Envisaging quantum transport phenomenon in a muddled base pair of DNA

Science.gov (United States)

Vohra, Rajan; Sawhney, Ravinder Singh

2018-05-01

The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

Science.gov (United States)

Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P

2015-02-10

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine

Science.gov (United States)

2016-01-01

5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair.

Science.gov (United States)

Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo

2012-11-01

Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

Science.gov (United States)

Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

2011-01-01

We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

International Nuclear Information System (INIS)

Mendel, D.; Dervan, P.B.

1987-01-01

Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

International Nuclear Information System (INIS)

Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.

1989-01-01

The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

Impact of School-Based HIV Prevention Program in Post-Conflict Liberia

Science.gov (United States)

Atwood, Katharine A.; Kennedy, Stephen B.; Shamblen, Steve; Tegli, Jemee; Garber, Salome; Fahnbulleh, Pearl W.; Korvah, Prince M.; Kolubah, Moses; Mulbah-Kamara, Comfort; Fulton, Shannon

2012-01-01

This paper presents findings of a feasibility study to adapt and evaluate the impact of an evidence-based HIV prevention intervention on sexual risk behaviors of in-school 6th grade youth in post-conflict Liberia (n = 812). The study used an attention-matched, group randomized controlled trial. Four matched pairs of elementary/middle schools in…

[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

Science.gov (United States)

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition

Science.gov (United States)

Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.

2013-01-01

Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

Directory of Open Access Journals (Sweden)

Y. Chen

2015-11-01

Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

International Nuclear Information System (INIS)

Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

2009-01-01

The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

Science.gov (United States)

Hirao, Ichiro; Kimoto, Michiko

2012-01-01

Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

Directory of Open Access Journals (Sweden)

Sergei Kuchin

2011-03-01

Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

Gender-Based Violence Prevention. Issues in Prevention

Science.gov (United States)

Higher Education Center for Alcohol, Drug Abuse, and Violence Prevention, 2012

2012-01-01

This issue of "Issues in Prevention" focuses on gender-based violence prevention. This issue contains the following articles: (1) Preventing Gender-Based Violence: An Overview (Linda Langford); (2) Q&A With Amelia Cobb; (3) Denim Day at HBCUs; (4) Dear Colleague Letter; (5) ED Grants for Violence Prevention; and (6) Higher Education Center…

UV-inactivation of Epstein-Barr virus: differences in early antigen expression in two different non-productive cell lines and influence of caffeine

International Nuclear Information System (INIS)

Suchankova, A.; Vonka, V.

1978-01-01

Two non-productive Epstein-Barr (EB) virus genome-carrying lymphoblastoid cell lines, namely Raji and NC37, were used for studying the effect of UV irradiation on the ability of P3HR-1 EB virus to induce early antigen (EA) formation. In NC37 cells infected with UV-irradiated virus the formation of EA was delayed; thus the slope of inactivation curve based on the early (24 hr) reading was steeper than that based on the late (72 hr) reading. This was not observed in Raji cells. Caffeine did not influence the percentage of EA positive cells in cultures infected with untreated virus; however, the drug exhibited a marked inhibitory effect on EA production after infection with UV-irradiated virus. The sensitivity to caffeine decreased more rapidly with time after infection of Raji than of NC37 cells, suggesting a higher degree of readiness of the host cell repair system in the former than in the latter cells. The caffeine effect was merely directed against the synthesis of R (restricted) component of EA; its influence on the D (diffuse) component formation was negligible. (author)

Signature scheme based on bilinear pairs

Science.gov (United States)

Tong, Rui Y.; Geng, Yong J.

2013-03-01

An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

Triple helical DNA in a duplex context and base pair opening

Science.gov (United States)

Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

2014-01-01

It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

Accurate interaction energies of base pairing and base stacking. The final chapter

Czech Academy of Sciences Publication Activity Database

Šponer, Jiří; Jurečka, Petr; Hobza, Pavel

2005-01-01

Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

Schwinger pair creation of Kaluza-Klein particles: Pair creation without tunneling

International Nuclear Information System (INIS)

Friedmann, Tamar; Verlinde, Herman

2005-01-01

We study Schwinger pair creation of charged Kaluza-Klein (KK) particles from a static KK electric field. We find that the gravitational backreaction of the electric field on the geometry--which is incorporated via the electric KK-Melvin solution--prevents the electrostatic potential from overcoming the rest mass of the KK particles, thus impeding the tunneling mechanism which is often thought of as responsible for the pair creation. However, we find that pair creation still occurs with a finite rate formally similar to the classic Schwinger result, but via an apparently different mechanism, involving a combination of the Unruh effect and vacuum polarization due to the E-field

Drama-based education to motivate participation in substance abuse prevention

Directory of Open Access Journals (Sweden)

Cameron Amura

2007-04-01

Full Text Available Abstract Background The substance abuse prevention goal of the theatre production "TUNNELS" was to provide community education on substance abuse to an audience in Durham, NC and surrounding communities. The education effort intended to increase awareness and understanding of the risk and protective factors associated with alcohol and other drug use, and to promote pro-active behaviors in substance abuse prevention within the adult community. It was hypothesized that community-based education via drama would change attitudes toward alcohol and substance abuse, and increase participation in family and community activities aimed at substance abuse prevention. Methods A focus group comprised of educators, substance abuse researchers and local substance abuse counselors developed "life stories" of users of alcohol and other drugs and a local playwright incorporated these and other experiences into a series of six vignettes. The production was publicized throughout the Durham area, and 700 adults attending the play signed a consent form and completed the pre-play survey. The participant pool was restricted to those adults who completed both the time-1 and time-2 surveys and resided within Durham and surrounding communities. Paired comparisons of mean responses were analyzed using a paired sample two-tailed t-test. A telephone survey three months after the play assessed attitudes toward substance abuse as a disease, and whether the respondents had increased their participation in prevention activities including discussions of the play with others. Results Viewing the play increased the knowledge base of participants regarding substance abuse as a disease, even though the audience demonstrated an appreciation of risk and protective factors prior to attending the performance. In the pre-play survey, participants indicated a strong opinion that parental involvement in teen life was important, and therefore this was not increased as a result of viewing

Intermittent pair-housing, pair relationship qualities, and HPA activity in adult female rhesus macaques.

Science.gov (United States)

Hannibal, Darcy L; Cassidy, Lauren C; Vandeleest, Jessica; Semple, Stuart; Barnard, Allison; Chun, Katie; Winkler, Sasha; McCowan, Brenda

2018-05-02

Laboratory rhesus macaques are often housed in pairs and may be temporarily or permanently separated for research, health, or management reasons. While both long-term social separations and introductions can stimulate a stress response that impacts inflammation and immune function, the effects of short-term overnight separations and whether qualities of the pair relationship mediate these effects are unknown. In this study, we investigated the effects of overnight separations on the urinary cortisol concentration of 20 differentially paired adult female rhesus macaques (Macaca mulatta) at the California National Primate Research Center. These females were initially kept in either continuous (no overnight separation) or intermittent (with overnight separation) pair-housing and then switched to the alternate pair-housing condition part way through the study. Each study subject was observed for 5 weeks, during which we collected measures of affiliative, aggressive, anxious, abnormal, and activity-state behaviors in both pair-housing conditions. Additionally, up to three urine samples were collected from each subject per week and assayed for urinary free cortisol and creatinine. Lastly, the behavioral observer scored each pair on four relationship quality attributes ("Anxious," "Tense," "Well-meshed," and "Friendly") using a seven-point scale. Data were analyzed using a generalized linear model with gamma distribution and an information theoretic approach to determine the best model set. An interaction between the intermittent pairing condition and tense pair adjective rating was in the top three models of the best model set. Dominance and rates of affiliation were also important for explaining urinary cortisol variation. Our results suggest that to prevent significant changes in HPA-axis activation in rhesus macaque females, which could have unintended effects on research outcomes, pairs with "Tense" relationships and overnight separations preventing tactile contact

AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

OpenAIRE

Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

2016-01-01

Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

Interactions between Cellulolytic Enzymes with Native, Autohydrolysis, and Technical Lignins and the Effect of a Polysorbate Amphiphile in Reducing Nonproductive Binding.

Science.gov (United States)

Fritz, Consuelo; Ferrer, Ana; Salas, Carlos; Jameel, Hasan; Rojas, Orlando J

2015-12-14

Understanding enzyme-substrate interactions is critical in designing strategies for bioconversion of lignocellulosic biomass. In this study we monitored molecular events, in situ and in real time, including the adsorption and desorption of cellulolytic enzymes on lignins and cellulose, by using quartz crystal microgravimetry and surface plasmon resonance. The effect of a nonionic surface active molecule was also elucidated. Three lignin substrates relevant to the sugar platform in biorefinery efforts were considered, namely, hardwood autohydrolysis cellulolytic (HWAH), hardwood native cellulolytic (MPCEL), and nonwood native cellulolytic (WSCEL) lignin. In addition, Kraft lignins derived from softwoods (SWK) and hardwoods (HWK) were used as references. The results indicated a high affinity between the lignins with both, monocomponent and multicomponent enzymes. More importantly, the addition of nonionic surfactants at concentrations above their critical micelle concentration reduced remarkably (by over 90%) the nonproductive interactions between the cellulolytic enzymes and the lignins. This effect was hypothesized to be a consequence of the balance of hydrophobic and hydrogen bonding interactions. Moreover, the reduction of surface roughness and increased wettability of lignin surfaces upon surfactant treatment contributed to a lower affinity with the enzymes. Conformational changes of cellulases were observed upon their adsorption on lignin carrying preadsorbed surfactant. Weak electrostatic interactions were determined in aqueous media at pH between 4.8 and 5.5 for the native cellulolytic lignins (MPCEL and WSCEL), whereby a ∼20% reduction in the enzyme affinity was observed. This was mainly explained by electrostatic interactions (osmotic pressure effects) between charged lignins and cellulases. Noteworthy, adsorption of nonionic surfactants onto cellulose, in the form cellulose nanofibrils, did not affect its hydrolytic conversion. Overall, our results

Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

Science.gov (United States)

Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

2018-05-01

In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

DFT study on metal-mediated uracil base pair complexes

Directory of Open Access Journals (Sweden)

Ayhan Üngördü

2017-11-01

Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

KAUST Repository

Chawla, Mohit

2018-01-02

The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

International Nuclear Information System (INIS)

Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.

1988-01-01

High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

Micromechanics of base pair unzipping in the DNA duplex

International Nuclear Information System (INIS)

Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

2012-01-01

All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT

Directory of Open Access Journals (Sweden)

Testiana Deni Wijayatiningsih

2017-04-01

Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.

Science.gov (United States)

Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej

2005-05-04

The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

International Nuclear Information System (INIS)

Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.

2005-01-01

The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

[Effect of school-based peer leader centered smoking prevention program].

Science.gov (United States)

Shin, Sung Rae; Oh, Pok Ja; Youn, Hye Kyung; Shin, Sun Hwa

2014-12-01

The purpose of this study was to develop and evaluate a school-based peer leader centered smoking prevention program. Non-equivalent control group with a pre/post-test design was used. Students (n=174) in two boys' junior high schools located in D city, Korea participated with 85 being selected for the experimental group and 89 for the control group. Five sessions were given to the experimental group and a 50 minute lecture to the control group. Knowledge, attitude, non-smoking intention, and non-smoking efficacy were measured for the both experimental and control group at two weeks before the program and one month after the program was completed. Data were analyzed using χ²-test, Fisher's exact test, independent t-test and paired t-test with the SPSS 21.0 program. The experimental group showed higher overall knowledge, negative attitude toward smoking, and higher non-smoking intention and efficacy. After receiving the school based peer leader centered smoking prevention program scores for attitude toward smoking and non-smoking efficacy increased in the experimental group were higher than in the control group. The school-based peer leader centered smoking prevention program needs longitudinal evaluation, but from this study, there is an indication that this program can be used with junior high school students and effectively change students' attitude toward smoking and promote non-smoking efficacy.

An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

KAUST Repository

Chawla, Mohit

2015-06-27

Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

KAUST Repository

Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi

2015-01-01

Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs.

Science.gov (United States)

McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F

2015-01-01

Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

OpenAIRE

Lang, Gregory I.; Murray, Andrew W.

2008-01-01

Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

DEFF Research Database (Denmark)

Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

2013-01-01

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

KAUST Repository

Chawla, Mohit

2013-10-10

The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

Science.gov (United States)

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs

Science.gov (United States)

Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.

2015-01-01

Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

Science.gov (United States)

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

KAUST Repository

Zhang, Yuetao

2012-01-01

Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

NARCIS (Netherlands)

Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.

2016-01-01

DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion

Science.gov (United States)

Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.

2014-01-01

The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

Science.gov (United States)

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-01

The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

International Nuclear Information System (INIS)

Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.

2011-01-01

Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

Charge transfer in DNA: role of base pairing

Czech Academy of Sciences Publication Activity Database

Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

2009-01-01

Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

Pilot Testing an Internet-Based STI and HIV Prevention Intervention With Chilean Women

Science.gov (United States)

Villegas, Natalia; Santisteban, Daniel; Cianelli, Rosina; Ferrer, Lilian; Ambrosia, Todd; Peragallo, Nilda; Lara, Loreto

2015-01-01

Purpose The incidence of sexually transmitted infections (STIs) and human immunodeficiency virus (HIV) is high among young Chilean women, and there are no STI or HIV prevention interventions available to them that incorporate technology. The purpose of this study was to investigate the preliminary efficacy of an Internet-based STI and HIV prevention intervention (I-STIPI) for Chilean young women on measures of STI- and HIV-related information, motivation, behavioral skills, and preventive behaviors. Design This is a pretest-posttest study. Forty young Chilean women between 18 and 24 years of age participated in an investigation of the I-STIPI’s preliminary efficacy on STI and HIV prevention-related outcomes between baseline and a postintervention assessment. The intervention consisted of four online modules. Data collection was conducted in Santiago, Chile. Paired-samples t test analysis was used to determine whether there were significant differences in each of the outcome variables. Findings After receiving I-STIPI, women reported a significant increase in levels of STI- and HIV-related knowledge, attitudes toward the use of condoms and perceived self-efficacy, and a reduction of risky sexual behaviors with uncommitted partners. Conclusions The I-STIPI showed promise as an Internet-based intervention that can reduce barriers to accessing preventive interventions and increase STI and HIV preventive behaviors in young Chilean women. Clinical Relevance The study provided important information about the ability of an Internet-based intervention to reduce young women’s risk factors and to provide positive preliminary efficacy on STI- and HIV-related outcomes. Internet-based interventions can eliminate many barriers to receiving prevention interventions and may prove to be cost effective. PMID:25410132

Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

Science.gov (United States)

Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

2012-07-01

Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

Photochemical selectivity in guanine-cytosine base-pair structures

Czech Academy of Sciences Publication Activity Database

Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.

2005-01-01

Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.

Science.gov (United States)

Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T

2012-02-15

We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří

2005-01-01

Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-10-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-01-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

Recent developments in the DOE Waste Minimization Pollution Prevention Program

International Nuclear Information System (INIS)

Hancock, J.K.

1993-01-01

The U.S. Department of Energy (DOE) is involved in a wide variety of research and development, remediation, and production activities at more than 100 sites throughout the United States. The wastes generated cover a diverse spectrum of sanitary, hazardous, and radioactive waste streams, including typical office environments, power generation facilities, laboratories, remediation sites, production facilities, and defense facilities. The DOE's initial waste minimization activities pre-date the Pollution Prevention Act of 1990 and focused on the defense program. Little emphasis was placed on nonproduction activities. In 1991 the Office of Waste Management Operations developed the Waste Minimization Division with the intention of coordinating and expanding the waste minimization pollution prevention approach to the entire complex. The diverse nature of DOE activities has led to several unique problems in addressing the needs of waste minimization and pollution prevention. The first problem is developing a program that addresses the geographical and institutional hurdles that exist; the second is developing a monitoring and reporting mechanism that one can use to assess the overall performance of the program

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

Science.gov (United States)

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

NARCIS (Netherlands)

Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias

2012-01-01

We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

Science.gov (United States)

Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

2012-07-01

Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

Indian Academy of Sciences (India)

The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

Concealed d-wave pairs in the s± condensate of iron-based superconductors.

Science.gov (United States)

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

2016-05-17

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

Directory of Open Access Journals (Sweden)

Shu-ichi Nakano

2014-08-01

Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

An entropy-based improved k-top scoring pairs (TSP) method for ...

African Journals Online (AJOL)

An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

Science.gov (United States)

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Watson-Crick base pairing controls excited-state decay in natural DNA.

Science.gov (United States)

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Performance of various density functionals for the hydrogen bonds in DNA base pairs

NARCIS (Netherlands)

van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.

2006-01-01

We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

Science.gov (United States)

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

International Nuclear Information System (INIS)

Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas

2012-01-01

We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

International Nuclear Information System (INIS)

Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo

2012-01-01

Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

Science.gov (United States)

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls

OpenAIRE

Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David

2015-01-01

International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

Nurse-coordinated multidisciplinary, family-based cardiovascular disease prevention programme (EUROACTION) for patients with coronary heart disease and asymptomatic individuals at high risk of cardiovascular disease: a paired, cluster-randomised controlled trial.

Science.gov (United States)

Wood, D A; Kotseva, K; Connolly, S; Jennings, C; Mead, A; Jones, J; Holden, A; De Bacquer, D; Collier, T; De Backer, G; Faergeman, O

2008-06-14

Our aim was to investigate whether a nurse-coordinated multidisciplinary, family-based preventive cardiology programme could improve standards of preventive care in routine clinical practice. In a matched, cluster-randomised, controlled trial in eight European countries, six pairs of hospitals and six pairs of general practices were assigned to an intervention programme (INT) or usual care (UC) for patients with coronary heart disease or those at high risk of developing cardiovascular disease. The primary endpoints-measured at 1 year-were family-based lifestyle change; management of blood pressure, lipids, and blood glucose to target concentrations; and prescription of cardioprotective drugs. Analysis was by intention to treat. The trial is registered as ISRCTN 71715857. 1589 and 1499 patients with coronary heart disease in hospitals and 1189 and 1128 at high risk were assigned to INT and UC, respectively. In patients with coronary heart disease who smoked in the month before the event, 136 (58%) in the INT and 154 (47%) in the UC groups did not smoke 1 year afterwards (difference in change 10.4%, 95% CI -0.3 to 21.2, p=0.06). Reduced consumption of saturated fat (196 [55%] vs 168 [40%]; 17.3%, 6.4 to 28.2, p=0.009), and increased consumption of fruit and vegetables (680 [72%] vs 349 [35%]; 37.3%, 18.1 to 56.5, p=0.004), and oily fish (156 [17%] vs 81 [8%]; 8.9%, 0.3 to 17.5, p=0.04) at 1 year were greatest in the INT group. High-risk individuals and partners showed changes only for fruit and vegetables (p=0.005). Blood-pressure target of less than 140/90 mm Hg was attained by both coronary (615 [65%] vs 547 [55%]; 10.4%, 0.6 to 20.2, p=0.04) and high-risk (586 [58%] vs 407 [41%]; 16.9%, 2.0 to 31.8, p=0.03) patients in the INT groups. Achievement of total cholesterol of less than 5 mmol/L did not differ between groups, but in high-risk patients the difference in change from baseline to 1 year was 12.7% (2.4 to 23.0, p=0.02) in favour of INT. In the hospital group

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

Science.gov (United States)

Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

2012-11-01

8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

Science.gov (United States)

Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

2012-01-01

8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs.

Science.gov (United States)

Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2015-11-02

Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

Indian Academy of Sciences (India)

Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

Time series regression-based pairs trading in the Korean equities market

Science.gov (United States)

Kim, Saejoon; Heo, Jun

2017-07-01

Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

A rule of seven in Watson-Crick base-pairing of mismatched sequences.

Science.gov (United States)

Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip

2012-05-13

Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

Prediction of plant promoters based on hexamers and random triplet pair analysis

Directory of Open Access Journals (Sweden)

Noman Nasimul

2011-06-01

Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles.

Science.gov (United States)

Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding

2013-07-16

Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

Effects of Storytelling-Based Education in the Prevention of Drug Abuse among Adolescents in Iran Based on a Readiness to Addiction Index.

Science.gov (United States)

Moghadam, Mahdieh Poodineh; Sari, Mahdieh; Balouchi, Abbas; Madarshahian, Farah; Moghadam, Khadijeh

2016-11-01

One of the most effective strategies in the prevention of addiction is increasing awareness among young people, towards the tendency for taking drugs their physical, mental and social side effects. Storytelling is effective for increasing characteristics of happiness and resilience. This study uses storytelling, a common and popular method to increase awareness among adolescents. To examine the effect of storytelling-based education on the prevention of drug abuse, based on a readiness to addiction index. This quasi-experimental study was conducted on 136 high school students (grade one), selected by a cluster sampling procedure from May 2014 to February 2015 in Zabol, Iran. The instrument for gathering data was a readiness to addiction questionnaire. This questionnaire included 41 items for which the scoring of each item followed the Likerts format. The data gathered was analysed using SPSS version 21 with descriptive statistics and inferential statistics. The results revealed that the mean of the readiness to addiction index in the case group fell from 75.66±19.99 to 69.57±21.83 (paired t-test; p =0.02); in the control group the same index changed from 103.01±21.88 to 93.98±27.70 (paired t-test, p = 0.775). That is, the index decreased for both groups, but the reduction was statistically significant only for the case group (p =0.02). This suggests that the narrative method is effective in reducing adolescents readiness to addiction. Storytelling is an effective way to raise awareness among young people about addiction and its detrimental impacts on health. Therefore, such a technique can be taken into consideration in teaching principles of prevention.

A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

NARCIS (Netherlands)

Moddemeijer, R

In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

International Nuclear Information System (INIS)

Li, Ying; Wilson, W.D.; Zon, G.

1991-01-01

1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

Directory of Open Access Journals (Sweden)

Ji-Jian Chin

2014-01-01

Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

Efficient and provable secure pairing-free security-mediated identity-based identification schemes.

Science.gov (United States)

Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W

2014-01-01

Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

Czech Academy of Sciences Publication Activity Database

Burda, J. V.; Šponer, Jiří; Leszczynski, J.

2001-01-01

Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.

Science.gov (United States)

Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei

2017-11-03

Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

Science.gov (United States)

Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

2014-09-04

Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

DEFF Research Database (Denmark)

Carli, Lorenzo; Genta, G; Cantatore, Angela

2011-01-01

3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

NARCIS (Netherlands)

Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.

2000-01-01

Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

International Nuclear Information System (INIS)

Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

2004-01-01

Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

Energy Technology Data Exchange (ETDEWEB)

Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)

2016-02-01

To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

International Nuclear Information System (INIS)

Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.

2016-01-01

To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

Dye-sensitized solar cell with a pair of carbon-based electrodes

International Nuclear Information System (INIS)

Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun

2012-01-01

We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

Single base pair mutation analysis by PNA directed PCR clamping

DEFF Research Database (Denmark)

Ørum, H.; Nielsen, P.E.; Egholm, M.

1993-01-01

A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

PandA : pairings and arithmetic

NARCIS (Netherlands)

Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.

2014-01-01

This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give

Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

Science.gov (United States)

Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

2018-02-19

It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

[Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine].

Science.gov (United States)

Brovarets', O O; Hovorun, D M

2010-01-01

A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

Directory of Open Access Journals (Sweden)

Rie Kawai

2012-03-01

Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

Science.gov (United States)

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling.

Science.gov (United States)

Liang, Feng; Lindsay, Stuart; Zhang, Peiming

2012-11-21

With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

Paired structures and other opposite-based models

DEFF Research Database (Denmark)

Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel

2015-01-01

, that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...

On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

International Nuclear Information System (INIS)

Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun

2017-01-01

Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

DNA electronic circular dichroism on the inter-base pair scale

DEFF Research Database (Denmark)

Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer

2015-01-01

A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit

2015-09-17

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

KAUST Repository

Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan

2015-01-01

We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing.

Science.gov (United States)

Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J

2012-09-12

8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

Directory of Open Access Journals (Sweden)

Das Tanmoy

2012-03-01

Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

The formation of Cooper pairs and the nature of superconducting currents

International Nuclear Information System (INIS)

Weisskopf, V.F.

1979-12-01

A simple physical explanation is given for the formation of Cooper pairs in a superconducting metal, for the origin of the attractive force causing the binding of the pairs, for the forming of a degenerate Bose gas by the Cooper pairs, for the finite energy gap that prevents the ensemble of electrons to change its quantum state at low temperatures, and for the existence of permanent currents in a superconducting wire. (orig.)

The formation of Cooper pairs and the nature of superconducting currents

International Nuclear Information System (INIS)

Weisskopf, V.F.

1981-01-01

A simple physical explanation is given for the formation of Cooper pairs in a superconducting metal, for the origin of the attractive force causing the binding of the pairs, for the forming of a degenerate Bose gas by the Cooper pairs, for the finite energy gap that prevents the ensemble of electrons from changing its quantum state at low temperatures, and for the existence of permanent currents in a superconducting wire. (author)

Non-standard base pairing and stacked structures in methyl xanthine clusters

Czech Academy of Sciences Publication Activity Database

Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.

2008-01-01

Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes.

Science.gov (United States)

Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie

2017-10-06

In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

International Nuclear Information System (INIS)

Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.

1985-01-01

The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

International Nuclear Information System (INIS)

Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi

2010-01-01

2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

Science.gov (United States)

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Efficient Implementation of the Pairing on Mobilephones Using BREW

Science.gov (United States)

Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki

Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.

Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing

Science.gov (United States)

Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.

2012-01-01

8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex†

Science.gov (United States)

Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.

2011-01-01

The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

Base pairing and structural insights into the 5-formylcytosine in RNA duplex

Science.gov (United States)

Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia

2016-01-01

Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

Czech Academy of Sciences Publication Activity Database

Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír

2012-01-01

Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

Comparability of results from pair and classical model formulations for different sexually transmitted infections.

Directory of Open Access Journals (Sweden)

Jimmy Boon Som Ong

Full Text Available The "classical model" for sexually transmitted infections treats partnerships as instantaneous events summarized by partner change rates, while individual-based and pair models explicitly account for time within partnerships and gaps between partnerships. We compared predictions from the classical and pair models over a range of partnership and gap combinations. While the former predicted similar or marginally higher prevalence at the shortest partnership lengths, the latter predicted self-sustaining transmission for gonorrhoea (GC and Chlamydia (CT over much broader partnership and gap combinations. Predictions on the critical level of condom use (C(c required to prevent transmission also differed substantially when using the same parameters. When calibrated to give the same disease prevalence as the pair model by adjusting the infectious duration for GC and CT, and by adjusting transmission probabilities for HIV, the classical model then predicted much higher C(c values for GC and CT, while C(c predictions for HIV were fairly close. In conclusion, the two approaches give different predictions over potentially important combinations of partnership and gap lengths. Assuming that it is more correct to explicitly model partnerships and gaps, then pair or individual-based models may be needed for GC and CT since model calibration does not resolve the differences.

Pilot Testing HIV Prevention in an Afro Caribbean Faith-Based Community.

Science.gov (United States)

Archibald, Cynthia M; Newman, David

2015-01-01

This research attempted to test an HIV prevention intervention for Afro-Caribbean female teens. The purpose was to improve knowledge and attitudes concerning HIV/AIDS, improve mother-daughter sexual communication, and to reduce risky sexual behaviors. Using a community-based approach, sixty mother and daughter pairs were randomly assigned. One condition was experimental using the Making Proud Choices Caribbean Style (MPCCS); another was a comparison of General Health Education. Independent t-tests were used for analysis between the pretest, posttest and 90 days posttests. MPCCS indicated clear usage with other Caribbean teens. This study helped to support the theory when Afro-Caribbean (AC) teens feel they need to become sexually active (subjective norm), and have referent support (parental support), they may blend values, knowledge, and skills (control beliefs), and are likely to make proud choices to reduce risky sexual behavior in minimizing HIV in their communities.

Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-01-01

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

Nurse-Led School-Based Child Obesity Prevention

Science.gov (United States)

Tucker, Sharon; Lanningham-Foster, Lorraine M.

2015-01-01

School-based childhood obesity prevention programs have grown in response to reductions in child physical activity (PA), increased sedentariness, poor diet, and soaring child obesity rates. Multiple systematic reviews indicate school-based obesity prevention/treatment interventions are effective, yet few studies have examined the school nurse role…

Multi-pair states in electron–positron pair creation

Directory of Open Access Journals (Sweden)

Anton Wöllert

2016-09-01

Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

Multi-pair states in electron–positron pair creation

Energy Technology Data Exchange (ETDEWEB)

Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.

2016-09-10

Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

Multi-pair states in electron–positron pair creation

International Nuclear Information System (INIS)

Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

2016-01-01

Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

International Nuclear Information System (INIS)

Swasey, Steven M; Gwinn, Elisabeth G

2016-01-01

The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)

Science.gov (United States)

2014-12-11

Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F

4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening

Science.gov (United States)

2011-01-01

Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

International Nuclear Information System (INIS)

Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie

2015-01-01

Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

Directory of Open Access Journals (Sweden)

Ye Zhi-Qiang

2011-08-01

Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

International Nuclear Information System (INIS)

Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia

2014-01-01

The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior

Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

Science.gov (United States)

Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

2017-07-06

The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs.

Science.gov (United States)

Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira

2014-02-24

The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

HIV/AIDS Prevention Activities of Faith-Based Christian ...

African Journals Online (AJOL)

Based on these findings, it was recommended that the faith-based Christian organizations should collaborate with relevant agencies, community based workers and non-formal education providers to improve HIV/AIDS prevention service delivery in the study area. Keywords: Prevention, Activities, HIV/AIDS, Empowerment, ...

Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

International Nuclear Information System (INIS)

Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.

1995-01-01

For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

Science.gov (United States)

Yang, Changwon; Kim, Eunae; Pak, Youngshang

2015-09-18

Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

HAL-2 promotes homologous pairing during Caenorhabditis elegans meiosis by antagonizing inhibitory effects of synaptonemal complex precursors.

Science.gov (United States)

Zhang, Weibin; Miley, Natasha; Zastrow, Michael S; MacQueen, Amy J; Sato, Aya; Nabeshima, Kentaro; Martinez-Perez, Enrique; Mlynarczyk-Evans, Susanna; Carlton, Peter M; Villeneuve, Anne M

2012-01-01

During meiosis, chromosomes align with their homologous pairing partners and stabilize this alignment through assembly of the synaptonemal complex (SC). Since the SC assembles cooperatively yet is indifferent to homology, pairing and SC assembly must be tightly coordinated. We identify HAL-2 as a key mediator in this coordination, showing that HAL-2 promotes pairing largely by preventing detrimental effects of SC precursors (SYP proteins). hal-2 mutants fail to establish pairing and lack multiple markers of chromosome movement mediated by pairing centers (PCs), chromosome sites that link chromosomes to cytoplasmic microtubules through nuclear envelope-spanning complexes. Moreover, SYP proteins load inappropriately along individual unpaired chromosomes in hal-2 mutants, and markers of PC-dependent movement and function are restored in hal-2; syp double mutants. These and other data indicate that SYP proteins can impede pairing and that HAL-2 promotes pairing predominantly but not exclusively by counteracting this inhibition, thereby enabling activation and regulation of PC function. HAL-2 concentrates in the germ cell nucleoplasm and colocalizes with SYP proteins in nuclear aggregates when SC assembly is prevented. We propose that HAL-2 functions to shepherd SYP proteins prior to licensing of SC assembly, preventing untimely interactions between SC precursors and chromosomes and allowing sufficient accumulation of precursors for rapid cooperative assembly upon homology verification.

Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

Science.gov (United States)

Mokhtari, D.; Fellah, M.; Allal, N. H.

2016-05-01

A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

International Nuclear Information System (INIS)

Lee, K.M.; Marshall, A.G.

1987-01-01

Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

School-Based Child Abuse Prevention Programs

Science.gov (United States)

Brassard, Marla R.; Fiorvanti, Christina M.

2015-01-01

Child abuse is a leading cause of emotional, behavioral, and health problems across the lifespan. It is also preventable. School-based abuse prevention programs for early childhood and elementary school children have been found to be effective in increasing student knowledge and protective behaviors. The purpose of this article is to help school…

Getting a Base Tan: Does it Prevent Sunburn?

Science.gov (United States)

Tanning: Does a base tan prevent sunburn? Should I go to a tanning salon before a sunny vacation to help prevent sunburn? Answers ... little evidence to support the idea that a base tan protects you against sunburn. A few sessions ...

Investigations into nuclear pairing

International Nuclear Information System (INIS)

Clark, R.M.

2006-01-01

This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

Genotype-based personalised nutrition for obesity prevention and ...

African Journals Online (AJOL)

Typically, genotype-based personalised nutrition involves genotyping for a number of susceptibility SNPs associated with the prevention, or management, of a particular disease. Dietary advice is then personalised to the individual's genotype to ensure optimal prevention or treatment outcomes. To ensure evidence-based ...

Matched molecular pair-based data sets for computer-aided medicinal chemistry

Science.gov (United States)

Bajorath, Jürgen

2014-01-01

Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.

Science.gov (United States)

Ishida, Riyoko; Iwahashi, Hideo

2018-03-01

Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies.

Science.gov (United States)

Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks

2017-11-02

The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy.

Science.gov (United States)

Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J

2013-12-12

The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review.

Science.gov (United States)

Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing

2017-09-01

Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

NARCIS (Netherlands)

Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

2013-01-01

Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

To pair or not to pair: Sources of social variability with white-faced saki monkeys (Pithecia pithecia) as a case study.

Science.gov (United States)

Thompson, Cynthia L

2016-05-01

Intraspecific variability in social systems is gaining increased recognition in primatology. Many primate species display variability in pair-living social organizations through incorporating extra adults into the group. While numerous models exist to explain primate pair-living, our tools to assess how and why variation in this trait occurs are currently limited. Here I outline an approach which: (i) utilizes conceptual models to identify the selective forces driving pair-living; (ii) outlines novel possible causes for variability in social organization; and (iii) conducts a holistic species-level analysis of social behavior to determine the factors contributing to variation in pair-living. A case study on white-faced sakis (Pithecia pithecia) is used to exemplify this approach. This species lives in either male-female pairs or groups incorporating "extra" adult males and/or females. Various conceptual models of pair-living suggest that high same-sex aggression toward extra-group individuals is a key component of the white-faced saki social system. Variable pair-living in white-faced sakis likely represents alternative strategies to achieve competency in this competition, in which animals experience conflicting selection pressures between achieving successful group defense and maintaining sole reproductive access to mates. Additionally, independent decisions by individuals may generate social variation by preventing other animals from adopting a social organization that maximizes fitness. White-faced saki inter-individual relationships and demographic patterns also lend conciliatory support to this conclusion. By utilizing both model-level and species-level approaches, with a consideration for potential sources of variation, researchers can gain insight into the factors generating variation in pair-living social organizations. © 2014 The Authors. American Journal of Primatology published by Wiley Periodicals, Inc.

Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues.

Science.gov (United States)

Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy

2007-05-17

Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

International Nuclear Information System (INIS)

Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R

2011-01-01

3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively

Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

Science.gov (United States)

Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

2016-12-01

The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Deficient incorporation of spike protein into virions contributes to the lack of infectivity following establishment of a persistent, non-productive infection in oligodendroglial cell culture by murine coronavirus

International Nuclear Information System (INIS)

Liu Yin; Herbst, Werner; Cao Jianzhong; Zhang Xuming

2011-01-01

Infection of mouse oligodendrocytes with a recombinant mouse hepatitis virus (MHV) expressing a green fluorescence protein facilitated specific selection of virus-infected cells and subsequent establishment of persistence. Interestingly, while viral genomic RNAs persisted in infected cells over 14 subsequent passages with concomitant synthesis of viral subgenomic mRNAs and structural proteins, no infectious virus was isolated beyond passage 2. Further biochemical and electron microscopic analyses revealed that virions, while assembled, contained little spike in the envelope, indicating that lack of infectivity during persistence was likely due to deficiency in spike incorporation. This type of non-lytic, non-productive persistence in oligodendrocytes is unique among animal viruses and resembles MHV persistence previously observed in the mouse central nervous system. Thus, establishment of such a culture system that can recapitulate the in vivo phenomenon will provide a powerful approach for elucidating the mechanisms of coronavirus persistence in glial cells at the cellular and molecular levels.

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

Science.gov (United States)

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

Science.gov (United States)

Kumar, Anil; Sevilla, Michael D.

2009-01-01

On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.

Science.gov (United States)

Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens

2013-10-01

A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

Effect of an Educational Intervention Based on Protection Motivation Theory on Preventing Cervical Cancer among

Science.gov (United States)

Malmir, Shabnam; Barati, Majid; Khani Jeihooni, Ali; Bashirian, Saeed; Hazavehei, Seyed Mohammad Mehdi

2018-03-27

Objective: This study aimed to determine the effectiveness of an educational intervention to prevent cervical cancer among marginalized Iranianwomen based on the Protection Motivation Theory (PMT) as a theoretical framework. Methods: This quasi-experimental study was carried out on 143 women of Kermanshah City in western Iran during 2017. Participants were recruited through cluster and simple random sampling and randomly divided into experimental (n=72) and control groups (n=71). All completed a self-administered questionnaire including PMT constructs and demographic variables. An intervention over six sessions was then applied to the experimental group. Reassessment was conducted three months after the intervention, with data was analyzed with SPSS-16 using chi-square, McNemar, paired T- and independent T-tests. Results: The mean scores for the constructs of PMT, and cervical cancer screening behavior showed no significant differences between the two groups before the intervention (P>0.05). The educational manipulation had significant effects on the experimental groups’ average response for perceived vulnerability, perceived severity, perceived reward, self-efficacy, response efficacy, response cost and protection motivation (all p health centers were significantly increased after 3 months in the experimental (P=0.048), but notthe control group (P>0.05). Conclusions: The results show that applying an educational intervention based on PMT might help prevent cervical cancer and improve regular Pap smear testing. Creative Commons Attribution License

Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model

OpenAIRE

Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.

2008-01-01

Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

School-based smoking prevention programmes: ethical aspects.

Science.gov (United States)

Lotrean, Lucia Maria; Trofor, Antigona; Mihălţan, Florin; Santillan, Edna Arillo

2011-01-01

School-based health education has the potential to inform and educate young people, in order to promote healthy behaviours among them, which will help to prevent diseases and social problems. The present study gives an overview of several ethical issues which must be considered in different phases of school-based smoking prevention programs. This will help health educators, public health professionals and researchers in their activity of health education in schools. The ethical issues must be taken into consideration during all the activities and refer to the involvement of officials, schools, parents, young people who participate into the program, authors and persons/institutions responsible with the implementation, evaluation or funding of the programs. The application into practice of these ethical principles, influence the quality of the health education, its acceptability BY the target group and the correctness of results. Also, it prevents possible problems and misunderstandings between persons and institutions involved in the health education and smoking prevention process, which could seriously affect and even destroy implementation of such health education activities.

Paired fuzzy sets

DEFF Research Database (Denmark)

Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

2015-01-01

In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs.

Science.gov (United States)

Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J

2010-07-29

A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the

An Intelligent Model for Pairs Trading Using Genetic Algorithms.

Science.gov (United States)

Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An

2015-01-01

Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.

Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

NARCIS (Netherlands)

Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.

2005-01-01

We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

School-Based Caries Prevention, Tooth Decay, and the Community Environment.

Science.gov (United States)

Ruff, R R; Niederman, R

2018-04-01

The school and community context can contribute to inequity in child oral health. Whether the school and community affect the effectiveness of school-based caries prevention is unknown. The association between the school and community environment and dental caries, as well as their moderating effects with school-based caries prevention, was assessed using multilevel mixed-effects regression. Data were derived from a 6-y prospective cohort study of children participating in a school-based caries prevention program. For the school and community, living in a dental-shortage area and the proportion of children receiving free or reduced lunch were significantly related to an increased risk of dental caries at baseline. Caries prevention was associated with a significant per-visit decrease in the risk of untreated caries, but the rate of total caries experience increased over time. Caries prevention was more effective in children who had prior dental care at baseline and in schools with a higher proportion of low socioeconomic status students. There was significant variation across schools in the baseline prevalence of dental caries and the effect of prevention over time, although effects were modest. The school and community environment have a direct impact on oral health and moderate the association between school-based caries prevention and dental caries. Knowledge Transfer Statement: School-based caries prevention can be an effective means to reduce oral health inequity by embedding dental care within schools. However, the socioeconomic makeup of schools and characteristics of the surrounding community can affect the impact of school-based care.

Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

International Nuclear Information System (INIS)

Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.

2003-01-01

Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA.

Science.gov (United States)

Chakraborty, Debayan; Wales, David J

2018-01-04

The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

Weighted profile likelihood-based confidence interval for the difference between two proportions with paired binomial data.

Science.gov (United States)

Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C

2014-07-30

Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.

Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

Science.gov (United States)

Renneberg, Dorte; Dervan, Peter B

2003-05-14

The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

Science.gov (United States)

Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

2014-10-01

Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

Frameworks: A Community-Based Approach to Preventing Youth Suicide

Science.gov (United States)

Baber, Kristine; Bean, Gretchen

2009-01-01

Few youth suicide prevention programs are theory based and systematically evaluated. This study evaluated the pilot implementation of a community-based youth suicide prevention project guided by an ecological perspective. One hundred fifty-seven adults representing various constituencies from educators to health care providers and 131 ninth-grade…

Aligning faith-based and national HIV/AIDS prevention responses? Factors influencing the HIV/AIDS prevention policy process and response of faith-based NGOs in Tanzania.

Science.gov (United States)

Morgan, Rosemary; Green, Andrew; Boesten, Jelke

2014-05-01

Faith-based organizations (FBOs) have a long tradition of providing HIV/AIDS prevention and mitigation services in Africa. The overall response of FBOs, however, has been controversial, particularly in regard to HIV/AIDS prevention and FBO's rejection of condom use and promotion, which can conflict with and negatively influence national HIV/AIDS prevention response efforts. This article reports the findings from a study that explored the factors influencing the HIV/AIDS prevention policy process within faith-based non-governmental organizations (NGOs) of different faiths. These factors were examined within three faith-based NGOs in Dar es Salaam, Tanzania-a Catholic, Anglican and Muslim organization. The research used an exploratory, qualitative case-study approach, and employed a health policy analysis framework, examining the context, actor and process factors and how they interact to form content in terms of policy and its implementation within each organization. Three key factors were found to influence faith-based NGOs' HIV/AIDS prevention response in terms of both policy and its implementation: (1) the faith structure in which the organizations are a part, (2) the presence or absence of organizational policy and (3) the professional nature of the organizations and its actors. The interaction between these factors, and how actors negotiate between them, was found to shape the organizations' HIV/AIDS prevention response. This article reports on these factors and analyses the different HIV/AIDS prevention responses found within each organization. By understanding the factors that influence faith-based NGOs' HIV/AIDS prevention policy process, the overall faith-based response to HIV/AIDS, and how it corresponds to national response efforts, is better understood. It is hoped that by doing so the government will be better able to identify how to best work with FBOs to meet national HIV/AIDS prevention targets, improving the overall role of FBOs in the fight against

Evidence-based obesity prevention in childhood and adolescence: critique of recent etiological studies, preventive interventions, and policies.

Science.gov (United States)

Reilly, John J

2012-07-01

Prevention of obesity in childhood and adolescence remains a worthwhile and realistic goal, but preventive efforts have been beset by a number of problems, which are the subject of this review. The review draws on recent systematic reviews and evidence appraisals and has a United Kingdom (UK) perspective because there is a rich evidence base in the United Kingdom that may be helpful to obesity prevention researchers elsewhere. Recent evidence of a leveling off in child and adolescent obesity prevalence in some Western nations should not encourage the belief that the obesity prevention problem has been solved, although a better understanding of recent secular trends might be helpful for prevention strategy in future. An adequate body of evidence provides behavioral targets of preventive interventions, and there are frameworks for prioritizing these targets logically and models for translating them into generalizable interventions with a wide reach (e.g., school-based prevention interventions such as Planet Health). An improved understanding of the "energy gap" that children and adolescents experience would be helpful to the design of preventive interventions and to their tailoring to particular groups. In the United Kingdom, some recent etiological evidence has been taken as indicative of the need for paradigm shifts in obesity prevention, but this evidence from single studies has not been replicated, and paradigm shifts probably occur only rarely. Ensuring that the evidence base on etiology and prevention influences policy effectively remains one of the greatest challenges for childhood obesity researchers.

Use of discriminant analysis to determine black shales of the Lesser Carpathian crystal field

Energy Technology Data Exchange (ETDEWEB)

Khun, M.

1980-01-01

Discriminant analysis of results from geochemical testing was used to separate black shales of the ore level from the nonproductive deposits. Based on a large number of experiments, the accuracy of isolating the black shales according to content of vandium, copper and nickel reached 78%. These elements have basic importance for separation of productive shales from nonproductive.

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

Science.gov (United States)

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Connect: An Effective Community-Based Youth Suicide Prevention Program

Science.gov (United States)

Bean, Gretchen; Baber, Kristine M.

2011-01-01

Youth suicide prevention is an important public health issue. However, few prevention programs are theory driven or systematically evaluated. This study evaluated Connect, a community-based youth suicide prevention program. Analysis of pre and posttraining questionnaires from 648 adults and 204 high school students revealed significant changes in…

PAIR'14 / PAIR'15 STUDENT CONFERENCES ON PLANNING IN ARTIFICIAL INTELLIGENCE AND ROBOTICS

Directory of Open Access Journals (Sweden)

Editorial Foreword

2015-12-01

Full Text Available Dear Readerthe original idea of the student conference on “Planning in Artificial Intelligence and Robotics” (PAIR is to join young researchers from particular laboratories in Czech Republic, where planning problems are investigated from artificial intelligence (AI or robotics points of view. The first year of PAIR has been organized at the Dept. of Computer Science, Faculty Electrical Engineering, Czech Technical University in 2014.At PAIR 2014, laboratories from Prague and Brno were presented. In particular, students and researchers from Charles University, Czech Technical University in Prague, Brno University of Technology, and Central European Institute of Technology participated at the event. Beside an introduction of the particular research groups and their topics, students presented contributions on their current research results. Ten papers were presented on topics ranging from domain–independent planning, trajectory planning to applications for unmanned aerial and legged robots. This first event provides us an initial experience with the community of young researchers in Czech Republic that are working planning in robotic or AI. Based on the success of PAIR 2014, we decided to continue with our effort to establish a suitable fora for students that are geographically very close, but usually do not meet, because of participation on different Robotics and AI events.The second student conference on Planning in Artificial Intelligence and Robotics (PAIR 2015 successfully continues the tradition of the first year of the conference organized in Prague. This year, the conference was collocated with 10th anniversary of RoboTour contest in Písek. This format enable us to extend the impact of the PAIR conference and improve the visibility of the growing student community. The conference reached a good amount of interesting papers focused on image processing for mobile robots, swarm control, driving simulation, robot control, or domain�

Single-fluorophore monitoring of DNA hybridization for investigating the effect of secondary structure on the nucleation step.

Science.gov (United States)

Jo, Joon-Jung; Kim, Min-Ji; Son, Jung-Tae; Kim, Jandi; Shin, Jong-Shik

2009-07-17

Nucleic acid hybridization is one of the essential biological processes involved in storage and transmission of genetic information. Here we quantitatively determined the effect of secondary structure on the hybridization activation energy using structurally defined oligonucleotides. It turned out that activation energy is linearly proportional to the length of a single-stranded region flanking a nucleation site, generating a 0.18 kcal/mol energy barrier per nucleotide. Based on this result, we propose that the presence of single-stranded segments available for non-productive base pairing with a nucleation counterpart extends the searching process for nucleation sites to find a perfect match. This result may provide insights into rational selection of a target mRNA site for siRNA and antisense gene silencing.

Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

Science.gov (United States)

Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

1997-01-01

RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems

OpenAIRE

Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan

2016-01-01

It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...

The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

Czech Academy of Sciences Publication Activity Database

Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír

2016-01-01

Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

Generalized pairing strategies-a bridge from pairing strategies to colorings

Directory of Open Access Journals (Sweden)

Győrffy Lajos

2016-12-01

Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.

A review of educational-based gambling prevention programs for adolescents

Directory of Open Access Journals (Sweden)

Boon Chin Oh

2017-06-01

Full Text Available Abstracts Educational-based problem gambling prevention programs are important avenues in targeting at-risk behaviors among adolescents to prevent an escalation of problematic behaviors into adulthood. The aim of this review is to examine features pertinent to effective educational-based programs in the area of adolescent problem gambling prevention in hopes of providing a foundation and future suggestions for preventive efforts. A stronger understanding of this research area will be essential in ensuring that past practical and theoretical advancements are integrated into the development of future programs.

Multi-user distribution of polarization entangled photon pairs

Energy Technology Data Exchange (ETDEWEB)

Trapateau, J.; Orieux, A.; Diamanti, E.; Zaquine, I., E-mail: isabelle.zaquine@telecom-paristech.fr [LTCI, CNRS, Télécom ParisTech, Université Paris-Saclay, 75013 Paris (France); Ghalbouni, J. [Applied Physics Laboratory, Faculty of Sciences 2, Lebanese University, Campus Fanar, BP 90656 Jdeidet (Lebanon)

2015-10-14

We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on the demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.

Atomic-Level Organization of Vicinal Acid-Base Pairs through the Chemisorption of Aniline and Derivatives onto Mesoporous SBA15

KAUST Repository

Basset, Jean-Marie

2016-06-09

The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.

[Biological and neural bases of partner preferences in rodents: models to understand human pair bonds].

Science.gov (United States)

Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

Science.gov (United States)

Mondal Roy, Sutapa

2018-08-01

The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

Energy Technology Data Exchange (ETDEWEB)

Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L. [Department of Physics, University of Basel, Klingelbergstrasse 82, 4056 Basel (Switzerland)

2015-07-01

Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.

Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

Science.gov (United States)

Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

2015-03-01

Based on the Bardeen-Cooper-Schrieffer theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the photon pairs produced can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.

Error-correcting pairs for a public-key cryptosystem

International Nuclear Information System (INIS)

Pellikaan, Ruud; Márquez-Corbella, Irene

2017-01-01

Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t -bounded decoding algorithms which is achieved in the case the code has a t -error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t -ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t -error correcting pair. (paper)

INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

Directory of Open Access Journals (Sweden)

Mudasir Mudasir

2010-06-01

Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC.

Science.gov (United States)

Guo, Xiurong; Seela, Frank

2017-09-04

α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

Czech Academy of Sciences Publication Activity Database

Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.

2002-01-01

Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

KAUST Repository

Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

2013-01-01

of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

NARCIS (Netherlands)

Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.

2008-01-01

We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

Evidence-Based Obesity Prevention in Childhood and Adolescence: Critique of Recent Etiological Studies, Preventive Interventions, and Policies123

Science.gov (United States)

Reilly, John J.

2012-01-01

Prevention of obesity in childhood and adolescence remains a worthwhile and realistic goal, but preventive efforts have been beset by a number of problems, which are the subject of this review. The review draws on recent systematic reviews and evidence appraisals and has a United Kingdom (UK) perspective because there is a rich evidence base in the United Kingdom that may be helpful to obesity prevention researchers elsewhere. Recent evidence of a leveling off in child and adolescent obesity prevalence in some Western nations should not encourage the belief that the obesity prevention problem has been solved, although a better understanding of recent secular trends might be helpful for prevention strategy in future. An adequate body of evidence provides behavioral targets of preventive interventions, and there are frameworks for prioritizing these targets logically and models for translating them into generalizable interventions with a wide reach (e.g., school-based prevention interventions such as Planet Health). An improved understanding of the “energy gap” that children and adolescents experience would be helpful to the design of preventive interventions and to their tailoring to particular groups. In the United Kingdom, some recent etiological evidence has been taken as indicative of the need for paradigm shifts in obesity prevention, but this evidence from single studies has not been replicated, and paradigm shifts probably occur only rarely. Ensuring that the evidence base on etiology and prevention influences policy effectively remains one of the greatest challenges for childhood obesity researchers. PMID:22798005

English for au pairs the au pair's guide to learning English

CERN Document Server

Curtis, Lucy

2014-01-01

English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.

Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

Czech Academy of Sciences Publication Activity Database

Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.

2010-01-01

Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

Directory of Open Access Journals (Sweden)

Kateřina Klapilová

2014-01-01

Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation

OpenAIRE

Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.

2014-01-01

Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...

Protocols for pressure ulcer prevention: are they evidence-based?

Science.gov (United States)

Chaves, Lidice M; Grypdonck, Mieke H F; Defloor, Tom

2010-03-01

This study is a report of a study to determine the quality of protocols for pressure ulcer prevention in home care in the Netherlands. If pressure ulcer prevention protocols are evidence-based and practitioners use them correctly in practice, this will result a reduction in pressure ulcers. Very little is known about the evidence-based content and quality of the pressure ulcer prevention protocols. In 2008, current pressure ulcer prevention protocols from 24 home-care agencies in the Netherlands were evaluated. A checklist developed and validated by two pressure ulcer prevention experts was used to assess the quality of the protocols, and weighted and unweighted quality scores were computed and analysed using descriptive statistics. The 24 pressure ulcer prevention protocols had a mean weighted quality score of 63.38 points out of a maximum of 100 (sd 5). The importance of observing the skin at the pressure points at least once a day was emphasized in 75% of the protocols. Only 42% correctly warned against the use of materials that were 'less effective or that could potentially cause harm'. Pressure ulcer prevention commands a reasonable amount of attention in home care, but the incidence of pressure ulcers and lack of a consistent, standardized document for use in actual practice indicate a need for systematic implementation of national pressure ulcer prevention standards in the Netherlands to ensure adherence to the established protocols.

Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

International Nuclear Information System (INIS)

Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.

2002-01-01

3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors.

Science.gov (United States)

Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping

2016-02-22

We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base.

Science.gov (United States)

McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F

2014-04-01

Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

Science.gov (United States)

Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

2010-10-14

Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate.

Science.gov (United States)

D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu

2007-02-07

A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation

NARCIS (Netherlands)

Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.

2011-01-01

Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.

Thermodynamics of pairing phase transition in nuclei

International Nuclear Information System (INIS)

Karim, Afaque; Ahmad, Shakeb

2014-01-01

The pairing gaps, pairing energy, heat capacity and entropy are calculated within BCS (Bardeen- Cooper-Schrieffer) based quasi particle approach, including thermal fluctuations on pairing field within pairing model for all nuclei (light, medium, heavy and super heavy nuclei). Quasi particles approach in BCS theory was introduced and reformulated to study various properties. For thermodynamic behavior of nuclei at finite temperatures, the anomalous averages of creation and annihilation operators are introduced. It is solved self consistently at finite temperatures to obtain BCS Hamiltonian. After doing unitary transformation, we obtained the Hamiltonian in the diagonal form. Thus, one gets temperature dependence gap parameter and pairing energy for nuclei. Moreover, the energy at finite temperatures is the sum of the condensation energy and the thermal energy of fermionic quasi particles. With the help of BCS Hamiltonian, specific heat, entropy and free energy are calculated for different nuclei. In this paper the gap parameter occupation number and pairing energy as a function of temperature which is important for all the light, medium, heavy and super heavy nuclei is calculated. Moreover, the various thermo dynamical quantities like specific heat, entropy and free energy is also obtained for different nuclei. Thus, the thermodynamics of pairing phase transition in nuclei is studied

Evaluating a Health Belief Model-Based Educational Program for School Injury Prevention among Hard-of-Hearing/Deaf High School Students

Directory of Open Access Journals (Sweden)

Fatemeh Vejdani-Aram

2015-03-01

Full Text Available Background and Objectives: While all students are vulnerable to injuries, such vulnerability may even be higher in the deaf and hard-of-hearing students. Therefore, this study evaluated a health belief model-based educational program to prevent school injuries among deaf and hard-of-hearing high school students. Materials and Methods: This quasi-experimental study was conducted on all deaf and hard-of-hearing students who attended two special schools in Hamadan (Iran during 2014. They were randomly assigned to either the intervention group (n = 23 or the control group (n = 27. Data were collected using a self-report questionnaire containing items on demographic characteristics, constructs of the health belief model, and knowledge and preventive behaviors. In both groups, the questionnaires were filled out through interviews before and two months after the intervention. The intervention included distributing booklets and holding five educational sessions. Data were analyzed with paired t, independent t, chi square, and Fisher’s exact tests in SPSS16. Results: After the educational intervention, the mean scores of knowledge (P=0.002, preventive behaviors (P=0.001, and constructs of the health belief model, i.e. perceived severity (P=0.001, perceived benefits (P=0.001, self-efficacy (P=0.001, and cues to action (P=0.001, were significantly higher in the intervention group than in the control group. Conclusion: According to our findings, an educational intervention based on the health belief model can promote behaviors to prevent school injuries among deaf and hard-of-hearing students.

Ion-pair chromatography of nucleic acid derivatives

International Nuclear Information System (INIS)

Perrone, P.A.; Brown, P.R.

1985-01-01

Little work has been done on the ion-pair chromatography of nucleic acid constituents, although there is a great potential for the use of this technique in the field. Since the classic work in 1949, nucleotides, as well as nucleosides and bases, have been separated by ion-exchange chromatography. However, ion exchange is a difficult mode and most researchers prefer the use of reversed-phase whenever possible. Although reversed-phase is now the method of choice, ionic compounds like nucleotides and some of the more polar bases are not adequately retained by many systems of this type. In addition, it is difficult to analyze simultaneously members of all three classes of nucleic acid compounds (bases, nucleosides, and nucleotides) using a reversed-phase system, even with gradient elution. Ion pairing can be a useful technique because, theoretically, the separation of nonionic bases and nucleosides along with the ionic nucleotides can be achieved. Additionally, each group of compounds may be separated isocratically. In this chapter, they will discuss ion-pair chromatography as applied to nucleic acid constituents. The current theories, advantages and disadvantages, a limited number of applications, and potential for future work are presented

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

Science.gov (United States)

Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

2005-03-10

Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

Directory of Open Access Journals (Sweden)

Maréchal Eric

2005-03-01

Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

International Nuclear Information System (INIS)

Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E.; Eghbalnia, Hamid R.

2012-01-01

The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ( 1 H– 15 N 2D HMQC) and proton–proton nuclear Overhauser enhancement spectroscopy ( 1 H– 1 H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino resonances for a

RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

Energy Technology Data Exchange (ETDEWEB)

Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E. [National Magnetic Resonance Facility at Madison (United States); Eghbalnia, Hamid R., E-mail: eghbalhd@uc.edu [University of Cincinnati, Department of Molecular and Cellular Physiology (United States)

2012-04-15

The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ({sup 1}H-{sup 15}N 2D HMQC) and proton-proton nuclear Overhauser enhancement spectroscopy ({sup 1}H-{sup 1}H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino

Effectiveness of Mindfulness-Based Relapse Prevention in opioid Dependence Treatment &Mental Health

Directory of Open Access Journals (Sweden)

2008-11-01

Findings: therapy compliance, retention in treatment, decrease in somatic symptoms, anxiety, social dysfunction and increase in health was significantly in both combination of psychological intervention method than the Naltroxan group. Mindfulness-based on relapse prevention was more effective than CBT relapse prevention in decreasing of, social dysfunction, relapse prevention, increase of therapy compliance, and health. Results: Mindfulness based relapse prevention was superior to CBT and Naltroxan and considerably increased effectiveness of opioid relapse prevention therapy.

Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality

Energy Technology Data Exchange (ETDEWEB)

Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)

2017-08-15

The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)

DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

International Nuclear Information System (INIS)

Straehle, U.; Klock, G.; Schuetz, G.

1987-01-01

To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis.

Science.gov (United States)

Brovarets, Ol'ha O; Hovorun, Dmytro M

2014-01-01

Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

Affine pairings on ARM

NARCIS (Netherlands)

Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.

2013-01-01

We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

Adiabatic pair creation in heavy-ion and laser fields

International Nuclear Information System (INIS)

Pickl, P.; Durr, D.

2008-01-01

The planned generation of lasers and heavy-ion colliders renews the hope to see electron-positron pair creation in strong classical fields. This old prediction is usually referred to as spontaneous pair creation. We observe that both heavy-ion collisions and pair creation in strong laser fields, are instances of the theory of adiabatic pair creation. We shall present the theory, thereby correcting earlier results. We give the momentum distribution of created pairs in overcritical fields. We discuss carefully the proposed experimental verifications and conclude that pure laser-based experiments are highly questionable. We propose a new experiment, joining laser fields and heavy ions, which may be feasible with present-day technology and which may indeed verify the theoretical prediction of adiabatic pair creation. Our presentation relies on recent rigorous works in mathematical physics. (authors)

Mahonian pairs

OpenAIRE

Sagan, Bruce E.; Savage, Carla D.

2012-01-01

We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

Lax pairs: a novel type of separability

International Nuclear Information System (INIS)

Fokas, A S

2009-01-01

An attempt is made to place into historical context the fundamental concept of Lax pairs. For economy of presentation, emphasis is placed on the effectiveness of Lax pairs for the analysis of integrable nonlinear evolution PDEs. It is argued that Lax pairs provide a deeper type of separability than the classical separation of variables. Indeed, it is shown that: (a) the solution of the Cauchy problem of evolution equations is based on the derivation of a nonlinear Fourier transform pair, and this is achieved by employing the spectral analysis of one of the two eigenvalue equations forming a Lax pair; thus, although this methodology still follows the reverent philosophy of the classical separation of variables and transform methods, it can be applied to a class of nonlinear PDEs. (b) The solution of initial-boundary-value problems of evolution equations is based on the simultaneous spectral analysis of both equations forming a Lax pair and hence, in a sense, it employs the synthesis instead of the separation of variables; this methodology does not have a direct classical analogue, however, it can be considered as the nonlinearization of a method which combines Green's function classical integral representations with an analogue of the method of images, but which are now formulated in the spectral (Fourier) instead of the physical space. In addition to presenting a general methodology for analysing initial- and initial-boundary-value problems for nonlinear integrable evolution equations in one and two spatial variables, recent progress is reviewed for the derivation and the solution of integrable nonlinear evolution PDEs formulated in higher than two spatial dimensions. (topical review)

Cooper pair splitter realized in a two-quantum-dot Y-junction.

Science.gov (United States)

Hofstetter, L; Csonka, S; Nygård, J; Schönenberger, C

2009-10-15

Non-locality is a fundamental property of quantum mechanics that manifests itself as correlations between spatially separated parts of a quantum system. A fundamental route for the exploration of such phenomena is the generation of Einstein-Podolsky-Rosen (EPR) pairs of quantum-entangled objects for the test of so-called Bell inequalities. Whereas such experimental tests of non-locality have been successfully conducted with pairwise entangled photons, it has not yet been possible to realize an electronic analogue of it in the solid state, where spin-1/2 mobile electrons are the natural quantum objects. The difficulty stems from the fact that electrons are immersed in a macroscopic ground state-the Fermi sea-which prevents the straightforward generation and splitting of entangled pairs of electrons on demand. A superconductor, however, could act as a source of EPR pairs of electrons, because its ground-state is composed of Cooper pairs in a spin-singlet state. These Cooper pairs can be extracted from a superconductor by tunnelling, but, to obtain an efficient EPR source of entangled electrons, the splitting of the Cooper pairs into separate electrons has to be enforced. This can be achieved by having the electrons 'repel' each other by Coulomb interaction. Controlled Cooper pair splitting can thereby be realized by coupling of the superconductor to two normal metal drain contacts by means of individually tunable quantum dots. Here we demonstrate the first experimental realization of such a tunable Cooper pair splitter, which shows a surprisingly high efficiency. Our findings open a route towards a first test of the EPR paradox and Bell inequalities in the solid state.

Noninteractive Verifiable Outsourcing Algorithm for Bilinear Pairing with Improved Checkability

Directory of Open Access Journals (Sweden)

Yanli Ren

2017-01-01

Full Text Available It is well known that the computation of bilinear pairing is the most expensive operation in pairing-based cryptography. In this paper, we propose a noninteractive verifiable outsourcing algorithm of bilinear pairing based on two servers in the one-malicious model. The outsourcer need not execute any expensive operation, such as scalar multiplication and modular exponentiation. Moreover, the outsourcer could detect any failure with a probability close to 1 if one of the servers misbehaves. Therefore, the proposed algorithm improves checkability and decreases communication cost compared with the previous ones. Finally, we utilize the proposed algorithm as a subroutine to achieve an anonymous identity-based encryption (AIBE scheme with outsourced decryption and an identity-based signature (IBS scheme with outsourced verification.

Pair-correlations in swimmer suspensions

Science.gov (United States)

Nambiar, Sankalp; Subramanian, Ganesh

2017-11-01

Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r > L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.

Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing.

Science.gov (United States)

Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud

2015-04-01

The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.

Ponderomotive effects in multiphoton pair production

Science.gov (United States)

Kohlfürst, Christian; Alkofer, Reinhard

2018-02-01

The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.

Technology-based suicide prevention: current applications and future directions.

Science.gov (United States)

Luxton, David D; June, Jennifer D; Kinn, Julie T

2011-01-01

This review reports on current and emerging technologies for suicide prevention. Technology-based programs discussed include interactive educational and social networking Web sites, e-mail outreach, and programs that use mobile devices and texting. We describe innovative applications such as virtual worlds, gaming, and text analysis that are currently being developed and applied to suicide prevention and outreach programs. We also discuss the benefits and limitations of technology-based applications and discuss future directions for their use.

Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions

Science.gov (United States)

Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang

2018-01-01

We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation)

Science.gov (United States)

Gajewski, Andrzej; Kolenderski, Piotr L.

2016-10-01

There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

Pair correlations in nuclei

International Nuclear Information System (INIS)

Shimizu, Yoshifumi

2009-01-01

Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

Human rights-based approach to unintentional injury prevention.

Science.gov (United States)

MacKay, J Morag; Ryan, Mark Andrew

2018-06-01

Unintentional injury remains an important global public health issue, and efforts to address it are often hampered by a lack of visibility, leadership, funding, infrastructure, capacity and evidence of effective solutions. The growing support for a socioecological model and a systems approach to prevention-along with the acknowledgement that injury prevention can be a byproduct of salutogenic design and activities-has increased opportunities to integrate unintentional injury prevention into other health promotion and disease prevention agendas. It has also helped to integrate it into the broader human development agenda through the Sustainable Development Goals. This growing support provides new opportunities to use a human rights-based approach to address the issue. The human rights-based approach is based on the idea that all members of society have social, economic and cultural rights and that governments are responsible and accountable for upholding those rights. It incorporates a systems approach, addresses inequity and places an emphasis on the most vulnerable corners of humanity. It also leverages legal statutes and provides organisations with the opportunity to build existing international goals and benchmarks into their monitoring efforts. This paper describes the approach and highlights how it can leverage attention and investment to address current challenges for unintentional injury. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Experimental many-pairs nonlocality

Science.gov (United States)

Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian

2017-08-01

Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.

Translating Evidence Based Violence and Drug Use Prevention to Obesity Prevention: Development and Construction of the Pathways Program

Science.gov (United States)

Sakuma, Kari-Lyn K.; Riggs, Nathaniel R.; Pentz, Mary Ann

2012-01-01

Effective school-based obesity prevention programs are needed to prevent and reduce the growing obesity risk among youth. Utilizing the evidence-rich areas of violence and substance use prevention, translation science may provide an efficient means for developing curricula across multiple health behaviors. This paper introduces Pathways to Health,…

Au pair trajectories

DEFF Research Database (Denmark)

Dalgas, Karina Märcher

2015-01-01

pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

Dislocation processes in quasicrystals-Kink-pair formation control or jog-pair formation control

International Nuclear Information System (INIS)

Takeuchi, Shin

2005-01-01

A computer simulation of dislocation in a model quasiperiodic lattice indicates that the dislocation feels a large Peierls potential when oriented in particular directions. For a dislocation with a high Peierls potential, the glide velocity and the climb velocity of the dislocation can be described almost in parallel in terms of the kink-pair formation followed by kink motion and the jog-pair formation followed by jog motion, respectively. The activation enthalpy of the kink-pair formation is the sum of the kink-pair formation enthalpy and the atomic jump activation enthalpy, while the activation enthalpy of the jog-pair formation involves the jog-pair enthalpy and the self-diffusion enthalpy. Since the kink-pair energy can be considerably larger than the jog-pair energy, the climb velocity can be faster than the glide velocity, so that the plastic deformation of quasicrystals can be brought not by dislocation glide but by dislocation climb at high temperatures

Transverse Momentum Distributions for Heavy Quark Pairs

OpenAIRE

Berger, Edmond L.; Meng, Ruibin

1993-01-01

We study the transverse momentum distribution for a $pair$ of heavy quarks produced in hadron-hadron interactions. Predictions for the large transverse momentum region are based on exact order $\\alpha_s^3$ QCD perturbation theory. For the small transverse momentum region, we use techniques for all orders resummation of leading logarithmic contributions associated with initial state soft gluon radiation. The combination provides the transverse momentum distribution of heavy quark pairs for all...

Isominkowskian theory of Cooper Pairs in superconductors

International Nuclear Information System (INIS)

Animalu, A.O.E.

1993-01-01

Via the use of Santilli's isominkowskian space, the author presents a relativistic extension of the author's recent treatment of the Cooper Pair in superconductivity based on the Lie-isotopic lifting of quantum mechanics known as Hadronic Mechanics. The isominkowskian treatment reduces the solution of the eiganvalue problem for the quasiparticle energy spectrum to a geometric problem of specifying the metric of the isominkowskian space inside the pair in various models of ordinary high T c superconductors. The use of an intriguing realization of the metric due to Dirac reduces the dimensionality of the interior space to two yielding a spin mutation from 1/2 to zero inside a Cooper pair in two-band BCS and Hubbard models. 12 refs

Essential elements for community engagement in evidence-based youth violence prevention.

Science.gov (United States)

Miao, Tai-An; Umemoto, Karen; Gonda, Deanna; Hishinuma, Earl S

2011-09-01

In the field of youth violence prevention, there has been increasing emphasis on "evidence based" programs and principles shown through scientific research as reaching their intended outcomes. Community mobilization and engagement play a critical role in many evidence-based programs and strategies, as it takes a concerted effort among a wide range of people within a community to alter behavior and maintain behavioral change. How do concerned individuals and groups within a community engage others within and outside of that community to effectively plan, develop and implement appropriate EB programs as well as evaluate the outcomes and impacts of locally developed programs yet to be proven? The authors discuss five elements essential for community engagement in evidence-based youth violence prevention based on their work in a university-community partnership through the Asian/Pacific Islander Youth Violence Prevention Center (API Center), a National Academic Center for Excellence on Youth Violence Prevention Center supported by the Centers for Disease Control and Prevention. They include: (a) aligning EBPs with a community's shared vision and values; (b) establishing an inclusive environment for the planning, implementation and evaluation of EBPs; (c) nurturing collaboration for increased effectiveness and efficacy of EBPs; (d) building adequate leadership and community capacity to develop and sustain EBPs; and (e) building a learning community for evaluation and self-reflection. The authors propose placing greater emphasis on "evaluative thinking" and organizational capacity for evaluation as we pursue evidence-based practices for youth violence prevention. This is especially important for ethnic groups for which an evidence base is not well established.

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

Science.gov (United States)

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections

Science.gov (United States)

Solberg, Katherine M.; Hanley, Gregory P.; Layer, Stacy A.; Ingvarsson, Einar T.

2007-01-01

The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once…

Systematic review of school-based interventions to prevent smoking for girls

NARCIS (Netherlands)

Kleijn, M.J.J. de; Farmer, M.M.; Booth, M.; Motala, A.; Smith, A.; Sherman, S.; Assendelft, W.J.J.; Shekelle, P.

2015-01-01

BACKGROUND: The purpose of this review is to study the effect of school-based interventions on smoking prevention for girls. METHODS: We performed a systematic review of articles published since 1992 on school-based tobacco-control interventions in controlled trials for smoking prevention among

Nucleic Acid Base Analog FRET-Pair Facilitating Detailed Structural Measurements in Nucleic Acid Containing Systems

DEFF Research Database (Denmark)

Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf

2009-01-01

We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...

Graph-based surface reconstruction from stereo pairs using image segmentation

Science.gov (United States)

Bleyer, Michael; Gelautz, Margrit

2005-01-01

This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

Single-flavour and two-flavour pairing in three-flavour quark matter

International Nuclear Information System (INIS)

Alford, Mark G; Cowan, Greig A

2006-01-01

We study single-flavour quark pairing ('self-pairing') in colour-superconducting phases of quark matter, paying particular attention to the difference between scenarios where all three flavours undergo single-flavour pairing, and scenarios where two flavours pair with each other ('2SC' pairing) and the remaining flavour self-pairs. We perform our calculations in the mean-field approximation using a pointlike four-fermion interaction based on single gluon exchange. We confirm the result from previous weakly-coupled-QCD calculations that when all three flavours self-pair the favoured channel for each is colour-spin-locked (CSL) pseudoisotropic pairing. However, we find that when the up and down quarks undergo 2SC pairing, they induce a colour chemical potential that disfavours the CSL phase. The strange quarks then self-pair in a 'polar' channel that breaks rotational invariance, although the CSL phase may survive in a narrow range of densities

Violent Extremism, Community-Based Violence Prevention, and Mental Health Professionals.

Science.gov (United States)

Weine, Stevan M; Stone, Andrew; Saeed, Aliya; Shanfield, Stephen; Beahrs, John; Gutman, Alisa; Mihajlovic, Aida

2017-01-01

New community-based initiatives being developed to address violent extremism in the United States are utilizing mental health services and leadership. This article reviews current approaches to preventing violent extremism, the contribution that mental illness and psychosocial problems can make to violent extremism, and the rationale for integrating mental health strategies into preventing violent extremism. The authors describe a community-based targeted violence prevention model and the potential roles of mental health professionals. This model consists of a multidisciplinary team that assesses at-risk individuals with comprehensive threat and behavioral evaluations, arranges for ongoing support and treatment, conducts follow-up evaluations, and offers outreach, education, and resources for communities. This model would enable mental health professionals in local communities to play key roles in preventing violent extremism through their practice and leadership.

Simulation-based investigation of the paired-gear method in cod-end selectivity studies

DEFF Research Database (Denmark)

Herrmann, Bent; Frandsen, Rikke; Holst, René

2007-01-01

In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...

A simple and highly selective 2,2-diferrocenylpropane-based multi-channel ion pair receptor for Pb(2+) and HSO4(-).

Science.gov (United States)

Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng

2015-03-28

A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).

rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

Science.gov (United States)

Guo, Liyuan; Wang, Jing

2018-01-04

Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Analysis of a variety of inorganic and organic additives in food products by ion-pairing liquid chromatography coupled to high-resolution mass spectrometry.

Science.gov (United States)

Kaufmann, Anton; Widmer, Mirjam; Maden, Kathryn; Butcher, Patrick; Walker, Stephan

2018-03-05

A reversed-phase ion-pairing chromatographic method was developed for the detection and quantification of inorganic and organic anionic food additives. A single-stage high-resolution mass spectrometer (orbitrap ion trap, Orbitrap) was used to detect the accurate masses of the unfragmented analyte ions. The developed ion-pairing chromatography method was based on a dibutylamine/hexafluoro-2-propanol buffer. Dibutylamine can be charged to serve as a chromatographic ion-pairing agent. This ensures sufficient retention of inorganic and organic anions. Yet, unlike quaternary amines, it can be de-charged in the electrospray to prevent the formation of neutral analyte ion-pairing agent adducts. This process is significantly facilitated by the added hexafluoro-2-propanol. This approach permits the sensitive detection and quantification of additives like nitrate and mono-, di-, and triphosphate as well as citric acid, a number of artificial sweeteners like cyclamate and aspartame, flavor enhancers like glutamate, and preservatives like sorbic acid. This is a major advantage, since the currently used analytical methods as utilized in food safety laboratories are only capable in monitoring a few compounds or a particular category of food additives. Graphical abstract Deptotonation of ion pair agent in the electrospray interface.

QED peripheral mechanism of pair production at colliders

International Nuclear Information System (INIS)

Ahmadov, A. I.; Galynskii, M. V.; Bystritskiy, Yu. M.; Kuraev, E. A.; Shatnev, M. G.

2008-01-01

Cross sections of the processes of production of neutral pions and pairs of charged fermions and bosons in peripheral interaction of leptons and photons are calculated in the main logarithmic approximation. We investigate the phase volumes and differential cross sections. The differential cross sections of production of a few neutral pions and a few pairs are written down explicitly. Considering the academic problem of summation over a number of pairs for massless particles we reproduce the known results obtained in the 1970s. The possibility of constructing the generator for Monte Carlo modeling of these processes based on these results is discussed.

Space-Efficient Re-Pair Compression

DEFF Research Database (Denmark)

Bille, Philip; Gørtz, Inge Li; Prezza, Nicola

2017-01-01

Re-Pair [5] is an effective grammar-based compression scheme achieving strong compression rates in practice. Let n, σ, and d be the text length, alphabet size, and dictionary size of the final grammar, respectively. In their original paper, the authors show how to compute the Re-Pair grammar...... in expected linear time and 5n + 4σ2 + 4d + √n words of working space on top of the text. In this work, we propose two algorithms improving on the space of their original solution. Our model assumes a memory word of [log2 n] bits and a re-writable input text composed by n such words. Our first algorithm runs...

The paired-domination and the upper paired-domination numbers of graphs

Directory of Open Access Journals (Sweden)

Włodzimierz Ulatowski

2015-01-01

Full Text Available In this paper we continue the study of paired-domination in graphs. A paired-dominating set, abbreviated PDS, of a graph \\(G\\ with no isolated vertex is a dominating set of vertices whose induced subgraph has a perfect matching. The paired-domination number of \\(G\\, denoted by \\(\\gamma_{p}(G\\, is the minimum cardinality of a PDS of \\(G\\. The upper paired-domination number of \\(G\\, denoted by \\(\\Gamma_{p}(G\\, is the maximum cardinality of a minimal PDS of \\(G\\. Let \\(G\\ be a connected graph of order \\(n\\geq 3\\. Haynes and Slater in [Paired-domination in graphs, Networks 32 (1998, 199-206], showed that \\(\\gamma_{p}(G\\leq n-1\\ and they determine the extremal graphs \\(G\\ achieving this bound. In this paper we obtain analogous results for \\(\\Gamma_{p}(G\\. Dorbec, Henning and McCoy in [Upper total domination versus upper paired-domination, Questiones Mathematicae 30 (2007, 1-12] determine \\(\\Gamma_{p}(P_n\\, instead in this paper we determine \\(\\Gamma_{p}(C_n\\. Moreover, we describe some families of graphs \\(G\\ for which the equality \\(\\gamma_{p}(G=\\Gamma_{p}(G\\ holds.

Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

NARCIS (Netherlands)

Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.

2006-01-01

We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing.

Science.gov (United States)

Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D

1984-06-19

The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults.

Science.gov (United States)

Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul

2012-11-01

Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

Seniority zero pair coupled cluster doubles theory

International Nuclear Information System (INIS)

Stein, Tamar; Henderson, Thomas M.; Scuseria, Gustavo E.

2014-01-01

Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems

A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

OpenAIRE

Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier

2005-01-01

Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

Science.gov (United States)

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

Effect of single interstitial impurity in iron-based superconductors with sign-changed s-wave pairing symmetry

Energy Technology Data Exchange (ETDEWEB)

Yu, Xiang-Long, E-mail: xlyu@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Liu, Da-Yong; Quan, Ya-Min; Zheng, Xiao-Jun [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Zou, Liang-Jian, E-mail: zou@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China)

2015-12-15

Highlights: • Effects of single interstitial impurity are studied in iron-based superconductors. • Bound states within the superconducting gap can be induced. • The interstitial impurity can induce a π phase shift of pairing order parameter. • For strong magnetic scattering the bound-state peak can appear at the Fermi level. - Abstract: We employ the self-consistent Bogoliubov-de Gennes (BdG) formulation to investigate the effect of single interstitial nonmagnetic/magnetic impurity in iron-based superconductors with s ± -wave pairing symmetry. We find that both the nonmagnetic and magnetic impurities can induce bound states within the superconducting (SC) gap and a π phase shift of SC order parameter at the impurity site. However, different from the interstitial-nonmagnetic-impurity case characterized by two symmetric peaks with respect to zero energy, the interstitial magnetic one only induces single bound-state peak. In the strong scattering regime this peak can appear at the Fermi level, which has been observed in the recent scanning tunneling microscope (STM) experiment of Fe(Te,Se) superconductor with interstitial Fe impurities (Yin et al. 2015 [44]). This novel single in-gap peak feature also distinguishes the interstitial case from the substitutional one with two peaks. These results provide important information for comparing the different impurity effects in the iron-based superconductors.

Pair- ${v}$ -SVR: A Novel and Efficient Pairing nu-Support Vector Regression Algorithm.

Science.gov (United States)

Hao, Pei-Yi

This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory. Moreover, pair--SVR has additional advantage of using parameter for controlling the bounds on fractions of SVs and errors. Furthermore, the upper bound and lower bound functions of the regression model estimated by pair--SVR capture well the characteristics of data distributions, thus facilitating automatic estimation of the conditional mean and predictive variance simultaneously. This may be useful in many cases, especially when the noise is heteroscedastic and depends strongly on the input values. The experimental results validate the superiority of our pair--SVR in both training/prediction speed and generalization ability.This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory

Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

Directory of Open Access Journals (Sweden)

Jiuqiang Han

2013-03-01

Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †

OpenAIRE

Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

2012-01-01

8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

Community Based Organizations in HIV/AIDS Prevention, Patient ...

African Journals Online (AJOL)

Community Based Organizations in HIV/AIDS Prevention, Patient. ... behavioral change communication methods that may contribute significantly to overcoming ... Towards that objective, CBOs need both internal strengthening of programs and ...

Observing Pair-Work Task in an English Speaking Class

Directory of Open Access Journals (Sweden)

Diana Achmad

2014-01-01

Full Text Available This paper reports on students’ pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger with the less competent ones (hereafter, weaker; therefore, eight pairs were observed during the lesson. The task given to the students was to express ‘Agree and Disagree’ in the context of giving opinions related to social life. Based on the observations, the task was successfully implemented by six pairs; thus, the two others faced some problems. From the first pair, it was seen that the stronger student had intimated the weaker one into speaking during the task. The other pair, who was both of the same native, did not converse in English as expected and mostly used their native language to speak with one another presumably due to respect from the stronger student towards the weaker one. In situations like this, when pair-work becomes unproductive, rotating pairs is recommended to strengthen information sharing and assigning roles to avoid a student from taking over the activity from his or her pair. In conclusion, pairing international learners with mixed speaking proficiency by teachers must be conducted as effectively as possible by initially identifying their ability and learning culture to profoundly expand the students’ language resources.

The Effect of Educational Program Based on the Health Belief Model on Brucellosis Preventive Behaviors among Traditional Ranchers in Rural Areas of Hamadan Province

Directory of Open Access Journals (Sweden)

Zahra Eskandari

2017-03-01

Full Text Available Background and Objectives: Training brucellosis preventive behaviors is mandatory to reduce the incidence of this disease in at-risk groups. Thus, the aim of this study was to determine the effectiveness of an educational program based on Health Belief Model (HBM on brucellosis preventive behaviors among traditional ranchers in rural areas of Hamadan Province, Iran. Materials and Methods: This interventional study was performed with a pretest-posttest design and a control group in 2016. The participants were traditional ranchers of the villages of Hamadan Province, who are identified at high risk for brucellosis. In this study, 70 ranchers were randomly selected and divided into experimental and control groups. The data was collected using a questionnaire consisting of demographic information, knowledge, behavior checklist, and HBM constructs. The experimental group received the educational intervention during 4 sessions with film screening and the use of video and text messages. Data was analyzed using chi-square, Fisher’s exact test, independent t-test, and paired t-test in SPSS. Results: After the intervention, the mean scores of knowledge, perceived susceptibility, perceived severity, perceived benefits, perceived self-efficacy, and cues to action and prevention of brucellosis in the experimental group had significantly increased in comparison to the control group (P<0.001. Conclusions: Results of this study showed that the educational intervention based on the Health Belief Model could promote brucellosis preventive behaviors among traditional ranchers.

NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy

Science.gov (United States)

Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt

1998-01-01

This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

Community-based osteoporosis prevention: Physical activity in relation to bone density, fall prevention, and the effect of training programmes : The Vadstena Osteoporosis Prevention Project

OpenAIRE

Grahn Kronhed, Ann-Charlotte

2003-01-01

This thesis is based on studies of the ten-year community-based intervention programme entitled, the Vadstena Osteoporosis Prevention Project (VOPP). The specific aims of the research were to describe the effects of physical activity and training programmes on bone mass and balance performance in adults, to determine whether a fall risk prevention programme could motivate personal actions among the elderly, to ascertain whether the intervention programme could reduce the incidence of forearm ...

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

Science.gov (United States)

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Prevention literacy: community-based advocacy for access and ownership of the HIV prevention toolkit.

Science.gov (United States)

Parker, Richard G; Perez-Brumer, Amaya; Garcia, Jonathan; Gavigan, Kelly; Ramirez, Ana; Milnor, Jack; Terto, Veriano

2016-01-01

efforts are limited and unsustainable. Success of prevention efforts depends on equity of access, community-based ownership, and multilevel support structures to enable usage and sustainability. For existing HIV prevention efforts to be effective in "real-world" settings, with limited resources, reflection on historical lessons and contextual realities (i.e. policies, financial constraints, and biomedical patents) indicated the need to extend principles developed for treatment access and treatment literacy, to support prevention literacy and prevention access as an integral part of the global response to HIV.

Deformable L-shaped microwell array for trapping pairs of heterogeneous cells

International Nuclear Information System (INIS)

Lee, Gi-Hun; Kim, Sung-Hwan; Park, Joong Yull; Kang, AhRan; Lee, Sang-Hoon; Takayama, Shuichi

2015-01-01

To study cell-to-cell interactions, there has been a continuous demand on developing microsystems for trapping pairs of two different cells in microwell arrays. Here, we propose an L-shaped microwell (L-microwell) array that relies on the elasticity of a polydimethylsiloxane (PDMS) substrate for trapping and pairing heterogeneous cells. We designed an L-microwell suitable for trapping single cell in each branch via stretching/releasing the PDMS substrate, and also performed 3D time-dependent diffusion simulations to visualize how cell-secreted molecules diffuse in the L-microwell and communicate with the partner cell. The computational results showed that the secreted molecule first contacted the partner cell after 35 min, and the secreted molecule fully covered the partner cell in 4 h (when referenced to 10% of the secreted molecular concentration). The molecules that diffused to the outside of the L-microwell were significantly diluted by the bulk solution, which prevented unwanted cellular communication between neighboring L-microwells. We produced over 5000 cell pairs in one 2.25 cm 2 array with about 30 000 L-microwells. The proposed L-microwell array offers a versatile and convenient cell pairing method to investigate cell-to-cell interactions in, for example, cell fusion, immune reactions, and cancer metastasis. (paper)

Smartphone-Based Solutions for Fall Detection and Prevention: Challenges and Open Issues

Directory of Open Access Journals (Sweden)

Mohammad Ashfak Habib

2014-04-01

Full Text Available This paper presents a state-of-the-art survey of smartphone (SP-based solutions for fall detection and prevention. Falls are considered as major health hazards for both the elderly and people with neurodegenerative diseases. To mitigate the adverse consequences of falling, a great deal of research has been conducted, mainly focused on two different approaches, namely, fall detection and fall prevention. Required hardware for both fall detection and prevention are also available in SPs. Consequently, researchers’ interest in finding SP-based solutions has increased dramatically over recent years. To the best of our knowledge, there has been no published review on SP-based fall detection and prevention. Thus in this paper, we present the taxonomy for SP-based fall detection and prevention solutions and systematic comparisons of existing studies. We have also identified three challenges and three open issues for future research, after reviewing the existing articles. Our time series analysis demonstrates a trend towards the integration of external sensing units with SPs for improvement in usability of the systems.

Three-dimensional x-ray stereometry from paired coplanar images: a progress report.

Science.gov (United States)

Baumrind, S; Moffitt, F H; Curry, S

1983-10-01

More than fifty years ago, Broadbent reported the development of a three-dimensional cephalometric method which complexed information from pairs of x-ray images oriented in two planes at right angles to each other. Empirical problems have prevented the routine clinical use of this "biplanar" method, notwithstanding its obvious conceptual brilliance. The present article reports on recent work toward the development of an alternative method of three-dimensional cephalometry in which the two images of each x-ray pair are positioned in the same plane rather than being at right angles to each other. It is believed that this "coplanar" method avoids many of the technical problems that have limited the use of the Broadbent method.

Implementation Measurement for Evidence-Based Violence Prevention Programs in Communities.

Science.gov (United States)

Massetti, Greta M; Holland, Kristin M; Gorman-Smith, Deborah

2016-08-01

Increasing attention to the evaluation, dissemination, and implementation of evidence-based programs (EBPs) has led to significant advancements in the science of community-based violence prevention. One of the prevailing challenges in moving from science to community involves implementing EBPs and strategies with quality. The CDC-funded National Centers of Excellence in Youth Violence Prevention (YVPCs) partner with communities to implement a comprehensive community-based strategy to prevent violence and to evaluate that strategy for impact on community-wide rates of violence. As part of their implementation approach, YVPCs document implementation of and fidelity to the components of the comprehensive youth violence prevention strategy. We describe the strategies and methods used by the six YVPCs to assess implementation and to use implementation data to inform program improvement efforts. The information presented describes the approach and measurement strategies employed by each center and for each program implemented in the partner communities. YVPCs employ both established and innovative strategies for measurement and tracking of implementation across a broad range of programs, practices, and strategies. The work of the YVPCs highlights the need to use data to understand the relationship between implementation of EBPs and youth violence outcomes.

Josephson junction analog and quasiparticle-pair current

DEFF Research Database (Denmark)

Bak, Christen Kjeldahl; Pedersen, Niels Falsig

1973-01-01

A close analogy exists between a Josephson junction and a phase-locked loop. A new type of electrical analog based on this principle is presented. It is shown that the inclusion in this analog of a low-pass filter gives rise to a current of the same form as the Josephson quasiparticle-pair current....... A simple picture of the quasiparticle-pair current, which gives the right dependences, is obtained by assuming a junction cutoff frequency to be at the energy gap. ©1973 American Institute of Physics...

[Internet-based resilience training and prevention of mental disorders].

Science.gov (United States)

Lehr, D; Kunzler, A; Helmreich, I; Behrendt, D; Chmitorz, A; Lieb, K

2018-05-30

Resilience is associated with a positive and resource-oriented perspective. Therefore, it seems especially attractive for health promotion and prevention. In recent years, interventions to foster resilience have been increasingly developed, which train resilience factors and are mainly conducted in a face to face group format. The question is raised what potential internet-based interventions (i-interventions) that train resilience factors have for health promotion and prevention. Based on a narrative overview, the possibilities for i‑interventions that train resilience factors for health promotion and prevention are investigated and the state of research is described. The effects of the i‑interventions presented here, which aim at fostering resilience, on measures of mental health and well-being are heterogeneous and vary between low to high effects. Stronger evidence for the efficacy of these measures exists for more general i‑interventions that also train resilience factors but are conceptualized for the prevention of specific disorders, such as depression or for stress reduction. Given the heterogeneous nature of intervention contents, theoretical foundations and therapeutic methods used, the heterogeneity of the evidence is discussed. In addition, perspectives for the further development of resource-oriented resilience interventions are outlined.

Designing an ASIP for cryptographic pairings over Barreto-Naehrig curves

NARCIS (Netherlands)

Kammler, D.; Zhang, D.; Schwabe, P.; Scharwaechter, H.; Langenberg, M.; Auras, D.; Ascheid, G.; Mathar, R.; Clavier, C.; Gaj, K.

2009-01-01

This paper presents a design-space exploration of an application-specific instruction-set processor (ASIP) for the computation of various cryptographic pairings over Barreto-Naehrig curves (BN curves). Cryptographic pairings are based on elliptic curves over finite fields—in the case of BN curves a

Baby Shampoo versus Commercial Anti-fogging Solution to Prevent Fogging during Nasal Endoscopy: A Randomized Double-Blinded, Matched-Pair, Equivalent Trial.

Science.gov (United States)

Chainansamit, Seksun; Piromchai, Patorn; Anantpinijwatna, Intira; Kasemsiri, Pornthep; Thanaviratananich, Sanguansak

2015-08-01

To compare the minimization of the fog condensation during nasal endoscopy between a commercial anti-fogging agent and baby shampoo. This randomized double-blinded matched pair study was conducted at the Department of Otorhinolaryngology, Faculty of Medicine, Khon Kaen University during February 4, 2013 to March 14, 2013. The commercial anti-fogging solution (Ultrastop®) and baby shampoo solution (Johnson's® no more tear®) were compared. A computer generated randomization was performed to select the solution applying on the lens for nasal endoscopy of the right nasal cavity. The other solution was then used for the left one. Three passes of endoscopy were performed to examine the floor of the nose, the sphenoethmoidal recess and the middle meatus area which spent about 30 seconds for each time of endoscopy. The time to become foggy on the lens and the preferred solution assessed by the endoscopists were recorded. There were 71 eligible patients recruited in the study, 37 males (52.1%) and 34 females (47.9%). There was no fogging during a 30-second nasal endoscopy either by baby shampoo or commercial anti-fogging solution. However, 9.86% (95% C12.75-16.97) of endoscopists preferred commercial anti-fogging agent, 7.04% (95% CI 0.94-13.14) preferred baby shampoo and 83.10% (95% CI 74.16-92.03) had equal satisfaction. Both agents had no statistically significant difference for preventing foggy on the lens. Baby shampoo is an effective agent to prevent fogging during nasal endoscopy and comparable with the commercial anti-fogging agent.

Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs

Science.gov (United States)

Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.

2018-02-01

For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

Directory of Open Access Journals (Sweden)

Ol'ha O. Brovarets'

2018-02-01

Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

Pair formation models for sexually transmitted infections: A primer

Directory of Open Access Journals (Sweden)

Mirjam Kretzschmar

2017-08-01

Full Text Available For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward transmission of the infection as long as they persist. In addition, for curable infections re-infection from an infected partner may occur. Furthermore, interventions based on contact tracing rely on the possibility of identifying and treating partners of infected individuals. To reflect these features in a mathematical model, pair formation models were introduced to mathematical epidemiology in the 1980's. They have since been developed into a widely used tool in modelling sexually transmitted infections and the impact of interventions. Here we give a basic introduction to the concepts of pair formation models for a susceptible-infected-susceptible (SIS epidemic. We review some results and applications of pair formation models mainly in the context of chlamydia infection. Keywords: Pair formation, Mathematical model, Partnership duration, Sexually transmitted infections, Basic reproduction number

Awakened Oscillations in Coupled Consumer-Resource Pairs

Directory of Open Access Journals (Sweden)

Almaz Mustafin

2014-01-01

Full Text Available The paper concerns two interacting consumer-resource pairs based on chemostat-like equations under the assumption that the dynamics of the resource is considerably slower than that of the consumer. The presence of two different time scales enables to carry out a fairly complete analysis of the problem. This is done by treating consumers and resources in the coupled system as fast-scale and slow-scale variables, respectively, and subsequently considering developments in phase planes of these variables, fast and slow, as if they are independent. When uncoupled, each pair has unique asymptotically stable steady state and no self-sustained oscillatory behavior (although damped oscillations about the equilibrium are admitted. When the consumer-resource pairs are weakly coupled through direct reciprocal inhibition of consumers, the whole system exhibits self-sustained relaxation oscillations with a period that can be significantly longer than intrinsic relaxation time of either pair. It is shown that the model equations adequately describe locally linked consumer-resource systems of quite different nature: living populations under interspecific interference competition and lasers coupled via their cavity losses.

Research calls for preventive approach to gender-based violence in ...

International Development Research Centre (IDRC) Digital Library (Canada)

Their research looked at the root causes and impacts of violence against women and also assessed the effectiveness of existing strategies to prevent and combat gender-based violence. Their work has identified key strategies to strengthen civil society and public organizations engaged in preventing violence against ...

Nanoscale protein diffusion by STED-based pair correlation analysis.

Directory of Open Access Journals (Sweden)

Paolo Bianchini

Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.

Cooper Pairs in Insulators?

International Nuclear Information System (INIS)

Valles, James

2008-01-01

Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

Science.gov (United States)

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

Optimal Decisions for Organ Exchanges in a Kidney Paired Donation Program.

Science.gov (United States)

Li, Yijiang; Song, Peter X-K; Zhou, Yan; Leichtman, Alan B; Rees, Michael A; Kalbfleisch, John D

2014-05-01

The traditional concept of barter exchange in economics has been extended in the modern era to the area of living-donor kidney transplantation, where one incompatible donor-candidate pair is matched to another pair with a complementary incompatibility, such that the donor from one pair gives an organ to a compatible candidate in the other pair and vice versa. Kidney paired donation (KPD) programs provide a unique and important platform for living incompatible donor-candidate pairs to exchange organs in order to achieve mutual benefit. In this paper, we propose novel organ allocation strategies to arrange kidney exchanges under uncertainties with advantages, including (i) allowance for a general utility-based evaluation of potential kidney transplants and an explicit consideration of stochastic features inherent in a KPD program; and (ii) exploitation of possible alternative exchanges when the originally planned allocation cannot be fully executed. This allocation strategy is implemented using an integer programming (IP) formulation, and its implication is assessed via a data-based simulation system by tracking an evolving KPD program over a series of match runs. Extensive simulation studies are provided to illustrate our proposed approach.

Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

Energy Technology Data Exchange (ETDEWEB)

Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

2016-04-19

By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

Understanding Fomalhaut as a Cooper pair

Science.gov (United States)

Feng, F.; Jones, H. R. A.

2018-03-01

Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.

[Involvement of cranial pairs as manifestation of prostatic cancer].

Science.gov (United States)

Ripa Saldias, L M; Ayuso Blanco, T; Delpon Pérez, E; Sarria Octavio de Toledo, L

1994-10-01

Two cases of prostate cancer (PC) which presented clinically with affectation of the cranial pairs due to skull base metastasis. In both cases, existence of intraparenchimatous brain metastasis was excluded. Initial improvement with hormonal therapy was followed by clinical, analytical and radiological relapse due to spread of process until death, at 11 and 36 months from diagnosis. Although PC's bone metastasis are frequent, their location at the skull base is uncommon. Even more rare are the cases which present with changes in the cranial pairs in the absence of signs and symptoms of prostatism.

Charge Aspects of Composite Pair Superconductivity

Science.gov (United States)

Flint, Rebecca

2014-03-01

Conventional Cooper pairs form from well-defined electronic quasiparticles, making the internal structure of the pair irrelevant. However, in the 115 family of superconductors, the heavy electrons are forming as they pair and the internal pair structure becomes as important as the pairing mechanism. Conventional spin fluctuation mediated pairing cannot capture the direct transition from incoherent local moments to heavy fermion superconductivity, but the formation of composite pairs favored by the two channel Kondo effect can. These composite pairs are local d-wave pairs formed by two conduction electrons in orthogonal Kondo channels screening the same local moment. Composite pairing shares the same symmetries as magnetically mediated pairing, however, only composite pairing necessarily involves a redistribution of charge within the unit cell originating from the internal pair structure, both as a monopole (valence change) and a quadrupole effect. This redistribution will onset sharply at the superconducting transition temperature. A smoking gun test for composite pairing is therefore a sharp signature at Tc - for example, a cusp in the Mossbauer isomer shift in NpPd5Al2 or in the NQR shift in (Ce,Pu)CoIn5.

A Systematic Review of Home-Based Childhood Obesity Prevention Studies

Science.gov (United States)

Fawole, Oluwakemi; Segal, Jodi; Wilson, Renee F.; Cheskin, Lawrence J.; Bleich, Sara N.; Wu, Yang; Lau, Brandyn; Wang, Youfa

2013-01-01

BACKGROUND AND OBJECTIVES: Childhood obesity is a global epidemic. Despite emerging research about the role of the family and home on obesity risk behaviors, the evidence base for the effectiveness of home-based interventions on obesity prevention remains uncertain. The objective was to systematically review the effectiveness of home-based interventions on weight, intermediate (eg, diet and physical activity [PA]), and clinical outcomes. METHODS: We searched Medline, Embase, PsychInfo, CINAHL, clinicaltrials.gov, and the Cochrane Library from inception through August 11, 2012. We included experimental and natural experimental studies with ≥1-year follow-up reporting weight-related outcomes and targeting children at home. Two independent reviewers screened studies and extracted data. We graded the strength of the evidence supporting interventions targeting diet, PA, or both for obesity prevention. RESULTS: We identified 6 studies; 3 tested combined interventions (diet and PA), 1 used diet intervention, 1 combined intervention with primary care and consumer health informatics components, and 1 combined intervention with school and community components. Select combined interventions had beneficial effects on fruit/vegetable intake and sedentary behaviors. However, none of the 6 studies reported a significant effect on weight outcomes. Overall, the strength of evidence is low that combined home-based interventions effectively prevent obesity. The evidence is insufficient for conclusions about home-based diet interventions or interventions implemented at home in association with other settings. CONCLUSIONS: The strength of evidence is low to support the effectiveness of home-based child obesity prevention programs. Additional research is needed to test interventions in the home setting, particularly those incorporating parenting strategies and addressing environmental influences. PMID:23753095

Evidence-Based Practices Project for Suicide Prevention

Science.gov (United States)

Rodgers, Philip L.; Sudak, Howard S.; Silverman, Morton M.; Litts, David A.

2007-01-01

Suicide continues to be a serious public health problem. In response to this problem, a myriad of suicide prevention programs have been developed and employed across the United States. Unfortunately, the effectiveness of many of these programs is unknown because they have not been evaluated using rigorous methods. The Evidence-Based Practices…

Universal quantum gates for Single Cooper Pair Box based quantum computing

Science.gov (United States)

Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.

2000-01-01

We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

Why the tautomerization of the G·C Watson-Crick base pair via the DPT does not cause point mutations during DNA replication? QM and QTAIM comprehensive analysis.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2014-01-01

The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied

Constructing "Packages" of Evidence-Based Programs to Prevent Youth Violence: Processes and Illustrative Examples From the CDC's Youth Violence Prevention Centers.

Science.gov (United States)

Kingston, Beverly; Bacallao, Martica; Smokowski, Paul; Sullivan, Terri; Sutherland, Kevin

2016-04-01

This paper describes the strategic efforts of six National Centers of Excellence in Youth Violence Prevention (YVPC), funded by the U.S. Centers for Disease Control and Prevention, to work in partnership with local communities to create comprehensive evidence-based program packages to prevent youth violence. Key components of a comprehensive evidence-based approach are defined and examples are provided from a variety of community settings (rural and urban) across the nation that illustrate attempts to respond to the unique needs of the communities while maintaining a focus on evidence-based programming and practices. At each YVPC site, the process of selecting prevention and intervention programs addressed the following factors: (1) community capacity, (2) researcher and community roles in selecting programs, (3) use of data in decision-making related to program selection, and (4) reach, resources, and dosage. We describe systemic barriers to these efforts, lessons learned, and opportunities for policy and practice. Although adopting an evidence-based comprehensive approach requires significant upfront resources and investment, it offers great potential for preventing youth violence and promoting the successful development of children, families and communities.

The study of variability and strain selection in Streptomyces atroolivaceus. III

International Nuclear Information System (INIS)

Blumauerova, M.; Lipavska, H.; Stajner, K.; Vanek, Z.

1976-01-01

Mutants of Streptomyces atroolivaceus blocked in the biosynthesis of mithramycin were isolated both by natural selection and after treatment with mutagenic factors (UV and gamma rays, nitrous acid). Both physical factors were more effective than nitrous acid. The selection was complicated by the high instability of isolates, out of which 20 to 80%=. (depending on their origin) reversed spontaneously to the parent type. Primary screening (selection of morphological variants and determination of their activity using the method of agar blocks) made it possible to detect only potentially non-productive strains; however, the final selection always had to be made under submerged conditions. Fifty-four stable non-productive mutants were divided, according to results of the chromatographic analysis, into five groups differing in the production of the six biologically inactive metabolites. The mutants did not accumulate chromomycinone, chromocyclomycin and chromocyclin. On mixed cultivation none of the pairs of mutants was capable of the cosynthesis of mithramycin or of new compounds differing from standard metabolites. Possible causes of the above results are discussed. (author)

Development of a novel device to trap heavy metal cations: application of the specific interaction between heavy metal cation and mismatch DNA base pair.

Science.gov (United States)

Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo

2009-01-01

We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.

Statistical deprojection of galaxy pairs

Science.gov (United States)

Nottale, Laurent; Chamaraux, Pierre

2018-06-01

Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.

Classification between normal and tumor tissues based on the pair-wise gene expression ratio

International Nuclear Information System (INIS)

Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine

2004-01-01

Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested

A 3-base pair deletion, c.9711_9713del, in DMD results in intellectual disability without muscular dystrophy

NARCIS (Netherlands)

Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.

2014-01-01

We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,

Mindfulness-based prevention for eating disorders: A school-based cluster randomized controlled study.

Science.gov (United States)

Atkinson, Melissa J; Wade, Tracey D

2015-11-01

Successful prevention of eating disorders represents an important goal due to damaging long-term impacts on health and well-being, modest treatment outcomes, and low treatment seeking among individuals at risk. Mindfulness-based approaches have received early support in the treatment of eating disorders, but have not been evaluated as a prevention strategy. This study aimed to assess the feasibility, acceptability, and efficacy of a novel mindfulness-based intervention for reducing the risk of eating disorders among adolescent females, under both optimal (trained facilitator) and task-shifted (non-expert facilitator) conditions. A school-based cluster randomized controlled trial was conducted in which 19 classes of adolescent girls (N = 347) were allocated to a three-session mindfulness-based intervention, dissonance-based intervention, or classes as usual control. A subset of classes (N = 156) receiving expert facilitation were analyzed separately as a proxy for delivery under optimal conditions. Task-shifted facilitation showed no significant intervention effects across outcomes. Under optimal facilitation, students receiving mindfulness demonstrated significant reductions in weight and shape concern, dietary restraint, thin-ideal internalization, eating disorder symptoms, and psychosocial impairment relative to control by 6-month follow-up. Students receiving dissonance showed significant reductions in socio-cultural pressures. There were no statistically significant differences between the two interventions. Moderate intervention acceptability was reported by both students and teaching staff. Findings show promise for the application of mindfulness in the prevention of eating disorders; however, further work is required to increase both impact and acceptability, and to enable successful outcomes when delivered by less expert providers. © 2015 Wiley Periodicals, Inc.

The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair.

Science.gov (United States)

Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle

2017-05-01

Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Rail Base Corrosion and Cracking Prevention: Phase 2

Science.gov (United States)

2018-04-09

EWI was engaged by the Federal Railroad Administration to research rail treatments to prevent rail base corrosion in corrosive environments. A coating system was selected in Phase 1 and recommended for field trials. In Phase 2, four railroads sponsor...

A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

Science.gov (United States)

Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

2013-01-01

This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

Serious Games for Learning: Games-Based Child Sexual Abuse Prevention in Schools

Science.gov (United States)

Scholes, Laura; Jones, Christian; Stieler-Hunt, Colleen; Rolfe, Ben

2014-01-01

In spite of research demonstrating conceptual weakness in many child sexual abuse (CSA) prevention programmes and outdated modes of delivery, students continue to participate in a diversity of initiatives. Referring to the development of a games-based approach to CSA prevention in Australia, this paper examines empirically based attributes of…

Evaluation of Smoking Prevention Television Messages Based on the Elaboration Likelihood Model

Science.gov (United States)

Flynn, Brian S.; Worden, John K.; Bunn, Janice Yanushka; Connolly, Scott W.; Dorwaldt, Anne L.

2011-01-01

Progress in reducing youth smoking may depend on developing improved methods to communicate with higher risk youth. This study explored the potential of smoking prevention messages based on the Elaboration Likelihood Model (ELM) to address these needs. Structured evaluations of 12 smoking prevention messages based on three strategies derived from…

Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

NARCIS (Netherlands)

Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.

1994-01-01

The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

Science.gov (United States)

Allan, Milan P.

2013-03-01

The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

A systematic review of school-based suicide prevention programs.

Science.gov (United States)

Katz, Cara; Bolton, Shay-Lee; Katz, Laurence Y; Isaak, Corinne; Tilston-Jones, Toni; Sareen, Jitender

2013-10-01

Suicide is one of the leading causes of death among youth today. Schools are a cost-effective way to reach youth, yet there is no conclusive evidence regarding the most effective prevention strategy. We conducted a systematic review of the empirical literature on school-based suicide prevention programs. Studies were identified through MEDLINE and Scopus searches, using keywords such as "suicide, education, prevention and program evaluation." Additional studies were identified with a manual search of relevant reference lists. Individual studies were rated for level of evidence, and the programs were given a grade of recommendation. Five reviewers rated all studies independently and disagreements were resolved through discussion. Sixteen programs were identified. Few programs have been evaluated for their effectiveness in reducing suicide attempts. Most studies evaluated the programs' abilities to improve students' and school staffs' knowledge and attitudes toward suicide. Signs of Suicide and the Good Behavior Game were the only programs found to reduce suicide attempts. Several other programs were found to reduce suicidal ideation, improve general life skills, and change gatekeeper behaviors. There are few evidence-based, school-based suicide prevention programs, a combination of which may be effective. It would be useful to evaluate the effectiveness of general mental health promotion programs on the outcome of suicide. The grades assigned in this review are reflective of the available literature, demonstrating a lack of randomized controlled trials. Further evaluation of programs examining suicidal behavior outcomes in randomized controlled trials is warranted. © 2013 Wiley Periodicals, Inc.

AVE bond index in the H-bond of the Watson-Crick pairs

International Nuclear Information System (INIS)

Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.

1981-01-01

The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt

Pair potentials in liquid metals

International Nuclear Information System (INIS)

Faber, T.E.

1980-01-01

The argument which justifies the use of a pair potential to describe the structure-dependent term in the energy of liquid metals is briefly reviewed. Because there is an additional term in the energy which depends upon volume rather than structure, and because the pair potential itself is volume-dependent, the relationship between pair potential and observable properties such as pressure, bulk modulus and pair distribution function is more complicated for liquid metals than it is for molecular liquids. Perhaps for this reason, the agreement between pair potentials inferred from observable properties and pair potentials calculated by means of pseudo-potential theory is still far from complete. The pair potential concept is applicable only to simple liquid metals, in which the electron-ion interaction is weak. No attempt is made to discuss liquid transition and rare-earth metals, which are not simple in this sense. (author)

Pairing correlations in nuclei

International Nuclear Information System (INIS)

Baba, C.V.K.

1988-01-01

There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs

Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

Science.gov (United States)

Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

2010-08-18

It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

Science.gov (United States)

Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

2010-08-25

Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

How effective are exercise-based injury prevention programmes for soccer players?

NARCIS (Netherlands)

Beijsterveldt, A.M.C. van; Horst, N. van der; Port, I.G.L. van de; Backx, F.J.G.

2013-01-01

The incidence of soccer (football) injuries is among the highest in sports. Despite this high rate, insufficient evidence is available on the efficacy of preventive training programmes on injury incidence. Objective To systematically study the evidence on preventive exercise-based training

Training medical providers in evidence-based approaches to suicide prevention.

Science.gov (United States)

DeHay, Tamara; Ross, Sarah; McFaul, Mimi

2015-01-01

Suicide is a significant issue in the United States and worldwide, and its prevention is a public health imperative. Primary care practices are an important setting for suicide prevention, as primary care providers have more frequent contact with patients at risk for suicide than any other type of health-care provider. The Western Interstate Commission for Higher Education, in partnership with the Suicide Prevention Resource Center, has developed a Suicide Prevention Toolkit and an associated training curriculum. These resources support the education of primary care providers in evidence-based strategies for identifying and treating patients at risk for suicide. The application of this curriculum to post-graduate medical training is presented here. © The Author(s) 2015.

Structures, physicochemical properties, and applications of T-Hg-II-T, C-Ag-I-C, and other metallo-base-pairs

Czech Academy of Sciences Publication Activity Database

Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.

2015-01-01

Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015

The coevolution of long-term pair bonds and cooperation.

Science.gov (United States)

Song, Z; Feldman, M W

2013-05-01

The evolution of social traits may not only depend on but also change the social structure of the population. In particular, the evolution of pairwise cooperation, such as biparental care, depends on the pair-matching distribution of the population, and the latter often emerges as a collective outcome of individual pair-bonding traits, which are also under selection. Here, we develop an analytical model and individual-based simulations to study the coevolution of long-term pair bonds and cooperation in parental care, where partners play a Snowdrift game in each breeding season. We illustrate that long-term pair bonds may coevolve with cooperation when bonding cost is below a threshold. As long-term pair bonds lead to assortative interactions through pair-matching dynamics, they may promote the prevalence of cooperation. In addition to the pay-off matrix of a single game, the evolutionarily stable equilibrium also depends on bonding cost and accidental divorce rate, and it is determined by a form of balancing selection because the benefit from pair-bond maintenance diminishes as the frequency of cooperators increases. Our findings highlight the importance of ecological factors affecting social bonding cost and stability in understanding the coevolution of social behaviour and social structures, which may lead to the diversity of biological social systems. © 2013 The Authors. Journal of Evolutionary Biology © 2013 European Society For Evolutionary Biology.

Solvent effect on the intermolecular proton transfer of the Watson and Crick guanine-cytosine and adenine-thymine base pairs: a polarizable continuum model study.

Science.gov (United States)

Romero, Eduardo E; Hernandez, Florencio E

2018-01-03

Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.

Web-based expert system for foundry pollution prevention

Science.gov (United States)

Moynihan, Gary P.

2004-02-01

Pollution prevention is a complex task. Many small foundries lack the in-house expertise to perform these tasks. Expert systems are a type of computer information system that incorporates artificial intelligence. As noted in the literature, they provide a means of automating specialized expertise. This approach may be further leveraged by implementing the expert system on the internet (or world-wide web). This will allow distribution of the expertise to a variety of geographically-dispersed foundries. The purpose of this research is to develop a prototype web-based expert system to support pollution prevention for the foundry industry. The prototype system identifies potential emissions for a specified process, and also provides recommendations for the prevention of these contaminants. The system is viewed as an initial step toward assisting the foundry industry in better meeting government pollution regulations, as well as improving operating efficiencies within these companies.

Pair Interaction of Catalytical Sphere Dimers in Chemically Active Media

Directory of Open Access Journals (Sweden)

Jing-Min Shi

2018-01-01

Full Text Available We study the pair dynamics of two self-propelled sphere dimers in the chemically active medium in which a cubic autocatalytic chemical reaction takes place. Concentration gradient around the dimer, created by reactions occurring on the catalytic sphere surface and responsible for the self-propulsion, is greatly influenced by the chemical activities of the environment. Consequently, the pair dynamics of two dimers mediated by the concentration field are affected. In the particle-based mesoscopic simulation, we combine molecular dynamics (MD for potential interactions and reactive multiparticle collision dynamics (RMPC for solvent flow and bulk reactions. Our results indicate three different configurations between a pair of dimers after the collision, i.e., two possible scenarios of bound dimer pairs and one unbound dimer pair. A phase diagram is sketched as a function of the rate coefficients of the environment reactions. Since the pair interactions are the basic elements of larger scale systems, we believe the results may shed light on the understanding of the collective dynamics.

Primary Prevention Is? A Global Perspective on How Organizations Engaging Men in Preventing Gender-Based Violence Conceptualize and Operationalize Their Work.

Science.gov (United States)

Storer, Heather L; Casey, Erin A; Carlson, Juliana; Edleson, Jeffrey L; Tolman, Richard M

2016-02-01

Engaging men in addressing violence against women (VAW) has become a strategy in the global prevention of gender-based violence. Concurrently, Western public health frameworks have been utilized to guide prevention agendas worldwide. Using qualitative methods, this study describes how global anti-violence organizations that partner with men conceptualize primary prevention in their work. Findings suggest that "primary prevention" is not a fixed term in the context of VAW and that front-line prevention work challenges rigidly delineated distinctions between levels of prevention. Much can be learned from global organizations' unique and contextualized approaches to the prevention of VAW. © The Author(s) 2015.

Au Pair and Trafficked? - Recruitment, Residence in Denmark and Dreams for the Future

DEFF Research Database (Denmark)

Korsby, Trine Mygind

Report on the prevalence and risk of human trafficking in the situations and experiences of a group of au pairs in Denmark. The report is based on a qualitative study with interviews with 27 au pairs living in Denmark. The au pairs come from the Philippines, Belarus, Ukraine, Serbia, Nepal and Ke...

Excited cooper pairs

Energy Technology Data Exchange (ETDEWEB)

Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)

2001-02-01

Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

PRIMARY PREVENTION IS? A GLOBAL PERSPECTIVE ON HOW ORGANIZATIONS ENGAGING MEN IN PREVENTING GENDER-BASED VIOLENCE CONCEPTUALIZE AND OPERATIONALIZE THEIR WORK

Science.gov (United States)

Storer, Heather L.; Casey, Erin A.; Carlson, Juliana; Edleson, Jeffrey L.; Tolman, Richard M.

2014-01-01

Engaging men in addressing violence against women (VAW) has become a strategy in the global prevention of gender-based violence. Concurrently, Western public health frameworks have been utilized to guide prevention agendas worldwide. Using qualitative methods, this study describes how global anti-violence organizations that partner with men conceptualize primary prevention in their work. Findings suggest that ‘primary prevention’ is not a fixed term in the context of VAW and that front-line prevention work challenges rigidly delineated distinctions between levels of prevention. Much can be learned from global organizations’ unique and contextualized approaches to the prevention of VAW. PMID:26333283

Molecular electrostatics for probing lone pair-π interactions.

Science.gov (United States)

Mohan, Neetha; Suresh, Cherumuttathu H; Kumar, Anmol; Gadre, Shridhar R

2013-11-14

An electrostatics-based approach has been proposed for probing the weak interactions between lone pair containing molecules and π deficient molecular systems. For electron-rich molecules, the negative minima in molecular electrostatic potential (MESP) topography give the location of electron localization and the MESP value at the minimum (Vmin) quantifies the electron-rich character of that region. Interactive behavior of a lone pair bearing molecule with electron deficient π-systems, such as hexafluorobenzene, 1,3,5-trinitrobenzene, 2,4,6-trifluoro-1,3,5-triazine and 1,2,4,5-tetracyanobenzene explored within DFT brings out good correlation of the lone pair-π interaction energy (E(int)) with the Vmin value of the electron-rich system. Such interaction is found to be portrayed well with the Electrostatic Potential for Intermolecular Complexation (EPIC) model. On the basis of the precise location of MESP minimum, a prediction for the orientation of a lone pair bearing molecule with an electron deficient π-system is possible in the majority of the cases studied.

Preventable trauma deaths: from panel review to population based-studies

Directory of Open Access Journals (Sweden)

Vesconi Sergio

2006-04-01

Full Text Available Abstract Preventable trauma deaths are defined as deaths which could be avoided if optimal care has been delivered. Studies on preventable trauma deaths have been accomplished initially with panel reviews of pre-hospital and hospital charts. However, several investigators questioned the reliability and validity of this method because of low reproducibility of implicit judgments when they are made by different experts. Nevertheless, number of studies were published all around the world and ultimately gained some credibility, particularly in regions where comparisons were made before and after trauma system implementation with a resultant fall in mortality. During the last decade of century the method of comparing observed survival with probability of survival calculated from large trauma registries has obtained popularity. Preventable trauma deaths were identified as deaths occurred notwithstanding a high calculated probability of survival. In recent years, preventable trauma deaths studies have been replaced by population-based studies, which use databases representative of overall population, therefore with high epidemiologic value. These databases contain readily available information which carry out the advantage of objectivity and large numbers. Nowadays, population-based researches provide the strongest evidence regarding the effectiveness of trauma systems and trauma centers on patient outcomes.

Mesoscopic pairing without superconductivity

Science.gov (United States)

Hofmann, Johannes

2017-12-01

We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

Pairing field and moments of inertia of superdeformed nuclei

International Nuclear Information System (INIS)

Chen Yongjing; Chen Yongshou; Xu Fuxin

2002-01-01

The authors have systematically analysed the dynamic moments of inertia of the experimental superdeformed (SD) bands observed in the A = 190, 150 and 60-80 mass regions as functions of rotational frequency. By combining the different mass regions, the dramatic features of the dynamic moments of inertia were found and explained based on the calculations of the pairing fields of SD nuclei with the anisotropic harmonic oscillator quadrupole pairing Hartree-Fock-Bogoliubov model

A landholder-based approach to the design of private-land conservation programs.

Science.gov (United States)

Moon, Katie; Cocklin, Chris

2011-06-01

Many ecosystems exist primarily, or solely, on privately owned (freehold) or managed (leasehold) land. In rural and semirural areas, local and regional government agencies are commonly responsible for encouraging landholders to conserve native vegetation and species on these private properties. Yet these agencies often lack the capacity to design and implement conservation programs tailored to rural and semirural landholdings and instead offer one program to all landholders. Landholders may elect not to participate because the program is irrelevant to their property or personal needs; consequently, vegetation-retention objectives may not be achieved. We differentiated landholders in Queensland, Australia, according to whether they derived income from the land (production landholders) or not (nonproduction landholders). We compared these two groups to identify similarities and differences that may inform the use of policy instruments (e.g., voluntary, economic, and regulatory) in conservation program design. We interviewed 45 landholders participating in three different conservation agreement programs (price-based rate [property tax] rebate; market-based tender; and voluntary, permanent covenant). Production landholders were more likely to participate in short-term programs that offered large financial incentives that applied to 75% of their property. These results may be explained by significant differences in the personal circumstances of production and nonproduction landholders (income, education, health) and differences in their norms (beliefs about how an individual is expected to act) and attitudes. Knowledge of these differences may allow for development of conservation programs that better meet the needs of landholders and thus increase participation in conservation programs and retention of native vegetation. ©2011 Society for Conservation Biology.

Evidence-based prevention of childhood malnutrition.

Science.gov (United States)

Imdad, Aamer; Sadiq, Kamran; Bhutta, Zulfiqar A

2011-05-01

Childhood malnutrition is prevalent in developing countries and contributes to one-third of all deaths in these countries. There have been advances in prevention of childhood malnutrition and the purpose of this article was to review the current evidence in the field. Multiple micronutrient (MMN) supplements during pregnancy reduce the incidence of maternal anemia and small for gestational-age babies. Recent evidence suggest that combined supplementation of MMNs with protein energy supplement is more effective than MMN supplementation alone. It is now recommended that HIV-infected mothers can exclusively breast-feed their infants for 6 months when the mother or infant is on effective antiretroviral therapy. Home fortification of complementary foods reduces the prevalence of anemia in infancy and combined supplementation of MMNs with lipid-based supplements improves growth in young children. Ready-to-use therapeutic foods have been successfully used to manage severe acute malnutrition in the community. Zinc supplementation is associated with a reduction in diarrhea and respiratory disease morbidity and improves linear growth. Vitamin A supplementation decreases the incidence of diarrhea and measles. Water supply, sanitation, and hygiene are important for the prevention of malnutrition because of their direct impact on infectious disease. There is clear evidence on the causes and consequences of malnutrition as well as effective interventions to prevent undernutrition. The next step is to implement these packages of interventions at large scale. A global effort is required that should entail unified and compelling advocacy among governments, lead organizations, and institutions.

Pair production of scalar dyons in Kerr-Newman black holes

Science.gov (United States)

Chen, Chiang-Mei; Kim, Sang Pyo; Sun, Jia-Rui; Tang, Fu-Yi

2018-06-01

We study the spontaneous pair production of scalar dyons in the near extremal dyonic Kerr-Newman (KN) black hole, which contains a warped AdS3 structure in the near horizon region. The leading term contribution of the pair production rate and the absorption cross section ratio are also calculated using the Hamilton-Jacobi approach and the thermal interpretation is given. In addition, the holographic dual conformal field theories (CFTs) descriptions of the pair production rate and absorption cross section ratios are analyzed both in the J-, Q- and P-pictures respectively based on the threefold dyonic KN/CFTs dualities.

Men's Perceptions of Treatment as Prevention in South Africa: Implications for Engagement in HIV Care and Treatment.

Science.gov (United States)

Mooney, Alyssa C; Gottert, Ann; Khoza, Nomhle; Rebombo, Dumisani; Hove, Jennifer; Suárez, Aimée Julien; Twine, Rhian; MacPhail, Catherine; Treves-Kagan, Sarah; Kahn, Kathleen; Pettifor, Audrey; Lippman, Sheri A

2017-06-01

While South Africa provides universal access to treatment, HIV testing and antiretroviral therapy (ART) uptake remains low, particularly among men. Little is known about community awareness of the effects of treatment on preventing transmission, and how this information might impact HIV service utilization. This qualitative study explored understandings of treatment as prevention (TasP) among rural South African men. Narratives emphasized the know value of ART for individual health, but none were aware of its preventive effects. Many expressed that preventing transmission to partners would incentivize testing, earlier treatment, and adherence in the absence of symptoms, and could reduce the weight of a diagnosis. Doubts about TasP impacts on testing and care included enduring risks of stigma and transmission. TasP information should be integrated into clinic-based counseling for those utilizing services, and community-based education for broader reach. Pairing TasP information with alternative testing options may increase engagement among men reluctant to be seen at clinics.

A Scaffold Analysis Tool Using Mate-Pair Information in Genome Sequencing

Directory of Open Access Journals (Sweden)

Pan-Gyu Kim

2008-01-01

Full Text Available We have developed a Windows-based program, ConPath, as a scaffold analyzer. ConPath constructs scaffolds by ordering and orienting separate sequence contigs by exploiting the mate-pair information between contig-pairs. Our algorithm builds directed graphs from link information and traverses them to find the longest acyclic graphs. Using end read pairs of fixed-sized mate-pair libraries, ConPath determines relative orientations of all contigs, estimates the gap size of each adjacent contig pair, and reports wrong assembly information by validating orientations and gap sizes. We have utilized ConPath in more than 10 microbial genome projects, including Mannheimia succiniciproducens and Vibro vulnificus, where we verified contig assembly and identified several erroneous contigs using the four types of error defined in ConPath. Also, ConPath supports some convenient features and viewers that permit investigation of each contig in detail; these include contig viewer, scaffold viewer, edge information list, mate-pair list, and the printing of complex scaffold structures.

Trauma Center Based Youth Violence Prevention Programs: An Integrative Review.

Science.gov (United States)

Mikhail, Judy Nanette; Nemeth, Lynne Sheri

2016-12-01

Youth violence recidivism remains a significant public health crisis in the United States. Violence prevention is a requirement of all trauma centers, yet little is known about the effectiveness of these programs. Therefore, this systematic review summarizes the effectiveness of trauma center-based youth violence prevention programs. A systematic review of articles from MEDLINE, CINAHL, and PsychINFO databases was performed to identify eligible control trials or observational studies. Included studies were from 1970 to 2013, describing and evaluating an intervention, were trauma center based, and targeted youth injured by violence (tertiary prevention). The social ecological model provided the guiding framework, and findings are summarized qualitatively. Ten studies met eligibility requirements. Case management and brief intervention were the primary strategies, and 90% of the studies showed some improvement in one or more outcome measures. These results held across both social ecological level and setting: both emergency department and inpatient unit settings. Brief intervention and case management are frequent and potentially effective trauma center-based violence prevention interventions. Case management initiated as an inpatient and continued beyond discharge was the most frequently used intervention and was associated with reduced rearrest or reinjury rates. Further research is needed, specifically longitudinal studies using experimental designs with high program fidelity incorporating uniform direct outcome measures. However, this review provides initial evidence that trauma centers can intervene with the highest of risk patients and break the youth violence recidivism cycle. © The Author(s) 2015.

Augmenting Think-Pair-Share with Simulations

Science.gov (United States)

Lee, Kevin M.; Siedell, C. M.; Prather, E. E.; CATS

2009-01-01

Computer simulations are valuable tools for the teaching and learning of introductory astronomy. They enable students to link together small pieces of information into mental models of complex physical systems that are far beyond their everyday experience. They can also be used to authentically test a student's conceptual understanding of a physical system by asking the student to make predictions regarding its behavior. Students receive formative feedback by testing their predictions in simulations. Think-Pair-Share - the posing of conceptual questions to students and having them vote on the answer before and after discussion with their peers - can benefit considerably from the incorporation of simulations. Simulations can be used for delivering content that precedes Think-Pair-Share, as the prompt the questions is based upon, or as a feedback tool to illustrate the answer to a question. These techniques are utilized in ClassAction - a collection of materials designed to enhance the metacognitive skills of Astro 101 students by promoting interactive engagement and providing rapid feedback. The main focus is dynamic conceptual questions largely based upon graphics that can be projected in the classroom. Many questions are available in a Flash computer database and instructors have the capability to recast these questions into alternate permutations based on their own preferences and student responses. Outlines, graphics, and simulations are included which instructors can use to provide feedback. This poster provides examples of simulation usage in Think-Pair-Share related to sky motions, lunar phases, and stellar properties. A multi-institutional classroom validation study of ClassAction is currently underway as a Collaboration of Astronomy Teaching Scholars (CATS) research project. All materials are publicly available at http://astro.unl.edu. We would like to thank the NSF for funding under Grant Nos. 0404988 and 0715517, a CCLI Phase III Grant for the

Efficient and accurate local approximations to coupled-electron pair approaches: An attempt to revive the pair natural orbital method.

Science.gov (United States)

Neese, Frank; Wennmohs, Frank; Hansen, Andreas

2009-03-21

Coupled-electron pair approximations (CEPAs) and coupled-pair functionals (CPFs) have been popular in the 1970s and 1980s and have yielded excellent results for small molecules. Recently, interest in CEPA and CPF methods has been renewed. It has been shown that these methods lead to competitive thermochemical, kinetic, and structural predictions. They greatly surpass second order Moller-Plesset and popular density functional theory based approaches in accuracy and are intermediate in quality between CCSD and CCSD(T) in extended benchmark studies. In this work an efficient production level implementation of the closed shell CEPA and CPF methods is reported that can be applied to medium sized molecules in the range of 50-100 atoms and up to about 2000 basis functions. The internal space is spanned by localized internal orbitals. The external space is greatly compressed through the method of pair natural orbitals (PNOs) that was also introduced by the pioneers of the CEPA approaches. Our implementation also makes extended use of density fitting (or resolution of the identity) techniques in order to speed up the laborious integral transformations. The method is called local pair natural orbital CEPA (LPNO-CEPA) (LPNO-CPF). The implementation is centered around the concepts of electron pairs and matrix operations. Altogether three cutoff parameters are introduced that control the size of the significant pair list, the average number of PNOs per electron pair, and the number of contributing basis functions per PNO. With the conservatively chosen default values of these thresholds, the method recovers about 99.8% of the canonical correlation energy. This translates to absolute deviations from the canonical result of only a few kcal mol(-1). Extended numerical test calculations demonstrate that LPNO-CEPA (LPNO-CPF) has essentially the same accuracy as parent CEPA (CPF) methods for thermochemistry, kinetics, weak interactions, and potential energy surfaces but is up to 500

ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups.

Directory of Open Access Journals (Sweden)

Alexandra Peacock-Villada

Full Text Available Accurate sequence dependent pairing of single-stranded DNA (ssDNA molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones.

[Comparative study on promoting blood effects of Danshen-Honghua herb pair with different preparations based on chemometrics and multi-attribute comprehensive index methods].

Science.gov (United States)

Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao

2017-08-01

To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood

Filipino au pairs on the move

DEFF Research Database (Denmark)

Dalgas, Karina Märcher

2016-01-01

Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial interdep......Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial...

Paired peer review of university classroom teaching in a school of nursing and midwifery.

Science.gov (United States)

Bennett, Paul N; Parker, Steve; Smigiel, Heather

2012-08-01

Peer review of university classroom teaching can increase the quality of teaching but is not universally practiced in Australian universities. To report an evaluation of paired peer-review process using both paper and web based teaching evaluation tools. Twenty university teachers in one metropolitan Australian School of Nursing and Midwifery were randomly paired and then randomly assigned to a paper based or web-based peer review tool. Each teacher reviewed each other's classroom teaching as part of a peer review program. The participants then completed an 18 question survey evaluating the peer review tool and paired evaluation process. Responses were analyzed using frequencies and percentages. Regardless of the tool used, participants found this process of peer review positive (75%), collegial (78%), supportive (61%) and non-threatening (71%). Participants reported that the peer review will improve their own classroom delivery (61%), teaching evaluation (61%) and planning (53%). The web-based tool was found to be easier to use and allowed more space than the paper-based tool. Implementation of a web-based paired peer review system can be a positive method of peer review of university classroom teaching. Pairing of teachers to review each other's classroom teaching is a promising strategy and has the potential to improve teaching in teaching universities. Copyright © 2011 Elsevier Ltd. All rights reserved.

School-based suicide prevention: content, process, and the role of trusted adults and peers.

Science.gov (United States)

Joshi, Shashank V; Hartley, Samantha N; Kessler, Moira; Barstead, Maura

2015-04-01

Suicide is a leading cause of preventable death in youth, and numerous curricula and other prevention and intervention programs have been developed in the last 15 years. Comprehensive suicide prevention planning should include the 4 components of health promotion, prevention/education, intervention, and postvention. School-based suicide prevention and mental health education programs have become more common as an efficient and cost-effective way to reach youth. Process considerations that are based on the principles of therapeutic engagement with patients and families can provide mental health professionals with strategies that can assist education professionals, students, and the larger school community simultaneously. Copyright © 2015 Elsevier Inc. All rights reserved.

Design, realization and testing of an adsorption refrigerator based on activated carbon/ethanol working pair

International Nuclear Information System (INIS)

Frazzica, A.; Palomba, V.; Dawoud, B.; Gullì, G.; Brancato, V.; Sapienza, A.; Vasta, S.; Freni, A.; Costa, F.; Restuccia, G.

2016-01-01

Highlights: • Development of a lab-scale adsorption refrigerator. • Optimization of working pair and adsorber configuration through experimental activity. • Experimental testing of the prototype under real working boundary conditions. - Abstract: In the present paper design, realization and testing of a novel small scale adsorption refrigerator prototype based on activated carbon/ethanol working pair is described. Firstly, experimental activity has been carried out for identification of the best performing activated carbon available on the market, through the evaluation of the achievable thermodynamic performance both under air conditioning and refrigeration conditions. Once identified the best performing activated carbon, the design of the adsorber was developed by experimental dynamic performance analysis, carried out by means of the Gravimetric-Large Temperature Jump (G-LTJ) apparatus available at CNR ITAE lab. Finally, the whole 0.5 kW refrigerator prototype was designed and built. First experimental results both under reference air conditioning and refrigeration cycles have been reported, to check the achievable performance. High Specific Cooling Powers (SCPs), 95 W/kg and 50 W/kg, for air conditioning and refrigeration respectively, were obtained, while the COP ranged between 0.09 and 0.11, thus showing an improvement of the current state of the art.

Skin cancer preventive behaviors among rural farmers: An intervention based on protection motivation theory.

Science.gov (United States)

Babazadeh, Towhid; Kamran, Aziz; Dargahi, Abdollah; Moradi, Fatemeh; Shariat, Fariba; Rezakhani Moghaddam, Hamed

2016-01-01

Background: Skin cancer is a serious public health problem in the world. Its prevalence in many countries has been increased in recent years. This study aimed to assess the effects of a theory-based educational intervention to promote skin cancer preventive behaviors (SCPBs) among rural farmers in Chalderan County, Iran. Methods: This was a quasi-randomized controlled field trial study conducted on 238 rural farmers. The data were collected by a questionnaire containing the constructs of the Protection Motivation Theory (PMT) as well as the items of SCPBs. The differences between the groups before and 3 months after the intervention were determined by independent t-test, paired t-test, and chi-square applying SPSS software. Results: Before the intervention, no significant difference was found in the scores of the PMT constructs between the two groups (p>0.05). However, significant differences were found between the scores of all the variables, as well as SCPBs, in the two groups after the intervention (p<0.05). Conclusion: The PMT was found to be an appropriate framework for designing educational interventions aiming at promoting SCPBs among rural farmers. It was concluded that designing an educational program with a focus on promoting perceived susceptibility increased the level of performing SCPBs among the rural farmers.

Plasma analog of particle-pair production

International Nuclear Information System (INIS)

Tsidulko, Yu.A.; Berk, H.L.

1996-09-01

It is shown that the plasma axial shear flow instability satisfies the Klein-Gordon equation. The plasma instability is then shown to be analogous to spontaneous particle-pair production when a potential energy is present that is greater than twice the particle rest mass energy. Stability criteria can be inferred based on field theoretical conservation laws

Knowledge-based errors in anesthesia: a paired, controlled trial of learning and retention.

Science.gov (United States)

Goldhaber-Fiebert, Sara N; Goldhaber-Fiebert, Jeremy D; Rosow, Carl E

2009-01-01

Optimizing patient safety by improving the training of physicians is a major challenge of medical education. In this pilot study, we hypothesized that a brief lecture, targeted to rare but potentially dangerous situations, could improve anesthesia practitioners' knowledge levels with significant retention of learning at six months. In this paired controlled trial, anesthesia residents and attending physicians at Massachusetts General Hospital took the same 14-question multiple choice examination three times: at baseline, immediately after a brief lecture, and six months later. The lecture covered material on seven "intervention" questions; the remaining seven were "control" questions. The authors measured immediate knowledge acquisition, defined as the change in percentage of correct answers on intervention questions between baseline and post-lecture, and measured learning retention as the difference between baseline and six months. Both measurements were corrected for change in performance on control questions. Fifty of the 89 subjects completed all three examinations. The post-lecture increase in percentage of questions answered correctly, adjusted for control, was 22.2% [95% confidence interval (CI) 16.0-28.4%; P learning at six months. Exposing residents or other practitioners to this type of inexpensive teaching intervention may help them to avoid preventable uncommon errors that are rooted in unfamiliarity with the situation or the equipment. The methods used for this study may also be applied to compare the effect of various other teaching modalities while, at the same time, preserving participant anonymity and making adjustments for ongoing learning.

Collective neutrino-pair emission due to Cooper pairing of protons in superconducting neutron stars

International Nuclear Information System (INIS)

Leinson, L.B.

2001-01-01

The neutrino emission due to formation and breaking of Cooper pairs of protons in superconducting cores of neutron stars is considered with taking into account the electromagnetic coupling of protons to ambient electrons. It is shown that collective response of electrons to the proton quantum transition contributes coherently to the complete interaction with a neutrino field and enhances the neutrino-pair production. Our calculation shows that the contribution of the vector weak current to the ννbar emissivity of protons is much larger than that calculated by different authors without taking into account the plasma effects. Partial contribution of the pairing protons to the total neutrino radiation from the neutron star core is very sensitive to the critical temperatures for the proton and neutron pairing. We show domains of these parameters where the neutrino radiation, caused by a singlet-state pairing of protons is dominating

The effectiveness of mindfulness-based relapse prevention on the prevention of relapse, craving and self-control in opiate-dependent individuals

OpenAIRE

alireza maredpour; Mahmmod Najafy; Farangiss amiri

2015-01-01

Abstract Objective: the aim of this study is to investigate the effectiveness of mindfulness-based relapse prevention on the prevention of relapse, craving and self-control in opiate-dependent individuals in Yasuj. Methodology: This quasi-experimental study applied pretest - posttest and a control group. The sample included 30 male patients with drug addiction in Yasuj who were chosen from addiction clinics based on criterion sampling. To collect the required data the short form of Self-Co...

QSO Pairs across Active Galaxies

Indian Academy of Sciences (India)

2016-01-27

Jan 27, 2016 ... Several QSO pairs have been reported and their redshifts determined, where the two objects in each pair are located across an active galaxy. The usually accepted explanation of such occurrences is that the pair is ejected from the parent galaxy. Currently interpreted redshifted spectra for both the QSOs ...

Near quantum limited amplification from inelastic Cooper-pair tunneling

Science.gov (United States)

Hofheinz, Max; Jebari, Salha; Blanchet, Florian; Grimm, Alexander; Hazra, Dibyendu; Albert, Romain; Portier, Fabien

Josephson parametric amplifiers approach quantum-limited noise performance but require strong external microwave pump tones which make them more difficult to use than DC powered amplifiers: The pump tone can affect the device under test and requires expensive room-temperature equipment. Inelastic Cooper pair tunneling processes through a small DC voltage-biased Josephson junction, where a tunneling Cooper pair dissipates its energy 2 eV in the form of two photons are reminiscent of parametric down conversion. We show that these processes can be used to provide amplification near the quantum limit without external microwave pump tone. We explain the measured gain and noise based on the P (E) theory of inelastic Cooper pair tunneling and general fluctuation-dissipation relations.

Multi-armed spirals and multi-pairs antispirals in spatial rock–paper–scissors games

Energy Technology Data Exchange (ETDEWEB)

Jiang, Luo-Luo, E-mail: jiangluoluo@gmail.com [College of Physics and Electronic Information Engineering, Wenzhou University, Wenzhou 325035 (China); College of Physics and Technology, Guangxi Normal University, Guilin, Guangxi 541004 (China); Wang, Wen-Xu [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, AZ 85287 (United States); Department of Physics, Beijing Normal University, Beijing 100875 (China); Lai, Ying-Cheng [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, AZ 85287 (United States); Department of Physics, Arizona State University, Tempe, AZ 85287 (United States); Ni, Xuan [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, AZ 85287 (United States)

2012-07-09

We study the formation of multi-armed spirals and multi-pairs antispirals in spatial rock–paper–scissors games with mobile individuals. We discover a set of seed distributions of species, which is able to produce multi-armed spirals and multi-pairs antispirals with a finite number of arms and pairs based on stochastic processes. The joint spiral waves are also predicted by a theoretical model based on partial differential equations associated with specific initial conditions. The spatial entropy of patterns is introduced to differentiate the multi-armed spirals and multi-pairs antispirals. For the given mobility, the spatial entropy of multi-armed spirals is higher than that of single armed spirals. The stability of the waves is explored with respect to individual mobility. Particularly, we find that both two armed spirals and one pair antispirals transform to the single armed spirals. Furthermore, multi-armed spirals and multi-pairs antispirals are relatively stable for intermediate mobility. The joint spirals with lower numbers of arms and pairs are relatively more stable than those with higher numbers of arms and pairs. In addition, comparing to large amount of previous work, we employ the no flux boundary conditions which enables quantitative studies of pattern formation and stability in the system of stochastic interactions in the absence of excitable media. -- Highlights: ► Multi-armed spirals and multi-pairs antispirals are observed. ► Patterns are predicted by computer simulations and partial differential equations. ► The spatial entropy of patterns is introduced. ► Patterns are relatively stable for intermediate mobility. ► The joint spirals with lower numbers of arms and pairs are relatively more stable.

Multi-armed spirals and multi-pairs antispirals in spatial rock–paper–scissors games

International Nuclear Information System (INIS)

Jiang, Luo-Luo; Wang, Wen-Xu; Lai, Ying-Cheng; Ni, Xuan

2012-01-01

We study the formation of multi-armed spirals and multi-pairs antispirals in spatial rock–paper–scissors games with mobile individuals. We discover a set of seed distributions of species, which is able to produce multi-armed spirals and multi-pairs antispirals with a finite number of arms and pairs based on stochastic processes. The joint spiral waves are also predicted by a theoretical model based on partial differential equations associated with specific initial conditions. The spatial entropy of patterns is introduced to differentiate the multi-armed spirals and multi-pairs antispirals. For the given mobility, the spatial entropy of multi-armed spirals is higher than that of single armed spirals. The stability of the waves is explored with respect to individual mobility. Particularly, we find that both two armed spirals and one pair antispirals transform to the single armed spirals. Furthermore, multi-armed spirals and multi-pairs antispirals are relatively stable for intermediate mobility. The joint spirals with lower numbers of arms and pairs are relatively more stable than those with higher numbers of arms and pairs. In addition, comparing to large amount of previous work, we employ the no flux boundary conditions which enables quantitative studies of pattern formation and stability in the system of stochastic interactions in the absence of excitable media. -- Highlights: ► Multi-armed spirals and multi-pairs antispirals are observed. ► Patterns are predicted by computer simulations and partial differential equations. ► The spatial entropy of patterns is introduced. ► Patterns are relatively stable for intermediate mobility. ► The joint spirals with lower numbers of arms and pairs are relatively more stable.

Au pairs on Facebook

DEFF Research Database (Denmark)

Dalgas, Karina Märcher

2016-01-01

Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... the au pairs resist and embrace such dominant representations, and on how such representations are ascribed different meanings in the transnational social fields of which the migrant are a part. The article is based on ethnographic fieldwork conducted between 2010 and 2014 in Denmark, the Philippines...

Preparation and Microbiological Evaluation of Amphiphilic Kanamycin-Lipoamino Acid Ion-Pairs

Directory of Open Access Journals (Sweden)

Rosario Pignatello

2014-05-01

Full Text Available Amphiphilic ion-pairs of kanamycin (KAN were prepared by evaporation of a water-ethanol co-solution of KAN base and a lipoamino acid bearing a 12-carbon atoms alkyl side chain (LAA12, at different molar ratios. Infrared spectroscopy confirmed the structure of ion-pairs, while differential scanning calorimetry (DSC and powder X-ray diffractometry (PXRD studies supported the formation of new saline species with a different crystalline structure than the starting components. The solubility pattern shown in a range of both aqueous and organic solvents confirmed that the ion-pairs possess an amphiphilic character. The LAA12 counter-ion showed not to improve the antibacterial activity of KAN, suggesting that such chemical strategy is not able to favor the penetration of this drug inside the bacteria cells. Nevertheless, a slight improving, i.e., a one-fold dilution, was observed in E. coli. The present study can also serve as the basis for a further evaluation of LAA ion-pairing of antibiotics, as a means to improve the loading of hydrophilic drugs into lipid-based nanocarriers.

Inclusive top-pair production phenomenology with TOPIXS

NARCIS (Netherlands)

Beneke, M.; Falgari, P|info:eu-repo/dai/nl/339938897; Klein, Sebastian; Piclum, J.; Schwinn, C.; Ubiali, M.; Yan, F.

2012-01-01

We discuss various aspects of inclusive top-quark pair production based on Topixs, a new, flexible program that computes the production cross section at the Tevatron and LHC at next-to-next-to-leading logarithmic accuracy in soft and Coulomb resummation, including bound-state effects and the

The base pairing RNA Spot 42 participates in a multi-output feedforward loop to help enact catabolite repression in Escherichia coli

Science.gov (United States)

Beisel, Chase L.; Storz, Gisela

2011-01-01

SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161

Improving preventive service delivery at adult complete health check-ups: the Preventive health Evidence-based Recommendation Form (PERFORM cluster randomized controlled trial

Directory of Open Access Journals (Sweden)

Moineddin Rahim

2006-07-01

Full Text Available Abstract Background To determine the effectiveness of a single checklist reminder form to improve the delivery of preventive health services at adult health check-ups in a family practice setting. Methods A prospective cluster randomized controlled trial was conducted at four urban family practice clinics among 38 primary care physicians affiliated with the University of Toronto. Preventive Care Checklist Forms© were created to be used by family physicians at adult health check-ups over a five-month period. The sex-specific forms incorporate evidence-based recommendations on preventive health services and documentation space for routine procedures such as physical examination. The forms were used in two intervention clinics and two control clinics. Rates and relative risks (RR of the performance of 13 preventive health maneuvers at baseline and post-intervention and the percentage of up-to-date preventive health services delivered per patient were compared between the two groups. Results Randomly-selected charts were reviewed at baseline (n = 509 and post-intervention (n = 608. Baseline rates for provision of preventive health services ranged from 3% (fecal occult blood testing to 93% (blood pressure measurement, similar to other settings. The percentage of up-to-date preventive health services delivered per patient at the end of the intervention was 48.9% in the control group and 71.7% in the intervention group. This is an overall 22.8% absolute increase (p = 0.0001, and 46.6% relative increase in the delivery of preventive health services per patient in the intervention group compared to controls. Eight of thirteen preventive health services showed a statistically significant change (p Conclusion This simple, low cost, clinically relevant intervention improves the delivery of preventive health services by prompting physicians of evidence-based recommendations in a checklist format that incorporates existing practice patterns. Periodic updates

Parietal lesion effects on cued recall following pair associate learning.

Science.gov (United States)

Ben-Zvi, Shir; Soroker, Nachum; Levy, Daniel A

2015-07-01

We investigated the involvement of the posterior parietal cortex in episodic memory in a lesion-effects study of cued recall following pair-associate learning. Groups of patients who had experienced first-incident stroke, generally in middle cerebral artery territory, and exhibited damage that included lateral posterior parietal regions, were tested within an early post-stroke time window. In three experiments, patients and matched healthy comparison groups executed repeated study and cued recall test blocks of pairs of words (Experiment 1), pairs of object pictures (Experiment 2), or pairs of object pictures and environmental sounds (Experiment 3). Patients' brain CT scans were subjected to quantitative analysis of lesion volumes. Behavioral and lesion data were used to compute correlations between area lesion extent and memory deficits, and to conduct voxel-based lesion-symptom mapping. These analyses implicated lateral ventral parietal cortex, especially the angular gyrus, in cued recall deficits, most pronouncedly in the cross-modal picture-sound pairs task, though significant parietal lesion effects were also found in the unimodal word pairs and picture pairs tasks. In contrast to an earlier study in which comparable parietal lesions did not cause deficits in item recognition, these results indicate that lateral posterior parietal areas make a substantive contribution to demanding forms of recollective retrieval as represented by cued recall, especially for complex associative representations. Copyright © 2015 Elsevier Ltd. All rights reserved.

Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

Science.gov (United States)

Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

2015-03-01

We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

Social pairing of Seychelles warblers under reduced constraints: MHC, neutral heterozygosity, and age.

Science.gov (United States)

Wright, David J; Brouwer, Lyanne; Mannarelli, Maria-Elena; Burke, Terry; Komdeur, Jan; Richardson, David S

2016-01-01

The prevalence and significance of precopulatory mate choice remains keenly debated. The major histocompatibility complex (MHC) plays a key role in vertebrate adaptive immunity, and variation at the MHC influences individual survival. Although MHC-dependent mate choice has been documented in certain species, many other studies find no such pattern. This may be, at least in part, because in natural systems constraints may reduce the choices available to individuals and prevent full expression of underlying preferences. We used translocations to previously unoccupied islands to experimentally reduce constraints on female social mate choice in the Seychelles warbler ( Acrocephalus sechellensis ), a species in which patterns of MHC-dependent extrapair paternity (EPP), but not social mate choice, have been observed. We find no evidence of MHC-dependent social mate choice in the new populations. Instead, we find that older males and males with more microsatellite heterozygosity are more likely to have successfully paired. Our data cannot resolve whether these patterns in pairing were due to male-male competition or female choice. However, our research does suggest that female Seychelles warblers do not choose social mates using MHC class I to increase fitness. It may also indicate that the MHC-dependent EPP observed in the source population is probably due to mechanisms other than female precopulatory mate choice based on MHC cues.

Galactic Pairs in the Early Universe

Science.gov (United States)

Kohler, Susanna

2018-02-01

,000 objects. They find that roughly 50 have a redshift of z 7, and 22 have a redshift of z 8. None of the galaxies at z 7 are in pairs, but the sample at z 8 includes three groups for which the distance between galaxies is less than 1 arcsecond.But are these three pairs actual merging galaxies?Conclusions from StatisticsTop: Gas density at z 7.7 in the authors simulation output. Bottom: Mock observations of this output withHubbles WFC3 (left) and JWSTs NIRCam (right). [Adapted from Chaikin et al. 2018]To answer this question, the authors next perform numerical simulations of galaxy formation and produce mock observations showing what the simulatedfield would look like in an equivalent deep Hubble exposure.Based on their simulation statistics, Chaikin and collaborators argue that the three pairs at z 8 do represent an unusually high merger fraction but projection coincidences or lensing are far less likely scenarios to account for all three pairs. If the three pairs are indeed all merging galaxies, it could indicate that this Hubble field corresponds to a local overdensity at a redshift of z 8.Looking AheadThe best way to improve on these measurements is to repeat this study with more advanced telescopes. Chaikin and collaborators demonstrate the superiority of the observations that the upcoming James Webb Space Telescope (JWST) will provide. They also point out the potential power of the Wide Field Infrared Survey Telescope (WFIRST) currently under threat under the proposed 2019 federal budget to extend the observational horizon well into the epoch of reionization.Continued studies backed by the power of these future telescopes are sure to discover a wealth of additional distant galactic duos, helping us to characterize the universe in its early stages.CitationEvgenii A. Chaikin et al 2018 ApJ 853 81. doi:10.3847/1538-4357/aaa196

Adatom pair distribution up to half coverage: O-Pd(100)

OpenAIRE

Kappus, Wolfgang

2017-01-01

Using substrate mediated elastic interactions fitted previously to first principles (FP) calculations, adatom pair distributions are derived for O-Pd(100) evaluating a statistical BGY based integral equation. The evaluation method utilizes the superposition approximation, a temperature scaling scheme, and for one variant the particle-hole symmetry of a pair interaction lattice gas Hamiltonian. The elastic Hamiltonian is taken from a previous 3 parameter analytical model. The resulting adatom ...

Majorana edge States in atomic wires coupled by pair hopping.

Science.gov (United States)

Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P

2013-10-25

We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.

Efficacy of computer technology-based HIV prevention interventions: a meta-analysis.

Science.gov (United States)

Noar, Seth M; Black, Hulda G; Pierce, Larson B

2009-01-02

To conduct a meta-analysis of computer technology-based HIV prevention behavioral interventions aimed at increasing condom use among a variety of at-risk populations. Systematic review and meta-analysis of existing published and unpublished studies testing computer-based interventions. Meta-analytic techniques were used to compute and aggregate effect sizes for 12 randomized controlled trials that met inclusion criteria. Variables that had the potential to moderate intervention efficacy were also tested. The overall mean weighted effect size for condom use was d = 0.259 (95% confidence interval = 0.201, 0.317; Z = 8.74, P partners, and incident sexually transmitted diseases. In addition, interventions were significantly more efficacious when they were directed at men or women (versus mixed sex groups), utilized individualized tailoring, used a Stages of Change model, and had more intervention sessions. Computer technology-based HIV prevention interventions have similar efficacy to more traditional human-delivered interventions. Given their low cost to deliver, ability to customize intervention content, and flexible dissemination channels, they hold much promise for the future of HIV prevention.

Affine pairings on ARM

NARCIS (Netherlands)

Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.

2011-01-01

Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and

Solutions of nuclear pairing

International Nuclear Information System (INIS)

Balantekin, A. B.; Pehlivan, Y.

2007-01-01

We give the exact solution of orbit dependent nuclear pairing problem between two nondegenerate energy levels using the Bethe ansatz technique. Our solution reduces to previously solved cases in the appropriate limits including Richardson's treatment of reduced pairing in terms of rational Gaudin algebra operators

The Zero Suicide Model: Applying Evidence-Based Suicide Prevention Practices to Clinical Care

Directory of Open Access Journals (Sweden)

Beth S. Brodsky

2018-02-01

Full Text Available Suicide is reaching epidemic proportions, with over 44,000 deaths by suicide in the US, and 800,000 worldwide in 2015. This, despite research and development of evidence-based interventions that target suicidal behavior directly. Suicide prevention efforts need a comprehensive approach, and research must lead to effective implementation across public and mental health systems. A 10-year systematic review of evidence-based findings in suicide prevention summarized the areas necessary for translating research into practice. These include risk assessment, means restriction, evidence-based treatments, population screening combined with chain of care, monitoring, and follow-up. In this article, we review how suicide prevention research informs implementation in clinical settings where those most at risk present for care. Evidence-based and best practices address the fluctuating nature of suicide risk, which requires ongoing risk assessment, direct intervention and monitoring. In the US, the National Action Alliance for Suicide Prevention has put forth the Zero Suicide (ZS Model, a framework to coordinate a multilevel approach to implementing evidence-based practices. We present the Assess, Intervene and Monitor for Suicide Prevention model (AIM-SP as a guide for implementation of ZS evidence-based and best practices in clinical settings. Ten basic steps for clinical management model will be described and illustrated through case vignette. These steps are designed to be easily incorporated into standard clinical practice to enhance suicide risk assessment, brief interventions to increase safety and teach coping strategies and to improve ongoing contact and monitoring of high-risk individuals during transitions in care and high risk periods.

The Peak Pairs algorithm for strain mapping from HRTEM images

Energy Technology Data Exchange (ETDEWEB)

Galindo, Pedro L. [Departamento de Lenguajes y Sistemas Informaticos, CASEM, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain)], E-mail: pedro.galindo@uca.es; Kret, Slawomir [Institute of Physics, PAS, AL. Lotnikow 32/46, 02-668 Warsaw (Poland); Sanchez, Ana M. [Departamento de Ciencia de los Materiales e Ing. Metalurgica y Q. Inorganica, Facultad de Ciencias, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain); Laval, Jean-Yves [Laboratoire de Physique du Solide, UPR5 CNRS-ESPCI, Paris (France); Yanez, Andres; Pizarro, Joaquin; Guerrero, Elisa [Departamento de Lenguajes y Sistemas Informaticos, CASEM, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain); Ben, Teresa; Molina, Sergio I. [Departamento de Ciencia de los Materiales e Ing. Metalurgica y Q. Inorganica, Facultad de Ciencias, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain)

2007-11-15

Strain mapping is defined as a numerical image-processing technique that measures the local shifts of image details around a crystal defect with respect to the ideal, defect-free, positions in the bulk. Algorithms to map elastic strains from high-resolution transmission electron microscopy (HRTEM) images may be classified into two categories: those based on the detection of peaks of intensity in real space and the Geometric Phase approach, calculated in Fourier space. In this paper, we discuss both categories and propose an alternative real space algorithm (Peak Pairs) based on the detection of pairs of intensity maxima in an affine transformed space dependent on the reference area. In spite of the fact that it is a real space approach, the Peak Pairs algorithm exhibits good behaviour at heavily distorted defect cores, e.g. interfaces and dislocations. Quantitative results are reported from experiments to determine local strain in different types of semiconductor heterostructures.

Quantifying inbreeding avoidance through extra-pair reproduction.

Science.gov (United States)

Reid, Jane M; Arcese, Peter; Keller, Lukas F; Germain, Ryan R; Duthie, A Bradley; Losdat, Sylvain; Wolak, Matthew E; Nietlisbach, Pirmin

2015-01-01

Extra-pair reproduction is widely hypothesized to allow females to avoid inbreeding with related socially paired males. Consequently, numerous field studies have tested the key predictions that extra-pair offspring are less inbred than females' alternative within-pair offspring, and that the probability of extra-pair reproduction increases with a female's relatedness to her socially paired male. However, such studies rarely measure inbreeding or relatedness sufficiently precisely to detect subtle effects, or consider biases stemming from failure to observe inbred offspring that die during early development. Analyses of multigenerational song sparrow (Melospiza melodia) pedigree data showed that most females had opportunity to increase or decrease the coefficient of inbreeding of their offspring through extra-pair reproduction with neighboring males. In practice, observed extra-pair offspring had lower inbreeding coefficients than females' within-pair offspring on average, while the probability of extra-pair reproduction increased substantially with the coefficient of kinship between a female and her socially paired male. However, simulations showed that such effects could simply reflect bias stemming from inbreeding depression in early offspring survival. The null hypothesis that extra-pair reproduction is random with respect to kinship therefore cannot be definitively rejected in song sparrows, and existing general evidence that females avoid inbreeding through extra-pair reproduction requires reevaluation given such biases. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

Preventing Medication Error Based on Knowledge Management Against Adverse Event

OpenAIRE

Hastuti, Apriyani Puji; Nursalam, Nursalam; Triharini, Mira

2017-01-01

Introductions: Medication error is one of many types of errors that could decrease the quality and safety of healthcare. Increasing number of adverse events (AE) reflects the number of medication errors. This study aimed to develop a model of medication error prevention based on knowledge management. This model is expected to improve knowledge and skill of nurses to prevent medication error which is characterized by the decrease of adverse events (AE). Methods: This study consisted of two sta...

Synergy between pair coupled cluster doubles and pair density functional theory

Energy Technology Data Exchange (ETDEWEB)

Garza, Alejandro J.; Bulik, Ireneusz W. [Department of Chemistry, Rice University, Houston, Texas 77251-1892 (United States); Henderson, Thomas M. [Department of Chemistry and Department of Physics and Astronomy, Rice University, Houston, Texas 77251-1892 (United States); Scuseria, Gustavo E. [Department of Chemistry and Department of Physics and Astronomy, Rice University, Houston, Texas 77251-1892 (United States); Chemistry Department, Faculty of Science, King Abdulaziz University, Jeddah 21589 (Saudi Arabia)

2015-01-28

Pair coupled cluster doubles (pCCD) has been recently studied as a method capable of accounting for static correlation with low polynomial cost. We present three combinations of pCCD with Kohn–Sham functionals of the density and on-top pair density (the probability of finding two electrons on top of each other) to add dynamic correlation to pCCD without double counting. With a negligible increase in computational cost, these pCCD+DFT blends greatly improve upon pCCD in the description of typical problems where static and dynamic correlations are both important. We argue that—as a black-box method with low scaling, size-extensivity, size-consistency, and a simple quasidiagonal two-particle density matrix—pCCD is an excellent match for pair density functionals in this type of fusion of multireference wavefunctions with DFT.

Secure pairing with biometrics

NARCIS (Netherlands)

Buhan, I.R.; Boom, B.J.; Doumen, J.M.; Hartel, Pieter H.; Veldhuis, Raymond N.J.

Secure pairing enables two devices that share no prior context with each other to agree upon a security association, which they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping and to a

Pair Housing of Dairy Calves and Age at Pairing: Effects on Weaning Stress, Health, Production and Social Networks.

Science.gov (United States)

Bolt, Sarah L; Boyland, Natasha K; Mlynski, David T; James, Richard; Croft, Darren P

2017-01-01

The early social environment can influence the health and behaviour of animals, with effects lasting into adulthood. In Europe, around 60% of dairy calves are reared individually during their first eight weeks of life, while others may be housed in pairs or small groups. This study assessed the effects of varying degrees of social contact on weaning stress, health and production during pen rearing, and on the social networks that calves later formed when grouped. Forty female Holstein-Friesian calves were allocated to one of three treatments: individually housed (I, n = 8), pair-housed from day five (P5, n = 8 pairs), and pair-housed from day 28 (P28, n = 8 pairs). From day 48, calves were weaned by gradual reduction of milk over three days, and vocalisations were recorded as a measure of stress for three days before, during and after weaning. Health and production (growth rate and concentrate intakes) were not affected by treatment during the weaning period or over the whole study. Vocalisations were highest post-weaning, and were significantly higher in I calves than pair-reared calves. Furthermore, P28 calves vocalised significantly more than P5 calves. The social network of calves was measured for one month after all calves were grouped in a barn, using association data from spatial proximity loggers. We tested for week-week stability, social differentiation and assortment in the calf network. Additionally, we tested for treatment differences in: coefficient of variation (CV) in association strength, percentage of time spent with ex-penmate (P5 and P28 calves only) and weighted degree centrality (the sum of the strength of an individual's associations). The network was relatively stable from weeks one to four and was significantly differentiated, with individuals assorting based on prior familiarity. P5 calves had significantly higher CV in association strength than I calves in week one (indicating more heterogeneous social associations) but there were no

A genomically modified Escherichia coli strain carrying an orthogonal E. coli histidyl-tRNA synthetase•tRNAHis pair.

Science.gov (United States)

Englert, Markus; Vargas-Rodriguez, Oscar; Reynolds, Noah M; Wang, Yane-Shih; Söll, Dieter; Umehara, Takuya

2017-11-01

Development of new aminoacyl-tRNA synthetase (aaRS)•tRNA pairs is central for incorporation of novel non-canonical amino acids (ncAAs) into proteins via genetic code expansion (GCE). The Escherichia coli and Caulobacter crescentus histidyl-tRNA synthetases (HisRS) evolved divergent mechanisms of tRNA His recognition that prevent their cross-reactivity. Although the E. coli HisRS•tRNA His pair is a good candidate for GCE, its use in C. crescentus is limited by the lack of established genetic selection methods and by the low transformation efficiency of C. crescentus. E. coli was genetically engineered to use a C. crescentus HisRS•tRNA His pair. Super-folder green fluorescent protein (sfGFP) and chloramphenicol acetyltransferase (CAT) were used as reporters for read-through assays. A library of 313 ncAAs coupled with the sfGFP reporter system was employed to investigate the specificity of E. coli HisRS in vivo. A genomically modified E. coli strain (named MEOV1) was created. MEVO1 requires an active C. crescentus HisRS•tRNA His pair for growth, and displays a similar doubling time as the parental E. coli strain. sfGFP- and CAT-based assays showed that the E. coli HisRS•tRNA His pair is orthogonal in MEOV1 cells. A mutation in the anticodon loop of E. coli tRNA His CUA elevated its suppression efficiency by 2-fold. The C. crescentus HisRS•tRNA His pair functionally complements an E. coli ΔhisS strain. The E. coli HisRS•tRNA His is orthogonal in MEOV1 cells. E. coli tRNA His CUA is an efficient amber suppressor in MEOV1. We developed a platform that allows protein engineering of E. coli HisRS that should facilitate GCE in E. coli. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

Property (RD) for Hecke Pairs

International Nuclear Information System (INIS)

Shirbisheh, Vahid

2012-01-01

As the first step towards developing noncommutative geometry over Hecke C ∗ -algebras, we study property (RD) (Rapid Decay) for Hecke pairs. When the subgroup H in a Hecke pair (G, H) is finite, we show that the Hecke pair (G, H) has (RD) if and only if G has (RD). This provides us with a family of examples of Hecke pairs with property (RD). We also adapt Paul Jolissant’s works in Jolissaint (J K-Theory 2:723–735, 1989; Trans Amer Math Soc 317(1):167–196, 1990) to the setting of Hecke C ∗ -algebras and show that when a Hecke pair (G, H) has property (RD), the algebra of rapidly decreasing functions on the set of double cosets is closed under holomorphic functional calculus of the associated (reduced) Hecke C ∗ -algebra. Hence they have the same K 0 -groups.

Population-based prevention of influenza in Dutch general practice

NARCIS (Netherlands)

Hak, E; Hermens, R P; van Essen, G A; Kuyvenhoven, M M; de Melker, R A

BACKGROUND: Although the effectiveness of influenza vaccination in high-risk groups has been proven, vaccine coverage continues to be less than 50% in The Netherlands. To improve vaccination rates, data on the organizational factors, which should be targeted in population-based prevention of

Using Dictionary Pair Learning for Seizure Detection.

Science.gov (United States)

Ma, Xin; Yu, Nana; Zhou, Weidong

2018-02-13

Automatic seizure detection is extremely important in the monitoring and diagnosis of epilepsy. The paper presents a novel method based on dictionary pair learning (DPL) for seizure detection in the long-term intracranial electroencephalogram (EEG) recordings. First, for the EEG data, wavelet filtering and differential filtering are applied, and the kernel function is performed to make the signal linearly separable. In DPL, the synthesis dictionary and analysis dictionary are learned jointly from original training samples with alternating minimization method, and sparse coefficients are obtained by using of linear projection instead of costly [Formula: see text]-norm or [Formula: see text]-norm optimization. At last, the reconstructed residuals associated with seizure and nonseizure sub-dictionary pairs are calculated as the decision values, and the postprocessing is performed for improving the recognition rate and reducing the false detection rate of the system. A total of 530[Formula: see text]h from 20 patients with 81 seizures were used to evaluate the system. Our proposed method has achieved an average segment-based sensitivity of 93.39%, specificity of 98.51%, and event-based sensitivity of 96.36% with false detection rate of 0.236/h.

Pairing versus phase coherence of doped holes in distinct quantum spin backgrounds

Science.gov (United States)

Zhu, Zheng; Sheng, D. N.; Weng, Zheng-Yu

2018-03-01

We examine the pairing structure of holes injected into two distinct spin backgrounds: a short-range antiferromagnetic phase versus a symmetry protected topological phase. Based on density matrix renormalization group (DMRG) simulation, we find that although there is a strong binding between two holes in both phases, phase fluctuations can significantly influence the pair-pair correlation depending on the spin-spin correlation in the background. Here the phase fluctuation is identified as an intrinsic string operator nonlocally controlled by the spins. We show that while the pairing amplitude is generally large, the coherent Cooper pairing can be substantially weakened by the phase fluctuation in the symmetry-protected topological phase, in contrast to the short-range antiferromagnetic phase. It provides an example of a non-BCS mechanism for pairing, in which the paring phase coherence is determined by the underlying spin state self-consistently, bearing an interesting resemblance to the pseudogap physics in the cuprate.

A natively paired antibody library yields drug leads with higher sensitivity and specificity than a randomly paired antibody library.

Science.gov (United States)

Adler, Adam S; Bedinger, Daniel; Adams, Matthew S; Asensio, Michael A; Edgar, Robert C; Leong, Renee; Leong, Jackson; Mizrahi, Rena A; Spindler, Matthew J; Bandi, Srinivasa Rao; Huang, Haichun; Tawde, Pallavi; Brams, Peter; Johnson, David S

2018-04-01

Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of "randomly paired" scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs.

Distributed wireless quantum communication networks with partially entangled pairs

International Nuclear Information System (INIS)

Yu Xu-Tao; Zhang Zai-Chen; Xu Jin

2014-01-01

Wireless quantum communication networks transfer quantum state by teleportation. Existing research focuses on maximal entangled pairs. In this paper, we analyse the distributed wireless quantum communication networks with partially entangled pairs. A quantum routing scheme with multi-hop teleportation is proposed. With the proposed scheme, is not necessary for the quantum path to be consistent with the classical path. The quantum path and its associated classical path are established in a distributed way. Direct multi-hop teleportation is conducted on the selected path to transfer a quantum state from the source to the destination. Based on the feature of multi-hop teleportation using partially entangled pairs, if the node number of the quantum path is even, the destination node will add another teleportation at itself. We simulated the performance of distributed wireless quantum communication networks with a partially entangled state. The probability of transferring the quantum state successfully is statistically analyzed. Our work shows that multi-hop teleportation on distributed wireless quantum networks with partially entangled pairs is feasible. (general)

Olfactory interference during inhibitory backward pairing in honey bees.

Directory of Open Access Journals (Sweden)

Matthieu Dacher

Full Text Available Restrained worker honey bees are a valuable model for studying the behavioral and neural bases of olfactory plasticity. The proboscis extension response (PER; the proboscis is the mouthpart of honey bees is released in response to sucrose stimulation. If sucrose stimulation is preceded one or a few times by an odor (forward pairing, the bee will form a memory for this association, and subsequent presentations of the odor alone are sufficient to elicit the PER. However, backward pairing between the two stimuli (sucrose, then odor has not been studied to any great extent in bees, although the vertebrate literature indicates that it elicits a form of inhibitory plasticity.If hungry bees are fed with sucrose, they will release a long lasting PER; however, this PER can be interrupted if an odor is presented 15 seconds (but not 7 or 30 seconds after the sucrose (backward pairing. We refer to this previously unreported process as olfactory interference. Bees receiving this 15 second backward pairing show reduced performance after a subsequent single forward pairing (excitatory conditioning trial. Analysis of the results supported a relationship between olfactory interference and a form of backward pairing-induced inhibitory learning/memory. Injecting the drug cimetidine into the deutocerebrum impaired olfactory interference.Olfactory interference depends on the associative link between odor and PER, rather than between odor and sucrose. Furthermore, pairing an odor with sucrose can lead either to association of this odor to PER or to the inhibition of PER by this odor. Olfactory interference may provide insight into processes that gate how excitatory and inhibitory memories for odor-PER associations are formed.

Chain propagation and termination mechanisms for polymerization of conjugated polar alkenes by [Al]-based frustrated Lewis pairs

KAUST Repository

He, Jianghua

2014-11-25

A combined experimental and theoretical study on mechanistic aspects of polymerization of conjugated polar alkenes by frustrated Lewis pairs (FLPs) based on N-heterocyclic carbene (NHC) and Al(C6F5)3 pairs is reported. This study consists of three key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated or isolated from the FLP activation of monomers such as 2-vinylpyridine and 2-isopropenyl-2-oxazoline-one of which, IMes+-CH2C(Me)=(C3H2NO)Al(C6F5)3 - (2), has been structurally characterized. Kinetics performed on the polymerization of 2-vinylpyridine by ItBu/Al(C6F5)3 revealed that the polymerization follows a zero-order dependence on monomer concentration and a first-order dependence on initiator (ItBu) and activator [Al(C6F5)3] concentrations, indicating a bimolecular, activated monomer propagation mechanism. The Lewis pair polymerization of conjugate polar alkenes such as methacrylates is accompanied by competing chain-termination side reactions; between the two possible chain-termination pathways, the one that proceeds via intramolecular backbiting cyclization involving nucleophilic attack of the activated ester group of the growing polymer chain by the O-ester enolate active chain end to generate a six-membered lactone (δ-valerolactone)-terminated polymer chain is kinetically favored, but thermodynamically disfavored, over the pathway leading to the -ketoester-terminated chain, as revealed by computational studies.

Role of pn-pairs in nuclear structure

International Nuclear Information System (INIS)

Nie, G.K.

2003-01-01

An α-cluster model of nuclear structure based on power of proton + neutron (pn)-pairs to bind themselves to α-clusters is proposed. The α-cluster is taken as the perfect condition of coupling of 2 pn- pairs, reminding complete electron shell in atomic physics. Pn-pairs create 2 other types of coupling of considerably less power between pn-pairs of nearby α-clusters ε α c and between pn-pair not bound into α-cluster with pn-pairs of nearby cluster ε pn c . Last two types of coupling are called covalent because of reminding similar electron coupling in chemistry. According the model nucleus is a liquid drop consisting of molecules, which are α-clusters, tied by covalent coupling with those ones which are in close vicinity. Then in case of even-even nuclei spin of the nucleus has to be zero I=0 + as sum of spinless particles. In case of nucleus has some nucleons (i) in intermolecular space, I=Σj i ; with taking into account that there is coupling of p and n in pn-pair. Therefore for 6 Li (1=0)I=2·1/2=1 + . The values ε α c , ε pn c and binding energy of the pn-pair itself ε pn have been estimated from analysis of binding energy of nuclei 6 Li, 10 B and 12 C. With the values the binding energy of the other nuclei with N=Z up to 58 Cu have been described with difference between experimental values and model ones in average less than 0.4 MeV. The structure reveals some regular forms, in which every cluster has reduced amount of covalent coupling, 3 or 4, and free pn-pair has 6 covalent coupling with 3 nearby clusters pn-pairs. Then the magic numbers are supposed to be the matter of geometry, when total amount of covalent couplings is optimal (minimal for the amount of clusters), α- clusters are placed in the same fixed distant from center of mass. It means that protons of the clusters can be considered as belonging to one shell. In the cluster model single particle effects have to be considered as single particle binding in one of the surface �

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

Science.gov (United States)

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multiple electromagnetic pair production in ultrarelativistic heavy ion collisions

International Nuclear Information System (INIS)

Best, C.

1992-04-01

The problem of the unitary violation in the pair production in ultrarelativistic heavy ion collisions was studied by a consideration of the field-theoretical foundations. The quantum electrodynamics in an external field were thereby reduced to a Dirac-sea model, the equivalence of which to the non-radiative QED resulted from the equality of the generating functionals. The latter can both be expressed explicitely by means of the complet set of the solutions of the Dirac equation in an external field. This method is based solely on the path-integral approach, which makes it possible to discriminate clearly between the physically given correlation functions and their generating functional at the one hand and at the other hand between the models constructed to their interpretation. From the model expression for the pair production amplitudes and multiplicities could be calculated, for which only the knowledge of the one-particle S matrix is necessary. For the calculation of the multiplicities different forms of the perturbation theory were discussed. Finally an impact-parameter dependent Weizsaecker-Williams approximation for the calculation of arbitrary two-photon graphs was constructed and applied to the given problem. The results indicate that at small distances very high pair multiplicities are to be expected. Finally a new approach to the pair production in an external field was discussed, which is not based on the canonical field theory, but on the formalism of the Wigner functions. (orig./HSI) [de

Optimization of polymeric triiodide membrane electrode based on clozapine-triiodide ion-pair using experimental design.

Science.gov (United States)

Farhadi, Khalil; Bahram, Morteza; Shokatynia, Donya; Salehiyan, Floria

2008-07-15

Central composite design (CCD) and response surface methodology (RSM) were developed as experimental strategies for modeling and optimization of the influence of some variables on the performance of a new PVC membrane triiodide ion-selective electrode. This triiodide sensor is based on triiodide-clozapine ion-pair complexation. PVC, plasticizers, ion-pair amounts and pH were investigated as four variables to build a model to achieve the best Nernstian slope (59.9 mV) as response. The electrode is prepared by incorporating the ion-exchanger in PVC matrix plasticized with 2-nitrophenyl octal ether, which is directly coated on the surface of a graphite electrode. The influence of foreign ions on the electrode performance was also investigated. The optimized membranes demonstrate Nernstian response for triiodide ions over a wide linear range from 5.0 x 10(-6) to 1.0 x 10(-2)mol L(-1) with a limit of detection 2.0 x 10(-6) mol L(-1) at 25 degrees C. The electrodes could be used over a wide pH range 4-8, and have the advantages of easy to prepare, good selectivity and fast response time, long lifetime (over 3 months) and small interferences from hydrogen ion. The proposed electrode was successfully used as indicator electrode in potentiometric titration of triiodide ions and ascorbic acid.

Instability of vortex pair leapfrogging

DEFF Research Database (Denmark)

Tophøj, Laust; Aref, Hassan

2013-01-01

Leapfrogging is a periodic solution of the four-vortex problem with two positive and two negative point vortices all of the same absolute circulation arranged as co-axial vortex pairs. The set of co-axial motions can be parameterized by the ratio 0 vortex pair sizes at the time when one...... pair passes through the other. Leapfrogging occurs for α > σ2, where is the silver ratio. The motion is known in full analytical detail since the 1877 thesis of Gröbli and a well known 1894 paper by Love. Acheson ["Instability of vortex leapfrogging," Eur. J. Phys.21, 269-273 (2000...... pairs fly off to infinity, and a "walkabout" mode, where the vortices depart from leapfrogging but still remain within a finite distance of one another. We show numerically that this transition is more gradual, a result that we relate to earlier investigations of chaotic scattering of vortex pairs [L...

Pairing induced superconductivity in holography

Science.gov (United States)