WorldWideScience

Sample records for preventing ribosomal assembly

  1. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  2. Defective ribosome assembly in Shwachman-Diamond syndrome.

    Science.gov (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  3. Assembly constraints drive co-evolution among ribosomal constituents.

    Science.gov (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip

    2015-06-23

    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

    2013-01-01

    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  5. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

    Science.gov (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

    2018-04-24

    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  6. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  7. Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    Science.gov (United States)

    2017-02-01

    and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

  8. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting.

    Science.gov (United States)

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A

    2016-07-01

    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi

    2016-01-01

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  10. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)

    2016-04-22

    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  11. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

    Science.gov (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

    2014-10-14

    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  12. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein

    2015-02-01

    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  13. The amino terminal end determines the stability and assembling capacity of eukaryotic ribosomal stalk proteins P1 and P2.

    Science.gov (United States)

    Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G

    2011-05-01

    The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.

  14. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    International Nuclear Information System (INIS)

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-01-01

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit

  15. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: alin@ym.edu.tw [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  16. Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly

    DEFF Research Database (Denmark)

    Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw

    2018-01-01

    Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...

  17. Assembly of the 30S subunit from Escherichia coli ribosomes occurs via two assembly domains which are initiated by S4 and S7

    International Nuclear Information System (INIS)

    Nowotny, V.; Nierhaus, K.H.

    1988-01-01

    A protein which initiates assembly of ribosomes is defined as a protein which binds to the respective rRNA without cooperativity (i.e., without the help of other proteins) during the onset of assembly and is essential for the formation of active ribosomal subunits. The number of proteins binding without cooperativity was determined by monitoring the reconstitution output of active particles at various inputs of 16S rRNA, in the present of constant amounts of 30S-derived proteins (TP30): This showed that only two of the proteins of the 30S subunit are assembly-initiator proteins. These two proteins are still present on a LiCl core particle comprising 16S rRNA and 12 proteins (including minor proteins). The 12 proteins were isolated, and a series of reconstitution experiments at various levels of rRNA excess demonstrated that S4 and S7 are the initiator proteins. Pulse-chase experiments performed during the early assembly with 14 C- and 3 H-labeled TP30 and the determination of the 14 C/ 3 H ratio of the individual proteins within the assembled particles revealed a bilobal structure of the 30S assembly: A group of six proteins headed by S4 (namely, S4, S20, S16, S15, S6, and S18) resisted the chasing most efficiently (S4 assembly domain). None of the proteins depending on S7 during assembly were found in this group but rather in a second group with intermediate chasing stability [S7 assembly domain; consisting of S7, S9, (S8), S19, and S3]. A number of proteins could be fully chased during the early assembly and therefore represent late assembly proteins (S10, S5, S13, S2, S21, S1). These findings fit well with the 30S assembly map. These data, together with the assembly map, imply that S8 and S5 play an important role in the interconnection of the two assembly domains

  18. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    Science.gov (United States)

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  19. Yeast polypeptide exit tunnel ribosomal proteins L17, L35 and L37 are necessary to recruit late-assembling factors required for 27SB pre-rRNA processing.

    Science.gov (United States)

    Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L

    2013-02-01

    Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.

  20. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena

    2017-04-01

    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  1. Rrp12 and the Exportin Crm1 participate in late assembly events in the nucleolus during 40S ribosomal subunit biogenesis.

    Science.gov (United States)

    Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes

    2014-12-01

    During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.

  2. Interdependence of Pes1, Bop1, and WDR12 controls nucleolar localization and assembly of the PeBoW complex required for maturation of the 60S ribosomal subunit.

    Science.gov (United States)

    Rohrmoser, Michaela; Hölzel, Michael; Grimm, Thomas; Malamoussi, Anastassia; Harasim, Thomas; Orban, Mathias; Pfisterer, Iris; Gruber-Eber, Anita; Kremmer, Elisabeth; Eick, Dirk

    2007-05-01

    The PeBoW complex is essential for cell proliferation and maturation of the large ribosomal subunit in mammalian cells. Here we examined the role of PeBoW-specific proteins Pes1, Bop1, and WDR12 in complex assembly and stability, nucleolar transport, and pre-ribosome association. Recombinant expression of the three subunits is sufficient for complex formation. The stability of all three subunits strongly increases upon incorporation into the complex. Only overexpression of Bop1 inhibits cell proliferation and rRNA processing, and its negative effects could be rescued by coexpression of WDR12, but not Pes1. Elevated levels of Bop1 induce Bop1/WDR12 and Bop1/Pes1 subcomplexes. Knockdown of Bop1 abolishes the copurification of Pes1 with WDR12, demonstrating Bop1 as the integral component of the complex. Overexpressed Bop1 substitutes for endogenous Bop1 in PeBoW complex assembly, leading to the instability of endogenous Bop1. Finally, indirect immunofluorescence, cell fractionation, and sucrose gradient centrifugation experiments indicate that transport of Bop1 from the cytoplasm to the nucleolus is Pes1 dependent, while Pes1 can migrate to the nucleolus and bind to preribosomal particles independently of Bop1. We conclude that the assembly and integrity of the PeBoW complex are highly sensitive to changes in Bop1 protein levels.

  3. NEDDylation promotes stress granule assembly.

    Science.gov (United States)

    Jayabalan, Aravinth Kumar; Sanchez, Anthony; Park, Ra Young; Yoon, Sang Pil; Kang, Gum-Yong; Baek, Je-Hyun; Anderson, Paul; Kee, Younghoon; Ohn, Takbum

    2016-07-06

    Stress granules (SGs) harbour translationally stalled messenger ribonucleoproteins and play important roles in regulating gene expression and cell fate. Here we show that neddylation promotes SG assembly in response to arsenite-induced oxidative stress. Inhibition or depletion of key components of the neddylation machinery concomitantly inhibits stress-induced polysome disassembly and SG assembly. Affinity purification and subsequent mass-spectrometric analysis of Nedd8-conjugated proteins from translationally stalled ribosomal fractions identified ribosomal proteins, translation factors and RNA-binding proteins (RBPs), including SRSF3, a previously known SG regulator. We show that SRSF3 is selectively neddylated at Lys85 in response to arsenite. A non-neddylatable SRSF3 (K85R) mutant do not prevent arsenite-induced polysome disassembly, but fails to support the SG assembly, suggesting that the neddylation pathway plays an important role in SG assembly.

  4. Systems and methods for preventing flashback in a combustor assembly

    Science.gov (United States)

    Johnson, Thomas Edward; Ziminsky, Willy Steve; Stevenson, Christian Xavier

    2016-04-05

    Embodiments of the present application include a combustor assembly. The combustor assembly may include a combustion chamber, a first plenum, a second plenum, and one or more elongate air/fuel premixing injection tubes. Each of the elongate air/fuel premixing injection tubes may include a first length at least partially disposed within the first plenum and configured to receive a first fluid from the first plenum. Moreover, each of the elongate air/fuel premixing injection tubes may include a second length disposed downstream of the first length and at least partially disposed within the second plenum. The second length may be formed of a porous wall configured to allow a second fluid from the second plenum to enter the second length and create a boundary layer about the porous wall.

  5. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  6. Device for preventing leakage of coolant in nuclear fuel assembly

    International Nuclear Information System (INIS)

    Kobayashi, Yukio; Sekiguchi, Mamoru; Yoshida, Hideo.

    1975-01-01

    Object: To prevent leakage of coolant from between lower tie plate and channel box without causing deformation of the channel box and also without the possibility of disturbing the installation and removal of the box by the provision of a thin plate provided with leakage holes for the lower tie plate. Structure: Static water pressure within the lower tie plate is adapted to act upon the bear side of a flat plate for leakage prevention through leakage holes formed in the tie plate, thus urging the flat plate against the channel box inner surface. Meanwhile, static water pressure having been led through the leakage holes in the flat plate is adapted to press the flat plate in the vertical direction, thus urging the flat plate against the channel box inner surface and thereby preventing leakage of the coolant through a gap between the channel box and lower tie plate. (Yoshino, Y.)

  7. Apparatus and method for preventing the rotation of rods used in nuclear fuel assemblies

    International Nuclear Information System (INIS)

    Pilgrim, L.G. Jr.; Jackson, L.F.

    1985-01-01

    Apparatus and method for preventing the rotation of one or more elongated rods used in nuclear fuel assemblies include an end plug secured to one longitudinal end of such an elongated rod and having an out-of-cavity, non-round structure affixed thereto and configured to mate with a complementary shaped structure in a lower tie plate of a nuclear fuel assembly in such a manner as to prevent the rotation of the rod about its longitudinal axis. In one embodiment, the end plug includes a pair of flats formed on a portion of the end plug and configured to abut against a pair of flats formed on the outer surface of a cylindrical boss or sleeve of the lower tie plate, thereby to prevent the rotation of the rod. In another embodiment, four grooves, disposed 90 0 apart about the periphery of an end plug of a rod form a spline. The grooves are configured to receive four, radially inwardly protruding, key members disposed 90 0 apart about the periphery of a sleeve secured to the lower tie plate, thereby to prevent the rotation of the rod. In a further embodiment, a sleeve is secured to an end plug of a rod and includes four elongated slots disposed 90 0 apart about the periphery of the sleeve and configured in width, depth and spacing to receive and mate with four web portions of the lower tie plate of the nuclear fuel assembly, thereby to secure the rod against rotation about its longitudinal axis

  8. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt

    2015-11-01

    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  9. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell

    2011-01-01

    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  10. CDK1 Prevents Unscheduled PLK4-STIL Complex Assembly in Centriole Biogenesis.

    Science.gov (United States)

    Zitouni, Sihem; Francia, Maria E; Leal, Filipe; Montenegro Gouveia, Susana; Nabais, Catarina; Duarte, Paulo; Gilberto, Samuel; Brito, Daniela; Moyer, Tyler; Kandels-Lewis, Steffi; Ohta, Midori; Kitagawa, Daiju; Holland, Andrew J; Karsenti, Eric; Lorca, Thierry; Lince-Faria, Mariana; Bettencourt-Dias, Mónica

    2016-05-09

    Centrioles are essential for the assembly of both centrosomes and cilia. Centriole biogenesis occurs once and only once per cell cycle and is temporally coordinated with cell-cycle progression, ensuring the formation of the right number of centrioles at the right time. The formation of new daughter centrioles is guided by a pre-existing, mother centriole. The proximity between mother and daughter centrioles was proposed to restrict new centriole formation until they separate beyond a critical distance. Paradoxically, mother and daughter centrioles overcome this distance in early mitosis, at a time when triggers for centriole biogenesis Polo-like kinase 4 (PLK4) and its substrate STIL are abundant. Here we show that in mitosis, the mitotic kinase CDK1-CyclinB binds STIL and prevents formation of the PLK4-STIL complex and STIL phosphorylation by PLK4, thus inhibiting untimely onset of centriole biogenesis. After CDK1-CyclinB inactivation upon mitotic exit, PLK4 can bind and phosphorylate STIL in G1, allowing pro-centriole assembly in the subsequent S phase. Our work shows that complementary mechanisms, such as mother-daughter centriole proximity and CDK1-CyclinB interaction with centriolar components, ensure that centriole biogenesis occurs once and only once per cell cycle, raising parallels to the cell-cycle regulation of DNA replication and centromere formation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

    Science.gov (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

    2014-01-01

    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  12. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo

    2016-06-01

    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  13. Expanding the ribosomal universe.

    Science.gov (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-09

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  14. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    Science.gov (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  15. Modeling the Hybrid Flow Shop Scheduling Problem Followed by an Assembly Stage Considering Aging Effects and Preventive Maintenance Activities

    Directory of Open Access Journals (Sweden)

    Seyyed Mohammad Hassan Hosseini

    2016-05-01

    Full Text Available Scheduling problem for the hybrid flow shop scheduling problem (HFSP followed by an assembly stage considering aging effects additional preventive and maintenance activities is studied in this paper. In this production system, a number of products of different kinds are produced. Each product is assembled with a set of several parts. The first stage is a hybrid flow shop to produce parts. All machines can process all kinds of parts in this stage but each machine can process only one part at the same time. The second stage is a single assembly machine or a single assembly team of workers. The aim is to schedule the parts on the machines and assembly sequence and also determine when the preventive maintenance activities get done in order to minimize the completion time of all products (makespan. A mathematical modeling is presented and its validation is shown by solving an example in small scale. Since this problem has been proved strongly NP-hard, in order to solve the problem in medium and large scale, four heuristic algorithms is proposed based on the Johnson’s algorithm. The numerical experiments are used to run the mathematical model and evaluate the performance of the proposed algorithms.

  16. Method of preventing criticality of fresh fuel assembly in storage facility

    International Nuclear Information System (INIS)

    Kawamura, Makoto.

    1990-01-01

    With an aim of improving the operation efficiency of a reactor, extention of the operation cycle by increasing U 235 enrichment degree of fuel uranium is planned. However, along with the increase of the enrichment degree of the fuel uranium, there occurs a problem of criticality upon fuel handling. Then, in the present invention, boric acid incorporating B-10 of great neutron absorption effect are packed with water soluble polymeric materials which are further packed with a fuel packing sheet, or the water soluble polymeric materials incorporating boric acids are packed with fuel packing sheets which are disposed to a fresh fuel assembly and stored in a store house as they are. The fuel packing sheet is a perforated sheet having a plurality of water intruding pores. Then, if water should intrude to the store house accidentally, the water soluble polymeric materials are dissolved, so that the intruded water is converted into aqueous boric acid easily and absorbs neutrons effectively to thereby attain the prevention of criticality. (T.M.)

  17. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun

    2017-05-01

    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  18. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    Science.gov (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  19. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati

    2013-07-01

    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  20. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

    Science.gov (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

    2013-07-11

    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  1. In vitro degradation of ribosomes.

    Science.gov (United States)

    Mora, G; Rivas, A

    1976-12-01

    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  2. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  3. Neutrophil proteomic analysis reveals the participation of antioxidant enzymes, motility and ribosomal proteins in the prevention of ischemic effects by preconditioning

    DEFF Research Database (Denmark)

    Arshid, S; Tahir, M; Fontes, B

    2017-01-01

    therapeutic application; however the exact underlying mechanism is not clear. Neutrophils play an important role in the mechanism of injuries caused by ischemia and reperfusion while IPC led to a decrease in neutrophil stimulation and activation. The effect of preconditioning on the neutrophil proteome...... in such conditions, there is no report of a proteomic study providing a broader view of this scenario. Here we describe a group of proteins significantly regulated by ischemia and reperfusion being such regulation prevented by preconditioning. Such finding may provide relevant information for a deeper understanding...

  4. Fuel assemblies

    International Nuclear Information System (INIS)

    Nakatsuka, Masafumi.

    1979-01-01

    Purpose: To prevent scattering of gaseous fission products released from fuel assemblies stored in an fbr type reactor. Constitution; A cap provided with means capable of storing gas is adapted to amount to the assembly handling head, for example, by way of threading in a storage rack of spent fuel assemblies consisting of a bottom plate, a top plate and an assembly support mechanism. By previously eliminating the gas inside of the assembly and the cap in the storage rack, gaseous fission products upon loading, if released from fuel rods during storage, are stored in the cap and do not scatter in the storage rack. (Horiuchi, T.)

  5. Participatory ergonomic intervention for prevention of low back pain: assembly line redesign case.

    Science.gov (United States)

    Bernardes, João Marcos; Wanderck, Claudia; Moro, Antônio Renato Pereira

    2012-01-01

    This paper gives an overview of a participatory ergonomic intervention aimed at reducing low back pain cases in the dispatch department of a catalogue and e-commerce retail company. Based on the findings of the ergonomic analysis and design committee, the company's own employees redesigned the assembly line's layout. As a result of these changes two job tasks that involved manual material handling of boxes, identified by the revised NIOSH equation as posing an increased risk for lifting-related low back pain, were totally eliminated, and the employees responsible for moving boxes from the end of the assembly line to pallets on the ground were given more control over their jobs, and these jobs were also enriched with a new, less heavy task. These results demonstrate that participatory ergonomic interventions are a viable and effective strategy to reduce the exposure to work-related physical and psychosocial risk factors for low back pain.

  6. Efficacy of dry-ice blasting in preventive maintenance of auto robotic assemblies

    Science.gov (United States)

    Baluch, Nazim; Mohtar, Shahimi; Abdullah, Che Sobry

    2016-08-01

    Welding robots are extensively applied in the automotive assemblies and `Spot Welding' is the most common welding application found in the auto stamping assembly manufacturing. Every manufacturing process is subject to variations - with resistance welding, these include; part fit up, part thickness variations, misaligned electrodes, variations in coating materials or thickness, sealers, weld force variations, shunting, machine tooling degradation; and slag and spatter damage. All welding gun tips undergo wear; an elemental part of the process. Though adaptive resistance welding control automatically compensates to keep production and quality up to the levels needed as gun tips undergo wear so that the welds remain reliable; the system cannot compensate for deterioration caused by the slag and spatter on the part holding fixtures, sensors, and gun tips. To cleanse welding robots of slag and spatter, dry-ice blasting has proven to be an effective remedy. This paper describes Spot welding process, analyses the slag and spatter formation during robotic welding of stamping assemblies, and concludes that the dry ice blasting process's utility in cleansing of welding robots in auto stamping plant operations is paramount and exigent.

  7. Biosynthesis: Reprogramming assembly lines

    Science.gov (United States)

    Menon, Binuraj R. K.; Jenner, Matthew

    2018-03-01

    Rational engineering of biosynthetic assembly lines for production of new compounds is an attractive prospect, yet it presents many challenges. Learning from biology, some of the rules for expanding the chemical diversity of non-ribosomal peptides have been uncovered in two recent studies.

  8. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence

    Science.gov (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros

    2014-01-01

    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  9. Sustainable MSD prevention: management for continuous improvement between prevention and production. Ergonomic intervention in two assembly line companies.

    Science.gov (United States)

    Caroly, S; Coutarel, F; Landry, A; Mary-Cheray, I

    2010-07-01

    To increase output and meet customers' needs, companies have turned to the development of production management systems: Kaizen, one piece flow, Kanban, etc. The aim of such systems is to accelerate decisions, react to environmental issues and manage various productions. In the main, this type of management system has led to the continuous improvement of production performance. Consequently, such production management systems can have unexpected negative effects on operators' health and safety. Conversely, regulation and control systems focusing on work-related risks have obliged firms to implement health and safety management systems such as OHSAS 18001. The purpose of this type of system, also based on continuous improvement, is to reduce risks, facilitate work-related activities and identify solutions in terms of equipment and tools. However, the prevention actions introduced through health and safety systems often result in other unexpected and unwanted effects on production. This paper shows how companies can improve the way they are run by taking into account both types of management system. Copyright 2010 Elsevier Ltd. All rights reserved.

  10. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    Science.gov (United States)

    Poirot, Olivier; Timsit, Youri

    2016-05-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  11. Overcoming inherent magnetic instability, preventing spin canting and magnetic coding in an assembly of ferrimagnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Dey, S.; Kumar, S., E-mail: kumars@phys.jdvu.ac.in [Department of Physics, Jadavpur University, Kolkata 700032 (India); Dey, S. K. [Department of Physics, Jadavpur University, Kolkata 700032 (India); Department of Physics, NITMAS, 24 Pargana(s) 743368 (India); Bagani, K.; Banerjee, S. [Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700064 (India); Majumder, S. [Department of Physics, Jadavpur University, Kolkata 700032 (India); Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700064 (India); Roychowdhury, A.; Das, D. [UGC-DAE CSR, Kolkata Centre, III/LB-8, Bidhannagar, Kolkata 700098 (India); Reddy, V. R. [UGC-DAE CSR, University Campus, Khandwa Road, Indore 452001 (India)

    2014-08-11

    The authors find that for mechanically milled Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2}O{sub 4} (∼10 nm), the mechanical strain induced enhancement of anisotropy energy helps to retain stable magnetic order. The reduction of magnetization can be prevented by keeping the cation distribution of nanometric ferrites at its equilibrium ratio. Moreover, the sample can be used in coding, storing, and retrieving of binary bit (“0” and “1”) through magnetic field change.

  12. The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

    Science.gov (United States)

    Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

    2017-02-15

    Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

  13. Ion Exchange Technology Development in Support of the Urine Processor Assembly Precipitation Prevention Project for the International Space Station

    Science.gov (United States)

    Mitchell, Julie L.; Broyan, James L.; Pickering, Karen D.; Adam, Niklas; Casteel, Michael; Callahan, Michael; Carrier, Chris

    2012-01-01

    In support of the Urine Processor Assembly Precipitation Prevention Project (UPA PPP), multiple technologies were explored to prevent CaSO4 2H2O (gypsum) precipitation during the on-orbit distillation process. Gypsum precipitation currently limits the water recovery rate onboard the International Space Station (ISS) to 70% versus the planned 85% target water recovery rate. Due to its ability to remove calcium cations in pretreated augmented urine (PTAU), ion exchange was selected as one of the technologies for further development by the PPP team. A total of 13 ion exchange resins were evaluated in various equilibrium and dynamic column tests with solutions of dissolved gypsum, urine ersatz, PTAU, and PTAU brine at 85% water recovery. While initial evaluations indicated that the Purolite SST60 resin had the highest calcium capacity in PTAU (0.30 meq/mL average), later tests showed that the Dowex G26 and Amberlite FPC12H resins had the highest capacity (0.5 meq/mL average). Testing at the Marshall Spaceflight Center (MSFC) integrates the ion exchange technology with a UPA ground article under flight-like pulsed flow conditions with PTAU. To date, no gypsum precipitation has taken place in any of the initial evaluations.

  14. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    Science.gov (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  15. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    Science.gov (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-06

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients.

    Science.gov (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J

    2013-08-08

    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  17. 5S rRNA and ribosome.

    Science.gov (United States)

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  18. Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.

    Science.gov (United States)

    Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T

    2017-02-21

    Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

  19. Chaperoning 5S RNA assembly.

    Science.gov (United States)

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.

  20. Valve assembly

    International Nuclear Information System (INIS)

    Sandling, M.

    1981-01-01

    An improved valve assembly, used for controlling the flow of radioactive slurry, is described. Radioactive contamination of the air during removal or replacement of the valve is prevented by sucking air from the atmosphere through a portion of the structure above the valve housing. (U.K.)

  1. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  2. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

    Science.gov (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

    2017-01-17

    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  3. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    Science.gov (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon

    2016-12-01

    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  5. Organization of proteins in mammalian mitochondrial ribosomes: accessibility to lactoperoxidase-catalyzed radioiodination

    International Nuclear Information System (INIS)

    Denslow, N.D.; O'Brien, T.W.

    1984-01-01

    To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles

  6. Energy Landscapes: From Protein Folding to Molecular Assembly

    Science.gov (United States)

    Databases National Security Education Center (NSEC) Center for Nonlinear Studies Engineering Institute assembly is very common in biology and in nanotechnology. Simple examples of self-assembly are the folding efflux pump machinery, ATP synthase, the ribosome, and many others. In nanotechnology, self-assembly has

  7. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    Science.gov (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  8. Prevention of significant deterioration permit application for the Fueled Clad Fabrication System, the Radioisotope Power Systems Facility, and the Fuel Assembly Area

    Energy Technology Data Exchange (ETDEWEB)

    1989-08-01

    This New Source Review'' has been submitted by the US Department of Energy-Richland Operations Office (PO Box 550, Richland, Washington 99352), pursuant to WAC 173-403-050 and in compliance with the Department of Ecology Guide to Processing A Prevention Of Significant Deterioration (PSD) Permit'' for three new sources of radionuclide emissions at the Hanford Site in Washington State. The three new sources, the Fueled Clad Fabrication System (FCFS), the Radioisotope Power Systems Facility (RPSF), and the Fuel Assembly Area (FAA), will be located in one facility, the Fuels and Materials Examination Facility (FMEF) of the 400 Area. The FMEF was originally designed to provide for post-irradiation examination and fabrication of breeder reactor fuels. These FMEF missions were cancelled before the introduction of any fuel materials or any irradiated material. The current plans are to use the facility to fabricate power supplies for use in space applications and to produce Fast Flux Test Facility (FFTF) fuel and target assemblies. The FCFS and the RPSF will produce materials and assemblies for application in space. The FAA project will produce FFTF fuel and target assemblies. The FCFS and the RPSF will share the same building, stack, and, in certain cases, the same floor space. Given this relationship, these systems will be dealt with separately to the extent possible. The FAA is a comparatively independent operation though it will share the FMEF complex.

  9. Trapping the ribosome to control gene expression.

    Science.gov (United States)

    Boehringer, Daniel; Ban, Nenad

    2007-09-21

    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  10. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov

    2015-11-01

    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  11. Fuel assembly

    International Nuclear Information System (INIS)

    Nakatsuka, Masafumi; Matsuzuka, Ryuji.

    1976-01-01

    Object: To provide a fuel assembly which can decrease pressure loss of coolant to uniform temperature. Structure: A sectional area of a flow passage in the vicinity of an inner peripheral surface of a wrapper tube is limited over the entire length to prevent the temperature of a fuel element in the outermost peripheral portion from being excessively decreased to thereby flatten temperature distribution. To this end, a plurality of pincture-frame-like sheet metals constituting a spacer for supporting a fuel assembly, which has a plurality of fuel elements planted lengthwise and in given spaced relation within the wrapper tube, is disposed in longitudinal grooves and in stacked fashion to form a substantially honeycomb-like space in cross section. The fuel elements are inserted and supported in the space to form a fuel assembly. (Kamimura, M.)

  12. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu

    2011-01-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  13. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  14. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh

    2015-01-01

    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  15. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

    2012-03-23

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  16. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

    Science.gov (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

    2012-01-01

    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  17. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    Science.gov (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G

    1993-01-01

    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  19. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  20. Assembly and disassembly of the nucleolus during the cell cycle.

    Science.gov (United States)

    Hernandez-Verdun, Danièle

    2011-01-01

    The nucleolus is a large nuclear domain in which transcription, maturation and assembly of ribosomes take place. In higher eukaryotes, nucleolar organization in three sub-domains reflects the compartmentation of the machineries related to active or inactive transcription of the ribosomal DNA, ribosomal RNA processing and assembly with ribosomal proteins of the two (40S and 60S) ribosomal subunits. The assembly of the nucleoli during telophase/early G(1) depends on pre-existing machineries inactivated during prophase (the transcription machinery and RNP processing complexes) and on partially processed 45S rRNAs inherited throughout mitosis. In telophase, the 45S rRNAs nucleate the prenucleolar bodies and order the dynamics of nucleolar assembly. The assembly/disassembly processes of the nucleolus depend on the equilibrium between phosphorylation/dephosphorylation of the transcription machinery and on the RNP processing complexes under the control of the CDK1-cyclin B kinase and PP1 phosphatases. The dynamics of assembly/disassembly of the nucleolus is time and space regulated.

  1. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.

    1997-01-01

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  2. Use of microscopy techniques in failure analysis of the plastic injection molded parts to prevent the risks of serial defects in the assembly processes

    Directory of Open Access Journals (Sweden)

    Braga Ion Cristian

    2017-01-01

    Full Text Available Nowadays, the plastic injected molded parts are components used in the automobile for both exterior and interior. A mechatronic device uses those molded parts for actuating in order to reach some effect; therefore they should be durable and aesthetically satisfying the customer requirements. The aim of this paper is to present the use of microscopy techniques in failure analysis of plastic molded parts as part of a mechatronic device in order to prevent the risks of cracking occurred in the serial assembly production. Due to the constraints, the thin walls are used in some small plastic parts and they can be broken in the next assembly steps, but the detection of the defects is not facile. At the validation of the batch, the sampling parts are tested to simulate the breakage and the tear zone is investigated using microscopy techniques. The information is used as a feedback to adjust the injection parameters, reference samples being created by experiments to support the team to reduce the time for adjusting the parameters.

  3. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  4. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  5. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

    Science.gov (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

    2016-01-15

    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  6. Prevention

    DEFF Research Database (Denmark)

    Halken, S; Høst, A

    2001-01-01

    , breastfeeding should be encouraged for 4-6 months. In high-risk infants a documented extensively hydrolysed formula is recommended if exclusive breastfeeding is not possible for the first 4 months of life. There is no evidence for preventive dietary intervention neither during pregnancy nor lactation...... populations. These theories remain to be documented in proper, controlled and prospective studies. Breastfeeding and the late introduction of solid foods (>4 months) is associated with a reduced risk of food allergy, atopic dermatitis, and recurrent wheezing and asthma in early childhood. In all infants....... Preventive dietary restrictions after the age of 4-6 months are not scientifically documented....

  7. Polerovirus protein P0 prevents the assembly of small RNA-containing RISC complexes and leads to degradation of ARGONAUTE1.

    Science.gov (United States)

    Csorba, Tibor; Lózsa, Rita; Hutvágner, György; Burgyán, József

    2010-05-01

    RNA silencing plays an important role in plants in defence against viruses. To overcome this defence, plant viruses encode suppressors of RNA silencing. The most common mode of silencing suppression is sequestration of double-stranded RNAs involved in the antiviral silencing pathways. Viral suppressors can also overcome silencing responses through protein-protein interaction. The poleroviral P0 silencing suppressor protein targets ARGONAUTE (AGO) proteins for degradation. AGO proteins are the core component of the RNA-induced silencing complex (RISC). We found that P0 does not interfere with the slicer activity of pre-programmed siRNA/miRNA containing AGO1, but prevents de novo formation of siRNA/miRNA containing AGO1. We show that the AGO1 protein is part of a high-molecular-weight complex, suggesting the existence of a multi-protein RISC in plants. We propose that P0 prevents RISC assembly by interacting with one of its protein components, thus inhibiting formation of siRNA/miRNA-RISC, and ultimately leading to AGO1 degradation. Our findings also suggest that siRNAs enhance the stability of co-expressed AGO1 in both the presence and absence of P0.

  8. Heat transfer enhancement for spent nuclear fuel assembly disposal packages using metallic void fillers: A prevention technique for solidification shrinkage-induced interfacial gaps

    Energy Technology Data Exchange (ETDEWEB)

    Park, Yongsoo, E-mail: yspark@alum.mit.edu; McKrell, Thomas J.; Driscoll, Michael J.

    2017-06-15

    This study considers replacing the externally accessible void spaces inside a disposal package containing a spent nuclear fuel assembly (SNFA) with high heat conducting metal to increase the effective thermal conductivity of the package and simplify the heat transfer mechanism inside the package by reducing it to a conduction dominant problem. The focus of the study is on preventing the gaps adjacent to the walls of the package components, produced by solidification shrinkage of poured liquid metal. We approached the problem by providing a temporary coating layer on the components to avoid direct build-up of thick metal oxides on their surface to promote metallic bonding at the interfaces under a non-inert environment. Laboratory scale experiments without SNFA were performed with Zn coated low carbon steel canisters and Zamak-3 void filler under two different filling temperature conditions – below and above the melting point of Zn (designated BMP and AMP respectively). Gap formation was successfully prevented in both cases while we confirmed an open gap in a control experiment, which used an uncoated canister. Minor growth of Al-Fe intermetallic phases was observed at the canister/filler interface of the sample produced under the BMP condition while their growth was significant and showed irregularly distributed morphology in the sample produced under the AMP condition, which has a potential to mitigate excessive residual stresses caused by shrinkage prevention. A procedure for the full-scale application was specified based on the results. - Highlights: •A void filling technique is introduced to enhance SNFA package heat transfer. •The technique is demonstrated via experiments using the Fe-Al-Zn system. •A procedure for the full scale application is proposed based on the results.

  9. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.

    1984-01-01

    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  10. Toxicity of ricin A chain is reduced in mammalian cells by inhibiting its interaction with the ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: cohick@aesop.rutgers.edu [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)

    2016-11-01

    Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.

  11. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F

    2010-05-01

    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  12. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex.

    Science.gov (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad

    2018-04-20

    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  13. Harnessing natural product assembly lines: structure, promiscuity, and engineering.

    Science.gov (United States)

    Ladner, Christopher C; Williams, Gavin J

    2016-03-01

    Many therapeutically relevant natural products are biosynthesized by the action of giant mega-enzyme assembly lines. By leveraging the specificity, promiscuity, and modularity of assembly lines, a variety of strategies has been developed that enables the biosynthesis of modified natural products. This review briefly summarizes recent structural advances related to natural product assembly lines, discusses chemical approaches to probing assembly line structures in the absence of traditional biophysical data, and surveys efforts that harness the inherent or engineered promiscuity of assembly lines for the synthesis of non-natural polyketides and non-ribosomal peptide analogues.

  14. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    Science.gov (United States)

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  15. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

    Science.gov (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

    2009-10-09

    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  16. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites.

    Science.gov (United States)

    Willcocks, Margaret M; Zaini, Salmah; Chamond, Nathalie; Ulryck, Nathalie; Allouche, Delphine; Rajagopalan, Noemie; Davids, Nana A; Fahnøe, Ulrik; Hadsbjerg, Johanne; Rasmussen, Thomas Bruun; Roberts, Lisa O; Sargueil, Bruno; Belsham, Graham J; Locker, Nicolas

    2017-12-15

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit. However, some HCV-like IRES elements possess an additional sub-domain, termed IIId2, whose function remains unclear. Herein, we show that IIId2 sub-domains from divergent viruses have different functions. The IIId2 sub-domain present in Seneca valley virus (SVV), a picornavirus, is dispensable for IRES activity, while the IIId2 sub-domains of two pestiviruses, classical swine fever virus (CSFV) and border disease virus (BDV), are required for 80S ribosomes assembly and IRES activity. Unlike in SVV, the deletion of IIId2 from the CSFV and BDV IRES elements impairs initiation of translation by inhibiting the assembly of 80S ribosomes. Consequently, this negatively affects the replication of CSFV and BDV. Finally, we show that the SVV IIId2 sub-domain is required for efficient viral RNA synthesis and growth of SVV, but not for IRES function. This study sheds light on the molecular evolution of viruses by clearly demonstrating that conserved RNA structures, within distantly related RNA viruses, have acquired different roles in the virus life cycles. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  18. An ultrathin polymer coating of carboxylate self-assembled monolayer adsorbed on passivated iron to prevent iron corrosion in 0.1 M Na2SO4

    International Nuclear Information System (INIS)

    Aramaki, Kunitsugu; Shimura, Tadashi

    2010-01-01

    For preparing an ultrathin two-dimensional polymer coating adsorbed on passivated iron, a 16-hydroxyhexadecanoate ion HO(CH 2 ) 15 CO 2 - self-assembled monolayer (SAM) was modified with 1,2-bis(triethoxysilyl)ethane (C 2 H 5 O) 3 Si(CH 2 ) 2 Si(OC 2 H 5 ) 3 and octadecyltriethoxysilane C 18 H 37 Si(OC 2 H 5 ) 3 . Protection of passivated iron against passive film breakdown and corrosion of iron was investigated by monitoring of the open-circuit potential and repeated polarization measurements in an aerated 0.1 M Na 2 SO 4 solution during immersion for many hours. The time required for passive film breakdown of the polymer-coated electrode was markedly higher in this solution than that of the passivated one, indicating protection of the passive film from breakdown by coverage with the polymer coating. The protective efficiencies of the passive film covered with the coating were extremely high, more than 99.9% in 0.1 M Na 2 SO 4 before the passive film was broken down, showing prominent cooperative suppression of iron corrosion in the solution by coverage with the passive film and polymer coating. The polymer-coated surface was characterized by contact angle measurement and electron-probe microanalysis (EPMA). Prevention of passive film breakdown and iron corrosion for the polymer-coated electrode healed in 0.1 M NaNO 3 was also examined in 0.1 M Na 2 SO 4 .

  19. Self-assembling peptide matrix for the prevention of esophageal stricture after endoscopic resection: a randomized controlled trial in a porcine model.

    Science.gov (United States)

    Barret, M; Bordaçahar, B; Beuvon, F; Terris, B; Camus, M; Coriat, R; Chaussade, S; Batteux, F; Prat, F

    2017-05-01

    Esophageal stricture formation after extensive endoscopic resection remains a major limitation of endoscopic therapy for early esophageal neoplasia. This study assessed a recently developed self-assembling peptide (SAP) matrix as a wound dressing after endoscopic resection for the prevention of esophageal stricture. Ten pigs were randomly assigned to the SAP or the control group after undergoing a 5-cm-long circumferential endoscopic submucosal dissection of the lower esophagus. Esophageal diameter on endoscopy and esophagogram, weight variation, and histological measurements of fibrosis, granulation tissue, and neoepithelium were assessed in each animal. The rate of esophageal stricture at day 14 was 40% in the SAP-treated group versus 100% in the control group (P = 0.2). Median interquartile range (IQR) esophageal diameter at day 14 was 8 mm (2.5-9) in the SAP-treated group versus 4 mm (3-4) in the control group (P = 0.13). The median (IQR) stricture indexes on esophagograms at day 14 were 0.32 (0.14-0.48) and 0.26 (0.14-0.33) in the SAP-treated and control groups, respectively (P = 0.42). Median (IQR) weight variation during the study was +0.2 (-7.4; +1.8) and -3.8 (-5.4; +0.6) in the SAP-treated and control groups, respectively (P = 0.9). Fibrosis, granulation tissue, and neoepithelium were not significantly different between the groups. The application of SAP matrix on esophageal wounds after a circumferential endoscopic submucosal dissection delayed the onset of esophageal stricture in a porcine model. © International Society for Diseases of the Esophagus 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  1. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  2. Architecture of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

    2014-01-23

    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  3. Evolutionary Conservation of the Ribosomal Biogenesis Factor Rbm19/Mrd1: Implications for Function

    OpenAIRE

    Kallberg, Yvonne; Segerstolpe, Åsa; Lackmann, Fredrik; Persson, Bengt; Wieslander, Lars

    2012-01-01

    Ribosome biogenesis in eukaryotes requires coordinated folding and assembly of a pre-rRNA into sequential pre-rRNA-protein complexes in which chemical modifications and RNA cleavages occur. These processes require many small nucleolar RNAs (snoRNAs) and proteins. Rbm19/Mrd1 is one such protein that is built from multiple RNA-binding domains (RBDs). We find that Rbm19/Mrd1 with five RBDs is present in all branches of the eukaryotic phylogenetic tree, except in animals and Choanoflagellates, th...

  4. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P

    2005-02-01

    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  5. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori

    2011-09-01

    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  6. Ribosomal RNA: a key to phylogeny

    Science.gov (United States)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  7. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  8. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    Science.gov (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  9. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.

    2013-01-01

    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  10. Bacteriophage Assembly

    Directory of Open Access Journals (Sweden)

    Anastasia A. Aksyuk

    2011-02-01

    Full Text Available Bacteriophages have been a model system to study assembly processes for over half a century. Formation of infectious phage particles involves specific protein-protein and protein-nucleic acid interactions, as well as large conformational changes of assembly precursors. The sequence and molecular mechanisms of phage assembly have been elucidated by a variety of methods. Differences and similarities of assembly processes in several different groups of bacteriophages are discussed in this review. The general principles of phage assembly are applicable to many macromolecular complexes.

  11. Sequence assembly

    DEFF Research Database (Denmark)

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  12. Defining the bacteroides ribosomal binding site.

    Science.gov (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R

    2013-03-01

    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  13. A self-assembling matrix-forming gel can be easily and safely applied to prevent delayed bleeding after endoscopic resections.

    Science.gov (United States)

    Pioche, Mathieu; Camus, Marine; Rivory, Jérôme; Leblanc, Sarah; Lienhart, Isabelle; Barret, Maximilien; Chaussade, Stanislas; Saurin, Jean-Christophe; Prat, Frederic; Ponchon, Thierry

    2016-04-01

    Endoscopic resections have low morbidity and mortality. Delayed bleeding has been reported in approximately 1 - 15 % of cases, increasing with antiplatelet/anticoagulant therapy or portal hypertension. A self-assembling peptide (SAP) forming a gel could protect the mucosal defect during early healing. This retrospective trial aimed to assess the safety and efficacy of SAP in preventing delayed bleeding after endoscopic resections. Consecutive patients with endoscopic resections were enrolled in two tertiary referral centers. Patients with a high risk of bleeding (antiplatelet agents, anticoagulation drugs with heparin bridge therapy, and cirrhosis with portal hypertension) were also included. The SAP gel was applied immediately after resection to cover the whole ulcer bed. In total, 56 patients were included with 65 lesions (esophagus [n = 8], stomach [n = 22], duodenum [n = 10], ampullary [n = 3], colon [n = 7], and rectum [n = 15]) in two centers. Among those 65 lesions, 29 were resected in high risk situations (9 uninterrupted aspirin therapy, 6 heparin bridge therapies, 5 cirrhosis and portal hypertension, 1 both cirrhosis and heparin bridge, 3 both cirrhosis and uninterrupted aspirin, 3 large duodenal lesions > 2 cm, and 2 early introduction of clopidogrel at day 1). The resection technique was endoscopic submucosal dissection (ESD) in 40 cases, en bloc endoscopic mucosal resection (EMR) in 16, piecemeal EMR in 6, and ampullectomy in 3. The mean lesion size was 37.9 mm (SD: 2.2 mm) with a mean area of 6.3 cm(2) (SD: 3.5 cm(2)). No difficulty was noted during application. Four delayed overt bleedings occurred (6.2 %) (3 hematochezia, 1 hematemesis) requiring endoscopic hemostasis. The mean hemoglobin drop off was 0.6 g/dL (- 0.6 to 3.1 g/dL). No adverse events occurred. The use of this novel extracellular matrix scaffold may help to reduce post-endoscopic resection bleedings including in high risk situations

  14. A self-assembling matrix-forming gel can be easily and safely applied to prevent delayed bleeding after endoscopic resections

    Science.gov (United States)

    Pioche, Mathieu; Camus, Marine; Rivory, Jérôme; Leblanc, Sarah; Lienhart, Isabelle; Barret, Maximilien; Chaussade, Stanislas; Saurin, Jean-Christophe; Prat, Frederic; Ponchon, Thierry

    2016-01-01

    Background: Endoscopic resections have low morbidity and mortality. Delayed bleeding has been reported in approximately 1 – 15 % of cases, increasing with antiplatelet/anticoagulant therapy or portal hypertension. A self-assembling peptide (SAP) forming a gel could protect the mucosal defect during early healing. This retrospective trial aimed to assess the safety and efficacy of SAP in preventing delayed bleeding after endoscopic resections. Methods: Consecutive patients with endoscopic resections were enrolled in two tertiary referral centers. Patients with a high risk of bleeding (antiplatelet agents, anticoagulation drugs with heparin bridge therapy, and cirrhosis with portal hypertension) were also included. The SAP gel was applied immediately after resection to cover the whole ulcer bed. Results: In total, 56 patients were included with 65 lesions (esophagus [n = 8], stomach [n = 22], duodenum [n = 10], ampullary [n = 3], colon [n = 7], and rectum [n = 15]) in two centers. Among those 65 lesions, 29 were resected in high risk situations (9 uninterrupted aspirin therapy, 6 heparin bridge therapies, 5 cirrhosis and portal hypertension, 1 both cirrhosis and heparin bridge, 3 both cirrhosis and uninterrupted aspirin, 3 large duodenal lesions > 2 cm, and 2 early introduction of clopidogrel at day 1). The resection technique was endoscopic submucosal dissection (ESD) in 40 cases, en bloc endoscopic mucosal resection (EMR) in 16, piecemeal EMR in 6, and ampullectomy in 3. The mean lesion size was 37.9 mm (SD: 2.2 mm) with a mean area of 6.3 cm2 (SD: 3.5 cm2). No difficulty was noted during application. Four delayed overt bleedings occurred (6.2 %) (3 hematochezia, 1 hematemesis) requiring endoscopic hemostasis. The mean hemoglobin drop off was 0.6 g/dL (– 0.6 to 3.1 g/dL). No adverse events occurred. Conclusion: The use of this novel extracellular matrix scaffold may help to reduce post-endoscopic resection

  15. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome

    DEFF Research Database (Denmark)

    Poulsen, S M; Karlsson, M; Johansson, L B

    2001-01-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs...... centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous...... results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer....

  16. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

    Science.gov (United States)

    Crossland, Hannah; Timmons, James A; Atherton, Philip J

    2017-12-01

    Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

  17. Nuclear fuel assembly

    International Nuclear Information System (INIS)

    Anthony, A.J.

    1980-01-01

    A bimetallic spacer means is cooperatively associated with a nuclear fuel assembly and operative to resist the occurrence of in-reactor bowing of the nuclear fuel assembly. The bimetallic spacer means in one embodiment of the invention includes a space grid formed, at least principally, of zircaloy to the external surface of which are attached a plurality of stainless steel strips. In another embodiment the strips are attached to fuel pins. In each of the embodiments, the stainless steel strips during power production expand outwardly to a greater extent than do the members to which the stainless steel strips are attached, thereby forming stiff springs which abut against like bimetallic spacer means with which the other nuclear fuel assemblies are provided in a given nuclear reactor core to thus prevent the occurrence of in-reactor bowing of the nuclear fuel assemblies. (author)

  18. Fuel Assembly Damping Summary

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Kanghee; Kang, Heungseok; Oh, Dongseok; Yoon, Kyungho; Kim, Hyungkyu; Kim, Jaeyong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2013-10-15

    This paper summary the fuel assembly damping data in air/in still water/under flow, released from foreign fuel vendors, compared our data with the published data. Some technical issues in fuel assembly damping measurement testing are also briefly discussed. Understanding of each fuel assembly damping mechanisms according to the surrounding medium and flow velocity can support the fuel design improvement in fuel assembly dynamics and structural integrity aspect. Because the upgraded requirements of the newly-developed advanced reactor system will demands to minimize fuel design margin in integrity evaluation, reduction in conservatism of fuel assembly damping can contribute to alleviate the fuel design margin for sure. Damping is an energy dissipation mechanism in a vibrating mechanical structure and prevents a resonant structure from having infinite vibration amplitudes. The sources of fuel assembly damping are various from support friction to flow contribution, and it can be increased by the viscosity or drag of surrounding fluid medium or the average velocity of water flowing. Fuel licensing requires fuel design evaluation in transient or accidental condition. Dynamic response analysis of fuel assembly is to show fuel integrity and requires information on assembly-wise damping in dry condition and under wet or water flowing condition. However, damping measurement test for the full-scale fuel assembly prototype is not easy to carry out because of the scale (fuel prototype, test facility), unsteadiness of test data (scattering, random sampling and processing), instrumentation under water flowing (water-proof response measurement), and noise. LWR fuel technology division in KAERI is preparing the infra structure for damping measurement test of full-scale fuel assembly, to support fuel industries and related research activities. Here is a preliminary summary of fuel assembly damping, published in the literature. Some technical issues in fuel assembly damping

  19. Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen

    2008-01-01

    indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

  20. RIBOSOMAL COMPLEX IN PROPHYLAXIS AND TREATMENT OF ACUTE RESPIRATORY INFECTIONS IN CHILDREN

    Directory of Open Access Journals (Sweden)

    A.A. Alekseeva

    2010-01-01

    Full Text Available Acute respiratory infections (ARI are widespread in children regardless of age and region of living; they are characterized with big amount of infectious agents and absence of a trend to morbidity decrease. Drugs for nonspecific prophylaxis (immunostimulators and immunomodulatory agents are frequently used for prevention of ARI. There are plenty of immunomodulating agents; the wellstudied medication with systemic action with good efficacy and safety in pediatric practice is ribosomal-proteoglycan complex. The article presents the description of clinical experience of treatment with this complex in pediatric practice.Key words: children, acute respiratory infections, prophylaxis, treatment, ribosomal complex.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2010;9(6:127-130

  1. CLINICAL CASE OF TREATMENT WITH RIBOSOMAL COMPLEX IN CHILD WITH COMPROMISED IMMUNITY

    Directory of Open Access Journals (Sweden)

    A.A. Alekseeva

    2011-01-01

    Full Text Available The leading pathology in children is acute respiratory infections (ARI according to the expert data of WHO. The incidence of prolonged and recurrent types of ARI increases during recent years. Patients with these diseases subsequently form the group of children with compromised immunity. Immunogens and immunomodulators are the drugs of nonspecific prophylaxis which are used for the prevention of ARI. The group of bacterial immunomodulators is big but most well-studied systemic drug from this group is Ribomunyl. Ribosomal complex is effective and safe in pediatric practice. The article presents the clinical case of treatment with ribosomal complex in immunocompronised child with allergic pathology.Key words: children with compromised immunity, allergy, acute respiratory infections, treatment.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2011; 10 (2: 211–215

  2. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)

    Madhu

    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  3. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  4. Proto-ribosome: a theoretical approach based on RNA relics

    OpenAIRE

    Demongeot, Jacques

    2017-01-01

    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  5. Off-pathway assembly of fimbria subunits is prevented by chaperone CfaA of CFA/I fimbriae from enterotoxigenic E. coli.

    Science.gov (United States)

    Bao, Rui; Liu, Yang; Savarino, Stephen J; Xia, Di

    2016-12-01

    The assembly of the class 5 colonization factor antigen I (CFA/I) fimbriae of enterotoxigenic E. coli was proposed to proceed via the alternate chaperone-usher pathway. Here, we show that in the absence of the chaperone CfaA, CfaB, the major pilin subunit of CFA/I fimbriae, is able to spontaneously refold and polymerize into cyclic trimers. CfaA kinetically traps CfaB to form a metastable complex that can be stabilized by mutations. Crystal structure of the stabilized complex reveals distinctive interactions provided by CfaA to trap CfaB in an assembly competent state through donor-strand complementation (DSC) and cleft-mediated anchorage. Mutagenesis indicated that DSC controls the stability of the chaperone-subunit complex and the cleft-mediated anchorage of the subunit C-terminus additionally assist in subunit refolding. Surprisingly, over-stabilization of the chaperone-subunit complex led to delayed fimbria assembly, whereas destabilizing the complex resulted in no fimbriation. Thus, CfaA acts predominantly as a kinetic trap by stabilizing subunit to avoid its off-pathway self-polymerization that results in energetically favorable trimers and could serve as a driving force for CFA/I pilus assembly, representing an energetic landscape unique to class 5 fimbria assembly. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Molecular Microbiology published by John Wiley & Sons Ltd.

  6. Deciphering the role of the Gag-Pol ribosomal frameshift signal in HIV-1 RNA genome packaging.

    Science.gov (United States)

    Nikolaitchik, Olga A; Hu, Wei-Shau

    2014-04-01

    A key step of retroviral replication is packaging of the viral RNA genome during virus assembly. Specific packaging is mediated by interactions between the viral protein Gag and elements in the viral RNA genome. In HIV-1, similar to most retroviruses, the packaging signal is located within the 5' untranslated region and extends into the gag-coding region. A recent study reported that a region including the Gag-Pol ribosomal frameshift signal plays an important role in HIV-1 RNA packaging; deletions or mutations that affect the RNA structure of this signal lead to drastic decreases (10- to 50-fold) in viral RNA packaging and virus titer. We examined here the role of the ribosomal frameshift signal in HIV-1 RNA packaging by studying the RNA packaging and virus titer in the context of proviruses. Three mutants with altered ribosomal frameshift signal, either through direct deletion of the signal, mutation of the 6U slippery sequence, or alterations of the secondary structure were examined. We found that RNAs from all three mutants were packaged efficiently, and they generate titers similar to that of a virus containing the wild-type ribosomal frameshift signal. We conclude that although the ribosomal frameshift signal plays an important role in regulating the replication cycle, this RNA element is not directly involved in regulating RNA encapsidation. To generate infectious viruses, HIV-1 must package viral RNA genome during virus assembly. The specific HIV-1 genome packaging is mediated by interactions between the structural protein Gag and elements near the 5' end of the viral RNA known as packaging signal. In this study, we examined whether the Gag-Pol ribosomal frameshift signal is important for HIV-1 RNA packaging as recently reported. Our results demonstrated that when Gag/Gag-Pol is supplied in trans, none of the tested ribosomal frameshift signal mutants has defects in RNA packaging or virus titer. These studies provide important information on how HIV-1

  7. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel

    2017-07-01

    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  8. Macrolide antibiotic interaction and resistance on the bacterial ribosome.

    Science.gov (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen

    2003-02-01

    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  9. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  10. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.

    1977-01-01

    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

  11. Technology for assembling and welding of top and bottom nozzles in fuel assembly

    International Nuclear Information System (INIS)

    Xia Chenglie; Wan Longfu

    1989-10-01

    The construction character, technology and sequence of assembling and welding, assembling jig used for preventing from deformation, and acceptance test of welding technology for top and bottom nozzles are presented

  12. WHO: World Health Assembly.

    Science.gov (United States)

    McGregor, A

    1992-05-23

    1200 delegates from 175 member countries attended the 45th World Health Assembly in Geneva. Everyone at the Assembly ratified measures to prevent and control AIDS. 12 countries intended to do long term planning for community based care for AIDS patients. Further the Assembly denounced instances where countries and individuals denied the gravity of the AIDS pandemic. In fact, it expressed the importance for urgent and intensive action against HIV/AIDS. The assembly backed proposals to prevent and control sexually transmitted diseases that affect AIDS patients, especially hepatitis B. For example, in countries with hepatitis B prevalence 8% (many countries in Sub-Sahara Africa, Asia, the Pacific region, and South America), health officials should introduce hepatitis B vaccine into their existing immunization programs by 1995. By 1997, this vaccine should be part of all immunization programs. The Assembly was aware of the obstacles of establishing reliable cold chains for nationwide distribution, however. Delegates in Committee A objected to the fact that 50% of the populations of developing countries continued to have limited access to essential drugs. They also expressed disapproval in implementation of WHO's 1988 ethical criteria for promotion of drugs which WHO entrusted to the Council for International Organisations of Medical Sciences (CIOMS). CIOMS lacked WHO's status and thus could not effectively monitor drug advertising. In fact, the pharmaceutical industry as well as WHO provided the funds for a meeting of 25 experts to discuss principles included in the ethical criteria. At least 4 countries insisted that WHO have the ultimate authority in monitoring drug advertising. Delegates did adopt a compromise resolution on this topic which required that industry promotion methods be reported to the 1994 Assembly via the Executive Board. The Assembly requested WHO to establish an international advisory committee on nursing and midwifery and to improve the network of

  13. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.

    1977-01-01

    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  14. Fuel assembly reconstitution

    International Nuclear Information System (INIS)

    Morgado, Mario M.; Oliveira, Monica G.N.; Ferreira Junior, Decio B.M.; Santos, Barbara O. dos; Santos, Jorge E. dos

    2009-01-01

    Fuel failures have been happened in Nuclear Power Plants worldwide, without lost of integrity and safety, mainly for the public, environment and power plants workers. The most common causes of these events are corrosion (CRUD), fretting and pellet cladding interaction. These failures are identified by increasing the activity of fission products, verified by chemical analyses of reactor coolant. Through these analyses, during the fourth operation cycle of Angra 2 Nuclear Power Plant, was possible to observe fuel failure indication. This indication was confirmed in the end of the cycle during the unloading of reactor core through leakage tests of fuel assembly, using the equipment called 'In Mast Sipping' and 'Box Sipping'. After confirmed, the fuel assembly reconstitution was scheduled, and happened in April, 2007, where was identified the cause and the fuel rod failure, which was substitute by dummy rods (zircaloy). The cause was fretting by 'debris'. The actions to avoid and prevent fuel assemblies failures are important. The goals of this work are to describe the methodology of fuel assembly reconstitution using the FARE (Fuel Assembly Reconstitution Equipment) system, to describe the results of this task in economic and security factors of the company and show how the fuel assembly failures are identified during operation and during the outage. (author)

  15. Fuel assembly in a reactor

    International Nuclear Information System (INIS)

    Saito, Shozo; Kawahara, Akira.

    1975-01-01

    Object: To provide a fuel assembly in a reactor which can effectively prevent damage of the clad tube caused by mutual interference between pellets and the clad tube. Structure: A clad tube for a fuel element, which is located in the outer peripheral portion, among the fuel elements constituting fuel assemblies arranged in assembled and lattice fashion within a channel box, is increased in thickness by reducing the inside diameter thereof to be smaller than that of fuel elements internally located, thereby preventing damage of the clad tube resulting from rapid rise in output produced when control rods are removed. (Kamimura, M.)

  16. Neutron detector assembly

    International Nuclear Information System (INIS)

    Hanai, Koi; Shirayama, Shinpei.

    1978-01-01

    Purpose: To prevent gamma-ray from leaking externally passing through the inside of a neutron detector assembly. Constitution: In a neutron detector assembly having a protection pipe formed with an enlarged diameter portion which serves also as a spacer, partition plates with predetermined width are disposed at the upper and the lower portions in this expanded portion. A lot of metal particles are filled into spaces formed by the partition plates. In such a structure, the metal particles well-absorb the gamma-rays from above and convert them into heat to provide shielding for the gamma-rays. (Horiuchi, T.)

  17. A comparison of structural and evolutionary attributes of Escherichia coli and Thermus thermophilus small ribosomal subunits: signatures of thermal adaptation.

    Directory of Open Access Journals (Sweden)

    Saurav Mallik

    Full Text Available Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU. Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend.

  18. Nuclear fuel assembly

    International Nuclear Information System (INIS)

    Hayashi, Hiroshi; Watari, Yoshio; Hizahara, Hiroshi; Masuoka, Ryuzo.

    1970-01-01

    When exchanging nuclear fuel assemblies during the operation of a nuclear reactor, melting of fuel bodies, and severence of tubular claddings is halted at the time of insertion by furnishing a neutron absorbing material such as B 10 , Cd, Gd or the like at the forward end of the fuel assembly to thereby lower the power peak at the forward ends of the fuel elements to within tolerable levels and thus prevent both fuel liquification and excessive expansion. The neutron absorbing material may be attached in the form of a plate to the fuel assembly forward tie plate, or may be inserted as a pellet into the front end of the tubular cladding. (Owens, K.J.)

  19. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige

    2015-09-01

    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  20. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.

    1988-01-01

    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  1. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Galas, D J; Branscomb, E W

    1976-08-12

    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  2. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.

    2009-01-01

    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  3. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Directory of Open Access Journals (Sweden)

    Joseph C Sanchez

    2017-10-01

    Full Text Available A form of dwarfism known as Meier-Gorlin syndrome (MGS is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5. These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45. The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C. We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  4. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Science.gov (United States)

    Sanchez, Joseph C; Kwan, Elizabeth X; Pohl, Thomas J; Amemiya, Haley M; Raghuraman, M K; Brewer, Bonita J

    2017-10-01

    A form of dwarfism known as Meier-Gorlin syndrome (MGS) is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5). These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45). The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C). We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA) locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  5. Fuel assembly inspection device

    International Nuclear Information System (INIS)

    Yaginuma, Yoshitaka

    1998-01-01

    The present invention provides a device suitable to inspect appearance of fuel assemblies by photographing the appearance of fuel assemblies. Namely, the inspection device of the present invention measures bowing of fuel assembly or each of fuel rods or both of them based on the partially photographed images of fuel assembly. In this case, there is disposed a means which flashily projects images in the form of horizontal line from a direction intersecting obliquely relative to a horizontal cross section of the fuel assembly. A first image processing means separates the projected image pictures including projected images and calculates bowing. A second image processing means replaces the projected image pictures of the projected images based on projected images just before and after the photographing. Then, images for the measurement of bowing and images for inspection can be obtained simultaneously. As a result, the time required for the photographing can be shortened, the time for inspection can be shortened and an effect of preventing deterioration of photographing means by radiation rays can be provided. (I.S.)

  6. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  7. Fuel assembly

    International Nuclear Information System (INIS)

    Abe, Hideaki; Sakai, Takao; Ishida, Tomio; Yokota, Norikatsu.

    1992-01-01

    The lower ends of a plurality of plate-like shape memory alloys are secured at the periphery of the upper inside of the handling head of a fuel assembly. As the shape memory alloy, a Cu-Zn alloy, a Ti-Pd alloy or a Fe-Ni alloy is used. When high temperature coolants flow out to the handling head, the shape memory alloy deforms by warping to the outer side more greatly toward the upper portion thereof with the temperature increase of the coolants. As the result, the shape of the flow channel of the coolants is changed so as to enlarge at the exit of the upper end of the fuel assembly. Then, the pressure loss of the coolants in the fuel assembly is decreased by the enlargement. Accordingly, the flow rate of the coolants in the fuel assembly is increased to lower the temperature of the coolants. Further, high temperature coolants and low temperature coolants are mixed sufficiently just above the fuel assembly. This can suppress the temperature fluctuation of the mixed coolants in the upper portion of the reactor core, thereby enabling to decrease a fatigue and failures of the structural components in the upper portion of the reactor core. (I.N.)

  8. Connecting the kinetics and energy landscape of tRNA translocation on the ribosome.

    Directory of Open Access Journals (Sweden)

    Paul C Whitford

    Full Text Available Functional rearrangements in biomolecular assemblies result from diffusion across an underlying energy landscape. While bulk kinetic measurements rely on discrete state-like approximations to the energy landscape, single-molecule methods can project the free energy onto specific coordinates. With measures of the diffusion, one may establish a quantitative bridge between state-like kinetic measurements and the continuous energy landscape. We used an all-atom molecular dynamics simulation of the 70S ribosome (2.1 million atoms; 1.3 microseconds to provide this bridge for specific conformational events associated with the process of tRNA translocation. Starting from a pre-translocation configuration, we identified sets of residues that collectively undergo rotary rearrangements implicated in ribosome function. Estimates of the diffusion coefficients along these collective coordinates for translocation were then used to interconvert between experimental rates and measures of the energy landscape. This analysis, in conjunction with previously reported experimental rates of translocation, provides an upper-bound estimate of the free-energy barriers associated with translocation. While this analysis was performed for a particular kinetic scheme of translocation, the quantitative framework is general and may be applied to energetic and kinetic descriptions that include any number of intermediates and transition states.

  9. Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA

    Energy Technology Data Exchange (ETDEWEB)

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

    2007-01-01

    Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.

  10. DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

    Science.gov (United States)

    Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

    2016-04-01

    RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

  11. Fuel assemblies

    International Nuclear Information System (INIS)

    Nagano, Mamoru; Yoshioka, Ritsuo

    1983-01-01

    Purpose: To effectively utilize nuclear fuels by increasing the reactivity of a fuel assembly and reduce the concentration at the central region thereof upon completion of the burning. Constitution: A fuel assembly is bisected into a central region and a peripheral region by disposing an inner channel box within a channel box. The flow rate of coolants passing through the central region is made greater than that in the peripheral region. The concentration of uranium 235 of the fuel rods in the central region is made higher. In such a structure, since the moderating effect in the central region is improved, the reactivity of the fuel assembly is increased and the uranium concentration in the central region upon completion of the burning can be reduced, fuel economy and effective utilization of uranium can be attained. (Kamimura, M.)

  12. Roles of Transcriptional and Translational Control Mechanisms in Regulation of Ribosomal Protein Synthesis in Escherichia coli.

    Science.gov (United States)

    Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L

    2017-11-01

    Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In

  13. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M

    1972-01-01

    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  14. Nuclear fuel assemblies and fuel pins usable in such assemblies

    International Nuclear Information System (INIS)

    Jolly, R.

    1982-01-01

    A novel end cap for a nuclear fuel assembly is described in detail. It consists of a trisection arrangement which is received within a cell of a cellular grid. The cell contains abutment means with which the trisection comes into abutment. The grid also contains an abutment means for preventing the trisections from being inserted into the cell in an incorrect orientation. The present design allows fuel pins to be securely held in a hold-down grid of a sub-assembly. The design also allows easier dis-assembly of the swollen and embrittled fuel pins prior to reprocessing. (U.K.)

  15. Prevention of passive film breakdown on iron in a borate buffer solution containing chloride ion by coverage with a self-assembled monolayer of hexadecanoate ion

    International Nuclear Information System (INIS)

    Aramaki, Kunitsugu; Shimura, Tadashi

    2003-01-01

    Breakdown of a passive film on iron in a borate buffer solution (pH 8.49) containing 0.1 M of Cl - was suppressed by coverage of the passive film surface with a self-assembled monolayer (SAM) of hexadecanoate ion C 15 H 31 CO 2 - (C 16 A - ). The pitting potential of an iron electrode previously passivated in the borate buffer at 0.50 V/SCE increased by treatment in an aqueous solution of sodium hexadecanoate for many hours, indicating protection of the passive film from breakdown caused by an attack on defects of the film with Cl - . No breakdown occurred over the potential range of the passive region by coverage with the SAM of C 16 A - in some cases. Structures of the passive film and the monolayer were characterized by X-ray photoelectron and Fourier transform infrared reflection spectroscopies and contact angle measurement with a drop of water

  16. Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients

    OpenAIRE

    Gu, Bai-Wei; Apicella, Marisa; Mills, Jason; Fan, Jian-Meng; Reeves, Dara A.; French, Deborah; Podsakoff, Gregory M.; Bessler, Monica; Mason, Philip J.

    2015-01-01

    Dyskeratosis congenita (DC) is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosom...

  17. Fuel assembly

    International Nuclear Information System (INIS)

    Gjertsen, R.K.; Bassler, E.A.; Huckestein, E.A.; Salton, R.B.; Tower, S.N.

    1988-01-01

    A fuel assembly adapted for use with a pressurized water nuclear reactor having capabilities for fluid moderator spectral shift control is described comprising: parallel arranged elongated nuclear fuel elements; means for providing for axial support of the fuel elements and for arranging the fuel elements in a spaced array; thimbles interspersed among the fuel elements adapted for insertion of a rod control cluster therewithin; means for structurally joining the fuel elements and the guide thimbles; fluid moderator control means for providing a volume of low neutron absorbing fluid within the fuel assembly and for removing a substantially equivalent volume of reactor coolant water therefrom, a first flow manifold at one end of the fuel assembly sealingly connected to a first end of the moderator control tubes whereby the first ends are commonly flow connected; and a second flow manifold, having an inlet passage and an outlet passage therein, sealingly connected to a second end of the moderator control tubes at a second end of the fuel assembly

  18. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  19. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

    Science.gov (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2017-07-05

    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  20. Ribosomes slide on lysine-encoding homopolymeric A stretches

    Science.gov (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637

  1. The Phosphorylation of Ribosomal Protein in Lemna minor

    Science.gov (United States)

    Trewavas, A.

    1973-01-01

    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  2. Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

    Science.gov (United States)

    Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

    2005-11-01

    Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

  3. Structural Studies of RNA Helicases Involved in Eukaryotic Pre-mRNA Splicing, Ribosome Biogenesis, and Translation Initiation

    DEFF Research Database (Denmark)

    He, Yangzi

    and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...

  4. Human C4orf14 interacts with the mitochondrial nucleoid and is involved in the biogenesis of the small mitochondrial ribosomal subunit.

    Science.gov (United States)

    He, J; Cooper, H M; Reyes, A; Di Re, M; Kazak, L; Wood, S R; Mao, C C; Fearnley, I M; Walker, J E; Holt, I J

    2012-07-01

    The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle.

  5. Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

    Directory of Open Access Journals (Sweden)

    Anirban Chakraborty

    Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

  6. Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate

    Science.gov (United States)

    Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

    2016-01-01

    Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes. PMID:27557515

  7. Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate.

    Science.gov (United States)

    Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

    2016-09-27

    Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes.

  8. Fuel assembly for a nuclear reactor

    International Nuclear Information System (INIS)

    Gjertsen, R.K.

    1982-01-01

    A fuel assembly in a nuclear reactor comprises a locking mechanism that is capable of locking the fuel assembly to the core plate of a nuclear reactor to prevent inadvertent movement of the fuel assembly. The locking mechanism comprises a ratchet mechanism 108 that allows the fuel assembly to be easily locked to the core plate but prevents unlocking except when the ratchet is disengaged. The ratchet mechanism is coupled to the locking mechanism by a rotatable guide tube for a control rod or water displacer rod. (author)

  9. Phyllanthus emblica Fruit Extract Activates Spindle Assembly Checkpoint, Prevents Mitotic Aberrations and Genomic Instability in Human Colon Epithelial NCM460 Cells

    Directory of Open Access Journals (Sweden)

    Xihan Guo

    2016-09-01

    Full Text Available The fruit of Phyllanthus emblica Linn. (PE has been widely consumed as a functional food and folk medicine in Southeast Asia due to its remarkable nutritional and pharmacological effects. Previous research showed PE delays mitotic progress and increases genomic instability (GIN in human colorectal cancer cells. This study aimed to investigate the similar effects of PE by the biomarkers related to spindle assembly checkpoint (SAC, mitotic aberrations and GIN in human NCM460 normal colon epithelial cells. Cells were treated with PE and harvested differently according to the biomarkers observed. Frequencies of micronuclei (MN, nucleoplasmic bridge (NPB and nuclear bud (NB in cytokinesis-block micronucleus assay were used as indicators of GIN. Mitotic aberrations were assessed by the biomarkers of chromosome misalignment, multipolar division, chromosome lagging and chromatin bridge. SAC activity was determined by anaphase-to- metaphase ratio (AMR and the expression of core SAC gene budding uninhibited by benzimidazoles related 1 (BubR1. Compared with the control, PE-treated cells showed (1 decreased incidences of MN, NPB and NB (p < 0.01; (2 decreased frequencies of all mitotic aberration biomarkers (p < 0.01; and (3 decreased AMR (p < 0.01 and increased BubR1 expression (p < 0.001. The results revealed PE has the potential to protect human normal colon epithelial cells from mitotic and genomic damages partially by enhancing the function of SAC.

  10. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research.

    Science.gov (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E

    2017-01-01

    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  11. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka

    2012-01-01

    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  12. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  13. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    Science.gov (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-04

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.

    2016-01-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  15. Structural basis for precursor protein-directed ribosomal peptide macrocyclization.

    Science.gov (United States)

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D

    2016-11-01

    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  16. Fuel assembly

    International Nuclear Information System (INIS)

    Yokota, Tokunobu.

    1990-01-01

    A fuel assembly used in a FBR type nuclear reactor comprises a plurality of fuel rods and a moderator guide member (water rod). A moderator exit opening/closing mechanism is formed at the upper portion of the moderator guide member for opening and closing a moderator exit. In the initial fuel charging operation cycle to the reactor, the moderator exit is closed by the moderator exit opening/closing mechanism. Then, voids are accumulated at the inner upper portion of the moderator guide member to harden spectrum and a great amount of plutonium is generated and accumulated in the fuel assembly. Further, in the fuel re-charging operation cycle, the moderator guide member is used having the moderator exit opened. In this case, voids are discharged from the moderator guide member to decrease the ratio, and the plutonium accumulated in the initial charging operation cycle is burnt. In this way, the fuel economy can be improved. (I.N.)

  17. Fuel assemblies

    International Nuclear Information System (INIS)

    Echigoya, Hironori; Nomata, Terumitsu.

    1983-01-01

    Purpose: To render the axial distribution relatively flat. Constitution: First nuclear element comprises a fuel can made of zircalloy i.e., the metal with less neutron absorption, which is filled with a plurality of UO 2 pellets and sealed by using a lower end plug, a plenum spring and an upper end plug by means of welding. Second fuel element is formed by substituting a part of the UO 2 pellets with a water tube which is sealed with water and has a space for allowing the heat expansion. The nuclear fuel assembly is constituted by using the first and second fuel elements together. In such a structure, since water reflects neutrons and decrease their leakage to increase the temperature, reactivity is added at the upper portion of the fuel assembly to thereby flatten the axial power distribution. Accordingly, stable operation is possible only by means of deep control rods while requiring no shallow control rods. (Sekiya, K.)

  18. Fuel assembly

    International Nuclear Information System (INIS)

    Kawai, Mitsuo.

    1988-01-01

    Purpose: To reduce the corrosion rate and suppress the increase of radioactive corrosion products in reactor water of nuclear fuel assemblies for use in BWR type reactors having spacer springs made of nickel based deposition reinforced type alloys. Constitution: Spacer rings made of nickel based deposition reinforced type alloy are incorporated and used as fuel assemblies after applying treatment of dipping and maintaining at high temperature water followed by heating in steams. Since this can remove the nickel leaching into reactor water at the initial stage, Co-58 as the radioactive corrosion products in the reactor water can be reduced, and the operation at in-service inspection or repairement can be facilitated to improve the working efficiency of the nuclear power plant. The dipping time is desirably more than 10 hours and more desirably more than 30 hours. (Horiuchi, T. )

  19. Fuel assembly

    International Nuclear Information System (INIS)

    Watanabe, Shoichi; Hirano, Yasushi.

    1998-01-01

    A one-half or more of entire fuel rods in a fuel assembly comprises MOX fuel rods containing less than 1wt% of burnable poisons, and at least a portion of the burnable poisons comprises gadolinium. Then, surplus reactivity at an initial stage of operation cycle is controlled to eliminate burnable poisons remained unburnt at a final stage, as well as increase thermal reactivity. In addition, the content of fission plutonium is determined to greater than the content of uranium 235, and fuel rods at corner portions are made not to incorporate burnable poisons. Fuel rods not containing burnable poisons are disposed at positions in adjacent with fuel rods facing to a water rod at one or two directions. Local power at radial center of the fuel assembly is increased to flatten the distortion of radial power distribution. (N.H.)

  20. General Assembly

    CERN Multimedia

    Staff Association

    2016-01-01

    5th April, 2016 – Ordinary General Assembly of the Staff Association! In the first semester of each year, the Staff Association (SA) invites its members to attend and participate in the Ordinary General Assembly (OGA). This year the OGA will be held on Tuesday, April 5th 2016 from 11:00 to 12:00 in BE Auditorium, Meyrin (6-2-024). During the Ordinary General Assembly, the activity and financial reports of the SA are presented and submitted for approval to the members. This is the occasion to get a global view on the activities of the SA, its financial management, and an opportunity to express one’s opinion, including taking part in the votes. Other points are listed on the agenda, as proposed by the Staff Council. Who can vote? Only “ordinary” members (MPE) of the SA can vote. Associated members (MPA) of the SA and/or affiliated pensioners have a right to vote on those topics that are of direct interest to them. Who can give his/her opinion? The Ordinary General Asse...

  1. Fuel assembly

    International Nuclear Information System (INIS)

    Ueda, Sei; Ando, Ryohei; Mitsutake, Toru.

    1995-01-01

    The present invention concerns a fuel assembly suitable to a BWR-type reactor and improved especially with the nuclear characteristic, heat performance, hydraulic performance, dismantling or assembling performance and economical property. A part of poison rods are formed as a large-diameter/multi-region poison rods having a larger diameter than a fuel rod. A large number of fuel rods are disposed surrounding a large diameter water rod and a group of the large-diameter/multi-region poison rods in adjacent with the water rod. The large-diameter water rod has a burnable poison at the tube wall portion. At least a portion of the large-diameter poison rods has a coolant circulation portion allowing coolants to circulate therethrough. Since the large-diameter poison rods are disposed at a position of high neutron fluxes, a large neutron multiplication factor suppression effect can be provided, thereby enabling to reduce the number of burnable poison rods relative to fuels. As a result, power peaking in the fuel assembly is moderated and a greater amount of plutonium can be loaded. In addition the flow of cooling water which tends to gather around the large diameter water rod can be controlled to improve cooling performance of fuels. (N.H.)

  2. A streamlined ribosome profiling protocol for the characterization of microorganisms

    DEFF Research Database (Denmark)

    Latif, Haythem; Szubin, Richard; Tan, Justin

    2015-01-01

    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...

  3. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  4. Nuclear fuel assembly

    International Nuclear Information System (INIS)

    Takeda, Tadashi; Sato, Kenji; Goto, Masakazu.

    1984-01-01

    Purpose: To facilitate identification of a fuel assembly upon fuel exchange in BWR type reactors. Constitution: Fluorescent material is coated or metal plating is applied to the impressed portion of a upper tie plate handle of a fuel assembly, and the fluorescent material or the metal plating surface is covered with a protective membrane made of transparent material. This enables to distinguish the impressed surface from a distant place and chemical reaction between the impressed surface and the reactor water can be prevented. Furthermore, since the protective membrane is formed such that it protrudes toward the upper side relative to the impressed surface, there is no risk of depositions of claddings thereover. (Moriyama, K.)

  5. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution

    Science.gov (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad

    2013-01-01

    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  6. Initial bridges between two ribosomal subunits are formed within 9.4 milliseconds, as studied by time-resolved cryo-EM.

    Science.gov (United States)

    Shaikh, Tanvir R; Yassin, Aymen S; Lu, Zonghuan; Barnard, David; Meng, Xing; Lu, Toh-Ming; Wagenknecht, Terence; Agrawal, Rajendra K

    2014-07-08

    Association of the two ribosomal subunits during the process of translation initiation is a crucial step of protein synthesis. The two subunits (30S and 50S) of the bacterial 70S ribosome are held together by 12 dynamic bridges involving RNA-RNA, RNA-protein, and protein-protein interactions. The process of bridge formation, such as whether all these bridges are formed simultaneously or in a sequential order, is poorly understood. To understand such processes, we have developed and implemented a class of microfluidic devices that mix two components to completion within 0.4 ms and spray the mixture in the form of microdroplets onto an electron microscopy grid, yielding a minimum reaction time of 9.4 ms before cryofixation. Using these devices, we have obtained cryo-EM data corresponding to reaction times of 9.4 and 43 ms and have determined 3D structures of ribosomal subunit association intermediates. Molecular analyses of the cryo-EM maps reveal that eight intersubunit bridges (bridges B1a, B1b, B2a, B2b, B3, B7a, B7b, and B8) form within 9.4 ms, whereas the remaining four bridges (bridges B2c, B4, B5, and B6) take longer than 43 ms to form, suggesting that bridges are formed in a stepwise fashion. Our approach can be used to characterize sequences of various dynamic functional events on complex macromolecular assemblies such as ribosomes.

  7. Fuel assembly

    International Nuclear Information System (INIS)

    Fujibayashi, Toru.

    1970-01-01

    Herein disclosed is a fuel assembly in which a fuel rod bundle is easily detachable by rotating a fuel rod fastener rotatably mounted to the upper surface of an upper tie-plate supporting a fuel bundle therebelow. A locking portion at the leading end of each fuel rod protrudes through the upper tie-plate and is engaged with or separated from the tie-plate by the rotation of the fastener. The removal of a desired fuel rod can therefore be remotely accomplished without the necessity of handling pawls, locking washers and nuts. (Owens, K.J.)

  8. Assembling consumption

    DEFF Research Database (Denmark)

    Assembling Consumption marks a definitive step in the institutionalisation of qualitative business research. By gathering leading scholars and educators who study markets, marketing and consumption through the lenses of philosophy, sociology and anthropology, this book clarifies and applies...... the investigative tools offered by assemblage theory, actor-network theory and non-representational theory. Clear theoretical explanation and methodological innovation, alongside empirical applications of these emerging frameworks will offer readers new and refreshing perspectives on consumer culture and market...... societies. This is an essential reading for both seasoned scholars and advanced students of markets, economies and social forms of consumption....

  9. Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

    African Journals Online (AJOL)

    The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

  10. The ribosome-associated complex antagonizes prion formation in yeast.

    Science.gov (United States)

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  11. Ribosomal DNA internal transcribed spacer 1 and internal ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

  12. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  13. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  14. Expression of a ribosome inactivating protein (curcin 2) in Jatropha ...

    Indian Academy of Sciences (India)

    Unknown

    mechanisms employed by a number of higher-plant species involve defensive ... of RIPs in the same plant species. ..... Lam C J, Ryals J A, Ward E R and Dixon R A 1992 Emerging ... against insect pests and diseases of plants: ribosome in-.

  15. Protein folding on the ribosome studied using NMR spectroscopy

    Science.gov (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  16. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

    1997-01-01

    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  17. Kinase Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

    Science.gov (United States)

    2017-02-01

    CK1delta/epsilon) inhibitors with potent antiproliferative properties. Bioorganic & medicinal chemistry letters 23, 4374-4380, doi:10.1016/j.bmcl...Autophagy 3. ACCOMPLISHMENTS Major Goals and Accomplishments Given the clear evolutionary selection against CRSIPR/cas9-directed Ltv1-deficient

  18. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2012-05-01

    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  19. Bridging Type 2 Diabetes and Alzheimer's Disease: Assembling the Puzzle Pieces in the Quest for the Molecules With Therapeutic and Preventive Potential.

    Science.gov (United States)

    de Matos, Ana Marta; de Macedo, Maria Paula; Rauter, Amélia Pilar

    2018-01-01

    Type 2 diabetes (T2D) and Alzheimer's disease (AD) are two age-related amyloid diseases that affect millions of people worldwide. Broadly supported by epidemiological data, the higher incidence of AD among type 2 diabetic patients led to the recognition of T2D as a tangible risk factor for the development of AD. Indeed, there is now growing evidence on brain structural and functional abnormalities arising from brain insulin resistance and deficiency, ultimately highlighting the need for new approaches capable of preventing the development of AD in type 2 diabetic patients. This review provides an update on overlapping pathophysiological mechanisms and pathways in T2D and AD, such as amyloidogenic events, oxidative stress, endothelial dysfunction, aberrant enzymatic activity, and even shared genetic background. These events will be presented as puzzle pieces put together, thus establishing potential therapeutic targets for drug discovery and development against T2D and diabetes-induced cognitive decline-a heavyweight contributor to the increasing incidence of dementia in developed countries. Hoping to pave the way in this direction, we will present some of the most promising and well-studied drug leads with potential against both pathologies, including their respective bioactivity reports, mechanisms of action, and structure-activity relationships. © 2017 Wiley Periodicals, Inc.

  20. Shaft seal assembly and method

    Science.gov (United States)

    Keba, John E. (Inventor)

    2007-01-01

    A pressure-actuated shaft seal assembly and associated method for controlling the flow of fluid adjacent a rotatable shaft are provided. The seal assembly includes one or more seal members that can be adjusted between open and closed positions, for example, according to the rotational speed of the shaft. For example, the seal member can be configured to be adjusted according to a radial pressure differential in a fluid that varies with the rotational speed of the shaft. In addition, in the closed position, each seal member can contact a rotatable member connected to the shaft to form a seal with the rotatable member and prevent fluid from flowing through the assembly. Thus, the seal can be closed at low speeds of operation and opened at high speeds of operation, thereby reducing the heat and wear in the seal assembly while maintaining a sufficient seal during all speeds of operation.

  1. Linezolid-induced lactic acidosis: the thin line between bacterial and mitochondrial ribosomes.

    Science.gov (United States)

    Santini, Alessandro; Ronchi, Dario; Garbellini, Manuela; Piga, Daniela; Protti, Alessandro

    2017-07-01

    Linezolid inhibits bacterial growth by targeting bacterial ribosomes and by interfering with bacterial protein synthesis. Lactic acidosis is a rare, but potentially lethal, side effect of linezolid. Areas covered: The pathogenesis of linezolid-induced lactic acidosis is reviewed with special emphasis on aspects relevant to the recognition, prevention and treatment of the syndrome. Expert opinion: Linezolid-induced lactic acidosis reflects the untoward interaction between the drug and mitochondrial ribosomes. The inhibition of mitochondrial protein synthesis diminishes the respiratory chain enzyme content and thus limits aerobic energy production. As a result, anaerobic glycolysis and lactate generation accelerate independently from tissue hypoxia. In the absence of any confirmatory test, linezolid-induced lactic acidosis should be suspected only after exclusion of other, more common, causes of lactic acidosis such as hypoxemia, anemia or low cardiac output. Normal-to-high whole-body oxygen delivery, high venous oxygen saturation and lack of response to interventions that effectively increase tissue oxygen provision all suggest a primary defect in oxygen use at the mitochondrial level. During prolonged therapy with linezolid, blood drug and lactate levels should be regularly monitored. The current standard-of-care treatment of linezolid-induced lactic acidosis consists of drug withdrawal to reverse mitochondrial intoxication and intercurrent life support.

  2. Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.

    Science.gov (United States)

    Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V

    2007-04-01

    During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.

  3. A pulse radiolysis investigation of the interactions of drugs and dyes with macromolecules and ribosomes

    International Nuclear Information System (INIS)

    Phillips, G.O.; Power, D.M.; Davies, J.V.

    1975-01-01

    The reactions of hydrated electrons produced during pulse radiolysis have been utilized to investigate the binding of eleven penicillins and four cephalosporins to bovine serum albumin. A primary binding site exists in the serum albumin molecule, which results indicate to be a hydrophobic cleft in the surface of the molecule separated by a distance > 0.5 mm from a cationic amino acid residue, probably lysine. Interaction of drugs with this binding site leads to a conformational change in the protein resulting in a decrease in reactivity towards hydrated electrons. Interaction of cephalosporin C and 6-amino penicillanic acid with serum albumin involves another site which consists of a cationic amino acid residue separted from anionic residue by a distance >0.7nm. Drug binding at this site induces a conformational change in serum albumin leading to greatly increased reactivity towards hydrated electrons. This increase is associated with an increased availability of disulphide bridges. Cephalosporin C also binds hydrophobically to serum a;lbumin resulting in a decrease in reactivity towards esub(aq)sup(-); such binding can be prevented by palmitic acid. Recent data clearly indicate that the pulse radiolysis technique can be further extended to investigate the nature of the interactions of bacterial ribosome suspensions with amino-acridines. Ion binding between benzoflavine and ribosomes has been examined over a wide temperature range and the thermodynamic parameters governing the interaction have been evaluated. (author)

  4. Fuel assembly

    International Nuclear Information System (INIS)

    Kurihara, Kunitoshi; Azekura, Kazuo.

    1992-01-01

    In a reactor core of a heavy water moderated light water cooled pressure tube type reactor, no sufficient effects have been obtained for the transfer width to a negative side of void reactivity change in a region of a great void coefficient. Then, a moderation region divided into upper and lower two regions is disposed at the central portion of a fuel assembly. Coolants flown into the lower region can be discharged to the cooling region from an opening disposed at the upper end portion of the lower region. Light water flows from the lower region of the moderator region to the cooling region of the reactor core upper portion, to lower the void coefficient. As a result, the reactivity performance at low void coefficient, i.e., a void reaction rate is transferred to the negative side. Thus, this flattens the power distribution in the fuel assembly, increases the thermal margin and enables rapid operaiton and control of the reactor core, as well as contributes to the increase of fuel burnup ratio and reduction of the fuel cycle cost. (N.H.)

  5. Fuel assembly

    International Nuclear Information System (INIS)

    Chaki, Masao; Nishida, Koji; Karasawa, Hidetoshi; Kanazawa, Toru; Orii, Akihito; Nagayoshi, Takuji; Kashiwai, Shin-ichi; Masuhara, Yasuhiro

    1998-01-01

    The present invention concerns a fuel assembly, for a BWR type nuclear reactor, comprising fuel rods in 9 x 9 matrix. The inner width of the channel box is about 132mm and the length of the fuel rods which are not short fuel rods is about 4m. Two water rods having a circular cross section are arranged on a diagonal line in a portion of 3 x 3 matrix at the center of the fuel assembly, and two fuel rods are disposed at vacant spaces, and the number of fuel rods is 74. Eight fuel rods are determined as short fuel rods among 74 fuel rods. Assuming the fuel inventory in the short fuel rod as X(kg), and the fuel inventory in the fuel rods other than the short fuel rods as Y(kg), X and Y satisfy the relation: X + Y ≥ 173m, Y ≤ - 9.7X + 292, Y ≤ - 0.3X + 203 and X > 0. Then, even when the short fuel rods are used, the fuel inventory is increased and fuel economy can be improved. (I.N.)

  6. Fuel assembly

    International Nuclear Information System (INIS)

    Fushimi, Atsushi; Shimada, Hidemitsu; Aoyama, Motoo; Nakajima, Junjiro

    1998-01-01

    In a fuel assembly for an n x n lattice-like BWR type reactor, n is determined to 9 or greater, and the enrichment degree of plutonium is determined to 4.4% by weight or less. Alternatively, n is determined to 10 or greater, and the enrichment degree of plutonium is determined to 5.2% by weight or less. An average take-out burnup degree is determined to 39GWd/t or less, and the matrix is determined to 9 x 9 or more, or the average take-out burnup degree is determined to 51GWd/t, and the matrix is determined to 10 x 10 or more and the increase of the margin of the maximum power density obtained thereby is utilized for the compensation of the increase of distortion of power distribution due to decrease of the kinds of plutonium enrichment degree, thereby enabling to reduce the kind of the enrichment degree of MOX fuel rods to one. As a result, the manufacturing step for fuel pellets can be simplified to reduce the manufacturing cost for MOX fuel assemblies. (N.H.)

  7. General Assembly

    CERN Multimedia

    Staff Association

    2015-01-01

    Mardi 5 mai à 11 h 00 Salle 13-2-005 Conformément aux statuts de l’Association du personnel, une Assemblée générale ordinaire est organisée une fois par année (article IV.2.1). Projet d’ordre du jour : 1- Adoption de l’ordre du jour. 2- Approbation du procès-verbal de l’Assemblée générale ordinaire du 22 mai 2014. 3- Présentation et approbation du rapport d’activités 2014. 4- Présentation et approbation du rapport financier 2014. 5- Présentation et approbation du rapport des vérificateurs aux comptes pour 2014. 6- Programme 2015. 7- Présentation et approbation du projet de budget 2015 et taux de cotisation pour 2015. 8- Pas de modifications aux Statuts de l'Association du personnel proposée. 9- Élections des membres de la Commission é...

  8. General Assembly

    CERN Multimedia

    Staff Association

    2017-01-01

    Conformément aux statuts de l’Association du personnel, une Assemblée générale ordinaire est organisée une fois par année (article IV.2.1). Projet d’ordre du jour : Adoption de l’ordre du jour. Approbation du procès-verbal de l’Assemblée générale ordinaire du 5 avril 2016. Présentation et approbation du rapport d’activités 2016. Présentation et approbation du rapport financier 2016. Présentation et approbation du rapport des vérificateurs aux comptes pour 2016. Programme de travail 2017. Présentation et approbation du projet de budget 2017 Approbation du taux de cotisation pour 2018. Modifications aux Statuts de l'Association du personnel proposées. Élections des membres de la Commission électorale. Élections des vérifica...

  9. General Assembly

    CERN Multimedia

    Staff Association

    2016-01-01

    Mardi 5 avril à 11 h 00 BE Auditorium Meyrin (6-2-024) Conformément aux statuts de l’Association du personnel, une Assemblée générale ordinaire est organisée une fois par année (article IV.2.1). Projet d’ordre du jour : Adoption de l’ordre du jour. Approbation du procès-verbal de l’Assemblée générale ordinaire du 5 mai 2015. Présentation et approbation du rapport d’activités 2015. Présentation et approbation du rapport financier 2015. Présentation et approbation du rapport des vérificateurs aux comptes pour 2015. Programme de travail 2016. Présentation et approbation du projet de budget 2016 Approbation du taux de cotisation pour 2017. Modifications aux Statuts de l'Association du personnel proposée. Élections des membres de la Commissio...

  10. General assembly

    CERN Multimedia

    Staff Association

    2015-01-01

    Mardi 5 mai à 11 h 00 Salle 13-2-005 Conformément aux statuts de l’Association du personnel, une Assemblée générale ordinaire est organisée une fois par année (article IV.2.1). Projet d’ordre du jour : Adoption de l’ordre du jour. Approbation du procès-verbal de l’Assemblée générale ordinaire du 22 mai 2014. Présentation et approbation du rapport d’activités 2014. Présentation et approbation du rapport financier 2014. Présentation et approbation du rapport des vérificateurs aux comptes pour 2014. Programme 2015. Présentation et approbation du projet de budget 2015 et taux de cotisation pour 2015. Pas de modifications aux Statuts de l'Association du personnel proposée. Élections des membres de la Commission électorale. &am...

  11. Fuel assembly

    International Nuclear Information System (INIS)

    Nomata, Terumitsu.

    1993-01-01

    Among fuel pellets to be loaded to fuel cans of a fuel assembly, fuel pellets having a small thermal power are charged in a region from the end of each of spacers up to about 50mm on the upstream of coolants that flow vertically at the periphery of fuel rods. Coolants at the periphery of fuel rods are heated by the heat generation, to result in voids. However, since cooling effect on the upstream of the spacers is low due to influences of the spacers. Further, since the fuel pellets disposed in the upstream region have small thermal power, a void coefficient is not increased. Even if a thermal power exceeding cooling performance should be generated, there is no worry of causing burnout in the upstream region. Even if burnout should be caused, safety margin and reliability relative to burnout are improved, to increase an allowable thermal power, thereby enabling to improve integrity and reliability of fuel rods and fuel assemblies. (N.H.)

  12. Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.

    OpenAIRE

    Ruggero, D; Londei, P

    1996-01-01

    Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

  13. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  14. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  15. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection.

    Science.gov (United States)

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J

    2016-03-22

    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  16. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  17. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  18. Studies on the catalytic rate constant of ribosomal peptidyltransferase.

    Science.gov (United States)

    Synetos, D; Coutsogeorgopoulos, C

    1987-02-20

    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  19. Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

    Science.gov (United States)

    Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

    2015-01-01

    Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

  20. Is there a channel in the ribosome for nascent peptide. Labellimg of translating ribosomes with atomar tritium

    Energy Technology Data Exchange (ETDEWEB)

    Kolb, V A; Kammer, A A; Spirin, A S

    1987-01-01

    The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.

  1. An optimized single chain TCR scaffold relying on the assembly with the native CD3-complex prevents residual mispairing with endogenous TCRs in human T-cells

    Science.gov (United States)

    Knies, Diana; Klobuch, Sebastian; Xue, Shao-An; Birtel, Matthias; Echchannaoui, Hakim; Yildiz, Oezlem; Omokoko, Tana; Guillaume, Philippe; Romero, Pedro; Stauss, Hans; Sahin, Ugur; Herr, Wolfgang; Theobald, Matthias; Thomas, Simone; Voss, Ralf-Holger

    2016-01-01

    Immunotherapy of cancer envisions the adoptive transfer of T-cells genetically engineered with tumor-specific heterodimeric α/β T-cell receptors (TCRα/β). However, potential mispairing of introduced TCRα/β-chains with endogenous β/α-ones may evoke unpredictable autoimmune reactivities. A novel single chain (sc)TCR format relies on the fusion of the Vα-Linker-Vβ-fragment to the TCR Cβ-domain and coexpression of the TCR Cα-domain capable of recruiting the natural CD3-complex for full and hence, native T-cell signaling. Here, we tested whether such a gp100(280-288)- or p53(264-272) tumor antigen-specific scTCR is still prone to mispairing with TCRα. In a human Jurkat-76 T-cell line lacking endogenous TCRs, surface expression and function of a scTCR could be reconstituted by any cointroduced TCRα-chain indicating mispairing to take place on a molecular basis. In contrast, transduction into human TCRα/β-positive T-cells revealed that mispairing is largely reduced. Competition experiments in Jurkat-76 confirmed the preference of dcTCR to selfpair and to spare scTCR. This also allowed for the generation of dc/scTCR-modified cytomegalovirus/tumor antigen-bispecific T-cells to augment T-cell activation in CMV-infected tumor patients. Residual mispairing was prevented by strenghtening the Vα-Li-Vβ-fragment through the design of a novel disulfide bond between a Vα- and a linker-resident residue close to Vβ. Multimer-stainings, and cytotoxicity-, IFNγ-secretion-, and CFSE-proliferation-assays, the latter towards dendritic cells endogenously processing RNA-electroporated gp100 antigen proved the absence of hybrid scTCR/TCRα-formation without impairing avidity of scTCR/Cα in T-cells. Moreover, a fragile cytomegalovirus pp65(495-503)-specific scTCR modified this way acquired enhanced cytotoxicity. Thus, optimized scTCR/Cα inhibits residual TCR mispairing to accomplish safe adoptive immunotherapy for bulk endogenous TCRα/β-positive T-cells. PMID:27028870

  2. Fuel assembly

    International Nuclear Information System (INIS)

    Ueda, Makoto; Ogiya, Shunsuke.

    1989-01-01

    For improving the economy of a BWR type reactor by making the operation cycle longer, the fuel enrichment degree has to be increased further. However, this makes the subcriticality shallower in the upper portion of the reactor core, to bring about a possibility that the reactor shutdown becomes impossible. In the present invention, a portion of fuel rod is constituted as partial length fuel rods (P-fuel rods) in which the entire stack length in the effective portion is made shorter by reducing the concentration of fissionable materials in the axial portion. A plurality of moderator rods are disposed at least on one diagonal line of a fuel assembly and P-fuel rods are arranged at a position put between the moderator rods. This makes it possible to reactor shutdown and makes the axial power distribution satisfactory even if the fuel enrichment degree is increased. (T.M.)

  3. Fuel assembly

    International Nuclear Information System (INIS)

    Bando, Masaru.

    1993-01-01

    As neutron irradiation progresses on a fuel assembly of an FBR type reactor, a strong force is exerted to cause ruptures if the arrangement of fuel elements is not displaced, whereas the fuel elements may be brought into direct contact with each other not by way of spacers to cause burning damages if the arrangement is displaced. In the present invention, the circumference of fuel elements arranged in a normal triangle lattice is surrounded by a wrapper tube having a hexagonal cross section, wire spacers are wound therearound, and deformable spacers are distributed to optional positions for fuel elements in the wrapper tube. Interaction between the fuel elements caused by irradiation is effectively absorbed, thereby enabling to delay the occurrence of the rupture and burning damages of the elements. (N.H.)

  4. Fuel assembly

    International Nuclear Information System (INIS)

    Ueda, Makoto.

    1991-01-01

    In a fuel assembly in which spectral shift type moderator guide members are arranged, the moderator guide member has a flow channel resistance member, that provides flow resistance against the moderators, in the upstream of a moderator flowing channel, by which the ratio of removing coolants is set greater at the upstream than downstream. With such a constitution, the void distribution increasing upward in the channel box except for the portion of the moderator guide member is moderated by the increase of the area of the void region that expands downward in the guide member. Accordingly, the axial power distribution is flattened throughout the operation cycle and excess distortion is eliminated to improve the fuel integrity. (T.M.)

  5. Fuel assembly

    International Nuclear Information System (INIS)

    Wataumi, Kazutoshi; Tajiri, Hiroshi.

    1992-01-01

    In a fuel assembly of a BWR type reactor, a pellet to be loaded comprises an external layer of fissile materials containing burnable poisons and an internal layer of fissile materials not containing burnable poison. For example, there is provided a dual type pellet comprising an external layer made of UO 2 incorporated with Gd 2 O 3 at a predetermined concentration as the burnable poisons and an internal layer made of UO 2 not containing Gd 2 O 3 . The amount of the burnable poisons required for predetermined places is controlled by the thickness of the ring of the external layer. This can dissipate an unnecessary poisoning effect at the final stage of the combustion cycle. Further, since only one or a few kinds of powder mixture of the burnable poisons and the fissile materials is necessary, production and product control can be facilitated. (I.N.)

  6. Fuel assembly

    International Nuclear Information System (INIS)

    Ishibashi, Yoko; Aoyama, Motoo; Oyama, Jun-ichi.

    1995-01-01

    Burnable poison-incorporating fuel rods of a first group are disposed in a region in adjacent with a water rod having a large diameter (neutron moderator rod) disposed to the central portion of a fuel assembly. Burnable poison-incorporating fuel rods of a second group are disposed to a region other than peripheral zone in adjacent with a channel box and corners positioned at an inner zone, in adjacent with the channel box. The average concentration of burnable poisons of the burnable poison-incorporating fuel rods of the first group is made greater than that of the second group. With such a constitution, when the burnable poisons of the first group are burnt out, the burnable poisons of the second group are also burnt out at the same time. Accordingly, an amount of burnable poisons left unburnt at the final stage of the operation cycle is reduced, to improve the reactivity. This can improve the economical property. (I.N.)

  7. Fuel assemblies

    International Nuclear Information System (INIS)

    Yoshioka, Ritsuo.

    1983-01-01

    Purpose: To improve the operation performance of a BWR type reactor by improving the distribution of the uranium enrichment and the incorporation amount of burnable poisons in fuel assemblies. Constitution: The average enrichment of uranium 235 is increased in the upper portion as compared with that in the lower portion, while the incorporation amount of burnable poisons is increased in an upper portion as compared with that in the lower portion. The difference in the incorporation amount of the burnable poisons between the upper and lower portions is attained by charging two kinds of fuel rods; the ones incorporated with the burnable poisons over the entire length and the others incorporated with the burnable poisons only in the upper portions. (Seki, T.)

  8. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  9. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  10. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    International Nuclear Information System (INIS)

    Boehm, H.; Stahl, J.; Bielka, H.

    1979-01-01

    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  11. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji

    2017-07-01

    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  12. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

    1975-06-01

    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  13. The pleuromutilin drugs tiamulin and valnemulin bind to the RNA at the peptidyl transferase centre on the ribosome.

    Science.gov (United States)

    Poulsen, S M; Karlsson, M; Johansson, L B; Vester, B

    2001-09-01

    The pleuromutilin antibiotic derivatives, tiamulin and valnemulin, inhibit protein synthesis by binding to the 50S ribosomal subunit of bacteria. The action and binding site of tiamulin and valnemulin was further characterized on Escherichia coli ribosomes. It was revealed that these drugs are strong inhibitors of peptidyl transferase and interact with domain V of 23S RNA, giving clear chemical footprints at nucleotides A2058-9, U2506 and U2584-5. Most of these nucleotides are highly conserved phylogenetically and functionally important, and all of them are at or near the peptidyl transferase centre and have been associated with binding of several antibiotics. Competitive footprinting shows that tiamulin and valnemulin can bind concurrently with the macrolide erythromycin but compete with the macrolide carbomycin, which is a peptidyl transferase inhibitor. We infer from these and previous results that tiamulin and valnemulin interact with the rRNA in the peptidyl transferase slot on the ribosomes in which they prevent the correct positioning of the CCA-ends of tRNAs for peptide transfer.

  14. PWR fuel assembly

    International Nuclear Information System (INIS)

    Yamada, Yuji.

    1995-01-01

    A lower end plug is secured to a lower end of a thimble tube. A bolt-like thimble screw is screw-coupled and fastened to a female screw disposed to the end plug by way of a bushing screw-coupled to a lower nozzle. Then, the thimble screw and the lower nozzle are welded to secure the thimble tube and the lower nozzle. The lower portion of the bushing extends near the lower surface of the lower nozzle. The extended portion is provided with a recess to which a bolt head of the thimble screw is tightly inserted and a seating-face portion against which a seating-face of the bolt head abuts. Then, the extended portion of the bushing and the lower nozzle are spot-welded on the side of the lower surface of the nozzle, to prevent rotation of the bushing. This can easily prevent the rotation of the bushing after adjustment, to simplify the assembling of the fuel assembly. (I.N.)

  15. ASSEMBLY TRANSFER SYSTEM DESCRIPTION DOCUMENT

    International Nuclear Information System (INIS)

    Gorpani, B.

    2000-01-01

    into the cask unloading pool. In the cask unloading pool the DPC is removed from the cask and placed in an overpack and the DPC lid is severed and removed. Assemblies are removed from either an open cask or DPC and loaded into assembly baskets positioned in the basket staging rack in the assembly unloading pool. A method called ''blending'' is utilized to load DCs with a heat output of less than 11.8 kW. This involves combining hotter and cooler assemblies from different baskets. Blending requires storing some of the hotter fuel assemblies in fuel-blending inventory pools until cooler assemblies are available. The assembly baskets are then transferred from the basket staging rack to the assembly handling cell and loaded into the assembly drying vessels. After drying, the assemblies are removed from the assembly drying vessels and loaded into a DC positioned below the DC load port. After installation of a DC inner lid and temporary sealing device, the DC is transferred to the DC decontamination cell where the top area of the DC, the DC lifting collar, and the DC inner lid and temporary sealing device are decontaminated, and the DC is evacuated and backfilled with inert gas to prevent prolonged clad exposure to air. The DC is then transferred to the Disposal Container Handling System for lid welding. In another cask preparation and decontamination area, lids are replaced on the empty transportation casks and DPC overpacks, the casks and DPC overpacks are decontaminated, inspected, and transferred to the Carrier/Cask Handling System for shipment off-site. All system equipment is designed to facilitate manual or remote operation, decontamination, and maintenance. The system interfaces with the Carrier/Cask Handling System for incoming and outgoing transportation casks and DPCs. The system also interfaces with the Disposal Container Handling System, which prepares the DC for loading and subsequently seals the loaded DC. The system support interfaces are the Waste Handling

  16. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data.

    Science.gov (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel

    2018-03-15

    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe

    2000-11-01

    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  18. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Science.gov (United States)

    Lalucque, Hervé; Silar, Philippe

    2000-01-01

    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  19. Fuel assemblies

    International Nuclear Information System (INIS)

    Mukai, Hideyuki

    1987-01-01

    Purpose: To prevent bending of fuel rods caused by the difference of irradiation growth between coupling fuel rods and standards fuel rods thereby maintain the fuel rod integrity. Constitution: The f value for a fuel can (the ratio of pole of zirconium crystals in the entire crystals along the axial direction of the fuel can) of a coupling fuel rod secured by upper and lower tie plates is made smaller than the f value for the fuel can of a standard fuel rod not secured by the upper and the lower tie plates. This can make the irradiation growth of the fuel can of the coupling fuel rod greater than the irradiation growth of the fuel can of the standard fuel rod and, accordingly, since the elongation of the standard fuel rod can always by made greater, bending of the standard fuel rod can be prevented. (Yoshihara, M.)

  20. Fuel assembly

    International Nuclear Information System (INIS)

    Sakuyama, Tadashi; Mukai, Hideyuki.

    1988-01-01

    Purpose: To prevent the bending of a fuel rod caused by the difference in the elongation between a joined fuel rod and a standard fuel rod thereby maintain the fuel rod integrity. Constitution: A joined fuel rod is in a thread engagement at its lower end plug thereof with a lower plate, while passed through at its upper end plug into an upper tie plate and secured with a nut. Further, a standard fuel rod is engaged at its upper end plug and lower end plug with the upper tie plate and the lower tie plate respectively. Expansion springs are mounted to the upper end plugs of these bonded fuel rods and the standard fuel rods for preventing this lifting. Each of the fuel rods comprises a plurality of sintered pellets of nuclear fuel materials laminated in a zircaloy fuel can. The content of the alloy ingredient in the fuel can of the bonded fuel rod is made greater than that of the alloy ingredient of the standard fuel rod. this can increase the elongation for the bonded fuel rod, and the spring of the standard fuel rod is tightly bonded to prevent the bending. (Yoshino, Y.)

  1. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.

    1987-01-01

    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  2. Ribosome-catalyzed formation of an abnormal peptide analogue

    International Nuclear Information System (INIS)

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.

    1986-01-01

    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  3. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

    1986-01-01

    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  4. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

    Science.gov (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

    1990-01-01

    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  5. Fuel assembly

    International Nuclear Information System (INIS)

    Hirukawa, Koji; Sakurada, Koichi.

    1992-01-01

    In a fuel assembly for a BWR type reactor, water rods or water crosses are disposed between fuel rods, and a value with a spring is disposed at the top of the coolant flow channel thereof, which opens a discharge port when pressure is increased to greater than a predetermined value. Further, a control element for the amount of coolant flow rate is inserted retractable to a control element guide tube formed at the lower portion of the water rod or the water cross. When the amount of control elements inserted to the control element guide tube is small and the inflown coolant flow rate is great, the void coefficient at the inside of the water rod is less than 5%. On the other hand, when the control elements are inserted, the flow resistance is increased, so that the void coefficient in the water rod is greater than 80%. When the pressure in the water rod is increased, the valve with the spring is raised to escape water or steams. Then, since the variation range of the change of the void coefficient can be controlled reliably by the amount of the control elements inserted, and nuclear fuel materials can be utilized effectively. (N.H.)

  6. Fuel assembly

    International Nuclear Information System (INIS)

    Hiraiwa, Koji; Ueda, Makoto

    1989-01-01

    In a fuel assembly used for a light water cooled reactor such as a BWR type reactor, a water rod is divided axially into an upper outer tube and a lower outer tube by means of a plug disposed from the lower end of a water rod to a position 1/4 - 1/2 of the entire length for the water rod. Inlet apertures and exit apertures for moderators are respectively perforated for the divided outer tube and upper and lower portions. Further, an upper inner tube with less neutron irradiation growing amount than the outer tube is perforated on the plug in the outer tube, while a lower inner tube with greater neutron irradiation growing amount than the outer tube is suspended from the lower surface of the plug in the outer tube. Then, the opening area for the exit apertures disposed to the upper outer tube and the lower outer tube is controlled depending on the difference of the neutron irradiation growing amount between the upper inner tube and the upper outer tube, and the difference of the neutron irradiation growing amount between the lower inner tube and the lower outer tube. This enables effective spectral shift operation and improve the fuel economy. (T.M.)

  7. Fuel assembly

    International Nuclear Information System (INIS)

    Yamazaki, Hajime.

    1995-01-01

    In a fuel assembly having fuel rods of different length, fuel pellets of mixed oxides of uranium and plutonium are loaded to a short fuel rod. The volume ratio of a pellet-loaded portion to a plenum portion of the short fuel rod is made greater than the volume ratio of a fuel rod to which uranium fuel pellets are loaded. In addition, the volume of the plenum portion of the short fuel rod is set greater depending on the plutonium content in the loaded fuel pellets. MOX fuel pellets are loaded on the short fuel rods having a greater degree of freedom relevant to the setting for the volume of the plenum portion compared with that of a long rod fuel, and the volume of the plenum portion is ensured greater depending on the plutonium content. Even if a large amount of FP gas and He gas are discharged from the MOX fuels compared with that from the uranium fuels, the internal pressure of the MOX fuel rod during operation is maintained substantially identical with that of the uranium fuel rod, so that a risk of generating excess stresses applied to the fuel cladding tubes and rupture of fuels are greatly reduced. (N.H.)

  8. Fuel assembly

    International Nuclear Information System (INIS)

    Nakajima, Akiyoshi; Bessho, Yasunori; Aoyama, Motoo; Koyama, Jun-ichi; Hirakawa, Hiromasa; Yamashita, Jun-ichi; Hayashi, Tatsuo

    1998-01-01

    In a fuel assembly of a BWR type reactor in which a water rod of a large diameter is disposed at the central portion, the cross sectional area perpendicular to the axial direction comprises a region a of a fuel rod group facing to a wide gap water region to which a control rod is inserted, a region b of a fuel rod group disposed on the side of the wide gap water region other than the region a, a region d of a fuel rod group facing to a narrow gap water region and a region c of a fuel rod group disposed on the side of the narrow gap water region other than the region d. When comparing an amount of fission products contained in the four regions relative to that in the entire regions and average enrichment degrees of fuel rods for the four regions, the relative amount and the average enrichment degree of the fuel rod group of the region a is minimized, and the relative amount and the average enrichment degree of the fuel rod group in the region b is maximized. Then, reactor shut down margin during cold operation can be improved while flattening the power in the cross section perpendicular to the axial direction. (N.H.)

  9. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    DEFF Research Database (Denmark)

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech

    2003-01-01

    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

  10. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.

    1985-01-01

    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  11. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.

    1987-01-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  12. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  13. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  14. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-01-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  15. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide.

    Science.gov (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria

    2017-07-06

    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

    International Nuclear Information System (INIS)

    Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

    1987-01-01

    The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

  17. Rotatable seal assembly

    International Nuclear Information System (INIS)

    Garibaldi, J.L.; Logan, C.M.

    1982-01-01

    An assembly is provided for rotatably supporting a rotor on a stator so that vacuum chambers in the rotor and stator remain in communication while the chambers are sealed from ambient air, which enables the use of a ball bearing or the like to support most of the weight of the rotor. The apparatus includes a seal device mounted on the rotor to rotate therewith, but shiftable in position on the rotor while being sealed to the rotor as by an oring. The seal device has a flat face that is biased towards a flat face on the stator, and pressurized air is pumped between the faces to prevent contact between them while spacing them a small distance apart to avoid the inflow of large amounts of air between the faces and into the vacuum chambers

  18. Nuclear fuel assembly

    International Nuclear Information System (INIS)

    Domoto, Noboru; Masuda, Hiroyuki

    1989-01-01

    In a nuclear fuel assembly loaded with a plurality of fuel rods, the inside of a fuel rod disposed at a high neutron flux region is divided into an inner region and an outer region, and more burnable poisons are mixed in the inner region than in the outer region. Alternatively, the central portion of a pellet disposed in a high neutron flux region is made hollow, in which burnable poisons are charged. This can prevent neutron infinite multiplication factor from decreasing extremely at the initial burning stage. Further, the burnable poisons are not rapidly burnt completely and local peaking coefficient can be controlled. Accordingly, in a case of suppressing a predetermined excess reactivity by using a fuel rod incorporated with the burnable poison, the fuel economy can be improved more and the reactor core controllability can also be improved as compared with the usual case. (T.M.)

  19. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh

    1973-01-01

    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  20. Computational resources for ribosome profiling: from database to Web server and software.

    Science.gov (United States)

    Wang, Hongwei; Wang, Yan; Xie, Zhi

    2017-08-14

    Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    Science.gov (United States)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  2. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  3. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav

    2007-08-01

    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  4. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants.

    Science.gov (United States)

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N

    1981-01-01

    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  5. Inhibition of Ribosome Recruitment Induces Stress Granule Formation Independently of Eukaryotic Initiation Factor 2α Phosphorylation

    Science.gov (United States)

    Mazroui, Rachid; Sukarieh, Rami; Bordeleau, Marie-Eve; Kaufman, Randal J.; Northcote, Peter; Tanaka, Junichi; Gallouzi, Imed

    2006-01-01

    Cytoplasmic aggregates known as stress granules (SGs) arise as a consequence of cellular stress and contain stalled translation preinitiation complexes. These foci are thought to serve as sites of mRNA storage or triage during the cell stress response. SG formation has been shown to require induction of eukaryotic initiation factor (eIF)2α phosphorylation. Herein, we investigate the potential role of other initiation factors in this process and demonstrate that interfering with eIF4A activity, an RNA helicase required for the ribosome recruitment phase of translation initiation, induces SG formation and that this event is not dependent on eIF2α phosphorylation. We also show that inhibition of eIF4A activity does not impair the ability of eIF2α to be phosphorylated under stress conditions. Furthermore, we observed SG assembly upon inhibition of cap-dependent translation after poliovirus infection. We propose that SG modeling can occur via both eIF2α phosphorylation-dependent and -independent pathways that target translation initiation. PMID:16870703

  6. Inhibition of ribosome recruitment induces stress granule formation independently of eukaryotic initiation factor 2alpha phosphorylation.

    Science.gov (United States)

    Mazroui, Rachid; Sukarieh, Rami; Bordeleau, Marie-Eve; Kaufman, Randal J; Northcote, Peter; Tanaka, Junichi; Gallouzi, Imed; Pelletier, Jerry

    2006-10-01

    Cytoplasmic aggregates known as stress granules (SGs) arise as a consequence of cellular stress and contain stalled translation preinitiation complexes. These foci are thought to serve as sites of mRNA storage or triage during the cell stress response. SG formation has been shown to require induction of eukaryotic initiation factor (eIF)2alpha phosphorylation. Herein, we investigate the potential role of other initiation factors in this process and demonstrate that interfering with eIF4A activity, an RNA helicase required for the ribosome recruitment phase of translation initiation, induces SG formation and that this event is not dependent on eIF2alpha phosphorylation. We also show that inhibition of eIF4A activity does not impair the ability of eIF2alpha to be phosphorylated under stress conditions. Furthermore, we observed SG assembly upon inhibition of cap-dependent translation after poliovirus infection. We propose that SG modeling can occur via both eIF2alpha phosphorylation-dependent and -independent pathways that target translation initiation.

  7. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

    Science.gov (United States)

    Kimura, J; Kimura, M

    1987-09-05

    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  8. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  9. mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Stevens, A.

    1980-01-01

    By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

  10. Potential roles for ubiquitin and the proteasome during ribosome biogenesis

    Czech Academy of Sciences Publication Activity Database

    Stavreva, D. A.; Kawasaki, M.; Dundr, M.; Koberna, Karel; Müller, W. G.; Tsujimura-Takahashi, T.; Komatsu, W.; Hayano, T.; Isobe, T.; Raška, Ivan; Misteli, T.; Takahashi, N.; McNally, J. G.

    2006-01-01

    Roč. 26, č. 13 (2006), s. 5131-5145 ISSN 0270-7306 R&D Projects: GA MŠk(CZ) LC535; GA ČR(CZ) GA304/05/0374; GA ČR(CZ) GA304/04/0692 Grant - others:NIH(US) Intramural Research Program; Ministry of Education(JP) Pioneer Research grant Institutional research plan: CEZ:AV0Z50110509 Keywords : the role of the ubikvitin * proteasome system in ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.773, year: 2006

  11. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    International Nuclear Information System (INIS)

    Suessmuth, R.; Widmann, A.

    1979-01-01

    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

  12. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy.

    Science.gov (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger

    2010-07-15

    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  13. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    Science.gov (United States)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  14. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-01

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  15. Newnes electronics assembly handbook

    CERN Document Server

    Brindley, Keith

    2013-01-01

    Newnes Electronics Assembly Handbook: Techniques, Standards and Quality Assurance focuses on the aspects of electronic assembling. The handbook first looks at the printed circuit board (PCB). Base materials, basic mechanical properties, cleaning of assemblies, design, and PCB manufacturing processes are then explained. The text also discusses surface mounted assemblies and packaging of electromechanical assemblies, as well as the soldering process. Requirements for the soldering process; solderability and protective coatings; cleaning of PCBs; and mass solder/component reflow soldering are des

  16. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

    Science.gov (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

    2017-09-01

    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  17. Ribosome-Inactivating Proteins from Plants: A Historical Overview

    Directory of Open Access Journals (Sweden)

    Andrea Bolognesi

    2016-11-01

    Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.

  18. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  19. [Family of ribosomal proteins S1 contains unique conservative domain].

    Science.gov (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  20. Interaction of Pleuromutilin Derivatives with the Ribosomal Peptidyl Transferase Center

    Science.gov (United States)

    Long, Katherine S.; Hansen, Lykke H.; Jakobsen, Lene; Vester, Birte

    2006-01-01

    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design of pleuromutilin-based drugs, the binding of the antibiotic pleuromutilin and three semisynthetic derivatives with different side chain extensions has been investigated using chemical footprinting. The nucleotides A2058, A2059, G2505, and U2506 are affected in all of the footprints, suggesting that the drugs are similarly anchored in the binding pocket by the common tricyclic mutilin core. However, varying effects are observed at U2584 and U2585, indicating that the side chain extensions adopt distinct conformations within the cavity and thereby affect the rRNA conformation differently. An Escherichia coli L3 mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding site. The data suggest that pleuromutilin drugs with enhanced antimicrobial activity may be obtained by maximizing the number of interactions between the side chain moiety and the peptidyl transferase cavity. PMID:16569865

  1. Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

    Directory of Open Access Journals (Sweden)

    Tetsuro Kawano

    Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

  2. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    Science.gov (United States)

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  3. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

    Science.gov (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

    2012-08-01

    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  4. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.

    1990-01-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  5. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    Science.gov (United States)

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  6. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    Science.gov (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  7. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen

    2013-01-01

    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  8. Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.

    Science.gov (United States)

    Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen

    2017-01-01

    Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of

  9. Fuel assembly guide tube

    International Nuclear Information System (INIS)

    Jabsen, F.S.

    1979-01-01

    This invention is directed toward a nuclear fuel assembly guide tube arrangement which restrains spacer grid movement due to coolant flow and which offers secondary means for supporting a fuel assembly during handling and transfer operations

  10. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

    International Nuclear Information System (INIS)

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-01-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

  11. The Ribosome and the 2009 Nobel Prize in Chemistry

    Indian Academy of Sciences (India)

    amino acid sequence of any protein is determined by the sequence of bases in some ... according to which amino acids are assembled and joined to- gether to form ..... has become a major health concern with pathogenic bacteria evolving ...

  12. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments

    OpenAIRE

    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.

    2013-01-01

    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  13. Polymer Directed Protein Assemblies

    NARCIS (Netherlands)

    van Rijn, Patrick

    2013-01-01

    Protein aggregation and protein self-assembly is an important occurrence in natural systems, and is in some form or other dictated by biopolymers. Very obvious influences of biopolymers on protein assemblies are, e. g., virus particles. Viruses are a multi-protein assembly of which the morphology is

  14. Nuclear reactor fuel assembly

    International Nuclear Information System (INIS)

    Sasaki, Y.; Tashima, J.

    1975-01-01

    A description is given of nuclear reactor fuel assemblies arranged in the form of a lattice wherein there is attached to the interface of one of two adjacent fuel assemblies a plate spring having a concave portion curved toward said interface and to the interface of the other fuel assembly a plate spring having a convex portion curved away from said interface

  15. Replication and meiotic transmission of yeast ribosomal RNA genes.

    Science.gov (United States)

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  16. Globular conformation of some ribosomal proteins in solution

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Spirin, A.S.

    1978-01-01

    The possibility that such RNA-binding proteins of the 30 S subparticle as S4, S7, S8 and S16 exist in the form of compact globules in solution has been explored experimentally. These proteins have been studied in D 2 O solution by neutron scattering to measure their radii of gyration. This type of radiation using D 2 O as a solvent provides the maximum 'contrast', that is the maximum difference between the scattering of the protein and the solvent. It allowed measurements to be made using protein at <= 1.5 mg/ml. The radii of gyration for the ribosomal proteins S4, S7, S8 and S16 were found to be relatively small corresponding to the radii of gyration of compact globular proteins of the same molecular weights. (Auth.)

  17. Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

    International Nuclear Information System (INIS)

    Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.

    1990-01-01

    Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

  18. Expanding the Entamoeba Universe: New Hosts Yield Novel Ribosomal Lineages.

    Science.gov (United States)

    Jacob, Alison S; Busby, Eloise J; Levy, Abigail D; Komm, Natasha; Clark, C Graham

    2016-01-01

    Removing the requirement for cell culture has led to a substantial increase in the number of lineages of Entamoeba recognized as distinct. Surveying the range of potential host species for this parasite genus has barely been started and it is clear that additional sampling of the same host in different locations often identifies additional diversity. In this study, using small subunit ribosomal RNA gene sequencing, we identify four new lineages of Entamoeba, including the first report of Entamoeba from an elephant, and extend the host range of some previously described lineages. In addition, examination of microbiome data from a number of host animals suggests that substantial Entamoeba diversity remains to be uncovered. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.

  19. Sensor mount assemblies and sensor assemblies

    Science.gov (United States)

    Miller, David H [Redondo Beach, CA

    2012-04-10

    Sensor mount assemblies and sensor assemblies are provided. In an embodiment, by way of example only, a sensor mount assembly includes a busbar, a main body, a backing surface, and a first finger. The busbar has a first end and a second end. The main body is overmolded onto the busbar. The backing surface extends radially outwardly relative to the main body. The first finger extends axially from the backing surface, and the first finger has a first end, a second end, and a tooth. The first end of the first finger is disposed on the backing surface, and the tooth is formed on the second end of the first finger.

  20. Cross-species functionality of pararetroviral elements driving ribosome shunting.

    Directory of Open Access Journals (Sweden)

    Mikhail M Pooggin

    Full Text Available BACKGROUND: Cauliflower mosaic virus (CaMV and Rice tungro bacilliform virus (RTBV belong to distinct genera of pararetroviruses infecting dicot and monocot plants, respectively. In both viruses, polycistronic translation of pregenomic (pg RNA is initiated by shunting ribosomes that bypass a large region of the pgRNA leader with several short (sORFs and a stable stem-loop structure. The shunt requires translation of a 5'-proximal sORF terminating near the stem. In CaMV, mutations knocking out this sORF nearly abolish shunting and virus viability. METHODOLOGY/PRINCIPAL FINDINGS: Here we show that two distant regions of the CaMV leader that form a minimal shunt configuration comprising the sORF, a bottom part of the stem, and a shunt landing sequence can be replaced by heterologous sequences that form a structurally similar configuration in RTBV without any dramatic effect on shunt-mediated translation and CaMV infectivity. The CaMV-RTBV chimeric leader sequence was largely stable over five viral passages in turnip plants: a few alterations that did eventually occur in the virus progenies are indicative of fine tuning of the chimeric sequence during adaptation to a new host. CONCLUSIONS/SIGNIFICANCE: Our findings demonstrate cross-species functionality of pararetroviral cis-elements driving ribosome shunting and evolutionary conservation of the shunt mechanism. We are grateful to Matthias Müller and Sandra Pauli for technical assistance. This work was initiated at Friedrich Miescher Institute (Basel, Switzerland. We thank Prof. Thomas Boller for hosting the group at the Institute of Botany.

  1. Ribosomal protein gene knockdown causes developmental defects in zebrafish.

    Directory of Open Access Journals (Sweden)

    Tamayo Uechi

    Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

  2. Regenerator cross arm seal assembly

    Science.gov (United States)

    Jackman, Anthony V.

    1988-01-01

    A seal assembly for disposition between a cross arm on a gas turbine engine block and a regenerator disc, the seal assembly including a platform coextensive with the cross arm, a seal and wear layer sealingly and slidingly engaging the regenerator disc, a porous and compliant support layer between the platform and the seal and wear layer porous enough to permit flow of cooling air therethrough and compliant to accommodate relative thermal growth and distortion, a dike between the seal and wear layer and the platform for preventing cross flow through the support layer between engine exhaust and pressurized air passages, and air diversion passages for directing unregenerated pressurized air through the support layer to cool the seal and wear layer and then back into the flow of regenerated pressurized air.

  3. tmRNA-mediated trans-translation as the major ribosome rescue system in a bacterial cell

    Directory of Open Access Journals (Sweden)

    Hyouta eHimeno

    2014-04-01

    Full Text Available tmRNA (transfer messenger RNA; also known as 10Sa RNA or SsrA RNA is a small RNA molecule that is conserved among bacteria. It has structural and functional similarities to tRNA: it has an upper half of the tRNA-like structure, its 5’ end is processed by RNase P, it has typical tRNA-specific base modifications, it is aminoacylated with alanine, it binds to EF-Tu after aminoacylation and it enters the ribosome with EF-Tu and GTP. However, tmRNA lacks an anticodon, and instead it has a coding sequence for a short peptide called tag-peptide. An elaborate interplay of actions of tmRNA as both tRNA and mRNA with the help of a tmRNA-binding protein, SmpB, facilitates trans-translation, which produces a single polypeptide from two mRNA molecules. Initially alanyl-tmRNA in complex with EF-Tu and SmpB enters the vacant A-site of the stalled ribosome like aminoacyl-tRNA but without a codon-anticodon interaction, and subsequently truncated mRNA is replaced with the tag-encoding region of tmRNA. During these processes, not only tmRNA but also SmpB structurally and functionally mimics both tRNA and mRNA. Thus trans-translation rescues the stalled ribosome, thereby allowing recycling of the ribosome. Since the tag-peptide serves as a target of AAA+ proteases, the trans-translation products are preferentially degraded so that they do not accumulate in the cell. Although alternative rescue systems have recently been revealed, trans-translation is the only system that universally exists in bacteria. Furthermore, it is unique in that it employs a small RNA and that it prevents accumulation of nonfunctional proteins from truncated mRNA in the cell. It might play the major role in rescuing the stalled translation in the bacterial cell.

  4. New localization and function of calpain-2 in nucleoli of colorectal cancer cells in ribosomal biogenesis: effect of KRAS status.

    Science.gov (United States)

    Telechea-Fernández, Marcelino; Rodríguez-Fernández, Lucia; García, Concha; Zaragozá, Rosa; Viña, Juan; Cervantes, Andrés; García-Trevijano, Elena R

    2018-02-06

    Calpain-2 belongs to a family of pleiotropic Cys-proteases with modulatory rather than degradative functions. Calpain (CAPN) overexpression has been controversially correlated with poor prognosis in several cancer types, including colorectal carcinoma (CRC). However, the mechanisms of substrate-recognition, calpain-2 regulation/deregulation and specific functions in CRC remain elusive. Herein, calpain subcellular distribution was studied as a key event for substrate-recognition and consequently, for calpain-mediated function. We describe a new localization for calpain-2 in the nucleoli of CRC cells. Calpain-2 nucleolar distribution resulted dependent on its enzymatic activity and on the mutational status of KRAS. In KRASWT/- cells serum-starvation induced CAPN2 expression, nucleolar accumulation and increased binding to the rDNA-core promoter and intergenic spacer (IGS), concomitant with a reduction in pre-rRNA levels. Depletion of calpain-2 by specific siRNA prevented pre-rRNA down-regulation after serum removal. Conversely, ribosomal biogenesis proceeded in the absence of serum in unresponsive KRASG13D/- cells whose CAPN2 expression, nucleolar localization and rDNA-occupancy remained unchanged during the time-course of serum starvation. We propose here that nucleolar calpain-2 might be a KRAS-dependent sensor to repress ribosomal biogenesis in growth limiting conditions. Under constitutive activation of the pathway commonly found in CRC, calpain-2 is deregulated and tumor cells become insensitive to the extracellular microenvironment.

  5. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

    Science.gov (United States)

    Andreeva, Irena

    2018-01-01

    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  6. Soldering in electronics assembly

    CERN Document Server

    Judd, Mike

    2013-01-01

    Soldering in Electronics Assembly discusses several concerns in soldering of electronic assemblies. The book is comprised of nine chapters that tackle different areas in electronic assembly soldering. Chapter 1 discusses the soldering process itself, while Chapter 2 covers the electronic assemblies. Chapter 3 talks about solders and Chapter 4 deals with flux. The text also tackles the CS and SC soldering process. The cleaning of soldered assemblies, solder quality, and standards and specifications are also discussed. The book will be of great use to professionals who deal with electronic assem

  7. Nuclear fuel string assembly

    International Nuclear Information System (INIS)

    Ip, A.K.; Koyanagi, K.; Tarasuk, W.R.

    1976-01-01

    A method of fabricating rodded fuels suitable for use in pressure tube type reactors and in pressure vessel type reactors is described. Fuel rods are secured as an inner and an outer sub-assembly, each rod attached between mounting rings secured to the rod ends. The two sub-assemblies are telescoped together and positioned by spaced thimbles located between them to provide precise positioning while permittng differential axial movement between the sub-assemblies. Such sub-assemblies are particularly suited for mounting as bundle strings. The method provides particular advantages in the assembly of annular-section fuel pins, which includes booster fuel containing enriched fuel material. (LL)

  8. Nuclear reactor fuel assembly

    International Nuclear Information System (INIS)

    Marmonier, Pierre; Mesnage, Bernard; Nervi, J.C.

    1975-01-01

    This invention refers to fuel assemblies for a liquid metal cooled fast neutron reactor. Each assembly is composed of a hollow vertical casing, of regular polygonal section, containing a bundle of clad pins filled with a fissile or fertile substance. The casing is open at its upper end and has a cylindrical foot at its lower end for positioning the assembly in a housing provided in the horizontal diagrid, on which the core assembly rests. A set of flat bars located on the external surface of the casing enables it to be correctly orientated in its housing among the other core assemblies [fr

  9. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.

    1978-01-01

    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  10. A protein interaction map of the kalimantacin biosynthesis assembly line

    Directory of Open Access Journals (Sweden)

    Birgit Uytterhoeven

    2016-11-01

    Full Text Available The antimicrobial secondary metabolite kalimantacin is produced by a hybrid polyketide/ non-ribosomal peptide system in Pseudomonas fluorescens BCCM_ID9359. In this study, the kalimantacin biosynthesis gene cluster is analyzed by yeast two-hybrid analysis, creating a protein-protein interaction map of the entire assembly line. In total, 28 potential interactions were identified, of which 13 could be confirmed further. These interactions include the dimerization of ketosynthase domains, a link between assembly line modules 9 and 10, and a specific interaction between the trans-acting enoyl reductase BatK and the carrier proteins of modules 8 and 10. These interactions reveal fundamental insight into the biosynthesis of secondary metabolites.This study is the first to reveal interactions in a complete biosynthetic pathway. Similar future studies could build a strong basis for engineering strategies in such clusters.

  11. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    Science.gov (United States)

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  12. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1997-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  13. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

    1998-12-31

    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  14. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann

    2015-12-01

    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  15. Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory.

    Science.gov (United States)

    Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean

    2013-09-01

    Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.

  16. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  17. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    Science.gov (United States)

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  18. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Directory of Open Access Journals (Sweden)

    Bruce R. Levin

    2017-02-01

    Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

  19. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love

    2015-08-01

    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  20. Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients.

    Directory of Open Access Journals (Sweden)

    Bai-Wei Gu

    Full Text Available Dyskeratosis congenita (DC is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed "corrected" lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells

  1. Impaired Telomere Maintenance and Decreased Canonical WNT Signaling but Normal Ribosome Biogenesis in Induced Pluripotent Stem Cells from X-Linked Dyskeratosis Congenita Patients.

    Science.gov (United States)

    Gu, Bai-Wei; Apicella, Marisa; Mills, Jason; Fan, Jian-Meng; Reeves, Dara A; French, Deborah; Podsakoff, Gregory M; Bessler, Monica; Mason, Philip J

    2015-01-01

    Dyskeratosis congenita (DC) is an inherited bone marrow failure syndrome characterized by the presence of short telomeres at presentation. Mutations in ten different genes, whose products are involved in the telomere maintenance pathway, have been shown to cause DC. The X-linked form is the most common form of the disease and is caused by mutations in the gene DKC1, encoding the protein dyskerin. Dyskerin is required for the assembly and stability of telomerase and is also involved in ribosomal RNA (rRNA) processing where it converts specific uridines to pseudouridine. DC is thought to result from failure to maintain tissues, like blood, that are renewed by stem cell activity, but research into pathogenic mechanisms has been hampered by the difficulty of obtaining stem cells from patients. We reasoned that induced pluripotent stem (iPS) cells from X-linked DC patients may provide information about the mechanisms involved. Here we describe the production of iPS cells from DC patients with DKC1 mutations Q31E, A353V and ΔL37. In addition we constructed "corrected" lines with a copy of the wild type dyskerin cDNA expressed from the AAVS1 safe harbor locus. We show that in iPS cells with DKC1 mutations telomere maintenance is compromised with short telomere lengths and decreased telomerase activity. The degree to which telomere lengths are affected by expression of telomerase during reprograming, or with ectopic expression of wild type dyskerin, is variable. The recurrent mutation A353V shows the most severe effect on telomere maintenance. A353V cells but not Q31E or ΔL37 cells, are refractory to correction by expression of wild type DKC1 cDNA. Because dyskerin is involved in both telomere maintenance and ribosome biogenesis it has been postulated that defective ribosome biogenesis and translation may contribute to the disease phenotype. Evidence from mouse and zebra fish models has supported the involvement of ribosome biogenesis but primary cells from human

  2. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

    Science.gov (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

    2004-12-01

    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  3. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

    Science.gov (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

    2016-01-01

    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  4. Purification and characterization of ribosomal proteins L27 and L30 having antimicrobial activity produced by the Lactobacillus salivarius SGL 03.

    Science.gov (United States)

    Pidutti, P; Federici, F; Brandi, J; Manna, L; Rizzi, E; Marini, U; Cecconi, D

    2018-02-01

    The aim of this study was to investigate the antimicrobial potential of proteins secreted by a new strain of Lactobacillus salivarius. The secretome of L. salivarius SGL 03 strain was analysed by gel-assisted fractionation and MS/MS to identify low-molecular-mass proteins. This strategy allowed us to identify 10 secreted proteins. Then, a combination of heterologous expression and agar well diffusion was used to characterize them as to their antimicrobial activity, mechanisms of action and stability. Our findings indicate that L27 and L30 proteins of the 50S ribosomal subunit have antimicrobial activity against Streptococcus pyogenes, Streptococcus uberis and Enterococcus faecium. In addition, both proteins are bactericidal against S. pyogenes and maintain their antimicrobial activity after different protease treatments, at acidic pH, after heat treatment, and if stored in a refrigerated ambient at least at 4°C. The overall results demonstrated that the L27 and L30 ribosomal proteins are of interest as new antimicrobial molecules to prevent the growth of S. pyogenes, S. uberis and E. faecium. Our results provide the first insight into the extra-ribosomal activity of L27 and L30 secreted proteins of L. salivarius. This study demonstrated the capacity of L. salivarius SGL 03 to produce antimicrobial molecules and suggested this strain as a promising probiotic candidate. © 2017 The Society for Applied Microbiology.

  5. High-Resolution Melting Curve Analysis of the 16S Ribosomal Gene to Detect and Identify Pathogenic and Saprophytic Leptospira Species in Colombian Isolates.

    Science.gov (United States)

    Peláez Sánchez, Ronald G; Quintero, Juan Álvaro López; Pereira, Martha María; Agudelo-Flórez, Piedad

    2017-05-01

    AbstractIt is important to identify the circulating Leptospira agent to enhance the performance of serodiagnostic tests by incorporating specific antigens of native species, develop vaccines that take into account the species/serovars circulating in different regions, and optimize prevention and control strategies. The objectives of this study were to develop a polymerase chain reaction (PCR)-high-resolution melting (HRM) assay for differentiating between species of the genus Leptospira and to verify its usefulness in identifying unknown samples to species level. A set of primers from the initial region of the 16S ribosomal gene was designed to detect and differentiate the 22 species of Leptospira . Eleven reference strains were used as controls to establish the reference species and differential melting curves. Twenty-five Colombian Leptospira isolates were studied to evaluate the usefulness of the PCR-HRM assay in identifying unknown samples to species level. This identification was confirmed by sequencing and phylogenetic analysis of the 16S ribosomal gene. Eleven Leptospira species were successfully identified, except for Leptospira meyeri / Leptospira yanagawae because the sequences were 100% identical. The 25 isolates from humans, animals, and environmental water sources were identified as Leptospira santarosai (twelve), Leptospira interrogans (nine), and L. meyeri / L. yanagawae (four). The species verification was 100% concordant between PCR-HRM and phylogenetic analysis of the 16S ribosomal gene. The PCR-HRM assay designed in this study is a useful tool for identifying Leptospira species from isolates.

  6. Improved Assembly for Gas Shielding During Welding or Brazing

    Science.gov (United States)

    Gradl, Paul; Baker, Kevin; Weeks, Jack

    2009-01-01

    An improved assembly for inert-gas shielding of a metallic joint is designed to be useable during any of a variety of both laser-based and traditional welding and brazing processes. The basic purpose of this assembly or of a typical prior related assembly is to channel the flow of a chemically inert gas to a joint to prevent environmental contamination of the joint during the welding or brazing process and, if required, to accelerate cooling upon completion of the process.

  7. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  8. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    Science.gov (United States)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  9. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    DEFF Research Database (Denmark)

    Issinger, O G

    1977-01-01

    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...

  10. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  12. Assembly tool design

    International Nuclear Information System (INIS)

    Kanamori, Naokazu; Nakahira, Masataka; Ohkawa, Yoshinao; Tada, Eisuke; Seki, Masahiro

    1996-06-01

    The reactor core of the International Thermonuclear Experimental Reactor (ITER) is assembled with a number of large and asymmetric components within a tight tolerance in order to assure the structural integrity for various loads and to provide the tritium confinement. In addition, the assembly procedure should be compatible with remote operation since the core structures will be activated by 14-MeV neutrons once it starts operation and thus personal access will be prohibited. Accordingly, the assembly procedure and tool design are quite essential and should be designed from the beginning to facilitate remote operation. According to the ITER Design Task Agreement, the Japan Atomic Energy Research Institute (JAERI) has performed design study to develop the assembly procedures and associated tool design for the ITER tokamak assembly. This report describes outlines of the assembly tools and the remaining issues obtained in this design study. (author)

  13. High-resolution microscopy of active ribosomal genes and key members of the rRNA processing machinery inside nucleolus-like bodies of fully-grown mouse oocytes.

    Science.gov (United States)

    Shishova, Kseniya V; Khodarovich, Yuriy M; Lavrentyeva, Elena A; Zatsepina, Olga V

    2015-10-01

    Nucleolus-like bodies (NLBs) of fully-grown (germinal vesicle, GV) mammalian oocytes are traditionally considered as morphologically distinct entities, which, unlike normal nucleoli, contain transcribed ribosomal genes (rDNA) solely at their surface. In the current study, we for the first time showed that active ribosomal genes are present not only on the surface but also inside NLBs of the NSN-type oocytes. The "internal" rRNA synthesis was evidenced by cytoplasmic microinjections of BrUTP as precursor and by fluorescence in situ hybridization with a probe to the short-lived 5'ETS segment of the 47S pre-rRNA. We further showed that in the NLB mass of NSN-oocytes, distribution of active rDNA, RNA polymerase I (UBF) and rRNA processing (fibrillarin) protein factors, U3 snoRNA, pre-rRNAs and 18S/28S rRNAs is remarkably similar to that in somatic nucleoli capable to make pre-ribosomes. Overall, these observations support the occurrence of rDNA transcription, rRNA processing and pre-ribosome assembly in the NSN-type NLBs and so that their functional similarity to normal nucleoli. Unlike the NSN-type NLBs, the NLBs of more mature SN-oocytes do not contain transcribed rRNA genes, U3 snoRNA, pre-rRNAs, 18S and 28S rRNAs. These results favor the idea that in a process of transformation of NSN-oocytes to SN-oocytes, NLBs cease to produce pre-ribosomes and, moreover, lose their rRNAs. We also concluded that a denaturing fixative 70% ethanol used in the study to fix oocytes could be more appropriate for light microscopy analysis of nucleolar RNAs and proteins in mammalian fully-grown oocytes than a commonly used cross-linking aldehyde fixative, formalin. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Fuel assembly storage pool

    International Nuclear Information System (INIS)

    Hiranuma, Hiroshi.

    1976-01-01

    Object: To remove limitation of the number of storage of fuel assemblies to increase the number of storage thereof so as to relatively reduce the water depth required for shielding radioactive rays. Structure: Fuel assembly storage rack containers for receiving a plurality of spent fuel assembly racks are stacked in multi-layer fashion within a storage pool filled with water for shielding radioactive rays and removing heat. (Furukawa, Y.)

  15. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  16. Target Assembly Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Target Assembly Facility integrates new armor concepts into actual armored vehicles. Featuring the capability ofmachining and cutting radioactive materials, it...

  17. Composite turbine bucket assembly

    Science.gov (United States)

    Liotta, Gary Charles; Garcia-Crespo, Andres

    2014-05-20

    A composite turbine blade assembly includes a ceramic blade including an airfoil portion, a shank portion and an attachment portion; and a transition assembly adapted to attach the ceramic blade to a turbine disk or rotor, the transition assembly including first and second transition components clamped together, trapping said ceramic airfoil therebetween. Interior surfaces of the first and second transition portions are formed to mate with the shank portion and the attachment portion of the ceramic blade, and exterior surfaces of said first and second transition components are formed to include an attachment feature enabling the transition assembly to be attached to the turbine rotor or disk.

  18. Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations

    Energy Technology Data Exchange (ETDEWEB)

    Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum

    1984-12-01

    Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 ..mu..m/sup 2/ can be derived from the experimental data.

  19. Analysis of Ribosome Inactivating Protein (RIP): A Bioinformatics Approach

    Science.gov (United States)

    Jothi, G. Edward Gnana; Majilla, G. Sahaya Jose; Subhashini, D.; Deivasigamani, B.

    2012-10-01

    In spite of the medical advances in recent years, the world is in need of different sources to encounter certain health issues.Ribosome Inactivating Proteins (RIPs) were found to be one among them. In order to get easy access about RIPs, there is a need to analyse RIPs towards constructing a database on RIPs. Also, multiple sequence alignment was done towards screening for homologues of significant RIPs from rare sources against RIPs from easily available sources in terms of similarity. Protein sequences were retrieved from SWISS-PROT and are further analysed using pair wise and multiple sequence alignment.Analysis shows that, 151 RIPs have been characterized to date. Amongst them, there are 87 type I, 37 type II, 1 type III and 25 unknown RIPs. The sequence length information of various RIPs about the availability of full or partial sequence was also found. The multiple sequence alignment of 37 type I RIP using the online server Multalin, indicates the presence of 20 conserved residues. Pairwise alignment and multiple sequence alignment of certain selected RIPs in two groups namely Group I and Group II were carried out and the consensus level was found to be 98%, 98% and 90% respectively.

  20. Automated genome mining of ribosomal peptide natural products

    Energy Technology Data Exchange (ETDEWEB)

    Mohimani, Hosein; Kersten, Roland; Liu, Wei; Wang, Mingxun; Purvine, Samuel O.; Wu, Si; Brewer, Heather M.; Pasa-Tolic, Ljiljana; Bandeira, Nuno; Moore, Bradley S.; Pevzner, Pavel A.; Dorrestein, Pieter C.

    2014-07-31

    Ribosomally synthesized and posttranslationally modified peptides (RiPPs), especially from microbial sources, are a large group of bioactive natural products that are a promising source of new (bio)chemistry and bioactivity (1). In light of exponentially increasing microbial genome databases and improved mass spectrometry (MS)-based metabolomic platforms, there is a need for computational tools that connect natural product genotypes predicted from microbial genome sequences with their corresponding chemotypes from metabolomic datasets. Here, we introduce RiPPquest, a tandem mass spectrometry database search tool for identification of microbial RiPPs and apply it for lanthipeptide discovery. RiPPquest uses genomics to limit search space to the vicinity of RiPP biosynthetic genes and proteomics to analyze extensive peptide modifications and compute p-values of peptide-spectrum matches (PSMs). We highlight RiPPquest by connection of multiple RiPPs from extracts of Streptomyces to their gene clusters and by the discovery of a new class III lanthipeptide, informatipeptin, from Streptomyces viridochromogenes DSM 40736 as the first natural product to be identified in an automated fashion by genome mining. The presented tool is available at cy-clo.ucsd.edu.

  1. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    Science.gov (United States)

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-04-16

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  2. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome.

    Science.gov (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad

    2017-05-19

    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  3. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk

    2005-01-01

    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....

  4. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne

    2011-01-01

    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  5. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena; Carbone, Ennio; Di Fabrizio, Enzo M.; Tirinato, Luca; Petruchek, Maria; Drummond, Catherine; Kovalevska, Larysa; Gurrapu, Sreeharsha; Mushtaq, Muhammad; Darekar, Suhas D.

    2015-01-01

    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways

  6. Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding.

    Science.gov (United States)

    Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter

    2013-07-01

    Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

  7. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation

    Science.gov (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.

    2016-01-01

    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  8. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    Science.gov (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  9. The ribosome uses two active mechanisms to unwind messenger RNA during translation.

    Science.gov (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio

    2011-07-06

    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  10. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T

    2003-01-01

    , of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

  11. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole

    1976-01-01

    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  12. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

    1978-01-01

    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  13. The complete structure of the large subunit of the mammalian mitochondrial ribosome.

    Science.gov (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

    2014-11-13

    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  14. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.

    Science.gov (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek

    2017-06-29

    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  16. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

    Science.gov (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

    2007-12-07

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  17. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes

    2018-02-01

    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  18. Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

    Science.gov (United States)

    Alejo, Jose L; Blanchard, Scott C

    2017-10-10

    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  19. Nuclear fuel assembly

    International Nuclear Information System (INIS)

    Delafosse, Jacques.

    1977-01-01

    This invention relates to a nuclear fuel assembly for a light or heavy water reactor, or for a fast reactor of the kind with a bundle of cladded pins, maintained parallel to each other in a regular network by an assembly of separate supporting grids, fitted with elastic bearing surfaces on these pins [fr

  20. Assembling Transgender Moments

    Science.gov (United States)

    Greteman, Adam J.

    2017-01-01

    In this article, the author seeks to assemble moments--scholarly, popular, and aesthetic--in order to explore the possibilities that emerge as moments collect in education's encounters with the needs, struggles, and possibilities of transgender lives and practices. Assembling moments, the author argues, illustrates the value of "moments"…

  1. Vertical pump assembly

    International Nuclear Information System (INIS)

    Dohnal, M.; Rosel, J.; Skarka, V.

    1988-01-01

    The mounting is described of the drive assembly of a vertical pump for nuclear power plants in areas with seismic risk. The assembly is attached to the building floor using flexible and damping elements. The design allows producing seismically resistant pumps without major design changes in the existing types of vertical pumps. (E.S.). 1 fig

  2. Self-assembled nanostructures

    CERN Document Server

    Zhang, Jin Z; Liu, Jun; Chen, Shaowei; Liu, Gang-yu

    2003-01-01

    Nanostructures refer to materials that have relevant dimensions on the nanometer length scales and reside in the mesoscopic regime between isolated atoms and molecules in bulk matter. These materials have unique physical properties that are distinctly different from bulk materials. Self-Assembled Nanostructures provides systematic coverage of basic nanomaterials science including materials assembly and synthesis, characterization, and application. Suitable for both beginners and experts, it balances the chemistry aspects of nanomaterials with physical principles. It also highlights nanomaterial-based architectures including assembled or self-assembled systems. Filled with in-depth discussion of important applications of nano-architectures as well as potential applications ranging from physical to chemical and biological systems, Self-Assembled Nanostructures is the essential reference or text for scientists involved with nanostructures.

  3. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome.

    Science.gov (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta

    2010-06-18

    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  4. Reusable fuel test assembly for the FFTF

    International Nuclear Information System (INIS)

    Pitner, A.L.; Dittmer, J.O.

    1992-01-01

    A fuel test assembly that provides re-irradiation capability after interim discharge and reconstitution of the test pin bundle has been developed for use in the Fast Flux Test Facility (FFTF). This test vehicle permits irradiation test data to be obtained at multiple exposures on a few select test pins without the substantial expense of fabricating individual test assemblies as would otherwise be required. A variety of test pin types can be loaded in the reusable test assembly. A reusable test vehicle for irradiation testing in the FFTF has long been desired, but a number of obstacles previously prevented the implementation of such an experimental rig. The MFF-8A test assembly employs a 169-pin bundle using HT-9 alloy for duct and cladding material. The standard driver pins in the fuel bundle are sodium-bonded metal fuel (U-10 wt% Zr). Thirty-seven positions in the bundle are replaceable pin positions. Standard MFF-8A driver pins can be loaded in any test pin location to fill the bundle if necessary. Application of the MFF-8A reusable test assembly in the FFTF constitutes a considerable cost-saving measure with regard to irradiation testing. Only a few well-characterized test pins need be fabricated to conduct a test program rather than constructing entire test assemblies

  5. TESS Lens-Bezel Assembly Modal Testing

    Science.gov (United States)

    Dilworth, Brandon J.; Karlicek, Alexandra

    2017-01-01

    The Transiting Exoplanet Survey Satellite (TESS) program, led by the Kavli Institute for Astrophysics and Space Research at the Massachusetts Institute of Technology (MIT) will be the first-ever spaceborne all-sky transit survey. MIT Lincoln Laboratory is responsible for the cameras, including the lens assemblies, detector assemblies, lens hoods, and camera mounts. TESS is scheduled to be launched in August of 2017 with the primary goal to detect small planets with bright host starts in the solar neighborhood, so that detailed characterizations of the planets and their atmospheres can be performed. The TESS payload consists of four identical cameras and a data handling unit. Each camera consists of a lens assembly with seven optical elements and a detector assembly with four charge-coupled devices (CCDs) including their associated electronics. The optical prescription requires that several of the lenses are in close proximity to a neighboring element. A finite element model (FEM) was developed to estimate the relative deflections between each lens-bezel assembly under launch loads to predict that there are adequate clearances preventing the lenses from making contact. Modal tests using non-contact response measurements were conducted to experimentally estimate the modal parameters of the lens-bezel assembly, and used to validate the initial FEM assumptions. Key Words Non-contact measurements, modal analysis, model validation

  6. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S

    1993-01-01

    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  7. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin

    2017-05-01

    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  8. TPX assembly plan

    International Nuclear Information System (INIS)

    Knutson, D.

    1993-01-01

    The TPX machine will be assembled in the TFTR Test Cell at the Plasma Physics Laboratory, utilizing the existing TFTR machine foundation. Preparation of the area for assembly will begin after completion of the decontamination and decommissioning phase on TFTR and certification that the radiation levels remaining, if any, are consistent with the types of operations planned. Assembly operations begin with the arrival of the first components, and conclude, approximately 24 months later, with the successful completion of the integrated systems tests and the achievement of a first plasma

  9. Nuclear reactor control assembly

    International Nuclear Information System (INIS)

    Negron, S.B.

    1991-01-01

    This patent describes an assembly for providing global power control in a nuclear reactor having the core split into two halves. It comprises a disk assembly formed from at least two disks each machined with an identical surface hole pattern such that rotation of one disk relative to the other causes the hole pattern to open or close, the disk assembly being positioned substantially at the longitudinal center of and coaxial with the core halves; and means for rotating at least one of the disks relative to the other

  10. Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

    Science.gov (United States)

    Högenauer, G; Ruf, C

    1981-01-01

    Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

  11. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

    Science.gov (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

    2012-10-01

    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  12. Small-molecule inhibitor leads of ribosome-inactivating proteins developed using the doorstop approach.

    Directory of Open Access Journals (Sweden)

    Yuan-Ping Pang

    2011-03-01

    Full Text Available Ribosome-inactivating proteins (RIPs are toxic because they bind to 28S rRNA and depurinate a specific adenine residue from the α-sarcin/ricin loop (SRL, thereby inhibiting protein synthesis. Shiga-like toxins (Stx1 and Stx2, produced by Escherichia coli, are RIPs that cause outbreaks of foodborne diseases with significant morbidity and mortality. Ricin, produced by the castor bean plant, is another RIP lethal to mammals. Currently, no US Food and Drug Administration-approved vaccines nor therapeutics exist to protect against ricin, Shiga-like toxins, or other RIPs. Development of effective small-molecule RIP inhibitors as therapeutics is challenging because strong electrostatic interactions at the RIP•SRL interface make drug-like molecules ineffective in competing with the rRNA for binding to RIPs. Herein, we report small molecules that show up to 20% cell protection against ricin or Stx2 at a drug concentration of 300 nM. These molecules were discovered using the doorstop approach, a new approach to protein•polynucleotide inhibitors that identifies small molecules as doorstops to prevent an active-site residue of an RIP (e.g., Tyr80 of ricin or Tyr77 of Stx2 from adopting an active conformation thereby blocking the function of the protein rather than contenders in the competition for binding to the RIP. This work offers promising leads for developing RIP therapeutics. The results suggest that the doorstop approach might also be applicable in the development of other protein•polynucleotide inhibitors as antiviral agents such as inhibitors of the Z-DNA binding proteins in poxviruses. This work also calls for careful chemical and biological characterization of drug leads obtained from chemical screens to avoid the identification of irrelevant chemical structures and to avoid the interference caused by direct interactions between the chemicals being screened and the luciferase reporter used in screening assays.

  13. Chromatin dynamics of plant telomeres and ribosomal genes

    Czech Academy of Sciences Publication Activity Database

    Dvořáčková, Martina; Fojtová, Miloslava; Fajkus, Jiří

    2015-01-01

    Roč. 83, č. 1 (2015), s. 18-37 ISSN 0960-7412 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0068; GA ČR(CZ) GA13-06943S; GA ČR(CZ) GP13-11563P Grant - others:GA ČR(CZ) GAP501/11/0289 Institutional support: RVO:68081707 Keywords : HISTONE VARIANT H3.3 * ASSEMBLY FACTOR-I * REPLICATION FORK PROGRESSION Subject RIV: BO - Biophysics Impact factor: 5.468, year: 2015

  14. Intragenomic polymorphisms among high-copy loci: a genus-wide study of nuclear ribosomal DNA in Asclepias (Apocynaceae).

    Science.gov (United States)

    Weitemier, Kevin; Straub, Shannon C K; Fishbein, Mark; Liston, Aaron

    2015-01-01

    Despite knowledge that concerted evolution of high-copy loci is often imperfect, studies that investigate the extent of intragenomic polymorphisms and comparisons across a large number of species are rarely made. We present a bioinformatic pipeline for characterizing polymorphisms within an individual among copies of a high-copy locus. Results are presented for nuclear ribosomal DNA (nrDNA) across the milkweed genus, Asclepias. The 18S-26S portion of the nrDNA cistron of Asclepias syriaca served as a reference for assembly of the region from 124 samples representing 90 species of Asclepias. Reads were mapped back to each individual's consensus and at each position reads differing from the consensus were tallied using a custom perl script. Low frequency polymorphisms existed in all individuals (mean = 5.8%). Most nrDNA positions (91%) were polymorphic in at least one individual, with polymorphic sites being less frequent in subunit regions and loops. Highly polymorphic sites existed in each individual, with highest abundance in the "noncoding" ITS regions. Phylogenetic signal was present in the distribution of intragenomic polymorphisms across the genus. Intragenomic polymorphisms in nrDNA are common in Asclepias, being found at higher frequency than any other study to date. The high and variable frequency of polymorphisms across species highlights concerns that phylogenetic applications of nrDNA may be error-prone. The new analytical approach provided here is applicable to other taxa and other high-copy regions characterized by low coverage genome sequencing (genome skimming).

  15. Prevention of nuclear war

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    Removing the threat of a nuclear war-as the General Assembly formally stated in the Final Document of its first special session devoted to disarmament, in 1978-is considered to be the task of the present day. In that Document, the General Assembly sought to establish principles, guidelines and procedures for preventing nuclear war. It declared that to that end, it was imperative to remove the threat of nuclear weapons, to halt and reverse the nuclear-arms race until the total elimination of nuclear weapons and their delivery systems had been achieved (see chapter iv), and to prevent the proliferation of nuclear weapons (see chapter VII). At the same time, it called for other measures designed to prevent the outbreak of nuclear war and to lessen the danger of the treat or use of nuclear weapons. The Assembly's clear call for action was dictated by the awareness that there was no insuperable barrier dividing peace from war and that, unless nations brought the spiralling nuclear-arms race to an end, the day might come when nuclear weapons would actually be used, with catastrophic consequences. In adopting the Final Document, the international community achieved, for the first time, a consensus on an international disarmament strategy having as its immediate goal the elimination of the danger of a nuclear war and the implementation of measures to halt and reverse the arms race. The General Assembly, at its second special session on disarmament, in 1982, reaffirmed the validity of the 1978 Final Document. This paper reports that nuclear issues and in particular the prevention of nuclear war remain, however, major concerns of all States. Undoubtedly, all nations have a vital interest in the negotiation of effective measures for her prevention of nuclear war, since nuclear weapons pose a unique threat to human survival. If nuclear war were to occur, its consequences would be global, not simple regional

  16. Fuel assembly spacer

    International Nuclear Information System (INIS)

    Shirakawa, Ken-etsu.

    1988-01-01

    Purpose: To reduce the pressure loss of coolants by fuel assembly spacers. Constitution: Spacers for supporting a fuel assembly are attached by means of a plurality of wires to an outer frame. The outer frame is made of shape memory alloy such that the wires are caused to slacken at normal temperature and the slacking of the wires is eliminated in excess of the transition temperature. Since the wires slacken at the normal temperature, fuel rods can be inserted easily. After the insertion of the fuel rods, when the entire portion or the outer frame is heated by water or gas at a predetermined temperature, the outer frame resumes its previously memorized shape to tighten the wires and, accordingly, the fuel rods can be supported firmly. In this way, since the fuel rods are inserted in the slacken state of the wires and, after the assembling, the outer frame resumes its memorized shape, the assembling work can be conducted efficiently. (Kamimura, M.)

  17. Nuclear reactor spacer assembly

    International Nuclear Information System (INIS)

    Anthony, A.J.; Groves, M.D.

    1979-01-01

    A fuel assembly for a nuclear reactor is disclosed wherein the fuel element receiving and supporting grid is comprised of a first metal, the guide tubes which pass through the grid assembly are comprised of a second metal and the grid is supported on the guide tubes by means of expanded sleeves located intermediate the grid and guide tubes. The fuel assembly is fabricated by inserting the sleeves, of initial outer diameter commensurate with the guide tube outer diameters, through the holes in the grid assembly provided for the guide tubes and thereafter expanding the sleeves radially outwardly along their entire length such that the guide tubes can subsequently be passed through the sleeves. The step of radial expansion, as a result of windows provided in the sleeves having dimensions commensurate with the geometry of the grid, mechanically captures the grid and simultaneously preloads the sleeve against the grid whereby relative motion between the grid and guide tube will be precluded

  18. Nuclear reactor fuel assembly

    International Nuclear Information System (INIS)

    Vikhorev, Yu.V.; Biryukov, G.I.; Kirilyuk, N.A.; Lobanov, V.N.

    1977-01-01

    A fuel assembly is proposed for nuclear reactors allowing remote replacement of control rod bundles or their shifting from one assembly to another, i.e., their multipurpose use. This leads to a significant increase in fuel assembly usability. In the fuel assembly the control rod bundle is placed in guide tube channels to which baffles are attached for fuel element spacing. The remote handling of control rods is provided by a hollow cylinder with openings in its lower bottom through which the control rods pass. All control rods in a bundle are mounted to a cross beam which in turn is mounted in the cylinder and is designed for grasping the whole rod bundle by a remotely controlled telescopic mechanism in bundle replacement or shifting. (Z.M.)

  19. Nuclear fuel assembly

    International Nuclear Information System (INIS)

    Betten, P.R.

    1976-01-01

    Under the invention the fuel assembly is particularly suitable for liquid metal cooled fast neutron breeder reactors. Hence, according to the invention a fuel assembly cladding includes inward corrugations with respect to the remainder of the cladding according to a recurring pattern determined by the pitch of the metal wire helically wound round the fuel rods of the assembly. The parts of the cladding pressed inwards correspond to the areas in which the wire encircling the peripheral fuel rods is generally located apart from the cladding, thereby reducing the play between the cladding and the peripheral fuel rods situated in these areas. The reduction in the play in turn improves the coolant flow in the internal secondary channels of the fuel assembly to the detriment of the flow in the peripheral secondary channels and thereby establishes a better coolant fluid temperature profile [fr

  20. Nuclear reactor fuel assembly

    International Nuclear Information System (INIS)

    Sakurai, Shungo; Ogiya, Shunsuke.

    1990-01-01

    In a fuel assembly, if the entire fuels comprise mixed oxide fuels, reactivity change in cold temperature-power operation is increased to worsen the reactor shutdown margin. The reactor shutdown margin has been improved by increasing the burnable poison concentration thereby reducing the reactivity of the fuel assembly. However, since unburnt poisons are present at the completion of the reactor operation, the reactivity can not be utilized effectively to bring about economical disadvantage. In view of the above, the reactivity change between lower temperature-power operations is reduced by providing a non-boiling range with more than 9.1% of cross sectional area at the inside of a channel at the central portion of the fuel assembly. As a result, the amount of the unburnt burnable poisons is decreased, the economy of fuel assembly is improved and the reactor shutdown margin can be increase. (N.H.)

  1. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.

    1982-01-01

    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  2. Polymer Directed Protein Assemblies

    Directory of Open Access Journals (Sweden)

    Patrick van Rijn

    2013-05-01

    Full Text Available Protein aggregation and protein self-assembly is an important occurrence in natural systems, and is in some form or other dictated by biopolymers. Very obvious influences of biopolymers on protein assemblies are, e.g., virus particles. Viruses are a multi-protein assembly of which the morphology is dictated by poly-nucleotides namely RNA or DNA. This “biopolymer” directs the proteins and imposes limitations on the structure like the length or diameter of the particle. Not only do these bionanoparticles use polymer-directed self-assembly, also processes like amyloid formation are in a way a result of directed protein assembly by partial unfolded/misfolded biopolymers namely, polypeptides. The combination of proteins and synthetic polymers, inspired by the natural processes, are therefore regarded as a highly promising area of research. Directed protein assembly is versatile with respect to the possible interactions which brings together the protein and polymer, e.g., electrostatic, v.d. Waals forces or covalent conjugation, and possible combinations are numerous due to the large amounts of different polymers and proteins available. The protein-polymer interacting behavior and overall morphology is envisioned to aid in clarifying protein-protein interactions and are thought to entail some interesting new functions and properties which will ultimately lead to novel bio-hybrid materials.

  3. The Insect Pathogen Serratia marcescens Db10 Uses a Hybrid Non-Ribosomal Peptide Synthetase-Polyketide Synthase to Produce the Antibiotic Althiomycin

    Science.gov (United States)

    Challis, Gregory L.; Stanley-Wall, Nicola R.; Coulthurst, Sarah J.

    2012-01-01

    There is a continuing need to discover new bioactive natural products, such as antibiotics, in genetically-amenable micro-organisms. We observed that the enteric insect pathogen, Serratia marcescens Db10, produced a diffusible compound that inhibited the growth of Bacillis subtilis and Staphyloccocus aureus. Mapping the genetic locus required for this activity revealed a putative natural product biosynthetic gene cluster, further defined to a six-gene operon named alb1–alb6. Bioinformatic analysis of the proteins encoded by alb1–6 predicted a hybrid non-ribosomal peptide synthetase-polyketide synthase (NRPS-PKS) assembly line (Alb4/5/6), tailoring enzymes (Alb2/3) and an export/resistance protein (Alb1), and suggested that the machinery assembled althiomycin or a related molecule. Althiomycin is a ribosome-inhibiting antibiotic whose biosynthetic machinery had been elusive for decades. Chromatographic and spectroscopic analyses confirmed that wild type S. marcescens produced althiomycin and that production was eliminated on disruption of the alb gene cluster. Construction of mutants with in-frame deletions of specific alb genes demonstrated that Alb2–Alb5 were essential for althiomycin production, whereas Alb6 was required for maximal production of the antibiotic. A phosphopantetheinyl transferase enzyme required for althiomycin biosynthesis was also identified. Expression of Alb1, a predicted major facilitator superfamily efflux pump, conferred althiomycin resistance on another, sensitive, strain of S. marcescens. This is the first report of althiomycin production outside of the Myxobacteria or Streptomyces and paves the way for future exploitation of the biosynthetic machinery, since S. marcescens represents a convenient and tractable producing organism. PMID:23028578

  4. p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

    Directory of Open Access Journals (Sweden)

    Kiran Hasygar

    2014-11-01

    Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

  5. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes.

    Science.gov (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V

    2009-01-01

    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  6. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando

    2010-01-01

    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  7. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN

    Science.gov (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth

    2015-01-01

    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  8. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus.

    Science.gov (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc

    2006-02-01

    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  9. The nuclear import of ribosomal proteins is regulated by mTOR

    Science.gov (United States)

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.

    2014-01-01

    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  10. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  11. Evidence that the primary effect of phosphorylation of eukaryotic initiation factor 2(alpha) in rabbit reticulocyte lysate is inhibition of the release of eukaryotic initiation factor-2.GDP from 60 S ribosomal subunits

    International Nuclear Information System (INIS)

    Gross, M.; Redman, R.; Kaplansky, D.A.

    1985-01-01

    The phosphorylation of eukaryotic initiation factor (eIF) 2 alpha that occurs when rabbit reticulocyte lysate is incubated in the absence of hemin or with poly(I.C) causes inhibition of polypeptide chain initiation by preventing a separate factor (termed RF) from promoting the exchange of GTP for GDP on eIF-2. When lysate was incubated in the presence of hemin and [ 14 C] eIF-2 or [alpha- 32 P]GTP, the authors observed binding of eIF-2 and GDP or GTP to 60 S ribosomal subunits that was slightly greater than that bound to 40 S subunits and little binding to 80 S ribosomes. When incubation was in the absence of hemin or in the presence of hemin plus 0.1 microgram/ml poly(I.C), eIF-2 and GDP binding to 60 S subunits was increased 1.5- to 2-fold, that bound to 80 S ribosomes was almost as great as that bound to 60 S subunits, and that bound to 40 S subunits was unchanged. The data indicate that about 40% of the eIF-2 that becomes bound to 60 S subunits and 80 S ribosomes in the absence of hemin or with poly(I.C) is eIF-2(alpha-P) and suggest that the eIF-2 and GDP bound is probably in the form of a binary complex. The rate of turnover of GDP (presumably eIF-2.GDP) on 60 S subunits and 80 S ribosomes in the absence of hemin is reduced to less than 10% the control rate, because the dissociation of eIF-2.GDP is inhibited. Our findings suggest that eIF-2.GTP binding to and eIF-2.GDP release from 60 S subunits may normally occur and serve to promote subunit joining

  12. Human Assisted Assembly Processes

    Energy Technology Data Exchange (ETDEWEB)

    CALTON,TERRI L.; PETERS,RALPH R.

    2000-01-01

    Automatic assembly sequencing and visualization tools are valuable in determining the best assembly sequences, but without Human Factors and Figure Models (HFFMs) it is difficult to evaluate or visualize human interaction. In industry, accelerating technological advances and shorter market windows have forced companies to turn to an agile manufacturing paradigm. This trend has promoted computerized automation of product design and manufacturing processes, such as automated assembly planning. However, all automated assembly planning software tools assume that the individual components fly into their assembled configuration and generate what appear to be a perfectly valid operations, but in reality the operations cannot physically be carried out by a human. Similarly, human figure modeling algorithms may indicate that assembly operations are not feasible and consequently force design modifications; however, if they had the capability to quickly generate alternative assembly sequences, they might have identified a feasible solution. To solve this problem HFFMs must be integrated with automated assembly planning to allow engineers to verify that assembly operations are possible and to see ways to make the designs even better. Factories will very likely put humans and robots together in cooperative environments to meet the demands for customized products, for purposes including robotic and automated assembly. For robots to work harmoniously within an integrated environment with humans the robots must have cooperative operational skills. For example, in a human only environment, humans may tolerate collisions with one another if they did not cause much pain. This level of tolerance may or may not apply to robot-human environments. Humans expect that robots will be able to operate and navigate in their environments without collisions or interference. The ability to accomplish this is linked to the sensing capabilities available. Current work in the field of cooperative

  13. Holddown device for nuclear fuel assembly

    International Nuclear Information System (INIS)

    Anthony, A.J.

    1978-01-01

    An apparatus for preventing ''floating'' of nuclear-reactor fuel assemblies due to hydraulic forces is disclosed. The apparatus uses a holddown column made of the same material as the core barrel. The column is positioned in a center guide-tube location in the fuel assembly in such a manner as to enable it either to slide within the center guide tube or, if the center guide tube is replaced by the column, to slide through openings in the spacer grids. The lower end of the holddown column engages the lower end fitting of the fuel assembly, and the upper end of the column engages a flow plate to which holddown force is applied. As a consequence of this arrangement, holddown force is transmitted from the flow plate through the holddown column to the lower end fitting. Movement of the fuel assembly is thereby prevented without a compression load being applied to the fuel-assemb1ly structure. In addition, variations due to thermal expansion in the distance between the lower core plate and the upper core plate are largely made up for by corresponding variations in the holddown column because the holddown column and the core barrel can be made of the same material

  14. Dynamic behaviour of diagnostic assemblies

    International Nuclear Information System (INIS)

    Pecinka, L.

    1980-01-01

    The methodology is shown of calculating the frequency spectrum of a diagnostic assembly. The oscillations of the assembly as a whole, of a fuel rod bundle, the assembly jacket and of the individual rods in the bundle were considered. The manufacture is suggested of a model assembly which would be used for testing forced vibrations using an experimental water loop. (M.S.)

  15. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus.

    Science.gov (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M

    1991-06-01

    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  16. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon.

    Science.gov (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad

    2016-01-25

    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  17. Detection of protein-protein interactions by ribosome display and protein in situ immobilisation.

    Science.gov (United States)

    He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J

    2009-12-31

    We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

  18. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A

    1982-01-01

    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  19. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y

    1989-01-01

    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  20. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.

    1987-01-01

    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  1. Site-specific fluorescent labeling of nascent proteins on the translating ribosome.

    Science.gov (United States)

    Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou

    2011-09-28

    As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.

  2. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  3. Free and membrane-bound ribosomes and polysomes in hippocampal neurons during a learning experiment.

    Science.gov (United States)

    Wenzel, J; David, H; Pohle, W; Marx, I; Matthies, H

    1975-01-24

    The ribosomes of the CA1 and CA3 pyramidal cells of hipocampus were investigated by morphometric methods after the acquisition of a shock-motivated brightness discrimination in rats. A significant increase in the total number of ribosomes was observed in CA1 cells of trained animals and in CA3 cells of both active controls and trained rats. A significant increase in membrane-bound ribosomes was obtained in CA1 and CA3 cells after training only. The results confirm the suggestion of an increased protein synthesis in hippocampal neurons during and after the acquisition of a brightness discrimination, as we have concluded from out previous investigations on the incorporation of labeled amino acids under identical experimental conditions. The results lead to the assumption that the protein synthesis in some neuronal cells may probably differ not only quantitatively, but also qualitatively in trained and untrained animals.

  4. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

  5. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.

    Science.gov (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C

    2015-11-05

    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    Science.gov (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-04

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  8. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

    2008-01-01

    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  9. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

    Science.gov (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

    2016-12-06

    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  10. The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel

    DEFF Research Database (Denmark)

    Wekselman, I.; Zimmerman, E.; Davidovich, C.

    2017-01-01

    in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...

  11. The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

    DEFF Research Database (Denmark)

    Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen

    2017-01-01

    Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

  12. Implementation of communication-mediating domains for non-ribosomal peptide production in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Siewers, Verena; San-Bento, Rita; Nielsen, Jens

    2010-01-01

    Saccharomyces cerevisiae has in several cases been proven to be a suitable host for the production of natural products and was recently exploited for the production of non-ribosomal peptides. Synthesis of non-ribosomal peptides (NRPs) is mediated by NRP synthetases (NRPSs), modular enzymes, which...... are often organized in enzyme complexes. In these complexes, partner NRPSs interact via communication-mediating domains (COM domains). In order to test whether functional interaction between separate NRPS modules is possible in yeast we constructed a yeast strain expressing two modules with compatible COM...

  13. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  14. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  15. Acidic ribosomal proteins and histone H3 from Leishmania present a high rate of divergence

    Directory of Open Access Journals (Sweden)

    Ysabel Montoya

    2000-08-01

    Full Text Available Another additional peculiarity in Leishmania will be discussed about of the amino acid divergence rate of three structural proteins: acidic ribosomal P1 and P2b proteins, and histone H3 by using multiple sequence alignment and dendrograms. These structural proteins present a high rate of divergence regarding to their homologous protein in Trypanosoma cruzi. At this regard, L. (V. peruviana P1 and T. cruzi P1 showed 57.4% of divergence rate. Likewise, L. (V. braziliensis histone H3 and acidic ribosomal P2 protein exhibited 31.8% and 41.7% respectively of rate of divergence in comparison with their homologous in T. cruzi.

  16. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A

    2014-01-01

    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  17. Blade attachment assembly

    Science.gov (United States)

    Garcia-Crespo, Andres Jose; Delvaux, John McConnell; Miller, Diane Patricia

    2016-05-03

    An assembly and method for affixing a turbomachine rotor blade to a rotor wheel are disclosed. In an embodiment, an adaptor member is provided disposed between the blade and the rotor wheel, the adaptor member including an adaptor attachment slot that is complementary to the blade attachment member, and an adaptor attachment member that is complementary to the rotor wheel attachment slot. A coverplate is provided, having a coverplate attachment member that is complementary to the rotor wheel attachment slot, and a hook for engaging the adaptor member. When assembled, the coverplate member matingly engages with the adaptor member, and retains the blade in the adaptor member, and the assembly in the rotor wheel.

  18. Reactor and fuel assembly

    International Nuclear Information System (INIS)

    Ishii, Yoshihiko; Bessho, Yasunori; Sano, Hiroki; Yokomizo, Osamu; Yamashita, Jun-ichi.

    1990-01-01

    The present invention realizes an effective spectral operation by applying an optimum pressure loss coefficient while taking the characteristics of a lower tie plate into consideration. That is, the pressure loss coefficient of the lower tie plate is optimized by varying the cross sectional area of a fuel assembly flow channel in the lower tie plate or varying the surface roughness of a coolant flow channel in the lower tie plate. Since there is a pressure loss coefficient to optimize the moderator density over a flow rate change region, the effect of spectral shift rods can be improved by setting the optimum pressure loss coefficient of the lower tie plate. According to the present invention, existent fuel assemblies can easily be changed successively to fuel assemblies having spectral shift rods of a great spectral shift effect by using existent reactor facilities as they are. (I.S.)

  19. Power module assembly

    Science.gov (United States)

    Campbell, Jeremy B [Torrance, CA; Newson, Steve [Redondo Beach, CA

    2011-11-15

    A power module assembly of the type suitable for deployment in a vehicular power inverter, wherein the power inverter has a grounded chassis, is provided. The power module assembly comprises a conductive base layer electrically coupled to the chassis, an insulating layer disposed on the conductive base layer, a first conductive node disposed on the insulating layer, a second conductive node disposed on the insulating layer, wherein the first and second conductive nodes are electrically isolated from each other. The power module assembly also comprises a first capacitor having a first electrode electrically connected to the conductive base layer, and a second electrode electrically connected to the first conductive node, and further comprises a second capacitor having a first electrode electrically connected to the conductive base layer, and a second electrode electrically connected to the second conductive node.

  20. Magnetic nanoparticle assemblies

    CERN Document Server

    Trohidou, Kalliopi N

    2014-01-01

    Magnetic nanoparticles with diameters in the range of a few nanometers are today at the cutting edge of modern technology and innovation because of their use in numerous applications ranging from engineering to biomedicine. A great deal of scientific interest has been focused on the functionalization of magnetic nanoparticle assemblies. The understanding of interparticle interactions is necessary to clarify the physics of these assemblies and their use in the development of high-performance magnetic materials. This book reviews prominent research studies on the static and dynamic magnetic properties of nanoparticle assemblies, gathering together experimental and computational techniques in an effort to reveal their optimized magnetic properties for biomedical use and as ultra-high magnetic recording media.

  1. Reactor fuel assembly

    International Nuclear Information System (INIS)

    Anthony, A.J.; Groves, M.D.

    1980-01-01

    A nuclear reactor fuel assembly having a lower end fitting and actuating means interacting therewith for holding the assembly down on the core support stand against the upward flow of coolant. Locking means for interacting with projections on the support stand are carried by the lower end fitting and are actuated by the movement of an actuating rod operated from above the top of the assembly. In one embodiment of the invention the downward movement of the actuating rod forces a latched spring to move outward into locking engagement with a shoulder on the support stand projections. In another embodiment, the actuating rod is rotated to effect the locking between the end fitting and the projection. (author)

  2. Liaison based assembly design

    Energy Technology Data Exchange (ETDEWEB)

    Ames, A.; Kholwadwala, D.; Wilson, R.H.

    1996-12-01

    Liaison Based Assembly Design extends the current information infrastructure to support design in terms of kinematic relationships between parts, or liaisons. These liaisons capture information regarding contact, degrees-of-freedom constraints and containment relationships between parts in an assembly. The project involved defining a useful collection of liaison representations, investigating their properties, and providing for maximum use of the data in downstream applications. We tested our ideas by implementing a prototype system involving extensions to Pro/Engineer and the Archimedes assembly planner. With an expanded product model, the design system is more able to capture design intent. When a product update is attempted, increased knowledge availability improves our ability to understand the effect of design changes. Manufacturing and analysis disciplines benefit from having liaison information available, so less time is wasted arguing over incomplete design specifications and our enterprise can be more completely integrated.

  3. Integrated magnetic transformer assembly

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to an integrated magnetics transformer assembly comprising a first magnetically permeable core forming a first substantially closed magnetic flux path and a second magnetically permeable core forming a second substantially closed magnetic flux path. A first input...... inductor winding is wound around a first predetermined segment of the first magnetically permeable core and a second input inductor winding is wound around a first predetermined segment of the second magnetically permeable core. The integrated magnetics transformer assembly further comprises a first output......-winding of the first output inductor winding and the first half-winding of the second output inductor winding are configured to produce aligned, i.e. in the same direction, magnetic fluxes through the first substantially closed magnetic flux path. The integrated magnetics transformer assembly is well- suited for use...

  4. Transfer of fuel assemblies

    International Nuclear Information System (INIS)

    Vuckovich, M.; Burkett, J. P.; Sallustio, J.

    1984-01-01

    Fuel assemblies of a nuclear reactor are transferred during fueling or refueling or the like by a crane. The work-engaging fixture of the crane picks up an assembly, removes it from this slot, transfers it to the deposit site and deposits it in its slot at the deposit site. The control for the crane includes a strain gauge connected to the crane line which raises and lowers the load. The strain gauge senses the load on the crane. The signal from the strain gauge is compared with setpoints; a high-level setpoint, a low-level setpoint and a slack-line setpoint. If the strain gauge signal exceeds the high-level setpoint, the line drive is disabled. This event may occur during raising of a fuel assembly which encounters resistance. The high-level setpoint may be overridden under proper precautions. The line drive is also disabled if the strain gauge signal is less than the low-level setpoint. This event occurs when a fuel assembly being deposited contacts the bottom of its slot or an obstruction in, or at the entry to the slot. To preclude lateral movement and possible damage to a fuel assembly suspended from the crane line, the traverse drive of the crane is disabled once the strain-gauge exceets the lov-level setpoint. The traverse drive can only be enabled after the strain-gauge signal is less than the slack-line set-point. This occurs when the lines has been set in slack-line setting. When the line is tensioned after slack-li ne setting, the traverse drive remains enabled only if the line has been disconnected from the fuel assembly

  5. Assembling RNA Nanoparticles.

    Science.gov (United States)

    Xiao, Shou-Jun

    2017-01-01

    RNA nanoparticles are designed and self-assembled according to noncanonical interactions of naturally conserved RNA motifs and/or canonical Watson-Crick base-pairing interactions, which have potential applications in gene therapy and nanomedicine. These artificially engineered nanoparticles are mainly synthesized from in vitro transcribed RNAs, purified by denaturing and native polyacrylamide gel electrophoresis (PAGE), and characterized with native PAGE, AFM, and TEM technologies. The protocols of in vitro transcription, denaturing and native PAGE, and RNA nanoparticle self-assembly are described in detail.

  6. Assembling an aesthetic.

    Science.gov (United States)

    Candela, Emily

    2012-12-01

    Recent research informing and related to the study of three-dimensional scientific models is assembled here in a way that explores an aesthetic, specifically, of touch. I concentrate on the materiality of models, drawing on insights from the history and philosophy of science, design and metaphysics. This article chronicles the ways in which touch, or material interactions, operate in the world of 3D models, and its role in what models mean and do. I end with a call for greater attention to scientific process, described as assembly of and within science, which is revealed by this focus on touch. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Nuclear fuel assembly

    International Nuclear Information System (INIS)

    1975-01-01

    The nuclear fuel assembly described includes a cluster of fuel elements supported at a distance from each other so that their axes are parallel in order to establish secondary channels between them reserved for the coolant. Several ducts for an auxiliary cooling fluid are arranged in the cluster. The wall of each duct is pierced with coolant ejection holes which are placed circumferentially to a pre-determined pattern established according to the position of the duct in the cluster and by the axial distance of the ejection hole along the duct. This assembly is intended for reactors cooled by light or heavy water [fr

  8. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie

    2017-01-01

    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...

  9. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation.

    Science.gov (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang

    2011-04-01

    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  10. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the factor...

  11. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  12. Influence of hyperthermia on the phosphorylation of ribosomal protein S6 from human skin fibroblasts and meningioma cells

    DEFF Research Database (Denmark)

    Richter, W W; Zang, K D; Issinger, O G

    1983-01-01

    Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...

  13. Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

    International Nuclear Information System (INIS)

    Stahl, J.; Boehm, H.; Voderberg, M.

    1981-01-01

    Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

  14. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko

    2011-01-01

    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  15. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni

    1999-01-01

    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the fact...

  16. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes.

    Science.gov (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques

    2017-12-05

    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  17. Fire resistant PV shingle assembly

    Science.gov (United States)

    Lenox, Carl J.

    2012-10-02

    A fire resistant PV shingle assembly includes a PV assembly, including PV body, a fire shield and a connection member connecting the fire shield below the PV body, and a support and inter-engagement assembly. The support and inter-engagement assembly is mounted to the PV assembly and comprises a vertical support element, supporting the PV assembly above a support surface, an upper interlock element, positioned towards the upper PV edge, and a lower interlock element, positioned towards the lower PV edge. The upper interlock element of one PV shingle assembly is inter-engageable with the lower interlock element of an adjacent PV shingle assembly. In some embodiments the PV shingle assembly may comprise a ventilation path below the PV body. The PV body may be slidably mounted to the connection member to facilitate removal of the PV body.

  18. Toward a molecular programming language for algorithmic self-assembly

    Science.gov (United States)

    Patitz, Matthew John

    Self-assembly is the process whereby relatively simple components autonomously combine to form more complex objects. Nature exhibits self-assembly to form everything from microscopic crystals to living cells to galaxies. With a desire to both form increasingly sophisticated products and to understand the basic components of living systems, scientists have developed and studied artificial self-assembling systems. One such framework is the Tile Assembly Model introduced by Erik Winfree in 1998. In this model, simple two-dimensional square 'tiles' are designed so that they self-assemble into desired shapes. The work in this thesis consists of a series of results which build toward the future goal of designing an abstracted, high-level programming language for designing the molecular components of self-assembling systems which can perform powerful computations and form into intricate structures. The first two sets of results demonstrate self-assembling systems which perform infinite series of computations that characterize computably enumerable and decidable languages, and exhibit tools for algorithmically generating the necessary sets of tiles. In the next chapter, methods for generating tile sets which self-assemble into complicated shapes, namely a class of discrete self-similar fractal structures, are presented. Next, a software package for graphically designing tile sets, simulating their self-assembly, and debugging designed systems is discussed. Finally, a high-level programming language which abstracts much of the complexity and tedium of designing such systems, while preventing many of the common errors, is presented. The summation of this body of work presents a broad coverage of the spectrum of desired outputs from artificial self-assembling systems and a progression in the sophistication of tools used to design them. By creating a broader and deeper set of modular tools for designing self-assembling systems, we hope to increase the complexity which is

  19. Reconstruction of ribosomal RNA genes from metagenomic data.

    Directory of Open Access Journals (Sweden)

    Lu Fan

    Full Text Available Direct sequencing of environmental DNA (metagenomics has a great potential for describing the 16S rRNA gene diversity of microbial communities. However current approaches using this 16S rRNA gene information to describe community diversity suffer from low taxonomic resolution or chimera problems. Here we describe a new strategy that involves stringent assembly and data filtering to reconstruct full-length 16S rRNA genes from metagenomicpyrosequencing data. Simulations showed that reconstructed 16S rRNA genes provided a true picture of the community diversity, had minimal rates of chimera formation and gave taxonomic resolution down to genus level. The strategy was furthermore compared to PCR-based methods to determine the microbial diversity in two marine sponges. This showed that about 30% of the abundant phylotypes reconstructed from metagenomic data failed to be amplified by PCR. Our approach is readily applicable to existing metagenomic datasets and is expected to lead to the discovery of new microbial phylotypes.

  20. Turbomachine blade assembly

    Science.gov (United States)

    Garcia Crespo, Andres Jose

    2016-11-01

    Embodiments of the present disclosure include a system comprising a turbomachine blade assembly having a blade portion, a shank portion, and a mounting portion, wherein the blade portion, the shank portion, and the mounting portion comprise a first plurality of plies extending from a tip of the airfoil to a base of the dovetail.

  1. Fuel sub-assembly

    International Nuclear Information System (INIS)

    Jolly, R.

    1982-01-01

    A fuel sub-assembly for a liquid metal cooled nuclear reactor is described in which the bundle of fuel pins are braced apart by a series of spaced grids. The grids at the lower end are capable of yielding, thus allowing pins swollen by irradiation to be withdrawn with a reduced risk of damage. (U.K.)

  2. Nanoparticle assemblies and superstructures

    National Research Council Canada - National Science Library

    Kotov, Nicholas A

    2006-01-01

    ... building blocks of larger and more complex systems. Therefore, the present challenge of nanoscale science is to shift from making certain building blocks to organizing them in one-, two-, and three-dimensional structures. Such assemblies and superstructures are the next logical step in the development of nanoscience and nanotechnology. In this re...

  3. Spool assembly support analysis

    International Nuclear Information System (INIS)

    Norman, B.F.

    1994-01-01

    This document provides the wind/seismic analysis and evaluation for the pump pit spool assemblies. Hand calculations were used for the analysis. UBC, AISC, and load factors were used in this evaluation. The results show that the actual loads are under the allowable loads and all requirements are met

  4. Nanotechnology: A molecular assembler

    Science.gov (United States)

    Kelly, T. Ross; Snapper, Marc L.

    2017-09-01

    The idea of nanometre-scale machines that can assemble molecules has long been thought of as the stuff of science fiction. Such a machine has now been built -- and might herald a new model for organic synthesis. See Letter p.374

  5. Macroscopic magnetic Self assembly

    NARCIS (Netherlands)

    Löthman, Per Arvid

    2018-01-01

    Exploring the macroscopic scale's similarities to the microscale is part and parcel of this thesis as reflected in the research question: what can we learn about the microscopic scale by studying the macroscale? Investigations of the environment in which the self-assembly takes place, and the

  6. Assembling Sustainable Territories

    DEFF Research Database (Denmark)

    Vandergeest, Peter; Ponte, Stefano; Bush, Simon

    2015-01-01

    that territorialisation is accomplished not just through (re)defining bounded space, but more broadly through the assembling of four elements: space, subjects, objects, and expertise. Four case studies of sustainability certification in seafood are analyzed to show that ‘green gabbing’ is not necessarily the central...

  7. Assembling sustainable territories

    NARCIS (Netherlands)

    Vandergeest, Peter; Ponte, Stefano; Bush, Simon

    2015-01-01

    The authors show how certification assembles ‘sustainable’ territories through a complex layering of regulatory authority in which both government and nongovernment entities claim rule-making authority, sometimes working together, sometimes in parallel, sometimes competitively. It is argued that

  8. Turneri preemia 2015: Assemble

    Index Scriptorium Estoniae

    2015-01-01

    Turneri 2015. aasta preemia pälvis radikaalne noorte arhitektide kollektiiv Assemble. Rühmitus on 18-liikmeline ja baseerub Ida-Londonis ning selle tegevust võib üldistatult nimetada hüljatud ruumide taaselustamiseks kogukondlike aktsioonide kaudu

  9. Industrial Assembly Cases

    DEFF Research Database (Denmark)

    Ellekilde, Lars-Peter; Buch, Jacob Pørksen; Iversen, Thorbjørn Mosekjær

    This technical report presents 13 different industrial assembly tasks, which are composed of 70 different operations. The report is written to provide an overview and do as such not contain product specific information such as object weights, dimensions etc. The operations are classified into a set...

  10. Ordinary General Assembly

    CERN Multimedia

    Staff Association

    2011-01-01

    Tuesday 12 April at 14.00 Council Chamber, Bldg 503 In conformity with the Statutes of the Staff Association, an ordinary General Assembly is organized once a year (article IV.2.1). Agenda   Adoption of the Agenda Approval of the Draft Minutes of the Ordinary General Assembly of 20 April 2010 Presentation and approval of the Activity Report 2010 Presentation and approval of the Financial Report 2010 Presentation and approval of the Auditors Report 2010 Programme for 2011 Presentation et and approval of the draft budget and subscription rate 2012 Election of the Election Committee Election of the Board of Auditors Miscellaneous We remind members of article IV.3.4 in the Statutes of the Association which reads: “After having dealt with all the items on the agenda, the members may, with the consent of the Assembly, have other matters discussed, but decisions may be taken only on the items listed on the agenda. Nevertheless, the Assembly ma...

  11. Ordinary General Assembly

    CERN Multimedia

    Staff Association

    2011-01-01

    Tuesday 12 April at 14.00 Council Chamber, Bldg 503 In conformity with the Statutes of the Staff Association, an ordinary General Assembly is organized once a year (article IV.2.1). Agenda   Adoption of the Agenda Approval of the Draft Minutes of the Ordinary General Assembly of 20 April 2010 Presentation and approval of the Activity Report 2010 Presentation and approval of the Financial Report 2010 Presentation and approval of the Auditors Report 2010 Programme for 2011 Presentation and approval of the draft budget and subscription rate 2012 Election of the Election Committee Election of the Board of Auditors Miscellaneous We remind members of article IV.3.4 in the Statutes of the Association which reads: “After having dealt with all the items on the agenda, the members may, with the consent of the Assembly, have other matters discussed, but decisions may be taken only on the items listed on the agenda. Nevertheless, the Assembly may r...

  12. Ordinary General Assembly

    CERN Multimedia

    Staff Association

    2010-01-01

    Tuesday 20 April at 10.00 Council Chamber, Bldg 503 In conformity with the Statutes of the Staff Association, an ordinary General Assembly is organized once a year (article IV.2.1). Agenda   Adoption of the Agenda Approval of the Draft Minutes of the Ordinary General Assembly of 12 May 2009 Presentation and approval of the Activity Report 2009 Presentation and approval of the Financial Report 2009 Presentation and approval of the Auditors Report 2009 Programme for 2010 Presentation et and approval of the draft budget and subscription rate 2010 Election of the Election Committee Election of the Board of Auditors Miscellaneous We remind members of article IV.3.4 in the Statutes of the Association which reads: “After having dealt with all the items on the agenda, the members may, with the consent of the Assembly, have other matters discussed, but decisions may be taken only on the items listed on the agenda. Nevertheless, the Assembly may require t...

  13. Lageos assembly operation plan

    Science.gov (United States)

    Brueger, J.

    1975-01-01

    Guidelines and constraints procedures for LAGEOS assembly, operation, and design performance are given. Special attention was given to thermal, optical, and dynamic analysis and testing. The operation procedures illustrate the interrelation and sequence of tasks in a flow diagram. The diagram also includes quality assurance functions for verification of operation tasks.

  14. Assembly of primary cilia

    DEFF Research Database (Denmark)

    Pedersen, Lotte B; Veland, Iben R; Schrøder, Jacob M

    2008-01-01

    knowledge about IFT is based on studies performed in Chlamydomonas and Caenorhabditis elegans. Therefore, our review of the IFT literature includes studies performed in these two model organisms. The role of several non-IFT proteins (e.g., centrosomal proteins) in the ciliary assembly process is also...... discussed. Developmental Dynamics, 2008. (c) 2008 Wiley-Liss, Inc....

  15. Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

    DEFF Research Database (Denmark)

    Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E

    2015-01-01

    Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...

  16. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.

    2006-01-01

    Transcription from the embryos own ribosomal genes is initiated in most species at the same time as the maternal-embryonic transition. Recently data have indicated that a minor activation may take place during the third embryonic cell cycle in the bovine, one cell cycle before the major activation...

  17. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  18. Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components

    International Nuclear Information System (INIS)

    Tejedor, F.; Ballesta, J.P.

    1986-01-01

    Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome

  19. Genome-Scale Analysis of Translation Elongation with a Ribosome Flow Model

    Science.gov (United States)

    Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan

    2011-01-01

    We describe the first large scale analysis of gene translation that is based on a model that takes into account the physical and dynamical nature of this process. The Ribosomal Flow Model (RFM) predicts fundamental features of the translation process, including translation rates, protein abundance levels, ribosomal densities and the relation between all these variables, better than alternative (‘non-physical’) approaches. In addition, we show that the RFM can be used for accurate inference of various other quantities including genes' initiation rates and translation costs. These quantities could not be inferred by previous predictors. We find that increasing the number of available ribosomes (or equivalently the initiation rate) increases the genomic translation rate and the mean ribosome density only up to a certain point, beyond which both saturate. Strikingly, assuming that the translation system is tuned to work at the pre-saturation point maximizes the predictive power of the model with respect to experimental data. This result suggests that in all organisms that were analyzed (from bacteria to Human), the global initiation rate is optimized to attain the pre-saturation point. The fact that similar results were not observed for heterologous genes indicates that this feature is under selection. Remarkably, the gap between the performance of the RFM and alternative predictors is strikingly large in the case of heterologous genes, testifying to the model's promising biotechnological value in predicting the abundance of heterologous proteins before expressing them in the desired host. PMID:21909250

  20. The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Shunfei Yan

    2017-01-01

    Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.

  1. Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

    Science.gov (United States)

    Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

    2018-03-15

    Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

  2. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  3. Computational discovery of specificity-conferring sites in non-ribosomal peptide synthetases

    DEFF Research Database (Denmark)

    Knudsen, Michael; Søndergaard, Dan Ariel; Tofting-Olesen, Claus

    2016-01-01

    Motivation: By using a class of large modular enzymes known as Non-Ribosomal Peptide Synthetases (NRPS), bacteria and fungi are capable of synthesizing a large variety of secondary metabolites, many of which are bioactive and have potential, pharmaceutical applications as e.g.~antibiotics. There ...

  4. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome

    Science.gov (United States)

    Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke

    2008-01-01

    Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

  5. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru

    1975-01-01

    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  6. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  7. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  8. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia

    2014-09-01

    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  9. Exploring ribosome composition and newly synthesized proteins through proteomics and potential biomedical applications

    Czech Academy of Sciences Publication Activity Database

    Šťastná, Miroslava; Gottlieb, R. A.; Van Eyk, J.E.

    2017-01-01

    Roč. 14, č. 6 (2017), s. 529-543 ISSN 1478-9450 Institutional support: RVO:68081715 Keywords : mass spectrometry * amino-acid labeling * translation * ribosomes * AHA Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 3.849, year: 2016

  10. Virtual Ribosome - a comprehensive DNA translation tool with support for integration of sequence feature annotation

    DEFF Research Database (Denmark)

    Wernersson, Rasmus

    2006-01-01

    of alternative start codons. ( ii) Integration of sequences feature annotation - in particular, native support for working with files containing intron/ exon structure annotation. The software is available for both download and online use at http://www.cbs.dtu.dk/services/VirtualRibosome/....

  11. Selection of scFvs specific for the HepG2 cell line using ribosome ...

    Indian Academy of Sciences (India)

    Madhsudhan

    the important advantage of requiring no prior knowledge of ... were amplified separately by RT-PCR, and an anti-HepG2 VH/k chain ribosome display library was constructed ..... Engert A, Hudson P R and Power B E 2007 Selection of human.

  12. In silico modelling and analysis of ribosome kinetics and aa-tRNA competition

    NARCIS (Netherlands)

    Bošnački, D.; Pronk, T.E.; de Vink, E.P.

    2008-01-01

    We present a formal analysis of ribosome kinetics using probabilistic model checking and the tool Prism. We compute different parameters of the model, like probabilities of translation errors and average insertion times per codon. The model predicts strong correlation to the quotient of the

  13. YbxF, a protein associated with exponential-phase ribosomes in Bacillus subtilis

    Czech Academy of Sciences Publication Activity Database

    Sojka, Luděk; Fučík, Vladimír; Krásný, Libor; Barvík, I.; Jonák, Jiří

    2007-01-01

    Roč. 189, č. 13 (2007), s. 4809-4814 ISSN 0021-9193 R&D Projects: GA AV ČR IAA5052206 Institutional research plan: CEZ:AV0Z50520514 Keywords : ybxF * ymxC * ribosomes * Bacillus subtilis * GFP * growth phase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.013, year: 2007

  14. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen

    2014-01-01

    -haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  15. Ribosome stalling regulates IRES-mediated translation in eukaryotes, a parallel to prokaryotic attenuation

    NARCIS (Netherlands)

    Fernandez, James; Yaman, Ibrahim; Huang, Charles; Liu, Haiyan; Lopez, Alex B.; Komar, Anton A.; Caprara, Mark G.; Merrick, William C.; Snider, Martin D.; Kaufman, Randal J.; Lamers, Wouter H.; Hatzoglou, Maria

    2005-01-01

    It was previously shown that the mRNA for the cat-1 Arg/Lys transporter is translated from an internal ribosome entry site (IRES) that is regulated by cellular stress. Amino acid starvation stimulated cat-1 translation via a mechanism that requires translation of an ORF in the mRNA leader and

  16. Development of Soft Tissue Sarcomas in Ribosomal Proteins L5 and S24 Heterozygous Mice

    Czech Academy of Sciences Publication Activity Database

    Kazerounian, S.; Ciarlini, P.D.S.C.; Yuan, D.; Ghazvinian, R.; Alberich-Jorda, Meritxell; Joshi, M.; Zhang, H.; Beggs, A.H.; Gazda, H.T.

    2016-01-01

    Roč. 7, č. 1 (2016), s. 32-36 ISSN 1837-9664 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : Ribosomal proteins RPL5 and RPS24 * Diamond-Blackfan anemia * Soft tissue sarcoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.916, year: 2016

  17. Ribosome-inhibiting proteins from in vitro cultures of Phytolacca dodecandra

    DEFF Research Database (Denmark)

    Thomsen, S.; Hansen, Harald S.; Nyman, U.

    1991-01-01

    Phytolacca dodecandra (L'Herit) grown in cell cultures was investigated for content of ribosome-inhibiting proteins, which was evaluated hy measuring inhibition of protein synthesis in a cell-free rat liver extract. Calli initiated from leaf, cotyledon, radicle, and hypocotyl and suspension cells...

  18. Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli

    DEFF Research Database (Denmark)

    Aagaard, C; Rosendahl, G; Dam, M

    1991-01-01

    The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...

  19. A rotational diffusion coefficient of the 70s ribosome determined by depolarized laser light scattering

    NARCIS (Netherlands)

    Bruining, J.; Fijnaut, H.M.

    We have obtained a rotational diffusion coefficient of the 70S ribosome isolated from Escherichia-coli (MRE-600), from the depolarized light scattering spectrum measured by photon correlation spectroscopy. The intensity correlation function of depolarized scattered light contains contributions due

  20. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    Science.gov (United States)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  1. Assembly of the membrane domain of ATP synthase in human mitochondria.

    Science.gov (United States)

    He, Jiuya; Ford, Holly C; Carroll, Joe; Douglas, Corsten; Gonzales, Evvia; Ding, Shujing; Fearnley, Ian M; Walker, John E

    2018-03-20

    The ATP synthase in human mitochondria is a membrane-bound assembly of 29 proteins of 18 kinds. All but two membrane components are encoded in nuclear genes, synthesized on cytoplasmic ribosomes, and imported into the matrix of the organelle, where they are assembled into the complex with ATP6 and ATP8, the products of overlapping genes in mitochondrial DNA. Disruption of individual human genes for the nuclear-encoded subunits in the membrane portion of the enzyme leads to the formation of intermediate vestigial ATPase complexes that provide a description of the pathway of assembly of the membrane domain. The key intermediate complex consists of the F 1 -c 8 complex inhibited by the ATPase inhibitor protein IF 1 and attached to the peripheral stalk, with subunits e, f, and g associated with the membrane domain of the peripheral stalk. This intermediate provides the template for insertion of ATP6 and ATP8, which are synthesized on mitochondrial ribosomes. Their association with the complex is stabilized by addition of the 6.8 proteolipid, and the complex is coupled to ATP synthesis at this point. A structure of the dimeric yeast F o membrane domain is consistent with this model of assembly. The human 6.8 proteolipid (yeast j subunit) locks ATP6 and ATP8 into the membrane assembly, and the monomeric complexes then dimerize via interactions between ATP6 subunits and between 6.8 proteolipids (j subunits). The dimers are linked together back-to-face by DAPIT (diabetes-associated protein in insulin-sensitive tissue; yeast subunit k), forming long oligomers along the edges of the cristae.

  2. BALB/c Mice Vaccinated with Leishmania major Ribosomal Proteins Extracts Combined with CpG Oligodeoxynucleotides Become Resistant to Disease Caused by a Secondary Parasite Challenge

    Directory of Open Access Journals (Sweden)

    Laura Ramírez

    2010-01-01

    Full Text Available Leishmaniasis is an increasing public health problem and effective vaccines are not currently available. We have previously demonstrated that vaccination with ribosomal proteins extracts administered in combination of CpG oligodeoxynucleotides protects susceptible BALB/c mice against primary Leishmania major infection. Here, we evaluate the long-term immunity to secondary infection conferred by this vaccine. We show that vaccinated and infected BALB/c mice were able to control a secondary Leishmania major challenge, since no inflammation and very low number of parasites were observed in the site of reinfection. In addition, although an increment in the parasite burden was observed in the draining lymph nodes of the primary site of infection we did not detected inflammatory lesions at that site. Resistance against reinfection correlated to a predominant Th1 response against parasite antigens. Thus, cell cultures established from spleens and the draining lymph node of the secondary site of infection produced high levels of parasite specific IFN-γ in the absence of IL-4 and IL-10 cytokine production. In addition, reinfected mice showed a high IgG2a/IgG1 ratio for anti-Leishmania antibodies. Our results suggest that ribosomal vaccine, which prevents pathology in a primary challenge, in combination with parasite persistence might be effective for long-term maintenance of immunity.

  3. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  4. Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.

    Science.gov (United States)

    Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter

    2012-12-18

    Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

  5. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: osvarcova@gmail.com [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: philc@medisin.uio.no [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)

    2011-09-02

    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  6. Appearance detection device for fuel assembly

    International Nuclear Information System (INIS)

    Matsuoka, Toshihiro

    1998-01-01

    The prevent invention provides an appearance detection device which improves accuracy of images on a display and facilitates editing and selection of images upon detection of appearance of a reactor fuel assembly. Namely, the device of the present invention comprises (1) television cameras movable along fuel assemblies of a reactor, (2) a detection means for detecting the positions of the television cameras, (3) a convertor for converting analog image signals of the television cameras to digital image signals, (4) a memory means for sampling a predetermined portion of the images of the television camera and storing it together with the position signal obtained by the detection means and (5) a computer for selecting a plurality of images and positions from the above-mentioned means and joining them to one or a plurality of static images of the fuel assembly. At least two television cameras are disposed oppositely with each other. Then, position signals of the television cameras are designated by the stored sampling signals, and the fuel assembly at the position can be displayed quickly. It is scrolled, compressed or enlarged and formed into images. (I.S.)

  7. School Assemblies: The Lost Art.

    Science.gov (United States)

    Beach, Daniel R.

    1979-01-01

    Guidelines and suggestions are offered for successful school assemblies. The school assembly should be a positive event; an occasion for developing unity, group loyalty, and desirable audience habits. (Author/MLF)

  8. Assembling large, complex environmental metagenomes

    Energy Technology Data Exchange (ETDEWEB)

    Howe, A. C. [Michigan State Univ., East Lansing, MI (United States). Microbiology and Molecular Genetics, Plant Soil and Microbial Sciences; Jansson, J. [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Earth Sciences Division; Malfatti, S. A. [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Tringe, S. G. [USDOE Joint Genome Institute (JGI), Walnut Creek, CA (United States); Tiedje, J. M. [Michigan State Univ., East Lansing, MI (United States). Microbiology and Molecular Genetics, Plant Soil and Microbial Sciences; Brown, C. T. [Michigan State Univ., East Lansing, MI (United States). Microbiology and Molecular Genetics, Computer Science and Engineering

    2012-12-28

    The large volumes of sequencing data required to sample complex environments deeply pose new challenges to sequence analysis approaches. De novo metagenomic assembly effectively reduces the total amount of data to be analyzed but requires significant computational resources. We apply two pre-assembly filtering approaches, digital normalization and partitioning, to make large metagenome assemblies more computationaly tractable. Using a human gut mock community dataset, we demonstrate that these methods result in assemblies nearly identical to assemblies from unprocessed data. We then assemble two large soil metagenomes from matched Iowa corn and native prairie soils. The predicted functional content and phylogenetic origin of the assembled contigs indicate significant taxonomic differences despite similar function. The assembly strategies presented are generic and can be extended to any metagenome; full source code is freely available under a BSD license.

  9. X-Ray Assembler Data

    Data.gov (United States)

    U.S. Department of Health & Human Services — Federal regulations require that an assembler who installs one or more certified components of a diagnostic x-ray system submit a report of assembly. This database...

  10. Welding facilities for NPP assembling

    International Nuclear Information System (INIS)

    Rojtenberg, S.S.

    1987-01-01

    Recommendations concerning the choice of equipment for welding in pre-assembling work shops, in the enlarging assembling shops and at the assembling site, are given. Advanced production automatic welders and semiautomatic machines, applied during the NPP equipment assembling as well as automatic machines specially produced for welding the main reactor components and pipelines are described. Automatic and semiautomatic machine and manual welding post supply sources are considered

  11. Reflector-moderated critical assemblies

    International Nuclear Information System (INIS)

    Paxton, H.C.; Jarvis, G.A.; Byers, C.C.

    1975-07-01

    Experiments with reflector-moderated critical assemblies were part of the Rover Program at the Los Alamos Scientific Laboratory (LASL). These assemblies were characterized by thick D 2 O or beryllium reflectors surrounding large cavities that contained highly enriched uranium at low average densities. Because interest in this type of system has been revived by LASL Plasma Cavity Assembly studies, more detailed descriptions of the early assemblies than had been available in the unclassified literature are provided. (U.S.)

  12. Guide tube insert assembly for use in a nuclear reactor

    International Nuclear Information System (INIS)

    Hopkins, R.J.; Land, J.T.

    1992-01-01

    This patent describes an internals assembly for a nuclear reactor of the type including an upper support plate and an upper core plate, each having apertures for conducting control rod assemblies into an out of fuel assemblies with the apertures of the upper support plate being aligned with the apertures of the upper core plate, a guide tube insert assembly comprising: an elongated tubular body extending between at least one of the aligned apertures formed in the upper support plate and the upper core plate; guide plates within the elongated tubular body, each of the guide plates having a planar surface extending substantially perpendicular to an axial direction of the tubular body; at least one interconnecting means for interconnecting the guide plates into a guide tube insert assembly such that the guide plates are simultaneously mountable within and removable from the elongated body, and the periphery of each of the guide plates is spaced apart from the inner walls of the elongated tubular body at every point when the insert assembly is mounted within the tubular body, and a stabilizing means for securing the lowermost guide plate of the guide tube insert assembly within the elongated tubular body to prevent rotational and lateral movement between the guide tube insert assembly and the tubular body

  13. Intragenomic polymorphisms among high-copy loci: a genus-wide study of nuclear ribosomal DNA in Asclepias (Apocynaceae

    Directory of Open Access Journals (Sweden)

    Kevin Weitemier

    2015-01-01

    Full Text Available Despite knowledge that concerted evolution of high-copy loci is often imperfect, studies that investigate the extent of intragenomic polymorphisms and comparisons across a large number of species are rarely made. We present a bioinformatic pipeline for characterizing polymorphisms within an individual among copies of a high-copy locus. Results are presented for nuclear ribosomal DNA (nrDNA across the milkweed genus, Asclepias. The 18S-26S portion of the nrDNA cistron of Asclepias syriaca served as a reference for assembly of the region from 124 samples representing 90 species of Asclepias. Reads were mapped back to each individual’s consensus and at each position reads differing from the consensus were tallied using a custom perl script. Low frequency polymorphisms existed in all individuals (mean = 5.8%. Most nrDNA positions (91% were polymorphic in at least one individual, with polymorphic sites being less frequent in subunit regions and loops. Highly polymorphic sites existed in each individual, with highest abundance in the “noncoding” ITS regions. Phylogenetic signal was present in the distribution of intragenomic polymorphisms across the genus. Intragenomic polymorphisms in nrDNA are common in Asclepias, being found at higher frequency than any other study to date. The high and variable frequency of polymorphisms across species highlights concerns that phylogenetic applications of nrDNA may be error-prone. The new analytical approach provided here is applicable to other taxa and other high-copy regions characterized by low coverage genome sequencing (genome skimming.

  14. Fuel nozzle assembly

    Science.gov (United States)

    Johnson, Thomas Edward [Greer, SC; Ziminsky, Willy Steve [Simpsonville, SC; Lacey, Benjamin Paul [Greer, SC; York, William David [Greer, SC; Stevenson, Christian Xavier [Inman, SC

    2011-08-30

    A fuel nozzle assembly is provided. The assembly includes an outer nozzle body having a first end and a second end and at least one inner nozzle tube having a first end and a second end. One of the nozzle body or nozzle tube includes a fuel plenum and a fuel passage extending therefrom, while the other of the nozzle body or nozzle tube includes a fuel injection hole slidably aligned with the fuel passage to form a fuel flow path therebetween at an interface between the body and the tube. The nozzle body and the nozzle tube are fixed against relative movement at the first ends of the nozzle body and nozzle tube, enabling the fuel flow path to close at the interface due to thermal growth after a flame enters the nozzle tube.

  15. Nuclear fuel assembly

    International Nuclear Information System (INIS)

    Ito, Arata; Wakamatsu, Mitsuo.

    1976-01-01

    Object: To permit the coolant in an FBR type reactor to enter from the entrance nozzle into a nuclear fuel assembly without causing cavitation. Structure: In a nuclear fuel assembly, which comprises a number of thin fuel pines bundled together at a uniform spacing and enclosed within an outer cylinder, with a handling head connected to an upper portion of the outer cylinder and an entrance nozzle connected to a lower portion of the cylinder, the inner surface of the entrance nozzle is provided with a buffer member and an orifice successively in the direction of flow of the coolant. The coolant entering from a low pressure coolant chamber into the entrance nozzle strikes the buffer member and is attenuated, and thereafter flows through an orifice into the outer cylinder. (Horiuchi, T.)

  16. Molten core retention assembly

    International Nuclear Information System (INIS)

    Lampe, R.F.

    1976-01-01

    Molten fuel produced in a core overheating accident is caught by a molten core retention assembly consisting of a horizontal baffle plate having a plurality of openings therein, heat exchange tubes having flow holes near the top thereof mounted in the openings, and a cylindrical imperforate baffle attached to the plate and surrounding the tubes. The baffle assembly is supported from the core support plate of the reactor by a plurality of hanger rods which are welded to radial beams passing under the baffle plate and intermittently welded thereto. Preferably the upper end of the cylindrical baffle terminates in an outwardly facing lip to which are welded a plurality of bearings having slots therein adapted to accept the hanger rods

  17. Nuclear fuel assemblies

    International Nuclear Information System (INIS)

    Butterfield, R.S.; Garner, D.L.M.

    1977-01-01

    Reference is made to nuclear fuel assemblies designed for cooling on the 'tube-in-shell' principle in which the fuel is contained by a shell and is cooled by coolant passed through tubes extending through the shell. It has been proposed to employ coated particle fuel as a porous bed on the tube side and the bleed coolant from the tubes into direct contact with the fuel particles. In this way heat is extracted both by direct contact with the fuel and by heat transfer through the coolant tube walls. The system described aims to provide an improved structure of tube and shell for a fuel assembly of this kind and is particularly suitable for use in a gas cooled fast reactor, being able to withstand the neutron flux and high temperature conditions in these reactors. Constructional details are given. (U.K.)

  18. Nuclear reactor fuel assembly

    International Nuclear Information System (INIS)

    1975-01-01

    A description is given of a nuclear reactor fuel assembly comprising a cluster of fuel elements supported by transversal grids so that their axes are parallel to and at a distance from each other, in order to establish interstices for the axial flow of a coolant. At least one of the interstices is occupied by an axial duct reserved for an auxiliary cooling fluid and is fitted with side holes through which the auxiliary cooling fluid is sprayed into the cluster. Deflectors extend as from a transversal grid in a position opposite the holes to deflect the cooling fluid jet towards those parts of the fuel elements that are not accessible to the auxiliary coolant. This assembly is intended for reactors cooled by light or heavy water [fr

  19. Gamma counter shutter assembly

    International Nuclear Information System (INIS)

    Aday, R.W. Jr.; Barber, D.G.

    1976-01-01

    A shutter assembly for a radioactivity measuring apparatus is described having a sample counting chamber, the assembly having a bulky solid lead cylinder with a sample access port extending therethrough for alignment with the sample chamber. The cylinder is rotated by a Geneva wheel arrangement having a drive wheel with a plurality of equi-angularly disposed pins perpendicular to the surface thereof engaging radially extending open-ended slots in a driven wheel secured to the lead cylinder for concurrent rotation therewith. The drive wheel is rotated at a constant speed with the driven wheel accelerating as a pin traverses the slot from the open end toward the driven wheel center and then decelerating as the pin traverses the reverse direction to provide precise positioning with adjacent pins engaging the open ends of adjacent slots in the stop position of the cylinder. 8 Claims, 3 Drawing Figures

  20. Mechanical seal assembly

    Science.gov (United States)

    Kotlyar, Oleg M.

    2001-01-01

    An improved mechanical seal assembly is provided for sealing rotating shafts with respect to their shaft housings, wherein the rotating shafts are subject to substantial axial vibrations. The mechanical seal assembly generally includes a rotating sealing ring fixed to the shaft, a non-rotating sealing ring adjacent to and in close contact with the rotating sealing ring for forming an annular seal about the shaft, and a mechanical diode element that applies a biasing force to the non-rotating sealing ring by means of hemispherical joint. The alignment of the mechanical diode with respect to the sealing rings is maintained by a series of linear bearings positioned axially along a desired length of the mechanical diode. Alternative embodiments include mechanical or hydraulic amplification components for amplifying axial displacement of the non-rotating sealing ring and transferring it to the mechanical diode.