

  3. Preventing Breast Cancer: Making Progress

    Science.gov (United States)

    ... Home Current Issue Past Issues Preventing Breast Cancer: Making Progress Past Issues / Fall 2006 Table of Contents ... the time a woman is taking the pills, notes Leslie Ford, M.D., associate director for NCI's ...

  4. Preventative maintenance program for bridges.

    Science.gov (United States)

    2015-07-01

    The Kentucky Transportation Cabinets (KYTC) bridge inventory is rapidly aging. As such, the Cabinet : needs to identify and implement relevant preventative maintenance (PM) actions to extend the useful : service lives of those structures. Maintena...

  5. Preventive maintenance study : interim report.

    Science.gov (United States)

    2017-09-01

    This interim report details the performance of 69 test sites treated with various preventive maintenance treatments. The maintenance treatments applied included crack sealing, full lane chip sealing, wheel path chip sealing, dig outs (mill and fill),...

  6. Body Lice Prevention and Control

    Science.gov (United States)

    ... Frequently Asked Questions (FAQs) Epidemiology & Risk Factors Disease Biology Diagnosis Treatment Prevention & Control Resources for Health Professionals Publications Get Email Updates To receive email updates about this page, enter ...

  7. Ethical aspects of obesity prevention.

    Science.gov (United States)

    Ten Have, Marieke

    2014-04-01

    Programs to prevent overweight and obesity are needed in order to improve individual and public health, to support informed choice and to diminish the societal costs associated with overweight. However, lifestyle interventions frequently evoke ethical debate. The potential ethical pitfalls that arise with respect to the prevention of overweight regard consequences for physical health, psychosocial well-being, equality, informed choice, social and cultural values, privacy, the attributions of responsibilities and liberty. For doctors in gastroenterology, it is important to be aware of these ethical pitfalls, either because they apply directly to questions in the consulting-room, or because they help to create awareness of the societal context a patient lives in. An ethical framework is being presented to show which ethical issues play a role in obesity prevention and how they can be prevented, followed by reflection on the ethical issues in interventions and in policy and media debate. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Prevent Injury After a Disaster

    Science.gov (United States)

    ... Preventing Violence Pressure Washer Safety Trench Foot or Immersion Foot Emergency Wound Care Wound Management for Healthcare ... as hard hat, safety glasses, hearing protection, heavy work gloves, and cut-resistant legwear. Avoid contact with ...

  9. Allergy and asthma prevention 2014

    DEFF Research Database (Denmark)

    Nieto, Antonio; Wahn, Ulrich; Bufe, Albrecht

    2014-01-01

    in high-risk infants reduces the incidence of atopic dermatitis, while there is for now not enough evidence to recommend other dietary modifications, pre-biotics, probiotics, or other microbial products. Pharmacologic agents used until now for prevention have not proved useful, while there is hope......Asthma and allergic diseases have become one of the epidemics of the 21st century in developed countries. Much of the success of other areas of medicine, such as infectious diseases, lies on preventive measures. Thus, much effort is also being placed lately in the prevention of asthma and allergy....... This manuscript reviews the current evidence, divided into four areas of activity. Interventions modifying environmental exposure to allergens have provided inconsistent results, with multifaceted interventions being more effective in the prevention of asthma. Regarding nutrition, the use of hydrolyzed formulas...

  10. Can we prevent road rage?

    Science.gov (United States)

    Asbridge, Mark; Smart, Reginald G; Mann, Robert E

    2006-04-01

    Road rage has become a serious concern in many countries, and preventive efforts are required. This article reviews what can be done to prevent road rage by exploring potential prevention avenues in five areas. First, legal changes aimed at increasing the penalties for road rage behavior could be instituted, drawing on models from aggressive-driving or impaired-driving laws. A second approach would involve the adoption of court programs for convicted road ragers. Third, car redesign offers a means of reducing crime through environmental design. Fourth, mass media education could be implemented to inform drivers of the risk from road rage and how to avoid situations that facilitate road rage. Finally, prevention efforts could be directed to long-term societal changes that emphasize structural modifications, such as reducing congestion on the roads, reduced driver stress, or promoting public transportation. The strengths and weaknesses of these strategies are discussed.

  11. Conflict Prevention and Resolution Center

    Science.gov (United States)

    The Conflict Prevention and Resolution Center is EPA's primary resource for services and expertise in the areas of consensus-building, collaborative problem solving, alternative dispute resolution, and environmental collaboration and conflict resolution.

  12. Treating and Preventing Sports Hernias

    Science.gov (United States)

    ... Close ‹ Back to Healthy Living Treating and Preventing Sports Hernias If you play ice hockey, tennis or ... for the most commonly misdiagnosed groin pain—a sports hernia. A sports hernia often results from overuse ...

  13. Preventing hepatitis B or C

    Science.gov (United States)

    ... ency/patientinstructions/000401.htm Preventing hepatitis B or C To use the sharing features on this page, please enable JavaScript. Hepatitis B and hepatitis C infections cause irritation and swelling of the liver. ...

  14. Clinical Cancer Genetics and Prevention

    Science.gov (United States)

    Olufunmilayo F. Olopade MD, FACP, Professor of Medicine and Human Genetics and Director of the Cancer Risk Clinic Department of Medicine, BSD Section of Hematology/Oncology University of Chicago, presented "Clinical Cancer Genetics and Prevention".

  15. Genetics, Disease Prevention and Treatment

    Science.gov (United States)

    Skip to main content FAQ About Genetics, Disease Prevention and Treatment Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News ...

  16. Preventing Ticks on Your Pets

    Science.gov (United States)

    ... Fipronil Pyrethroids (permethrin, etc.) Amitraz Repel Ticks on Dogs A repellent product may prevent the tick from coming into contact with an animal at all or have anti-feeding effects once the tick comes into contact with ...

  17. Gravidomimetic Prevention of Breast Cancer

    National Research Council Canada - National Science Library

    Andersen, Thomas

    2002-01-01

    To test the hypothesis that a novel synthetic peptide can prevent breast cancer, we utilized a standard model to induce breast cancer in rats and initiated a dose-finding study in which four log doses...

  18. Tips to Prevent Tick Bites

    Science.gov (United States)

    Using the right insect repellent and other preventive actions can discourage ticks, mosquitoes, and other biting insects from landing on you. Tips include avoiding tick habitats and minimizing exposed skin.

  19. Tips to Prevent Mosquito Bites

    Science.gov (United States)

    Using the right insect repellent and other preventive actions can discourage mosquitoes from landing on you. Tips include removing mosquito habitats such as standing water, minimizing exposed skin, and staying indoors while mosquitoes are most active.

  20. [Prevention levels in occupational nursing].

    Science.gov (United States)

    Nogueira, Maria Jacyra de Campos

    1982-12-01

    The autor, based in nursing functions concepts of HENDERSON and of HORTA, and in the prevention levels of LEAVELL & CLARK, write about the of the occupational health nursing personnel in Brasil and describes their actions and activities.

  1. Noise and Hearing Loss Prevention

    Science.gov (United States)

    ... message, please visit this page: About CDC.gov . NOISE AND HEARING LOSS PREVENTION Language: English (US) Español ( ... when hazardous noise levels cannot be adequately reduced. Noise and Hearing Loss on the NIOSH Science Blog ...

  2. Lessons from obesity prevention for the prevention of mental disorders: the primordial prevention approach.

    Science.gov (United States)

    Hayward, Joshua; Jacka, Felice N; Waters, Elizabeth; Allender, Steven

    2014-09-10

    Emerging evidence supports a relationship between risk factors for obesity and the genesis of the common mental disorders, depression and anxiety. This suggests common mental disorders should be considered as a form of non-communicable disease, preventable through the modification of lifestyle behaviours, particularly diet and physical activity. Obesity prevention research since the 1970's represents a considerable body of knowledge regarding strategies to modify diet and physical activity and so there may be clear lessons from obesity prevention that apply to the prevention of mental disorders. For obesity, as for common mental disorders, adolescence represents a key period of vulnerability. In this paper we briefly discuss relationships between modifiable lifestyle risk factors and mental health, lifestyle risk factor interventions in obesity prevention research, the current state of mental health prevention, and the implications of current applications of systems thinking in obesity prevention research for lifestyle interventions. We propose a potential focus for future mental health promotion interventions and emphasise the importance of lessons available from other lifestyle modification intervention programmes.

  3. Bullying Prevention for the Public

    Centers for Disease Control (CDC) Podcasts

    2012-01-19

    This is the first podcast of a series to discuss the severity of bullying and provide resources for prevention efforts. CDC shares the most recent statistics and trends, provides valuable tips to implement in communities, and teaches individuals how to take action against bullying.  Created: 1/19/2012 by National Center for Injury Prevention and Control (NCIPC).   Date Released: 1/19/2012.

  4. Skin contamination - prevention and decontaminating

    International Nuclear Information System (INIS)

    Henning, K.

    2001-01-01

    A detailed examination is made of the structure of human skin. Measures were drawn up to prevent skin contamination in nuclear installations as well as contaminated skin was decontaminated from the personnel. By systematically applying these measures a significant level of success was achieved in preventing contamination in nuclear installations. Cases where more far-reaching chemical methods had to be used were kept to a minimum. (R.P.)

  5. Preventive strategies for substance use

    Directory of Open Access Journals (Sweden)

    Anju Dhawan

    2017-01-01

    Full Text Available Drug use among adolescents is on the rise, posing a great challenge to the health-care providers. The above concerns have led to recent research initiatives aiming at the development of preventive interventions for adolescents. This review gives an overview of such initiatives which target at reducing modifiable risk factors and enhancing protective factors through family, school, and community prevention programs.

  6. Prevention of Infection in Pregnancy

    Directory of Open Access Journals (Sweden)

    William J. Ledger

    1997-01-01

    Full Text Available We believe the prevention of infection-related adverse pregnancy outcome is the most important focus for obstetricians today. An emphasis upon immunization of susceptible women, prevention of transmissible disease by modification of patient behavior, and identification and treatment of silent infections should become standards of practice. This will require educational initiatives for physicians and their patients as well as continued clinical trials to determine costs and effectiveness.

  7. Musculoskeletal Health and Injury Prevention

    Science.gov (United States)

    2008-07-01

    involving the lateral ankle . • Ankle sprains represent 21 to 53% and 17 to 29% of all basketball and soccer injuries respectively. • Ankle sprains...Musculoskeletal Health and Injury Prevention Francis G. O’Connor, MD, MPH Patricia A. Deuster, PhD, MPH Department of Military and Emergency...DATES COVERED - 4. TITLE AND SUBTITLE Musculoskeletal Health and Injury Prevention 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  8. A naproxen complex of dysprosium intercalates into calf thymus DNA base pairs

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Mengsi; Jin, Jianhua; Xu, Guiqing [School of Chemistry and Chemical Engineering, Key Laboratory of Green Chemical Media and Reactions, Ministry of Education, Henan Normal University, Xinxiang 453007 (China); Cui, Fengling, E-mail: fenglingcui@hotmail.com [School of Chemistry and Chemical Engineering, Key Laboratory of Green Chemical Media and Reactions, Ministry of Education, Henan Normal University, Xinxiang 453007 (China); Luo, Hongxia [Department of Chemistry, Renmin University of China, Beijing 100872 (China)

    2014-01-15

    Highlights: • Binding mode to ctDNA was studied by various methods. • Intercalation is the most possible binding mode. • Dynamic and static quenching occurred simultaneously. • Hydrophobic force played a major role. • Binding characteristic of rare earth complexes to DNA are dependent on the element. - Abstract: The binding mode and mechanism of dysprosium–naproxen complex (Dy–NAP) with calf thymus deoxyribonucleic acid (ctDNA) were studied using UV–vis and fluorescence spectra in physiological buffer (pH 7.4). The results showed that more than one type of quenching process occurred and the binding mode between Dy–NAP with ctDNA might be intercalation. In addition, ionic strength, iodide quenching and fluorescence polarization experiments corroborated the intercalation binding mode between Dy–NAP and ctDNA. The calculated thermodynamic parameters ΔG, ΔH and ΔS at different temperature demonstrated that hydrophobic interaction force played a major role in the binding process.

  9. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

    Science.gov (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

    2012-02-15

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A is ~28% of that of T-A, and most of this interaction does not arise from the F···HN interaction, but rather from the CH···N interaction. The nucleobase analogue shows no inherent selectivity for adenine over other bases, and L-A pairing energies are slightly weaker than for F-A. Overall, the results are consistent with a small favorable noncovalent interaction of F with A offset by a large desolvation cost for the polar partner. We discuss the findings in light of recent structural studies and of DNA replication experiments involving these analogues.

  10. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs

    OpenAIRE

    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.

    2012-01-01

    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  11. Computational analysis of the stabilization effects in successive U-Hg-U base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Sychrovský, Vladimír

    2010-01-01

    Roč. 17, 1a (2010), b14-b14 ISSN 1210-8529. [Discussions in Structural Molecular Biology /8./. 18.03.-20.03.2010, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : metallophilic attraction * metallated nucleic acids * mercury

  12. The revised 8307 base pair coding sequence of human thyroglobulin transiently expressed in eukaryotic cells

    NARCIS (Netherlands)

    van de Graaf, S. A.; Pauws, E.; de Vijlder, J. J.; Ris-Stalpers, C. R.

    1997-01-01

    We developed a transient transfection system for human thyroglobulin (TG) cDNA in both human thyroid cells and in COS-1 cells. Four overlapping TG cDNA fragments were amplified by reverse transcription-PCR from RNA of normal thyroid tissue. The most 5' fragment includes the natural translation

  13. Base pairing motifs involving 1,8-naphthyridine: an ab initio study

    Czech Academy of Sciences Publication Activity Database

    Czernek, Jiří

    2006-01-01

    Roč. 7, - (2006), s. 124-127. ISBN 90-6764-443-9. ISSN 1573-4196. [International Conference on Computational Methods in Sciences and Engineering. Chania, Crete, 27.10.2006-01.11.2006] R&D Projects: GA AV ČR KJB400500602; GA AV ČR 1ET400500402 Institutional research plan: CEZ:AV0Z40500505 Keywords : ab initio * electron correlation * MP2 Subject RIV: CD - Macromolecular Chemistry

  14. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  15. Studies of base pair sequence effects on DNA solvation based on all ...

    Indian Academy of Sciences (India)

    pdb1. 2.00. CATGGCCATG. 158d.pdb1. 1.90. CCAAGCTTGG. 167d.pdb1. 2.30. CCATTAATGG. 194d.pdb1. 2.30. CGCGTTAACGCG. 196d.pdb1. 1.70. CTCTCGAGAG. 1bd1.pdb1. 1.60. CCAGGCCTGG. 1bdn.pdb1. 2.60. CGCAAAAATGCG.

  16. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  17. Asymmetric opening reaction mechanism of Z-DNA base pairs: a hydrogen exchange study

    International Nuclear Information System (INIS)

    Ramstein, J.; Vogt, N.; Leng, M.

    1985-01-01

    With the tritium-Sephadex method, the hydrogen-exchange kinetics of the five NH protons of guanine and cytosine residues in Z-form poly(dG-dC) X poly (dG-dC) were measured as a function of temperature and catalyst concentration. Over the measured temperature range from 0 to 34 degrees C, two classes of protons with constant amplitudes are found. The three protons of the fast class, which were assigned to the guanine amino and imino protons, have an exchange half-time in the minute time range (at 20 degrees C the half-time is 2.5 min) and an activation energy of 18 kcal mol-1. Since these two types of protons exchange at the same rate in spite of their grossly different pK values, the exchange of these protons must be limited by the same nucleic acid conformational change. The two cytosine amino protons of the slow class are especially slow with exchange half-times in the hour time range (at 20 degrees C the exchange half-time is 1 h) and the activation energy is 20 kcal mol-1. The exchange of these two protons is not limited by some nucleic acid conformational change as shown by the marked exchange acceleration of these protons upon addition of 0.2 M imidazole. In addition, we have also reexamined the hydrogen-deuterium exchange kinetics of the amino protons of guanosine cyclic 2',3'-monophosphate by a spectral difference method using a stopped-flow spectrophotometer. The measured kinetic process is monophasic with a rate constant of 3 s-1 at 20 degrees C, which is in the same range as the predicted rate constant of the guanine amino protons

  18. Charge transport in DNA oligonucleotides with various base-pairing patterns

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Todorciuc, Tatiana; Král, Karel; Němec, Hynek; Bunček, M.; Šebera, Jakub; Záliš, Stanislav; Vokáčová, Zuzana; Sychrovský, Vladimír; Bednárová, Lucie; Mojzeš, P.; Schneider, Bohdan

    2010-01-01

    Roč. 114, č. 15 (2010), 5196–5205 ISSN 1520-6106 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA ČR GA202/07/0643; GA AV ČR IAA400550701; GA AV ČR KAN200100801; GA AV ČR KAN100400702; GA ČR GA202/09/0193 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z40400503; CEZ:AV0Z40550506; CEZ:AV0Z50520701 Keywords : DNA * charge transport * Scanning Tunneling Microscopy Subject RIV: CC - Organic Chemistry Impact factor: 3.603, year: 2010

  19. Structure of 2,4-Diaminopyrimidine-Theobromine Alternate Base Pairs

    NARCIS (Netherlands)

    Gengeliczki, Z.; Callahan, M. P.; Kabelac, M.; Rijs, A. M.; de Vries, M. S.

    2011-01-01

    We report the structure of dusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate

  20. Structure of 2,4-Diaminopyrimidine-Theobromine Alternate Base Pairs

    Czech Academy of Sciences Publication Activity Database

    Gengeliczki, Z.; Callahan, M. P.; Kabeláč, Martin; Rijs, A. M.; de Vries, M. S.

    2011-01-01

    Roč. 115, č. 41 (2011), s. 11423-11427 ISSN 1089-5639 R&D Projects: GA MŠk LC512; GA AV ČR IAA400550808 Institutional research plan: CEZ:AV0Z40550506 Keywords : ab-initio calculations * double resonance spectroscopy * basis-set * guanine * cytosine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.946, year: 2011

  1. Imidazopyridopyrimidine base pairing motifs consisting of four hydrogen bonds: a quantum chemical study

    Czech Academy of Sciences Publication Activity Database

    Czernek, Jiří

    2004-01-01

    Roč. 392, 4-6 (2004), s. 508-513 ISSN 0009-2614 R&D Projects: GA AV ČR KJB4050311 Institutional research plan: CEZ:AV0Z4050913 Keywords : ab initio * stabilization * DNA Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.438, year: 2004

  2. New ab initio based pair potential for accurate simulation of phase transitions in ZnO

    NARCIS (Netherlands)

    Wang, Shuaiwei; Fan, Zhaochuan; Koster, Rik S.; Fang, Changming; Van Huis, Marijn A.; Yalcin, Anil O.; Tichelaar, Frans D.; Zandbergen, Henny W.; Vlugt, Thijs J H

    2014-01-01

    A set of interatomic pair potentials is developed for ZnO based on the partially charged rigid ion model (PCRIM). The derivation of the potentials combines lattice inversion, empirical fitting, and ab initio energy surface fitting. We show that, despite the low number of parameters in this model

  3. Theoretical NMR study of Watson-Crick/Sugar edge RNA base pair family

    Czech Academy of Sciences Publication Activity Database

    Vokáčová, Zuzana; Šponer, Jiří; Sychrovský, Vladimír

    2007-01-01

    Roč. 14, č. 1 (2007), L12-L12 ISSN 1211-5894. [Discussions in Structural Molecular Biology /6./. 29.03.2007-31.03.2007, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507 Keywords : Watson-Crick/Sugar edge * RNA * NMR Subject RIV: CF - Physical ; Theoretical Chemistry

  4. Deep RNA sequencing at single base-pair resolution reveals high complexity of the rice transcriptome

    DEFF Research Database (Denmark)

    Zhang, Guojie; Guo, Guangwu; Hu, Xueda

    2010-01-01

    fusion events are more common than expected. In-depth analysis revealed a multitude of fusion transcripts that might be by-products of alternative splicing. Validation and chimeric transcript structural analysis provided evidence that some of these transcripts are likely to be functional in the cell...

  5. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles

    Czech Academy of Sciences Publication Activity Database

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal

    2016-01-01

    Roč. 120, č. 27 (2016), s. 4720-4730 ISSN 1089-5639 R&D Projects: GA ČR GA14-14082S Institutional support: RVO:61388955 ; RVO:61388963 Keywords : doped nanoparticles * argon * biomolecules Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.847, year: 2016

  6. Comparison of Three Cre-LoxP Based Paired-End Library Construction Methods

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Ze; Nath, Nandita; Tritt, Andrew; Liang, Shoudan; Han, James; Pennacchio, Len; Chen, Feng

    2013-03-26

    Paired-end library sequencing has been proven useful in scaffold construction during de novo whole genome shotgun assembly. The ability of generating mate pairs with > 8 Kb insert sizes is especially important for genomes containing long repeats. To make mate paired libraries for next generation sequencing, DNA fragments need to be circularized to bring the ends together. There are several methods that can be used for DNA circulation, namely ligation, hybridization and Cre-LoxP recombination. With higher circularization efficiency with large insert DNA fragments, Cre-LoxP recombination method generally has been used for constructing >8 kb insert size paired-end libraries. Second fragmentation step is also crucial for maintaining high library complexity and uniform genome coverage. Here we will describe the following three fragmentation methods: restriction enzyme digestion, random shearing and nick translation. We will present the comparison results for these three methods. Our data showed that all three methods are able to generate paired-end libraries with greater than 20 kb insert. Advantages and disadvantages of these three methods will be discussed as well.

  7. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.

    Science.gov (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J

    2013-04-18

    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  8. A human B cell methylome at 100−base pair resolution

    Science.gov (United States)

    Rauch, Tibor A.; Wu, Xiwei; Zhong, Xueyan; Riggs, Arthur D.; Pfeifer, Gerd P.

    2009-01-01

    Using a methylated-DNA enrichment technique (methylated CpG island recovery assay, MIRA) in combination with whole-genome tiling arrays, we have characterized by MIRA-chip the entire B cell “methylome” of an individual human at 100-bp resolution. We find that at the chromosome level high CpG methylation density is correlated with subtelomeric regions and Giemsa-light bands (R bands). The majority of the most highly methylated regions that could be identified on the tiling arrays were associated with genes. Approximately 10% of all promoters in B cells were found to be methylated, and this methylation correlates with low gene expression. Notably, apparent exceptions to this correlation were the result of transcription from previously unidentified, unmethylated transcription start sites, suggesting that methylation may control alternate promoter usage. Methylation of intragenic (gene body) sequences was found to correlate with increased, not decreased, transcription, and a methylated region near the 3′ end was found in approximately 12% of all genes. The majority of broad regions (10–44 kb) of high methylation were at segmental duplications. Our data provide a valuable resource for the analysis of CpG methylation patterns in a differentiated human cell type and provide new clues regarding the function of mammalian DNA methylation. PMID:19139413

  9. NMR spectroscopic studies on metallo-base-pair in DNA duplex

    Czech Academy of Sciences Publication Activity Database

    Tanaka, Y.; Okamoto, I.; Furuita, K.; Šebera, Jakub; Kondo, J.; Torigoe, H.; Urata, H.; Dairaku, T.; Ono, A.; Kojima, C.; Sychrovský, Vladimír

    2014-01-01

    Roč. 19, Suppl 2 (2014), S732-S733 ISSN 0949-8257. [European Biological Inorganic Chemistry Conference /12./. 24.08.2014-28.08.2014, Zurich] Institutional support: RVO:61388963 Keywords : NMR * DNA * mercury * thymine Subject RIV: CF - Physical ; Theoretical Chemistry

  10. Base Pair Fraying in Molecular Dynamics Simulations of DNA and RNA

    Czech Academy of Sciences Publication Activity Database

    Zgarbová, M.; Otyepka, Michal; Šponer, Jiří; Lankaš, Filip; Jurečka, P.

    2014-01-01

    Roč. 10, č. 8 (2014), s. 3177-3189 ISSN 1549-9618 Grant - others:GA ČR(CZ) GP14-29874P Institutional support: RVO:68081707 ; RVO:61388963 Keywords : QUANTUM-CHEMICAL COMPUTATIONS * NUCLEIC-ACID STRUCTURES * AMBER FORCE-FIELD Subject RIV: BO - Biophysics; CC - Organic Chemistry (UOCHB-X) Impact factor: 5.498, year: 2014

  11. Hg-II/Ag-I-mediated base pairs and their NMR spectroscopic studies

    Czech Academy of Sciences Publication Activity Database

    Dairaku, T.; Furuita, K.; Sato, H.; Šebera, Jakub; Nakashima, K.; Ono, A.; Sychrovský, Vladimír; Kojima, C.; Tanaka, Y.

    2016-01-01

    Roč. 452, Oct 1 (2016), s. 34-42 ISSN 0020-1693 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : NMR * Hg * Ag * metal-DNA Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  12. Electronic structure of an anticancer drug DC81 and its interaction with DNA base pairs

    Energy Technology Data Exchange (ETDEWEB)

    Tiwari, Gargi, E-mail: gargi.tiwari@rediffmail.com; Sharma, Dipendra, E-mail: d-11sharma@rediffmail.com; Dwivedi, K. K., E-mail: dwivedikarunesh4@gmail.com [Department of Physics, DDU Gorakhpur University, Gorakhpur (India); Dwivedi, M. K., E-mail: dwivedi-ji@rediffmail.com [Department of Physics, Banaras Hindu University, Varanasi (India)

    2016-05-06

    The drug, 8-Hydroxy-7-methoxy-pyrrolo-[2,1-c][1,4] benzodiazepine-5-one, commonly christened as DC81 belongs to the pyrrolo-[2,1-c][1,4]benzodiazepine (PBDs) family. It is a member of the group of naturally occurring antitumour antibiotics produced by various Streptomyces species. The antitumour activity of DC81 is attributed to its sequence specific interaction with G-C rich DNA region in particular, for Pu-G-Pu motifs. In the present paper, physico-chemical properties DC81 have been carried out using an ab-initio method, HF/6-31G(d,p) with GAMESS program. MEP, HOMO and LUMO surfaces have been scanned. Ionization potential, electron affinity, electronegativity, global hardness and softness of the drug have been calculated. Further, drug-DNA interactions have been examined using modified second order perturbation theory along with multicentred-multipole expansion technique. Results have been discussed in the light of other theoretical and experimental observations. Efforts have been made to elucidate the binding patterns and thereby biological properties of the drug.

  13. Guanine Bases in DNA G-Quadruplex Adopt Nonplanar Geometries Owing to Solvation and Base Pairing

    Czech Academy of Sciences Publication Activity Database

    Sychrovský, Vladimír; Sochorová Vokáčová, Zuzana; Trantírek, L.

    2012-01-01

    Roč. 116, č. 16 (2012), s. 4144-4151 ISSN 1089-5639 R&D Projects: GA ČR GAP205/10/0228 Institutional research plan: CEZ:AV0Z40550506 Keywords : pyramidalization * nonplanarity * G-quadruplex * DNA * solvent effect Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.771, year: 2012

  14. Nutritional epigenomics: a portal to disease prevention.

    Science.gov (United States)

    Choi, Sang-Woon; Claycombe, Kate J; Martinez, J Alfredo; Friso, Simonetta; Schalinske, Kevin L

    2013-09-01

    Epigenetics can be defined as inheritable and reversible phenomena that affect gene expression without altering the underlying base pair sequence. Epigenomics is the study of genome-wide epigenetic modifications. Because gene expression changes are critical in both normal development and disease progression, epigenetics is widely applicable to many aspects of biological research. The influences of nutrients and bioactive food components on epigenetic phenomena such as DNA methylation and various types of histone modifications have been extensively investigated. Because an individual's epigenetic patterns are established during early gestation and are changed and personalized by environmental factors during our lifetime, epigenetic mechanisms are quite important in the development of transgenerational and adult obesity as well as in the development of diabetes mellitus. Aging and cancer demonstrate profound genome-wide DNA methylation changes, suggesting that nutrition may affect the aging process and cancer development through epigenetic mechanisms.

  15. Prevention of diseases after menopause.

    Science.gov (United States)

    Lobo, R A; Davis, S R; De Villiers, T J; Gompel, A; Henderson, V W; Hodis, H N; Lumsden, M A; Mack, W J; Shapiro, S; Baber, R J

    2014-10-01

    Women may expect to spend more than a third of their lives after menopause. Beginning in the sixth decade, many chronic diseases will begin to emerge, which will affect both the quality and quantity of a woman's life. Thus, the onset of menopause heralds an opportunity for prevention strategies to improve the quality of life and enhance longevity. Obesity, metabolic syndrome and diabetes, cardiovascular disease, osteoporosis and osteoarthritis, cognitive decline, dementia and depression, and cancer are the major diseases of concern. Prevention strategies at menopause have to begin with screening and careful assessment for risk factors, which should also include molecular and genetic diagnostics, as these become available. Identification of certain risks will then allow directed therapy. Evidence-based prevention for the diseases noted above include lifestyle management, cessation of smoking, curtailing excessive alcohol consumption, a healthy diet and moderate exercise, as well as mentally stimulating activities. Although the most recent publications from the follow-up studies of the Women's Health Initiative do not recommend menopause hormonal therapy as a prevention strategy, these conclusions may not be fully valid for midlife women, on the basis of the existing data. For healthy women aged 50-59 years, estrogen therapy decreases coronary heart disease and all-cause mortality; this interpretation is entirely consistent with results from other randomized, controlled trials and observational studies. Thus. as part of a comprehensive strategy to prevent chronic disease after menopause, menopausal hormone therapy, particularly estrogen therapy may be considered as part of the armamentarium.

  16. Prevention strategies in child maltreatment.

    Science.gov (United States)

    Scribano, Philip V

    2010-10-01

    Child maltreatment remains a prevalent problem for which notable best practices such as home visitation can be effective; however, most eligible families do not receive these beneficial services. Additionally, there are other promising prevention interventions to effectively address child maltreatment. This review focuses on the recent advances and strategies for child maltreatment prevention. Although home visiting does not have a single clearly defined methodology of providing service to children and families, the general supportive framework to improve maternal, child, and family factors makes this intervention the most widely studied and accepted prevention strategy. However, there has been limited effectiveness for most models. The Nurse-Family Partnership (NFP) has provided consistently positive results by targeting families with many risk factors by using highly trained professionals when implementing a research-based intervention. A promising public health approach to parent training (Triple P) may reduce maltreatment and out-of-home placement. Parent-child interaction therapy (PCIT), while a treatment model, is becoming an increasingly important approach to child maltreatment prevention. There may be an opportunity to reduce child maltreatment by enhancing care in the pediatric medical home setting. Effective child maltreatment prevention efforts exist; however, not all programs provide the same effectiveness, or target the same maltreatment issues. Pediatricians are in a key position to offer support to families in their own practice, as well as to direct families to the appropriate resources available.

  17. Pressure ulcer prevention and management.

    Science.gov (United States)

    Lyder, Courtney H

    2002-01-01

    This chapter reviews 218 published and unpublished research reports of pressure ulcer prevention and management by nurse researchers and researchers from other disciplines. The electronic databases MEDLINE (1966-July 2001), CINAHL (1982-June 2001), AMED (1985-July 2001), and EI Compedex Plus (1980-June 2001) were selected for the searches because of their focus on health and applied research. Moreover, evaluations of previous review articles and seminal studies that were published before 1966 are also included. Research conducted worldwide and published in English between 1930 and 2001 was included for review. Studies using descriptive, correlational, longitudinal, and randomized control trials were included. This review found that numerous gaps remain in our understanding of effective pressure ulcer prevention and management. Moreover, the majority of pressure ulcer care is derived from expert opinion rather than empirical evidence. Thus, additional research is needed to investigate pressure ulcer risk factors of ethnic minorities. Further studies are needed that examine the impact of specific preventive interventions (e.g., turning intervals based on risk stratification) and the cost-effectiveness of comprehensive prevention programs to prevent pressure ulcers. Finally, an evaluation is needed of various aspects of pressure ulcer management (e.g., use of support surfaces, use of adjunctive therapies) and healing of pressure ulcers.

  18. Fall Prevention in Apprentice Carpenters

    Science.gov (United States)

    Kaskutas, Vicki; Dale, Ann Marie; Lipscomb, Hester; Gaal, John; Fuchs, Mark; Evanoff, Bradley; Faucette, Julia; Gillen, Marion; Deych, Elena

    2013-01-01

    Objectives Falls from heights are a leading cause of mortality and morbidity in the construction industry, especially among inexperienced workers. We surveyed apprentice carpenters to identify individual and organizational factors associated with falls from heights. Methods We developed a 72-item fall prevention survey with multiple domains including fall experience, fall prevention knowledge, risk perceptions, confidence in ability to prevent falls, training experience, and perceptions of the safety climate and crew safety behaviors. We administered the questionnaire to apprentice carpenters in this cross-sectional study. Results Of the 1,025 respondents, 51% knew someone who had fallen from height at work and 16% had personally fallen in the past year, with ladders accounting for most of the falls. Despite participation in school-based and on-the-job training, fall prevention knowledge was poor. Ladders were perceived as low risk and ladder training was rare. Apprentices reported high levels of unsafe fall-related behaviors on their work crews. Apprentices working residential construction were more likely to fall than those working commercial construction, as were apprentices working on crews with fewer senior carpenters to provide mentorship, and those reporting more unsafe behaviors among fellow workers. Conclusions Despite participation in a formal apprenticeship program, many apprentices work at heights without adequate preparation and subsequently experience falls. Apprenticeship programs can improve the timing and content of fall prevention training. This study suggests that organizational changes in building practices, mentorship, and safety culture must also occur in order to decrease worker falls from heights. PMID:19953214

  19. The Money Laundering Prevention System

    Directory of Open Access Journals (Sweden)

    Sonja Cindori

    2007-03-01

    Full Text Available The paper presents the money laundering and terrorist financing prevention system in Croatia. The basic concepts are defined, the principles and fundamentals of international regulations analysed, and the regulatory system in Croatia covered by statute and money laundering prevention Regulations is presented, in conjunction with a description of the organisation, remit and international actions of the Money Laundering Prevention Office.The infiltration of dirty money is a crucial problem from national economies. The purchase of shares, of real estate, the establishment of dirty investment funds and the use of the banking system for the embedding of such resources is a danger to the credibility of a whole country, and in particular to the security of the financial and banking system. Croatia has adopted statutory measures aimed at the effective detection and prevention of suspicious financial transactions, in other words the prevention of money laundering.Launderers constantly find new ways, make use of new non-financial channels and expand their activities to real estate, artworks and insurance. Hence it is necessary to keep up with European approaches and recommendations, to strive for further improvement of the laws and the modernisation of the system, and to adopt new regulations harmonised with international standards, particularly with Directive 2005/60/EC.

  20. Prevention vs. treatment: what's the right balance?

    National Research Council Canada - National Science Library

    Faust, Halley S; Menzel, Paul T

    2012-01-01

    .... This book explores this observation by examining the actual spending on prevention, the history of health policies and structural features that affect prevention's apparent relative lack of emphasis...

  1. Preventing pollution from plutonium processing

    International Nuclear Information System (INIS)

    Pillay, K.K.S.

    1993-01-01

    The plutonium processing facility at Los Alamos has adopted the strategic goal of becoming a facility that processes plutonium in a way that produces only environmentally benign waste streams. Pollution prevention through source reduction and environmentally sound recycling are being pursued. General approaches to waste reductions are administrative controls, modification of process technologies, and additional waste polishing. Recycling of waste materials, such as spent acids and salts, are technical possibilities and are being pursued to accomplish additional waste reduction. Liquid waste stream polishing to remove final traces of plutonium and hazardous chemical constituents is accomplished through (a) process modifications, (b) use of alternative chemicals and sorbents for residue removal, (c) acid recycling, and (d) judicious use of a variety of waste polishing technologies. Technologies that show promise in waste minimization and pollution prevention are identified. Working toward this goal of pollution prevention is a worthwhile endeavor, not only for Los Alamos, but for the Nuclear Complex of the future

  2. Preventing pollution from plutonium processing

    International Nuclear Information System (INIS)

    Pillay, K.K.S.

    1995-01-01

    The plutonium processing facility at Los Alamos has adopted the strategic goal of becoming a facility that processes plutonium in a way that produces only environmentally benign waste streams. Pollution prevention through source reduction and environmentally sound recycling are being pursued. General approaches to waste reductions are administrative controls, modification of process technologies, and additional waste polishing. Recycling of waste materials, such as spent acids and salts, are technical possibilities and are being pursued to accomplish additional waste reduction. Liquid waste stream polishing to remove final traces of plutonium and hazardous chemical constituents is accomplished through process modifications, use of alternative chemicals and sorbents for residue removal, acid recycling, and judicious use of a variety of waste polishing technologies. Technologies that show promise in waste minimization and pollution prevention are identified. Working toward this goal of pollution prevention is a worthwhile endeavor , not only for Los Alamos, but for the Nuclear Complex of the future. (author) 12 refs.; 2 figs

  3. Prevention of unintentional childhood injury.

    Science.gov (United States)

    Theurer, Wesley M; Bhavsar, Amit K

    2013-04-01

    Unintentional injury accounts for 40 percent of childhood deaths annually, most commonly from motor vehicle crashes. The proper use of child restraints is the most effective strategy to prevent injury or death. Motor vehicle restraint guidelines have recently been revised to an age-based system that delays the progression in type of restraint for most children. Strategies to prevent suffocation in children include using appropriate bedding, positioning babies on their backs to sleep, and removing items from the sleep and play environment that could potentially entrap or entangle the child. Fencing that isolates a swimming pool from the yard and surrounding area and "touch" adult supervision (i.e., an adult is in the water and able to reach and grab a child) have been shown to be most effective in preventing drownings. Swimming lessons are recommended for children older than four years. Poison prevention programs have been shown to improve prevention behavior among caregivers, but may not decrease poisoning incidence. Syrup of ipecac is not recommended. Smoke detector maintenance, a home escape plan, and educating children about how to respond during a fire emergency are effective strategies for preventing fire injuries or death. Fall injuries may be reduced by not using walkers for infants and toddlers or bunk beds for children six years and younger. Consistent helmet use while bicycling reduces head and brain injuries. Although direct counseling by physicians appears to improve some parental safety behaviors, its effect on reducing childhood injuries is uncertain. Community-based interventions can be effective in high-risk populations.

  4. Preventing childhood obesity: what works?

    Science.gov (United States)

    Birch, L L; Ventura, A K

    2009-04-01

    Rates of overweight in North American children and adolescents have increased dramatically since the 1970s. Childhood obesity has reached epidemic proportions and calls for prevention and treatment programs to reverse this trend have been made. However, the evidence base needed for effective action is still incomplete, especially for childhood obesity prevention programs. This paper focuses on primary prevention of childhood obesity and has three aims: (1) to briefly describe current primary prevention approaches for childhood obesity and the evidence for their impact; (2) to elucidate promising, but untested intervention strategies using an ecological framework and evidence from experimental and epidemiological research on factors influencing children's eating and weight status; and (3) to introduce a multiphase strategy for screening intervention components and building and evaluating potent interventions for childhood obesity. Most childhood obesity prevention programs have focused on school-aged children and have had little success. We suggest that, given these findings, prevention efforts should be expanded to explore other contexts in which children live as possible settings for intervention efforts, including the family and childcare settings. Given that 25% of preschool children are already overweight, intervening with children before school entry should be a priority. A review of experimental research on the developing controls of food intake in infancy and childhood suggests possible intervention strategies, focusing on parenting and aspects of the feeding environment. Epidemiological findings point to even earlier modifiable risk factors, including gestational weight gain, maternal prepregnancy weight, and formula feeding. However, the potential impact of altering these risk factors remains to be evaluated. In response to this problem, we suggest a new, multiphase method for accomplishing this, including screening intervention components, refining

  5. Health promotion and prevention strategies.

    Science.gov (United States)

    Bradbury-Golas, Kathleen

    2013-09-01

    Opiate dependency is a medical disorder that requires treatment intervention. Primary health care not only entails treatment of illness but also involves disease prevention and health promotion. Based on Pender's revised Health Promotion Model, a descriptive study comparing the health promoting behaviors/practices in abusing and recovering opiate-dependent drug users is analyzed. Using the Health Promoting Lifestyle Profile II, a comparative descriptive, exploratory, nonexperimental design study was conducted to identify key health-promoting behaviors in recovering opiate-dependent drug users. Prevention strategy recommendations are discussed, along with future research recommendations. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Preventing urinary incontinence in women.

    Science.gov (United States)

    Newman, Diane K; Cardozo, Linda; Sievert, Karl-Dietrich

    2013-10-01

    This review examines the evidence to date, analyzes specific risk factors and assesses the ability to prevent urinary incontinence in women, while providing clinical recommendations. More extraordinary risk factors such as ethnicity and race, mixed and fecal incontinence, iatrogenic and neurogenic factors should be discussed in a follow-up report. Studies have revealed that certain factors place women at risk for developing urinary incontinence, including age, obesity, diabetes, pregnancy and delivery, high-impact physical exercise factors and estrogen deficiency. Healthcare providers should screen women who are at risk for developing urinary incontinence and institute specific interventions, specifically behavioral and even rehabilitative techniques, to prevent this prevalent and distressing condition.

  7. Recognizing and Preventing Whooping Cough

    Centers for Disease Control (CDC) Podcasts

    2015-01-22

    This podcast provides information about the symptoms of whooping cough and how vaccines can help prevent this serious disease for people of all ages. It is especially important for those who will have close contact with a baby to be up to date with their whooping cough vaccine.  Created: 1/22/2015 by National Center for Immunization and Respiratory Diseases (NCIRD), Division of Bacterial Diseases (DBD), Meningitis and Vaccine Preventable Diseases Branch (MVPDB).   Date Released: 1/22/2015.

  8. FOOD ALLERGY PREVENTION IN INFANCY

    Directory of Open Access Journals (Sweden)

    S.G. Makarova

    2006-01-01

    Full Text Available The article deals with new data about food tolerance induction among the children, belonging to the high risk groups disposed to atopy. Authors show the role of gut microflora in formation of child immune system, effect of breast feeding on activation of local immune response, growth stimulation of bifid bacteria and lactic acid bacilli. The present work gives the randomized research findings, which confirm the effectiveness of prolonged breast feeding, use of highly or partially hydrolyzed mixtures and timely introduction of supplemental feeding in food allergy prevention.Key words: prevention, food allergy, children, breast feeding, hypo allergic mixtures, milk protein hydrolysates, supplemental feeding, gut microflora, probiotics.

  9. Preventing crime through selective incapacitation

    NARCIS (Netherlands)

    Vollaard, B.A.

    Making the length of a prison sentence conditional upon an individual’s offence history is shown to be a powerful way of preventing crime. Under a law adopted in the Netherlands in 2001, prolific offenders could be sentenced to a prison term that was approximately 10 times longer than usual. We

  10. Intimate Partner Violence. Prevention Update

    Science.gov (United States)

    Higher Education Center for Alcohol, Drug Abuse, and Violence Prevention, 2011

    2011-01-01

    The Centers for Disease Control and Prevention (CDC) defines intimate partner violence (IPV) as violence between two people in a close relationship, including current and former spouses and dating partners. IPV occurs on a continuum from a single episode to ongoing battering and can include physical violence, sexual violence, threats, emotional…

  11. Pollution prevention program implementation plan

    International Nuclear Information System (INIS)

    Engel, J.A.

    1996-09-01

    The Pollution Prevention Program Implementation Plan (the Plan) describes the Pacific Northwest National Laboratory's (PNNL) Pollution Prevention (P2) Program. The Plan also shows how the P2 Program at PNNL will be in support of and in compliance with the Hanford Site Waste Minimization and Pollution Prevention (WMin/P2) Awareness Program Plan and the Hanford Site Guide for Preparing and Maintaining Generator Group Pollution Prevention Program Documentation. In addition, this plan describes how PNNL will demonstrate compliance with various legal and policy requirements for P2. This plan documents the strategy for implementing the PNNL P2 Program. The scope of the P2 Program includes implementing and helping to implement P2 activities at PNNL. These activities will be implemented according to the Environmental Protection Agency's (EPA) hierarchy of source reduction, recycling, treatment, and disposal. The PNNL P2 Program covers all wastes generated at the Laboratory. These include hazardous waste, low-level radioactive waste, radioactive mixed waste, radioactive liquid waste system waste, polychlorinated biphenyl waste, transuranic waste, and sanitary waste generated by activities at PNNL. Materials, resource, and energy conservation are also within the scope of the PNNL P2 Program

  12. Asphalt rutting and its prevention

    CSIR Research Space (South Africa)

    Verhaeghe, Benoit MJA

    2007-09-01

    Full Text Available The paper seeks to redress the concerns expressed at the eight Conference on Asphalt pavements for Southern Africa (CAPSA) that the design of hot-mix asphalt did not adequately address prevention of rutting. It presents a consolidation of best...

  13. Preventing Stroke Deaths PSA (:60)

    Centers for Disease Control (CDC) Podcasts

    2017-09-06

    This 60 second public service announcement is based on the July 2017 CDC Vital Signs report. Higher opioid prescribing puts patients at risk for addiction and overdose. Learn what can be done about this serious problem.  Created: 9/6/2017 by Centers for Disease Control and Prevention (CDC).   Date Released: 9/6/2017.

  14. Crime Prevention through Environmental Design

    Science.gov (United States)

    Draper, Rick; Cadzow, Emma

    2004-01-01

    Applying CPTED (Crime Prevention Through Environmental Design) strategies to schools can significantly contribute to a safer learning environment by influencing the behaviour of students and visitors. CPTED has three overlapping primary concepts that are intended to reduce opportunities for crime as well as fear of crime: access control,…

  15. Childhood Obesity: Prediction and Prevention.

    Science.gov (United States)

    Miller, Michael D.

    Obesity in children is a problem both insidious and acute. Childhood obesity has been indicated as a forerunner of adult obesity; it is also an immediate problem for the child. Given the lack of evidence for long term maintenance of any weight loss, this paper investigates the etiology of the disorder as a prelude to prevention. Upon review of the…

  16. Cancer Prevention Research in China.

    Science.gov (United States)

    Yu, Siwang; Yang, Chung S; Li, Junyao; You, Weicheng; Chen, Jianguo; Cao, Ya; Dong, Zigang; Qiao, Youlin

    2015-08-01

    Although cancer incidence and mortality rates in the United States and some European countries have started to decrease, those in developing countries are increasing. China, the most populous developing country, is facing a serious challenge from cancer. Cancer incidence has been increasing for decades, and cancer is the leading cause of death in China. In 2012, the cancer incidence was 174.0 per 100,000, and the cancer mortality was 122.2 per 100,000 in China. In addition to the still-prevalent traditional Chinese cancers of the stomach, liver, esophagus, cervix, and nasopharynx, the incidence of "Western" cancers such those of the lung, breast, and colorectum has increased alarmingly in recent years. These increases are likely due to the lifestyle and environmental changes associated with rapid economic development and population aging. More importantly, a large portion of these cancers are preventable. Researchers in China have made important contributions to cancer prevention research, especially in the traditional Chinese cancers. More cancer prevention research and measures, especially on the major emerging cancers, are urgently needed. This review article highlights some of the past achievements and present needs in cancer prevention research in China and suggests important areas for future studies. ©2015 American Association for Cancer Research.

  17. Preventing Child Abuse and Neglect

    Science.gov (United States)

    ... Federal and national organizations and State contacts that work to prevent child abuse. Promoting child & family well-being Information on ... awareness & creating supportive communities Tools for sharing a child abuse ... research on what works, information on the role of related professionals, and ...

  18. EDITORIAL PREVENTABLE CAUSES OF BLINDNESS

    African Journals Online (AJOL)

    Damary

    2006-04-01

    Apr 1, 2006 ... eye changes improve markedly on treatment with diethylcarbamazine. Xerophthalmia is the leading ... for children of this land, and the recent severe food shortages are not helping matters either. Vitamin A ... from this cause is not rare but obviously preventable. Leprosy is a disease caused by the acid fast ...

  19. PREVENTION OF ALLERGIES IN CHILDREN

    Directory of Open Access Journals (Sweden)

    E. A. Vishneva

    2014-01-01

    Full Text Available The article is dedicated to the issue of preventing allergies in children. Increase in the spread of allergic diseases among children and adolescents remains one of the most significant medical and social issues and constitutes a heavy burden for healthcare budgets of many countries around the world. The Federal clinical recommendations must become modern guidelines for practicing clinicians everywhere; these are modern regulatory documents – protocols of medical care rendering to children with various allergic manifestations. The authors substantiate complex approach to the therapy of allergic diseases and determine the role of preventive measures and elimination of trigger effects. The authors traditionally distinguish between primary, secondary and tertiary measures and demonstrate their orientation. They consider the issue of preventing respiratory infections, which often constitute a factor of exacerbation of chronic allergic processes and are one of the frequent causative agents of allergic inflammation. The optimal preventive effect and maximum reduction in the incidence rate of respiratory infections may be achieved by combining vaccination and immune pharmacotherapy. 

  20. Understanding and Preventing Toddler Biting.

    Science.gov (United States)

    Garcia, Veronica

    1999-01-01

    Discusses the problem of toddler biting behavior in child care settings. Describes reasons for biting by toddlers, recommends caregiver responses to toddler biting, presents tips for observing children to identify the biter's patterns, and outlines ways to prevent biting in child care settings. (KB)