WorldWideScience

Sample records for preparing massive protective

  1. Chronology protection in Galileon models and massive gravity

    Science.gov (United States)

    Burrage, Clare; de Rham, Claudia; Heisenberg, Lavinia; Tolley, Andrew J.

    2012-07-01

    Galileon models are a class of effective field theories that have recently received much attention. They arise in the decoupling limit of theories of massive gravity, and in some cases they have been treated in their own right as scalar field theories with a specific nonlinearly realized global symmetry (Galilean transformation). It is well known that in the presence of a source, these Galileon theories admit superluminal propagating solutions, implying that as quantum field theories they must admit a different notion of causality than standard local Lorentz invariant theories. We show that in these theories it is easy to construct closed timelike curves (CTCs) within the naive regime of validity of the effective field theory. However, on closer inspection we see that the CTCs could never arise since the Galileon inevitably becomes infinitely strongly coupled at the onset of the formation of a CTC. This implies an infinite amount of backreaction, first on the background for the Galileon field, signaling the break down of the effective field theory, and subsequently on the spacetime geometry, forbidding the formation of the CTC. Furthermore the background solution required to create CTCs becomes unstable with an arbitrarily fast decay time. Thus Galileon theories satisfy a direct analogue of Hawking's chronology protection conjecture.

  2. Massive preparation of pitch-based organic microporous polymers for gas storage.

    Science.gov (United States)

    Li, Wenqing; Zhang, Aijuan; Gao, Hui; Chen, Mingjie; Liu, Anhua; Bai, Hua; Li, Lei

    2016-02-14

    A general challenge for preparing organic microporous polymers (MOPs) is to use cheap and sustainable building blocks while retaining the advanced functions. We demonstrate a strategy to massively prepare pitch-based MOPs, which are thermally and chemically stable. A maximum BET surface area of 758 m(2) g(-1) and high gas storage capacity were achieved.

  3. Chronology Protection in Galileon Models and Massive Gravity

    CERN Document Server

    Burrage, Clare; Heisenberg, Lavinia; Tolley, Andrew J

    2011-01-01

    Galileon models are a class of effective field theories that have recently received much attention. They arise in the decoupling limit of theories of massive gravity, and in some cases they have been treated in their own right as scalar field theories with a specific nonlinearly realized global symmetry (Galilean transformation). It is well known that in the presence of a source, these Galileon theories admit superluminal propagating solutions, implying that as quantum field theories they must admit a different notion of causality than standard local Lorentz invariant theories. We show that in these theories it is easy to construct closed timelike curves (CTCs) within the {\\it naive} regime of validity of the effective field theory. However, on closer inspection we see that the CTCs could never arise since the Galileon inevitably becomes infinitely strongly coupled at the onset of the formation of a CTC. This implies an infinite amount of backreaction, first on the background for the Galileon field, signaling...

  4. Military plans massive Arctic exercise to prepare for environmental disaster

    Energy Technology Data Exchange (ETDEWEB)

    Anon

    2004-12-01

    Planning by the Canadian military for a major exercise to prepare for a possible environmental disaster in the Mackenzie Delta is reported. There has been intense energy exploration over the least few years in the region and more is expected as the proposed pipeline to transport natural gas to southern markets is constructed. Additional drilling in the Beaufort Sea is also being rumored, which would represent further threat to the environment. The object of the exercise is for the military to be ready to respond to any industrial or shipping accident since the territorial government does not have the resources to do so. The Canadian Coast Guard and the RCMP also participated in the exercise last year; current plans call for bringing in Parks Canada, Environment Canada, the Department of Fisheries and Oceans, and some of the Alaska-based Americans to participate in the exercises this year. This year's exercises will address some of the recommendations contained in the 2000 Arctic Capability Report which was particularly critical of the lack of contingency planning, the reduced Arctic training received by the military, and the quality of equipment available to the military to respond to emergencies.

  5. A protection method against massive error mails caused by sender spoofed spam mails

    OpenAIRE

    Yamai, Nariyoshi; Okayama, Kiyohiko; Miyashita, Takuya; MARUYAMA, Shin; Nakamura, Motonori

    2005-01-01

    Wide spread of spam mails is one of the most serious problems on e-mail environment. Particularly, spam mails with a spoofed sender address should not be left alone, since they make the mail server corresponding to the spoofed address be overloaded with massive error mails generated by the spam mails, and since they waste a lot of network and computer resources. In this paper, we propose a protection method of the mail server against such massive error mails. This method introduces an additio...

  6. Library preparation and multiplex capture for massive parallel sequencing applications made efficient and easy.

    Directory of Open Access Journals (Sweden)

    Mårten Neiman

    Full Text Available During the recent years, rapid development of sequencing technologies and a competitive market has enabled researchers to perform massive sequencing projects at a reasonable cost. As the price for the actual sequencing reactions drops, enabling more samples to be sequenced, the relative price for preparing libraries gets larger and the practical laboratory work becomes complex and tedious. We present a cost-effective strategy for simplified library preparation compatible with both whole genome- and targeted sequencing experiments. An optimized enzyme composition and reaction buffer reduces the number of required clean-up steps and allows for usage of bulk enzymes which makes the whole process cheap, efficient and simple. We also present a two-tagging strategy, which allows for multiplex sequencing of targeted regions. To prove our concept, we have prepared libraries for low-pass sequencing from 100 ng DNA, performed 2-, 4- and 8-plex exome capture and a 96-plex capture of a 500 kb region. In all samples we see a high concordance (>99.4% of SNP calls when comparing to commercially available SNP-chip platforms.

  7. Simvastatin reduces fibrosis and protects against muscle weakness after massive rotator cuff tear.

    Science.gov (United States)

    Davis, Max E; Korn, Michael A; Gumucio, Jonathan P; Harning, Julie A; Saripalli, Anjali L; Bedi, Asheesh; Mendias, Christopher L

    2015-02-01

    Chronic rotator cuff tears are a common source of shoulder pain and disability, and patients with chronic cuff tears often have substantial weakness, fibrosis, inflammation, and fat accumulation. Identifying therapies to prevent the development of these pathologic processes will likely have a positive impact on clinical outcomes. Simvastatin is a drug with demonstrated anti-inflammatory and antifibrotic effects in many tissues but had not previously been studied in the context of rotator cuff tears. We hypothesized that after the induction of a massive supraspinatus tear, simvastatin would protect muscles from a loss of force production and fibrosis. We measured changes in muscle fiber contractility, histology, and biochemical markers of fibrosis and fatty infiltration in rats that received a full-thickness supraspinatus tear and were treated with either carrier alone or simvastatin. Compared with vehicle-treated controls, simvastatin did not have an appreciable effect on muscle fiber size, but treatment did increase muscle fiber specific force by 20%. Simvastatin also reduced collagen accumulation by 50% but did not affect triglyceride content of muscles. Several favorable changes in the expression of genes and other markers of inflammation, fibrosis, and regeneration were also observed. Simvastatin partially protected muscles from the weakness that occurs as a result of chronic rotator cuff tear. Fibrosis was also markedly reduced in simvastatin-treated animals. Whereas further studies are necessary, statin medication could potentially help improve outcomes for patients with rotator cuff tears. Copyright © 2015 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  8. A New Method of Preparing Alkanethiol-Protected Gold Nanoparticals

    Institute of Scientific and Technical Information of China (English)

    HU Xiao-ya; XU Qin; GUO Rong

    2003-01-01

    In a new two-phase system ( tetrahydrofuran/ saturated NaCl aqueous solution ) monolayer protected clusters ( MPCs ) were prepared. The AuCl-4 anion in saturated electrolyte aqueous solution was transferred into the organic phase of tetrahydrofuran by tetra-n-butylammoniun bromide ( ( C4 H9 )4 NBr )and was reduced quickly by sodium borohydride in the presence of alkanethiol. The functionalized MPCs were characterized by solubility , transmission electron microscopy (TEM), Fourier transform infrared spectroscopy ( FTIR ), energy-dispersive X-ray (EDX) analysis and UV-vis spectroscopy. Electrochemical measurements of MPCs in CH2 Cl2 exhibited 7 pairs of reversible voltammetric waves within the potential range of - 1.0 to 1.0 V ( vs Ag/ AgCl ), which was ascribed to the quantized capacitance charging of nanoparticle double layers. All the results show that the new preparing method is feasible.

  9. New Chicago-Indiana computer network prepared to handle massive data flow

    CERN Multimedia

    2006-01-01

    "The Chicago-Indiana system is ont of five Tier-2 (regional) centers in the United States that will receive data from one of four massive detectors at the Large Hadron Collider at CERN, the European particle physics laboratory in Geneva. When the new instrument begins operating late next year, beams of protons will collide 40 million times a second. When each of those proton beams reaches full intensity, each collision will produce approximately 23 interactions between protons that will create various types of subatomic particles." (1,5 page)

  10. Massive bleeding on a bladder protectant: a case report of pentosan polysulfate sodium-induced coagulopathy.

    Science.gov (United States)

    Gill, Sharlene; Naiman, Sheldon C; Jamal, Abeed; Vickars, Linda M

    2002-07-22

    Pentosan polysulfate sodium (Elmiron; Alza Pharmaceuticals, Mountain View, Calif) is an oral preparation of pentosan polysulfate used in the symptomatic management of interstitial cystitis. While pentosan polysulfate has a known heparin-like effect in its parenteral form, there have been no previous reports of coagulopathy with oral use. We present an interesting case of inadvertent systemic anticoagulation resulting in serious bleeding complications in a young woman taking oral pentosan polysulfate for interstitial cystitis.

  11. Preparation of Eco-environmental Protection Bricks from Lake Sludge

    Institute of Scientific and Technical Information of China (English)

    WU Jianfeng; LI Fangwen; XU Xiaohong; SU Xianli

    2008-01-01

    Eco-environmental protection hollow bricks manufactured from lake sludge collected from North Lake in Wuhan of China were investigated.At first,the recipes of round sampies(diameter in 5 cm and thickness in 1 cm) prepared by pressing molding under a pressure of 8 MPa and firing system were optimized,and properties such as bending strength,compressive strength,total shrinkage rate,water adsorption rate,apparent porosity and bulk density of the fired samples were tested.The experimental results showed that water adsorption rate and apparent porosity decreased,while bulk density increased with firing temperature increasing.Addition of additive can result in the improvement of strength of fired samples.At the same time,fly ash and additive may also broaden the firing temperature range and reduce firing temperature.Toxic characteristic leaching procedure (TLCP)tests of samples also show that the metal leaching level is low.The conditions for manufacturing good quality sample include 80% sludge with 10% additive and 10% flyash fired at 1000 ℃ for 60 min.Bending strength and compressive strength of samples prepared under the conditions are 24.64 MPa,131.95 MPa,respectively,which are far beyond the requirements of clay solid bricks of CNS.Finally,according to the optimized recipe,the eco-environmental protection hollow bricks with the sizes of 40 mm×38 mm×25 mm were made and tested by extrusion molding.Compared with the Chinese National Standards (CNS:GB 13545-2003),compressive strength,water adsorption and bulk denstiy of the hollow bricks are 11.55 MPa ,14.5% and 986 kg/m3 when they were fired at 1040 ℃,which are far beyond the require of of CNS.Especially,its water adsorption arrives to standard of high-class products(16.0%) and compressive strength is above the hightest class(MU 10.0).

  12. Complete data preparation flow for Massively Parallel E-Beam lithography on 28nm node full-field design

    Science.gov (United States)

    Fay, Aurélien; Browning, Clyde; Brandt, Pieter; Chartoire, Jacky; Bérard-Bergery, Sébastien; Hazart, Jérôme; Chagoya, Alexandre; Postnikov, Sergei; Saib, Mohamed; Lattard, Ludovic; Schavione, Patrick

    2016-03-01

    Massively parallel mask-less electron beam lithography (MP-EBL) offers a large intrinsic flexibility at a low cost of ownership in comparison to conventional optical lithography tools. This attractive direct-write technique needs a dedicated data preparation flow to correct both electronic and resist processes. Moreover, Data Prep has to be completed in a short enough time to preserve the flexibility advantage of MP-EBL. While the MP-EBL tools have currently entered an advanced stage of development, this paper will focus on the data preparation side of the work for specifically the MAPPER Lithography FLX-1200 tool [1]-[4], using the ASELTA Nanographics Inscale software. The complete flow as well as the methodology used to achieve a full-field layout data preparation, within an acceptable cycle time, will be presented. Layout used for Data Prep evaluation was one of a 28 nm technology node Metal1 chip with a field size of 26x33mm2, compatible with typical stepper/scanner field sizes and wafer stepping plans. Proximity Effect Correction (PEC) was applied to the entire field, which was then exported as a single file to MAPPER Lithography's machine format, containing fractured shapes and dose assignments. The Soft Edge beam to beam stitching method was employed in the specific overlap regions defined by the machine format as well. In addition to PEC, verification of the correction was included as part of the overall data preparation cycle time. This verification step was executed on the machine file format to ensure pattern fidelity and accuracy as late in the flow as possible. Verification over the full chip, involving billions of evaluation points, is performed both at nominal conditions and at Process Window corners in order to ensure proper exposure and process latitude. The complete MP-EBL data preparation flow was demonstrated for a 28 nm node Metal1 layout in 37 hours. The final verification step shows that the Edge Placement Error (EPE) is kept below 2.25 nm

  13. Computer Forensic Function Testing: Media Preparation, Write Protection And Verification

    Directory of Open Access Journals (Sweden)

    Yinghua (David Guo

    2010-06-01

    Full Text Available Normal 0 false false false EN-US JA AR-SA The growth in the computer forensic field has created a demand for new software (or increased functionality to existing software and a means to verify that this software is truly forensic i.e. capable of meeting the requirements of the trier of fact. In this work, we review our previous work---a function oriented testing framework for validation and verification of computer forensic tools. This framework consists of three parts: function mapping, requirements specification and reference set development. Through function mapping, we give a scientific and systemical description of the fundamentals of computer forensic discipline, i.e. what functions are needed in the computer forensic investigation process. We focus this paper on the functions of media preparation, write protection and verification. Specifically, we complete the function mapping of these functions and specify their requirements. Based on this work, future work can be conducted to develop corresponding reference sets to test any tools that possess these functions.

  14. Dense protective coatings, methods for their preparation and coated articles

    Energy Technology Data Exchange (ETDEWEB)

    Tulyani, Sonia; Bhatia, Tania; Smeggil, John G.

    2015-12-29

    A method for depositing a protective coating on a complex shaped substrate includes the steps of: (1) dipping a complex shaped substrate into a slurry to form a base coat thereon, the slurry comprising an aqueous solution, at least one refractory metal oxide, and at least one transient fluid additive present in an amount of about 0.1 percent to 10 percent by weight of the slurry; (2) curing the dipped substrate; (3) dipping the substrate into a precursor solution to form a top barrier coat thereon; and (4) heat treating the dipped, cured substrate to form a protective coating.

  15. Comparison of pre-analytical FFPE sample preparation methods and their impact on massively parallel sequencing in routine diagnostics.

    Directory of Open Access Journals (Sweden)

    Carina Heydt

    Full Text Available Over the last years, massively parallel sequencing has rapidly evolved and has now transitioned into molecular pathology routine laboratories. It is an attractive platform for analysing multiple genes at the same time with very little input material. Therefore, the need for high quality DNA obtained from automated DNA extraction systems has increased, especially to those laboratories which are dealing with formalin-fixed paraffin-embedded (FFPE material and high sample throughput. This study evaluated five automated FFPE DNA extraction systems as well as five DNA quantification systems using the three most common techniques, UV spectrophotometry, fluorescent dye-based quantification and quantitative PCR, on 26 FFPE tissue samples. Additionally, the effects on downstream applications were analysed to find the most suitable pre-analytical methods for massively parallel sequencing in routine diagnostics. The results revealed that the Maxwell 16 from Promega (Mannheim, Germany seems to be the superior system for DNA extraction from FFPE material. The extracts had a 1.3-24.6-fold higher DNA concentration in comparison to the other extraction systems, a higher quality and were most suitable for downstream applications. The comparison of the five quantification methods showed intermethod variations but all methods could be used to estimate the right amount for PCR amplification and for massively parallel sequencing. Interestingly, the best results in massively parallel sequencing were obtained with a DNA input of 15 ng determined by the NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA. No difference could be detected in mutation analysis based on the results of the quantification methods. These findings emphasise, that it is particularly important to choose the most reliable and constant DNA extraction system, especially when using small biopsies and low elution volumes, and that all common DNA quantification techniques can

  16. Clinical observations of noncoping overdenture abutments protected by tannin-fluoride preparation.

    Science.gov (United States)

    Yamaga, T; Nokubi, T

    1997-09-01

    The exposed dentin of overdenture abutments can lead to caries. Therefore chemical protection is needed to prevent caries. Considering that dentin contains both organic and inorganic components, reinforcement of both components should give reasonable results. Tannin-fluoride preparation strengthens both the organic and inorganic components of teeth. This study examined whether the tannin-fluoride preparation protects noncoping abutments. Thirty-one subjects aged 36 to 86 years participated in the clinical trial. A trial autopolymerizing resin containing the preparation or a conventional autopolymerizing resin was applied to the inner surface of the denture base, which was in contact with the abutments. When there were autopolymerizing resin group abutments, there was also at least one preparation group abutment under the overdenture. The incidence of caries in the preparation and autopolymerizing resin groups were 0% and 0%, respectively, for the first 2 years, 4.5% and 0%, respectively, during the 3- to 4-year period, 13.8% and 75%, respectively, during the 5- to 8-year period, and 10% and 15%, respectively, in total. Gingival crevicular fluid demonstrated a tendency to decrease in both groups over time. The trial autopolymerizing resin containing the preparation has a long-term caries prevention effect, and helps to maintain gingival health. Without adding clinical steps, abutments can be protected by the tannin-fluoride preparation.

  17. Massive Gravity

    National Research Council Canada - National Science Library

    de Rham, Claudia

    2014-01-01

    We review recent progress in massive gravity. We start by showing how different theories of massive gravity emerge from a higher-dimensional theory of general relativity, leading to the Dvali–Gabadadze–Porrati model (DGP...

  18. Students and Institutions Protecting Whiteness as Property: A Critical Race Theory Analysis of Student Affairs Preparation

    Science.gov (United States)

    Bondi, Stephanie

    2012-01-01

    This study is based on interviews with White students graduating from a student affairs preparation program as well as a literature review of whiteness in education. Applying "critical race theory," the author examined the ways that students and institutions protected whiteness. Institutions and those within them concerned with equity must have…

  19. Massive gravity

    OpenAIRE

    Claudia de Rham

    2016-01-01

    We review recent progress in massive gravity. We start by showing how different theories of massive gravity emerge from a higher-dimensional theory of general relativity, leading to the Dvali-Gabadadze-Porrati model (DGP), cascading gravity, and ghost-free massive gravity. We then explore their theoretical and phenomenological consistency, proving the absence of Boulware-Deser ghosts and reviewing the Vainshtein mechanism and the cosmological solutions in these models. Finally, we present alt...

  20. Massive Gravity

    OpenAIRE

    de Rham, Claudia

    2014-01-01

    We review recent progress in massive gravity. We start by showing how different theories of massive gravity emerge from a higher-dimensional theory of general relativity, leading to the Dvali-Gabadadze-Porrati model (DGP), cascading gravity, and ghost-free massive gravity. We then explore their theoretical and phenomenological consistency, proving the absence of Boulware-Deser ghosts and reviewing the Vainshtein mechanism and the cosmological solutions in these models. Finally, we present alt...

  1. Massive Gravity

    OpenAIRE

    2014-01-01

    We review recent progress in massive gravity. We start by showing how different theories of massive gravity emerge from a higher-dimensional theory of general relativity, leading to the Dvali–Gabadadze–Porrati model (DGP), cascading gravity, and ghost-free massive gravity. We then explore their theoretical and phenomenological consistency, proving the absence of Boulware–Deser ghosts and reviewing the Vainshtein mechanism and the cosmological solutions in these models. Finally, we present alt...

  2. Co3O4 protective coatings prepared by Pulsed Injection Metal Organic Chemical Vapour Deposition

    DEFF Research Database (Denmark)

    Burriel, M.; Garcia, G.; Santiso, J.

    2005-01-01

    Cobalt oxide films were grown by Pulsed Injection Metal Organic Chemical Vapour Deposition (PI-MOCVD) using Co(acac)(3) (acac=acetylacetonate) precursor dissolved in toluene. The structure, morphology and growth rate of the layers deposited on silicon substrates were studied as a function...... of deposition temperature. Pure Co3O4 spinel structure was found for deposition temperatures ranging from 360 to 540 degreesC. The optimum experimental parameters to prepare dense layers with a high growth rate were determined and used to prepare corrosion protective coatings for Fe-22Cr metallic interconnects...

  3. Massive Stars

    Science.gov (United States)

    Livio, Mario; Villaver, Eva

    2009-11-01

    Participants; Preface Mario Livio and Eva Villaver; 1. High-mass star formation by gravitational collapse of massive cores M. R. Krumholz; 2. Observations of massive star formation N. A. Patel; 3. Massive star formation in the Galactic center D. F. Figer; 4. An X-ray tour of massive star-forming regions with Chandra L. K. Townsley; 5. Massive stars: feedback effects in the local universe M. S. Oey and C. J. Clarke; 6. The initial mass function in clusters B. G. Elmegreen; 7. Massive stars and star clusters in the Antennae galaxies B. C. Whitmore; 8. On the binarity of Eta Carinae T. R. Gull; 9. Parameters and winds of hot massive stars R. P. Kudritzki and M. A. Urbaneja; 10. Unraveling the Galaxy to find the first stars J. Tumlinson; 11. Optically observable zero-age main-sequence O stars N. R. Walborn; 12. Metallicity-dependent Wolf-Raynet winds P. A. Crowther; 13. Eruptive mass loss in very massive stars and Population III stars N. Smith; 14. From progenitor to afterlife R. A. Chevalier; 15. Pair-production supernovae: theory and observation E. Scannapieco; 16. Cosmic infrared background and Population III: an overview A. Kashlinsky.

  4. The Effect of Serial Culture and Storage on the Protective Potential of a Competitive Exclusion Preparation

    Directory of Open Access Journals (Sweden)

    Almeida WAF

    2002-01-01

    Full Text Available The competitive exclusion method (EC was used to protect day-old birds against colonisation of the intestinal tract by Salmonella enterica serovar Enteritidis (SE. The culture prepared in nutrient broth incubated at 37ºC/24 h inhibited SE growth in the caecal contents. The beneficial effect was also observed after serial passage of the feces culture for up to 14 times. The material obtained after 12 serial sub-cultures after storage for 28 days at 4-6ºC also kept its action on SE.

  5. Sol-gel prepared active ternary oxide coating on titanium in cathodic protection

    Directory of Open Access Journals (Sweden)

    VLADIMIR V. PANIC

    2007-12-01

    Full Text Available The characteristics of a ternary oxide coating, on titanium, which consisted of TiO2, RuO2 and IrO2 in the molar ratio 0.6:0.3:0.1, calculated on the metal atom, were investigated for potential application for cathodic protection in a seawater environment. The oxide coatings on titanium were prepared by the sol gel procedure from a mixture of inorganic oxide sols, which were obtained by forced hydrolysis of metal chlorides. The morphology of the coating was examined by scanning electron microscopy. The electrochemical properties of activated titanium anodes were investigated by cyclic voltammetry and polarization measurements in a H2SO4- and NaCl-containing electrolyte, as well as in seawater sampled on the Adriatic coast in Tivat, Montenegro. The anode stability during operation in seawater was investigated by the galvanostatic accelerated corrosion stability test. The morphology and electrochemical characteristics of the ternary coating are compared to that of a sol-gel-prepared binary Ti0.6Ru0.4O2 coating. The activity of the ternary coating was similar to that of the binary Ti0.6Ru0.4O2 coating in the investigated solutions. However, the corrosion stability in seawater is found to be considerably greater for the ternary coating.

  6. Influences of age and light touch on the preparation for protective stepping reactions.

    Science.gov (United States)

    O-Phartkaruna, Tippawan; Pichaiyongwongdee, Sopa; Tretriluxana, Jarugool; Vachalathiti, Rungtiwa

    2014-07-01

    The present study examined the effect of light touch on the preparation for fall-induced protective stepping in elderly and young individuals. The subjects were perturbed with forward pull with no-touch and light touch conditions. Anticipatory periods, lift-off onset, center of pressure displacement and velocity were measured and analyzed. The authors observed a stabilizing effect during with light touch in pre-perturbation periods. During the perturbation, the elderly took steps earlier than did the young individuals by reducing anticipatory periods; however, their anterior stability limit was similar to that of the youth, indicating that the step was pre-selected. In the youth, a delay in anticipatory onset and shorter periods were observed with light touch, resulting from a limitation in lateral limb loading. Additionally, the stabilizing effect in the pre-perturbation period did not influence stabilization of preparatory period before stepping. In the elderly, shorter anticipatory periods and lower stability limits were also shown in light touch conditions. The authors concluded that the elderly were more concerned with a postural task than with light touch. Protective stepping is reflected in the state of balance stability and involves a pre-selection process. Light touch enhances postural stability in stance and impacts the stepping.

  7. Preparation of Vanadium Dioxide Films for Protection from High-energy Laser Hits

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Vanadium dioxide(VO2)thin films are used for protection from high-energy laser hits due to their semiconductor-to-metal phase transition experienced during heating at temperature of approximately 68℃,which followed by a abrupt change of optical behavior, namely from transparent semiconductor state below 68℃ to highly reflective metallic state beyond 68℃.The preparation and properties of the films are described as well as the primary principle of the device for protection from high energy laser hits. An ion-beam-sputtering system is used to deposit VO2 thin films.The technique is reactive ion beam sputtering of vanadium at temperature of 200℃ on Si, Ge and Si3N4 substrates in a well controlled atmosphere of argon with a partial pressure of O2, followed by a post annealing at 400-550℃ with argon gas.The optical transmittance changes from 60% to 4% are obtained within the temperature range from 50℃ to 70℃. X-ray diffraction (XRD) shows that the films are of single-phase VO2.

  8. Preparing the United States for Zika Virus: Pre-emptive Vector Control and Personal Protection.

    Science.gov (United States)

    Diaz, James H

    2016-12-01

    Discovered in 1947 in a monkey in the Zika forest of Uganda, Zika virus was dismissed as a cause of a mild illness that was confined to Africa and Southeast Asia and transmitted by Aedes mosquitoes. In 2007, Zika virus appeared outside of its endemic borders in an outbreak on the South Pacific Island of Yap. In 2013, Zika virus was associated with a major neurological complication, Guillain-Barré syndrome, in a larger outbreak in the French Polynesian Islands. From the South Pacific, Zika invaded Brazil in 2015 and caused another severe neurological complication, fetal microcephaly. The mosquito-borne transmission of Zika virus can be propagated by sexual transmission and, possibly, by blood transfusions, close personal contacts, and organ transplants, like other flaviviruses. Since these combined mechanisms of infectious disease transmission could result in catastrophic incidences of severe neurological diseases in adults and children, the public should know what to expect from Zika virus, how to prevent infection, and what the most likely failures in preventive measures will be. With federal research funding stalled, a Zika vaccine is far away. The only national strategies to prepare the United States for Zika virus invasion now are effective vector control measures and personal protection from mosquito bites. In addition to a basic knowledge of Aedes mosquito vectors and their biting behaviors, an understanding of simple household vector control measures, and the selection of the best chemical and physical mosquito repellents will be required to repel the Zika threat.

  9. Protecting groups for RNA synthesis: an increasing need for selective preparative methods.

    Science.gov (United States)

    Somoza, Alvaro

    2008-12-01

    RNA can be chemically synthesized by automated DNA/RNA synthesizers, using protected ribonucleosides activated as phosphoramidites. The efficiency of the synthesis depends greatly on the protecting groups used, especially the protecting group on the 2'-hydroxyl functionality. The strategies employed to place the protecting groups on the desired functionality are quite inefficient, requiring additional modifications of the substrate, or leading to mixtures of protected compounds. In this tutorial review, the methods available for the selective protection of ribonucleosides are commented on, introducing the reader to the synthetic challenges involved.

  10. Preparation and characterization of polymeric nanocomposite films for application as protective coatings

    Science.gov (United States)

    Gagliardi, S.; Rondino, F.; D'Erme, C.; Persia, F.; Menchini, F.; Santarelli, M. L.; Paulke, B.-R.; Enayati, A. L.; Falconieri, M.

    2017-08-01

    Addiction of ceramic nanoparticles to acrylic polymers provides a simple and effective means to produce paints with important properties, such as mechanical resistance and tailored wettability, even though for optimal performances, an engineered nanoparticle distribution would be desirable. In this paper we report on the realization and on the morphological and functional characterization of nanocomposites where the nanophase is distributed on the surface of acrylic polymer films, in order to enhance the expression of surface-related properties. To this aim, commercial titanium oxide and silicon oxide nanopowders were dispersed in water and the suspensions were air-sprayed on polymeric films prepared by paint brushing, thus producing a nanostructured ceramic surface coating. Control of the pH of suspensions and acrylic acid functionalization of the surface of titania were used together with high power ultrasonic treatments in order to control dimension of the aggregates in the sprayed suspensions. Optical microscopy, mechanical profilometry, and atomic force microscopy were used to characterize the nanocomposite surface morphology and correlate it to the coating functional properties, evaluated through mechanical abrasion tests and contact angle measurements; also, colorimetry on coated stones was performed in order to test the impact of the coatings on the aesthetical appearance and their photostability under UV irradiation. Results show that the nanostructured ceramic layer slightly improves the resistance of coatings to mechanical abrasion in case of polymer films prepared from latexes. The nanocomposite surface layer does not affect the wettability of the polymer, which remained slightly hydrophilic; this behavior is likely due to inadequate distribution of the nanophase. On the other hand UV-induced superhydrophilicity was observed when the concentration of surface titania nanoparticles is about 0.6 mg/cm2. Colorimetric analysis on historical and Carrara

  11. Polyacrylamide preparations for protection of water quality threatened by agricultural runoff contaminants

    Energy Technology Data Exchange (ETDEWEB)

    Entry, J.A.; Sojka, R.E.; Watwood, Maribeth; Ross, Craig

    2002-12-01

    Polyacrylamide preparations show promise in reducing flow of sediments, nutrients and microorganisms from animal production facilities. - Waste streams associated with a variety of agricultural runoff sources are major contributors of nutrients, pesticides and enteric microorganisms to surface and ground waters. Water soluble anionic polyacrylamide (PAM) was found to be a highly effective erosion-preventing and infiltration-enhancing polymer, when applied at rates of 1-10 g m{sup -3} in furrow irrigation water. Water flowing from PAM treated irrigation furrows show large reductions in sediment, nutrients and pesticides. Recently PAM and PAM+CaO and PAM+Al(SO{sub 4}){sub 3} mixtures have been shown to filter bacteria, fungi and nutrients from animal wastewater. Low concentrations of PAM [175-350 g PAM ha{sup -1} as PAM or as PAM+CaO and PAM+Al(SO{sub 4}) mixture] applied to the soil surface, resulted in dramatic decreases (10 fold) of total, coliform and fecal streptococci bacteria in cattle, fish and swine wastewater leachate and surface runoff. PAM treatment also filtered significant amounts of NH{sub 4}, PO{sub 4} and total P in cattle and swine wastewater. This points to the potential of developing PAM as a water quality protection measure in combination with large-scale animal feeding operations. Potential benefits of PAM treatment of animal facility waste streams include: (1) low cost, (2) easy and quick application, (3) suitability for use with other pollution reduction techniques. Research on the efficacy of PAM for removal of protozoan parasites and viruses and more thorough assessment of PAM degradation in different soils is still needed to completely evaluate PAM treatment as an effective waste water treatment. We will present analysis and feasibility of using PAM, PAM+Al(SO{sub 4}){sub 3}, and PAM+CaO application for specific applications. Our results demonstrate their potential efficacy in reducing sediment, nutrients and microorganisms from animal

  12. Preparation, characterization and evaluation of moisturizing and UV protecting effects of topical solid lipid nanoparticles

    Directory of Open Access Journals (Sweden)

    Shiva Golmohammadzadeh

    2012-12-01

    Full Text Available Solid lipid nanoparticles (SLN were recently proposed as carriers for various pharmaceutical and cosmetic actives. These lipid nanoparticles can act as moisturizers and physical sunscreens on their own. Therefore, the full potential of these carriers has yet to be determined. The present study was aimed to determine and compare moisturizing and UV-protecting effects of different solid lipid nanoparticles (SLN prepared by different solid lipids including Glyceryl monostearate (GMS, Precirol® (P and cetyl palmitate (CP as carrier systems of moisturizers and sunscreens. The influence of the size and matrix crystallinity of the solid lipids on the occlusive factor, skin hydration and UV-protection were evaluated by in vitro and in vivo methods. The SLN were prepared by high-shear homogenization and ultrasound methods. Size, zeta potential and morphological characteristics of the samples were assessed by transmission electron microscopy (TEM and thermotropic properties with differential scanning calorimetry (DSC technique. Results of the assessments showed that SLN-CP significantly increases skin hydration and UV-protection, compared to SLN-GMS and SLN-P. It was demonstrated that the size of SLN, crystallinity index of solid lipid in SLN and probably other mechanisms besides the occlusive factor can influence skin hydration and UV-protection indices. Furthermore, findings of the assessments demonstrated significant difference between in vitro and in vivo assessments regarding occlusive factor and moisturizing effects. Findings of the present study indicate that the SLN-CP could be a promising carrier for sunscreens and moisturizers.Nanopartículas lipídicas sólidas (NLS foram, recentemente, propostas como carreadores de vários ativos cosméticos e farmacêuticos. Essas nanopartículas lipídicas podem atuar como hidratantes e protetores solares físicos por si só. Assim sendo, determinou-se o potencial desses carreadores. Os objetivos do

  13. Preparation of DNA Containing 5-Hydroxymethyl-2′-Deoxycytidine Modification Through Phosphoramidites with TBDMS as 5-Hydroxymethyl Protecting Group

    Science.gov (United States)

    Dai, Qing; He, Chuan

    2013-01-01

    This unit describes procedures for preparation of two phosphoramidite building blocks III and IV, both containing a TBDMS as 5-CH2OH-protecting group. Phosphoramidites III and IV allow efficient incorporation of 5-hmC into DNA and a “one-step” deprotection procedure to cleanly remove all the protecting groups. A “two-step” deprotection strategy is compatible with ultramild DNA synthesis, which enables the synthesis of 5hmC-containing DNA with additional modifications. Methods are also presented for their incorporation into oligonucleotides by solid-phase synthesis, subsequent deprotection, and HPLC analysis. PMID:22147420

  14. Preparation

    Directory of Open Access Journals (Sweden)

    M.M. Dardir

    2014-03-01

    Full Text Available Some hexanamide-mono and di-linoleniate esters were prepared by the reaction of linolenic acid and hexanamide (derived from the reaction of hexanoic acid and diethanolamine. The chemical structure for the newly prepared hexanamide-mono and di-linoleniate esters were elucidated using elemental analysis, (FTIR, H 1NMR and chemical ionization mass spectra (CI/Ms spectroscopic techniques. The results of the spectroscopic analysis indicated that they were prepared through the right method and they have high purity. The new prepared esters have high biodegradability and lower toxicity (environmentally friendly so they were evaluated as a synthetic-based mud (ester-based mud for oil-well drilling fluids. The evaluation included study of the rheological properties, filtration and thermal properties of the ester based-muds formulated with the newly prepared esters compared to the reference commercial synthetic-based mud.

  15. Novel Preparation of Methoxy Carbamates of 1-Protected Indole- 3-methylamines as Precursor of Indole-3-methylamine

    Institute of Scientific and Technical Information of China (English)

    SONG,Hao; XIN,Jun-Guo; WANG,Yin; CHEN,Wei; YANG,Jun; QIN,Yong

    2004-01-01

    @@ Indole-3-methylamine (1) has been well demonstrated to be a very useful intermediate as a pharmaceutical building block and starting material for syntheses of phytoalexins.[1] The instability of indole-3-methylamine (1) has undoubtedly restricted its application in synthetic chemistry. Hofmann rearrangement that directly converts carboxamides to alky carbamates in the presence of alcohol required unexceptionally a strong base,[2] which devaluated the possible usefulness of Hofmann rearrangement in preparation of base sensitive amines, especially for the preparation of unstable indole-3-methylamine (1). Herein we would like to report a convenient method for the preparation of alkyl carbamates of 1-protected indole-3-methylamines (4) via the diacetoxyiodobenzene (DIB) promoted Hofmann rearrangement under neutral condition.

  16. Preparation of Novel meta- and para-Substituted N-Benzyl Protected Quinuclidine Esters and Their Resolution with Butyrylcholinesterase

    Directory of Open Access Journals (Sweden)

    Srđanka Tomić

    2012-01-01

    Full Text Available Since the optically active quinuclidin-3-ol is an important intermediate in the preparation of physiologically or pharmacologically active compounds, a new biocatalytic method for the production of chiral quinuclidin-3-ols was examined. Butyrylcholinesterase (BChE; EC 3.1.1.8 was chosen as a biocatalyst in a preparative kinetic resolution of enantiomers. A series of racemic, (R- and (S-esters of quinuclidin-3-ol and acetic, benzoic, phthalic and isonicotinic acids were synthesized, as well as their racemic quaternary N-benzyl, meta- and para-N-bromo and N-methylbenzyl derivatives. After the resolution, all N-benzyl protected groups were successfully removed by catalytic transfer hydrogenation with ammonium formate (10% Pd-C. Hydrolyses studies with BChE confirmed that (R-enantiomers of the prepared esters are much better substrates for the enzyme than (S-enantiomers. Introduction of bromine atom or methyl group in the meta or para position of the benzyl moiety resulted in a considerable improvement of the stereoselectivity compared to the non-substituted compounds. Optically pure quinuclidin-3-ols were prepared in high yields and enantiopurity by the usage of various N-benzyl protected groups and BChE as a biocatalyst.

  17. Robust preparation and manipulation of protected qubits using time--varying Hamiltonians

    CERN Document Server

    Coudreau, Thomas; Dubessy, Romain; Andreoli, Daria; Milman, Pérola

    2011-01-01

    We show that it is possible to initialize and manipulate in a deterministic manner protected qubits using time varying Hamiltonians. Taking advantage of the symmetries of the system, we predict the effect of the noise during the initialization and manipulation. These predictions are in good agreement with numerical simulations. Our study shows that the topological protection remains efficient under realistic experimental conditions.

  18. Silver nanoparticles prepared by chemical reduction-protection method, and their application in electrically conductive silver nanopaste

    Energy Technology Data Exchange (ETDEWEB)

    Liu Jianguo, E-mail: ljg712@yahoo.com.c [Wuhan National Laboratory for Optoelectronics, College of Optoelectronics Science and Engineering, Huazhong University of Science and Technology, Wuhan, Hubei 430074 (China); Li Xiangyou; Zeng Xiaoyan [Wuhan National Laboratory for Optoelectronics, College of Optoelectronics Science and Engineering, Huazhong University of Science and Technology, Wuhan, Hubei 430074 (China)

    2010-04-02

    Ag nanoparticles were prepared in a water-phase system with a mixture of silver-ammonia complex, sodium borohydride, and lauric acid according to molar feed ratio of approximately 6:3:1. The mechanism of preparation and separation by chemical reduction-protection method was explored. The as-synthesized Ag nanoparticles were characterized by transmission electron microscopy (TEM), X-ray diffraction (XRD) and UV-vis spectroscopy, respectively. It was found that the size of high purity Ag particles was ranging from 30 to 50 nm with slight agglomeration. In addition, the as-synthesized wet Ag nanoparticles were dispersed stably in organic vehicle to formulate electrically conductive nanopaste. Upon direct-written and sintered, the array pattern of the nanopaste with the resolution of about 30 {mu}m was achieved with the electrical resistivity in the order of magnitude of 10{sup -5} {Omega} cm.

  19. Preparation of flower-like CuS by solvothermal method and its photodegradation and UV protection

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Xiao-Sai; Shen, Yong, E-mail: shenyong@sues.edu.cn; Xu, Li-Hui; Wang, Li-Ming; Xing, Ya-Jun

    2016-07-25

    The flower-like CuS with hierarchical structures were synthesized by a solvothermal method. X-ray diffraction (XRD), scanning electron microscopy (SEM), Fourier transform infrared (FTIR) spectroscopy, UV–vis optical absorption spectroscopy and thermogravimetric analysis (TGA) and ultraviolet transmittance analyzer labsphere were used to characterize the as-prepared products. The results of photocatalytic degradation of Methylene blue (MB) demonstrated that the as-prepared flower-like CuS possessed high photocatalytic performance in UV and visible range and its band gap was 1.45 eV. The degradation rate of MB by CuS with the absence of H{sub 2}O{sub 2} was 98.23% and 100% under xenon lamp and Mercury tungsten blended lamp for 30 min, respectively. And a new approach for ultraviolet (UV) protection of cotton fabrics treated by flower-like CuS microspheres was innovatively investigated and the results showed that flower-like CuS was a good UV resistant material. - Highlights: • The flower-like CuS was prepared via solvothermal method. • The as-prepared CuS showed better photodegradation of MB solution under visible region. • The cotton fabric treated by the obtained flower-like CuS was proved to have a potential application in anti-UV field.

  20. Preparation and Evaluation of Children's Rights Education Curriculum: An Action Research Regarding on Protection Rights Module

    Science.gov (United States)

    Uçus, Sükran; Dedeoglu, Hakan

    2016-01-01

    Children's rights education is to enable children to gain the necessary social behaviors and essential knowledge for creating a democratic society that is based on respecting human rights. The purpose of this study was to investigate the preparation, application and assessment of a curriculum for teaching children's rights in elementary education.…

  1. [The protective action of a natural preparation of anthocyan (pelargonidin-3,5-diglucoside)].

    Science.gov (United States)

    Akhmadieva, A Kh; Zaichkina, S I; Ruzieva, R Kh; Ganassi, E E

    1993-01-01

    The effect of an anthocyan preparation isolated from flower petals of Pelargonium roseum and Rosa canina was studied in the Chinese hamster fibroblasts and Vicia faba seedlings in respect of cytogenetic damage and mouse survival. The pronounced radioprotective effect and the absence of the toxic effect were observed.

  2. Preparation and Properties of Smart Thermal Control and Radiation Protection Materials for Multi-functional Structure of Small Spacecraft

    Institute of Scientific and Technical Information of China (English)

    shijie Zhang; Xibin Cao; Yingqiang Luan; Xinxin Ma; Xiaohui Lin; Xianren Kong

    2011-01-01

    Considering the unique properties of small spacecraft, such as light weight, low power-consumption and high heat flux density, a new kind of lightweight boron carbide (B4C) radiation-protection coating material was proposed. New techniques for preparing LSMO thermal control coating and B4C radiation-protection coating were developed. The sample piece of multi-functional structure was manufactured by using the proposed materials, and a series of performance tests, such as thermal control and radiation-protection behaviors were evaluated. Test results show that: the emissivity of the multi-functional structure varies from 0.42 to 0.86 at 240 K to 353 K and the phase transition temperature is about 260 K. The electron radiation-protection ability of the multi-functional structure is 3.3 times better than that of Al material. The performance index of this multi-functional structure can meet the requirements for space application in on-board electronic equipment.

  3. Is microencapsulation the future of probiotic preparations? The increased efficacy of gastro-protected probiotics.

    Science.gov (United States)

    Del Piano, Mario; Carmagnola, Stefania; Ballarè, Marco; Sartori, Massimo; Orsello, Marco; Balzarini, Marco; Pagliarulo, Michela; Tari, Roberto; Anderloni, Andrea; Strozzi, Gian Paolo; Mogna, Luca; Sforza, Filomena; Capurso, Lucio

    2011-01-01

    In a recent publication we assessed the kinetics of intestinal colonization by microencapsulated probiotic bacteria in comparison with the same strains given in an uncoated form. It's well known, in fact, that microencapsulation of probiotics with specific materials is able to confer a significant resistance to gastric juice, thus protecting the cells during the gastric and duodenal transit and enhancing the probiotic efficacy of any supplementation. In any case, this was the first study reporting the fecal amounts of probiotics administered in a coated, protected form compared with traditional, uncoated ones. Here we discuss additional in vitro data of resistance of the same bacteria to gastric juice, human bile and pancreatic secretion and correlate them with the results of in vivo gut colonization.

  4. Preparation of UV-protective kefiran/nano-ZnO nanocomposites: physical and mechanical properties.

    Science.gov (United States)

    Shahabi-Ghahfarrokhi, Iman; Khodaiyan, Faramarz; Mousavi, Mohammad; Yousefi, Hossein

    2015-01-01

    In this study, we investigated the effect of ZnO nanoparticles (ZN) as a UV-protective agent of kefiran biopolymers. Our results showed that with increasing ZN content, the tensile strength, elongation at break, and tensile energy to break the kefiran film and nanocomposites also increased. Kefiran nanocomposites with a ZN content higher than 2% produced a UV-protective film with good visual properties, low sensibility to water, and low water-vapor permeability. The thermal properties of all specimens, analyzed by DSC, showed that the ZN content had a negative effect on Tg and a positive effect on nanocomposites' melting point. TEM, SEM micrography and XRD spectrum analysis confirmed the hypothesis that ZNs act like a ball bearing, making movement of kefiran chains easier and increasing elongation at break, while simultaneously decreasing the Tg of kefiran nanocomposites.

  5. Strategies for the Preparation of Differentially Protected ortho-Prenylated Phenols.

    Science.gov (United States)

    Hoarau, Christophe; Pettus, Thomas R R

    2003-01-01

    A new process for ortho-prenylation of phenols is presented within the context of known methods. All of the processes are briefly assessed with regards to the substitution patterns and accompanying functional groups tolerated by each strategy. The conclusion reached is that a new procedure using ortho-quinone methides, for which an experimental protocol is provided, offers the greatest generality and flexibility in the preparation of ortho-prenylated phenol derivatives.

  6. Epidemiology of Massive Transfusion

    DEFF Research Database (Denmark)

    Halmin, Märit; Chiesa, Flaminia; Vasan, Senthil K;

    2016-01-01

    OBJECTIVE: There is an increasing focus on massive transfusion, but there is a paucity of comprehensive descriptions of the massively transfused patients and their outcomes. The objective of this study is to describe the incidence rate of massive transfusion, patient characteristics, and the mort...

  7. Are gluons massive ?

    CERN Document Server

    Gilani, A H S

    2004-01-01

    It is claimed that only one gluon is massless and the other seven gluons are massive. Out of eight gluons, six are colored and two are neutral. Among neutral gluons, one is massless and other one is massive. Massive neutral gluon is heavier than the colored gluons. Gluons can only be predicted by set theory but not by SU(3).

  8. Preparation and Characterization of Chitosan/Zinc Oxide Nanoparticles for Imparting Antimicrobial and UV Protection to Cotton Fabric

    Directory of Open Access Journals (Sweden)

    M. M. AbdElhady

    2012-01-01

    Full Text Available Synthesis of chitosan/ZnO nanoparticles was performed using different concentrations of ZnO at different temperatures. Nanoparticles of ZnO/chitosan were prepared in rod form with average length 60 nm and average width 5–15 nm. Thus, obtained nanoparticles of ZnO/chitosan were characterized using UV spectrophotometer, FTIR, TEM, X-ray, and SEM. Size and shape of chitosan/ZnO nanoparticles relied on conditions of their synthesis. Notably, chitosan/ZnO in rod form with average length of 60 nm and average width 5–15 nm could be achieved. Application of chitosan/ZnO nanoparticles to cotton fabric conferred on the latter antibacterial and UV protection properties. Cotton fabric was characterized using SEM, ultraviolet protection factor (UPF rating, and antibacterial (gram-positive and gram-negative characteristics. Finished cotton fabric exhibited good antibacterial properties against gram-positive and gram-negative bacteria. The UV testes indicated a significant improvement in UV protection of finished cotton fabric which is increasing by increasing the concentration of nanoparticles of ZnO/chitosan.

  9. Protection of mouse hematopoietic stem cells by a preparation of herb mixture (hemoHIM) against whole body irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Jung, W. H.; Park, H. R.; Oh, H.; Jung, I. Y.; Cho, S. K. [KAERI, Taejon (Korea, Republic of)

    2002-10-01

    A preparation of herb mixture (HemoHIM) was designed from three medicinal herbs including Angelica gigantis Radix to protect gastrointestine, hematopoietic organs and immune system against radiation damage. In the present study, we investigated the radioprotective effects of HemoHIM on hematopoietic stem cells in {gamma}-irradiated mice and the underlying mechanisms. The administration of HemoHIM significantly increased the formation of endogenous spleen colony and reduced apoptosis of bone marrow cells in {gamma}-irradiated mice. These results showed that HemoHIM protected hematopoietic stem cells from irradiation. To investigate the mechanism of the protection, the effects of HemoHIM on expression of radioprotective cytokines was examined. HemoHIM increased the mRNA levels of IL-1{beta}, TNF-{alpha}, SCF and IL-6 in bone marrow cells and peritoneal macrophages in vitro. In vivo administration of HemoHIM increased the mRNA levels of IL-1{beta}, TNF-{alpha} in spleen. The examination of radical scavenging activity of HemoHIM as another mechanism revealed that HemoHIM was effective at scavenging DPPH radicals and hydroxyl radicals. From these results, it is suggested that HemoHIM exerts these radioprotective effects through the induction of radioprotective cytokines and/or through directly scavenging radicals produced by {gamma}-irradiation.

  10. Preparation and Characterization of Catalase-Loaded Solid Lipid Nanoparticles Protecting Enzyme against Proteolysis

    Directory of Open Access Journals (Sweden)

    Ce Qi

    2011-07-01

    Full Text Available Catalase-loaded solid lipid nanoparticles (SLNs were prepared by the double emulsion method (w/o/w and solvent evaporation techniques, using acetone/methylene chloride (1:1 as an organic solvent, lecithin and triglyceride as oil phase and Poloxmer 188 as a surfactant. The optimized SLN was prepared by lecithin: triglyceride ratio (5%, 20-second + 30-second sonication, and 2% Poloxmer 188. The mean particle size of SLN was 296.0 ± 7.0 nm, polydispersity index range and zeta potential were 0.322–0.354 and −36.4 ± 0.6, respectively, and the encapsulation efficiency reached its maximum of 77.9 ± 1.56. Catalase distributed between the solid lipid and inner aqueous phase and gradually released from Poloxmer coated SLNs up to 20% within 20 h. Catalase-loaded SLN remained at 30% of H2O2-degrading activity after being incubated with Proteinase K for 24 h, while free catalase lost activity within 1 h.

  11. Preparation of ultraviolet-cured nanocomposite coatings for protecting against corrosion of metal substrates

    Energy Technology Data Exchange (ETDEWEB)

    Malucelli, G.; Di Gianni, A. [Dipartimento di Scienza dei Materiali e Ingegneria Chimica, Politecnico di Torino, c. so Duca degli Abruzzi 24, 10129 Torino (Italy); Deflorian, F. [Dipartimento di Ingegneria dei Materiali e Tecnologie Industriali, Universita di Trento, Via Mesiano 77, 38050 Trento (Italy)], E-mail: defloria@ing.unitn.it; Fedel, M. [Dipartimento di Ingegneria dei Materiali e Tecnologie Industriali, Universita di Trento, Via Mesiano 77, 38050 Trento (Italy); Bongiovanni, R. [Dipartimento di Scienza dei Materiali e Ingegneria Chimica, Politecnico di Torino, c. so Duca degli Abruzzi 24, 10129 Torino (Italy)

    2009-08-15

    A cycloaliphatic di-epoxy monomer was used to prepare ultraviolet-cured coatings, in the presence of montmorillonites, either commercially available, or modified on purpose (Cloisite Na{sup +}, Cloisite 30B), dispersed at two different concentrations (5% and 10% w/w). The corrosion resistance of the ultraviolet-cured films coated on a metal substrate was investigated with electrochemical techniques and compared to the behaviour of the neat ultraviolet-cured epoxy resin films. The coatings showed different stability as revealed by the measurements of the barrier properties depending on the type of nanoclay used. Changing the modifier employed the coatings exhibited intercalated or exfoliated morphologies, as assessed by electron microscopy analysis and confirmed by X-ray diffraction results; the prevention of corrosion was proved dependent on the morphology.

  12. U.S. Environmental Protection Agency's activities to prepare for regulatory and risk assessment applications of genomics information.

    Science.gov (United States)

    Benson, William H; Gallagher, Kathryn; McClintock, J Thomas

    2007-06-01

    Genomics is expected to have significant implications for risk assessment and regulatory decision making. Since 2002, the U.S. Environmental Protection Agency (EPA) has undertaken a number of cross-agency activities to further prepare itself to receive, interpret, and apply genomics information for risk assessment and regulatory purposes. These activities include: (1) the issuance of an Interim Genomics Policy on the use of genomics information in risk assessments and decision making, (2) the release of the 2004 Genomics White Paper, which outlines potential applications and implications of genomics for EPA, and (3) the recent release of the external review draft of the Interim Guidance on Microarray-Based Assays, which outlines data submission, quality, analysis, management, and training considerations for such data. This manuscript discusses these activities and more recent follow-up activities with the aim of further communicating these efforts to the broader scientific and stakeholder community.

  13. Chitosan and Cystatin/Lysozyme Preparation as Protective Edible Films Components

    Directory of Open Access Journals (Sweden)

    Anna Zimoch-Korzycka

    2015-01-01

    Full Text Available This work characterizes biological, physical, and chemical properties of films formed from an aqueous solution of hydroxypropyl methylcellulose (HPMC, with different concentrations of chitosan (CH and bioactive cystatin/lysozyme preparation (C/L. The properties of biocomposites were examined by Dynamic Mechanical Analysis (DMA, Fourier’s transfer infrared spectroscopy (FTIR, water vapour permeability (WVP, and tensile testing. Antimicrobial activity against Micrococcus flavus, Bacillus cereus, Escherichia coli, Pseudomonas fluorescens, and Candida famata was conducted. Films glass transition and storage modulus were dependent on the C/L and CH concentration. Modulus values decreased during the temperature scan and with higher reagents levels. An increase of CH and C/L concentrations in the films resulted in a decrease in tensile strength from 2.62 to 1.08 MPa. It suggests the hydrolyzing influence of C/L, also observed in smaller peak size of α relaxation. C/L addition caused shifting Tg to higher temperature. DMA and FTIR analysis proved that HPMC and CH are compatible polymers. Water resistance was improved with rising CH concentration from 1.08E-09 to 7.71E−10 g/m∗s∗Pa. The highest inhibition zone in M. flavus and C. famata was recorded at the highest concentration of CH and C/L.

  14. Preparation of Crosslinked Amphiphilic Silver Nanogel as Thin Film Corrosion Protective Layer for Steel

    Directory of Open Access Journals (Sweden)

    Ayman M. Atta

    2014-07-01

    Full Text Available Monodisperse silver nanoparticles were synthesized by a new developed method via reaction of AgNO3 and oleic acid with the addition of a trace amount of Fe3+ ions. Emulsion polymerization at room temperature was employed to prepare a core-shell silver nanoparticle with controllable particle size. N,N'-methylenebisacrylamide (MBA and potassium peroxydisulfate (KPS were used as a crosslinker, and as redox initiator system, respectively for crosslinking polymerization. The structure and morphology of the silver nanogels were characterized by Fourier transform infrared spectroscopy (FTIR, transmission and scanning electron microscopy (TEM and SEM. The effectiveness of the synthesized compounds as corrosion inhibitors for steel in 1 M HCl was investigated by various electrochemical techniques such as potentiodynamic polarization and electrochemical impedance spectroscopy (EIS. Monolayers of silver nanoparticle were self-assembled on the fresh active surface of the steel electrode and have been tested as a corrosion inhibitor for steel in 1 M HCl solution. The results of polarization measurements showed that nanogel particles act as a mixed type inhibitor.

  15. Preparation of crosslinked amphiphilic silver nanogel as thin film corrosion protective layer for steel.

    Science.gov (United States)

    Atta, Ayman M; El-Mahdy, Gamal A; Al-Lohedan, Hamad A; Ezzat, Abdelrahman O

    2014-07-17

    Monodisperse silver nanoparticles were synthesized by a new developed method via reaction of AgNO3 and oleic acid with the addition of a trace amount of Fe3+ ions. Emulsion polymerization at room temperature was employed to prepare a core-shell silver nanoparticle with controllable particle size. N,N'-methylenebisacrylamide (MBA) and potassium peroxydisulfate (KPS) were used as a crosslinker, and as redox initiator system, respectively for crosslinking polymerization. The structure and morphology of the silver nanogels were characterized by Fourier transform infrared spectroscopy (FTIR), transmission and scanning electron microscopy (TEM and SEM). The effectiveness of the synthesized compounds as corrosion inhibitors for steel in 1 M HCl was investigated by various electrochemical techniques such as potentiodynamic polarization and electrochemical impedance spectroscopy (EIS). Monolayers of silver nanoparticle were self-assembled on the fresh active surface of the steel electrode and have been tested as a corrosion inhibitor for steel in 1 M HCl solution. The results of polarization measurements showed that nanogel particles act as a mixed type inhibitor.

  16. Liposomes containing glycocholate as potential oral insulin delivery systems: preparation, in vitro characterization, and improved protection against enzymatic degradation

    Science.gov (United States)

    Niu, Mengmeng; Lu, Yi; Hovgaard, Lars; Wu, Wei

    2011-01-01

    Background: Oral delivery of insulin is challenging and must overcome the barriers of gastric and enzymatic degradation as well as low permeation across the intestinal epithelium. The present study aimed to develop a liposomal delivery system containing glycocholate as an enzyme inhibitor and permeation enhancer for oral insulin delivery. Methods: Liposomes containing sodium glycocholate were prepared by a reversed-phase evaporation method followed by homogenization. The particle size and entrapment efficiency of recombinant human insulin (rhINS)-loaded sodium glycocholate liposomes can be easily adjusted by tuning the homogenization parameters, phospholipid:sodium glycocholate ratio, insulin:phospholipid ratio, water:ether volume ratio, interior water phase pH, and the hydration buffer pH. Results: The optimal formulation showed an insulin entrapment efficiency of 30% ± 2% and a particle size of 154 ± 18 nm. A conformational study by circular dichroism spectroscopy and a bioactivity study confirmed the preserved integrity of rhINS against preparative stress. Transmission electron micrographs revealed a nearly spherical and deformed structure with discernable lamella for sodium glycocholate liposomes. Sodium glycocholate liposomes showed better protection of insulin against enzymatic degradation by pepsin, trypsin, and α-chymotrypsin than liposomes containing the bile salt counterparts of sodium taurocholate and sodium deoxycholate. Conclusion: Sodium glycocholate liposomes showed promising in vitro characteristics and have the potential to be able to deliver insulin orally. PMID:21822379

  17. Preparation of total flavonoids from loquat flower and its protective effect on acute alcohol-induced liver injury in mice

    Directory of Open Access Journals (Sweden)

    Shao-Kang Wu

    2015-03-01

    Full Text Available This study aimed to research the preparation techniques of total flavones from loquat flower (TFLF, its anti-oxidation capacity, and its protective effect on hepatic injury. The best extraction parameters by orthogonal experimentation were water at 100°C, extraction time 2.5 hours, solid/liquid ratio 1:20, and three decoctions. The chromogenic reaction to the flavones showed that loquat flowers mainly contained flavone, flavonol, and flavanone compounds combining ortho-phenolic hydroxyl group structure in the 10–30% ethanol fraction. The anti-oxidant capacity of O2−· was 26.09% and of OH−·was 83.01% by salicylic acid and pyrogallol auto-oxidation. Compared with the model group, TFLF lowered the levels of alanine aminotransferase, aspartate aminotransferase, triglyceride, and malondialdehyde and liver index significantly, and upregulated the expression of adipose triglyceride lipase and Heine oxygenase-1 mRNA. The present findings suggest that TFLF has protective effect on acute alcoholinduced liver injury in mice and may be related to its antioxidant and free-radical scavenging activity.

  18. Protective effect of an herbal preparation (HemoHIM) on radiation-induced intestinal injury in mice.

    Science.gov (United States)

    Kim, Sung Ho; Lee, Hae June; Kim, Joong Sun; Moon, Changjong; Kim, Jong Choon; Park, Hae-Ran; Jung, Uhee; Jang, Jong Sik; Jo, Sung Kee

    2009-12-01

    The protective properties of an herbal preparation (HemoHIM) against intestinal damage were examined by evaluating its effects on jejunal crypt survival, morphological changes, and apoptosis in gamma-irradiated mice. The mice were whole-body irradiated with 12 Gy for the examination of jejunal crypt survival and any morphological changes and with 2 Gy for the detection of apoptosis and Ki-67 labeling. Irradiation was conducted using (60)Co gamma-rays. HemoHIM treatment was administered intraperitonially at a dosage of 50 mg/kg of body weight at 36 and 12 hours pre-irradiation and 30 minutes post-irradiation or orally at a dosage of 250 mg/kg of body weight/day for 7 or 11 days before necropsy. The HemoHIM-treated group displayed a significant increase in survival of jejunal crypts, when compared to the irradiation controls. HemoHIM treatment decreased intestinal morphological changes such as crypt depth, villus height, mucosal length, and basal lamina length of 10 enterocytes after irradiation. Furthermore, the administration of HemoHIM protected intestinal cells from irradiation-induced apoptosis. These results suggested that HemoHIM may be therapeutically useful to reduce intestinal injury following irradiation.

  19. Protective

    Directory of Open Access Journals (Sweden)

    Wessam M. Abdel-Wahab

    2013-10-01

    Full Text Available Many active ingredients extracted from herbal and medicinal plants are extensively studied for their beneficial effects. Antioxidant activity and free radical scavenging properties of thymoquinone (TQ have been reported. The present study evaluated the possible protective effects of TQ against the toxicity and oxidative stress of sodium fluoride (NaF in the liver of rats. Rats were divided into four groups, the first group served as the control group and was administered distilled water whereas the NaF group received NaF orally at a dose of 10 mg/kg for 4 weeks, TQ group was administered TQ orally at a dose of 10 mg/kg for 5 weeks, and the NaF-TQ group was first given TQ for 1 week and was secondly administered 10 mg/kg/day NaF in association with 10 mg/kg TQ for 4 weeks. Rats intoxicated with NaF showed a significant increase in lipid peroxidation whereas the level of reduced glutathione (GSH and the activity of superoxide dismutase (SOD, catalase (CAT, glutathione S-transferase (GST and glutathione peroxidase (GPx were reduced in hepatic tissues. The proper functioning of the liver was also disrupted as indicated by alterations in the measured liver function indices and biochemical parameters. TQ supplementation counteracted the NaF-induced hepatotoxicity probably due to its strong antioxidant activity. In conclusion, the results obtained clearly indicated the role of oxidative stress in the induction of NaF toxicity and suggested hepatoprotective effects of TQ against the toxicity of fluoride compounds.

  20. Logistics of massive transfusions.

    Science.gov (United States)

    DeLoughery, Thomas G

    2010-01-01

    Care of the patient with massive bleeding involves more than aggressive surgery and infusion of large amounts of blood products. The proper management of massive transfusions-whether they are in trauma patients or other bleeding patients-requires coordination of the personnel in the surgical suite or the emergency department, the blood bank, and laboratory.

  1. Simplifying Massive Contour Maps

    DEFF Research Database (Denmark)

    Arge, Lars; Deleuran, Lasse Kosetski; Mølhave, Thomas;

    2012-01-01

    We present a simple, efficient and practical algorithm for constructing and subsequently simplifying contour maps from massive high-resolution DEMs, under some practically realistic assumptions on the DEM and contours.......We present a simple, efficient and practical algorithm for constructing and subsequently simplifying contour maps from massive high-resolution DEMs, under some practically realistic assumptions on the DEM and contours....

  2. Determination of attenuation properties of massive ceramic bricks cladded with mortars containing barite used as protective barrier for radiodiagnostic rooms; Determinacao das propriedades de atenuacao de tijolos ceramicos macicos revestidos com argamassa baritada em sua utilizacao como barreira de protecao em salas de radiodiagnostico

    Energy Technology Data Exchange (ETDEWEB)

    Barros, Frieda S.; Schelin, Hugo R.; Tilly Junior, Joao G. [Centro Federal de Educacao Tecnologica do Parana (CEFET-PR), Curitiba, PR (Brazil); Costa, Paulo R.; Nersissian, Denise Y.; Pereira, Marco A.G. [Sao Paulo Univ., SP (Brazil). Inst. de Eletrotecnica e Energia

    2001-07-01

    The purpose of this work is to determine the properties of attenuation of the walls built with massive ceramic bricks to be used as protection barriers in environments of Medicine and Dentistry, when submitted to X-ray diagnosis. Massive ceramic bricks are used thoroughly in constructions as a calking element. The properties of attenuation of these materials were obtained starting from the application of the model of Archer to a group of attenuation curves with wide beams generated in the tensions of 70, 80, 100, 120, 140 and 150 kVp. A radiological equipment of constant potential was used in the Laboratory of IEE/USP, two cameras of ionization of 6cm{sup 3}, coupled to two radiation monitors. The results show that for a tension of 100kVp, the thickness of 10cm of wall made with massive ceramic bricks corresponds to 1mm of lead. (author)

  3. Liposomes containing glycocholate as potential oral insulin delivery systems: preparation, in vitro characterization, and improved protection against enzymatic degradation

    Directory of Open Access Journals (Sweden)

    Niu M

    2011-06-01

    Full Text Available Mengmeng Niu1, Yi Lu1, Lars Hovgaard2, Wei Wu11School of Pharmacy, Fudan University, Shanghai, People's Republic of China; 2Oral Formulation Development, Novo Nordisk A/S, Maalov, DenmarkBackground: Oral delivery of insulin is challenging and must overcome the barriers of gastric and enzymatic degradation as well as low permeation across the intestinal epithelium. The present study aimed to develop a liposomal delivery system containing glycocholate as an enzyme inhibitor and permeation enhancer for oral insulin delivery.Methods: Liposomes containing sodium glycocholate were prepared by a reversed-phase evaporation method followed by homogenization. The particle size and entrapment efficiency of recombinant human insulin (rhINS-loaded sodium glycocholate liposomes can be easily adjusted by tuning the homogenization parameters, phospholipid:sodium glycocholate ratio, insulin:phospholipid ratio, water:ether volume ratio, interior water phase pH, and the hydration buffer pH.Results: The optimal formulation showed an insulin entrapment efficiency of 30% ± 2% and a particle size of 154 ± 18 nm. A conformational study by circular dichroism spectroscopy and a bioactivity study confirmed the preserved integrity of rhINS against preparative stress. Transmission electron micrographs revealed a nearly spherical and deformed structure with discernable lamella for sodium glycocholate liposomes. Sodium glycocholate liposomes showed better protection of insulin against enzymatic degradation by pepsin, trypsin, and a-chymotrypsin than liposomes containing the bile salt counterparts of sodium taurocholate and sodium deoxycholate.Conclusion: Sodium glycocholate liposomes showed promising in vitro characteristics and have the potential to be able to deliver insulin orally.Keywords: liposomes, glycocholate, insulin, enzymatic degradation, oral

  4. Design and synthesis of Fmoc-Thr[PO(OH)(OPOM)] for the preparation of peptide prodrugs containing phosphothreonine in fully protected form.

    Science.gov (United States)

    Qian, Wen-Jian; Lai, Christopher C; Kelley, James A; Burke, Terrence R

    2014-05-01

    The design and efficient synthesis of N-Fmoc-phosphothreonine protected by a mono-(pivaloyloxy)methyl (POM) moiety at its phosphoryl group (Fmoc-Thr[PO(OH)(OPOM)]-OH, 1, is reported. This reagent is suitable for solid-phase syntheses employing acid-labile resins and Fmoc-based protocols. It allows the preparation of phosphothreonine (pThr)-containing peptides bearing bis-POM-phosphoryl protection. The methodology allows the first reported synthesis of pThr-containing polypeptides having bioreversible prodrug protection, and as such it should be useful in a variety of biological applications. Copyright © 2014 Verlag Helvetica Chimica Acta AG, Zürich.

  5. Protective effect of the extract of Yi-Qi-Fu-Mai preparation on hypoxia-induced heart injury in mice

    Institute of Scientific and Technical Information of China (English)

    FENG Ya-Qian; JU Ai-Chun; LIU Chun-Hua; WANG Ting; YU Bo-Yang; QI Jin

    2016-01-01

    Yi-Qi-Fu-Mai (YQFM) is extensively used clinically to treat cardiovascular diseases in China.To explore the anti-hypoxia effect of the extract of YQFM preparation (EYQFM),the EYQFM (1.4,2.8,and 5.5 g·kg-1·d-1) was assessed for its heart-protective effect in a chronic intermittent hypoxia (CIH) animal model (oxygen pressure 7%-8%,20 min per day) for 28 days of treatment.Betaloc (0.151 6 g·kg-1·d-1) was used as a positive control.The histopathological analyses of heart in CIH mice were conducted.Several cardiac state parameters,such as left ventricular ejection fractions (EF),stroke volume (SV),expression of creatine kinase (CK),lactate dehydrogenase (LDH),superoxide dismutase (SOD),and malondialdehyde (MDA) were measured.The results showed that treatment with EYQFM markedly reversed swelling of the endothelial cells and vacuolization in the heart when compared with the model group.Further study demonstrated that EYQFM significantly improved ventricular myocardial contractility by increasing EF and SV.In addition,EYQFM inhibited the activity of CK,LDH,decreased the level of MDA and improved SOD activity.The results demonstrated that EYQFM significantly improved the tolerability of myocardium to hypoxia and ameliorated the cardiac damage in the CIH model.

  6. Supersymmetrizing Massive Gravity

    CERN Document Server

    Malaeb, Ola

    2013-01-01

    When four scalar fields with global Lorentz symmetry are coupled to gravity and take a vacuum expectation value breaking diffeomorphism invariance spontaneously, the graviton becomes massive. This model is supersymmetrized by considering four N=1 chiral superfields with global Lorentz symmetry. When the scalar components of the chiral multiplets z^A acquire a vacuum expectation value, both diffeomorphism invariance and local supersymmetry are broken spontaneously. The global Lorentz index A becomes identified with the space-time Lorentz index making the scalar fields z^A vectors and the chiral spinors \\psi^A spin-3/2 Rarita-Schwinger fields. The global supersymmetry is promoted to a local one using the rules of tensor calculus of coupling the N=1 supergravity Lagrangian to the four chiral multiplets. We show that the spectrum of the model in the broken phase consists of a massive spin-2 field, two massive spin-3/2 fields with different mass and a massive vector.

  7. Peculiarities of massive vectormesons

    CERN Document Server

    Schroer, Bert

    2015-01-01

    Massive QED, different from its massless counterpart, posesses two conserved charges; one is a screened (vanishing) Maxwell charge which is directly associated with the massive vectormesons through the identically conserved Maxwell current while the particle-antiparticle counting charge has its origin on the matter side. A somewhat peculiar situation arises in case of A-H couplings to Hermitian matter fields; in that case the only current is the screened Maxwell current and the coupling disappears in the massless limit. In case of selfinteracting massive vectormesons the situation becomes even more peculiar in that the usually renormalizability guaranteeing validity of the first order power-counting criterion breaks down in second order and requires the compensatory presence of an additional A-H coupling. In this case the massive counterpart of (spinor or scalar) QCD needs the presence of the A-H coupling which only disappears in the massless limit. Some aspect of these observation have already been noticed i...

  8. Quantum massive conformal gravity

    Energy Technology Data Exchange (ETDEWEB)

    Faria, F.F. [Universidade Estadual do Piaui, Centro de Ciencias da Natureza, Teresina, PI (Brazil)

    2016-04-15

    We first find the linear approximation of the second plus fourth order derivative massive conformal gravity action. Then we reduce the linearized action to separated second order derivative terms, which allows us to quantize the theory by using the standard first order canonical quantization method. It is shown that quantum massive conformal gravity is renormalizable but has ghost states. A possible decoupling of these ghost states at high energies is discussed. (orig.)

  9. Preparation of porous TiO{sub 2}/ZnO composite film and its photocathodic protection properties for 304 stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Hongmei; Liu, Wei, E-mail: weiliu@ouc.edu.cn; Cao, Lixin; Su, Ge; Duan, Ruijing

    2014-05-01

    Highlights: • Porous TiO{sub 2}/ZnO composite films were prepared on the 304 stainless steel. • The preparation parameters of the composite films were optimized. • Porous TiO{sub 2}/ZnO composite films provide an effective photogenerated cathodic protection for 304 stainless steel. - Abstract: TiO{sub 2}/ZnO composite films with porous structure were prepared on the 304 stainless steel (304SS) by the sol-gel method and heating treatment. The crystalline phase and morphology of as-prepared TiO{sub 2}/ZnO composite films were characterized systematically by X-ray diffraction (XRD), scanning electron microscope (SEM) and ultraviolet–visible (UV–vis) spectroscopy, respectively. The influences of Ti/Zn molar ratio and the annealing temperature on the photoelectric property of the samples have been investigated and their photocathodic protection performances for 304 stainless steel under dark and UV conditions have also been evaluated in 3.0% NaCl solution by the electrochemical measurements. The results indicate that porous TiO{sub 2}/ZnO composite film has a great enhancement of the light absorption and photoelectric property under UV illumination. This can be ascribed to the mutual effect of TiO{sub 2}/ZnO heterojunctions and the porous structures in the composite films, which provide a better photogenerated cathodic protection for 304SS.

  10. [Anesthetic management of massive endobronchial hemorrhage after pulmonary embolectomy].

    Science.gov (United States)

    Nakayama, Shin; Miyabe, Masayuki; Tabata, Kouya; Toyooka, Hidenori

    2003-08-01

    We report a case of massive endobronchial hemorrhage after pulmonary embolectomy. A 63-year-old woman underwent emergency pulmonary embolectomy with cardiopulmonary bypass (CPB). During partial CPB, we found massive blood gushing out from the endotracheal tube. Approximately 2,000 ml of blood was aspirated in 10 minutes. To ensure adequate oxygenation, emergent percutaneous cardiopulmonary support system (PCPS) was started. After neutralization of heparin and the institution of 10 cmH2O of positive end-expiratory pressure, the bleeding diminished. Institution of PCPS allows performance of unhurried bronchoscopy to identify the actual bleeding point and to lavage the airway. In addition to this management, we administrated steroids and neutrophil elastase inhibitor to stabilize pulmonary capillary membrane. Without complications, the patient was extubated 2 days after operation and the following course was uneventful. Immediate institution of PEEP and pharmacological interventions to reduce pulmonary blood pressure were beneficial in arresting hemorrhage. The bleeding begins usually at the time of discontinuation of CPB. We should recognize the possible occurrence of endobronchial bleeding after pulmonary embolectomy and prepare to protect the airway and to maintain oxygenation and cardiac function.

  11. Cosmic decoherence: massive fields

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Junyu [Department of Physics, California Institute of Technology,Pasadena, California 91125 (United States); School of the Gifted Young, University of Science and Technology of China,Hefei, Anhui 230026 (China); Sou, Chon-Man; Wang, Yi [Department of Physics, The Hong Kong University of Science and Technology,Clear Water Bay, Kowloon, Hong Kong (China)

    2016-10-14

    We study the decoherence of massive fields during inflation based on the Zurek’s density matrix approach. With the cubic interaction between inflaton and massive fields, the reduced density matrix for the massive fields can be calculated in the Schrödinger picture which is related to the variance of the non-Gaussian exponent in the wave functional. The decoherence rate is computed in the one-loop form from functional integration. For heavy fields with m≳O(H), quantum fluctuations will easily stay in the quantum state and decoherence is unlikely. While for light fields with mass smaller than O(H), quantum fluctuations are easily decohered within 5∼10 e-folds after Hubble crossing. Thus heavy fields can play a key role in studying problems involving inflationary quantum information.

  12. Cosmic Decoherence: Massive Fields

    CERN Document Server

    Liu, Junyu; Wang, Yi

    2016-01-01

    We study the decoherence of massive fields during inflation based on the Zurek's density matrix approach. With the cubic interaction between inflaton and massive fields, the reduced density matrix for the massive fields can be calculated in the Schr\\"odinger picture which is related to the variance of the non-Gaussian exponent in the wave functional. The decoherence rate is computed in the one-loop form from functional integration. For heavy fields with $m\\gtrsim \\mathcal{O}(H)$, quantum fluctuations will easily stay in the quantum state and decoherence is unlikely. While for light fields with mass smaller than $\\mathcal{O}(H)$, quantum fluctuations are easily decohered within $5\\sim10$ e-folds after Hubble crossing. Thus heavy fields can play a key role in studying problems involving inflationary quantum information.

  13. Problems of Massive Gravities

    CERN Document Server

    Deser, S; Ong, Y C; Waldron, A

    2014-01-01

    The method of characteristics is a key tool for studying consistency of equations of motion; it allows issues such as predictability, maximal propagation speed, superluminality, unitarity and acausality to be addressed without requiring explicit solutions. We review this method and its application to massive gravity theories to show the limitations of these models' physical viability: Among their problems are loss of unique evolution, superluminal signals, matter coupling inconsistencies and micro-acausality (propagation of signals around local closed timelike/causal curves). We extend previous no-go results to the entire three-parameter range of massive gravity theories. It is also argued that bimetric models suffer a similar fate.

  14. Compendium of Case Studies Prepared for the Global Forum on Nutrition-Sensitive Social Protection Programs, 2015

    OpenAIRE

    Spray, Andrea L.

    2016-01-01

    The SecureNutrition Series on Nutrition-Sensitive Social Protection is intended to augment the available guidance on improving nutrition through multisectoral approaches, and inform ongoing and future efforts to improve nutrition outcomes through investments in the social protection sector. Since publication of the World Bank’s “Improving Nutrition Through Multisectoral Approaches” in 2013, numerous development partners have explored the mutual synchronicities between social protection an...

  15. Protective effects of a preparation(hemoHIM) of herb mixture on self-renewal tissues and immune system in whole body irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Park, Hae-Ran; Oh, Heon; Jo, Sung-Kee [Korea Atomic Energy Research Institute, Daejon (Korea, Republic of); Kim, Sung-Ho [Chonnam National Univ., Kwangju (Korea, Republic of); Yee, Sung-Tae [Sunchon National Univ., Sunchon (Korea, Republic of)

    2002-07-01

    A preparation (HemoHIM) of herb mixture was designed to protect the gastrointestine and hematopoietic organs and to promote recovery of the immune system against radiation damage. The mixture of 3 edible medicinal herbs (Angelica gagantis Radix, etc.) was decocted with hot water and the extract was fractionated with ethanol. The preparation HemoHIM was made up with addition of ethanol- insoluble fraction yielded from one half of the total water extract to the other half of the total water extract. In vitro, lymphocytes were protected by HemoHIM, its polysaccharide and ethanol fractions against radiation. The proliferation of lymphocytes and bone marrow cells by HemoHIM was due to its polysaccharide fraction. In mice administered with the preparation (HemoHIM) before gamma- irradiation, the jejunal crypt survival was increased and the apoptosis of crypt cells was decreased. HemoHIM administration increased the survival of bone marrow stem cells and promoted the repopulation of blood cells following irradiation. In the analysis of the repopulated lymphocyte subsets, B cells were firstly regenerated and then T cells were recovered in mice administrated with HemoHIM. The antibody production against T-dependent antigen DNP-KLH was augmented by HemoHIM in irradiated mice. These results indicated that HemoHIM, a preparation of the herb mixture, protected the stem cells of self-renewal tissues and hematopoietic organs and promoted recovery of the immune system against radiation damage. Since the preparation of herb mixture is a relatively nontoxic natural product, it might be a useful modifier for prevention and control of radiation damages.

  16. Evaluation of In Vitro Anti-Inflammatory Activities and Protective Effect of Fermented Preparations of Rhizoma Atractylodis Macrocephalae on Intestinal Barrier Function against Lipopolysaccharide Insult

    Directory of Open Access Journals (Sweden)

    Shambhunath Bose

    2013-01-01

    Full Text Available Lipopolysaccharide (LPS, a potent inducer of systemic inflammatory responses, is known to cause impairment of intestinal barrier function. Here, we evaluated the in vitro protective effect of an unfermented formulation of Rhizoma Atractylodis Macrocephalae (RAM, a traditional Chinese herbal medicine widely used in the treatment of many digestive and gastrointestinal disorders, and two fermented preparations of RAM, designated as FRAM-1 (prepared in Luria-Bertani broth and FRAM-2 (prepared in glucose, on intestinal epithelial cells (IECs against LPS insult. In general, fermented formulations, especially FRAM-2, but not unfermented RAM, exerted an appreciable protective effect on IECs against LPS-induced perturbation of membrane resistance and permeability. Both fermented formulations exhibited appreciable anti-inflammatory activities in terms of their ability to inhibit LPS-induced gene expression and induced production of a number of key inflammatory mediators and cytokines in RAW 264.7 macrophage cells. However, in most cases, FRAM-2 exhibited stronger anti-inflammatory effects than FRAM-1. Our findings also suggest that suppression of nuclear factor-κβ (NF-κβ activity might be one of the possible mechanisms by which the fermented RAM exerts its anti-inflammatory effects. Collectively, our results highlight the benefits of using fermented products of RAM to protect against LPS-induced inflammatory insult and impairment in intestinal barrier function.

  17. Cell-wall preparation containing poly-γ-D-glutamate covalently linked to peptidoglycan, a straightforward extractable molecule, protects mice against experimental anthrax infection.

    Science.gov (United States)

    Candela, Thomas; Dumetz, Fabien; Tosi-Couture, Evelyne; Mock, Michèle; Goossens, Pierre L; Fouet, Agnès

    2012-12-17

    Bacillus anthracis is the causative agent of anthrax that is characterized by septicemia and toxemia. Many vaccine strategies were described to counteract anthrax infection. In contrast with veterinary live vaccines, currently human vaccines are acellular with the protective antigen, a toxin component, as the main constituent. However, in animal models this vaccine is less efficient than the live vaccine. In this study, we analyzed the protection afforded by a single extractable surface element. The poly-γ-D-glutamate capsule is covalently linked to the peptidoglycan. A preparation of peptidoglycan-linked poly-γ-D-glutamate (GluPG) was tested for its immunogenicity and its protective effect. GluPG injection, in mice, elicited the production of specific antibodies directed against poly-glutamate and partially protected the animals against lethal challenges with a non-toxinogenic strain. When combined to protective antigen, GluPG immunization conferred full protection against cutaneous anthrax induced with a fully virulent strain. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Preparation and catalytic activity of poly(N-vinyl-2-pyrrolidone)-protected Au nanoparticles for the aerobic oxidation of glucose.

    Science.gov (United States)

    Zhang, Haijun; Li, Wenqi; Gu, Yajun; Zhang, Shaowei

    2014-08-01

    PVP-protected Au nanoparticles (NPs) for the aerobic oxidation of glucose were prepared by using NaBH4 reduction method. The effects of processing parameters such as Au3+ ion concentration, reaction temperature, ratio of NaBH4 or PVP to Au3+, and solvent composition on their particle sizes and catalytic activities were studied in detail and the synthesis conditions optimized. As-prepared Au NPs possessed a FCC structure, with an average size varying from about 100 to 2.6 nm depending on their preparation conditions. The size changes affected their catalytic activities in the aerobic oxidation of glucose. The Au NPs with the average size of 2.6 nm prepared under the optimal conditions showed a high instantaneous catalytic activity as well as a high long-time stability. Based on the kinetic study on the glucose oxidation over the PVP-protected Au NPs, the corresponding apparent activation energy was determined as 82 kJ mol(-1).

  19. Commission’s Approach to Minority Protection during the Preparation of the EU’s Eastern Enlargement: Is 2 Better than the Promised 1?

    Directory of Open Access Journals (Sweden)

    Dimitry Kochenov

    2007-11-01

    Full Text Available Although minority protection was one of the Copenhagen political criteria and thus was at the core of the conditionality principle presupposing a fair assessment of the candidate countries’ progress towards accession on the merits, the Commission simultaneously promoted two contradicting approaches to the issue throughout the whole duration of the pre–accession process. They included, on the one hand, de facto assimilation (prohibited by art. 5(2 of the Framework Convention for the Protection of National Minorities and, on the other hand, cultural autonomy, bringing to life a complicated web of partly overlapping – partly contradicting standards. This paper is dedicated to outlining the main differences between the two key approaches to minority protection espoused by the Commission in the course of the latest enlargements’ preparation.

  20. Massive and Open

    Science.gov (United States)

    Fasimpaur, Karen

    2013-01-01

    MOOCs--massive open online courses--are all the rage these days, with hundreds of thousands of participants signing up and investors plunking down millions to get a piece of the pie. Why is there so much excitement about this new disruptive form of online learning, and how does this model apply to professional learning for teachers? Traditional…

  1. Multiplicity of massive stars

    CERN Document Server

    Preibisch, T; Zinnecker, H; Preibisch, Thomas; Weigelt, Gerd; Zinnecker, Hans

    2000-01-01

    We discuss the observed multiplicity of massive stars and implications on theories of massive star formation. After a short summary of the literature on massive star multiplicity, we focus on the O- and B-type stars in the Orion Nebula Cluster, which constitute a homogenous sample of very young massive stars. 13 of these stars have recently been the targets of a bispectrum speckle interferometry survey for companions. Considering the visual and also the known spectroscopic companions of these stars, the total number of companions is at least 14. Extrapolation with correction for the unresolved systems suggests that there are at least 1.5 and perhaps as much as 4 companions per primary star on average. This number is clearly higher than the mean number of about 0.5 companions per primary star found for the low-mass stars in the general field population and also in the Orion Nebula cluster. This suggests that a different mechanism is at work in the formation of high-mass multiple systems in the dense Orion Nebu...

  2. Massive antenatal fetomaternal hemorrhage

    DEFF Research Database (Denmark)

    Dziegiel, Morten Hanefeld; Koldkjaer, Ole; Berkowicz, Adela

    2005-01-01

    Massive fetomaternal hemorrhage (FMH) can lead to life-threatening anemia. Quantification based on flow cytometry with anti-hemoglobin F (HbF) is applicable in all cases but underestimation of large fetal bleeds has been reported. A large FMH from an ABO-compatible fetus allows an estimation...

  3. Silyl-based alkyne-modifying linker for the preparation of C-terminal acetylene-derivatized protected peptides.

    Science.gov (United States)

    Strack, Martin; Langklotz, Sina; Bandow, Julia E; Metzler-Nolte, Nils; Albada, H Bauke

    2012-11-16

    A novel linker for the synthesis of C-terminal acetylene-functionalized protected peptides is described. This SAM1 linker is applied in the manual Fmoc-based solid-phase peptide synthesis of Leu-enkephalin and in microwave-assisted automated synthesis of Maculatin 2.1, an antibacterial peptide that contains 18 amino acid residues. For the cleavage, treatment with tetramethylammonium fluoride results in protected acetylene-derivatized peptides. Alternatively, a one-pot cleavage-click procedure affords the protected 1,2,3-triazole conjugate in high yields after purification.

  4. Sections prepared for inclusion in an IAEA technical document handbook on Designing and Implementing a Physical Protection System

    Energy Technology Data Exchange (ETDEWEB)

    Snell, Mark K. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-11-01

    Two major sections were drafted (each with several subsections) for the IAEA dealing with designing and implementing a Physical Protection System (PPS). Areas addressed were Search Systems and the evaluation of PPS effectiveness.

  5. Minimal massive 3D gravity

    NARCIS (Netherlands)

    Bergshoeff, Eric; Hohm, Olaf; Merbis, Wout; Routh, Alasdair J.; Townsend, Paul K.

    2014-01-01

    We present an alternative to topologically massive gravity (TMG) with the same 'minimal' bulk properties; i.e. a single local degree of freedom that is realized as a massive graviton in linearization about an anti-de Sitter (AdS) vacuum. However, in contrast to TMG, the new 'minimal massive gravity'

  6. New improved massive gravity

    Science.gov (United States)

    Dereli, T.; Yetişmişoğlu, C.

    2016-06-01

    We derive the field equations for topologically massive gravity coupled with the most general quadratic curvature terms using the language of exterior differential forms and a first-order constrained variational principle. We find variational field equations both in the presence and absence of torsion. We then show that spaces of constant negative curvature (i.e. the anti de-Sitter space AdS 3) and constant torsion provide exact solutions.

  7. SO(3) massive gravity

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Chunshan

    2013-11-25

    In this Letter, we propose a massive gravity theory with 5 degrees of freedom. The mass term is constructed by 3 Stückelberg scalar fields, which respects SO(3) symmetry in the fields' configuration. By the analysis on the linear cosmological perturbations, we found that such 5 d.o.f. are free from ghost instability, gradient instability, and tachyonic instability.

  8. Dual massive gravity

    Energy Technology Data Exchange (ETDEWEB)

    Morand, Kevin, E-mail: Kevin.Morand@lmpt.univ-tours.fr [Laboratoire de Mathematiques et Physique Theorique, Universite Francois-Rabelais Tours, Federation Denis Poisson - CNRS, Parc de Grandmont, 37200 Tours (France); Solodukhin, Sergey N., E-mail: Sergey.Solodukhin@lmpt.univ-tours.fr [Laboratoire de Mathematiques et Physique Theorique, Universite Francois-Rabelais Tours, Federation Denis Poisson - CNRS, Parc de Grandmont, 37200 Tours (France)

    2012-08-29

    The linearized massive gravity in three dimensions, over any maximally symmetric background, is known to be presented in a self-dual form as a first order equation which encodes not only the massive Klein-Gordon type field equation but also the supplementary transverse-traceless conditions. We generalize this construction to higher dimensions. The appropriate dual description in d dimensions, additionally to a (non-symmetric) tensor field h{sub {mu}{nu}}, involves an extra rank-(d-1) field equivalently represented by the torsion rank-3 tensor. The symmetry condition for h{sub {mu}{nu}} arises on-shell as a consequence of the field equations. The action principle of the dual theory is formulated. The focus has been made on four dimensions. Solving one of the fields in terms of the other and putting back in the action one obtains two other equivalent formulations of the theory in which the action is quadratic in derivatives. In one of these representations the theory is formulated entirely in terms of a rank-2 non-symmetric tensor h{sub {mu}{nu}}. This quadratic theory is not identical to the Fierz-Pauli theory and contains the coupling between the symmetric and antisymmetric parts of h{sub {mu}{nu}}. Nevertheless, the only singularity in the propagator is the same as in the Fierz-Pauli theory so that only the massive spin-2 particle is propagating. In the other representation, the theory is formulated in terms of the torsion rank-3 tensor only. We analyze the conditions which follow from the field equations and show that they restrict to 5 degrees of freedom thus producing an alternative description to the massive spin-2 particle. A generalization to higher dimensions is suggested.

  9. Phases of massive gravity

    Science.gov (United States)

    Dubovsky, Sergei L.

    2004-10-01

    We systematically study the most general Lorentz-violating graviton mass invariant under three-dimensional Eucledian group. We find that at general values of mass parameters the massive graviton has six propagating degrees of freedom, and some of them are ghosts or lead to rapid classical instabilities. However, there is a number of different regions in the mass parameter space where massive gravity is described by a consistent low-energy effective theory with cutoff ~ (mMPl)1/2. This theory is free of rapid instabilities and vDVZ discontinuity. Each of these regions is characterized by certain fine-tuning relations between mass parameters, generalizing the Fierz Pauli condition. In some cases the required fine-tunings are consequences of the existence of the subgroups of the diffeomorphism group that are left unbroken by the graviton mass. We found two new cases, when the resulting theories have a property of UV insensitivity, i.e. remain well behaved after inclusion of arbitrary higher dimension operators without assuming any fine-tunings among the coefficients of these operators, besides those enforced by the symmetries. These theories can be thought of as generalizations of the ghost condensate model with a smaller residual symmetry group. We briefly discuss what kind of cosmology can one expect in massive gravity and argue that the allowed values of the graviton mass may be quite large, affecting growth of primordial perturbations, structure formation and, perhaps, enhancing the backreaction of inhomogeneities on the expansion rate of the Universe.

  10. Preparation of flower-like CuS by solvothermal method for photocatalytic, UV protection and EMI shielding applications

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Xiao-Sai; Shen, Yong, E-mail: shenyong@sues.edu.cn; Xu, Li-Hui; Wang, Li-Ming; Lu, Li-sha; Zhang, Ya-ting

    2016-11-01

    Highlights: • The flower-like CuS was synthesized by a facil solvothermal method. • The as-prepared flower-like CuS showed better solar light-driven photocatalytic activity. • The as-prepared CuS could act as a novel UV blocker. • The flower-like CuS potentially hold promise as electromagnetic shielding material. - Abstract: The flower-like CuS hierarchical structures were synthesized by solvothermal method. The as-prepared products were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), Fourier transform infrared(FTIR) spectroscopy, UV–vis optical absorption spectroscopy and thermogravimetric analysis (TGA). The results demonstrated that the as-prepared flower-like CuS with the diameter of 1–5 um was pure hexagonal phase CuS and had well-defined flower-like structures. (1) The as-prepared CuS was proved to possess high photocatalytic performance with band gap of 1.45 eV. The degradation rate of Methylene blue (MB) was up to, 98.26%, 100% after 30 min under UV and visible irradiation. (2)The UPF of cotton fabric treated with CuS reached up to 174 compared with the original untreated fabric with the UPF 20.62. (3) The electromagnetic interference shielding effectiveness (EMI SE) of CuS coating was up to 27–31 dB when the content of CuS increased to 28.6%wt in the frequency of 300 KHz–3 GHz. Furthermore, the influence of reaction conditions on the morphology of the as-prepared CuS was investigated systematically and the possible formation mechanism of the CuS hierarchical structure was also proposed.

  11. Variations in status of preparation of personal protective equipment for preventing norovirus gastroenteritis in long-term care facilities for the elderly.

    Science.gov (United States)

    Fujiki, Saori; Ishizaki, Tatsuro; Nakayama, Takeo

    2017-05-16

    Residents of long-term care facilities are highly susceptible to norovirus gastroenteritis, and each facility is concerned about the need to implement norovirus infection control. Among control measures, personal protective equipment (PPE), such as disposable gloves and masks, plays a major role in reducing infectious spread. However, the preparation status of PPE in facilities before infection outbreaks has not been reported. The aim was to clarify the implementation status of preventive measures for norovirus gastroenteritis and the cost of preparing the necessary PPE in long-term care facilities. A questionnaire survey of facilities affiliated with the Kyoto Prefecture and Osaka Prefecture branches of the Japan Association of Geriatric Health Services Facilities was conducted. The survey items were the characteristics of the facility, whether preventive measures had been implemented for norovirus gastroenteritis from October through the following March in both 2009 and 2010, and the quantities and unit prices of PPE prepared for preventive measures. Twenty-six (11.2%) of 232 surveyed facilities (as of August 2011) answered the survey. Among them, 24 (92.3%) in 2009 and 25 (96.2%) in 2010 reported having implemented preventive measures for norovirus gastroenteritis, while 21 facilities (80.8%) in 2009 and 22 facilities (84.6%) in 2010 had prepared PPE. The median total cost for preparing the PPE needed for the preventive measures was US $2601 (range US $221-9192) in 2009 and US $3904 (range US $305-6427) in 2010. Although the results need careful interpretation because of the low response rate, most of the surveyed long-term care facilities had implemented preventive measures for norovirus gastroenteritis. However, the cost of preparing the PPE needed for the preventive measures varied among the facilities. © 2017 John Wiley & Sons, Ltd.

  12. Preparation of flower-like CuS by solvothermal method for photocatalytic, UV protection and EMI shielding applications

    Science.gov (United States)

    Hu, Xiao-Sai; Shen, Yong; Xu, Li-Hui; Wang, Li-Ming; Lu, Li-sha; Zhang, Ya-ting

    2016-11-01

    The flower-like CuS hierarchical structures were synthesized by solvothermal method. The as-prepared products were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), Fourier transform infrared(FTIR) spectroscopy, UV-vis optical absorption spectroscopy and thermogravimetric analysis (TGA). The results demonstrated that the as-prepared flower-like CuS with the diameter of 1-5 um was pure hexagonal phase CuS and had well-defined flower-like structures. (1) The as-prepared CuS was proved to possess high photocatalytic performance with band gap of 1.45 eV. The degradation rate of Methylene blue (MB) was up to, 98.26%, 100% after 30 min under UV and visible irradiation. (2)The UPF of cotton fabric treated with CuS reached up to 174 compared with the original untreated fabric with the UPF 20.62. (3) The electromagnetic interference shielding effectiveness (EMI SE) of CuS coating was up to 27-31 dB when the content of CuS increased to 28.6%wt in the frequency of 300 KHz-3 GHz. Furthermore, the influence of reaction conditions on the morphology of the as-prepared CuS was investigated systematically and the possible formation mechanism of the CuS hierarchical structure was also proposed.

  13. Massively Parallel Genetics.

    Science.gov (United States)

    Shendure, Jay; Fields, Stanley

    2016-06-01

    Human genetics has historically depended on the identification of individuals whose natural genetic variation underlies an observable trait or disease risk. Here we argue that new technologies now augment this historical approach by allowing the use of massively parallel assays in model systems to measure the functional effects of genetic variation in many human genes. These studies will help establish the disease risk of both observed and potential genetic variants and to overcome the problem of "variants of uncertain significance." Copyright © 2016 by the Genetics Society of America.

  14. Use of a purified outer membrane protein F (porin) preparation of Pseudomonas aeruginosa as a protective vaccine in mice.

    OpenAIRE

    Gilleland, H. E.; Parker, M G; Matthews, J.M.; Berg, R D

    1984-01-01

    The outer membrane protein F (porin) from the PAO1 strain of Pseudomonas aeruginosa was purified by two different methods. One procedure involved separation by column chromatography of proteins extracted from isolated outer membranes, whereas the other involved extraction from gels after slab polyacrylamide gel electrophoresis of proteins extracted from cell envelopes. Both procedures yielded protein F preparations which successfully immunized mice from subsequent challenge with the PAO1 stra...

  15. The role of surface preparation in corrosion protection of copper with nanometer-thick ALD alumina coatings

    Energy Technology Data Exchange (ETDEWEB)

    Mirhashemihaghighi, Shadi; Światowska, Jolanta [PSL Research University, CNRS – Chimie ParisTech, Institut de Recherche de Chimie Paris (IRCP), 11 rue Pierre et Marie Curie, 75005 Paris (France); Maurice, Vincent, E-mail: vincent.maurice@chimie-paristech.fr [PSL Research University, CNRS – Chimie ParisTech, Institut de Recherche de Chimie Paris (IRCP), 11 rue Pierre et Marie Curie, 75005 Paris (France); Seyeux, Antoine; Klein, Lorena H. [PSL Research University, CNRS – Chimie ParisTech, Institut de Recherche de Chimie Paris (IRCP), 11 rue Pierre et Marie Curie, 75005 Paris (France); Salmi, Emma; Ritala, Mikko [Laboratory of Inorganic Chemistry, Department of Chemistry, University of Helsinki, P.O. Box 55, FIN-00014 Helsinki (Finland); Marcus, Philippe [PSL Research University, CNRS – Chimie ParisTech, Institut de Recherche de Chimie Paris (IRCP), 11 rue Pierre et Marie Curie, 75005 Paris (France)

    2016-11-30

    Highlights: • 10–50 nm thick alumina coatings were grown on copper by atomic layer deposition. • Surface smoothening by substrate annealing was studied as pre-deposition treatment. • Corrosion protection is promoted by pre-treatment for 10 nm but not for thicker films. • Local adhesion failure is assigned to the stresses accumulated in the thicker films. • Surface smoothening decreases the interfacial strength bearing the film stresses. - Abstract: Surface smoothening by substrate annealing was studied as a pre-treatment for improving the corrosion protection provided to copper by 10, 20 and 50 nm thick alumina coatings deposited by atomic layer deposition. The interplay between substrate surface state and deposited film thickness for controlling the corrosion protection provided by ultrathin barrier films is demonstrated. Pre-annealing at 750 °C heals out the dispersed surface heterogeneities left by electropolishing and reduces the surface roughness to less than 2 nm independently of the deposited film thickness. For 10 nm coatings, substrate surface smoothening promotes the corrosion resistance. However, for 20 and 50 nm coatings, it is detrimental to the corrosion protection due to local detachment of the deposited films. The weaker adherence of the thicker coatings is assigned to the stresses accumulated in the films with increasing deposited thickness. Healing out the local heterogeneities on the substrate surface diminishes the interfacial strength that is bearing the stresses of the deposited films, thereby increasing adhesion failure for the thicker films. Pitting corrosion occurs at the local sites of adhesion failure. Intergranular corrosion occurs at the initially well coated substrate grain boundaries because of the growth of a more defective and permeable coating at grain boundaries.

  16. The role of surface preparation in corrosion protection of copper with nanometer-thick ALD alumina coatings

    Science.gov (United States)

    Mirhashemihaghighi, Shadi; Światowska, Jolanta; Maurice, Vincent; Seyeux, Antoine; Klein, Lorena H.; Salmi, Emma; Ritala, Mikko; Marcus, Philippe

    2016-11-01

    Surface smoothening by substrate annealing was studied as a pre-treatment for improving the corrosion protection provided to copper by 10, 20 and 50 nm thick alumina coatings deposited by atomic layer deposition. The interplay between substrate surface state and deposited film thickness for controlling the corrosion protection provided by ultrathin barrier films is demonstrated. Pre-annealing at 750 °C heals out the dispersed surface heterogeneities left by electropolishing and reduces the surface roughness to less than 2 nm independently of the deposited film thickness. For 10 nm coatings, substrate surface smoothening promotes the corrosion resistance. However, for 20 and 50 nm coatings, it is detrimental to the corrosion protection due to local detachment of the deposited films. The weaker adherence of the thicker coatings is assigned to the stresses accumulated in the films with increasing deposited thickness. Healing out the local heterogeneities on the substrate surface diminishes the interfacial strength that is bearing the stresses of the deposited films, thereby increasing adhesion failure for the thicker films. Pitting corrosion occurs at the local sites of adhesion failure. Intergranular corrosion occurs at the initially well coated substrate grain boundaries because of the growth of a more defective and permeable coating at grain boundaries.

  17. Massive star forming environments

    Science.gov (United States)

    Devine, Kathryn Elizabeth

    2010-12-01

    We present a study of the earliest stages of massive star formation, in which we focus on Infrared Dark Clouds (IRDCs) and young massive clusters. We present Very Large Array spectral line observations of ammonia (NH 3) and CCS toward four IRDCs. The NH3 lines provide diagnostics of the temperature and density structure within IRDCs. Based upon the NH 3 column density, IRDCs have masses of ˜ 103 to 10 4 M⊙ . We detect twenty NH3 clumps within four IRDCs, with radii regions are presented from the Near Infrared Imager (NIRIM) camera on the 3.5 m WIYN telescope. We report J, H, and K' band photometry in the clusters AFGL437, AFGL5180, and AFGL5142 and use these results to probe the stellar populations, extinction, and ages of the clusters. We find that all three clusters suffer significant extinction (AK ˜1), have ages ≤ 5 Myr, and are actively forming stars. We conclude that the properties of these embedded clusters are consistent with their evolving from IRDC clumps.

  18. Phases of massive gravity

    CERN Document Server

    Dubovsky, S L

    2004-01-01

    We systematically study the most general Lorentz-violating graviton mass invariant under three-dimensional Eucledian group using the explicitly covariant language. We find that at general values of mass parameters the massive graviton has six propagating degrees of freedom, and some of them are ghosts or lead to rapid classical instabilities. However, there is a number of different regions in the mass parameter space where massive gravity can be described by a consistent low-energy effective theory with cutoff $\\sim\\sqrt{mM_{Pl}}$ free of rapid instabilities and vDVZ discontinuity. Each of these regions is characterized by certain fine-tuning relations between mass parameters, generalizing the Fierz--Pauli condition. In some cases the required fine-tunings are consequences of the existence of the subgroups of the diffeomorphism group that are left unbroken by the graviton mass. We found two new cases, when the resulting theories have a property of UV insensitivity, i.e. remain well behaved after inclusion of ...

  19. Preparation of porous TiO2/ZnO composite film and its photocathodic protection properties for 304 stainless steel

    Science.gov (United States)

    Xu, Hongmei; Liu, Wei; Cao, Lixin; Su, Ge; Duan, Ruijing

    2014-05-01

    TiO2/ZnO composite films with porous structure were prepared on the 304 stainless steel (304SS) by the sol-gel method and heating treatment. The crystalline phase and morphology of as-prepared TiO2/ZnO composite films were characterized systematically by X-ray diffraction (XRD), scanning electron microscope (SEM) and ultraviolet-visible (UV-vis) spectroscopy, respectively. The influences of Ti/Zn molar ratio and the annealing temperature on the photoelectric property of the samples have been investigated and their photocathodic protection performances for 304 stainless steel under dark and UV conditions have also been evaluated in 3.0% NaCl solution by the electrochemical measurements. The results indicate that porous TiO2/ZnO composite film has a great enhancement of the light absorption and photoelectric property under UV illumination. This can be ascribed to the mutual effect of TiO2/ZnO heterojunctions and the porous structures in the composite films, which provide a better photogenerated cathodic protection for 304SS.

  20. Massive Storage Systems

    Institute of Scientific and Technical Information of China (English)

    Dan Feng; Hai Jin

    2006-01-01

    To accommodate the explosively increasing amount of data in many areas such as scientific computing and e-Business, physical storage devices and control components have been separated from traditional computing systems to become a scalable, intelligent storage subsystem that, when appropriately designed, should provide transparent storage interface, effective data allocation, flexible and efficient storage management, and other impressive features. The design goals and desirable features of such a storage subsystem include high performance, high scalability, high availability, high reliability and high security. Extensive research has been conducted in this field by researchers all over the world, yet many issues still remain open and challenging. This paper studies five different online massive storage systems and one offline storage system that we have developed with the research grant support from China. The storage pool with multiple network-attached RAIDs avoids expensive store-and-forward data copying between the server and storage system, improving data transfer rate by a factor of 2-3 over a traditional disk array. Two types of high performance distributed storage systems for local-area network storage are introduced in the paper. One of them is the Virtual Interface Storage Architecture (VISA) where VI as a communication protocol replaces the TCP/IP protocol in the system. VISA's performance is shown to achieve better than that of IP SAN by designing and implementing the vSCSI (VI-attached SCSI) protocol to support SCSI commands in the VI network. The other is a fault-tolerant parallel virtual file system that is designed and implemented to provide high I/O performance and high reliability. A global distributed storage system for wide-area network storage is discussed in detail in the paper, where a Storage Service Provider is added to provide storage service and plays the role of user agent for the storage system. Object based Storage Systems not only

  1. Higher dimensional nonlinear massive gravity

    CERN Document Server

    Do, Tuan Q

    2016-01-01

    Inspired by a recent ghost-free nonlinear massive gravity in four-dimensional spacetime, we study its higher dimensional scenarios. As a result, we are able to show the constant-like behavior of massive graviton terms for some well-known metrics such as the Friedmann-Lemaitre-Robertson-Walker, Bianchi type I, and Schwarzschild-Tangherlini-(A)dS metrics in a specific five-dimensional nonlinear massive gravity under an assumption that its fiducial metrics are compatible with physical ones. In addition, some simple cosmological solutions of the five-dimensional massive gravity will be figured out consistently.

  2. Magnetospheres of massive stars

    Science.gov (United States)

    Küker, M.

    We study the interaction of line-driven winds from massive stars with the magnetic field rooted in these stars by carrying out numerical simulations using the Nirvana MHD code in 2D in spherical polar coordinates. The code's adaptive mesh refinement feature allows high spatial resolution across the whole simulation box. We study both O and Wolf-Rayet stars for a range of magnetic field strengths from weak to strong as measured by the confinement parameter. For weak fields our simulations show that the initially dipolar field opens up far away from the star and a thin disk-like structure forms in the equatorial plane of the magnetic field. For stronger fields the disk is disrupted close to the stellar surface and closed field lines persist at low latitudes. For very strong fields a pronounced magnetosphere forms where the gas is forced to move along the field lines and eventually falls back to the stellar surface.

  3. massive excision of liver

    Directory of Open Access Journals (Sweden)

    Dong-liang LI

    2014-10-01

    Full Text Available Objective To observe the promotion effect of bone mesenchymal stem cells (BMSCs transplantation and mobilized bone marrow stem cells on the recovery of liver function and liver tissue regeneration after massive partial hepatectomy in rats. Methods The rats were randomly divided into four groups after massive partial hepatectomy (about 85%, namely massive hepatectomy group (control group, n=15, received massive hepatectomy only, G-CSF group [n=15, received rhG-CSF 150μg/(kg•d by intraperitoneal injection after the operation for 5 days], MSCs group [n=15, received 5ml suspension of MSCs (about 1.5×106 by tail vein injection after the operation], and G-CSF+MSCs group [n=14, received 1.5ml suspension of MSCs (about 1.5×106 by tail vein injection and rhG-CSF 150μg/(kg•d by intraperitoneal injection for 5 days after the operation]. The CD34+ cells in the peripheral blood of the rats were assessed by flow cytometry after G-CSF mobilization. Liver function tests including ALT, AST and ALB were performed on the 3rd and 9th day after surgery. All the rats were sacrificed and liver tissue was harvested for histopathological study. The expression of Ki-67 and BrdU positive cells in the liver were determined by immunohistochemistry. Results Flow cytometric results identified the isolated cells were MSCs. BMSCs in peripheral blood significantly increased in number after rhG-CSF mobilization, and reaching the maximum number on the 5th day. After mobilization for 3, 5 and 9 days, the positive CD34 cells in G-CSF group were 0.009%, 0.016%, 0.019% respectively, which were higher than those in control group. The level of albumin was significantly elevated in three treatment groups compared with control group on the 9th day after the hepatectomy (P<0.05 or P<0.01. The expression of Ki-67 (110.16±27.64, 103.57±33.90, 98.52±21.87 vs 72.39±27.04 cells and BrdU positive cells (17.96±5.57, 16.45±5.75, 16.66±5.11 vs 11.72±3.83 cells in three

  4. A massive graviton in topologically new massive gravity

    CERN Document Server

    Kim, Yong-Wan; Park, Young-Jai

    2013-01-01

    We investigate the topologically new massive gravity in three dimensions. It turns out that a single massive mode is propagating in the flat spacetime, comparing to the conformal Chern-Simons gravity which has no physically propagating degrees of freedom. Also we discuss the realization of the BMS/GCA correspondence.

  5. Preparation of Size-tunable, Highly Monodisperse PVP-Protected Pt-nanoparticles by Seed-mediated Growth

    Energy Technology Data Exchange (ETDEWEB)

    Koebel, Matthias Michael; Jones, Louis C.; Somorjai, Gabor A.

    2008-04-02

    We demonstrate a preparative method which produces highly-monodisperse Pt-nanoparticles of tunable size without the external addition of seed particles. Hexachloroplatinic acid is dosed slowly to an ethylene glycol solution at 120 C and reduced in the presence of a stabilizing polymer poly-N-vinylpyrollidone (PVP). Slow addition of the Pt-salt first will first lead to the formation of nuclei (seeds) which then grow further to produce larger particles of any desired size between 3 and 8nm. The amount of added hexachloroplatinic acid precursor controls the size of the final nanoparticle product. TEM was used to determine size and morphology and to confirm the crystalline nature of the nanoparticles. Good reproducibility of the technique was demonstrated. Above 7nm, the particle shape and morphology changes suddenly indicating a change in the deposition selectivity of the Pt-precursor from (100) towards (111) crystal faces and breaking up of larger particles into smaller entities.

  6. Preparation of Cross-Linked Glucoamylase Aggregates Immobilization by Using Dextrin and Xanthan Gum as Protecting Agents

    Directory of Open Access Journals (Sweden)

    Xiao-Dong Li

    2016-05-01

    Full Text Available In this paper glucoamylase from Aspergillus niger was immobilized by using a modified version of cross-linked enzyme aggregates (CLEA. The co-aggregates were cross-linked with glutaraldehyde; meanwhile dextrin and xanthan gum as protecting agents were added, which provides high affinity with the enzyme molecules. The immobilized glucoamylase was stable over a broad range of pH (3.0–8.0 and temperature (55–75 °C; dependence shows more catalytic activity than a free enzyme. The thermostability, kinetic behavior, and first-order inactivation rate constant (ki were investigated. The two types of protector made the immobilized glucoamylase more robust than the free form. Both of the immobilized enzymes have excellent recyclability, retaining over 45% of the relative activity after 24 runs. In addition, immobilized enzymes reduced only 40% of the initial activity after three months by the storability measure, indicating high activity.

  7. Massive Gravity in Three Dimensions

    NARCIS (Netherlands)

    Bergshoeff, Eric A.; Hohm, Olaf; Townsend, Paul K.

    2009-01-01

    A particular higher-derivative extension of the Einstein-Hilbert action in three spacetime dimensions is shown to be equivalent at the linearized level to the (unitary) Pauli-Fierz action for a massive spin-2 field. A more general model, which also includes "topologically-massive" gravity as a speci

  8. BNFL's experience in preparing and implementing radiation protection programmes for the control of exposure to workers involved with the international transport of nuclear cargoes

    Energy Technology Data Exchange (ETDEWEB)

    Billing, D. [Spent Fuel Services, British Nuclear Fuels plc, Warrington, Cheshire (United Kingdom)

    2004-07-01

    BNFL International Transport have successfully developed appropriate Radiation Protection Programmes for their business. The business supports BNFL's worldwide Nuclear Fuel Services with key customer bases in Europe, Japan and the UK, utilising marine, rail and road modal transports. Experience in the business spans over 4 decades. The preparation of RPP's for each aspect of its operations has been made relatively straight forward in that the key elements within the internationally recognised model RPP (by WNTI) were already in place in BNFL's procedures to satisfy current National UK and International Regulations. Arrangements are supported by Management systems which comply with International Standards for Quality Assurance. Exposure to key worker groups continues to be within Category 1 (less than 1mSv/y) of the IAEA Transport Regulations TS-R-1 (ST-1 revised).

  9. Protective effects of kidney-tonifying Chinese herbal preparation on substantia nigra neurons in a mouse model of Parkinson's disease

    Institute of Scientific and Technical Information of China (English)

    Jing Cai; Yun Tian; Ruhui Lin; Xuzheng Chen; Zhizhen Liu; Jindong Xie

    2012-01-01

    The Chinese herbs Herba Epimedii, Fructus Ligustri Lucidi and Rhizoma Polygonati were injected into Parkinson's disease mice established via intraperitoneal injection of 1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine hydrochloride. The selective monoamine oxidase B inhibitor selegiline was used as a positive control drug. After successive administration for 4 weeks, Herba Epimedii could downregulate the expression of caspase-3 and increase the brain-derived neurotrophic factor level, as well as increase tyrosine hydroxylase activity in the substantia nigra of Parkinson's disease mouse models. Rhizoma Polygonati could downregulate the expression of caspase-3 and FasL, and increase neural growth factor and brain-derived neurotrophic factor levels. Fructus Ligustri Lucidi could downregulate caspase-3 expression. Rhizoma Polygonati and Fructus Ligustri Lucidi did not produce obvious effects on tyrosine hydroxylase activity. Herba Epimedii and Fructus Ligustri Lucidi yielded similar effects on apoptosis-promoting factors to those elicited by selegiline. Herba Epimedii and Rhizoma Polygonati significantly increased the levels of neurotrophic factors compared with selegiline. Herba Epimedii significantly increased tyrosine hydroxylase activity compared with selegiline. It is indicated that the kidney-tonifying Chinese herbal preparation can downregulate the expression of apoptosis-promoting factors, increase neurotrophic factors levels in the substantia nigra and striatum, as well as increase tyrosine hydroxylase activity in the substantia nigra of Parkinson's disease mouse models, thereby exerting a stronger or similar neuroprotective effects compared with selegiline.

  10. Preparation and characterization of a novel aspirin derivative with anti-thrombotic and gastric mucosal protection properties.

    Directory of Open Access Journals (Sweden)

    Xi-E Zhen

    Full Text Available The use of acetylsalicylic acid (ASP is limited by its adverse effects, especially the effect on the gastric mucosa. To address this problem, we synthesized a derivative form of ASP, prepared by modification of ASP with nano-hydroxyapatite (a kind of inorganic particle containing Ca(2+. The derivative was named Ca-ASP. Structural study showed that Ca-ASP was a kind of carboxylate containing intramolecular hydrogen bonds. Rats given a high dose of Ca-ASP (5 mmol per kg body weight showed similar anti-thrombotic activity as those given the same dose of ASP, but had much lower gastric mucosal damage than ASP (UI: 2 versus UI: 12.5. These rats also showed reduced expression of COX-2, but their COX-1 expression was similar to that of control rats, but significantly higher than that of ASP-administered rats. Furthermore, the level of prostaglandin E2 (PGE2 was up-regulated in Ca-ASP-administered rats compared to ASP-administered rats. Taken together, the results showed that Ca-ASP possessed similar antithrombotic activity as ASP but without the side effect associated with ASP, and the underlying mechanism may center on inhibiting COX-2 without inhibiting COX-1, and thus favouring the production of PGE2, the prostaglandin that plays a vital role in the suppression of platelet aggregation and thrombosis, as well as in the repair of gastric damage.

  11. Preparation of ecofriendly UV-protective food packaging material by starch/TiO2 bio-nanocomposite: Characterization.

    Science.gov (United States)

    Goudarzi, Vahid; Shahabi-Ghahfarrokhi, Iman; Babaei-Ghazvini, Amin

    2017-02-01

    In this study, ecofriendly starch/TiO2 bio-nanocomposites were produced using with different nano-TiO2 (TiO2) content (1, 3, and 5 (wt%)). Physical, mechanical, thermal, water-vapor permeability (WVP) properties and UV transmittance were investigated. Our results showed that the increasing TiO2 content increased the hydrophobicity of starch/TiO2 films. WVP of the bio-nanocomposites was reduced, simultaneously. With increasing TiO2 content, tensile strength and Young's modulus of the film specimens were reduced while elongation at break and tensile energy to break were increased. The thermal properties of specimens showed that glass transition temperature of the films increased but melting point of the specimen films was decreased by increasing TiO2 content. Scanning electron microscopy observations demonstrated, the most of films' physical properties were in relation to their microstructures. The starch/TiO2 nanocomposites effectively protect goods against UV light, and could potentially be applied as UV-shielding packaging materials.

  12. Massive gauge-flation

    Science.gov (United States)

    Nieto, Carlos M.; Rodríguez, Yeinzon

    2016-06-01

    Gauge-flation model at zeroth-order in cosmological perturbation theory offers an interesting scenario for realizing inflation within a particle physics context, allowing us to investigate interesting possible connections between inflation and the subsequent evolution of the Universe. Difficulties, however, arise at the perturbative level, thus motivating a modification of the original model. In order to agree with the latest Planck observations, we modify the model such that the new dynamics can produce a relation between the spectral index ns and the tensor-to-scalar ratio r allowed by the data. By including an identical mass term for each of the fields of the system, we find interesting dynamics leading to slow-roll inflation of the right length. The presence of the mass term has the potential to modify the ns versus r relation so as to agree with the data. As a first step, we study the model at zeroth-order in cosmological perturbation theory, finding the conditions required for slow-roll inflation and the number of e-foldings of inflation. Numerical solutions are used to explore the impact of the mass term. We conclude that the massive version of gauge-flation offers a viable inflationary model.

  13. Synthesis of dendron-protected porphyrin wires and preparation of a one-dimensional assembly of gold nanoparticles chemically linked to the pi-conjugated wires.

    Science.gov (United States)

    Ozawa, Hiroaki; Kawao, Masahiro; Tanaka, Hirofumi; Ogawa, Takuji

    2007-05-22

    A one-dimensional assembly of gold nanoparticles chemically bonded to pi-conjugated porphyrin polymers was prepared on a chemically modified glass surface and on an undoped naturally oxidized silicon surface by the following methods: pi-conjugated porphyrin polymers were prepared by oxidative coupling of 5,15-diethynyl-10,20-bis-((4-dendron)phenyl) porphyrin (6), and its homologues (larger than 40-mer) were collected by analytical gel permeation chromatography (GPC). The porphyrin polymers (>40-mer) were deposited using the Langmuir-Blodgett (LB) method on substrate surfaces, which were then soaked in a solution of gold nanoparticles (2.7 +/- 0.8 nm) protected with t-dodecanethiol and 4-pyridineethanethiol. The topographical images of the surface observed by tapping mode atomic force microscopy (AFM) showed that the polymers could be dispersed on both substrates, with a height of 2.8 +/- 0.5 nm on the modified glass and 3.1 +/- 0.5 nm on silicon. The height clearly increased after soaking in the gold nanoparticle solution, to 5.3 +/- 0.5 nm on glass and 5.4 +/- 0.7 nm on silicon. The differences in height (2.5 nm on glass and 2.3 nm on silicon) corresponded to the diameter of the gold nanoparticles bonded to the porphyrin polymers. The distance between gold nanoparticles observed in scanning electron microscopic images was ca. 5 nm, indicating that they were bonded at every four or five porphyrin units.

  14. Preparation of Ginsenoside Rg3 and Protection against H2O2-Induced Oxidative Stress in Human Neuroblastoma SK-N-SH Cells

    Directory of Open Access Journals (Sweden)

    Gang Li

    2014-01-01

    Full Text Available The aim of this study is to evaluate the protection of ginsenoside Rg3 against oxidative stress in human neuroblastoma SK-N-SH cells. 20(R-ginsenoside Rg3 (20(R-Rg3 and 20(S-ginsenoside Rg3 (20(S-Rg3 were prepared by the method of chemical degradation and column chromatography, and the structure of the two compounds was characterized by 1H-NMR and 13C-NMR spectroscopy. MTT assay and LDH leakage assay were used to determine the cell viability and the oxidative stress cellular model was established by means of H2O2 (600 μM for 4 h. We also investigated the changes of intracellular MDA content, SOD activity, and ROS formation after the treatment of ginsenoside Rg3 for 20 h. The results indicated that both 20 (R-Rg3 and 20 (S-Rg3 had obvious protection against H2O2-induced oxidative stress in SK-N-SH cells. Moreover, 20(R-Rg3 exhibited better antioxidant activity than 20(S-Rg3 in vitro. These findings are expected to provide some implication for further research and application of ginsenoside Rg3 in neuroprotection.

  15. Preparation of SiO2-Protecting Metallic Fe Nanoparticle/SiO2 Composite Spheres for Biomedical Application

    Directory of Open Access Journals (Sweden)

    Pin-Wei Hsieh

    2015-11-01

    Full Text Available Functionalized Fe nanoparticles (NPs have played an important role in biomedical applications. In this study, metallic Fe NPs were deposited on SiO2 spheres to form a Fe/SiO2 composite. To protect the Fe from oxidation, a thin SiO2 layer was coated on the Fe/SiO2 spheres thereafter. The size and morphology of the SiO2@Fe/SiO2 composite spheres were examined by transmission electron microscopy (TEM. The iron form and its content and magnetic properties were examined by X-ray diffraction (XRD, inductively-coupled plasma mass spectrometry (ICP-MS and a superconducting quantum interference device (SQUID. The biocompatibility of the SiO2@Fe/SiO2 composite spheres was examined by Cell Counting Kit-8 (CCK-8 and lactate dehydrogenase (LDH tests. The intracellular distribution of the SiO2@Fe/SiO2 composite spheres was observed using TEM. XRD analysis revealed the formation of metallic iron on the surface of the SiO2 spheres. According to the ICP-MS and SQUID results, using 0.375 M FeCl3·6H2O for Fe NPs synthesis resulted in the highest iron content and magnetization of the SiO2@Fe/SiO2 spheres. Using a dye loading experiment, a slow release of a fluorescence dye from SiO2@Fe/SiO2 composite spheres was confirmed. The SiO2@Fe/SiO2 composite spheres co-cultured with L929 cells exhibit biocompatibility at concentrations <16.25 µg/mL. The TEM images show that the SiO2@Fe/SiO2 composite spheres were uptaken into the cytoplasm and retained in the endosome. The above results demonstrate that the SiO2@Fe/SiO2 composite spheres could be used as a multi-functional agent, such as a magnetic resonance imaging (MRI contrast agent or drug carriers in biomedical applications.

  16. The Destructive Birth of Massive Stars and Massive Star Clusters

    Science.gov (United States)

    Rosen, Anna; Krumholz, Mark; McKee, Christopher F.; Klein, Richard I.; Ramirez-Ruiz, Enrico

    2017-01-01

    Massive stars play an essential role in the Universe. They are rare, yet the energy and momentum they inject into the interstellar medium with their intense radiation fields dwarfs the contribution by their vastly more numerous low-mass cousins. Previous theoretical and observational studies have concluded that the feedback associated with massive stars' radiation fields is the dominant mechanism regulating massive star and massive star cluster (MSC) formation. Therefore detailed simulation of the formation of massive stars and MSCs, which host hundreds to thousands of massive stars, requires an accurate treatment of radiation. For this purpose, we have developed a new, highly accurate hybrid radiation algorithm that properly treats the absorption of the direct radiation field from stars and the re-emission and processing by interstellar dust. We use our new tool to perform a suite of three-dimensional radiation-hydrodynamic simulations of the formation of massive stars and MSCs. For individual massive stellar systems, we simulate the collapse of massive pre-stellar cores with laminar and turbulent initial conditions and properly resolve regions where we expect instabilities to grow. We find that mass is channeled to the massive stellar system via gravitational and Rayleigh-Taylor (RT) instabilities. For laminar initial conditions, proper treatment of the direct radiation field produces later onset of RT instability, but does not suppress it entirely provided the edges of the radiation-dominated bubbles are adequately resolved. RT instabilities arise immediately for turbulent pre-stellar cores because the initial turbulence seeds the instabilities. To model MSC formation, we simulate the collapse of a dense, turbulent, magnetized Mcl = 106 M⊙ molecular cloud. We find that the influence of the magnetic pressure and radiative feedback slows down star formation. Furthermore, we find that star formation is suppressed along dense filaments where the magnetic field is

  17. Gauge Model with Massive Gravitons

    Institute of Scientific and Technical Information of China (English)

    WU Ning

    2003-01-01

    Gauge theory of gravity is formulated based on principle of local gauge invariance. Because the model hasstrict local gravitational gauge symmetry, and gauge theory of gravity is a perturbatively renormalizable quantum model.However, in the original model, all gauge gravitons are massless. We want to ask whether there exist massive gravitonsin Nature. In this paper, we will propose a gauge model with massive gravitons. The mass term of gravitational gaugefield is introduced into the theory without violating the strict local gravitational gauge symmetry. Massive gravitons canbe considered to be possible origin of dark energy and dark matter in the Universe.

  18. A not so massive cluster hosting a very massive star

    CERN Document Server

    Alegría, S Ramírez; Borissova, J; Kurtev, R; Navarro, C; Kuhn, M; Carballo-Bello, J A

    2015-01-01

    We present the first physical characterization of the young open cluster VVV CL041. We spectroscopically observed the cluster main-sequence stellar population and a very-massive star candidate: WR62-2. CMFGEN modeling to our near-infrared spectra indicates that WR62-2 is a very luminous (10$^{6.4\\pm0.2} L_{\\odot}$) and massive ($\\sim80 M_{\\odot}$) star.

  19. Core-shell hybrid liposomal vesicles loaded with panax notoginsenoside: preparation, characterization and protective effects on global cerebral ischemia/reperfusion injury and acute myocardial ischemia in rats

    Directory of Open Access Journals (Sweden)

    Zhang J

    2012-08-01

    Full Text Available Jing Zhang,1,* Xizhen Han,1,* Xiang Li,2 Yun Luo,1 Haiping Zhao,1 Ming Yang,1 Bin Ni,1 Zhenggen Liao11Key Laboratory of Modern Preparation of TCM, Ministry of Education, 2National Pharmaceutical Engineering Center for Solid Preparation in Chinese Herbal Medicine, Jiangxi University of Traditional Chinese Medicine, Nanchang, People's Republic of China*These authors contributed equally to this workPurpose: Novel panax notoginsenoside-loaded core-shell hybrid liposomal vesicles (PNS-HLV were developed to resolve the restricted bioavailability of PNS and to enhance its protective effects in vivo on oral administration.Methods: Physicochemical characterizations of PNS-HLV included assessment of morphology, particle size and zeta potential, encapsulation efficiency (EE%, stability and in vitro release study. In addition, to evaluate its oral treatment potential, we compared the effect of PNS-HLV on global cerebral ischemia/reperfusion and acute myocardial ischemia injury with those of PNS solution, conventional PNS-loaded nanoparticles, and liposomes.Results: In comparison with PNS solution, conventional PNS-loaded nanoparticles and liposomes, PNS-HLV was stable for at least 12 months at 4°C. Satisfactory improvements in the EE% of notoginsenoside R1, ginsenoside Rb1, and ginsenoside Rg1 were shown with the differences in EE% shortened and the greater controlled drug release profiles were exhibited from PNS-HLV. The improvements in the physicochemical properties of HLV contributed to the results that PNS-HLV was able to significantly inhibit the edema of brain and reduce the infarct volume, while it could markedly inhibit H2O2, modified Dixon agar, and serum lactate dehydrogenase, and increase superoxide dismutase (P < 0.05.Conclusion: The results of the present study imply that HLV has promising prospects for improving free drug bioactivity on oral administration.Keywords: liposomes, nanoparticles, panax notoginsenoside, physicochemical properties

  20. Role of information in preparing men for transrectal ultrasound guided prostate biopsy: a qualitative study embedded in the ProtecT trial.

    Science.gov (United States)

    Wade, Julia; Rosario, Derek J; Howson, Joanne; Avery, Kerry N L; Salter, C Elizabeth; Goodwin, M Louise; Blazeby, Jane M; Lane, J Athene; Metcalfe, Chris; Neal, David E; Hamdy, Freddie C; Donovan, Jenny L

    2015-02-28

    The histological diagnosis of prostate cancer requires a prostate needle biopsy. Little is known about the relationship between information provided to prepare men for transrectal ultrasound guided biopsy (TRUS-Bx) and how men experience biopsy. The objectives were a) to understand men's experiences of biopsy as compared to their expectations; and b) to propose current evidence-based information for men undergoing TRUS-Bx. Between February 2006 and May 2008, 1,147 men undergoing a standardised 10-core transrectal ultrasound guided biopsy protocol under antibiotic cover following a PSA 3.0-19.9 ng/ml in the Prostate Testing for Cancer and Treatment (ProtecT) trial, completed questionnaires about biopsy symptoms. In this embedded qualitative study, in-depth interviews were undertaken with 85 men (mean age 63.6 yrs, mean PSA 4.5 ng/ml) to explore men's experiences of prostate biopsy and how the experience might be improved. Interview data were analysed thematically using qualitative research methods. Findings from the qualitative study were used to guide selection of key findings from the questionnaire study in developing a patient information leaflet preparing men for biopsy. Although most men tolerated TRUS-Bx, a quarter reported problematic side-effects and anxiety. Side effects were perceived as problematic and anxiety arose most commonly when experiences deviated from information provided. Men who were unprepared for elements of TRUS-Bx procedure or its sequelae responded by contacting health professionals for reassurance and voiced frustration that pre-biopsy information had understated the possible severity or duration of pain/discomfort and bleeding. Findings from questionnaire and interview data were combined to propose a comprehensive, evidence-based patient information leaflet for TRUS-Bx. Men reported anxiety associated with TRUS-Bx or its side-effects most commonly if they felt inadequately prepared for the procedure. Data from this qualitative study and

  1. Holographically Viable Extensions of Topologically Massive and Minimal Massive Gravity?

    CERN Document Server

    Altas, Emel

    2015-01-01

    Recently, an extension of the topologically massive gravity (TMG) in $2+1$ dimensions, dubbed as minimal massive gravity (MMG), was found which is free of the bulk-boundary unitarity clash that inflicts the former theory and all the other known three dimensional theories. Field equations of MMG differ from those of TMG at quadratic terms in the curvature that do not come from the variation of an action depending on the metric alone. Here we show that MMG is a unique theory and there does not exist a deformation of TMG or MMG at the cubic and quartic order (and beyond) in the curvature that is consistent at the level of the field equations. The only extension of TMG with the desired bulk and boundary properties having a single massive degree of freedom is MMG.

  2. The evolution of massive and very massive stars in clusters

    CERN Document Server

    Vanbeveren, Dany

    2008-01-01

    The present paper reviews massive star (initial mass smaller than 120 M0) and very massive star (initial mass larger than 120 M0) evolution. I will focus on evolutionary facts and questions that may critically affect predictions of population and spectral synthesis of starburst regions. We discuss the ever-lasting factor 2 or more uncertainty in the stellar wind mass loss rates. We may ask ourselves if stellar rotation is one of the keys to understand the universe, why so many massive stars are binary components and why binaries are ignored or are considered as the poor cousins by some people? And finally, do ultra luminous X-ray sources harbor an intermediate mass black hole with a mass of the order of 1000 M0?

  3. Preparation of Nanogold Colloid Using Triphenylphosphine as Protective Agent%以三苯基膦为保护剂制备纳米金溶胶

    Institute of Scientific and Technical Information of China (English)

    邵霞; 索掌怀

    2015-01-01

    以三苯基膦( PPh3)为保护剂,采用水相化学还原法制备了纳米金溶胶.利用紫外可见分光光度计和透射电子显微镜对纳米金颗粒的尺寸及形貌进行表征.讨论了还原剂种类与用量、保护剂用量与加入方式、金粒子浓度、溶液pH值等因素对纳米金颗粒粒径、形貌和分散性的影响.结果表明:采用硼氢化钠为还原剂时,PPh3与金质量比为0.02∶1,溶液pH值为7,制得纳米金粒子平均粒径为4~5 nm.采用柠檬酸钠为还原剂时,PPh3与金质量比为0.04∶1,柠檬酸钠与金质量比为10∶1,溶液pH=3~4,制得金粒子平均粒径为13~15 nm.采用草酸为还原剂时,PPh3与金质量比为0.08∶1,草酸与金质量比为3∶1,金前驱液pH值为6,制得金粒子平均粒径为23~25 nm.加入保护剂后,粒子的分散性增强,形状不规则粒子增多.%Nanogold colloid is synthesized by chemical reduction using triphenylphosphine ( PPh3 ) solution as pro-tective agent. UV-Vis spectroscopy and transmission electron microscopy ( TEM) are used to characterize the pre-pared Au nanoparticles. Some factors such as the type and the amount of reducing agent, the adding way and the a-mount of protective agent, the concentration and pH value of Au solution, which affects the particle size, morpholo-gy and dispersion of Au nanoparticles, are discussed. The results show that the optimized processing parameters for preparing gold nanoparticles using NaBH4 with an average diameter from 4 to 5 nm are:mPPh3∶mAu=0. 02∶1, pH=7. The optimal conditions obtained for making gold nanoparticles using Na3 C6 H5 O7 with particle size from 13 to 15 nm are:mPPh3∶mAu =0. 04∶1, mNa3C6H5O7∶mAu =10∶1, pH =3 -4. The size of Au nanoparticles prepared with H2 C2 O4 is within the range of 23~25 nm. The optimal conditions are mPPh3∶mAu=0. 08∶1, mH2C2O4∶mAu=3∶1, pH=6. After adding a certain amount of PPh3 , colloidal gold nanoparticles show higher dispersion and more

  4. Perturbations in Massive Gravity Cosmology

    CERN Document Server

    Crisostomi, Marco; Pilo, Luigi

    2012-01-01

    We study cosmological perturbations for a ghost free massive gravity theory formulated with a dynamical extra metric that is needed to massive deform GR. In this formulation FRW background solutions fall in two branches. In the dynamics of perturbations around the first branch solutions, no extra degree of freedom with respect to GR ispresent at linearized level, likewise what is found in the Stuckelberg formulation of massive gravity where the extra metric isflat and non dynamical. In the first branch, perturbations are probably strongly coupled. On the contrary, for perturbations around the second branch solutions all expected degrees of freedom propagate. While tensor and vector perturbations of the physical metric that couples with matter follow closely the ones of GR, scalars develop an exponential Jeans-like instability on sub-horizon scales. On the other hand, around a de Sitter background there is no instability. We argue that one could get rid of the instabilities by introducing a mirror dark matter ...

  5. Massive ascites of unknown origin

    Science.gov (United States)

    Yuan, Shi-Min

    2014-01-01

    Massive ascites of unknown origin is an uncommon condition, which represent a diagnostic challenge. Patients with delayed diagnosis and treatment may have a poor prognosis. A 22-year-old female was referred to this hospital due to a 4-year progressive abdominal distension with massive ascites of unknown origin. By thorough investigations, she was eventually diagnosed as chronic calcified constrictive pericarditis. She received pericardiectomy and had an uneventful postoperative course. With a few day paracentesis, ascites did not progress any more. She was doing well at 5-month follow-up and has returned to work. Extracardiac manifestations, such as massive ascites and liver cirrhosis, were rare in patients with constrictive pericarditis. Pericardiectomy can be a radical solution for the treatment of chronic constrictive pericarditis. In order to avoid delayed diagnosis and treatment, physicians have to bear in mind this rare manifestation of chronic calcified constrictive pericarditis. PMID:24600502

  6. Quantum Corrections in Massive Gravity

    CERN Document Server

    de Rham, Claudia; Ribeiro, Raquel H

    2013-01-01

    We compute the one-loop quantum corrections to the potential of ghost-free massive gravity. We show how the mass of external matter fields contribute to the running of the cosmological constant, but do not change the ghost-free structure of the massive gravity potential at one-loop. When considering gravitons running in the loops, we show how the structure of the potential gets destabilized at the quantum level, but in a way which would never involve a ghost with a mass smaller than the Planck scale. This is done by explicitly computing the one-loop effective action and supplementing it with the Vainshtein mechanism. We conclude that to one-loop order the special mass structure of ghost-free massive gravity is technically natural.

  7. Quantum corrections in massive gravity

    Science.gov (United States)

    de Rham, Claudia; Heisenberg, Lavinia; Ribeiro, Raquel H.

    2013-10-01

    We compute the one-loop quantum corrections to the potential of ghost-free massive gravity. We show how the mass of external matter fields contributes to the running of the cosmological constant, but does not change the ghost-free structure of the massive gravity potential at one-loop. When considering gravitons running in the loops, we show how the structure of the potential gets destabilized at the quantum level, but in a way which would never involve a ghost with a mass smaller than the Planck scale. This is done by explicitly computing the one-loop effective action and supplementing it with the Vainshtein mechanism. We conclude that to one-loop order the special mass structure of ghost-free massive gravity is technically natural.

  8. A Massive Substellar Companion to the Massive Giant HD 119445

    CERN Document Server

    Omiya, Masashi; Han, Inwoo; Lee, Byeong-Cheol; Sato, Bun'ei; Kambe, Eiji; Kim, Kang-Min; Yoon, Tae Seog; Yoshida, Michitoshi; Masuda, Seiji; Toyota, Eri; Urakawa, Seitaro; Takada-Hidai, Masahide

    2009-01-01

    We detected a brown dwarf-mass companion around the intermediate-mass giant star HD 119445 (G6III) using the Doppler technique. This discovery is the first result from a Korean-Japanese planet search program based on precise radial velocity measurements. The radial velocity of this star exhibits a periodic Keplerian variation with a period, semi-amplitude and eccentricity of 410.2 days, 413.5 m/s and 0.082, respectively. Adopting a stellar mass of 3.9 M_solar, we were able to confirm the presence of a massive substellar companion with a semimajor axis of 1.71 AU and a minimum mass of 37.6 M_Jup, which falls in the middle of the brown dwarf-mass region. This substellar companion is the most massive ever discovered within 3 AU of a central intermediate-mass star. The host star also ranks among the most massive stars with substellar companions ever detected by the Doppler technique. This result supports the current view of substellar systems that more massive substellar companions tend to exist around more massi...

  9. Broadbeam for Massive MIMO Systems

    Science.gov (United States)

    Qiao, Deli; Qian, Haifeng; Li, Geoffrey Ye

    2016-05-01

    Massive MIMO has been identified as one of the promising disruptive air interface techniques to address the huge capacity requirement demanded by 5G wireless communications. For practical deployment of such systems, the control message need to be broadcast to all users reliably in the cell using broadbeam. A broadbeam is expected to have the same radiated power in all directions to cover users in any place in a cell. In this paper, we will show that there is no perfect broadbeam. Therefore, we develop a method for generating broadbeam that can allow tiny fluctuations in radiated power. Overall, this can serve as an ingredient for practical deployment of the massive MIMO systems.

  10. Cleaning Massive Sonar Point Clouds

    DEFF Research Database (Denmark)

    Arge, Lars Allan; Larsen, Kasper Green; Mølhave, Thomas;

    2010-01-01

    We consider the problem of automatically cleaning massive sonar data point clouds, that is, the problem of automatically removing noisy points that for example appear as a result of scans of (shoals of) fish, multiple reflections, scanner self-reflections, refraction in gas bubbles, and so on. We...... describe a new algorithm that avoids the problems of previous local-neighbourhood based algorithms. Our algorithm is theoretically I/O-efficient, that is, it is capable of efficiently processing massive sonar point clouds that do not fit in internal memory but must reside on disk. The algorithm is also...

  11. Massive Gravitons on Bohmian Congruences

    CERN Document Server

    Fathi, Mohsen

    2016-01-01

    Taking a quantum corrected form of Raychaudhuri equation in a geometric background described by a Lorentz-violating massive theory of gravity, we go through investigating a time-like congruence of massive gravitons affected by a Bohmian quantum potential. We find some definite conditions upon which these gravitons are confined to diverging Bohmian trajectories. The respective behaviour of those quantum potentials are also derived and discussed. Additionally, and through a relativistic quantum treatment of a typical wave function, we demonstrate schematic conditions on the associated frequency to the gravitons, in order to satisfy the necessity of divergence.

  12. Electronic structure and Schottky-barrier formation on GaAs (100) surfaces prepared by thermal desorption of a protective arsenic coating

    Energy Technology Data Exchange (ETDEWEB)

    Spindt, C.J.; Yamada, M.; Meissner, P.L.; Miyano, K.E.; Kendelewicz, T.; Herrera-Gomez, A.; Spicer, W.E. (Stanford Electronics Laboratories, Stanford University, Stanford, California 94305-4055 (United States)); Arko, A.J. (Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States))

    1992-05-15

    Soft-x-ray photoemission spectroscopy has been used to characterize GaAs(100) surfaces and interfaces grown by molecular-beam epitaxy and prepared by the thermal desorption of a protective As coating. The samples studied were grown and arsenic capped identically to those used in a previous study (Brillson {ital et} {ital al}., J. Vac. Sci. Technol. B 6, 1263 (1988)). In this previous work, unpinned'' Schottky-barrier formation was reported, with barrier heights over a wide (0.75-eV) range. This is a striking result, as it was previously believed that all metals will pin GaAs surfaces in a narrow energy range near the middle of the band gap. This large range of barrier heights later led to the suggestion that the (100) surface could become an insulating layer that could screen out the effects of metal-induced gap states. Motivated by this work, we have studied Al and Au Schottky barriers since the deposition of these two metals gave the extreme low and high barriers in the 0.75-eV range. We have also characterized the clean surfaces prepared by desorbing the As caps at different temperatures. The As 3{ital d} and Ga 3{ital d} core levels showed that the surface stoichiometry could be varied significantly with the desorption temperature. The As 3{ital d} line shape was found to be the best indication of the surface stoichiometry after the anneal. The valence-band spectra did not show any strong features which could be used to determine when the sample was completely decapped. The electronic structure of the surface layer was investigated experimentally, and no evidence of an insulating reconstruction was found. In our study of band bending, we found that the low-doped samples used here and in the earlier study showed significant photovoltages resulting in incorrect band-bending measurements. We also found that the Au measurements are made difficult by the presence of core-level shifts due to Au-Ga alloying.

  13. NCB-02(standardized Curcumin preparation)protects dinitrochlorobenzene-induced colitis through down-regulation of NFκ-B and iNOS

    Institute of Scientific and Technical Information of China (English)

    MV Venkataranganna; Md Rafiq; S Gopumadhavan; Ghouse Peer; UV Babu; SK Mitra

    2007-01-01

    AIM:To evaluate the efficacy and mechanism of action of NCB-02,a standardized Curcumin preparation,against 2,4-dinitrochlorobenzene(DNCB)-induced ulcerative colitis in rats.METHODS:Ulcerative colitis was induced in male rats by sensitizing with topical application of DNCB in acetone for 14 d and intra-colonol challenge with DNCB on day 15.A separate group of animals with vehicle treatment in similar fashion served as control group.Colitis rats were divided into different groups and treated with NCB-02 at doses of 25,50 and 100 mg/kg b.wt p.o.for 10 d.Sulfasalazine at a dose of 100 mg/kg b.wt for 10 d served as a reference group.On day 10 after respective assigned treatment,all the animals were euthanized and the length of the colon,weight of entire colon and distal 8 cm of the colon were recorded.The distal part of the colon was immediately observed under a stereomicroscope and the degree of damage was scored.Further distal 8 cm of the colon was subject to the determination of colonic myeloperoxidase(MPO),lipid peroxidation(LPO)and alkaline phosphatase (ALP)activities.A small piece of the sample from distal colon of each animal was fixed in 10% neutral buffered formalin and embedded in paraffin wax and sectioned for immunohistochemical examination of NFκ-B and iNOS expression.RESULTS:NCB-02 showed a dose dependent protection against DNCB-induced alteration in colon length and weight.NCB-02 treatment also showed a dose dependent protection against the elevated levels of MPO,LPO and ALP,induced by DNCB.NCB-02 demonstrated a significant effect at a dose of 100 mg/kg b.wt.,which was almost equipotent to 100 mg/kg b.wt.of sulfasalazine.Treatment with sulfasalazine and curcumin at a dose of 100 mg/kg b.wt.inhibited the DNCB-induced overexpression of NFκ-B and iNOS in the colon.CONCLUSION:Curcumin treatment ameliorates colonic damage in DNCB-induced colitic rats,an effect associated with an improvement in intestinal oxidative stress and downregulation of colonic NFκ

  14. Multiplexed microsatellite recovery using massively parallel sequencing.

    Science.gov (United States)

    Jennings, T N; Knaus, B J; Mullins, T D; Haig, S M; Cronn, R C

    2011-11-01

    Conservation and management of natural populations requires accurate and inexpensive genotyping methods. Traditional microsatellite, or simple sequence repeat (SSR), marker analysis remains a popular genotyping method because of the comparatively low cost of marker development, ease of analysis and high power of genotype discrimination. With the availability of massively parallel sequencing (MPS), it is now possible to sequence microsatellite-enriched genomic libraries in multiplex pools. To test this approach, we prepared seven microsatellite-enriched, barcoded genomic libraries from diverse taxa (two conifer trees, five birds) and sequenced these on one lane of the Illumina Genome Analyzer using paired-end 80-bp reads. In this experiment, we screened 6.1 million sequences and identified 356,958 unique microreads that contained di- or trinucleotide microsatellites. Examination of four species shows that our conversion rate from raw sequences to polymorphic markers compares favourably to Sanger- and 454-based methods. The advantage of multiplexed MPS is that the staggering capacity of modern microread sequencing is spread across many libraries; this reduces sample preparation and sequencing costs to less than $400 (USD) per species. This price is sufficiently low that microsatellite libraries could be prepared and sequenced for all 1373 organisms listed as 'threatened' and 'endangered' in the United States for under $0.5 M (USD).

  15. Massively parallel quantum computer simulator

    NARCIS (Netherlands)

    De Raedt, K.; Michielsen, K.; De Raedt, H.; Trieu, B.; Arnold, G.; Richter, M.; Lippert, Th.; Watanabe, H.; Ito, N.

    2007-01-01

    We describe portable software to simulate universal quantum computers on massive parallel Computers. We illustrate the use of the simulation software by running various quantum algorithms on different computer architectures, such as a IBM BlueGene/L, a IBM Regatta p690+, a Hitachi SR11000/J1, a Cray

  16. Understanding massively open online courses.

    Science.gov (United States)

    Billings, Diane M

    2014-02-01

    Massively open online courses (MOOCs) are an innovative delivery system for educational offerings. MOOCs have been hailed with optimism for making education accessible to many, but at the same time, they have been criticized for poor participant completion rates. Nurse educators are considering whether and how to use MOOCs; this column explains MOOCs and their advantages and disadvantages for nurse educators.

  17. Fast, Massively Parallel Data Processors

    Science.gov (United States)

    Heaton, Robert A.; Blevins, Donald W.; Davis, ED

    1994-01-01

    Proposed fast, massively parallel data processor contains 8x16 array of processing elements with efficient interconnection scheme and options for flexible local control. Processing elements communicate with each other on "X" interconnection grid with external memory via high-capacity input/output bus. This approach to conditional operation nearly doubles speed of various arithmetic operations.

  18. Five-loop massive tadpoles

    CERN Document Server

    Luthe, T

    2016-01-01

    We provide an update on a long-term project that aims at evaluating massive vacuum integrals at the five-loop frontier, with high precision and in various space-time dimensions. A number of applications are sketched, mainly concerning the determination of anomalous dimensions, for quantum field theories in four, three and two dimensions.

  19. Cosmological solutions with massive gravitons

    Energy Technology Data Exchange (ETDEWEB)

    Chamseddine, Ali H. [Physics Department, American University of Beirut (Lebanon); Laboratoire de Mathematiques et Physique Theorique CNRS-UMR 6083, Universite de Tours, Parc de Grandmont, 37200 Tours (France); LE STUDIUM, Loire Valley Institute for Advanced Studies, Tours and Orleans (France); I.H.E.S., F-91440 Bures-sur-Yvette (France); Volkov, Mikhail S., E-mail: volkov@lmpt.univ-tours.fr [Laboratoire de Mathematiques et Physique Theorique CNRS-UMR 6083, Universite de Tours, Parc de Grandmont, 37200 Tours (France)

    2011-10-25

    We present solutions describing spatially closed, open, or flat cosmologies in the massive gravity theory within the recently proposed tetrad formulation. We find that the effect of the graviton mass is equivalent to introducing to the Einstein equations a matter source that can consist of several different matter types - a cosmological term, quintessence, gas of cosmic strings, and non-relativistic cold matter.

  20. Non-local massive gravity

    CERN Document Server

    Modesto, Leonardo

    2013-01-01

    We present a general covariant action for massive gravity merging together a class of "non-polynomial" and super-renormalizable or finite theories of gravity with the non-local theory of gravity recently proposed by Jaccard, Maggiore and Mitsou (arXiv:1305.3034 [hep-th]). Our diffeomorphism invariant action gives rise to the equations of motion appearing in non-local massive massive gravity plus quadratic curvature terms. Not only the massive graviton propagator reduces smoothly to the massless one without a vDVZ discontinuity, but also our finite theory of gravity is unitary at tree level around the Minkowski background. We also show that, as long as the graviton mass $m$ is much smaller the today's Hubble parameter $H_0$, a late-time cosmic acceleration can be realized without a dark energy component due to the growth of a scalar degree of freedom. In the presence of the cosmological constant $\\Lambda$, the dominance of the non-local mass term leads to a kind of "degravitation" for $\\Lambda$ at the late cos...

  1. Supernovae from massive AGB stars

    NARCIS (Netherlands)

    Poelarends, A.J.T.; Izzard, R.G.; Herwig, F.; Langer, N.; Heger, A.

    2006-01-01

    We present new computations of the final fate of massive AGB-stars. These stars form ONeMg cores after a phase of carbon burning and are called Super AGB stars (SAGB). Detailed stellar evolutionary models until the thermally pulsing AGB were computed using three di erent stellar evolution codes. The

  2. Causality Constraints on Massive Gravity

    CERN Document Server

    Camanho, Xian O; Rahman, Rakibur

    2016-01-01

    The parameter space of the de Rham-Gabadadze-Tolley massive gravity ought to be constrained essentially to a line. The theory is shown to admit pp-wave backgrounds on which linear fluctuations otherwise undergo significant time advances, potentially leading to closed time-like curves. This classical phenomenon takes place well within the theory's validity regime.

  3. Multimedia over massive MIMO wireless systems

    OpenAIRE

    Wang, Haichao; Ge, Xiaohu; Zi, Ran; Zhang, Jing; Ni, Qiang

    2015-01-01

    To satisfy the massive wireless traffic transmission generated by multimedia applications, the massive multi-input-multi-output (MIMO) wireless system has emerged as a possible solution for future 5G wireless communication systems. However, the mutual coupling effect of massive MIMO systems has a negative effect potential on the wireless capacity. In this paper, the receive diversity gain is first defined and analyzed for massive MIMO wireless systems. Furthermore, we propose an effective cap...

  4. Massive binary stars as a probe of massive star formation

    Science.gov (United States)

    Kiminki, Daniel C.

    2010-10-01

    Massive stars are among the largest and most influential objects we know of on a sub-galactic scale. Binary systems, composed of at least one of these stars, may be responsible for several types of phenomena, including type Ib/c supernovae, short and long gamma ray bursts, high-velocity runaway O and B-type stars, and the density of the parent star clusters. Our understanding of these stars has met with limited success, especially in the area of their formation. Current formation theories rely on the accumulated statistics of massive binary systems that are limited because of their sample size or the inhomogeneous environments from which the statistics are collected. The purpose of this work is to provide a higher-level analysis of close massive binary characteristics using the radial velocity information of 113 massive stars (B3 and earlier) and binary orbital properties for the 19 known close massive binaries in the Cygnus OB2 Association. This work provides an analysis using the largest amount of massive star and binary information ever compiled for an O-star rich cluster like Cygnus OB2, and compliments other O-star binary studies such as NGC 6231, NGC 2244, and NGC 6611. I first report the discovery of 73 new O or B-type stars and 13 new massive binaries by this survey. This work involved the use of 75 successful nights of spectroscopic observation at the Wyoming Infrared Observatory in addition to observations obtained using the Hydra multi-object spectrograph at WIYN, the HIRES echelle spectrograph at KECK, and the Hamilton spectrograph at LICK. I use these data to estimate the spectrophotometric distance to the cluster and to measure the mean systemic velocity and the one-sided velocity dispersion of the cluster. Finally, I compare these data to a series of Monte Carlo models, the results of which indicate that the binary fraction of the cluster is 57 +/- 5% and that the indices for the power law distributions, describing the log of the periods, mass

  5. Minimal theory of massive gravity

    CERN Document Server

    De Felice, Antonio

    2016-01-01

    We propose a new theory of massive gravity with only two propagating degrees of freedom. After defining the theory in the unitary gauge in the vielbein language, we shall perform a Hamiltonian analysis to count the number of physical degrees of freedom, and then study some phenomenologies. While the homogeneous and isotropic background cosmology and the tensor linear perturbations around it are described by exactly the same equations as those in the de Rham - Gabadadze - Tolley (dRGT) massive gravity, the scalar and vector gravitational degrees of freedom are absent in the new theory at the fully nonlinear level. Hence the new theory provides a stable nonlinear completion of the self-accelerating cosmological solution that was originally found in the dRGT theory.

  6. Formation of Massive Stars: Theoretical Considerations

    Science.gov (United States)

    Yorke, Harold W.

    2008-01-01

    This slide presentation reviews theoretical considerations of the formation of massive stars. It addresses the questions that assuming a gravitationally unstable massive clump, how does enough material become concentrated into a sufficiently small volume within a sufficiently short time? and how does the forming massive star influence its immediate surroundings to limit its mass?

  7. Theoretical Considerations of Massive Star Formation

    Science.gov (United States)

    Yorke, Harold W.

    2006-01-01

    This viewgraph presentation reviews the formation of massive stars. The formation of massive stars is different in many ways from the formation of other stars. The presentation shows the math, and the mechanisms that must be possible for a massive star to form.

  8. Massive gravity on a brane

    Energy Technology Data Exchange (ETDEWEB)

    Chacko, Z.; Graesser, M.L.; Grojean, C.; Pilo, L.

    2003-12-11

    At present no theory of a massive graviton is known that is consistent with experiments at both long and short distances. The problem is that consistency with long distance experiments requires the graviton mass to be very small. Such a small graviton mass however implies an ultraviolet cutoff for the theory at length scales far larger than the millimeter scale at which gravity has already been measured. In this paper we attempt to construct a model which avoids this problem. We consider a brane world setup in warped AdS spacetime and we investigate the consequences of writing a mass term for the graviton on a the infrared brane where the local cutoff is of order a large (galactic) distance scale. The advantage of this setup is that the low cutoff for physics on the infrared brane does not significantly affect the predictivity of the theory for observers localized on the ultraviolet brane. For such observers the predictions of this theory agree with general relativity at distances smaller than the infrared scale but go over to those of a theory of massive gravity at longer distances. A careful analysis of the graviton two-point function, however, reveals the presence of a ghost in the low energy spectrum. A mode decomposition of the higher dimensional theory reveals that the ghost corresponds to the radion field. We also investigate the theory with a brane localized mass for the graviton on the ultraviolet brane, and show that the physics of this case is similar to that of a conventional four dimensional theory with a massive graviton, but with one important difference: when the infrared brane decouples and the would-be massive graviton gets heavier than the regular Kaluza-Klein modes, it becomes unstable and it has a finite width to decay off the brane into the continuum of Kaluza-Klein states.

  9. Massive star clusters in galaxies

    CERN Document Server

    Harris, William E

    2009-01-01

    The ensemble of all star clusters in a galaxy constitutes its star cluster system. In this review, the focus of the discussion is on the ability of star clusters, particularly the systems of old massive globular clusters (GCSs), to mark the early evolutionary history of galaxies. I review current themes and key findings in GCS research, and highlight some of the outstanding questions that are emerging from recent work.

  10. The Massive Thermal Basketball Diagram

    CERN Document Server

    Andersen, J O; Strickland, Michael T; Andersen, Jens O.; Braaten, Eric; Strickland, Michael

    2000-01-01

    The "basketball diagram" is a three-loop vacuum diagram for a scalar fieldtheory that cannot be expressed in terms of one-loop diagrams. We calculatethis diagram for a massive scalar field at nonzero temperature, reducing it toexpressions involving three-dimensional integrals that can be easily evaluatednumerically. We use this result to calculate the free energy for a massivescalar field with a phi^4 interaction to three-loop order.

  11. The Nature of Massive Neutrinos

    Directory of Open Access Journals (Sweden)

    S. T. Petcov

    2013-01-01

    massive Majorana neutrinos are summarised. The physics potential of the experiments, searching for ( β β 0 ν -decay for providing information on the type of the neutrino mass spectrum, on the absolute scale of neutrino masses, and on the Majorana CP-violation phases in the PMNS neutrino mixing matrix, is also briefly discussed. The opened questions and the main goals of future research in the field of neutrino physics are outlined.

  12. Causality in 3D Massive Gravity Theories

    CERN Document Server

    Edelstein, Jose D; Kilicarslan, Ercan; Leoni, Matias; Tekin, Bayram

    2016-01-01

    We study the constraints coming from local causality requirement in various 2+1 dimensional dynamical theories of gravity. In Topologically Massive Gravity, with a single parity noninvariant massive degree of freedom, and in New Massive Gravity, with two massive spin-$2$ degrees of freedom, causality and unitarity are compatible with each other and they both require the Newton's constant to be negative. In their extensions, such as the Born-Infeld gravity and the minimal massive gravity the situation is similar and quite different from their higher dimensional counterparts, such as quadratic (e.g., Einstein-Gauss-Bonnet) or cubic theories, where causality and unitarity are in conflict.

  13. Protecting Yourself from Computer Data Loss.

    Science.gov (United States)

    Saye, Lee

    1997-01-01

    Schools can protect themselves against massive loss of computer data by taking action. Lists steps to plan a disaster recovery program, focus efforts to install it, and see that all bases are covered when it is in place. (MLF)

  14. Massive Pellet and Rupture Disk Testing for Disruption Mitigation Applications

    Energy Technology Data Exchange (ETDEWEB)

    Combs, Stephen Kirk [ORNL; Meitner, Steven J [ORNL; Baylor, Larry R [ORNL; Caughman, John B [ORNL; Commaux, Nicolas JC [ORNL; Fehling, Dan T [ORNL; Foust, Charles R [ORNL; Jernigan, Thomas C [ORNL; McGill, James M [ORNL; Parks, P. B. [General Atomics; Rasmussen, David A [ORNL

    2009-01-01

    Injection of massive quantities of noble gases or D2 has proven to be effective at mitigating some of the deleterious effects of disruptions in tokamaks. Two alternative methods that might offer some advantages over the present technique for massive gas injection are shattering massive pellets and employing close-coupled rupture disks. Laboratory testing has been carried out to evaluate their feasibility. For the study of massive pellets, a pipe gun pellet injector cooled with a cryogenic refrigerator was fitted with a relatively large barrel (16.5 mm bore), and D2 and Ne pellets were made and were accelerated to speeds of ~600 and 300 m/s, respectively. Based on the successful proof-of-principle testing with the injector and a special double-impact target to shatter pellets, a similar system has been prepared and installed on DIII-D and should be ready for experiments later this year. To study the applicability of rupture disks for disruption mitigation, a simple test apparatus was assembled in the lab. Commercially available rupture disks of 1 in. nominal diameter were tested at conditions relevant for the application on tokamaks, including tests with Ar and He gases and rupture pressures of ~54 bar. Some technical and practical issues of implementing this technique on a tokamak are discussed.

  15. STABLE ISOTOPE GEOCHEMISTRY OF MASSIVE ICE

    Directory of Open Access Journals (Sweden)

    Yurij K. Vasil’chuk

    2016-01-01

    Full Text Available The paper summarises stable-isotope research on massive ice in the Russian and North American Arctic, and includes the latest understanding of massive-ice formation. A new classification of massive-ice complexes is proposed, encompassing the range and variabilityof massive ice. It distinguishes two new categories of massive-ice complexes: homogeneousmassive-ice complexes have a similar structure, properties and genesis throughout, whereasheterogeneous massive-ice complexes vary spatially (in their structure and properties andgenetically within a locality and consist of two or more homogeneous massive-ice bodies.Analysis of pollen and spores in massive ice from Subarctic regions and from ice and snow cover of Arctic ice caps assists with interpretation of the origin of massive ice. Radiocarbon ages of massive ice and host sediments are considered together with isotope values of heavy oxygen and deuterium from massive ice plotted at a uniform scale in order to assist interpretation and correlation of the ice.

  16. Kinetic evaluation of highly active supported gold catalysts prepared from monolayer-protected clusters: an experimental Michaelis-Menten approach for determining the oxygen binding constant during CO oxidation catalysis.

    Science.gov (United States)

    Long, Cormac G; Gilbertson, John D; Vijayaraghavan, Ganesh; Stevenson, Keith J; Pursell, Christopher J; Chandler, Bert D

    2008-08-06

    Thiol monolayer-protected Au clusters (MPCs) were prepared using dendrimer templates, deposited onto a high-surface-area titania, and then the thiol stabilizers were removed under H2/N2. The resulting Au catalysts were characterized with transmission electron microscopy, X-ray photoelectron spectroscopy, and infrared spectroscopy of adsorbed CO. The Au catalysts prepared via this route displayed minimal particle agglomeration during the deposition and activation steps. Structural data obtained from the physical characterization of the Au catalysts were comparable to features exhibited from a traditionally prepared standard Au catalyst obtained from the World Gold Council (WGC). A differential kinetic study of CO oxidation catalysis by the MPC-prepared Au and the standard WGC catalyst showed that these two catalyst systems have essentially the same reaction order and Arrhenius apparent activation energies (28 kJ/mol). However, the MPC-prepared Au catalyst shows 50% greater activity for CO oxidation. Using a Michaelis-Menten approach, the oxygen binding constants for the two catalyst systems were determined and found to be essentially the same within experimental error. To our knowledge, this kinetic evaluation is the first experimental determination of oxygen binding by supported Au nanoparticle catalysts under working conditions. The values for the oxygen binding equilibrium constant obtained from the Michaelis-Menten treatment (ca. 29-39) are consistent with ultra-high-vacuum measurements on model catalyst systems and support density functional theory calculations for oxygen binding at corner or edge atoms on Au nanoparticles and clusters.

  17. Core-shell hybrid liposomal vesicles loaded with panax notoginsenoside: preparation, characterization and protective effects on global cerebral ischemia/reperfusion injury and acute myocardial ischemia in rats

    OpenAIRE

    Zhang J.; Han XZ; Li X.; Luo Y; Zhao HP; Yang M.; Ni B; Liao ZG

    2012-01-01

    Jing Zhang,1,* Xizhen Han,1,* Xiang Li,2 Yun Luo,1 Haiping Zhao,1 Ming Yang,1 Bin Ni,1 Zhenggen Liao11Key Laboratory of Modern Preparation of TCM, Ministry of Education, 2National Pharmaceutical Engineering Center for Solid Preparation in Chinese Herbal Medicine, Jiangxi University of Traditional Chinese Medicine, Nanchang, People's Republic of China*These authors contributed equally to this workPurpose: Novel panax notoginsenoside-loaded core-shell hybrid liposomal vesicles (PNS-HLV)...

  18. Cosmological perturbations in massive bigravity

    Energy Technology Data Exchange (ETDEWEB)

    Lagos, Macarena; Ferreira, Pedro G., E-mail: m.lagos13@imperial.ac.uk, E-mail: p.ferreira1@physics.ox.ac.uk [Astrophysics, University of Oxford, DWB, Keble road, Oxford OX1 3RH (United Kingdom)

    2014-12-01

    We present a comprehensive analysis of classical scalar, vector and tensor cosmological perturbations in ghost-free massive bigravity. In particular, we find the full evolution equations and analytical solutions in a wide range of regimes. We show that there are viable cosmological backgrounds but, as has been found in the literature, these models generally have exponential instabilities in linear perturbation theory. However, it is possible to find stable scalar cosmological perturbations for a very particular choice of parameters. For this stable subclass of models we find that vector and tensor perturbations have growing solutions. We argue that special initial conditions are needed for tensor modes in order to have a viable model.

  19. Massive hiatal hernia in children.

    Science.gov (United States)

    al-Arfaj, A L; Khwaja, M S; Upadhyaya, P

    1991-08-01

    Ten children had massive hiatal hernias repaired between January 1982 and February 1991. Their clinical presentation, association with other congenital abnormalities, and postoperative complications were different from those seen in adults. Vomiting (n = 7) and anaemia (n = 7) were the most common symptoms, followed by respiratory distress (n = 5), cough (n = 3), and regurgitation (n = 3). Abdominal pain was uncommon. The clinical diagnosis was confirmed in seven cases by barium meal examination. The most common operation was Nissen's fundoplication (n = 7); the hiatus alone was repaired in the remainder. Five patients developed postoperative complications and two died probably as a result of delay in diagnosis and associated malformations.

  20. Radio observations of massive stars

    CERN Document Server

    Blomme, Ronny

    2011-01-01

    Detectable radio emission occurs during almost all phases of massive star evolution. I will concentrate on the thermal and non-thermal continuum emission from early-type stars. The thermal radio emission is due to free-free interactions in the ionized stellar wind material. Early ideas that this would lead to an easy and straightforward way of measuring the mass-loss rates were thwarted by the presence of clumping in the stellar wind. Multi-wavelength observations provide important constraints on this clumping, but do not allow its full determination. Non-thermal radio emission is associated with binarity. This conclusion was already known for some time for Wolf-Rayet stars and in recent years it has become clear that it is also true for O-type stars. In a massive-star binary, the two stellar winds collide and around the shocks a fraction of the electrons are accelerated to relativistic speeds. Spiralling in the magnetic field these electrons emit synchrotron radiation, which we detect as non-thermal radio em...

  1. Solid Holography and Massive Gravity

    CERN Document Server

    Alberte, Lasma; Khmelnitsky, Andrei; Pujolas, Oriol

    2015-01-01

    Momentum dissipation is an important ingredient in condensed matter physics that requires a translation breaking sector. In the bottom-up gauge/gravity duality, this implies that the gravity dual is massive. We start here a systematic analysis of holographic massive gravity (HMG) theories, which admit field theory dual interpretations and which, therefore, might store interesting condensed matter applications. We show that there are many phases of HMG that are fully consistent effective field theories and which have been left overlooked in the literature. The most important distinction between the different HMG phases is that they can be clearly separated into solids and fluids. This can be done both at the level of the unbroken spacetime symmetries as well as concerning the elastic properties of the dual materials. We extract the modulus of rigidity of the solid HMG black brane solutions and show how it relates to the graviton mass term. We also consider the implications of the different HMGs on the electric...

  2. Filter Bank Multicarrier for Massive MIMO

    OpenAIRE

    Farhang, Arman,; Marchetti, Nicola; Doyle, Linda E.; Farhang-Boroujeny, Behrouz

    2014-01-01

    This paper introduces filter bank multicarrier (FBMC) as a potential candidate in the application of massive MIMO communication. It also points out the advantages of FBMC over OFDM (orthogonal frequency division multiplexing) in the application of massive MIMO. The absence of cyclic prefix in FBMC increases the bandwidth efficiency. In addition, FBMC allows carrier aggregation straightforwardly. Self-equalization, a property of FBMC in massive MIMO that is introduced in this paper, has the im...

  3. Massive Gravity with N=1 local Supersymmetry

    CERN Document Server

    Malaeb, Ola

    2013-01-01

    A consistent theory of massive gravity, where the graviton acquires mass by spontaneously breaking diffeomorphism invariance, is now well established. We supersymmetrize this construction using N =1 fields. Coupling to N = 1 supergravity is done by applying the rules of tensor calculus to construct an action invariant under local N = 1 supersymmetry. The supersymmetric action is shown, at the quadratic level, to be free of ghosts and have as its spectrum a massive graviton, two gravitinos with different masses, and a massive vector.

  4. On the singularities of massive superstring amplitudes

    Energy Technology Data Exchange (ETDEWEB)

    Foda, O.

    1987-06-04

    Superstring one-loop amplitudes with massive external states are shown to be in general ill-defined due to internal on-shell propagators. However, we argue that since any massive string state (in the uncompactified theory) has a finite lifetime to decay into massless particles, such amplitudes are not terms in the perturbative expansion of physical S-matrix elements: These can be defined only with massless external states. Consistent massive amplitudes repuire an off-shell formalism.

  5. Massive production of nanoparticles via mist reaction

    Science.gov (United States)

    Liu, Ran; Liu, Lei; Liu, Jing

    2009-06-01

    A novel conceptual nanoparticle fabrication method is proposed in this paper. It can be easily implemented for the preparation of micro or nanoparticles through a reaction between mists with different specific chemical compounds produced by ultrasonic atomization technology. Ultrasonic atomization is an established technology that easily atomizes liquid to produce very small droplets-in the orders of tens to hundreds of micrometers. The results reveal that metal oxide nanoparticles, such as iron oxide can be massively produced via reactions between metal chlorides and sodium carbonate in an experimental set-up based on physical and chemical principles. The density of the nanoparticle distribution is also investigated and determined to be dependent on the amount of mist reacted and the collection time. Moreover, since the vibrational frequency of ultrasound can be adjusted, we can control the size of micro-droplets of reactants, hence producing particles of different dimensions. Given that the double mist reaction method is easily controllable, environmentally friendly and extremely low in cost, it can potentially become a significant method for making micro/nano particles in the newly emerging field of nanofabrication and integration.

  6. MASSIVE HYBRID PARALLELISM FOR FULLY IMPLICIT MULTIPHYSICS

    Energy Technology Data Exchange (ETDEWEB)

    Cody J. Permann; David Andrs; John W. Peterson; Derek R. Gaston

    2013-05-01

    As hardware advances continue to modify the supercomputing landscape, traditional scientific software development practices will become more outdated, ineffective, and inefficient. The process of rewriting/retooling existing software for new architectures is a Sisyphean task, and results in substantial hours of development time, effort, and money. Software libraries which provide an abstraction of the resources provided by such architectures are therefore essential if the computational engineering and science communities are to continue to flourish in this modern computing environment. The Multiphysics Object Oriented Simulation Environment (MOOSE) framework enables complex multiphysics analysis tools to be built rapidly by scientists, engineers, and domain specialists, while also allowing them to both take advantage of current HPC architectures, and efficiently prepare for future supercomputer designs. MOOSE employs a hybrid shared-memory and distributed-memory parallel model and provides a complete and consistent interface for creating multiphysics analysis tools. In this paper, a brief discussion of the mathematical algorithms underlying the framework and the internal object-oriented hybrid parallel design are given. Representative massively parallel results from several applications areas are presented, and a brief discussion of future areas of research for the framework are provided.

  7. Rotation and massive close binary evolution

    CERN Document Server

    Langer, N; Yoon, S -C; Hunter, I; Brott, I; Lennon, D J; de Mink, S E; Verheijdt, M

    2008-01-01

    We review the role of rotation in massive close binary systems. Rotation has been advocated as an essential ingredient in massive single star models. However, rotation clearly is most important in massive binaries where one star accretes matter from a close companion, as the resulting spin-up drives the accretor towards critical rotation. Here, we explore our understanding of this process, and its observable consequences. When accounting for these consequences, the question remains whether rotational effects in massive single stars are still needed to explain the observations.

  8. Megaloblastic anemia presenting with massive reversible splenomegaly.

    Science.gov (United States)

    Behera, Vineet; Randive, Makarand; Sharma, Praveen; Nair, Velu

    2015-06-01

    Megaloblastic anemia (MA) is a common disorder with varied manifestations. It generally results in mild to moderate splenomegaly which is due to sequestration of macrocytic erythrocytes in spleen. Massive splenomegaly is generally seen in infections, myeloproliferative diseases, neoplasms, storage disorders or hematological conditions; but is not heard of and has rarely been reported in MA. We discuss a case of massive splenomegaly who presented with symptomatic anemia and was found to have MA. He was extensive evaluated for all other causes of massive splenomegaly which was normal. Further, after a therapeutic trial of MA he showed a regression in spleen size confirming that the massive splenomegaly was attributable to MA.

  9. Increased Understanding of Accretion in Massive YSOs

    Science.gov (United States)

    De Wit, Willem-Jan; Caratti, A.; Kraus, S.

    2017-06-01

    That massive stars up to 20Msol form by disk accretion is by now reasonably well established. We will present the latest observational results for the formation of single and multiple massive YSOs. By means of optical interferometry using the newly commissioned instrument Gravity at the VLT-I, we show the discovery of a young, embedded, 170AU-wide binary and is the most massive and most compact accreting young binary to date. We will also present the results of a multi-site multi-epoch follow-up campaign of the first well studied accretion outburst in a massive YSO.

  10. MASSIVE STAR FORMATION IN THE MAGELLANIC CLOUDS

    Directory of Open Access Journals (Sweden)

    M. Rubio

    2009-01-01

    Full Text Available Multiwavelenghts studies of massive star formation regions in the LMC and SMC reveal that a second generation of stars is being formed in dense molecular clouds located in the surroundings of the massive clusters. These dense molecular clouds have survive the action of massive star UV radiation elds and winds and they appear as compact dense H2 knots in regions of weak CO emission. We present results of observations obtained towards massive star forming regions in the low metallicity molecular clouds in the Magellanic Clouds and investigate its implication on star formation in the early universe.

  11. 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides.

    Science.gov (United States)

    Marchán, Vicente; Cieślak, Jacek; Livengood, Victor; Beaucage, Serge L

    2004-08-11

    Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.

  12. Massive Parallel Quantum Computer Simulator

    CERN Document Server

    De Raedt, K; De Raedt, H; Ito, N; Lippert, T; Michielsen, K; Richter, M; Trieu, B; Watanabe, H; Lippert, Th.

    2006-01-01

    We describe portable software to simulate universal quantum computers on massive parallel computers. We illustrate the use of the simulation software by running various quantum algorithms on different computer architectures, such as a IBM BlueGene/L, a IBM Regatta p690+, a Hitachi SR11000/J1, a Cray X1E, a SGI Altix 3700 and clusters of PCs running Windows XP. We study the performance of the software by simulating quantum computers containing up to 36 qubits, using up to 4096 processors and up to 1 TB of memory. Our results demonstrate that the simulator exhibits nearly ideal scaling as a function of the number of processors and suggest that the simulation software described in this paper may also serve as benchmark for testing high-end parallel computers.

  13. Massive Variability Surveys from Venezuela

    CERN Document Server

    Briceño, C

    2003-01-01

    At the Venezuela National Astronomical Observatory we are carrying out variability surveys spanning many hundreds of square degrees near the celestial equator, using an 8k x 8k CCD Mosaic Camera optimized for drift-scanning on a 1m Schmidt telescope. Among the initial efforts was a project to obtain the first moderately deep, homogeneous sample of young stars over an area of ~180sqr.deg. encompassing the entire Orion OB1 association, one of the nearest and most active regions of star formation. The results show that variability is a powerful technique to identify pre-main sequence populations, specially in sparse areas devoid of gas and dust. We are currently developing a massive database, equipped with web-based data mining tools, that will make our data and results available to the astronomical community.

  14. Stable massive particles at colliders

    Energy Technology Data Exchange (ETDEWEB)

    Fairbairn, M.; /Stockholm U.; Kraan, A.C.; /Pennsylvania U.; Milstead, D.A.; /Stockholm U.; Sjostrand, T.; /Lund U.; Skands, P.; /Fermilab; Sloan, T.; /Lancaster U.

    2006-11-01

    We review the theoretical motivations and experimental status of searches for stable massive particles (SMPs) which could be sufficiently long-lived as to be directly detected at collider experiments. The discovery of such particles would address a number of important questions in modern physics including the origin and composition of dark matter in the universe and the unification of the fundamental forces. This review describes the techniques used in SMP-searches at collider experiments and the limits so far obtained on the production of SMPs which possess various colour, electric and magnetic charge quantum numbers. We also describe theoretical scenarios which predict SMPs, the phenomenology needed to model their production at colliders and interactions with matter. In addition, the interplay between collider searches and open questions in cosmology such as dark matter composition are addressed.

  15. Mixing in massive stellar mergers

    CERN Document Server

    Gaburov, E; Zwart, S Portegies

    2007-01-01

    The early evolution of dense star clusters is possibly dominated by close interactions between stars, and physical collisions between stars may occur quite frequently. Simulating a stellar collision event can be an intensive numerical task, as detailed calculations of this process require hydrodynamic simulations in three dimensions. We present a computationally inexpensive method in which we approximate the merger process, including shock heating, hydrodynamic mixing and mass loss, with a simple algorithm which is based on conservation laws and a basic qualitative understanding of the hydrodynamics of stellar mergers. The algorithm is based on Archimedes' principle, which dictates the distribution of the fluid in stable equilibrium situation. We calibrate and apply the method to mergers of massive stars, as these are expected to occur in young and dense star clusters. We find that mergers between spectral type B stars ($\\sim$10\\msun) result in substantial mixing, whereas mergers between stars of different sp...

  16. Derivative couplings in massive bigravity

    CERN Document Server

    Gao, Xian

    2016-01-01

    In this work we study the cosmological perturbations in massive bigravity in the presence of non-minimal derivative couplings. For this purpose we consider a specific subclass of Horndeski scalar-tensor interactions that live on the unique composite effective metric. For the viability of the model both metrics have to be dynamical. Nevertheless, the number of allowed kinetic terms is crucial. We adapt to the restriction of having one single kinetic term. After deriving the full set of equations of motion for flat Friedmann-Lemaitre-Robertson-Walker background, we study linear perturbations on top of it. We show explicitly that only four tensor, two vector and two scalar degrees of freedom propagate, one of which being the Horndeski scalar, while the Boulware-Deser ghost can be integrated out.

  17. Derivative couplings in massive bigravity

    Science.gov (United States)

    Gao, Xian; Heisenberg, Lavinia

    2016-03-01

    In this work we study the cosmological perturbations in massive bigravity in the presence of non-minimal derivative couplings. For this purpose we consider a specific subclass of Horndeski scalar-tensor interactions that live on the unique composite effective metric. For the viability of the model both metrics have to be dynamical. Nevertheless, the number of allowed kinetic terms is crucial. We adapt to the restriction of having one single kinetic term. After deriving the full set of equations of motion for flat Friedmann-Lemaitre-Robertson-Walker background, we study linear perturbations on top of it. We show explicitly that only four tensor, two vector and two scalar degrees of freedom propagate, one of which being the Horndeski scalar, while the Boulware-Deser ghost can be integrated out.

  18. C++ and Massively Parallel Computers

    Directory of Open Access Journals (Sweden)

    Daniel J. Lickly

    1993-01-01

    Full Text Available Our goal is to apply the software engineering advantages of object-oriented programming to the raw power of massively parallel architectures. To do this we have constructed a hierarchy of C++ classes to support the data-parallel paradigm. Feasibility studies and initial coding can be supported by any serial machine that has a C++ compiler. Parallel execution requires an extended Cfront, which understands the data-parallel classes and generates C* code. (C* is a data-parallel superset of ANSI C developed by Thinking Machines Corporation. This approach provides potential portability across parallel architectures and leverages the existing compiler technology for translating data-parallel programs onto both SIMD and MIMD hardware.

  19. Massive Black Holes and Galaxies

    CERN Document Server

    CERN. Geneva

    2016-01-01

    Evidence has been accumulating for several decades that many galaxies harbor central mass concentrations that may be in the form of black holes with masses between a few million to a few billion time the mass of the Sun. I will discuss measurements over the last two decades, employing adaptive optics imaging and spectroscopy on large ground-based telescopes that prove the existence of such a massive black hole in the Center of our Milky Way, beyond any reasonable doubt. These data also provide key insights into its properties and environment. Most recently, a tidally disrupting cloud of gas has been discovered on an almost radial orbit that reached its peri-distance of ~2000 Schwarzschild radii in 2014, promising to be a valuable tool for exploring the innermost accretion zone. Future interferometric studies of the Galactic Center Black hole promise to be able to test gravity in its strong field limit.

  20. Cosmological attractors in massive gravity

    CERN Document Server

    Dubovsky, S; Tkachev, I I

    2005-01-01

    We study Lorentz-violating models of massive gravity which preserve rotations and are invariant under time-dependent shifts of the spatial coordinates. In the linear approximation the Newtonian potential in these models has an extra ``confining'' term proportional to the distance from the source. We argue that during cosmological expansion the Universe may be driven to an attractor point with larger symmetry which includes particular simultaneous dilatations of time and space coordinates. The confining term in the potential vanishes as one approaches the attractor. In the vicinity of the attractor the extra contribution is present in the Friedmann equation which, in a certain range of parameters, gives rise to the cosmic acceleration.

  1. How I treat patients with massive hemorrhage

    DEFF Research Database (Denmark)

    Johansson, Pär I; Stensballe, Jakob; Oliveri, Roberto

    2014-01-01

    Massive hemorrhage is associated with coagulopathy and high mortality. The transfusion guidelines up to 2006 recommended that resuscitation of massive hemorrhage should occur in successive steps using crystalloids, colloids and red blood cells (RBC) in the early phase, and plasma and platelets in...

  2. Stefan-Boltzmann law for massive photons

    CERN Document Server

    Moreira, E S

    2015-01-01

    Thirty years ago a paper appeared in the literature generalizing the Stefan-Boltzmann law to include massive photons. The paper suffers from a flaw though: it assumes that a massive photon travels at the speed of (massless) light. The present work fixes the mistake and presents the correct formula for the radiance.

  3. Stefan-Boltzmann Law for Massive Photons

    Science.gov (United States)

    Moreira, E. S.; Ribeiro, T. G.

    2016-08-01

    This paper generalizes the Stefan-Boltzmann law to include massive photons. A crucial ingredient to obtain the correct formula for the radiance is to realize that a massive photon does not travel at the speed of (massless) light. It follows that, contrary to what could be expected, the radiance is not proportional to the energy density times the speed of light.

  4. Mass Loss and Evolution of Massive Stars

    NARCIS (Netherlands)

    Lamers, H.J.G.L.M.

    2013-01-01

    I discuss the early observations and the discovery of stellar winds from massive stars, including the development of wind theories, the effects of mass loss on stellar evolution, the role of rotation and the evolutionary connection between different types of massive stars. Because of the special

  5. The massive Kaluza-Klein monopole

    NARCIS (Netherlands)

    Bergshoeff, E; Eyras, E; Lozano, Y

    1998-01-01

    We construct the (bosonic) effective worldvolume action of an M-theory Kaluza-Klein monopole in a background given by the bosonic sector of eleven-dimensional massive supergravity, i.e, a "massive Kaluza-Klein monopole". As a consistency check we show that the direct dimensional reduction along the

  6. 10 billion years of massive Galaxies

    NARCIS (Netherlands)

    Taylor, Edward Nairne Cunningham

    2009-01-01

    The most massive galaxies in the local universe are not forming new stars -- but we don’t know why. As a step towards figuring out why big galaxies stop forming stars, we set out to measure when they stop forming stars. By looking at the colors of massive galaxies have changed over 10 billion year

  7. On the singularities of massive superstring amplitudes

    NARCIS (Netherlands)

    Foda, O.

    1987-01-01

    Superstring one-loop amplitudes with massive external states are shown to be in general ill-defined due to internal on-shell propagators. However, we argue that since any massive string state (in the uncompactified theory) has a finite lifetime to decay into massless particles, such amplitudes are n

  8. On the singularities of massive superstring amplitudes

    NARCIS (Netherlands)

    Foda, O.

    1987-01-01

    Superstring one-loop amplitudes with massive external states are shown to be in general ill-defined due to internal on-shell propagators. However, we argue that since any massive string state (in the uncompactified theory) has a finite lifetime to decay into massless particles, such amplitudes are

  9. Preparation and Performance Test of Environmental Protection Noise Reduction Coatings Used for Ship%船舶用环保降噪声涂料的制备及性能测试

    Institute of Scientific and Technical Information of China (English)

    王颖; 周春艳; 刘华荣

    2013-01-01

      以丙烯酸酯改性聚氨酯为基体,通过加入空心玻璃泡、聚丙烯短切玻璃纤维、纳米丙烯酸酯橡胶粉末和乳液共混的方法制备了新型船舶用环保降噪声涂料,并对该涂料的性能进行了分析测试。结果表明,应用该基体得到的复合降噪声涂料的降噪性能、黏接强度、耐水性能、阻燃性能、环保性能均可满足设计要求。%New type of environmental protection and noise reduction coatings used for ship were prepared by using acrylate modified polyurethane as matrix, hollow glass bubble, chopped glass polyacrylates fiber and polyacrylates were blended with emulsion, and the properties of this coating were analyzed and tested. The results show that the noise reduction performance, adhesive strength, water resistance, flame resistance performance and environmental protection performance of the composite noise reduction coatings which prepared by this matrix can meet the design requirements.

  10. XFEM for Thermal Crack of Massive Concrete

    Directory of Open Access Journals (Sweden)

    Guowei Liu

    2013-01-01

    Full Text Available Thermal cracking of massive concrete structures occurs as a result of stresses caused by hydration in real environment conditions. The extended finite element method that combines thermal fields and creep is used in this study to analyze the thermal cracking of massive concrete structures. The temperature field is accurately simulated through an equivalent equation of heat conduction that considers the effect of a cooling pipe system. The time-dependent creep behavior of massive concrete is determined by the viscoelastic constitutive model with Prony series. Based on the degree of hydration, we consider the main properties related to cracking evolving with time. Numerical simulations of a real massive concrete structure are conducted. Results show that the developed method is efficient for numerical calculations of thermal cracks on massive concrete. Further analyses indicate that a cooling system and appropriate heat preservation measures can efficiently prevent the occurrence of thermal cracks.

  11. Massive Star Formation: The Power of Interferometry

    CERN Document Server

    Beuther, Henrik

    2007-01-01

    This article presents recent work to constrain the physical and chemical properties in high-mass star formation based largely on interferometric high-spatial-resolution continuum and spectral line studies at (sub)mm wavelengths. After outlining the concepts, potential observational tests, a proposed evolutionary sequence and different possible definitions for massive protostars, four particular topics are highlighted: (a) What are the physical conditions at the onset of massive star formation? (b) What are the characteristics of potential massive accretion disks and what do they tell us about massive star formation in general? (c) How do massive clumps fragment, and what does it imply to high-mass star formation? (d) What do we learn from imaging spectral line surveys with respect to the chemistry itself as well as for utilizing molecules as tools for astrophysical investigations?

  12. Massive MIMO Wireless Networks: An Overview

    Directory of Open Access Journals (Sweden)

    Noha Hassan

    2017-09-01

    Full Text Available Massive multiple-input-multiple-output (MIMO systems use few hundred antennas to simultaneously serve large number of wireless broadband terminals. It has been incorporated into standards like long term evolution (LTE and IEEE802.11 (Wi-Fi. Basically, the more the antennas, the better shall be the performance. Massive MIMO systems envision accurate beamforming and decoding with simpler and possibly linear algorithms. However, efficient signal processing techniques have to be used at both ends to overcome the signaling overhead complexity. There are few fundamental issues about massive MIMO networks that need to be better understood before their successful deployment. In this paper, we present a detailed review of massive MIMO homogeneous, and heterogeneous systems, highlighting key system components, pros, cons, and research directions. In addition, we emphasize the advantage of employing millimeter wave (mmWave frequency in the beamforming, and precoding operations in single, and multi-tier massive MIMO systems.

  13. A massively asynchronous, parallel brain

    Science.gov (United States)

    Zeki, Semir

    2015-01-01

    Whether the visual brain uses a parallel or a serial, hierarchical, strategy to process visual signals, the end result appears to be that different attributes of the visual scene are perceived asynchronously—with colour leading form (orientation) by 40 ms and direction of motion by about 80 ms. Whatever the neural root of this asynchrony, it creates a problem that has not been properly addressed, namely how visual attributes that are perceived asynchronously over brief time windows after stimulus onset are bound together in the longer term to give us a unified experience of the visual world, in which all attributes are apparently seen in perfect registration. In this review, I suggest that there is no central neural clock in the (visual) brain that synchronizes the activity of different processing systems. More likely, activity in each of the parallel processing-perceptual systems of the visual brain is reset independently, making of the brain a massively asynchronous organ, just like the new generation of more efficient computers promise to be. Given the asynchronous operations of the brain, it is likely that the results of activities in the different processing-perceptual systems are not bound by physiological interactions between cells in the specialized visual areas, but post-perceptually, outside the visual brain. PMID:25823871

  14. Nanoemulsions containing octyl methoxycinnamate and solid particles of TiO₂: preparation, characterization and in vitro evaluation of the solar protection factor.

    Science.gov (United States)

    Silva, Flavia F F; Ricci-Júnior, Eduardo; Mansur, Claudia R E

    2013-09-01

    The objective of this work was to develop and evaluate the physical-chemical properties of oil-in-water nanoemulsions for application as nanocosmetics for sun protection. Oil-in-water dispersions were processed by ultrasound (US) to obtain small emulsion droplets. These emulsions were obtained in the presence of commercial nonionic surfactants based on polyoxides and avocado oil as the oil phase. The US generated small but unstable droplets. This problem was solved by using a different surfactant, with a longer ethylene oxide chain, able to promote stabilization by steric mechanisms. The light scattering technique was used to characterize the nanoemulsions by their dispersed droplets' size, size distribution and variation of distribution with time (stability). Chemical and physical sunscreens - octyl methoxycinnamate (OMC) and titanium dioxide (TiO₂), respectively - were added to the stable system. The anti-UVB activity of the nanoemulsions and their components were evaluated by the method of Mansur et al. (1986) and spectral transmittance. The solar protection factor (SPF) was proportional to the OMC and TiO₂ concentrations. The in vitro OMC release was evaluated, and the presence of TiO₂ in the nanoemulsion did not affect the release profile, which showed the diffusion-dependent kinetics of the active ingredient in the formulation.

  15. Snailase Preparation of Ginsenoside M1 from Protopanaxadiol-Type Ginsenoside and Their Protective Effects Against CCl4-Induced Chronic Hepatotoxicity in Mice

    Directory of Open Access Journals (Sweden)

    Li Chen

    2011-12-01

    Full Text Available To investigate the protective effects of protopanaxadiol-type ginsenoside (PDG and its metabolite ginsenoside M1 (G-M1 on carbon tetrachloride (CCl4-induced chronic liver injury in ICR mice, we carried out conversion of protopanaxadiol-type ginsenosides to ginsenoside M1 using snailase. The optimum time for the conversion was 24 h at a constant pH of 4.5 and an optimum temperature of 50 °C. The transformation products were identified by high-performance liquid chromatography and electrospray ion-mass spectrometry. Subsequently, most of PDG was decomposed and converted into G-M1 by 24 h post-reaction. During the study on hepatoprotective in a mice model of chronic liver injury, PDG or G-M1 supplement significantly ameliorated the CCl4-induced liver lesions, lowered the serum levels of select hepatic enzyme markers (alanine aminotransferase, ALT, and aspartate aminotransferase, AST and malondialdehyde and increased the activity of superoxide dismutase in liver. Histopathology of the liver tissues showed that PDG and G-M1 attenuated the hepatocellular necrosis and led to reduction of inflammatory cell infiltration. Therefore, the results of this study show that PDG and G-M1 can be proposed to protect the liver against CCl4-induced oxidative injury in mice, and the hepatoprotective effect might be attributed to amelioration of oxidative stress.

  16. Turmoil in Orion: The Nearest Massive Protostar

    CERN Document Server

    Tan, Jonathan C

    2008-01-01

    I discuss different theories of massive star formation: formation from massive cores, competitive Bondi-Hoyle accretion, and protostellar collisions. I summarize basic features of the Turbulent Core Model (TCM). I then introduce the Orion Kleinmann-Low (KL) region, embedded in the Orion Nebula Cluster (ONC) and one of the nearest regions of massive star formation. The KL region contains three principal radio sources, known as "I", "n" and "BN". BN is known to be a runaway star, almost certainly set in motion by dynamical ejection within the ONC from a multiple system of massive stars, that would leave behind a recoiling, hard, massive, probably eccentric binary. I review the debate about whether this binary is Theta^1C, the most massive star in the ONC, or source "I", and argue that it is most likely to be Theta^1C, since this is now known be a recoiling, hard, massive, eccentric binary, with properties that satisfy the energy and momentum constraints implied by BN's motion. Source "n" is a relatively low-mas...

  17. Using massive digital libraries a LITA guide

    CERN Document Server

    Weiss, Andrew

    2014-01-01

    Some have viewed the ascendance of the digital library as some kind of existential apocalypse, nothing less than the beginning of the end for the traditional library. But Weiss, recognizing the concept of the library as a ""big idea"" that has been implemented in many ways over thousands of years, is not so gloomy. In this thought-provoking and unabashedly optimistic book, he explores how massive digital libraries are already adapting to society's needs, and looks ahead to the massive digital libraries of tomorrow, coveringThe author's criteria for defining massive digital librariesA history o

  18. Geometric massive higher spins and current exchanges

    CERN Document Server

    Francia, Dario

    2008-01-01

    Generalised Fierz-Pauli mass terms allow to describe massive higher-spin fields on flat background by means of simple quadratic deformations of the corresponding geometric, massless Lagrangians. In this framework there is no need for auxiliary fields. We briefly review the construction in the bosonic case and study the interaction of these massive fields with external sources, computing the corresponding propagators. In the same fashion as for the massive graviton, but differently from theories where auxiliary fields are present, the structure of the current exchange is completely determined by the form of the mass term itself.

  19. Massive Star Formation: Accreting from Companion

    Indian Academy of Sciences (India)

    X. Chen; J. S. Zhang

    2014-09-01

    We report the possible accretion from companion in the massive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO are connected by the shock-excited 4.5 m emission, suggesting that the massive star may form through accreting material from the companion in this system.

  20. Morganella morganii sepsis with massive hemolysis.

    Science.gov (United States)

    Kim, Jong Hoon; Cho, Chong Rae; Um, Tae Hyun; Rhu, Ji Yoon; Kim, Eu Suk; Jeong, Jae Won; Lee, Hye Ran

    2007-12-01

    Morganella morganii is a facultative gram-negative and anaerobic rod. It may be a cause of devastating infections in neonates and immunocompromised hosts. Some bacterial infections such as Clostridium and Vibrio are associated with hemolysis. However, massive hemolysis caused by M. morganii sepsis has not yet been reported. We observed a 59-yr-old man who had chemotherapy-induced neutropenia and was found to have massive hemolysis and metabolic acidosis due to sepsis. He died 6 hr after admission in spite of aggressive treatment. Two sets of blood cultures revealed the growth of M. morganii. We report here that M. morganii sepsis can cause fatal massive hemolysis leading to death.

  1. Development of functional foods for radiation workers - In vivo test on the effect of functional food for stem cell protection and preparing the provisional product

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Ho; Oh, Heon; Kim, Se Ra; Lee, Song Eun [Chonnam National University, Kwangju (Korea)

    2000-04-01

    We performed this study to determine (1) the effect of several oriental prescriptions as energy tonic (Chinese medical concept : Bu-Qi) or blood building (Chinese medical concept : Bu-Xie) decoction and its major ingredients, (2) the biological stability of irradiated Chinese medical prescriptions, and (3) the effect of several proposed prescriptions and its fractions on jejunal crypt survival (12 Gy), endogenous spleen colony formation(6.5 Gy), and apoptosis(2 Gy) in jejunal crypt cells of mice irradiated with high and low dose of gamma-irradiation. For the study of evaluation on the radioprotective effects of effective prescriptions, we tried the test on change of survival and hematological changes and finally we prepared the provisional product. 57 refs., 5 figs., 38 tabs. (Author)

  2. Massive Black Hole Binary Evolution

    Directory of Open Access Journals (Sweden)

    Merritt David

    2005-11-01

    Full Text Available Coalescence of binary supermassive black holes (SBHs would constitute the strongest sources of gravitational waves to be observed by LISA. While the formation of binary SBHs during galaxy mergers is almost inevitable, coalescence requires that the separation between binary components first drop by a few orders of magnitude, due presumably to interaction of the binary with stars and gas in a galactic nucleus. This article reviews the observational evidence for binary SBHs and discusses how they would evolve. No completely convincing case of a bound, binary SBH has yet been found, although a handful of systems (e.g. interacting galaxies; remnants of galaxy mergers are now believed to contain two SBHs at projected separations of <~ 1kpc. N-body studies of binary evolution in gas-free galaxies have reached large enough particle numbers to reproduce the slow, “diffusive” refilling of the binary’s loss cone that is believed to characterize binary evolution in real galactic nuclei. While some of the results of these simulations - e.g. the binary hardening rate and eccentricity evolution - are strongly N-dependent, others - e.g. the “damage” inflicted by the binary on the nucleus - are not. Luminous early-type galaxies often exhibit depleted cores with masses of ~ 1-2 times the mass of their nuclear SBHs, consistent with the predictions of the binary model. Studies of the interaction of massive binaries with gas are still in their infancy, although much progress is expected in the near future. Binary coalescence has a large influence on the spins of SBHs, even for mass ratios as extreme as 10:1, and evidence of spin-flips may have been observed.

  3. A Cosmological Study in Massive Gravity theory

    CERN Document Server

    Pan, Supriya

    2015-01-01

    A detailed study of the various cosmological aspects in massive gravity theory has been presented in the present work. For the homogeneous and isotropic FLRW model, the deceleration parameter has been evaluated, and, it has been examined whether there is any transition from deceleration to acceleration in recent past, or not. With the proper choice of the free parameters, it has been shown that the massive gravity theory is equivalent to Einstein gravity with a modified Newtonian gravitational constant together with a negative cosmological constant. Also, in this context, it has been examined whether the emergent scenario is possible, or not, in massive gravity theory. Finally, we have done a cosmographic analysis in massive gravity theory.

  4. Gauged/Massive Supergravities in Diverse Dimensions

    CERN Document Server

    Alonso-Alberca, N; Alonso-Alberca, Natxo; Ortin, Tomas

    2003-01-01

    We show how massive/gauged maximal supergravities in 11-n dimensions with SO(n-l,l) gauge groups (and other non-semisimple subgroups of Sl(n,R)) can be systematically obtained by dimensional reduction of ``massive 11-dimensional supergravity''. This series of massive/gauged supergravities includes, for instance, Romans' massive N=2A,d=10 supergravity for n=1, N=2,d=9 SO(2) and SO(1,1) gauged supergravities for n=2, and N=8,d=5 SO(6-l,l) gauged supergravity. In all cases, higher p-form fields get masses through the Stuckelberg mechanism which is an alternative to self-duality in odd dimensions.

  5. Symmetries of Massive and Massless Neutrinos

    CERN Document Server

    Kim, Y S

    2016-01-01

    Wigner's little groups are subgroups of the Lorentz group dictating the internal space-time symmetries of massive and massless particles. These little groups are like O(3) and E(2) for massive and massless particles respectively. While the geometry of the O(3) symmetry is familiar to us, the geometry of the flat plane cannot explain the E(2)-like symmetry for massless particles. However, the geometry of a circular cylinder can explain the symmetry with the helicity and gauge degrees of freedom. It is shown further that the symmetry of the massless particle can be obtained as a zero-mass limit of O(3)-like symmetry for massive particles. It is shown further that the polarization of massless neutrinos is a consequence of gauge invariance, while the symmetry of massive neutrinos is still like O(3).

  6. Massive perturbers in the galactic center

    CERN Document Server

    Perets, H B; Alexander, T; Perets, Hagai B.; Hopman, Clovis; Alexander, Tal

    2006-01-01

    We investigate the role of massive perturbers, such as giant molecular clouds or stellar clusters, in supplying low-angular momentum stars that pass very close to the central massive black hole (MBH) or fall into it. We show that massive pe rturbers can play an important role in supplying both binaries and single stars to the vicinity of the MBH. We discuss possible implications for the ejection of high velocity stars; for the capture of stars on tight orbits around the MBH; for the emission of gravitational waves from low-eccentricity inspiraling stars; and for the origin of the young main sequence B stars observed very near the Gal actic MBH. Massive perturbers may also enhance the the growth rate of MBHs, and may accelerate the dynamical orbital decay of coalescing binary MBHs.

  7. Magnetic monopole solutions with a massive dilaton

    CERN Document Server

    Forgács, Péter; Forgacs, Peter; Gyurusi, Jozsef

    1998-01-01

    Static, spherically symmetric monopole solutions of a spontaneously broken SU(2) gauge theory coupled to a massive dilaton field are studied in detail in function of the dilaton coupling strength and of the dilaton mass.

  8. Current management of massive hemorrhage in trauma

    DEFF Research Database (Denmark)

    Johansson, Pär I; Stensballe, Jakob; Ostrowski, Sisse R

    2012-01-01

    ABSTRACT: Hemorrhage remains a major cause of potentially preventable deaths. Trauma and massive transfusion are associated with coagulopathy secondary to tissue injury, hypoperfusion, dilution, and consumption of clotting factors and platelets. Concepts of damage control surgery have evolved...

  9. 5G multimedia massive MIMO communications systems

    OpenAIRE

    Ge, Xiaohu; Wang, Haichao; Zi, Ran; Li, Qiang; Ni, Qiang

    2016-01-01

    In the fifth generation (5G) wireless communication systems, a majority of the traffic demands are contributed by various multimedia applications. To support the future 5G multimedia communication systems, the massive multiple-input multiple-output (MIMO) technique is recognized as a key enabler because of its high spectral efficiency. The massive antennas and radio frequency chains not only improve the implementation cost of 5G wireless communication systems but also result in an intense mut...

  10. The Evolution and Explosion of Massive Stars

    OpenAIRE

    Sukhbold, Tuguldur

    2016-01-01

    How a massive star ends its life depends upon how that life has been lived - the rotation, mass and composition it was born with, mass loss and exchange, and the complex convective and nuclear burning episodes it experienced along the way. In the end, the presupernova stellar core has a density structure that can be characterized by its "compactness" - essentially how fast the density declines outside the iron core. The likelihood that a massive star explodes, by any means, is sensitive to th...

  11. [Protective activity of S-PT84, a heat-killed preparation of Lactobacillus pentosus, against oral and gastric candidiasis in an experimental murine model].

    Science.gov (United States)

    Hayama, Kazumi; Ishijima, Sanae; Ono, Yoshiko; Izumo, Takayuki; Ida, Masayuki; Shibata, Hiroshi; Abe, Shigeru

    2014-01-01

    The effect of S-PT84, a heat-killed preparation of Lactobacillus pentosus on growth of Candida albicans was examined in vitro and in vivo. The mycelial growth was effectively inhibited by S-PT84 and seemed to bind to the hyphae. We assessed the potential of S-PT84 for treatment of oral and gastric candidiasis using a murine model. When 2 mg of S-PT84 was administered three times into the oral cavity of orally Candida infected mice, the score of lesions on the tongue was improved on day 2. When 50 μl and 200 μl of S-PT84 (10 mg/ml) were administered three times into the oral cavity (0.5 mg × 3) and the stomach (2 mg × 3) of the same mouse model, the number of viable Candida cells in the stomach was reduced significantly on day 2. These findings suggest the possibility that S-PT84 has potential as a food ingredient supporting anti-Candida treatment, especially for Candida infection in the gastrointestinal tract.

  12. Protective Sliding Carbon-Based Nanolayers Prepared by Argon or Nitrogen Ion-Beam Assisted Deposition on Ti6Al4V Alloy

    Directory of Open Access Journals (Sweden)

    Petr Vlcak

    2016-01-01

    Full Text Available The microstructure and the surface properties of samples coated by carbon-based nanolayer were investigated in an effort to increase the surface hardness and reduce the coefficient of friction of the Ti6Al4V alloy. Protective carbon-based nanolayers were fabricated by argon or nitrogen ion-beam assisted deposition at ion energy of 700 eV on Ti6Al4V substrates. The Raman spectra indicated that nanolayers had a diamond-like carbon character with sp2 rich bonds. The TiC and TiN compounds formed in the surface area were detected by X-ray diffraction. Nanoscratch tests showed increased adhesion of a carbon-based nanolayer deposited with ion assistance in comparison with a carbon nanolayer deposited without ion assistance. The results showed that argon ion assistance leads to greater nanohardness than a sample coated by a carbon-based nanolayer with nitrogen ion assistance. A more than twofold increase in nanohardness and a more than fivefold decrease in the coefficient of friction were obtained for samples coated by a carbon-based nanolayer with ion assistance, in comparison with the reference sample.

  13. Radiation Protection

    Science.gov (United States)

    ... EPA United States Environmental Protection Agency Search Search Radiation Protection Share Facebook Twitter Google+ Pinterest Contact Us Radiation Protection Document Library View and download EPA radiation ...

  14. Au and Al Schottky barrier formation on GaAs (100) surfaces prepared by thermal desorption of a protective arsenic coating

    Energy Technology Data Exchange (ETDEWEB)

    Spindt, C.J.; Yamada, M.; Meissner, P.L.; Miyano, K.E.; Herrera, A.; Spicer, W.E. (Stanford Electronics Laboratories, Stanford University, Stanford, California 94305-4055 (US)); Arko, A.J. (Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (US))

    1991-07-01

    Soft x-ray photoemission spectroscopy has been used to investigate the initial stages of Schottky barrier formation on GaAs (100) surfaces prepared by the thermal desorption of an As cap. This work was motivated by a previous study (Brillson {ital et} {ital al}., J. Vac. Sci. Technol. B {bold 6}, 1263 (1988)) of identically grown and capped samples which reported unpinned'' Schottky barrier formation, with barrier heights falling over a wide range (0.75 eV) of energies. This large energy range is a striking result, as a considerable number of prior studies on both (110) and (100) surfaces have found that all metals will pin in a narrow (0.25 eV) range near midgap. Since Au and Al are the extremes of the larger 0.75 eV span of Schottky barriers, we have studied the deposition of these two metals. We found that the barrier height measurements on the low doped {ital n}-type samples used in this work and in the paper referenced above are affected by photovoltaic effects, even at room temperature. These photovoltaic effects cause shifts in the band bending, which are an artifact of the measurement. We also performed measurements on more heavily doped samples, and the photovoltaic effects were removed. In addition, we point out that Au--Ga alloying makes the case of Au potentially misleading. With the photovoltaic effects removed, and the Au--Ga alloying carefully accounted for, we found that the barriers heights for Au and Al differ by only 0.25 eV.

  15. Cross-platform compatibility of Hi-Plex, a streamlined approach for targeted massively parallel sequencing.

    Science.gov (United States)

    Nguyen-Dumont, Tú; Pope, Bernard J; Hammet, Fleur; Mahmoodi, Maryam; Tsimiklis, Helen; Southey, Melissa C; Park, Daniel J

    2013-11-15

    Although per-base sequencing costs have decreased during recent years, library preparation for targeted massively parallel sequencing remains constrained by high reagent cost, limited design flexibility, and protocol complexity. To address these limitations, we previously developed Hi-Plex, a polymerase chain reaction (PCR) massively parallel sequencing strategy for screening panels of genomic target regions. Here, we demonstrate that Hi-Plex applied with hybrid adapters can generate a library suitable for sequencing with both the Ion Torrent and the TruSeq chemistries and that adjusting primer concentrations improves coverage uniformity. These results expand Hi-Plex capabilities as an accurate, affordable, flexible, and rapid approach for various genetic screening applications.

  16. Au and Al Schottky barrier formation on GaAs (100) surfaces prepared by thermal desorption of a protective arsenic coating

    Energy Technology Data Exchange (ETDEWEB)

    Spindt, C.J.; Yamada, M.; Meissner, P.L.; Miyano, K.E.; Herrera, A.; Spicer, W.E. (Stanford Univ., CA (United States). Stanford Electronics Labs.); Arko, A.J. (Los Alamos National Lab., NM (United States)); Woodall, J.M.; Pettit, G.D. (International Business Machines Corp., Yorktown Heights, NY (United States). Thomas J. Watson Research Center)

    1991-01-01

    Photoelectron spectroscopy has been used as a tool to investigate the initial stages of Schottky barrier formation on GaAs (100) surfaces. This is a popular technique that has been used by many researchers in the past to measure the band bending (or shift) of the valence band and conduction band (a measure of the Schottky barrier shift), while the Fermi level remains fixed at the system ground (i.e., the ground of the spectrometer). Metal deposition on a semiconductor surface can alter the Schottky barrier at the surface and pin the Fermi level near the middle of the energy gap. Extremely clean and crystallographically perfect surfaces are required in this study. Toward this end, a method of protecting the GaAs surface was employed which consists of capping the GaAs surface with a layer of As. Upon introduction into the high vacuum system the As is thermally desorbed, revealing a pure GaAs surface. Our work was motivated by a previous study (Brillson et al) on similarly capped specimens, which suggested that metal overlayers do not pin the Schottky barrier in GaAs. Barrier heights varied by as much as 0.75 eV between Al and Au overlayers. This large energy range is a striking result in view of the fact that a considerable number of prior studies on both (110) and (100) surfaces have found that all metals will pin within a narrow (0.25 eV) range at midgap. We repeated the measurements of Brillson on the identically doped samples used in their study using two extreme range metals of Au and Al as overlayers. We found that the barrier height measurements on low doped n-type samples used in this work and in the previous work are affected by photovoltaic effects, even at room temperature. This was determined from taking spectra at a number of temperatures between 20 K and room temperature and looking for shifts. 16 refs., 7 figs.

  17. Study on preparing PSA tape with high temperature resistance for FPC protecting film%FPC保护膜用耐高温PSA胶带的研制

    Institute of Scientific and Technical Information of China (English)

    柳彬彬; 向如亭; 吕红; 李永胜; 杨春强

    2012-01-01

    With 2-ethyl hexyl acrylate(2-EHA) ,2-hydroxyethyl acrylate(HEA),acrylic acid(AA) and vinyl acetate(Vac) as comonomers,E-5C(epoxy-series cross linker)/XDl(xlylene diisocyanale cross linker) as composite cross linker,and TOTM(trioclyl trimellale) as plasticizer,a solvent-based acrylate PSA(pressure sensitive adhesive) was made by solution copolymerization. Then a PSA tape with high temperature resistance and acid -alkali resistance for FPC(flexible printed circuit) protecting film was also made by post-crosslinker and plasticizer modification. The research results showed that the corresponding PSA tape had good combination property and its trial production could fully meet application requirement of FPC processing process because its initial tack was moderate,and high temperature resistance and acid-alkali resistance were excellent when mass ratio of m(acrylate copolymersolulion):m(E-5C):m(XDI):m(TOTM) was 100:15:1.5:3 and thickness of dry adhesive coat was 8-10 μm.%以丙烯酸-2-乙基己酯(2-EHA)、丙烯酸-2-羟乙酯(HEA)、丙烯酸(AA)和醋酸乙烯酯(VAc)为共聚单体,以环氧系列交联剂(E-5C)和苯二亚甲基二异氰酸酯交联剂(XDI)为复合交联剂,以偏苯三酸三辛酯( TOTM)为增塑剂,采用溶液共聚法制备溶剂型丙烯酸酯压敏胶(PSA);然后通过后期交联和增塑改性,制成柔性印刷电路板(FPC)保护膜用耐高温耐酸碱型PSA胶带.研究结果表明:当m(丙烯酸酯共聚溶液)∶m(E-5C)∶m(XDI)∶m(TOTM)=100∶15∶1.5∶3和干胶厚度为8~10 μm时,相应PSA胶带的综合性能良好,其初始黏合力适中、耐高温性能和耐酸碱性能优异,并且其中试产品完全满足FPC加工过程的应用要求.

  18. Integrating Building Functions into Massive External Walls

    Directory of Open Access Journals (Sweden)

    Ahmed Hisham Hafez

    2016-05-01

    Full Text Available Well into the twentieth century, brick and stone were the materials used. Bricklaying and stonemasonry were the construction technologies employed for the exterior walls of virtually all major structures. However, with the rise in quality of life, the massive walls alone became incapable of fulfilling all the developed needs. Adjacent systems and layers had then to be attached to the massive layer. Nowadays, the external wall is usually composed of a layered construction. Each external wall function is usually represented by a separate layer or system. The massive layer of the wall is usually responsible for the load-bearing function.Traditional massive external walls vary in terms of their external appearance, their composition and attached layers. However, their design and construction process is usually a repeated process. It is a linear process where each discipline is concerned with a separate layer or system. These disciplines usually take their tasks away and bring them back to be re-integrated in a layered manner. New massive technologies with additional function have recently become available.Such technologies can provide the external wall with other functions in addition to its load-bearing function. The purpose of this research is to map the changes required to the traditional design and construction process when massive technologies with additional function are applied in external walls. Moreover, the research aims at assessing the performance of massive solutions with additional function when compared to traditional solutions in two different contexts, the Netherlands and Egypt.Through the analysis of different additional function technologies in external walls, a guidance scheme for different stakeholders is generated. It shows the expected process changes as related to the product level and customization level. Moreover, the research concludes that the performance of additional insulating technologies, and specifically Autoclaved

  19. Protecting the Amazon with protected areas.

    Science.gov (United States)

    Walker, Robert; Moore, Nathan J; Arima, Eugenio; Perz, Stephen; Simmons, Cynthia; Caldas, Marcellus; Vergara, Dante; Bohrer, Claudio

    2009-06-30

    This article addresses climate-tipping points in the Amazon Basin resulting from deforestation. It applies a regional climate model to assess whether the system of protected areas in Brazil is able to avoid such tipping points, with massive conversion to semiarid vegetation, particularly along the south and southeastern margins of the basin. The regional climate model produces spatially distributed annual rainfall under a variety of external forcing conditions, assuming that all land outside protected areas is deforested. It translates these results into dry season impacts on resident ecosystems and shows that Amazonian dry ecosystems in the southern and southeastern basin do not desiccate appreciably and that extensive areas experience an increase in precipitation. Nor do the moist forests dry out to an excessive amount. Evidently, Brazilian environmental policy has created a sustainable core of protected areas in the Amazon that buffers against potential climate-tipping points and protects the drier ecosystems of the basin. Thus, all efforts should be made to manage them effectively.

  20. Evolution and fate of very massive stars

    CERN Document Server

    Yusof, Norhasliza; Meynet, Georges; Crowther, Paul A; Ekstrom, Sylvia; Frischknecht, Urs; Georgy, Cyril; Kassim, Hasan Abu; Schnurr, Olivier; 10.1093/mnras/stt794

    2013-01-01

    There is observational evidence that supports the existence of Very Massive Stars in the local universe. First, very massive stars (Mini<=320 M) have been observed in the Large Magellanic Cloud . Second, there are observed SNe that bear the characteristics of Pair Creation Supernovae which have very massive stars as progenitors. The most promising candidate to date is SN2007bi. In order to investigate the evolution and fate of nearby very massive stars, we calculated a new grid of models for such objects, for solar, LMC and SMC metallicities, which covers the initial mass range from 120 to 500M. Both rotating and non-rotating models were calculated using the Geneva stellar evolution code and evolved until at least the end of helium burning and for most models until oxygen burning. Since very massive stars have very large convective cores during the Main-Sequence phase, their evolution is not so much affected by rotational mixing, but more by mass loss through stellar winds. Their evolution is never far fro...

  1. A Hunt for Massive Starless Cores

    CERN Document Server

    Kong, Shuo; Caselli, Paola; Fontani, Francesco; Liu, Mengyao; Butler, Michael J

    2016-01-01

    We carry out an ALMA $\\rm N_2D^+$(3-2) and 1.3~mm continuum survey towards 32 high mass surface density regions in seven Infrared Dark Clouds with the aim of finding massive starless cores, which may be the initial conditions for the formation of massive stars. Cores showing strong $\\rm N_2D^+$(3-2) emission are expected to be highly deuterated and indicative of early, potentially pre-stellar stages of star formation. We also present maps of these regions in ancillary line tracers, including C$^{18}$O(2-1), DCN(3-2) and DCO$^+$(3-2). Over 100 $\\rm N_2D^+$ cores are identified with our newly developed core-finding algorithm based on connected structures in position-velocity space. The most massive core has $\\gtrsim70\\:M_\\odot$ (potentially $\\sim170\\:M_\\odot$) and so may be representative of the initial conditions for massive star formation. The existence and dynamical properties of such cores constrain massive star formation theories. We measure the line widths and thus velocity dispersion of six of the cores ...

  2. A cosmological context for compact massive galaxies

    CERN Document Server

    Stringer, Martin; Vecchia, Claudio Dalla; Martinez-Valpuesta, Inma

    2015-01-01

    To provide a quantitative cosmological context to ongoing observational work on the formation histories and location of compact massive galaxies, we locate and study a sample of exceptionally compact systems in the Bolshoi simulation, using the dark matter structural parameters from a real, compact massive galaxy (NGC1277) as a basis for our working criteria. We find that over 80% of objects in this nominal compact category are substructures of more massive groups or clusters, and that the probability of a given massive substructure being this compact increases significantly with the mass of the host structure; rising to ~30% for the most massive clusters in the simulation. Tracking the main progenitors of this subsample back to z=2, we find them all to be distinct structures with scale radii and densities representative of the population as a whole at this epoch. What does characterise their histories, in addition to mostly becoming substructures, is that they have almost all experienced below-average mass a...

  3. Screening of Excipients for Preparing Tablet Bait to Protect Antherae pernyi from Katydids%柞蚕害虫螽斯防控颗粒饵剂中的赋形剂筛选

    Institute of Scientific and Technical Information of China (English)

    王立石; 牛雄雷; 张惠淳; 杨金琛; 刘洪丽; 陈有嗣; 季明刚; 倪振田

    2014-01-01

    Excipient is one of the main additives in pharmaceutical formulation.In the preparation of tablet bait formulations using pesticide acephate for protection of tussah silkworm (Antheraea pernyi) against katydid,potato powder was used as nutrient material and sorbitol,agar and beeswax were used as excipient.Through measuring shape-forming ability,water retention capability and other properties of the prepared tablet bait,beeswax was found to be the best excipient.Furthermore,the dosage of excipient was optimized by taking into account the bait yield,stacking performance,water retention capability,anti-water erosion performance and average intake by katydids.When the mass ratio of beeswax to other ingredients (potato powder etc) was 0.4,the prepared bait had the maximum bait yield,excellent stacking,high water retention,anti-water erosion performance,and high intake amount by katydids.Therefore,the tablet bait prepared by using beeswax as excipient according to optimized formula is favorable for maintaining the toxicity of acephate against katydids.%赋形剂是药物制剂的主要助剂之一.在用杀虫剂乙酰甲胺磷制备防控柞蚕害虫螽斯的颗粒饵剂配方中,以马铃薯粉为营养成分,分别以山梨糖醇、琼脂和蜂蜡作为赋形剂,通过测定颗粒饵剂的成形性能和保水性能等指标,筛选蜂蜡为最佳赋形剂.进一步考察颗粒饵剂的物料收率、堆码性能、保水性能、耐水性能和螽斯平均取食量等指标,优化赋形剂蜂蜡的用量,当蜂蜡与其他辅料(马铃薯粉等)的质量比为0.4时,颗粒饵剂的物料收率达到最大值,堆码及保水、耐水性能好,螽斯的取食量也较高.以蜂蜡为赋形剂并按优化的配比制备的颗粒铒剂,有利于保持乙酰甲胺磷对螽斯的杀灭效果.

  4. Stability of massive graviton around BTZ black hole in three dimensional massive gravities

    CERN Document Server

    Moon, Taeyoon

    2013-01-01

    We investigate the massive graviton stability of the BTZ black hole obtained from three dimensional massive gravities which are classified into the parity-even and parity-odd gravity theories. In the parity-even gravity theory, we perform the $s$-mode stability analysis by using the BTZ black string perturbations, which gives two Schr\\"odinger equations with frequency-dependent potentials. The $s$-mode stability is consistent with the generalized Breitenlohner-Freedman bound for spin-2 field. It seems that for the parity-odd massive gravity theory, the BTZ black hole is stable when the imaginary part of quasinormal frequencies of massive graviton is positive. However, this condition is not consistent with the $s$-mode stability based on the second-order equation obtained after squaring the first-order equation. Finally we explore the black hole stability connection between the parity-odd and parity-even massive gravity theories.

  5. Limited Feedback Precoding for Massive MIMO

    Directory of Open Access Journals (Sweden)

    Xin Su

    2013-01-01

    Full Text Available The large-scale array antenna system with numerous low-power antennas deployed at the base station, also known as massive multiple-input multiple-output (MIMO, can provide a plethora of advantages over the classical array antenna system. Precoding is important to exploit massive MIMO performance, and codebook design is crucial due to the limited feedback channel. In this paper, we propose a new avenue of codebook design based on a Kronecker-type approximation of the array correlation structure for the uniform rectangular antenna array, which is preferable for the antenna deployment of massive MIMO. Although the feedback overhead is quite limited, the codebook design can provide an effective solution to support multiple users in different scenarios. Simulation results demonstrate that our proposed codebook outperforms the previously known codebooks remarkably.

  6. Massive Particle Reflection from Moving Mirrors

    Science.gov (United States)

    Sfarti, Adrian

    2016-09-01

    We investigate the reflection of massive particles from moving mirrors. The adoption of the formalism based on the energy-momentum allowed us to derive the most general set of formulas, valid for massive and, in the limit, also for massless particles. We show that the momentum change of the reflecting particle always lies along the normal to the mirror, independent of the mirror speed. The subject is interesting not only to physicists designing concentrators for fascicles of massive particles and electron microscopes but also to computer scientists working in raytracing operating in the photon sector. The paper, far from being only theoretical, has profound and novel practical applications in both domains of engineering design and computer science.

  7. Primordial inhomogeneities from massive defects during inflation

    Science.gov (United States)

    Firouzjahi, Hassan; Karami, Asieh; Rostami, Tahereh

    2016-10-01

    We consider the imprints of local massive defects, such as a black hole or a massive monopole, during inflation. The massive defect breaks the background homogeneity. We consider the limit that the physical Schwarzschild radius of the defect is much smaller than the inflationary Hubble radius so a perturbative analysis is allowed. The inhomogeneities induced in scalar and gravitational wave power spectrum are calculated. We obtain the amplitudes of dipole, quadrupole and octupole anisotropies in curvature perturbation power spectrum and identify the relative configuration of the defect to CMB sphere in which large observable dipole asymmetry can be generated. We observe a curious reflection symmetry in which the configuration where the defect is inside the CMB comoving sphere has the same inhomogeneous variance as its mirror configuration where the defect is outside the CMB sphere.

  8. Primordial inhomogeneities from massive defects during inflation

    CERN Document Server

    Firouzjahi, Hassan; Rostami, Tahereh

    2016-01-01

    We consider the imprints of local massive defects, such as a black hole or a massive monopole, during inflation. The massive defect breaks the background homogeneity. We consider the limit that the physical Schwarzschild radius of the defect is much smaller than the inflationary Hubble radius so a perturbative analysis is allowed. The inhomogeneities induced in scalar and gravitational wave power spectrum are calculated. We obtain the amplitudes of dipole, quadrupole and octupole anisotropies in curvature perturbation power spectrum and identify the relative configuration of the defect to CMB sphere in which large observable dipole asymmetry can be generated. We observe a curious reflection symmetry in which the configuration where the defect is inside the CMB comoving sphere has the same inhomogeneous variance as its mirror configuration where the defect is outside the CMB sphere.

  9. How to Find Young Massive Cluster Progenitors

    CERN Document Server

    Bressert, Eli; Battersby, Cara; Bally, John; Longmore, Steven; Testi, Leonardo

    2012-01-01

    We propose that bound, young massive stellar clusters form from dense clouds that have escape speeds greater than the sound speed in photo-ionized gas. In these clumps, radiative feedback in the form of gas ionization is bottled up, enabling star formation to proceed to sufficiently high efficiency so that the resulting star cluster remains bound even after gas removal. We estimate the observable properties of the massive proto-clusters (MPCs) for existing Galactic plane surveys and suggest how they may be sought in recent and upcoming extragalactic observations. These surveys will potentially provide a significant sample of MPC candidates that will allow us to better understand extreme star-formation and massive cluster formation in the Local Universe.

  10. Pseudoangiomatous stromal hyperplasia causing massive breast enlargement.

    Science.gov (United States)

    Bourke, Anita Geraldine; Tiang, Stephen; Harvey, Nathan; McClure, Robert

    2015-10-16

    Pseudoangiomatous stromal hyperplasia (PASH) of the breast is a benign mesenchymal proliferative process, initially described by Vuitch et al. We report an unusual case of a 46-year-old woman who presented with a 6-week history of bilateral massive, asymmetrical, painful enlargement of her breasts, without a history of trauma. On clinical examination, both breasts were markedly enlarged and oedematous, but there were no discrete palpable masses. Preoperative image-guided core biopsies and surgery showed PASH. PASH is increasingly recognised as an incidental finding on image-guided core biopsy performed for screen detected lesions. There are a few reported cases of PASH presenting as rapid breast enlargement. In our case, the patient presented with painful, asymmetrical, massive breast enlargement. Awareness needs to be raised of this entity as a differential diagnosis in massive, painful breast enlargement.

  11. Massive acetabular bone loss: Limits of trabecular metal cages

    Directory of Open Access Journals (Sweden)

    Villanueva-Martínez Manuel

    2011-01-01

    Full Text Available Massive acetabular bone loss (more than 50% of the acetabular area can result in insufficient native bone for stable fixation and long-term bone ingrowth of conventional porous cups. The development of trabecular metal cages with osteoconductive properties may allow a more biological and versatile approach that will help restore bone loss, thus reducing the frequency of implant failure in the short-to-medium term. We report a case of massive bone loss affecting the dome of the acetabulum and the ilium, which was treated with a trabecular metal cage and particulate allograft. Although the trabecular metal components had no intrinsic stability, they did enhance osseointegration and incorporation of a non-impacted particulate graft, thus preventing failure of the reconstruction. The minimum 50% contact area between the native bone and the cup required for osseointegration with the use of porous cups may not hold for new trabecular metal cups, thus reducing the need for antiprotrusio cages. The osteoconductive properties of trabecular metal enhanced allograft incorportation and iliac bone rebuilding without the need to fill the defect with multiple wedges nor protect the reconstruction with an antiprotrusio cage.

  12. Satellite Accretion Onto Massive Galaxies With Central Black Holes

    CERN Document Server

    Boylan-Kolchin, M; Boylan-Kolchin, Michael; Ma, Chung-Pei

    2006-01-01

    Minor mergers of galaxies are expected to be common in a hierarchical cosmology such as $\\Lambda$CDM and have the potential to significantly affect galactic structure. In this paper we dissect the case-by-case outcome from a set of numerical simulations of a single satellite elliptical galaxy accreting onto a massive elliptical galaxy. We take care to explore cosmologically relevant orbital parameters and to set up realistic initial galaxy models that include all three relevant dynamical components: dark matter halos, stellar bulges, and central massive black holes. The effects of several different parameters are considered, including orbital energy and angular momentum, satellite density and inner density profile, satellite-to-host mass ratio, and presence of a black hole at the center of the host. Black holes play a crucial role in protecting the shallow stellar cores of the hosts, as satellites merging onto a host with a central black hole are more strongly disrupted than those merging onto hosts without b...

  13. CSW rules for a massive scalar

    DEFF Research Database (Denmark)

    Boels, Rutger Herman; Schwinn, Christian

    2008-01-01

    We derive the analog of the Cachazo-Svrcek-Witten (CSW) diagrammatic Feynman rules for four-dimensional Yang-Mills gauge theory coupled to a massive colored scalar. The mass term is shown to give rise to a new tower of vertices in addition to the CSW vertices for massless scalars in non-supersymm......We derive the analog of the Cachazo-Svrcek-Witten (CSW) diagrammatic Feynman rules for four-dimensional Yang-Mills gauge theory coupled to a massive colored scalar. The mass term is shown to give rise to a new tower of vertices in addition to the CSW vertices for massless scalars in non...

  14. A Massively Parallel Face Recognition System

    Directory of Open Access Journals (Sweden)

    Lahdenoja Olli

    2007-01-01

    Full Text Available We present methods for processing the LBPs (local binary patterns with a massively parallel hardware, especially with CNN-UM (cellular nonlinear network-universal machine. In particular, we present a framework for implementing a massively parallel face recognition system, including a dedicated highly accurate algorithm suitable for various types of platforms (e.g., CNN-UM and digital FPGA. We study in detail a dedicated mixed-mode implementation of the algorithm and estimate its implementation cost in the view of its performance and accuracy restrictions.

  15. A Massively Parallel Face Recognition System

    Directory of Open Access Journals (Sweden)

    Ari Paasio

    2006-12-01

    Full Text Available We present methods for processing the LBPs (local binary patterns with a massively parallel hardware, especially with CNN-UM (cellular nonlinear network-universal machine. In particular, we present a framework for implementing a massively parallel face recognition system, including a dedicated highly accurate algorithm suitable for various types of platforms (e.g., CNN-UM and digital FPGA. We study in detail a dedicated mixed-mode implementation of the algorithm and estimate its implementation cost in the view of its performance and accuracy restrictions.

  16. Nonlinear interactions for massive spin-2 fields

    CERN Document Server

    Schmidt-May, Angnis

    2016-01-01

    We give a basic introduction to ghost-free nonlinear theories involving massive spin-2 fields, focussing on bimetric theory. After motivating the construction of such models from field theoretical considerations, we review the linear theories for massive and massless spin-2 fluctuations propagating on maximally symmetric backgrounds. The structure of general nonlinear spin-2 interactions is explained before we specialise to the ghost-free case. We review the maximally symmetric solutions of bimetric theory, its mass spectrum and the parameter limit which brings the theory close to general relativity. Finally we discuss applications of bimetric theory to cosmology with particular emphasis on the role of the general relativity limit.

  17. M2M massive wireless access

    DEFF Research Database (Denmark)

    Zanella, Andrea; Zorzi, Michele; Santos, André F.

    2013-01-01

    In order to make the Internet of Things a reality, ubiquitous coverage and low-complexity connectivity are required. Cellular networks are hence the most straightforward and realistic solution to enable a massive deployment of always connected Machines around the globe. Nevertheless, a paradigm...... of the current cellular standards. Here, we provide insights and introduce potential solutions for the cellular radio protocol that will allow the efficient support of Machine-to-Machine (M2M) communications. The paper focuses on the massive aspect of M2M. We will introduce PHY and MAC approaches such as Coded...

  18. Olivier Chesneau's work on massive stars

    CERN Document Server

    Millour, Florentin

    2016-01-01

    Olivier Chesneau challenged several fields of observational stellar astrophysics with bright ideas and an impressive amount of work to make them real in the span of his career, from his first paper on P Cygni in 2000, up to his last one on V838 Mon in 2014. He was using all the so-called high-angular resolution techniques since it helped his science to be made, namely study in details the inner structure of the environments around stars, be it small mass (AGBs), more massive (supergiant stars), or explosives (Novae). I will focus here on his work on massive stars.

  19. Doubly coupled matter fields in massive bigravity

    CERN Document Server

    Gao, Xian

    2016-01-01

    In the context of massive (bi-)gravity non-minimal matter couplings have been proposed. These couplings are special in the sense that they are free of the Boulware-Deser ghost below the strong coupling scale and can be used consistently as an effective field theory. Furthermore, they enrich the phenomenology of massive gravity. We consider these couplings in the framework of bimetric gravity and study the cosmological implications for background and linear tensor, vector, and scalar perturbations. Previous works have investigated special branch of solutions. Here we perform a complete perturbation analysis for the general background equations of motion completing previous analysis.

  20. SALT Spectroscopy of Evolved Massive Stars

    Science.gov (United States)

    Kniazev, A. Y.; Gvaramadze, V. V.; Berdnikov, L. N.

    2017-06-01

    Long-slit spectroscopy with the Southern African Large Telescope (SALT) of central stars of mid-infrared nebulae detected with the Spitzer Space Telescope and Wide-Field Infrared Survey Explorer (WISE) led to the discovery of numerous candidate luminous blue variables (cLBVs) and other rare evolved massive stars. With the recent advent of the SALT fiber-fed high-resolution echelle spectrograph (HRS), a new perspective for the study of these interesting objects is appeared. Using the HRS we obtained spectra of a dozen newly identified massive stars. Some results on the recently identified cLBV Hen 3-729 are presented.

  1. Massive intracerebral hemorrhage associated with Wegener granulomatosis.

    Science.gov (United States)

    Ceri, Mevlut; Ortabozkoyun, Levent; Unverdi, Selman; Kirac, Mustafa; Duranay, Murat

    2012-06-01

    Wegener granulomatosis (WG) is a necrotizing granulomatous vasculitis that predominantly affects airways and kidneys. But central nervous system involvement (7-11%) is an uncommon. Massive ICH may occur in the course of WG, and this serious condition is related with high risk of mortality. Therefore, the new treatment strategies may be considered in addition to classical practices in serious organ involvement and recurrent attack. Here, we present an adult patient with WG whose disease was complicated by a massive intracerebral hemorrhage (ICH), which subsequently led to death.

  2. SALT spectroscopy of evolved massive stars

    CERN Document Server

    Kniazev, A Y; Berdnikov, L N

    2016-01-01

    Long-slit spectroscopy with the Southern African Large Telescope (SALT) of central stars of mid-infrared nebulae detected with the Spitzer Space Telescope and Wide-field Infrared Survey Explorer (WISE) led to the discovery of numerous candidate luminous blue variables (cLBVs) and other rare evolved massive stars. With the recent advent of the SALT fibre-fed high-resolution echelle spectrograph (HRS), a new perspective for the study of these interesting objects is appeared. Using the HRS we obtained spectra of a dozen newly identified massive stars. Some results on the recently identified cLBV Hen 3-729 are presented.

  3. Evolution of massive binary black holes

    CERN Document Server

    Yu, Q

    2002-01-01

    Since many or most galaxies have central massive black holes (BHs), mergers of galaxies can form massive binary black holes (BBHs). In this paper, we study the evolution of massive BBHs in realistic galaxy models, using a generalization of techniques used to study tidal disruption rates around massive BHs. The evolution of BBHs depends on BH mass ratio and host galaxy type. BBHs with very low mass ratios (say, $\\la$ 0.001) are hardly ever formed by mergers of galaxies because the dynamical friction timescale is too long for the smaller BH to sink into the galactic center within a Hubble time. BBHs with moderate mass ratios are most likely to form and survive in spherical or nearly spherical galaxies and in high-luminosity or high-dispersion galaxies; they are most likely to have merged in low-dispersion galaxies (line-of-sight velocity dispersion $\\la$ 90 km/s) or in highly flattened or triaxial galaxies. The semimajor axes and orbital periods of surviving BBHs are generally in the range 10^{-3}-10 pc and 10-...

  4. Massive Job Cuts Looming in Textile Industry

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Massive job losses are in the offing in the textile sector, says the theApparel Export Promotion Council (AEPC).The high prices of cotton have pushed up the cost of the fabric andthe end product. We are now in a situation where we are forced to rejectrepeat orders as we can’t justify the high prices to our foreign buyers.

  5. All-Multiplicity Amplitudes with Massive Scalars

    CERN Document Server

    Forde, D; Forde, Darren; Kosower, David A.

    2005-01-01

    We compute two infinite series of tree-level amplitudes with a massive scalar pair and an arbitrary number of gluons. We provide results for amplitudes where all gluons have identical helicity, and amplitudes with one gluon of opposite helicity. These amplitudes are useful for unitarity-based one-loop calculations in nonsupersymmetric gauge theories generally, and QCD in particular.

  6. Charged Black Holes in New Massive Gravity

    OpenAIRE

    Ghodsi, Ahmad; Moghadassi, Mohammad

    2010-01-01

    We construct charged black hole solutions to three-dimensional New Massive Gravity (NMG), by adding electromagnetic Maxwell and Chern-Simons actions. We find charged black holes in the form of warped AdS_3 and "log" solutions in specific critical point. The entropy, mass and angular momentum of these black holes are computed.

  7. SIMP (Strongly Interacting Massive Particle) Search

    CERN Document Server

    Teplitz, V L; Olness, F I; Stroynowski, R; Teplitz, Vigdor L.; Mohapatra, Rabindra N.; Olness, Fred; Stroynowski, Ryszard

    2000-01-01

    We consider laboratory experiments that can detect stable, neutral stronglyinteracting massive particles (SIMPs). We explore the SIMP annihilation crosssection from its minimum value (restricted by cosmological bounds) to the barnrange, and vary the mass values from a GeV to a TeV. We also consider the prospects and problems of detecting such particles at theTevatron.

  8. FRW Cosmological Perturbations in Massive Bigravity

    CERN Document Server

    Comelli, D; Pilo, L

    2014-01-01

    Cosmological perturbations of FRW solutions in ghost free massive bigravity, including also a second matter sector, are studied in detail. At early time, we find that sub horizon exponential instabilities are unavoidable and they lead to a premature departure from the perturbative regime of cosmological perturbations.

  9. Hamiltonian analysis of BHT massive gravity

    CERN Document Server

    Blagojević, M

    2010-01-01

    We study the Hamiltonian structure of the Bergshoeff-Hohm-Townsend (BHT) massive gravity with a cosmological constant. In the space of coupling constants $(\\Lambda_0,m^2)$, our canonical analysis reveals the special role of the condition $\\Lambda_0/m^2\

  10. Consistent truncations with massive modes and holography

    CERN Document Server

    Cassani, Davide; Faedo, Anton F

    2011-01-01

    We review the basic features of some recently found consistent Kaluza-Klein truncations including massive modes. We emphasize the general ideas underlying the reduction procedure, then we focus on type IIB supergravity on 5-dimensional manifolds admitting a Sasaki-Einstein structure, which leads to half-maximal gauged supergravity in five dimensions. Finally, we comment on the holographic picture of consistency.

  11. Gauge Invariance for the Massive Axion

    CERN Document Server

    Arias, P J; Arias, Pio Jose; Khoudeir, Adel

    1997-01-01

    A massive gauge invariant formulation for scalar ($\\phi$) and antisymmetric ($C_{mnp}$) fields with a topological coupling, which provides a mass for the axion field, is considered. The dual and local equivalence with the non-gauge invariant proposal is established, but on manifolds with non-trivial topological structure both formulations are not globally equivalent.

  12. Embeddings of the "New Massive Gravity"

    Science.gov (United States)

    Dalmazi, D.; Mendonça, E. L.

    2016-07-01

    Here we apply different types of embeddings of the equations of motion of the linearized "New Massive Gravity" in order to generate alternative and even higher-order (in derivatives) massive gravity theories in D=2+1. In the first part of the work we use the Weyl symmetry as a guiding principle for the embeddings. First we show that a Noether gauge embedding of the Weyl symmetry leads to a sixth-order model in derivatives with either a massive or a massless ghost, according to the chosen overall sign of the theory. On the other hand, if the Weyl symmetry is implemented by means of a Stueckelberg field we obtain a new scalar-tensor model for massive gravitons. It is ghost-free and Weyl invariant at the linearized level around Minkowski space. The model can be nonlinearly completed into a scalar field coupled to the NMG theory. The elimination of the scalar field leads to a nonlocal modification of the NMG. In the second part of the work we prove to all orders in derivatives that there is no local, ghost-free embedding of the linearized NMG equations of motion around Minkowski space when written in terms of one symmetric tensor. Regarding that point, NMG differs from the Fierz-Pauli theory, since in the latter case we can replace the Einstein-Hilbert action by specific f(R,Box R) generalizations and still keep the theory ghost-free at the linearized level.

  13. Complete recovery after massive ethylene glycol ingestion.

    Science.gov (United States)

    Curtin, L; Kraner, J; Wine, H; Savitt, D; Abuelo, J G

    1992-06-01

    We treated a 64-year-old man who recovered completely from a massive antifreeze ingestion with ethylene glycol levels well above those of previously described survivors. Rapid and aggressive treatment of the patient with recognized methods, including hemodialysis, resulted in the favorable outcome.

  14. Very Massive Stars in the local Universe

    NARCIS (Netherlands)

    Vink, J.S.; Heger, A.; Krumholz, M.R.; Puls, J.; Banerjee, S.; Castro, N.; Chen, K.J.; Chenè, A.N.; Crowther, P.A.; Daminelli, A.; Gräfener, G.; Groh, J.H.; Hamann, W.R.; Heap, S.; Herrero, A.; Kaper, L.; Najarro, F.; Oskinova, L.M.; Roman-Lopes, A.; Rosen, A.; Sander, A.; Shirazi, M.; Sugawara, Y.; Tramper, F.; Vanbeveren, D.; Voss, R.; Wofford, A.; Zhang, Y.

    2015-01-01

    Recent studies have claimed the existence of very massive stars (VMS) up to 300 M⊙ in the local Universe. As this finding may represent a paradigm shift for the canonical stellar upper-mass limit of 150 M⊙, it is timely to discuss the status of the data, as well as the far-reaching implications of s

  15. Massive Black Holes Across Cosmic Time

    CERN Document Server

    Madau, P; Bender, P; Di Matteo, T; Haiman, Z; Hughes, S; Loeb, A; Phinney, E; Primack, J; Prince, T; Rees, M; Richstone, D; Schutz, B; Thorne, K; Volonteri, M

    2009-01-01

    This White Paper to the National Academy of Sciences Astro2010 Decadal Review Committee outlines some of the outstanding questions regarding the assembly history of Massive Black Holes in the nuclei of galaxies and the revolutionary contributions anticipated in this field from low-frequency gravitational wave astronomy.

  16. A Taxonomy of Massive Open Online Courses

    Science.gov (United States)

    Pilli, Olga; Admiraal, Wilfried

    2016-01-01

    Massive Open Online Courses (MOOCs) as a new approach to distance education, which originated from the open education resources (OER) movement, are becoming widespread throughout the world. Over time, early versions of cMOOCs have undergone changes in terms of use, name and structure. In their short life, MOOCs have been categorized into different…

  17. Embeddings of the "New Massive Gravity"

    CERN Document Server

    Dalmazi, D

    2016-01-01

    Using different types of embeddings of equations of motion we investigate the existence of generalizations of the "New Massive Gravity" (NMG) model with the same particle content (massive gravitons). By using the Weyl symmetry as a guiding principle for the embeddings we show that the Noether gauge embedding approach leads us to a sixth order model in derivatives with either a massive or a massless ghost. If the Weyl symmetry is implemented by means of a Stueckelberg field we obtain a new scalar-tensor model for massive gravitons. It is ghost free and Weyl invariant at linearized level. The model can be nonlinearly completed into a scalar field coupled to the NMG theory. The elimination of the scalar field leads to a nonlocal modification of the NMG. We also prove to all orders in derivatives that there is no local, ghost free embedding of the linearized NMG equations of motion around Minkowski space when written in terms of one symmetric tensor. Regarding that point, NMG differs from the Fierz-Pauli theory, ...

  18. The Dynamics of Massive Starless Cores

    Science.gov (United States)

    Tan, Jonathan; Caselli, P.; Fontani, F.; Kong, S.; Butler, M. J.

    2012-05-01

    Progress towards resolving a decade-long debate about how massive stars form can be made by determining if massive starless cores exist in a state of near virial equilibrium. These are the initial conditions invoked by the Core Accretion model of McKee & Tan (2003). Alternatively, the Competitive Accretion model of Bonnell et al. (2001) requires sub-virial conditions. We have identified 4 prime examples of massive ( 50 Msun) cores from mid-infrared (MIR) extinction mapping (Butler & Tan 2009, 2012) of Infrared Dark Clouds. We have found spectacularly high deuterated fractions of N_2H+ of 0.5 in these objects with the IRAM 30m telescope (Fontani et al. 2011). Thus N_2D+ is expected to be an excellent tracer of the kinematics of these cold, dark cores, where most other molecular tracers are thought to be depleted from the gas phase. We report on ALMA Cycle 0 Compact Configuration Band 6 observations of these 4 cores that probe the N_2D+(3-2) line on scales from 9" down to 2.3", well-matched to the structures we see in MIR extinction and discuss their implications for massive star formation theories.

  19. Very Massive Stars in the local Universe

    NARCIS (Netherlands)

    Vink, J.S.; Heger, A.; Krumholz, M.R.; Puls, J.; Banerjee, S.; Castro, N.; Chen, K.J.; Chenè, A.N.; Crowther, P.A.; Daminelli, A.; Gräfener, G.; Groh, J.H.; Hamann, W.R.; Heap, S.; Herrero, A.; Kaper, L.; Najarro, F.; Oskinova, L.M.; Roman-Lopes, A.; Rosen, A.; Sander, A.; Shirazi, M.; Sugawara, Y.; Tramper, F.; Vanbeveren, D.; Voss, R.; Wofford, A.; Zhang, Y.

    2015-01-01

    Recent studies have claimed the existence of very massive stars (VMS) up to 300 M⊙ in the local Universe. As this finding may represent a paradigm shift for the canonical stellar upper-mass limit of 150 M⊙, it is timely to discuss the status of the data, as well as the far-reaching implications of s

  20. A Massive Chinese Floral Corpus Completed

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    @@ Through the efforts of several generations of Chinese botanists over the past 50years, a massive 80-volume corpus (in 126 books) on China's flora,Flora Reipublicae Popularis Sinicae (Chinese edition), has finally been completed. This was announced at a press meeting on March 31 in Beijing.

  1. Schwinger's Method for the Massive Casimir Effect

    OpenAIRE

    1994-01-01

    We apply to the massive scalar field a method recently proposed by Schwinger to calculate the Casimir effect. The method is applied with two different regularization schemes: the Schwinger original one by means of Poisson formula and another one by means of analytical continuation.

  2. A Massive Non-Abelian Vector Model

    CERN Document Server

    Chishtie, F A

    2012-01-01

    The introduction of a Lagrange multiplier field to ensure that the classical equations of motion are satisfied serves to restrict radiative corrections in a model to being only one loop. The consequences of this for a massive non-Abelian vector model are considered.

  3. Semiconductor surface protection material

    Science.gov (United States)

    Packard, R. D. (Inventor)

    1973-01-01

    A method and a product for protecting semiconductor surfaces is disclosed. The protective coating material is prepared by heating a suitable protective resin with an organic solvent which is solid at room temperature and converting the resulting solution into sheets by a conventional casting operation. Pieces of such sheets of suitable shape and thickness are placed on the semiconductor areas to be coated and heat and vacuum are then applied to melt the sheet and to drive off the solvent and cure the resin. A uniform adherent coating, free of bubbles and other defects, is thus obtained exactly where it is desired.

  4. Positivity constraints for pseudolinear massive spin-2 and vector Galileons

    Science.gov (United States)

    Bonifacio, James; Hinterbichler, Kurt; Rosen, Rachel A.

    2016-11-01

    We derive analyticity constraints on a nonlinear ghost-free effective theory of a massive spin-2 particle known as pseudolinear massive gravity, and on a generalized theory of a massive spin-1 particle, both of which provide simple IR completions of Galileon theories. For pseudolinear massive gravity we find that, unlike de Rham, Gabadadze, and Tolley massive gravity, there is no window of parameter space which satisfies the analyticity constraints. For massive vectors which reduce to Galileons in the decoupling limit, we find that no two-derivative actions are compatible with positivity but that higher derivative actions can be made compatible.

  5. Placing Observational Constraints on Massive Star Models

    Science.gov (United States)

    Rosenfield, Philip

    2011-10-01

    The lives and deaths of massive stars are intricately linked to the evolution of galaxies. Yet, despite their integral importance to understanding galaxy evolution, models of massive stars are inconsistent with observations. These uncertainties can be traced to limited observational constraints available for improving massive star models. A sensitive test of the underlying physics of massive stars, e.g., convection, rotation, and mass loss is to measure the ratio of blue core helium burning stars {BHeB} to red core helium burning stars {RHeB}, 5-20Msun stars in the stage evolution immediately following the main sequence. Even the most sophisticated models cannot accurately predict the observed ratio over a range of metallicities, suggesting an insufficient understanding of the underlying physics. However, observational measurements of this ratio over a wide range of environments would provide substantial constraints on the physical parameters governing the evolution of all stars >5 Msun.We propose to place stringent observational constraints on the physics of massive star evolution by uniformly measuring the B/R HeB ratio in a wide range of galaxies. The HST archive contains high quality optical imaging of resolved stellar populations of dozens of nearby galaxies. From the ANGST program, we identified 38 galaxies, spanning 2 dex in metallicity that have significant BHeB and RHeB populations. Using this sample, we will empirically characterize the colors of the BHeB and RHeB sequences as a function of luminosity and metallicity, measure the B/R ratio, and constrain the lifetimes of the BHeB and RHeBs in the Padova stellar evolution models and the Cambridge STARS code.

  6. The Massive Star Population in M101

    Science.gov (United States)

    Grammer, Skyler; Humphreys, R. M.

    2014-01-01

    An increasing number of non-terminal giant eruptions are being observed by modern supernova and transient surveys. But very little is known about the origin of these giant eruptions and their progenitors, many of which are presumably very massive, evolved stars. Motivated by the small number of progenitors positively associated with these giant eruptions, we have begun a survey of the evolved massive star populations in nearby galaxies. The nearby, nearly face on, giant spiral M101 is an excellent laboratory for studying a large population of very massive stars and their environments. Using archival Hubble Space Telescope (HST) Advanced Camera For Surveys (ACS) data, we have produced a catalog of luminous stars with photometric errors history (SFH) of the massive star population in M101. We examine how the build up of stars over the last 100 Myrs has proceeded both radially in the disk, and in the spiral arms and inter- arms. Our results indicate the presence of a radial age gradient in the disk with the youngest stars occurring at smaller radii. Comparing the SFHs in the arms to the inter-arms, we find that the star formation rates (SFR) are higher in the arms, by ˜ 1 dex, over the 100 Myr time. The cumulative star formation functions in the arm and inter-arms do not differ appreciably suggesting the arm and inter-arm populations have evolved coevally. We have determined the light curves for a large sample of the massive stars in M101 from the Large Binocular Telescope (LBT) nearby galaxy monitoring program. We have also obtained spectra of the visually brightest and most luminous variable sources with the multiple object spectrograph Hectospec on the Multiple Mirror Telescope and with the Multiple Object Dual Spectrograph on the LBT.

  7. The Rb problem in massive AGB stars.

    Science.gov (United States)

    Pérez-Mesa, V.; García-Hernández, D. A.; Zamora, O.; Plez, B.; Manchado, A.; Karakas, A. I.; Lugaro, M.

    2017-03-01

    The asymptotic giant branch (AGB) is formed by low- and intermediate-mass stars (0.8 M_{⊙} develop thermal pulses (TP) and suffer extreme mass loss. AGB stars are the main contributor to the enrichment of the interstellar medium (ISM) and thus to the chemical evolution of galaxies. In particular, the more massive AGB stars (M > 4 M_{⊙}) are expected to produce light (e.g., Li, N) and heavy neutron-rich s-process elements (such as Rb, Zr, Ba, Y, etc.), which are not formed in lower mass AGB stars and Supernova explosions. Classical chemical analyses using hydrostatic atmospheres revealed strong Rb overabundances and high [Rb/Zr] ratios in massive AGB stars of our Galaxy and the Magellanic Clouds (MC), confirming for the first time that the ^{22}Ne neutron source dominates the production of s-process elements in these stars. The extremely high Rb abundances and [Rb/Zr] ratios observed in the most massive stars (specially in the low-metallicity MC stars) uncovered a Rb problem; such extreme Rb and [Rb/Zr] values are not predicted by the s-process AGB models, suggesting fundamental problems in our present understanding of their atmospheres. We present more realistic dynamical model atmospheres that consider a gaseous circumstellar envelope with a radial wind and we re-derive the Rb (and Zr) abundances in massive Galactic AGB stars. The new Rb abundances and [Rb/Zr] ratios derived with these dynamical models significantly resolve the problem of the mismatch between the observations and the theoretical predictions of the more massive AGB stars.

  8. The Effects of Annealing and Discharging on the Characteristics of MgO Thin Films Prepared by Ion Beam-Assisted Deposition as a Protective Layer of AC-PDP

    Institute of Scientific and Technical Information of China (English)

    YU Zhinong; SUN Jian; XUE Wei; ZHENG Dexiu

    2007-01-01

    This study investigated the effects of annealing and discharging on the characteristics of MgO thin films prepared by ion beam-assisted deposition as a protective layer of AC-PDP. By an annealing process at a temperature of 450 °C for more than three hours, the crystallinity of the deposited MgO films was improved, but the surface of the (200)-oriented MgO thin films in the vicinity of the discharge electrodes, especially on the inner sides of the electrodes, was subjected to crack formation. The failure mechanism of the (200)-oriented MgO films was due to the compressive stress of MgO films plus the additional compressive stress induced by the differences in the coefficient of thermal expansion between the electrode and the dielectric layer. In the discharging process, all MgO films were eroded unevenly, and the serious erosion occurred near the edges of the discharge electrodes. ATM(atomic force microscopy) images show that the eroded surface of the (200)-oriented MgO thin film is smoother than that of the (lll)-oriented film. Also, the (200)-oriented MgO thin film shows an improved ability to resist ion erosion compared to the (lll)-oriented film.

  9. Preparation of Gold Nanoparticles Protected with Polyelectrolyte

    Institute of Scientific and Technical Information of China (English)

    Xu Ping SUN; Zhe Ling ZHANG; Bai Lin ZHANG; Xian Dui DONG; Shao Jun DONG; Er Kang WANG

    2003-01-01

    Gold nanoparticles were synthesized through the reduction of tetrachlorauric acid (HAuCl4) by NaBH4, with polyethyleneimine(PEI) as stabilizer. The nanoparticles were characterized by UV-vis spectroscopy and atomic force microscopy(AFM).

  10. Preliminary Failure Modes and Effects Analysis of the US Massive Gas Injection Disruption Mitigation System Design

    Energy Technology Data Exchange (ETDEWEB)

    Lee C. Cadwallader

    2013-10-01

    This report presents the results of a preliminary failure modes and effects analysis (FMEA) of a candidate design for the ITER Disruption Mitigation System. This candidate is the Massive Gas Injection System that provides machine protection in a plasma disruption event. The FMEA was quantified with “generic” component failure rate data as well as some data calculated from operating facilities, and the failure events were ranked for their criticality to system operation.

  11. Massively Parallel Algorithms for Solution of Schrodinger Equation

    Science.gov (United States)

    Fijany, Amir; Barhen, Jacob; Toomerian, Nikzad

    1994-01-01

    In this paper massively parallel algorithms for solution of Schrodinger equation are developed. Our results clearly indicate that the Crank-Nicolson method, in addition to its excellent numerical properties, is also highly suitable for massively parallel computation.

  12. Massive vulvar edema in pregnancy. A case report.

    Science.gov (United States)

    Jakobi, P; Friedman, M; Goldstein, I; Zaidise, I; Itskovitz-Eldor, J

    1995-06-01

    Massive vulvar edema in pregnancy is a rarely reported condition. We treated a case of severe labial edema complicating pregnancy. Massive edema of the vulva appears to usually be a sequela of an underlying, systemic disease in pregnant women.

  13. Massive MIMO Systems: Signal Processing Challenges and Research Trends

    OpenAIRE

    de Lamare, R.C.

    2013-01-01

    This article presents a tutorial on multiuser multiple-antenna wireless systems with a very large number of antennas, known as massive multi-input multi-output (MIMO) systems. Signal processing challenges and future trends in the area of massive MIMO systems are presented and key application scenarios are detailed. A linear algebra approach is considered for the description of the system and data models of massive MIMO architectures. The operational requirements of massive MIMO systems are di...

  14. Adapting algorithms to massively parallel hardware

    CERN Document Server

    Sioulas, Panagiotis

    2016-01-01

    In the recent years, the trend in computing has shifted from delivering processors with faster clock speeds to increasing the number of cores per processor. This marks a paradigm shift towards parallel programming in which applications are programmed to exploit the power provided by multi-cores. Usually there is gain in terms of the time-to-solution and the memory footprint. Specifically, this trend has sparked an interest towards massively parallel systems that can provide a large number of processors, and possibly computing nodes, as in the GPUs and MPPAs (Massively Parallel Processor Arrays). In this project, the focus was on two distinct computing problems: k-d tree searches and track seeding cellular automata. The goal was to adapt the algorithms to parallel systems and evaluate their performance in different cases.

  15. Frontiers in the Interiors of Massive Planets

    Science.gov (United States)

    Stevenson, David J.

    2008-03-01

    The understanding of structures of massive planets such as Jupiter and somewhat lower mass planets such as Uranus can help us tackle some of the central questions in planetary science, such as whether and how planets form. On a decadal timescale, NASA is spending billions of dollars on missions devoted to answering such questions. A crucial part of this understanding is the properties of materials under extreme conditions. Typical conditions inside Jupiter are megabars and ten thousand kelvin, accessible in lab experiment and through simulation. Typical materials are cosmically abundant hydrogen, helium, oxygen, carbon and nitrogen (in appropriate mixtures) and also Earthlike ("rock" and iron). Equation of state, including slopes of isentropes, etc, phase diagrams and transport properties (especially electrical conductivity) are of particular interest. I will describe some of the outstanding unsolved problems for planets, including extrasolar planets more massive than Jupiter.

  16. Massively Parallel Computing: A Sandia Perspective

    Energy Technology Data Exchange (ETDEWEB)

    Dosanjh, Sudip S.; Greenberg, David S.; Hendrickson, Bruce; Heroux, Michael A.; Plimpton, Steve J.; Tomkins, James L.; Womble, David E.

    1999-05-06

    The computing power available to scientists and engineers has increased dramatically in the past decade, due in part to progress in making massively parallel computing practical and available. The expectation for these machines has been great. The reality is that progress has been slower than expected. Nevertheless, massively parallel computing is beginning to realize its potential for enabling significant break-throughs in science and engineering. This paper provides a perspective on the state of the field, colored by the authors' experiences using large scale parallel machines at Sandia National Laboratories. We address trends in hardware, system software and algorithms, and we also offer our view of the forces shaping the parallel computing industry.

  17. Stability of Metal-Rich Massive Stars

    CERN Document Server

    White, Christopher J

    2014-01-01

    We revisit the stability of very massive main-sequence stars at solar metallicity, with the goal of understanding whether pulsations set a physical upper limit to stellar mass. Models of up to 938 solar masses are constructed with the MESA code, and their radial linear stability analysed with a nonadiabatic method following that of Castor. Despite uncertainty about the effects of convection on the linear growth rate, we conclude that even if the fundamental radial mode is unstable, the growth rate will be small. Consequently the amplitude at nonlinear saturation will also be small and not dangerous to the star. We demonstrate this for our most massive model by estimating the nonlinear parametric coupling to short-wavelength g modes. Although our stellar models are hydrostatic, the structure of their outer parts suggests that optically thick, radiatively driven winds are more likely to limit the main-sequence lifetime.

  18. Charged Black Holes in Massive Gravity's Rainbow

    CERN Document Server

    Hendi, S H; Panahiyan, S

    2016-01-01

    Violation of Lorentz invariancy in the high energy quantum gravity, motivates one to consider an energy dependent spacetime with massive deformation of standard general relativity. In this paper, we take into account an energy dependent metric in the context of a massive gravity model to obtain exact solutions. We investigate the geometry of the solutions and show that that there is a curvature singularity at the origin ($r=0$) which can be covered with an event horizon. We also calculate the conserved and thermodynamic quantities, which are fully reproduced by the analysis performed with the standard techniques. Finally, we examine the validity of the first law of thermodynamics. Next, we conduct a study regarding the positivity and negativity of total mass in de Sitter and anti de Sitter spacetime.

  19. Massive Predictive Modeling using Oracle R Enterprise

    CERN Document Server

    CERN. Geneva

    2014-01-01

    R is fast becoming the lingua franca for analyzing data via statistics, visualization, and predictive analytics. For enterprise-scale data, R users have three main concerns: scalability, performance, and production deployment. Oracle's R-based technologies - Oracle R Distribution, Oracle R Enterprise, Oracle R Connector for Hadoop, and the R package ROracle - address these concerns. In this talk, we introduce Oracle's R technologies, highlighting how each enables R users to achieve scalability and performance while making production deployment of R results a natural outcome of the data analyst/scientist efforts. The focus then turns to Oracle R Enterprise with code examples using the transparency layer and embedded R execution, targeting massive predictive modeling. One goal behind massive predictive modeling is to build models per entity, such as customers, zip codes, simulations, in an effort to understand behavior and tailor predictions at the entity level. Predictions...

  20. Metatarsal fracture leading to massive pulmonary embolism

    Directory of Open Access Journals (Sweden)

    Vikas Rajpurohit

    2017-01-01

    Full Text Available Immobilization and bed rest after fracture and orthopedic surgery are routinely advised protocol. Period of bed rest usually depends on the type of injury and orthopedic procedure, ranging from few days to weeks. The trauma, surgery, and immobilization with other contributing factors can lead to deep vein thrombosis and pulmonary embolism (PE in these patients. Although there is high incidence of PE in such patients, it is difficult to diagnose, primarily because of the variety of nonspecific signs and symptoms. Here, we discuss a case of a 30-year-old female, who had suffered a trivial roadside accident leading to metatarsal bone fracture and later on presented in emergency with seizures, pulmonary edema, and cardiac arrest, after immobilization of just 5 days which was diagnosed to be result of massive PE. Here, we will discuss the pathophysiology, risk factors, and management of massive PE.

  1. Path Integral Bosonization of Massive GNO Fermions

    CERN Document Server

    Park, Q H

    1997-01-01

    We show the quantum equivalence between certain symmetric space sine-Gordon models and the massive free fermions. In the massless limit, these fermions reduce to the free fermions introduced by Goddard, Nahm and Olive (GNO) in association with symmetric spaces $K/G$. A path integral formulation is given in terms of the Wess-Zumino-Witten action where the field variable $g$ takes value in the orthogonal, unitary, and symplectic representations of the group $G$ in the basis of the symmetric space. We show that, for example, such a path integral bosonization is possible when the symmetric spaces $K/G$ are $SU(N) the relation between massive GNO fermions and the nonabelian solitons, and explain the restriction imposed on the fermion mass matrix due to the integrability of the bosonic model.

  2. Carcinoma of the cervix with massive eosinophilia.

    Science.gov (United States)

    Lowe, D G

    1988-04-01

    Massive local eosinophilia of 100 or more eosinophils per high power field was found in 3.2% cases of invasive carcinoma of the cervix. The prevalence, length of history before presentation to surgery and histological features were similar in patients from Great Britain and Malawi, but in both populations the mean age at diagnosis was lower than in patients with cervical carcinomas without tissue eosinophilia. In some of the tumours, the malignant cells were very difficult to find because of the eosinophil infiltrate, and misinterpretation as an inflammatory lesion was possible. In the absence of circulating eosinophilia, cervical carcinomas with massive eosinophilia were found to have a better prognosis than tumours without. Five patients had circulating eosinophilia as well as local tumour eosinophil infiltration, and each of them had extensive tumour spread.

  3. Hierarchical Codebook Design for Massive MIMO

    Directory of Open Access Journals (Sweden)

    Xin Su

    2015-02-01

    Full Text Available The Research of Massive MIMO is an emerging area, since the more antennas the transmitters or receivers equipped with, the higher spectral efficiency and link reliability the system can provide. Due to the limited feedback channel, precoding and codebook design are important to exploit the performance of massive MIMO. To improve the precoding performance, we propose a novel hierarchical codebook with the Fourier-based perturbation matrices as the subcodebook and the Kerdock codebook as the main codebook, which could reduce storage and search complexity due to the finite a lphabet. Moreover, t o f urther r educe t he search complexity and feedback overhead without noticeable performance degradation, we use an adaptive selection algorithm to decide whether to use the subcodebook. Simulation results show that the proposed codebook has remarkable performance gain compared to the conventional Kerdock codebook, without significant increase in feedback overhead and search complexity.

  4. Very Massive Stars in the local Universe

    Science.gov (United States)

    Vink, Jorick S.; Heger, Alexander; Krumholz, Mark R.; Puls, Joachim; Banerjee, S.; Castro, N.; Chen, K.-J.; Chenè, A.-N.; Crowther, P. A.; Daminelli, A.; Gräfener, G.; Groh, J. H.; Hamann, W.-R.; Heap, S.; Herrero, A.; Kaper, L.; Najarro, F.; Oskinova, L. M.; Roman-Lopes, A.; Rosen, A.; Sander, A.; Shirazi, M.; Sugawara, Y.; Tramper, F.; Vanbeveren, D.; Voss, R.; Wofford, A.; Zhang, Y.

    2015-03-01

    Recent studies have claimed the existence of very massive stars (VMS) up to 300 M ⊙ in the local Universe. As this finding may represent a paradigm shift for the canonical stellar upper-mass limit of 150 M ⊙, it is timely to discuss the status of the data, as well as the far-reaching implications of such objects. We held a Joint Discussion at the General Assembly in Beijing to discuss (i) the determination of the current masses of the most massive stars, (ii) the formation of VMS, (iii) their mass loss, and (iv) their evolution and final fate. The prime aim was to reach broad consensus between observers and theorists on how to identify and quantify the dominant physical processes.

  5. Very massive stars in the local universe

    CERN Document Server

    2015-01-01

    This book presents the status of research on very massive stars in the Universe. While it has been claimed that stars with over 100 solar masses existed in the very early Universe, recent studies have also discussed the existence and deaths of stars up to 300 solar masses in the local Universe. This represents a paradigm shift for the stellar upper-mass limit, which may have major implications far beyond the field of stellar physics. The book comprises 7 chapters, which describe this discipline and provide sufficient background and introductory content for graduate (PhD) students and researchers from different branches of astronomy to be able to enter this exciting new field of very massive stars.

  6. Massive higher spins from BRST and tractors

    Science.gov (United States)

    Grigoriev, Maxim; Waldron, Andrew

    2011-12-01

    We obtain the higher spin tractor equations of motion conjectured by Gover et al. from a BRST approach and use those methods to prove that they describe massive, partially massless and massless higher spins in conformally flat backgrounds. The tractor description makes invariance under local choices of unit systems manifest. In this approach, physical models are described by conformal, rather than (pseudo-)Riemannian geometry. In particular masses become geometric quantities, namely the weights of tractor fields. Massive models can therefore be handled in a unified and simple manner mimicking the gauge principle usually employed for massless models. From a holographic viewpoint, these models describe both the bulk and boundary theories in terms of conformal geometry. This is an important advance, because tying the boundary conformal structure to that of the bulk theory gives greater control over a bulk-boundary correspondence.

  7. Massive Higher Spins from BRST and Tractors

    CERN Document Server

    Grigoriev, Maxim

    2011-01-01

    We obtain the higher spin tractor equations of motion conjectured by Gover et al. from a BRST approach and use those methods to prove that they describe massive, partially massless and massless higher spins in conformally flat backgrounds. The tractor description makes invariance under local choices of unit system manifest. In this approach, physical systems are described by conformal, rather than (pseudo-)Riemannian geometry. In particular masses become geometric quantities, namely the weights of tractor fields. Massive systems can therefore be handled in a unified and simple manner mimicking the gauge principle usually employed for massless models. From a holographic viewpoint, these models describe both the bulk and boundary theories in terms of conformal geometry. This is an important advance, because tying the boundary conformal structure to that of the bulk theory gives greater control over a bulk--boundary correspondence.

  8. How Massive Single Stars End their Life

    CERN Document Server

    Heger, A; Woosley, S E; Langer, N; Hartmann, D H

    2003-01-01

    How massive stars die -- what sort of explosion and remnant each produces -- depends chiefly on the masses of their helium cores and hydrogen envelopes at death. For single stars, stellar winds are the only means of mass loss, and these are chiefly a function of the metallicity of the star. We discuss how metallicity, and a simplified prescription for its effect on mass loss, affects the evolution and final fate of massive stars. We map, as a function of mass and metallicity, where black holes and neutron stars are likely to form and where different types of supernovae are produced. Integrating over an initial mass function, we derive the relative populations as a function of metallicity. Provided single stars rotate rapidly enough at death, we speculate upon stellar populations that might produce gamma-ray bursts and jet-driven supernovae.

  9. Cosmological Perturbations in Extended Massive Gravity

    CERN Document Server

    Gumrukcuoglu, A Emir; Lin, Chunshan; Mukohyama, Shinji; Trodden, Mark

    2013-01-01

    We study cosmological perturbations around self-accelerating solutions to two extensions of nonlinear massive gravity: the quasi-dilaton theory and the mass-varying theory. We examine stability of the cosmological solutions, and the extent to which the vanishing of the kinetic terms for scalar and vector perturbations of self-accelerating solutions in massive gravity is generic when the theory is extended. We find that these kinetic terms are in general non-vanishing in both extensions, though there are constraints on the parameters and background evolution from demanding that they have the correct sign. In particular, the self-accelerating solutions of the quasi-dilaton theory are always unstable to scalar perturbations with wavelength shorter than the Hubble length.

  10. Gravitational wave signal from massive gravity

    CERN Document Server

    Gumrukcuoglu, A Emir; Lin, Chunshan; Mukohyama, Shinji; Tanahashi, Norihiro

    2012-01-01

    We discuss the detectability of gravitational waves with a time dependent mass contribution, by means of the stochastic gravitational wave observations. Such a mass term typically arises in the cosmological solutions of massive gravity theories. We conduct the analysis based on a general quadratic action, and thus the results apply universally to any massive gravity theories in which modification of general relativity appears primarily in the tensor modes. The primary manifestation of the modification in the gravitational wave spectrum is a sharp peak. The position and height of the peak carry information on the present value of the mass term, as well as the duration of the inflationary stage. We also discuss the detectability of such a gravitational wave signal using the future-planned gravitational wave observatories.

  11. Massive ovarian edema, due to adjacent appendicitis.

    Science.gov (United States)

    Callen, Andrew L; Illangasekare, Tushani; Poder, Liina

    2017-04-01

    Massive ovarian edema is a benign clinical entity, the imaging findings of which can mimic an adnexal mass or ovarian torsion. In the setting of acute abdominal pain, identifying massive ovarian edema is a key in avoiding potential fertility-threatening surgery in young women. In addition, it is important to consider other contributing pathology when ovarian edema is secondary to another process. We present a case of a young woman presenting with subacute abdominal pain, whose initial workup revealed marked enlarged right ovary. Further imaging, diagnostic tests, and eventually diagnostic laparoscopy revealed that the ovarian enlargement was secondary to subacute appendicitis, rather than a primary adnexal process. We review the classic ultrasound and MRI imaging findings and pitfalls that relate to this diagnosis.

  12. Interaction of massive stars with their surroundings

    CERN Document Server

    Hensler, Gerhard

    2008-01-01

    Due to their short lifetimes but their enormous energy release in all stages of their lives massive stars are the major engines for the comic matter circuit. They affect not only their close environment but are also responsible to drive mass flows on galactic scales. Recent 2D models of radiation-driven and wind-blown HII regions are summarized which explore the impact of massive stars to the interstellar medium but find surprisingly small energy transfer efficiencies while an observable Carbon self-enrichment in the Wolf-Rayet phase is detected in the warm ionized gas. Finally, the focus is set on state-of-the-art modelling of HII regions and its present weaknesses with respect to uncertainties and simplifications but on a perspective of the requested art of their modelling in the 21st century.

  13. Nonlinear Properties of Vielbein Massive Gravity

    CERN Document Server

    Nibbelink, S G; Sexton, M; Nibbelink, Stefan Groot; Peloso, Marco; Sexton, Matthew

    2006-01-01

    We consider a special theory of massive gravity, which is obtained in a decoupling limit from a bi-gravity theory in the vielbein formulation, with only cosmological constant-like interactions between the two gravitational sectors. We investigate this theory using the Stueckelberg method, and construct a 't Hooft-Feynman gauge fixing in which the tensor, vector and scalar Stueckelberg fields are decoupled. We prove that this model has the softest possible ultraviolet behavior which can be expected from any generic (Lorentz invariant) theory of massive gravity, namely that it becomes strong only at the scale Lambda_3 = (m_g^2 M_P)^{1/3} . Finally, we confirm that also this model is plagued by a ghost instability, which, in the Stueckelberg formalism, arises from quartic scalar-vector and scalar-tensor interactions.

  14. Evolution and Nucleosynthesis of Very Massive Stars

    CERN Document Server

    Hirschi, Raphael

    2014-01-01

    In this chapter, after a brief introduction and overview of stellar evolution, we discuss the evolution and nucleosynthesis of very massive stars (VMS: M>100 solar masses) in the context of recent stellar evolution model calculations. This chapter covers the following aspects: general properties, evolution of surface properties, late central evolution, and nucleosynthesis including their dependence on metallicity, mass loss and rotation. Since very massive stars have very large convective cores during the main-sequence phase, their evolution is not so much affected by rotational mixing, but more by mass loss through stellar winds. Their evolution is never far from a homogeneous evolution even without rotational mixing. All VMS at metallicities close to solar end their life as WC(-WO) type Wolf-Rayet stars. Due to very important mass loss through stellar winds, these stars may have luminosities during the advanced phases of their evolution similar to stars with initial masses between 60 and 120 solar masses. A...

  15. Superdense massive galaxies in the Nearby Universe

    CERN Document Server

    Trujillo, Ignacio; de Lorenzo-Caceres, Adriana; Vazdekis, Alexandre; de la Rosa, Ignacio G; Cava, Antonio

    2009-01-01

    Superdense massive galaxies (r_e~1 kpc; M~10^{11} Msun) were common in the early universe (z>1.5). Within some hierarchical merging scenarios, a non-negligible fraction (1-10%) of these galaxies is expected to survive since that epoch retaining their compactness and presenting old stellar populations in the present universe. Using the NYU Value-Added Galaxy Catalog from the SDSS Data Release 6 we find only a tiny fraction of galaxies (~0.03%) with r_e8x10^{10} Msun in the local Universe (z<0.2). Surprinsingly, they are relatively young (~2 Gyr) and metal-rich ([Z/H]~0.2). The consequences of these findings within the current two competing size evolution scenarios for the most massive galaxies ("dry" mergers vs "puffing up" due to quasar activity) are discussed.

  16. Exact Spherically Symmetric Solutions in Massive Gravity

    CERN Document Server

    Berezhiani, Z; Nesti, F; Pilo, L

    2008-01-01

    A phase of massive gravity free from pathologies can be obtained by coupling the metric to an additional spin-two field. We study the gravitational field produced by a static spherically symmetric body, by finding the exact solution that generalizes the Schwarzschild metric to the case of massive gravity. Besides the usual 1/r term, the main effects of the new spin-two field are a shift of the total mass of the body and the presence of a new power-like term, with sizes determined by the mass and the shape (the radius) of the source. These modifications, being source dependent, give rise to a dynamical violation of the Strong Equivalence Principle. Depending on the details of the coupling of the new field, the power-like term may dominate at large distances or even in the ultraviolet. The effect persists also when the dynamics of the extra field is decoupled.

  17. Deployment and Implementation Strategies for Massive MIMO in 5G

    DEFF Research Database (Denmark)

    Panzner, Berthold; Zirwas, Wolfgang; Dierks, Stefan

    2015-01-01

    Massive MIMO has emerged as one technology enabler for the next generation mobile communications 5G. The gains promised by massive MIMO are augured to overcome the capacity crunch in today's mobile networks and to pave the way for the ambitious targets of 5G. The challenge to realize massive MIMO...

  18. Which massive stars are gamma-ray burst progenitors?

    NARCIS (Netherlands)

    Petrovic, J.; Langer, N.; Yoon, S.C.; Heger, A.

    2005-01-01

    The collapsar model for gamma-ray bursts requires three essential ingredients: a massive core, removal of the hydrogen envelope, and enough angular momentum in the core. We study current massive star evolution models of solar metallicity to determine which massive star physics is capable of

  19. Pre-supernova mass loss predictions for massive stars

    NARCIS (Netherlands)

    J.S. Vink; A. de Koter; R. Kotak

    2006-01-01

    Massive stars and supernovae (SNe) have a huge impact on their environment. Despite their importance, a comprehensive knowledge of which massive stars produce which SNe is hitherto lacking. We use a Monte Carlo method to predict the mass-loss rates of massive stars in the Hertzsprung-Russell Diagram

  20. Non Pauli-Fierz Massive Gravitons

    CERN Document Server

    Dvali, Gia; Redi, Michele

    2008-01-01

    We study general Lorentz invariant theories of massive gravitons. We show that, contrary to the standard lore, there exist consistent theories where the graviton mass term violates Pauli-Fierz structure. For theories where the graviton is a resonance this does not imply the existence of a scalar ghost if the deviation from Pauli-Fierz becomes sufficiently small at high energies. These types of mass terms are required by any consistent realization of the DGP model in higher dimension.

  1. Massive upper gastrointestinal bleed from epiphrenic diverticulum.

    Science.gov (United States)

    Garcia, Cesar J; Dias, Ajoy; Hejazi, Reza A; Burgos, Jose D; Huerta, Ana; Zuckerman, Marc J

    2011-05-01

    Epiphrenic diverticula are outpouchings of the esophagus that retain some or all layers of the esophageal wall. Symptoms such as intermittent dysphagia and vomiting may occur. The authors present a case of an elderly woman with a history of dysphagia who presented with a massive upper gastrointestinal bleed because of a bleeding epiphrenic diverticulum seen at endoscopy who responded to conservative management. Bleeding epiphrenic diverticula should be considered as a cause of upper gastrointestinal bleeding.

  2. Response of massive bodies to gravitational waves

    CERN Document Server

    Hannibal, L; Hannibal, Ludger; Warkall, Jens

    2000-01-01

    The repsonse of a massive body to gravitational waves is decribed on the microscopic level, taking the metric perturbations of the electromagnetic and gravitational forces into account. The effects found substantially differ from those obtained in the commonly used oscillator model. The electromagnetic coupling induces a dominant surface effect, the gravitational coupling gives rise to the excitation of quadrupole modes, but several oredes of magnitude smaller.

  3. Antenna Splitting Functions for Massive Particles

    Energy Technology Data Exchange (ETDEWEB)

    Larkoski, Andrew J.; Peskin, Michael E.; /SLAC

    2011-06-22

    An antenna shower is a parton shower in which the basic move is a color-coherent 2 {yields} 3 parton splitting process. In this paper, we give compact forms for the spin-dependent antenna splitting functions involving massive partons of spin 0 and spin 1/2. We hope that this formalism we have presented will be useful in describing the QCD dynamics of the top quark and other heavy particles at LHC.

  4. Massively parallel evolutionary computation on GPGPUs

    CERN Document Server

    Tsutsui, Shigeyoshi

    2013-01-01

    Evolutionary algorithms (EAs) are metaheuristics that learn from natural collective behavior and are applied to solve optimization problems in domains such as scheduling, engineering, bioinformatics, and finance. Such applications demand acceptable solutions with high-speed execution using finite computational resources. Therefore, there have been many attempts to develop platforms for running parallel EAs using multicore machines, massively parallel cluster machines, or grid computing environments. Recent advances in general-purpose computing on graphics processing units (GPGPU) have opened u

  5. Quantization of massive Weyl fields in vacuum

    CERN Document Server

    Dvornikov, Maxim

    2013-01-01

    We briefly review the main methods for the description of massive Weyl fields in vacuum. On the classical level we discuss Weyl fields expressed through Grassmann variables as well as having spinors with commuting components. In both approaches we quantize the system. We get the correct anticommutation relations between creation and annihilation operators, which result in the proper form of the total energy of the field. However, the commuting classical Weyl fields require the new method of quantization.

  6. Scalable services for massively multiplayer online games

    OpenAIRE

    Veron, Maxime Pierre Andre

    2015-01-01

    Massively Multi-player Online Games (MMOGs) aim at gathering an infinite number ofplayers within the same virtual universe. Yet all existing MMOGs rely on centralizedclient/server architectures which impose a limit on the maximum number of players(avatars) and resources that can coexist in any given virtual universe. This thesisaims at proposing solutions to improve the scalability of MMOGs.There are many variants of MMOGs, like role playing games (MMORPGs), first personshooters (MMOFPSs), an...

  7. Phenomenology in minimal theory of massive gravity

    Energy Technology Data Exchange (ETDEWEB)

    Felice, Antonio De [Yukawa Institute for Theoretical Physics, Kyoto University,606-8502, Kyoto (Japan); Mukohyama, Shinji [Yukawa Institute for Theoretical Physics, Kyoto University,606-8502, Kyoto (Japan); Kavli Institute for the Physics and Mathematics of the Universe (WPI), University of Tokyo,277-8583, Chiba (Japan)

    2016-04-15

    We investigate the minimal theory of massive gravity (MTMG) recently introduced. After reviewing the original construction based on its Hamiltonian in the vielbein formalism, we reformulate it in terms of its Lagrangian in both the vielbein and the metric formalisms. It then becomes obvious that, unlike previous attempts in the literature of Lorentz-violating massive gravity, not only the potential but also the kinetic structure of the action is modified from the de Rham-Gabadadze-Tolley (dRGT) massive gravity theory. We confirm that the number of physical degrees of freedom in MTMG is two at fully nonlinear level. This proves the absence of various possible pathologies such as superluminality, acausality and strong coupling. Afterwards, we discuss the phenomenology of MTMG in the presence of a dust fluid. We find that on a flat homogeneous and isotropic background we have two branches. One of them (self-accelerating branch) naturally leads to acceleration without the genuine cosmological constant or dark energy. For this branch both the scalar and the vector modes behave exactly as in general relativity (GR). The phenomenology of this branch differs from GR in the tensor modes sector, as the tensor modes acquire a non-zero mass. Hence, MTMG serves as a stable nonlinear completion of the self-accelerating cosmological solution found originally in dRGT theory. The other branch (normal branch) has a dynamics which depends on the time-dependent fiducial metric. For the normal branch, the scalar mode sector, even though as in GR only one scalar mode is present (due to the dust fluid), differs from the one in GR, and, in general, structure formation will follow a different phenomenology. The tensor modes will be massive, whereas the vector modes, for both branches, will have the same phenomenology as in GR.

  8. Magnetic fields and massive star formation

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Qizhou; Keto, Eric; Ho, Paul T. P.; Ching, Tao-Chung; Chen, How-Huan [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Qiu, Keping [School of Astronomy and Space Science, Nanjing University, 22 Hankou Road, Nanjing 210093 (China); Girart, Josep M.; Juárez, Carmen [Institut de Ciències de l' Espai, (CSIC-IEEC), Campus UAB, Facultat de Ciències, C5p 2, E-08193 Bellaterra, Catalonia (Spain); Liu, Hauyu; Tang, Ya-Wen; Koch, Patrick M.; Rao, Ramprasad; Lai, Shih-Ping [Academia Sinica Institute of Astronomy and Astrophysics, P.O. Box 23-141, Taipei 106, Taiwan (China); Li, Zhi-Yun [Department of Astronomy, University of Virginia, P.O. Box 400325, Charlottesville, VA 22904 (United States); Frau, Pau [Observatorio Astronómico Nacional, Alfonso XII, 3 E-28014 Madrid (Spain); Li, Hua-Bai [Department of Physics, The Chinese University of Hong Kong, Hong Kong (China); Padovani, Marco [Laboratoire de Radioastronomie Millimétrique, UMR 8112 du CNRS, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Bontemps, Sylvain [OASU/LAB-UMR5804, CNRS, Université Bordeaux 1, F-33270 Floirac (France); Csengeri, Timea, E-mail: qzhang@cfa.harvard.edu [Max Planck Institute for Radioastronomy, Auf dem Hügel 69, D-53121 Bonn (Germany)

    2014-09-10

    Massive stars (M > 8 M {sub ☉}) typically form in parsec-scale molecular clumps that collapse and fragment, leading to the birth of a cluster of stellar objects. We investigate the role of magnetic fields in this process through dust polarization at 870 μm obtained with the Submillimeter Array (SMA). The SMA observations reveal polarization at scales of ≲0.1 pc. The polarization pattern in these objects ranges from ordered hour-glass configurations to more chaotic distributions. By comparing the SMA data with the single dish data at parsec scales, we found that magnetic fields at dense core scales are either aligned within 40° of or perpendicular to the parsec-scale magnetic fields. This finding indicates that magnetic fields play an important role during the collapse and fragmentation of massive molecular clumps and the formation of dense cores. We further compare magnetic fields in dense cores with the major axis of molecular outflows. Despite a limited number of outflows, we found that the outflow axis appears to be randomly oriented with respect to the magnetic field in the core. This result suggests that at the scale of accretion disks (≲ 10{sup 3} AU), angular momentum and dynamic interactions possibly due to close binary or multiple systems dominate over magnetic fields. With this unprecedentedly large sample of massive clumps, we argue on a statistical basis that magnetic fields play an important role during the formation of dense cores at spatial scales of 0.01-0.1 pc in the context of massive star and cluster star formation.

  9. Massive Multi-Agent Systems Control

    Science.gov (United States)

    Campagne, Jean-Charles; Gardon, Alain; Collomb, Etienne; Nishida, Toyoaki

    2004-01-01

    In order to build massive multi-agent systems, considered as complex and dynamic systems, one needs a method to analyze and control the system. We suggest an approach using morphology to represent and control the state of large organizations composed of a great number of light software agents. Morphology is understood as representing the state of the multi-agent system as shapes in an abstract geometrical space, this notion is close to the notion of phase space in physics.

  10. Very Massive Stars and the Eddington Limit

    CERN Document Server

    Crowther, Paul A; Walborn, Nolan R; Yusof, N

    2012-01-01

    We use contemporary evolutionary models for Very Massive Stars (VMS) to assess whether the Eddington limit constrains the upper stellar mass limit. We also consider the interplay between mass and age for the wind properties and spectral morphology of VMS, with reference to the recently modified classification scheme for O2-3.5If*/WN stars. Finally, the death of VMS in the local universe is considered in the context of pair instability supernovae.

  11. Massive thin accretion discs. Pt. 2; Polarization

    Energy Technology Data Exchange (ETDEWEB)

    Laor, A.; Netzer, H. (Tel Aviv Univ. (Israel)); Piran, T. (Hebrew Univ., Jerusalem (Israel). Racah Inst. of Physics)

    1990-02-15

    Thin accretion discs around massive black holes are believed to produce much of the observed optical-UV emission from AGN. Classical calculations predict that this radiation is highly polarized at large inclination angles, in contrast to observations of quasars and Seyfert galaxies. We have calculated the spectrum and polarization of such discs using an improved radiative transfer method with all the relevant opacity sources, and a full general relativistic treatment of the radiation propagation. (author).

  12. Massive hydrothorax following subclavian vein catheterization

    OpenAIRE

    Omar, Hesham R.; fathy, Ahmad; Elghonemy, Mohamed; Rashad, Rania; Helal, Engy; Mangar, Devanand; Camporesi, Enrico

    2010-01-01

    Since the introduction of central venous catheterization for monitoring of the venous pressure, fluid infusion and hyperalimentation, the literature has been full of serious life-threatening complications. Of these complications is the false positioning of the central venous catheter and subsequent development of pleural effusion. In this report we are describing a case of iatrogenic massive pleural effusion following subclavian vein catheterization necessitating intercostal tube drainage and...

  13. Generalised matter couplings in massive bigravity

    OpenAIRE

    2016-01-01

    We investigate matter couplings in massive bigravity. We find a new family of such consistent couplings, including and extending known consistent matter couplings, and we investigate their decoupling limits, ADM decompositions, Higuchi bounds and further aspects. We show that differences to previous known consistent couplings only arise beyond the $\\Lambda_3$ decoupling limit and discuss the uniqueness of consistent matter couplings and how this is related to the so-called symmetric vielbein ...

  14. Thoracic Cavernous Lymphangioma Provoking Massive Chyloptysis

    Directory of Open Access Journals (Sweden)

    Robert Ferguson MD

    2013-09-01

    Full Text Available Chyloptysis is a relatively rare embodiment of disease that encompasses a lengthy differential and provides many diagnostic and therapeutic challenges. Presented here is the case of a young woman with massive chyloptysis due to a thoracic cavernous lymphangioma arising in the peripartum period. The severity of her condition mandated the use of cardiopulmonary bypass to resect her lymphangioma. We believe that the extent of her symptoms, etiology of disease, and surgical management represent a unique scenario in the literature.

  15. M2M massive wireless access

    DEFF Research Database (Denmark)

    Zanella, Andrea; Zorzi, Michele; Santos, André F.

    2013-01-01

    of the current cellular standards. Here, we provide insights and introduce potential solutions for the cellular radio protocol that will allow the efficient support of Machine-to-Machine (M2M) communications. The paper focuses on the massive aspect of M2M. We will introduce PHY and MAC approaches such as Coded...... and research guidelines for enabling future networks to support efficiently M2M communications....

  16. Theoretical Developments in Understanding Massive Star Formation

    Science.gov (United States)

    Yorke, Harold W.; Bodenheimer, Peter

    2007-01-01

    Except under special circumstances massive stars in galactic disks will form through accretion. The gravitational collapse of a molecular cloud core will initially produce one or more low mass quasi-hydrostatic objects of a few Jupiter masses. Through subsequent accretion the masses of these cores grow as they simultaneously evolve toward hydrogen burning central densities and temperatures. We review the evolution of accreting (proto-)stars, including new results calculated with a publicly available stellar evolution code written by the authors.

  17. Massive graph visualization : LDRD final report.

    Energy Technology Data Exchange (ETDEWEB)

    Wylie, Brian Neil; Moreland, Kenneth D.

    2007-10-01

    Graphs are a vital way of organizing data with complex correlations. A good visualization of a graph can fundamentally change human understanding of the data. Consequently, there is a rich body of work on graph visualization. Although there are many techniques that are effective on small to medium sized graphs (tens of thousands of nodes), there is a void in the research for visualizing massive graphs containing millions of nodes. Sandia is one of the few entities in the world that has the means and motivation to handle data on such a massive scale. For example, homeland security generates graphs from prolific media sources such as television, telephone, and the Internet. The purpose of this project is to provide the groundwork for visualizing such massive graphs. The research provides for two major feature gaps: a parallel, interactive visualization framework and scalable algorithms to make the framework usable to a practical application. Both the frameworks and algorithms are designed to run on distributed parallel computers, which are already available at Sandia. Some features are integrated into the ThreatView{trademark} application and future work will integrate further parallel algorithms.

  18. The early evolution of massive black holes

    CERN Document Server

    Volonteri, Marta

    2009-01-01

    Massive black holes are nowadays believed to reside in most local galaxies. Studies have also established a number of relations between the MBH mass and properties of the host galaxy such as bulge mass and velocity dispersion. These results suggest that central MBHs, while much less massive than the host (~0.1%), are linked to the evolution of galactic structure. When did it all start? In hierarchical cosmologies, a single big galaxy today can be traced back to the stage when it was split up in hundreds of smaller components. Did MBH seeds form with the same efficiency in small proto-galaxies, or did their formation had to await the buildup of substantial galaxies with deeper potential wells? I briefly review here some of the physical processes that are conducive to the evolution of the massive black hole population. I will discuss black hole formation processes for `seed' black holes that are likely to place at early cosmic epochs, and possible observational tests of these scenarios.

  19. Propagation peculiarities of mean field massive gravity

    Directory of Open Access Journals (Sweden)

    S. Deser

    2015-10-01

    Full Text Available Massive gravity (mGR describes a dynamical “metric” on a fiducial, background one. We investigate fluctuations of the dynamics about mGR solutions, that is about its “mean field theory”. Analyzing mean field massive gravity (m‾GR propagation characteristics is not only equivalent to studying those of the full non-linear theory, but also in direct correspondence with earlier analyses of charged higher spin systems, the oldest example being the charged, massive spin 3/2 Rarita–Schwinger (RS theory. The fiducial and mGR mean field background metrics in the m‾GR model correspond to the RS Minkowski metric and external EM field. The common implications in both systems are that hyperbolicity holds only in a weak background-mean-field limit, immediately ruling both theories out as fundamental theories; a situation in stark contrast with general relativity (GR which is at least a consistent classical theory. Moreover, even though both m‾GR and RS theories can still in principle be considered as predictive effective models in the weak regime, their lower helicities then exhibit superluminal behavior: lower helicity gravitons are superluminal as compared to photons propagating on either the fiducial or background metric. Thus our approach has uncovered a novel, dispersive, “crystal-like” phenomenon of differing helicities having differing propagation speeds. This applies both to m‾GR and mGR, and is a peculiar feature that is also problematic for consistent coupling to matter.

  20. The Stellar Halos of Massive Elliptical Galaxies

    CERN Document Server

    Greene, Jenny E; Comerford, Julia M; Gebhardt, Karl; Adams, Joshua J

    2012-01-01

    We use the Mitchell Spectrograph (formerly VIRUS-P) on the McDonald Observatory 2.7m Harlan J. Smith Telescope to search for the chemical signatures of massive elliptical galaxy assembly. The Mitchell Spectrograph is an integral-field spectrograph with a uniquely wide field of view (107x107 sq arcsec), allowing us to achieve remarkably high signal-to-noise ratios of ~20-70 per pixel in radial bins of 2-2.5 times the effective radii of the eight galaxies in our sample. Focusing on a sample of massive elliptical galaxies with stellar velocity dispersions sigma* > 150 km/s, we study the radial dependence in the equivalent widths (EWs) of key metal absorption lines. By twice the effective radius, the Mgb EWs have dropped by ~50%, and only a weak correlation between sigma* and Mgb EW remains. The Mgb EWs at large radii are comparable to those seen in the centers of elliptical galaxies that are approximately an order of magnitude less massive. We find that the well-known metallicity gradients often observed within ...

  1. Massive Stars in the Quintuplet Cluster

    CERN Document Server

    Figer, D F; Morris, M; Figer, Donald F.; Lean, Ian S. Mc

    1999-01-01

    We present near-infrared photometry and K-band spectra of newly-identified massive stars in the Quintuplet Cluster, one of the three massive clusters projected within 50 pc of the Galactic Center. We find that the cluster contains a variety of massive stars, including more unambiguously identified Wolf-Rayet stars than any cluster in the Galaxy, and over a dozen stars in earlier stages of evolution, i.e., LBV, Ofpe/WN9, and OB supergiants. One newly identified star is the second ``Luminous Blue Variable'' in the cluster, after the ``Pistol Star.'' Given the evolutionary stages of the identified stars, the cluster appears to be about 4 \\pm 1 Myr old, assuming coeval formation. The total mass in observed stars is $\\sim 10^3 \\Msun$, and the implied mass is initial mass function. The implied mass density in stars is at least a few thousand $\\Msun pc^{-3}$. The newly-identified stars increase the estimated ionizing flux from this cluster by about an order of magnitude with respect to earlier estimates, to 10^{50.9...

  2. Effects of massive transfusion on oxygen availability

    Directory of Open Access Journals (Sweden)

    José Otávio Costa Auler Jr

    Full Text Available OBJECTIVE: To determine oxygen derived parameters, hemodynamic and biochemical laboratory data (2,3 Diphosphoglycerate, lactate and blood gases analysis in patients after cardiac surgery who received massive blood replacement. DESIGN: Prospective study. SETTING: Heart Institute (Instituto do Coração, Hospital das Clínicas, Faculdade de Medicina, Universidade de São Paulo, Brazil. PARTICIPANTS: Twelve patients after cardiac surgery who received massive transfusion replacement; six of them evolved to a fatal outcome within the three-day postoperative follow-up. MEASUREMENTS AND MAIN RESULTS: The non-survivors group (n=6 presented high lactate levels and low P50 levels, when compared to the survivors group (p<0.05. Both groups presented an increase in oxygen consumption and O2 extraction, and there were no significant differences between them regarding these parameters. The 2,3 DPG levels were slightly reduced in both groups. CONCLUSIONS: This study shows that patients who are massively transfused following cardiovascular surgery present cell oxygenation disturbances probably as a result of O2 transport inadequacy.

  3. Forming Compact Massive Galaxies at z~2

    CERN Document Server

    van Dokkum, Pieter G; Franx, Marijn; Momcheva, Ivelina; Brammer, Gabriel; Schreiber, Natascha M Forster; Skelton, Rosalind E; Whitaker, Katherine E; van der Wel, Arjen; Bezanson, Rachel; Fumagalli, Mattia; Kriek, Mariska; Leja, Joel; Wuyts, Stijn

    2015-01-01

    In this paper we study a key phase in the formation of massive galaxies: the transition of star forming galaxies into massive (M_stars~10^11 Msun), compact (r_e~1 kpc) quiescent galaxies, which takes place from z~3 to z~1.5. We use HST grism redshifts and extensive photometry in all five 3D-HST/CANDELS fields, more than doubling the area used previously for such studies, and combine these data with Keck MOSFIRE and NIRSPEC spectroscopy. We first confirm that a population of massive, compact, star forming galaxies exists at z~2, using K-band spectroscopy of 25 of these objects at 2.0

  4. On the formation of massive stellar clusters

    CERN Document Server

    Tenorio-Tagle, G; Silich, S A; Medina-Tanco, G A; Muñoz-Tunón, C; Tenorio-Tagle, Guillermo; Palous, Jan; Silich, Sergiy; Medina-Tanco, Gustavo A.; Munoz-Tunon, Casiana

    2003-01-01

    Here we model a star forming factory in which the continuous creation of stars results in a highly concentrated, massive (globular cluster-like) stellar system. We show that under very general conditions a large-scale gravitational instability in the ISM, which triggers the collapse of a massive cloud, leads with the aid of a spontaneous first generation of massive stars, to a standing, small-radius, cold and dense shell. Eventually, as more of the collapsing matter is processed and incorporated, the shell becomes gravitationally unstable and begins to fragment, allowing the formation of new stars, while keeping its location. This is due to a detailed balance established between the ram pressure from the collapsing cloud which, together with the gravitational force exerted on the shell by the forming cluster, acts against the mechanical energy deposited by the collection of new stars. We analyze the mass spectrum of fragments that result from the continuous fragmentation of the standing shell and show that it...

  5. Massive transfusion protocols: current best practice

    Directory of Open Access Journals (Sweden)

    Hsu YM

    2016-03-01

    Full Text Available Yen-Michael S Hsu,1 Thorsten Haas,2 Melissa M Cushing1 1Department of Pathology and Laboratory Medicine, Weill Cornell Medical College, New York, NY, USA; 2Department of Anesthesia, University Children's Hospital Zurich, Zurich, Switzerland Abstract: Massive transfusion protocols (MTPs are established to provide rapid blood replacement in a setting of severe hemorrhage. Early optimal blood transfusion is essential to sustain organ perfusion and oxygenation. There are many variables to consider when establishing an MTP, and studies have prospectively evaluated different scenarios and patient populations to establish the best practices to attain improved patient outcomes. The establishment and utilization of an optimal MTP is challenging given the ever-changing patient status during resuscitation efforts. Much of the MTP literature comes from the trauma population, due to the fact that massive hemorrhage is the leading cause of preventable trauma-related death. As we come to further understand the positive and negative clinical impacts of transfusion-related factors, massive transfusion practice can be further refined. This article will first discuss specific MTPs targeting different patient populations and current relevant international guidelines. Then, we will examine a wide selection of therapeutic products to support MTPs, including newly available products and the most suitable of the traditional products. Lastly, we will discuss the best design for an MTP, including ratio-based MTPs and MTPs based on the use of point-of-care coagulation diagnostic tools. Keywords: hemorrhage, MTP, antifibrinolytics, coagulopathy, trauma, ratio, logistics, guidelines, hemostatic

  6. Does massive gravity have viable cosmologies?

    CERN Document Server

    Solomon, Adam R; Akrami, Yashar; Koivisto, Tomi S; Könnig, Frank; Mörtsell, Edvard

    2015-01-01

    Massive gravity has a well-known no-go theorem forbidding flat FLRW solutions; other solutions are unstable, seemingly ruling out the possibility of homogeneous and isotropic massive cosmology. Recently, de Rham, Heisenberg, and Ribeiro showed that this can be overcome if matter is coupled to both the spacetime metric and the reference metric, reopening the possibilities for cosmology with a single, massive graviton. It is shown that this proof, however, relies crucially on the existence of a scalar field or some other nonstandard matter, while a universe filled with only dust or radiation faces the same no-go restriction as in the original theory. Unusually, the total density, pressure, and Einstein-frame Friedmann equation are completely determined in terms of the scale factor, independent of the matter content; the physical Hubble rate, however, does not have this property. In the presence of a scalar, these models possess pathological evolution at both early and late times, unless the scalar has a highly ...

  7. Preparation of Spirocyclic β-Proline Esters

    DEFF Research Database (Denmark)

    Fjelbye, Kasper; Marigo, Mauro; Clausen, Rasmus Prætorius

    2017-01-01

    A series of novel N-Bn-protected spirocyclic β-proline esters were prepared using [3+2] cycloaddition and subsequently converted into their corresponding aldehydes. In addition, two novel N-Cbz-protected spirocyclic β-proline esters were prepared using intramolecular cyclization starting from...

  8. Massive Stars in the Quintuplet Cluster

    Science.gov (United States)

    Figer, Donald F.; McLean, Ian S.; Morris, Mark

    1999-03-01

    We present near-infrared photometry and K-band spectra of newly identified massive stars in the Quintuplet cluster, one of the three massive clusters projected within 50 pc of the Galactic center. We find that the cluster contains a variety of massive stars, including more unambiguously identified Wolf-Rayet stars than any cluster in the Galaxy, and over a dozen stars in earlier stages of evolution, i.e., luminous blue variables (LBVs), Ofpe/WN9, and OB supergiants. One newly identified star is the second luminous blue variable in the cluster, after the ``Pistol star.'' Although we are unable to provide certain spectral classifications for the five enigmatic Quintuplet-proper members, we tentatively propose that they are extremely dusty versions of the WC stars found elsewhere in the cluster and similar to the dozen or so known examples in the Galaxy. Although the cluster parameters are uncertain because of photometric errors and uncertainties in stellar models, i.e., extrapolating initial masses and estimating ionizing fluxes, we have the following conclusions. Given the evolutionary stages of the identified stars, the cluster appears to be about 4+/-1 Myr old, assuming coeval formation. The total mass in observed stars is ~103 Msolar, and the implied mass is ~104 Msolar, assuming a lower mass cutoff of 1 Msolar and a Salpeter initial mass function. The implied mass density in stars is greater than or similar to a few thousand Msolar pc-3. The newly identified stars increase the estimated ionizing flux from this cluster by about an order of magnitude with respect to earlier estimates, to 1050.9 photons s-1, or roughly what is required to ionize the nearby ``Sickle'' H II region (G0.18-0.04). The total luminosity from the massive cluster stars is ~107.5 Lsolar, enough to account for the heating of the nearby molecular cloud, M0.20-0.033. We propose a picture that integrates most of the major features in this part of the sky, excepting the nonthermal filaments. We

  9. On General Relativity with Massive Graviton

    Science.gov (United States)

    Berezhiani, Lasha

    We begin this thesis by studying the properties of horizons in the de Rham-Gabadadze-Tolley model of massive GR. In massive gravity the generic black hole (BH) solutions on Minkowski space happen to convert horizons into a certain type of singularities. Here we explore whether these singularities can be avoided if space-time is not asymptotically Minkowskian. We find an exact analytic BH solution which evades the above problem by a transition at large scales to self-induced de Sitter (dS) space-time, with the curvature scale set by the graviton mass. The solution demonstrates that in massive GR, in the Schwarzschild coordinate system, a BH metric has to be accompanied by the Stückelberg fields with nontrivial backgrounds to prevent the horizons to convert into the singularities. We also find an analogous solution for a Reissner-Nordström BH on dS space. The second part concerns with the geometrical construction of massive gravity. Namely, the theory of gravity with an auxiliary extra dimension is known to give a ghost-free cubic completion of the Fierz-Pauli mass term in the decoupling limit. Yet, the theory propagates ghost in quartic order and beyond. Our work proposes a completion of the boundary condition in the auxiliary dimension that avoids ghosts order-by-order in the decoupling limit. Furthermore, we show that the multi-dimensional extension, with the rotationally invariant boundaries of the bulk, is equivalent to the model with a single auxiliary dimension. Therefore, all these constructions require the appropriate adjustment of the boundary condition. The other possible extension of the original model, by the Gauss-Bonnet term, is studied as well. In the last part we analyze the models known as "gravitational Higgs theories" against instabilities. We show that these models, although seemingly different from the effective field theories of massive gravity, are in fact equivalent to them. We also show the equivalence between the non-covariant mode

  10. On the Formation of Massive Stars

    Science.gov (United States)

    Yorke, Harold W.; Sonnhalter, Cordula

    2002-01-01

    We calculate numerically the collapse of slowly rotating, nonmagnetic, massive molecular clumps of masses 30,60, and 120 Stellar Mass, which conceivably could lead to the formation of massive stars. Because radiative acceleration on dust grains plays a critical role in the clump's dynamical evolution, we have improved the module for continuum radiation transfer in an existing two-dimensional (axial symmetry assumed) radiation hydrodynamic code. In particular, rather than using "gray" dust opacities and "gray" radiation transfer, we calculate the dust's wavelength-dependent absorption and emission simultaneously with the radiation density at each wavelength and the equilibrium temperatures of three grain components: amorphous carbon particles. silicates, and " dirty ice " -coated silicates. Because our simulations cannot spatially resolve the innermost regions of the molecular clump, however, we cannot distinguish between the formation of a dense central cluster or a single massive object. Furthermore, we cannot exclude significant mass loss from the central object(s) that may interact with the inflow into the central grid cell. Thus, with our basic assumption that all material in the innermost grid cell accretes onto a single object. we are able to provide only an upper limit to the mass of stars that could possibly be formed. We introduce a semianalytical scheme for augmenting existing evolutionary tracks of pre-main-sequence protostars by including the effects of accretion. By considering an open outermost boundary, an arbitrary amount of material could, in principal, be accreted onto this central star. However, for the three cases considered (30, 60, and 120 Stellar Mass originally within the computation grid), radiation acceleration limited the final masses to 3 1.6, 33.6, and 42.9 Stellar Mass, respectively, for wavelength-dependent radiation transfer and to 19.1, 20.1, and 22.9 Stellar Mass. for the corresponding simulations with gray radiation transfer. Our

  11. Thermodynamics inducing massive particles' tunneling and cosmic censorship

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Baocheng [Chinese Academy of Sciences, State Key Laboratory of Magnetic Resonances and Atomic and Molecular Physics, Wuhan Institute of Physics and Mathematics, Wuhan (China); Graduate University of Chinese Academy of Sciences, Beijing (China); Cai, Qing-yu [Chinese Academy of Sciences, State Key Laboratory of Magnetic Resonances and Atomic and Molecular Physics, Wuhan Institute of Physics and Mathematics, Wuhan (China); Zhan, Ming-sheng [Chinese Academy of Sciences, State Key Laboratory of Magnetic Resonances and Atomic and Molecular Physics, Wuhan Institute of Physics and Mathematics, Wuhan (China); Chinese Academy of Sciences, Center for Cold Atom Physics, Wuhan (China)

    2010-08-15

    By calculating the change of entropy, we prove that the first law of black hole thermodynamics leads to the tunneling probability of massive particles through the horizon, including the tunneling probability of massive charged particles from the Reissner-Nordstroem black hole and the Kerr-Newman black hole. Novelly, we find the trajectories of massive particles are close to that of massless particles near the horizon, although the trajectories of massive charged particles may be affected by electromagnetic forces. We show that Hawking radiation as massive particles tunneling does not lead to violation of the weak cosmic-censorship conjecture. (orig.)

  12. Alternative Techniques for Injecting Massive Quantities of Gas for Plasma Disruption Mitigation

    Energy Technology Data Exchange (ETDEWEB)

    Combs, Stephen Kirk [ORNL; Meitner, Steven J [ORNL; Caughman, John B [ORNL; Commaux, Nicolas JC [ORNL; Fehling, Dan T [ORNL; Foust, Charles R [ORNL; Jernigan, Thomas C [ORNL; McGill, James M [ORNL; Parks, P. B. [General Atomics; Rasmussen, David A [ORNL

    2010-01-01

    Injection of massive quantities of noble gases or D2 has proven to be effective at mitigating some of the deleterious effects of disruptions in tokamaks. Two alternative methods that might offer some advantages over the present technique for massive gas injection are shattering massive pellets and employing closecoupled rupture disks. Laboratory testing has been carried out to evaluate their feasibility. For the study of massive pellets, a pipe gun pellet injector cooled with a cryogenic refrigerator was fitted with a relatively large barrel (16.5 mm bore), and D2 and Ne pellets were made and were accelerated to speeds of ~600 and 300 m/s, respectively. Based on the successful proof-of-principle testing with the injector and a special double-impact target to shatter pellets, a similar system has been prepared and installed on DIII-D, with preliminary experiments already carried out. To study the applicability of rupture disks for disruption mitigation, a simple test apparatus was assembled in the lab. Commercially available rupture disks of 1 in. nominal diameter were tested at conditions relevant for the application on tokamaks, including tests with Ar and He gases and rupture pressures of ~54 bar. Some technical and practical issues of implementing this technique on a tokamak are discussed.

  13. Sun protection

    Science.gov (United States)

    ... surfaces that reflect light, such as water, sand, concrete, snow, and areas that are painted white. DO ... protect the ears or sides of the face. Special clothing that protects the skin by absorbing UV ...

  14. Negotiating Protection

    DEFF Research Database (Denmark)

    Bille, Mikkel

    strategies are entangled in cultural, religious, and national identities. Using ethnographic methods, I investigate protection against selected risks: harm from evil eyes, violation of domestic sanctity, and cultural heritage dilapidation. Protection against these risks is examined through studies...

  15. Sun Protection

    Science.gov (United States)

    ... 100% UV ray protection (look for models that advertise both UVB and UVA protection). Use a broad- ... feeds Follow FDA on Twitter Follow FDA on Facebook View FDA videos on YouTube View FDA photos ...

  16. Birth of Massive Black Hole Binaries

    Energy Technology Data Exchange (ETDEWEB)

    Colpi, M.; /Milan Bicocca U.; Dotti, M.; /Insubria U., Como; Mayer, L.; /Zurich, ETH; Kazantzidis, S.; /KIPAC, Menlo Park

    2007-11-19

    If massive black holes (BHs) are ubiquitous in galaxies and galaxies experience multiple mergers during their cosmic assembly, then BH binaries should be common albeit temporary features of most galactic bulges. Observationally, the paucity of active BH pairs points toward binary lifetimes far shorter than the Hubble time, indicating rapid inspiral of the BHs down to the domain where gravitational waves lead to their coalescence. Here, we review a series of studies on the dynamics of massive BHs in gas-rich galaxy mergers that underscore the vital role played by a cool, gaseous component in promoting the rapid formation of the BH binary. The BH binary is found to reside at the center of a massive self-gravitating nuclear disc resulting from the collision of the two gaseous discs present in the mother galaxies. Hardening by gravitational torques against gas in this grand disc is found to continue down to sub-parsec scales. The eccentricity decreases with time to zero and when the binary is circular, accretion sets in around the two BHs. When this occurs, each BH is endowed with it own small-size ({approx}< 0.01 pc) accretion disc comprising a few percent of the BH mass. Double AGN activity is expected to occur on an estimated timescale of {approx}< 1 Myr. The double nuclear point-like sources that may appear have typical separation of {approx}< 10 pc, and are likely to be embedded in the still ongoing starburst. We note that a potential threat of binary stalling, in a gaseous environment, may come from radiation and/or mechanical energy injections by the BHs. Only short-lived or sub-Eddington accretion episodes can guarantee the persistence of a dense cool gas structure around the binary necessary for continuing BH inspiral.

  17. A new quasidilaton theory of massive gravity

    CERN Document Server

    Mukohyama, Shinji

    2014-01-01

    We present a new quasidilaton theory of Poincare invariant massive gravity, based on the recently proposed framework of matter coupling that makes it possible for the kinetic energy of the quasidilaton scalar to couple to both physical and fiducial metrics simultaneously. We find a scaling-type exact solution that expresses a self-accelerating de Sitter universe, and then analyze linear perturbations around it. It is shown that in a range of parameters all physical degrees of freedom have non-vanishing quadratic kinetic terms and are stable in the subhorizon limit, while the effective Newton's constant for the background is kept positive.

  18. Massive phytoplankton blooms under Arctic sea ice.

    Science.gov (United States)

    Arrigo, Kevin R; Perovich, Donald K; Pickart, Robert S; Brown, Zachary W; van Dijken, Gert L; Lowry, Kate E; Mills, Matthew M; Palmer, Molly A; Balch, William M; Bahr, Frank; Bates, Nicholas R; Benitez-Nelson, Claudia; Bowler, Bruce; Brownlee, Emily; Ehn, Jens K; Frey, Karen E; Garley, Rebecca; Laney, Samuel R; Lubelczyk, Laura; Mathis, Jeremy; Matsuoka, Atsushi; Mitchell, B Greg; Moore, G W K; Ortega-Retuerta, Eva; Pal, Sharmila; Polashenski, Chris M; Reynolds, Rick A; Schieber, Brian; Sosik, Heidi M; Stephens, Michael; Swift, James H

    2012-06-15

    Phytoplankton blooms over Arctic Ocean continental shelves are thought to be restricted to waters free of sea ice. Here, we document a massive phytoplankton bloom beneath fully consolidated pack ice far from the ice edge in the Chukchi Sea, where light transmission has increased in recent decades because of thinning ice cover and proliferation of melt ponds. The bloom was characterized by high diatom biomass and rates of growth and primary production. Evidence suggests that under-ice phytoplankton blooms may be more widespread over nutrient-rich Arctic continental shelves and that satellite-based estimates of annual primary production in these waters may be underestimated by up to 10-fold.

  19. Pattern recognition and massively distributed computing.

    Science.gov (United States)

    Davies, E Keith; Glick, Meir; Harrison, Karl N; Richards, W Graham

    2002-12-01

    A feature of Peter Kollman's research was his exploitation of the latest computational techniques to devise novel applications of the free energy perturbation method. He would certainly have seized upon the opportunities offered by massively distributed computing. Here we describe the use of over a million personal computers to perform virtual screening of 3.5 billion druglike molecules against protein targets by pharmacophore pattern matching, together with other applications of pattern recognition such as docking ligands without any a priori knowledge about the binding site location.

  20. Hamiltonian analysis of BHT massive gravity

    Science.gov (United States)

    Blagojević, M.; Cvetković, B.

    2011-01-01

    We study the Hamiltonian structure of the Bergshoeff-Hohm-Townsend (BHT) massive gravity with a cosmological constant. In the space of coupling constants ( Λ 0, m 2), our canonical analysis reveals the special role of the condition Λ 0/ m 2 ≠ -1. In this sector, the dimension of the physical phase space is found to be N ∗ = 4, which corresponds to two Lagrangian degree of freedom. When applied to the AdS asymptotic region, the canonical approach yields the conserved charges of the BTZ black hole, and central charges of the asymptotic symmetry algebra.

  1. Massively parallel sequencing of forensic STRs

    DEFF Research Database (Denmark)

    Parson, Walther; Ballard, David; Budowle, Bruce

    2016-01-01

    The DNA Commission of the International Society for Forensic Genetics (ISFG) is reviewing factors that need to be considered ahead of the adoption by the forensic community of short tandem repeat (STR) genotyping by massively parallel sequencing (MPS) technologies. MPS produces sequence data...... accessible genome assembly, and in place before the uptake of MPS by the general forensic community starts to generate sequence data on a large scale. While the established nomenclature for CE-based STR analysis will remain unchanged in the future, the nomenclature of sequence-based STR genotypes will need...

  2. Massive hemothorax following administration of intrapleural streptokinase

    Directory of Open Access Journals (Sweden)

    Chai Feng

    2011-01-01

    Full Text Available The administration of intrapleural streptokinase (IPSK is widely practiced in the management of loculated empyema thoracis. To our knowledge, there have been only 4 cases of hemorrhagic complications attributed to the administration of IPSK reported in the literature. In this article, we report a case of a 17-year-old girl who received IPSK and developed shock, anemia, coagulopathy and massive hemothorax. Our discussion focuses on the hemorrhagic complication of chest tube insertion and the role of IPSK in blood clot lysis and inhibition of local hemostasis.

  3. Dressler Syndrome is Characterized by Massive Hemoptysis

    Directory of Open Access Journals (Sweden)

    Erkan Ceylan

    2016-01-01

    Full Text Available A 63-year-old man was admitted with signs of dyspnea, pleuritic chest pain, fever, leukocytosis, high sedimentation rate, increase on C-reactive protein level, pleural effusion 2 weeks after coronary artery bypass surgery. According to the clinic and laboratory findings, Dressler syndrome diagnosed by the exclusion of pulmonary embolism, pneumonia, congestive heart failure and coronary artery bypass surgery complications. Massive hemoptysis was thought to be a result of local inflammatory reaction triggered by the immune activation and pleura, pericardium and vascular structures.

  4. Massive juvenile angiomatosis of maxilla and mandible

    Directory of Open Access Journals (Sweden)

    Dinesh Singh Chauhan

    2014-01-01

    Full Text Available Angiomatosis is a complex vascular malformation of infancy and childhood consisting of proliferating blood vessels with accompanying mature fat, fibrous tissue, lymphatic′s and nerves, which may involve skin, subcutaneous tissue, skeletal muscle and occasionally bone. It is extremely rare and benign, but a clinically extensive vascular lesion of soft-tissue, which usually becomes symptomatic during childhood or adolescence. We report a rare case of massive juvenile angiomatosis of maxilla and mandible in a 15-year-old male patient.

  5. Very Massive Stars in the Local Universe

    CERN Document Server

    Vink, Jorick S

    2014-01-01

    Recent studies suggest the existence of very massive stars (VMS) up to 300 solar masses in the local Universe. As this finding may represent a paradigm shift for the canonical stellar upper-mass limit of 150 solar masses, it is timely to evaluate the physics specific to VMS, which is currently missing. For this reason, we decided to construct a book entailing both a discussion of the accuracy of VMS masses (Martins), as well as the physics of VMS formation (Krumholz), mass loss (Vink), instabilities (Owocki), evolution (Hirschi), and fate (theory -- Woosley & Heger; observations -- Smith).

  6. Massively Parallel Direct Simulation of Multiphase Flow

    Energy Technology Data Exchange (ETDEWEB)

    COOK,BENJAMIN K.; PREECE,DALE S.; WILLIAMS,J.R.

    2000-08-10

    The authors understanding of multiphase physics and the associated predictive capability for multi-phase systems are severely limited by current continuum modeling methods and experimental approaches. This research will deliver an unprecedented modeling capability to directly simulate three-dimensional multi-phase systems at the particle-scale. The model solves the fully coupled equations of motion governing the fluid phase and the individual particles comprising the solid phase using a newly discovered, highly efficient coupled numerical method based on the discrete-element method and the Lattice-Boltzmann method. A massively parallel implementation will enable the solution of large, physically realistic systems.

  7. New Cosmological Solutions in Massive Gravity Theory

    Science.gov (United States)

    Pinho, S. S. A.; Pereira, S. H.; Mendonça, E. L.

    2017-04-01

    In this paper we present some new cosmological solutions in massive gravity theory. Some homogeneous and isotropic solutions correctly describe accelerated evolutions for the universe. The study was realized considering a specific form to the fiducial metric and found different functions and constant parameters of the theory that guarantee the conservation of the energy momentum tensor. Several accelerating cosmologies were found, all of them reproducing a cosmological constant term proportional to the graviton mass, with a de Sitter type solution for the scale factor. We have also verified that when the fiducial metric is close to the physical metric the solutions are absent, except for some specific open cases.

  8. Hamiltonian cosmology in bigravity and massive gravity

    CERN Document Server

    Soloviev, Vladimir O

    2015-01-01

    In the Hamiltonian language we provide a study of flat-space cosmology in bigravity and massive gravity constructed mostly with de Rham, Gabadadze, Tolley (dRGT) potential. It is demonstrated that the Hamiltonian methods are powerful not only in proving the absence of the Boulware-Deser ghost, but also in solving other problems. The purpose of this work is to give an introduction both to the Hamiltonian formalism and to the cosmology of bigravity. We sketch three roads to the Hamiltonian of bigravity with the dRGT potential: the metric, the tetrad and the minisuperspace approaches.

  9. Towards Realistic Modeling of Massive Star Clusters

    Science.gov (United States)

    Gnedin, O.; Li, H.

    2016-06-01

    Cosmological simulations of galaxy formation are rapidly advancing towards smaller scales. Current models can now resolve giant molecular clouds in galaxies and predict basic properties of star clusters forming within them. I will describe new theoretical simulations of the formation of the Milky Way throughout cosmic time, with the adaptive mesh refinement code ART. However, many challenges - physical and numerical - still remain. I will discuss how observations of massive star clusters and star forming regions can help us overcome some of them. Video of the talk is available at https://goo.gl/ZoZOfX

  10. Massive Preperitoneal Hematoma after a Subcutaneous Injection

    Directory of Open Access Journals (Sweden)

    Hideki Katagiri

    2016-01-01

    Full Text Available Preperitoneal hematomas are rare and can develop after surgery or trauma. A 74-year-old woman, receiving systemic anticoagulation, developed a massive preperitoneal hematoma after a subcutaneous injection of teriparatide using a 32-gauge, 4 mm needle. In this patient, there were two factors, the subcutaneous injection of teriparatide and systemic anticoagulation, associated with development of the hematoma. These two factors are especially significant, because they are widely used clinically. Although extremely rare, physicians must consider this potentially life-threatening complication after subcutaneous injections, especially in patients receiving anticoagulation.

  11. Massive Gauge Fields and the Planck Scale

    CERN Document Server

    Acosta, G D

    2004-01-01

    The present work is devoted to massive gauge fields in special relativity with two fundamental constants-the velocity of light, and the Planck length, so called doubly special relativity (DSR). The two invariant scales are accounted for by properly modified boost parameters. Within above framework we construct the vector potential as the (1/2,0)x(0,1/2) direct product, build the associated field strength tensor together with the Dirac spinors and use them to calculate various observables as functions of the Planck length.

  12. Generalised matter couplings in massive bigravity

    Energy Technology Data Exchange (ETDEWEB)

    Melville, Scott [Harvard University,Cambridge, Massachusetts 02138 (United States); The Queen’s College,High Street, Oxford, OX1 4AW (United Kingdom); Noller, Johannes [The Queen’s College,High Street, Oxford, OX1 4AW (United Kingdom); Astrophysics, University of Oxford,DWB, Keble Road, Oxford, OX1 3RH (United Kingdom)

    2016-01-18

    We investigate matter couplings in massive bigravity. We find a new family of such consistent couplings, including and extending known consistent matter couplings, and we investigate their decoupling limits, ADM decompositions, Higuchi bounds and further aspects. We show that differences to previous known consistent couplings only arise beyond the Λ{sub 3} decoupling limit and discuss the uniqueness of consistent matter couplings and how this is related to the so-called symmetric vielbein condition. Since we work in a vielbein formulation, these results easily generalise to multi-gravity.

  13. Drag phenomena from holographic massive gravity

    Science.gov (United States)

    Baggioli, Matteo; Brattan, Daniel K.

    2017-01-01

    We consider the motion of point particles in a strongly coupled field theory with broken translation invariance. We obtain the energy and momentum loss rates and drag coefficients for a class of such particles by solving for the motion of classical strings in holographic massive gravity. At low temperatures compared to the graviton mass the behaviour of the string is controlled by the appearance of an exotic ground state with non-zero entropy at zero temperature. Additionally, we find an upper bound on the diffusion constant for a collection of these particles which is saturated when the mass of the graviton goes to zero.

  14. Drag phenomena from holographic massive gravity

    CERN Document Server

    Baggioli, Matteo

    2015-01-01

    We consider the motion of point particles in a strongly coupled field theory with broken translation invariance. We obtain the energy and momentum loss rates and drag coefficients for a class of such particles by solving for the motion of classical strings in holographic massive gravity. At low temperatures compared to the graviton mass the behaviour of the string is controlled by the appearance of an exotic ground state with non-zero entropy at zero temperature. Additionally we find an upper bound on the diffusion constant for a collection of these particles which is saturated when the mass of the graviton goes to zero.

  15. Optimization of massive countermeasure design in complex rockfall settings

    Science.gov (United States)

    Agliardi, Federico; Crosta, Giovanni B.

    2015-04-01

    Rockfall protection is a major need in areas impended by subvertical rockwalls with complex 3D morphology and little or no talus to provide natural rockfall attenuation. The design of massive embankments, usually required to ensure such protection, is particularly difficult in complex rockfall settings, due to: widespread occurrence of rockfall sources; difficult characterization of size distribution and location of unstable volumes; variability of failure mechanisms; spatial scattering of rockfall trajectories; high expected kinetic energies. Moreover, rockwalls in complex lithological and structural settings are often prone to mass falls related to rock mass sector collapses. All these issues may hamper a safe application of classic embankment analysis approaches, using empirical rules or 2D-based height/energy statistics, and point to the need of integrated analyses of rock slope instability and rockfall runout in 3D. We explore the potential of combining advanced rock mass characterisation techniques and 3D rockfall modelling to support challenging countermeasure design at a site near Lecco (Southern Alps, Italy). Here subvertical cliffs up to 600 m high impend on a narrow (flat land along the Como Lake shore. Rock is thickly bedded limestone (Dolomia Principale Fm) involved in a ENE-trending, S-verging kilometre-scale anticline fold. The spatial variability of bedding attitude and fracture intensity is strongly controlled by the geological structure, with individual block sizes varying in the range 0.2-15 m3. This results in spatially variable rockfall susceptibility and mechanisms, from single block falls to mass falls. Several rockfall events occurred between 1981 and 2010 motivated the design of slope benching and a massive embankment. To support reliable design verification and optimization we performed a 3D assessment of both rock slope instability and rockfall runout. We characterised fracture patterns and rock mass quality associated to different

  16. Research Progress in the Preparation Methods and Applications of the Superhydrophobic Surface for Metal Protection%金属防护用超疏水表面主要制备方法及应用研究进展

    Institute of Scientific and Technical Information of China (English)

    赵欢; 吕晓璇; 周圣文; 方亮; 王力

    2015-01-01

    金属及其合金制品的腐蚀给人类带来巨大危害. 主要从金属表面超疏水的角度探究金属的防护,在介绍超疏水表面相关理论的基础上,详细综述了国内外金属基体超疏水表面的最新研究进展和应用,讨论了化学腐蚀法、激光毛化技术、喷涂法、电化学技术、水热法、等离子体处理技术、置换沉积法、溶液浸泡法、复合法等超疏水表面制备技术的研究进展,这些技术都在一定程度上实现了金属表面超疏水性能,接触角达到150 °以上,滚动角小于10 °. 除此之外,还介绍了超疏水表面在装饰金属材料、耐腐蚀、自清洁、防结冰、抗菌等方面的应用. 最后指出了金属基体超疏水表面制备在工业应用中存在的缺陷,并对今后的发展方向进行了展望.%The corrosion of metals and their alloys has caused great harm to mankind. In this paper, we explored the protection of metals from the point of superhydrophobic metal surface. On the basis of the theory about superhydrophobic surface, the latest research progress and application of superhydrophobic surface on metal substrates were reviewed. Research progresses in prepara-tion methods of superhydrophobic surface such as chemical etching, laser texturing, spraying, electrochemical, hydrothermal, plasma treatment, replacement deposition, solution immersion and composite were discussed in detail. These methods mentioned above have achieved the superhydrophobic properties of the metals to a certain degree with the contact angle of more than 150 de-gree and sliding angle of less than 10 degree. Furthermore, this paper also introduced the applications of the superhydrophobic sur-face in decorating metal materials, corrosion resistance, self-cleaning, anti-freezing and anti-bacteria. At the end of the paper, the existing defects of superhydrophobic metal surface preparation in industrial application were pointed out, and the development di-rection in the

  17. 用于皮肤组织抗氧化的维生素E醇质体的研制与表征%Study on Preparation and Characterization of Vitamine E Ethosomes for Antioxidant Protection of Deeper Layers of Skin

    Institute of Scientific and Technical Information of China (English)

    刘利萍; 唐春红

    2011-01-01

    目的 制备能渗透到皮肤深层的维生素E(VE)醇质体制剂.方法 VE含量测定采用高效液相色谱法;VE醇质体制备采用注入法并结合L9(34)正交实验优化处方参数;用挤压法和Franz扩散法分别测定醇质体的变形性和在大鼠皮内的滞留量.结果 以Sinochrom ODS-BP(4.6 mm ×200 mm,5μm)为色之谱柱、甲醇-乙醚溶液(7:3)为流动相、流速1.0 mL·min-1、检测波长284nm、进样量20μL,辅料不干抚VE测定,VE在2.584~192.2μg·mL-1线性关系良好;VE醇质体的优化处方为:卵磷脂1.5%、乙醇30%、药/磷脂比1:10,得到VE包封率为(96.25±0.07)%、平均粒径167.58nm、跨距0.4的VE醇质体;VE醇质体在不同压力下的变形性是对应脂质体的3.5~6.4倍,渗透到真皮层中的含量是脂质体的11.95倍.结论 醇质体载体能有效地促进VE在真皮层中的分布,更好地保护皮肤.%OBJECTIVE To study the preparation of vitamin E (VE) ethosomes which can penetrate into deep skin. METHODS The amount of VE was assayed by HPLC. Sinochrom ODS-BP column(4.6 mm ×200 mm,5 μm)was used. VE was eluted using methanol-ether (7: 3) as mobile phase at a flow rate of 1.0 mL · min -1. The detection was carried out at 284 nm. To study the effect of variables on the encapsulation efficiency of ethosome, different batches of samples were prepared using injection method with L9 (3)4 orthogonal design. The deformability of ethosomes was determined by extrusion method. The deposition in skin was investigated on excised rat's skin with Franz diffusion cells. RESULTS The standard curve was linear over the range of 2. 584 - 192. 2 μg·mL-1. The optimized formula was as follows:lecithin 1.5%, drug/lecithin 1/10(mass/mass) and ethanol 30%. The encapsulation efficiency was (96. 25 ± 0. 071 ) %, and the mean size was 167. 58 nm with span of O. 4. The deformability of ethosomes was 3. 5 -6.4 times higher than that of liposomes under different extruding pressures. And the dermal

  18. 海洋操作平台钢结构用防护涂料的制备与性能%Preparation and performance of protective coatings for steel structure of marine operation platform

    Institute of Scientific and Technical Information of China (English)

    张熠; 陈炳耀; 谭学锋; 许耀魁; 陈明毅; 陈炳江

    2012-01-01

    以聚己内酯、新戊二醇与顺丁烯二酸酐合成了聚酯树脂,然后与六亚甲基二异氰酸酯(HDI)反应以提高支化度,引入有机硅后再同丙烯酸单体反应制得丙烯酸改性聚酯树脂.以此丙烯酸改性聚酯树脂和适量的颜填料为甲组分、拜耳3390固化剂为乙组分,开发了适用于海洋气候的钢结构表面防护涂层.研究了顺丁烯二酸酐含量、丙烯酸改性聚酯树脂羟基含量、n(—NCO)∶n(—OH)值和聚合条件对面漆性能的影响.当顺丁烯二酸酐的用量为聚酯树脂的5%,自制的丙烯酸改性聚酯树脂羟基含量为4.5%±0.3%,n(—NCO)∶n(—OH)=1.1~1.4时,所制备的丙烯酸改性聚酯树脂面漆配以环氧富锌底漆及环氧云母氧化铁中涂漆得到的涂层体系能够满足海上平台钢结构的防护要求.%A polyester resin was synthesized with polycaprolactone, neopentyl glycol, and maleic anhydride, and then reacted with acrylic monomers after the improvement of branching degree with hexamethylene diisocyanate (HDI) and the introduction of organosilicon to form an acrylic-modified polyester resin. A steel structure surface protective coating used in marine environment was developed with the acrylic-modified polyester resin and proper amount of pigments and fillers as the first component and with Bayer 3390 curing agent as the second component. The effects of maleic anhydride content, hydroxyl content of acrylic-modified polyester resin, molar ratio of —NCO to —OH, and polymerization condition on the performance of topcoat were studied. The coating system obtained by the prepared acrylic-modified polyester resin combined with epoxy zinc-rich primer and micaceous iron oxide epoxy mid-coat can meet the protection requirement of steel structure of marine operation platform when the dosage of maleic anhydride is 5% of polyester resin, hydroxyl content of the acrylic-modified polyester resin 4.5% ± 0.3%, and molar ratio of-NCO to-OH 1.1-1.4.

  19. 聚丙烯酸钐/环氧树脂辐射防护材料的制备工艺及性能%Preparation and Property of Polyacrylic Acid Samarium/Epoxy Resin Composite Material for Radiation-Protection

    Institute of Scientific and Technical Information of China (English)

    李江苏; 戴耀东; 张瑜; 孙浩; 常树全

    2011-01-01

    通过辐照接枝聚合的方法制备聚丙烯酸钐/环氧树脂辐射防护材料和聚丙烯酸钐/丙烯酸铅/环氧树脂辐射防护材料,研究不同剂量γ射线照射下样品的性能差异和不同金属浓度样品的性能差异,并比较钐元素和铅元素对光子的屏蔽能力.采用X射线衍射(XRD)、傅里叶变换红外光谱(FT-IR )、扫描电镜(SEM)、能量色散型X射线能谱(EDAX)等方法研究了材料的微观结构;对材料的力学性能进行了测试和分析;用多道Y谱仪和Gamma Vision软件测试并分析了材料的辐射防护性能.结果表明:复合材料较纯环氧树脂力学性能得到了改善;材料制备过程中7射线的照射剂量控制在50 kGy左右为宜;稀土元素钐防护低能射线的能力强于传统的屏蔽元素Pb.%Polyacrylic acid samarium/epoxy resin composite material was prepared for radiation-protection via graft copolymerization route induced by gamma radiation. The samples under different dose and samples of different metal concentration were studied.The radiation-shielding abilities of Sm and Pb were compared. The composite material's microstructures were studied by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), scanning electron microscope (SEM) and energy dispersive X-ray spectroscope (EDAX). Mechanical property of the material was also tested and analyzed. Gamma energy spectrum system and GammaVision software were used to calculate its radiation shielding property. The results indicate that the mechanical property of material is better than that of pure epoxy resin. The suitable dose for the process of inducing gamma irradiation is 50 kGy. For the low energy photon, the radiationshielding ability of element Sm is better than that of element Pb.

  20. Magnetic Fields and Massive Star Formation

    CERN Document Server

    Zhang, Qizhou; Girart, Josep M; Hauyu,; Liu,; Tang, Ya-Wen; Koch, Patrick M; Li, Zhi-Yun; Keto, Eric; Ho, Paul T P; Rao, Ramprasad; Lai, Shih-Ping; Ching, Tao-Chung; Frau, Pau; Chen, How-Huan; Li, Hua-Bai; Padovani, Marco; Bontemps, Sylvain; Csengeri, Timea; Juarez, Carmen

    2014-01-01

    Massive stars ($M > 8$ \\msun) typically form in parsec-scale molecular clumps that collapse and fragment, leading to the birth of a cluster of stellar objects. We investigate the role of magnetic fields in this process through dust polarization at 870 $\\mu$m obtained with the Submillimeter Array (SMA). The SMA observations reveal polarization at scales of $\\lsim$ 0.1 pc. The polarization pattern in these objects ranges from ordered hour-glass configurations to more chaotic distributions. By comparing the SMA data with the single dish data at parsec scales, we found that magnetic fields at dense core scales are either aligned within $40^\\circ$ of or perpendicular to the parsec-scale magnetic fields. This finding indicates that magnetic fields play an important role during the collapse and fragmentation of massive molecular clumps and the formation of dense cores. We further compare magnetic fields in dense cores with the major axis of molecular outflows. Despite a limited number of outflows, we found that the ...

  1. Massive clot formation after tooth extraction

    Directory of Open Access Journals (Sweden)

    Santosh Hunasgi

    2015-01-01

    Full Text Available Oral surgical procedures mainly tooth extraction can be related with an extended hemorrhage owed to the nature of the process resulting in an "open wound." The attempt of this paper is to present a case of massive postoperative clot formation after tooth extraction and highlight on the oral complications of surgical procedures. A 32-year-old male patient reported to the Dental Clinic for evaluation and extraction of grossly decayed 46. Clinical evaluation of 46 revealed root stumps. Extraction of the root stumps was performed, and it was uneventful. Hemostasis was achieved and postsurgical instructions were specified to the patient. The patient reported to the clinic, the very subsequent morning with a criticism of bleeding at the extraction site. On clinical examination, bleeding was noted from the socket in relation to 46. To control bleeding, oral hemostatic drugs Revici - E (Ethamsylate 500 mg was prescribed and bleeding was stopped in 2 h. However, a massive clot was formed at the extraction site. Further, this clot resolved on its own in 1-week time. Despite the fact that dental extraction is considered to be a minor surgical procedure, some cases may present with life-threatening complications including hemorrhage. Vigilant and significant history taking, physical and dental examinations prior to dental procedures are a must to avoid intraoperative and postoperative complications.

  2. Chemically homogeneous evolution in massive binaries

    CERN Document Server

    de Mink, S E; Langer, N; Pols, O R

    2010-01-01

    Rotation can have severe consequences for the evolution of massive stars. It is now considered as one of the main parameters, alongside mass and metallicity that determine the final fate of single stars. In massive, fast rotating stars mixing processes induced by rotation may be so efficient that helium produced in the center is mixed throughout the envelope. Such stars evolve almost chemically homogeneously. At low metallicity they remain blue and compact, while they gradually evolve into Wolf-Rayet stars and possibly into progenitors of long gamma-ray bursts. In binaries this type of evolution may occur because of (I) tides in very close binaries, as a result of (II) spin up by mass transfer, as result of (III) a merger of the two stars and (IV) when one of the components in the binary was born with a very high initial rotation rate. As these stars stay compact, the evolutionary channels are very different from what classical binary evolutionary models predict. In this contribution we discuss examples of ne...

  3. Two cases of asymptomatic massive fetomaternal hemorrhage.

    Science.gov (United States)

    Peedin, Alexis R; Mazepa, Marshall A; Park, Yara A; Weimer, Eric T; Schmitz, John L; Raval, Jay S

    2015-04-01

    Evaluation of fetomaternal hemorrhage (FMH) in the immediate postpartum period is critical for the timely administration of Rh immunoglobulin (RhIG) prophylaxis to minimize the risk of alloimmunization in D-negative mothers of D-positive newborns. We report a series of two clinically-unsuspected cases of massive FMHs identified at our university medical center. Retrospective records of two cases of massive FMH were investigated using the electronic medical record. After positive fetal bleed screens, flow cytometric analysis for hemoglobin F was performed to quantify the volume of the hemorrhages in both cases. Flow cytometric enumeration with anti-D was also performed in one case. The two patients had 209.5 and 75 mL of fetal blood in circulation, resulting in 8 and 4 doses of RhIG administered, respectively. For the former patient, flow cytometric analysis with anti-D ruled out hereditary persistence of fetal hemoglobin and supported the fetal origin of the red cells. Due to the clinically-silent nature of both hemorrhages, further evaluation of the newborns' blood was not performed. These cases highlight the importance of rapidly obtaining accurate measurements of fetal blood loss via flow cytometric analysis in cases of FMH, particularly in clinically-unsuspected cases, to ensure timely administration of adequate immunoprophylaxis to D-negative mothers.

  4. Symmetries of Elko and massive vector fields

    CERN Document Server

    Lee, Cheng-Yang

    2013-01-01

    This thesis studies the symmetries and phenomenologies of the massive vector fields of indefinite spin with both scalar and spin-one degrees of freedom and Elko. The investigation is conducted by using and extending the quantum field theory formalism developed by Wigner and Weinberg. In particular, we explore the possibility that the $W^{\\pm}$ and $Z$ bosons have an additional scalar degree of freedom and show that Elko is a fermionic dark matter candidate. We show that the massive vector fields of indefinite spin are consistent with Poincar\\'{e} symmetry and have physically desirable properties that are absent for their pure spin-one counterpart. Using the new vector fields, the decay of the $W^{\\pm}$ and $Z$ bosons to leptons at tree-level are in agreement with the Standard Model (SM) predictions. For higher order scattering amplitudes, the theory has better convergent behaviour than the intermediate vector boson model and the Fermi theory. Elko has the unusual property that it satisfies the Klein-Gordon bu...

  5. Nitrogen chronology of massive main sequence stars

    CERN Document Server

    Köhler, K; Brott, I; Langer, N; de Koter, A

    2012-01-01

    Rotational mixing in massive main sequence stars is predicted to monotonically increase their surface nitrogen abundance with time. We use this effect to design a method for constraining the age and the inclination angle of massive main sequence stars, given their observed luminosity, effective temperature, projected rotational velocity and surface nitrogen abundance. This method relies on stellar evolution models for different metallicities, masses and rotation rates. We use the population synthesis code STARMAKER to show the range of applicability of our method. We apply this method to 79 early B-type main sequence stars near the LMC clusters NGC 2004 and N 11 and the SMC clusters NGC 330 and NGC 346. From all stars within the sample, 17 were found to be suitable for an age analysis. For ten of them, which are rapidly rotating stars without a strong nitrogen enhancement, it has been previously concluded that they did not evolve as rotationally mixed single stars. This is confirmed by our analysis, which fla...

  6. Knowledge Discovery from Massive Healthcare Claims Data

    Energy Technology Data Exchange (ETDEWEB)

    Chandola, Varun [ORNL; Sukumar, Sreenivas R [ORNL; Schryver, Jack C [ORNL

    2013-01-01

    The role of big data in addressing the needs of the present healthcare system in US and rest of the world has been echoed by government, private, and academic sectors. There has been a growing emphasis to explore the promise of big data analytics in tapping the potential of the massive healthcare data emanating from private and government health insurance providers. While the domain implications of such collaboration are well known, this type of data has been explored to a limited extent in the data mining community. The objective of this paper is two fold: first, we introduce the emerging domain of big"healthcare claims data to the KDD community, and second, we describe the success and challenges that we encountered in analyzing this data using state of art analytics for massive data. Specically, we translate the problem of analyzing healthcare data into some of the most well-known analysis problems in the data mining community, social network analysis, text mining, and temporal analysis and higher order feature construction, and describe how advances within each of these areas can be leveraged to understand the domain of healthcare. Each case study illustrates a unique intersection of data mining and healthcare with a common objective of improving the cost-care ratio by mining for opportunities to improve healthcare operations and reducing hat seems to fall under fraud, waste,and abuse.

  7. Dipolar dark matter with massive bigravity

    Energy Technology Data Exchange (ETDEWEB)

    Blanchet, Luc [GRECO Institut d’Astrophysique de Paris - UMR 7095 du CNRS,Université Pierre & Marie Curie,98" b" i" s boulevard Arago, 75014 Paris (France); Heisenberg, Lavinia [Nordita, KTH Royal Institute of Technology and Stockholm University,Roslagstullsbacken 23, 10691 Stockholm (Sweden); Department of Physics & The Oskar Klein Centre, AlbaNova University Centre,Roslagstullsbacken 21, 10691 Stockholm (Sweden)

    2015-12-14

    Massive gravity theories have been developed as viable IR modifications of gravity motivated by dark energy and the problem of the cosmological constant. On the other hand, modified gravity and modified dark matter theories were developed with the aim of solving the problems of standard cold dark matter at galactic scales. Here we propose to adapt the framework of ghost-free massive bigravity theories to reformulate the problem of dark matter at galactic scales. We investigate a promising alternative to dark matter called dipolar dark matter (DDM) in which two different species of dark matter are separately coupled to the two metrics of bigravity and are linked together by an internal vector field. We show that this model successfully reproduces the phenomenology of dark matter at galactic scales (i.e. MOND) as a result of a mechanism of gravitational polarisation. The model is safe in the gravitational sector, but because of the particular couplings of the matter fields and vector field to the metrics, a ghost in the decoupling limit is present in the dark matter sector. However, it might be possible to push the mass of the ghost beyond the strong coupling scale by an appropriate choice of the parameters of the model. Crucial questions to address in future work are the exact mass of the ghost, and the cosmological implications of the model.

  8. Dipolar dark matter with massive bigravity

    Science.gov (United States)

    Blanchet, Luc; Heisenberg, Lavinia

    2015-12-01

    Massive gravity theories have been developed as viable IR modifications of gravity motivated by dark energy and the problem of the cosmological constant. On the other hand, modified gravity and modified dark matter theories were developed with the aim of solving the problems of standard cold dark matter at galactic scales. Here we propose to adapt the framework of ghost-free massive bigravity theories to reformulate the problem of dark matter at galactic scales. We investigate a promising alternative to dark matter called dipolar dark matter (DDM) in which two different species of dark matter are separately coupled to the two metrics of bigravity and are linked together by an internal vector field. We show that this model successfully reproduces the phenomenology of dark matter at galactic scales (i.e. MOND) as a result of a mechanism of gravitational polarisation. The model is safe in the gravitational sector, but because of the particular couplings of the matter fields and vector field to the metrics, a ghost in the decoupling limit is present in the dark matter sector. However, it might be possible to push the mass of the ghost beyond the strong coupling scale by an appropriate choice of the parameters of the model. Crucial questions to address in future work are the exact mass of the ghost, and the cosmological implications of the model.

  9. Phenomenology in minimal theory of massive gravity

    CERN Document Server

    De Felice, Antonio

    2015-01-01

    We investigate the minimal theory of massive gravity (MTMG) recently introduced. After reviewing the original construction based on its Hamiltonian in the vielbein formalism, we reformulate it in terms of its Lagrangian in both the vielbein and the metric formalisms. It then becomes obvious that, unlike previous attempts in the literature, not only the potential but also the kinetic structure of the action is modified from the de Rham-Gabadadze-Tolley (dRGT) massive gravity theory. We confirm that the number of physical degrees of freedom in MTMG is two at fully nonlinear level. This proves the absence of various possible pathologies such as superluminality, acausality and strong coupling. Afterwards, we discuss the phenomenology of MTMG in the presence of a dust fluid. We find that on a flat homogeneous and isotropic background we have two branches. One of them (self-accelerating branch) naturally leads to acceleration without the genuine cosmological constant or dark energy. For this branch both the scalar ...

  10. Planckian Interacting Massive Particles as Dark Matter

    Science.gov (United States)

    Garny, Mathias; Sandora, McCullen; Sloth, Martin S.

    2016-03-01

    The standard model could be self-consistent up to the Planck scale according to the present measurements of the Higgs boson mass and top quark Yukawa coupling. It is therefore possible that new physics is only coupled to the standard model through Planck suppressed higher dimensional operators. In this case the weakly interacting massive particle miracle is a mirage, and instead minimality as dictated by Occam's razor would indicate that dark matter is related to the Planck scale, where quantum gravity is anyway expected to manifest itself. Assuming within this framework that dark matter is a Planckian interacting massive particle, we show that the most natural mass larger than 0.01 Mp is already ruled out by the absence of tensor modes in the cosmic microwave background (CMB). This also indicates that we expect tensor modes in the CMB to be observed soon for this type of minimal dark matter model. Finally, we touch upon the Kaluza-Klein graviton mode as a possible realization of this scenario within UV complete models, as well as further potential signatures and peculiar properties of this type of dark matter candidate. This paradigm therefore leads to a subtle connection between quantum gravity, the physics of primordial inflation, and the nature of dark matter.

  11. MASSIVE PLEURAL EFFUSION: A CASE REPORT

    Directory of Open Access Journals (Sweden)

    Putu Bayu Dian Tresna Dewi

    2013-03-01

    Full Text Available Pleural effusion is abnormal fluid accumulation within pleural cavity between the parietal pleura and visceralis pleura, either transudation or exudates. A 47 year-old female presented with dyspneu, cough, and decreased of appetite. She had history of right lung tumor. Physical examination revealed asymmetric chest movement where right part of lung was lagged during breathing, vocal fremitus on the right chest was decreased, dullness at the right chest, decreased vesicular sound in the right chest, enlargement of supraclavicular and colli dextra lymph nodes, and hepatomegali. Complete blood count showed leukocytosis. Clinical chemistry analysis showed hipoalbumin and decreased liver function. Blood gas analysis showed hypoxemia. Pleural fluid analysis showed an exudates, murky red liquid color filled with erythrocytes, number of cells. Cytological examination showed existence of a non-small cell carcinoma tends adeno type. From chest X-ray showed massive right pleural effusion. Based on history, physical examination and investigations, she was diagnosed with massive pleural effusion et causa suspected malignancy. She had underwent pleural fluid evacuation and treated with analgesics and antibiotics.

  12. The differing locations of massive stellar explosions

    CERN Document Server

    Fruchter, A S; Burud, I; Castro-Tirado, A J; Cerón, J M C; Conselice, C J; Dahlen, T; Ferguson, H C; Fynbo, J P U; Garnavich, P M; Gibbons, R A; Gorosabel, J; Gull, T R; Hjorth, J; Holland, S T; Kouveliotou, C; Levan, A J; Levay, Z; Livio, M; Metzger, M R; Nugent, P; Petro, L; Pian, E; Rhoads, J E; Riess, A G; Sahu, K C; Smette, A; Strolger, L; Tanvir, N R; Thorsett, S E; Vreeswijk, P M; Wijers, R A M J; Woosley, S E

    2006-01-01

    When massive stars exhaust their fuel they collapse and often produce the extraordinarily bright explosions known as core-collapse supernovae. On occasion, this stellar collapse also powers an even more brilliant relativistic explosion known as a long-duration gamma-ray burst. One would then expect that gamma-ray bursts and supernovae should be found in similar environments. Here we show that this expectation is wrong. Using Hubble Space Telescope imaging of the host galaxies of long-duration gamma-ray bursts and core-collapse supernovae, we find that the gamma-ray bursts are far more concentrated on the very brightest regions of their hosts than are the supernovae. Furthermore, the host galaxies of the gamma-ray bursts are significantly fainter and more irregular than the hosts of the supernovae. Together these results suggest that long-duration gamma-ray bursts are associated with the very most massive stars and may be restricted to galaxies of limited chemical evolution. Our results directly imply that lon...

  13. Topologically Massive Gauge Theory: A Lorentzian Solution

    CERN Document Server

    Saygili, K

    2006-01-01

    We obtain a lorentzian solution for the topologically massive non-abelian gauge theory on AdS space by means of a SU(1, 1) gauge transformation of the previously found abelian solution. There exists a natural scale of length which is determined by the inverse topological mass. The topological mass is proportional to the square of the gauge coupling constant. In the topologically massive electrodynamics the field strength locally determines the gauge potential up to a closed 1-form via the (anti-)self-duality equation. We introduce a transformation of the gauge potential using the dual field strength which can be identified with an abelian gauge transformation. Then we present the map from the AdS space to the pseudo-sphere including the topological mass. This is the lorentzian analog of the Hopf map. This map yields a global decomposition of the AdS space as a trivial circle bundle over the upper portion of the pseudo-sphere which is the the Hyperboloid model for the Lobachevski geometry. This leads to a redu...

  14. The Deuteration Clock for Massive Starless Cores

    CERN Document Server

    Kong, Shuo; Caselli, Paola; Fontani, Francesco

    2015-01-01

    To understand massive star formation requires study of its initial conditions. Two massive starless core candidates, C1-N & C1-S, have been detected in IRDC G028.37+00.07 in $\\rm N_2D^+$(3-2) with $ALMA$. From their line widths, either the cores are subvirial and are thus young structures on the verge of near free-fall collapse, or they are threaded by $\\sim1$ mG $B$-fields that help support them in near virial equilibrium and potentially have older ages. We modeled the deuteration rate of $\\rm N_2H^+$ to constrain collapse rates of the cores. First, to measure their current deuterium fraction, $D_{\\rm frac}^{\\rm N_2H^+}$ $\\equiv [\\rm N_2D^+]/[N_2H^+]$, we observed multiple transitions of $\\rm N_2H^+$ and $\\rm N_2D^+$ with $CARMA$, $SMA$, $JCMT$, $NRO~45m$ and $IRAM~30m$, to complement the $ALMA$ data. For both cores we derived $D_{\\rm frac}^{\\rm N_2H^+}\\sim0.3$, several orders of magnitude above the cosmic [D]/[H] ratio. We then carried out chemodynamical modeling, exploring how collapse rate relative to...

  15. Radiative Ablation of Disks Around Massive Stars

    CERN Document Server

    Kee, N D

    2015-01-01

    Hot, massive stars (spectral types O and B) have extreme luminosities ($10^4 -10^6 L_\\odot$) that drive strong stellar winds through UV line-scattering. Some massive stars also have disks, formed by either decretion from the star (as in the rapidly rotating "Classical Be stars"), or accretion during the star's formation. This dissertation examines the role of stellar radiation in driving (ablating) material away from these circumstellar disks. A key result is that the observed month to year decay of Classical Be disks can be explained by line-driven ablation without, as previously done, appealing to anomalously strong viscous diffusion. Moreover, the higher luminosity of O stars leads to ablation of optically thin disks on dynamical timescales of order a day, providing a natural explanation for the lack of observed Oe stars. In addition to the destruction of Be disks, this dissertation also introduces a model for their formation by coupling observationally inferred non-radial pulsation modes and rapid stellar...

  16. Planckian Interacting Massive Particles as Dark Matter.

    Science.gov (United States)

    Garny, Mathias; Sandora, McCullen; Sloth, Martin S

    2016-03-11

    The standard model could be self-consistent up to the Planck scale according to the present measurements of the Higgs boson mass and top quark Yukawa coupling. It is therefore possible that new physics is only coupled to the standard model through Planck suppressed higher dimensional operators. In this case the weakly interacting massive particle miracle is a mirage, and instead minimality as dictated by Occam's razor would indicate that dark matter is related to the Planck scale, where quantum gravity is anyway expected to manifest itself. Assuming within this framework that dark matter is a Planckian interacting massive particle, we show that the most natural mass larger than 0.01M_{p} is already ruled out by the absence of tensor modes in the cosmic microwave background (CMB). This also indicates that we expect tensor modes in the CMB to be observed soon for this type of minimal dark matter model. Finally, we touch upon the Kaluza-Klein graviton mode as a possible realization of this scenario within UV complete models, as well as further potential signatures and peculiar properties of this type of dark matter candidate. This paradigm therefore leads to a subtle connection between quantum gravity, the physics of primordial inflation, and the nature of dark matter.

  17. Abdominal sacral colpopexy for massive genital prolapse.

    Science.gov (United States)

    Powell; Joseph

    1998-07-01

    Objective: A retrospective study to determine the success and complications of abdominal sacral colpopexy in correcting massive genital prolapse over an 8-year period between September 1989 and January 1997.Methods: The charts were reviewed for 3 patients with massive procidentia and 15 patients with symptomatic posthysterectomy vaginal vault prolapse, who desired preservation of sexual function and underwent abdominal sacral colpopexy with Marlex mesh at two community teaching hospitals.Results: In 16 of the 18 patients, one or more concurrent procedures were performed at the same time, including three Burch colpocystourethropexies and one Raz bladder neck suspension, which successfully controlled urinary stress incontinence. In three cases, staging procedures were done for ovarian neoplasia. There were no intraoperative complications. One patient developed a superficial abdominal wound infection, one patient had a deep venous thrombosis in her left leg 7 days postoperatively, and one patient experienced a 1 cm area of graft erosion 10 months postoperative requiring partial resection. Duration of follow-up has varied from 8 months to 5 years. One patient died 43 months after surgery of unrelated causes. No patients developed recurrent prolapse.Conclusions: Abdominal sacral colpopexy is a successful operation for the correction of prolapse. Serious complications are infrequent. Photographs of the technique and a review of the literature are presented.

  18. FRW Cosmology in Ghost Free Massive Gravity

    CERN Document Server

    Comelli, D; Nesti, F; Pilo, L

    2011-01-01

    We study FRW homogeneous cosmological solutions in the recently found ghost free massive gravity. In previous works it was shown that when the additional extra metric, needed to generate the mass term, is taken as non-dynamical and flat, no homogeneous FRW cosmology exists. We show that, when the additional metric is a dynamical field, a perfectly safe FRW universe exists. FRW solutions fall in two branches. In the first branch the massive deformation is equivalent to an effectively generated cosmological constant whose scale is determined by the graviton mass. The second branch is quite rich: we have FRW cosmology in the presence of a "gravitational" fluid. The control parameter xi is the ratio of the two conformal factors. When xi is large, generically the cosmological evolution greatly differs from GR at the early time. In the small xi region, the evolution is similar to GR and the universe flows at late time toward an attractor represented by a dS phase.

  19. Theoretical Near-IR Spectra for Surface Abundance Studies of Massive Stars

    Science.gov (United States)

    Sonneborn, George; Bouret, J.

    2011-01-01

    We present initial results of a study of abundance and mass loss properties of O-type stars based on theoretical near-IR spectra computed with state-of-the-art stellar atmosphere models. The James Webb Space Telescope (JWST) will be a powerful tool to obtain high signal-to-noise ratio near-IR (1-5 micron) spectra of massive stars in different environments of local galaxies. Our goal is to analyze model near-IR spectra corresponding to those expected from NIRspec on JWST in order to map the wind properties and surface composition across the parameter range of 0 stars and to determine projected rotational velocities. As a massive star evolves, internal coupling, related mixing, and mass loss impact its intrinsic rotation rate. These three parameters form an intricate loop, where enhanced rotation leads to more mixing which in turn changes the mass loss rate, the latter thus affecting the rotation rate. Since the effects of rotation are expected to be much more pronounced at low metallicity, we pay special attention to models for massive stars in the the Small Magellanic Cloud. This galaxy provides a unique opportunity to probe stellar evolution, and the feedback of massive stars on galactic evol.ution in conditions similar to the epoch of maximal star formation. Plain-Language Abstract: We present initial results of a study of abundance and mass loss properties of massive stars based on theoretical near-infrared (1-5 micron) spectra computed with state-of-the-art stellar atmosphere models. This study is to prepare for observations by the James Webb Space Telescope.

  20. Topological massive Dirac edge modes and long-range superconducting Hamiltonians

    Science.gov (United States)

    Viyuela, O.; Vodola, D.; Pupillo, G.; Martin-Delgado, M. A.

    2016-09-01

    We discover novel topological effects in the one-dimensional Kitaev chain modified by long-range Hamiltonian deformations in the hopping and pairing terms. This class of models display symmetry-protected topological order measured by the Berry/Zak phase of the lower-band eigenvector and the winding number of the Hamiltonians. For exponentially decaying hopping amplitudes, the topological sector can be significantly augmented as the penetration length increases, something experimentally achievable. For power-law decaying superconducting pairings, the massless Majorana modes at the edges get paired together into a massive nonlocal Dirac fermion localized at both edges of the chain: a new topological quasiparticle that we call topological massive Dirac fermion. This topological phase has fractional topological numbers as a consequence of the long-range couplings. Possible applications to current experimental setups and topological quantum computation are also discussed.

  1. Farming-up coastal fish assemblages through a massive aquaculture escape event.

    Science.gov (United States)

    Toledo-Guedes, Kilian; Sanchez-Jerez, Pablo; Benjumea, María E; Brito, Alberto

    2014-07-01

    We investigated the changes on the mean trophic level of fish assemblages across different spatiotemporal scales, before and after a massive escape event occurred off La Palma (Canary Islands), which resulted in the release of 1.5 million fish (mostly Dicentrarchus labrax) into the wild. The presence of escaped fish altered significantly the mean trophic level of fish assemblages in shallow coastal waters. This alteration was exacerbated by the massive escape. A nearby marine protected area buffered the changes in mean trophic level but exhibited the same temporal patterns as highly fished areas. Moreover, escaped fish exploited natural resources according to their total length and possibly, time since escapement. New concerns arise as a "farming up" process is detected in shallow coastal fish assemblages where marine aquaculture is established.

  2. The diverse evolutionary paths of simulated high-z massive, compact galaxies to z = 0

    Science.gov (United States)

    Wellons, Sarah; Torrey, Paul; Ma, Chung-Pei; Rodriguez-Gomez, Vicente; Pillepich, Annalisa; Nelson, Dylan; Genel, Shy; Vogelsberger, Mark; Hernquist, Lars

    2016-02-01

    Massive quiescent galaxies have much smaller physical sizes at high redshift than today. The strong evolution of galaxy size may be caused by progenitor bias, major and minor mergers, adiabatic expansion, and/or renewed star formation, but it is difficult to test these theories observationally. Herein, we select a sample of 35 massive, compact galaxies (M* = 1-3 × 1011 M⊙, M*/R1.5 > 1010.5 M⊙/kpc1.5) at z = 2 in the cosmological hydrodynamical simulation Illustris and trace them forwards to z = 0 to uncover their evolution and identify their descendants. By z = 0, the original factor of 3 difference in stellar mass spreads to a factor of 20. The dark matter halo masses similarly spread from a factor of 5 to 40. The galaxies' evolutionary paths are diverse: about half acquire an ex situ envelope and are the core of a more massive descendant, a third survive undisturbed and gain very little mass, 15 per cent are consumed in a merger with a more massive galaxy, and a small remainder are thoroughly mixed by major mergers. The galaxies grow in size as well as mass, and only ˜10 per cent remain compact by z = 0. The majority of the size growth is driven by the acquisition of ex situ mass. The most massive galaxies at z = 0 are the most likely to have compact progenitors, but this trend possesses significant dispersion which precludes a direct linkage to compact galaxies at z = 2. The compact galaxies' merger rates are influenced by their z = 2 environments, so that isolated or satellite compact galaxies (which are protected from mergers) are the most likely to survive to the present day.

  3. Binary interaction dominates the evolution of massive stars

    CERN Document Server

    Sana, H; de Koter, A; Langer, N; Evans, C J; Gieles, M; Gosset, E; Izzard, R G; Bouquin, J -B Le; Schneider, F R N; 10.1126/science.1223344

    2012-01-01

    The presence of a nearby companion alters the evolution of massive stars in binary systems, leading to phenomena such as stellar mergers, X-ray binaries and gamma-ray bursts. Unambiguous constraints on the fraction of massive stars affected by binary interaction were lacking. We simultaneously measured all relevant binary characteristics in a sample of Galactic massive O stars and quantified the frequency and nature of binary interactions. Over seventy per cent of all massive stars will exchange mass with a companion, leading to a binary merger in one third of the cases. These numbers greatly exceed previous estimates and imply that binary interaction dominates the evolution of massive stars, with implications for populations of massive stars and their supernovae.

  4. Neutron stars structure in the context of massive gravity

    Science.gov (United States)

    Hendi, S. H.; Bordbar, G. H.; Eslam Panah, B.; Panahiyan, S.

    2017-07-01

    Motivated by the recent interests in spin-2 massive gravitons, we study the structure of neutron star in the context of massive gravity. The modifications of TOV equation in the presence of massive gravity are explored in 4 and higher dimensions. Next, by considering the modern equation of state for the neutron star matter (which is extracted by the lowest order constrained variational (LOCV) method with the AV18 potential), different physical properties of the neutron star (such as Le Chatelier's principle, stability and energy conditions) are investigated. It is shown that consideration of the massive gravity has specific contributions into the structure of neutron star and introduces new prescriptions for the massive astrophysical objects. The mass-radius relation is examined and the effects of massive gravity on the Schwarzschild radius, average density, compactness, gravitational redshift and dynamical stability are studied. Finally, a relation between mass and radius of neutron star versus the Planck mass is extracted.

  5. Reappraising the concept of massive transfusion in trauma

    DEFF Research Database (Denmark)

    Stanworth, Simon J; Morris, Timothy P; Gaarder, Christine;

    2010-01-01

    ABSTRACT : INTRODUCTION : The massive-transfusion concept was introduced to recognize the dilutional complications resulting from large volumes of packed red blood cells (PRBCs). Definitions of massive transfusion vary and lack supporting clinical evidence. Damage-control resuscitation regimens...... of modern trauma care are targeted to the early correction of acute traumatic coagulopathy. The aim of this study was to identify a clinically relevant definition of trauma massive transfusion based on clinical outcomes. We also examined whether the concept was useful in that early prediction of massive...... : No threshold for definition exists at which a massive transfusion specifically results in worse outcomes. Even with a large sample size across multiple trauma datasets, it was not possible to develop a transportable and clinically useful prediction model based on available admission parameters. Massive...

  6. ATLASGAL --- towards a complete sample of massive star forming clumps

    CERN Document Server

    Urquhart, J S; Csengeri, T; Wyrowski, F; Schuller, F; Hoare, M G; Lumsden, S L; Mottram, J C; Thompson, M A; Menten, K M; Walmsley, C M; Bronfman, L; Pfalzner, S; König, C; Wienen, M

    2014-01-01

    By matching infrared-selected, massive young stellar objects (MYSOs) and compact HII regions in the RMS survey to massive clumps found in the submillimetre ATLASGAL survey, we have identified ~1000 embedded young massive stars between 280\\degr < $\\ell$ < 350\\degr and 10degr < $\\ell$ < 60\\degr with |b|<1.5degr. Combined with an existing sample of radio-selected methanol masers and compact HII regions, the result is a catalogue of ~1700 massive stars embedded within ~1300 clumps located across the inner Galaxy, containing three observationally distinct subsamples, methanol-maser, MYSO and HII-region associations, covering the most important tracers of massive star formation, thought to represent key stages of evolution. We find that massive star formation is strongly correlated with the regions of highest column density in spherical, centrally condensed clumps. We find no significant differences between the three samples in clump structure or the relative location of the embedded stars, which sug...

  7. Ghost free massive gravity with singular reference metrics

    Science.gov (United States)

    Zhang, Hongsheng; Li, Xin-Zhou

    2016-06-01

    An auxiliary metric (reference metric) is inevitable in massive gravity theory. In the scenario of the gauge/gravity duality, massive gravity with a singular reference metric is used to study momentum dissipation, which describes the electric and heat conductivity for normal conductors. We demonstrate in detail that the de Rham-Gabadadze-Tolley (dRGT) massive gravity with a singular reference metric is ghost free.

  8. 40 CFR 791.27 - Pre-hearing preparation.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 31 2010-07-01 2010-07-01 true Pre-hearing preparation. 791.27 Section 791.27 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT (CONTINUED) DATA REIMBURSEMENT Hearing Procedures § 791.27 Pre-hearing preparation. (a) Responses...

  9. Deployment and Implementation Strategies for Massive MIMO in 5G

    OpenAIRE

    Panzner, Berthold; Zirwas, Wolfgang; Dierks, Stefan; Lauridsen, Mads; Mogensen, Preben; Pajukoski, Kari; Miao, Deshan

    2015-01-01

    Massive MIMO has emerged as one technology enabler for the next generation mobile communications 5G. The gains promised by massive MIMO are augured to overcome the capacity crunch in today's mobile networks and to pave the way for the ambitious targets of 5G. The challenge to realize massive MIMO for 5G is a successful and cost-efficient integration in the overall network concept. This work highlights deployment and implementation strategies for massive MIMO in the context of 5G indoor small ...

  10. Massive gravitons from Extended Gravity to Effective Field Theories

    CERN Document Server

    Capozziello, Salvatore; Paolella, Mariacristina; Ricciardi, Giulia

    2013-01-01

    Massive gravitons in effective field theories can be recovered by extending General Relativity and taking into account generic functions of the curvature invariants not necessarily linear in the Ricci scalar R. In particular, adopting the minimal extension of f(R) gravity, an effective field theory with a massive state is straightforwardly recovered. This approach allows to evade shortcomings like ghosts and discontinuities if a suitable choice of expansion parameters is performed. We show that the massive state can be identified with a massive graviton.

  11. Globular cluster-massive black hole interactions in galactic centers

    CERN Document Server

    Capuzzo-Dolcetta, R

    2016-01-01

    Many, if not all, galaxies host massive compact objects at their centers. They are present as singularities (super massive black holes) or high density star clusters (nuclear tar clusters). In some cases they coexist, and interact more or less strongly. In this short paper I will talk of the 'merger' globular cluster scenario, which has been shown in the past to be an explanation of the substantial mass accumulation in galactic centers. In particular, I will present the many astrophysical implications of such scenario pointing the attention on the mutual feedback of orbitally decaying globular clusters with massive and super massive black holes.

  12. Feedback Processes [in Massive Star Formation]: A Theoretical Perspective

    CERN Document Server

    Mac Low, Mordecai-Mark

    2007-01-01

    I review the evidence for the importance of feedback from massive stars at small and large scales. The feedback mechanisms include accretion luminosity, ionizing radiation, collimated outflows, and stellar winds. The good news is that feedback doesn't entirely prevent the formation of massive stars, while the bad news is that we don't know what does limit their masses. Feedback from massive stars also influences their surroundings. I argue that this does not produce a triggering efficiency above unity, nor does it prevent lots of prompt star formation in GMCs, though it may preserve massive remnants of the clouds for many dynamical times.

  13. Solution preparation

    Energy Technology Data Exchange (ETDEWEB)

    Seitz, M.G.

    1982-01-01

    Reviewed in this statement are methods of preparing solutions to be used in laboratory experiments to examine technical issues related to the safe disposal of nuclear waste from power generation. Each approach currently used to prepare solutions has advantages and any one approach may be preferred over the others in particular situations, depending upon the goals of the experimental program. These advantages are highlighted herein for three approaches to solution preparation that are currently used most in studies of nuclear waste disposal. Discussion of the disadvantages of each approach is presented to help a user select a preparation method for his particular studies. Also presented in this statement are general observations regarding solution preparation. These observations are used as examples of the types of concerns that need to be addressed regarding solution preparation. As shown by these examples, prior to experimentation or chemical analyses, laboratory techniques based on scientific knowledge of solutions can be applied to solutions, often resulting in great improvement in the usefulness of results.

  14. Damage control resuscitation for massive hemorrhage

    Institute of Scientific and Technical Information of China (English)

    Osaree Akaraborworn

    2014-01-01

    Hemorrhage is the second most common cause of death among trauma patients and almost half of the deaths occur within 24 hours after arrival.Damage control resuscitation is a new paradigm for patients with massive bleeding.It consists of permissive hypotension,hemostatic resuscitation and transfusion strategies,and damage control surgery.Permissive hypotension seems to have better results before the bleeding is controlled.The strategy of fluid resuscitation is minimizing crystalloid infusion and increasing early transfusion with a high ratio of fresh frozen plasma to packed red cells.Damage control surgery is done when the patient's condition is unfit for definitive surgery.Hemorrhage and contamination control with temporary abdominal closure is performed before transferring the patients to intensive care unit and the operating room for a permanent laparotomy.

  15. Revisiting perturbations in extended quasidilaton massive gravity

    Science.gov (United States)

    Heisenberg, Lavinia

    2015-04-01

    In this work we study the theory of extended quasidilaton massive gravity together with the presence of matter fields. After discussing the homogeneous and isotropic fully dynamical background equations, which governs the exact expansion history of the universe, we consider small cosmological perturbations around these general FLRW solutions. The stability of tensor, vector and scalar perturbations on top of these general background solutions give rise to slightly different constraints on the parameters of the theory than those obtained in the approximative assumption of the late-time asymptotic form of the expansion history, which does not correspond to our current epoch. This opens up the possibility of stable FLRW solutions to be compared with current data on cosmic expansion with the restricted parameter space based on theoretical ground.

  16. Massive cortical reorganization in sighted Braille readers.

    Science.gov (United States)

    Siuda-Krzywicka, Katarzyna; Bola, Łukasz; Paplińska, Małgorzata; Sumera, Ewa; Jednoróg, Katarzyna; Marchewka, Artur; Śliwińska, Magdalena W; Amedi, Amir; Szwed, Marcin

    2016-03-15

    The brain is capable of large-scale reorganization in blindness or after massive injury. Such reorganization crosses the division into separate sensory cortices (visual, somatosensory...). As its result, the visual cortex of the blind becomes active during tactile Braille reading. Although the possibility of such reorganization in the normal, adult brain has been raised, definitive evidence has been lacking. Here, we demonstrate such extensive reorganization in normal, sighted adults who learned Braille while their brain activity was investigated with fMRI and transcranial magnetic stimulation (TMS). Subjects showed enhanced activity for tactile reading in the visual cortex, including the visual word form area (VWFA) that was modulated by their Braille reading speed and strengthened resting-state connectivity between visual and somatosensory cortices. Moreover, TMS disruption of VWFA activity decreased their tactile reading accuracy. Our results indicate that large-scale reorganization is a viable mechanism recruited when learning complex skills.

  17. The Merging History of Massive Black Holes

    CERN Document Server

    Volonteri, M; Madau, P; Sesana, A

    2003-01-01

    We investigate a hierarchical structure formation scenario describing the evolution of a Super Massive Black Holes (SMBHs) population. The seeds of the local SMBHs are assumed to be 'pregalactic' black holes, remnants of the first POPIII stars. As these pregalactic holes become incorporated through a series of mergers into larger and larger halos, they sink to the center owing to dynamical friction, accrete a fraction of the gas in the merger remnant to become supermassive, form a binary system, and eventually coalesce. A simple model in which the damage done to a stellar cusps by decaying BH pairs is cumulative is able to reproduce the observed scaling relation between galaxy luminosity and core size. An accretion model connecting quasar activity with major mergers and the observed BH mass-velocity dispersion correlation reproduces remarkably well the observed luminosity function of optically-selected quasars in the redshift range 1

  18. Quasistars: Accreting black holes inside massive envelopes

    CERN Document Server

    Begelman, Mitchell C; Armitage, Philip J

    2007-01-01

    We study the structure and evolution of "quasistars," accreting black holes embedded within massive hydrostatic gaseous envelopes. These configurations may model the early growth of supermassive black hole seeds. The accretion rate onto the black hole adjusts so that the luminosity carried by the convective envelope equals the Eddington limit for the total mass. This greatly exceeds the Eddington limit for the black hole mass alone, leading to rapid growth of the black hole. We use analytic models and numerical stellar structure calculations to study the structure and evolution of quasistars. We derive analytically the scaling of the photospheric temperature with the black hole mass and envelope mass, and show that it decreases with time as the black hole mass increases. Once the photospheric temperature becomes lower than 10000 K, the photospheric opacity drops precipitously and the photospheric temperature hits a limiting value, analogous to the Hayashi track for red giants and protostars, below which no hy...

  19. Holographic Josephson Junction from Massive Gravity

    CERN Document Server

    Hu, Ya-Peng; Zeng, Hua-Bi; Zhang, Hai-Qing

    2015-01-01

    We study the holographic superconductor-normal metal-superconductor (SNS) Josephon junction in the massive gravity. In the homogeneous case of the chemical potential, we find that the graviton mass will make the normal metal-superconductor phase transition harder to take place. In the holographic model of Josephson junction, it is found that the maximal tunneling current will decrease according to the graviton mass. Besides, the coherence length of the junction decreases as well with respect to the graviton mass. If one interprets the graviton mass as the effect of momentum dissipation in the boundary field theory, it indicates that the stronger the momentum dissipation is, the smaller the coherence length is.

  20. Planckian Interacting Massive Particles as Dark Matter

    DEFF Research Database (Denmark)

    Garny, Mathias; Sandora, McCullen; Sloth, Martin S.

    2016-01-01

    . In this case the WIMP miracle is a mirage, and instead minimality as dictated by Occam's razor would indicate that dark matter is related to the Planck scale, where quantum gravity is anyway expected to manifest itself. Assuming within this framework that dark matter is a Planckian Interacting Massive Particle......, we show that the most natural mass larger than $0.01\\,\\textrm{M}_p$ is already ruled out by the absence of tensor modes in the CMB. This also indicates that we expect tensor modes in the CMB to be observed soon for this type of minimal dark matter model. Finally, we touch upon the KK graviton mode...... as a possible realization of this scenario within UV complete models, as well as further potential signatures and peculiar properties of this type of dark matter candidate. This paradigm therefore leads to a subtle connection between quantum gravity, the physics of primordial inflation, and the nature of dark...

  1. Massive open online courses in public health.

    Science.gov (United States)

    Gooding, Ira; Klaas, Brian; Yager, James D; Kanchanaraksa, Sukon

    2013-01-01

    Massive open online courses (MOOCs) represent a new and potentially transformative model for providing educational opportunities to learners not enrolled in a formal educational program. The authors describe the experience of developing and offering eight MOOCs on a variety of public health topics. Existing institutional infrastructure and experience with both for-credit online education and open educational resources mitigated the institutional risk and resource requirements. Although learners are able to enroll easily and freely and do so in large numbers, there is considerable variety in the level of participation and engagement among enrollees. As a result, comprehensive and accurate assessment of meaningful learning progress remains a major challenge for evaluating the effectiveness of MOOCs for providing public health education.

  2. Cosmic expansion in extended quasidilaton massive gravity

    Science.gov (United States)

    Kahniashvili, Tina; Kar, Arjun; Lavrelashvili, George; Agarwal, Nishant; Heisenberg, Lavinia; Kosowsky, Arthur

    2015-02-01

    Quasidilaton massive gravity offers a physically well-defined gravitational theory with nonzero graviton mass. We present the full set of dynamical equations governing the expansion history of the Universe, valid during radiation domination, matter domination, and a late-time self-accelerating epoch related to the graviton mass. The existence of self-consistent solutions constrains the amplitude of the quasidilaton field and the graviton mass, as well as other model parameters. We point out that the effective mass of gravitational waves can be significantly larger than the graviton mass, opening the possibility that a single theory can explain both the late-time acceleration of cosmic expansion and modifications of structure growth leading to the suppression of large-angle correlations observed in the cosmic microwave background.

  3. Revisiting perturbations in extended quasidilaton massive gravity

    CERN Document Server

    Heisenberg, Lavinia

    2015-01-01

    In this work we study the theory of extended quasidilaton massive gravity together with the presence of matter fields. After discussing the homogeneous and isotropic fully dynamical background equations, which governs the exact expansion history of the universe, we consider small cosmological perturbations around these general FLRW solutions. The stability of tensor, vector and scalar perturbations on top of these general background solutions give rise to slightly different constraints on the parameters of the theory than those obtained in the approximative assumption of the late-time asymptotic form of the expansion history, which does not correspond to our current epoch. This opens up the possibility of stable FLRW solutions to be compared with current data on cosmic expansion with the restricted parameter space based on theoretical ground.

  4. Cosmic Expansion in Extended Quasidilaton Massive Gravity

    CERN Document Server

    Kahniashvili, Tina; Lavrelashvili, George; Agarwal, Nishant; Heisenberg, Lavinia; Kosowsky, Arthur

    2014-01-01

    Quasidilaton massive gravity offers a physically well-defined gravitational theory with non-zero graviton mass. We present the full set of dynamical equations governing the expansion history of the universe, valid during radiation domination, matter domination, and a late-time self-accelerating epoch related to the graviton mass. The existence of self-consistent solutions constrains the amplitude of the quasi-dilaton field and the graviton mass, as well as other model parameters. We point out that the effective mass of gravitational waves can be significantly larger than the graviton mass, opening the possibility that a single theory can explain both the late-time acceleration of the cosmic expansion and modifications of structure growth leading to the suppression of large-angle correlations observed in the cosmic microwave background.

  5. The Massive Star Population in M101

    Science.gov (United States)

    Grammer, Skyler H.

    An increasing number of non-terminal giant eruptions are being observed by modern supernova and transient surveys. Very little is known about the origin of these giant eruptions and their progenitors which are presumably very-massive, evolved stars such as luminous blue variables, hypergiants, and supergiants. Motivated by the small number of progenitors positively associated with these giant eruptions, we have begun a survey of the luminous and evolved massive star populations in several nearby galaxies. We aim to identify the likely progenitors of the giant eruptions, study the spatial variations in the stellar populations, and examine the relationship between massive star populations and their environment. The work presented here is focused on stellar populations in the relatively nearby, giant, spiral galaxy M101 from sixteen archival BVI HST/ACS images. We create a catalog of stars in the direction to M101 with photometric errors history (SFH) for the stellar populations in five 2' wide annuli by fitting the color-magnitude diagrams. Binning the SFH into time frames corresponding to populations traced by Halpha, far ultraviolet (FUV), and near ultraviolet (NUV) emission, we show that the fraction of stellar populations young enough to contribute in Halpha is 15% " 35% in the inner regions, compared to less than 5% in the outer regions. This provides a sufficient explanation for the lack of Halpha emission at large radii. We also model the blue to red supergiant ratio in our five annuli, examine the effects that a metallicity gradient and variable SFH have on the predicted ratios, and compare to the observed values. We find that the radial behavior of our modeled blue to red supergiant ratios is highly sensitive to both spatial variations in the SFH and metallicity. Incorporating the derived SFH into the modeled ratios, we are able to reproduce the observed values at large radii (low metallicity), but at small radii (high metallicity) the modeled and observed

  6. [An unusual case of massive funicular lipoma].

    Science.gov (United States)

    Masciovecchio, Stefano; Saldutto, Pietro; Del Rosso, Alessandro; Galatioto, Giuseppe Paradiso; Vicentini, Carlo

    2014-01-01

    Intrascrotal lipomas are benign diseases that originate from adipose tissue inside the scrotal sac or constituting the scrotal wall itself. Paratesticular spermatic cord lipomas are a rare type of intrascrotal lipomas. A 78 years old patient in good health comes to our attention for massive tense-elastic swelling of left hemiscrotum appeared about 3 years ago and slowly increasing. Ultrasound evaluation of the intrascrotal mass showed inhomogeneous images mainly hyperechoic, not infiltrating the ipsilateral testis and scrotal wall. The ultrasonography found a lipomatous lesion with benign characteristics and a surgical excision has been performed. The lipomatous mass removed presented a size equal to 25 cm x 14 cm x 11 cm and a weight of about 490 gr. The microscopic examination of the tissue showed only the presence of mature adipocytes in the absence of cellular atypia, of other cellular types and of vascular abnormalities.

  7. Spectral modelling of massive binary systems

    CERN Document Server

    Palate, Matthieu; Koenigsberger, Gloria; Moreno, Edmundo

    2013-01-01

    Aims: We simulate the spectra of massive binaries at different phases of the orbital cycle, accounting for the gravitational influence of the companion star on the shape and physical properties of the stellar surface. Methods: We used the Roche potential modified to account for radiation pressure to compute the stellar surface of close circular systems and we used the TIDES code for surface computation of eccentric systems. In both cases, we accounted for gravity darkening and mutual heating generated by irradiation to compute the surface temperature. We then interpolated NLTE plane-parallel atmosphere model spectra in a grid to obtain the local spectrum at each surface point. We finally summed all contributions, accounting for the Doppler shift, limb-darkening, and visibility to obtain the total synthetic spectrum. We computed different orbital phases and sets of physical and orbital parameters. Results: Our models predict line strength variations through the orbital cycle, but fail to completely reproduce t...

  8. Formation and Assembly of Massive Star Clusters

    Science.gov (United States)

    McMillan, Stephen

    The formation of stars and star clusters is a major unresolved problem in astrophysics. It is central to modeling stellar populations and understanding galaxy luminosity distributions in cosmological models. Young massive clusters are major components of starburst galaxies, while globular clusters are cornerstones of the cosmic distance scale and represent vital laboratories for studies of stellar dynamics and stellar evolution. Yet how these clusters form and how rapidly and efficiently they expel their natal gas remain unclear, as do the consequences of this gas expulsion for cluster structure and survival. Also unclear is how the properties of low-mass clusters, which form from small-scale instabilities in galactic disks and inform much of our understanding of cluster formation and star-formation efficiency, differ from those of more massive clusters, which probably formed in starburst events driven by fast accretion at high redshift, or colliding gas flows in merging galaxies. Modeling cluster formation requires simulating many simultaneous physical processes, placing stringent demands on both software and hardware. Simulations of galaxies evolving in cosmological contexts usually lack the numerical resolution to simulate star formation in detail. They do not include detailed treatments of important physical effects such as magnetic fields, radiation pressure, ionization, and supernova feedback. Simulations of smaller clusters include these effects, but fall far short of the mass of even single young globular clusters. With major advances in computing power and software, we can now directly address this problem. We propose to model the formation of massive star clusters by integrating the FLASH adaptive mesh refinement magnetohydrodynamics (MHD) code into the Astrophysical Multi-purpose Software Environment (AMUSE) framework, to work with existing stellar-dynamical and stellar evolution modules in AMUSE. All software will be freely distributed on-line, allowing

  9. GENERATE TRIANGULATED SURFACES FROM MASSIVE UNORGANIZED POINTS

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    A region-growing method for reconstructing triangulated surfaces from massive unorganized points is presented. To save memory space, a ring data-structure is adopted to build connections between points and triangulated surfaces. The data-structure allows the efficient retrieval of all neighboring vertices and triangles of a given vertice. To narrow the search range of adjacent points and avoid triangle intersection, an influence area is defined for each active-edge. In the region-growing process of triangulated surfaces, a minimum-edge-angle-product algorithm is put forward to select an appropriate point to form a new triangle for an active edge. Results indicate that the presented method has high efficiency and needs less memory space, optimized triangulated surfaces with reliable topological quality can be obtained after triangulation.

  10. Signatures of massive collisions in debris discs

    CERN Document Server

    Kral, Quentin; Augereau, Jean-Charles; Boccaletti, Anthony; Charnoz, Sebastien

    2014-01-01

    Violent stochastic collisional events have been invoked as a possible explanation for some debris discs displaying pronounced asymmetries or having a great luminosity excess. So far, no thorough modelling of the consequences of such events has been carried out, mainly because of the extreme numerical challenge of coupling the dynamical and collisional evolution of dust. We perform the first fully self-consistent modelling of the aftermath of massive breakups in debris discs. We follow the collisional and dynamical evolution of dust released after the breakup of a Ceres-sized body at 6 AU from its central star. We investigate the duration, magnitude and spatial structure of the signature left by such a violent event, as well as its observational detectability. We use the recently developed LIDT-DD code (Kral et al., 2013), which handles the coupled collisional and dynamical evolution of debris discs. The main focus is placed on the complex interplay between destructive collisions, Keplerian dynamics and radiat...

  11. Four-dimensional unsubtraction with massive particles

    CERN Document Server

    Sborlini, German F R; Rodrigo, German

    2016-01-01

    We extend the four-dimensional unsubtraction method, which is based on the loop-tree duality (LTD), to deal with processes involving heavy particles. The method allows to perform the summation over degenerate IR configurations directly at integrand level in such a way that NLO corrections can be implemented directly in four space-time dimensions. We define a general momentum mapping between the real and virtual kinematics that accounts properly for the quasi-collinear configurations, and leads to an smooth massless limit. We illustrate the method first with an scalar toy example, and then analyse the case of the decay of a scalar or vector boson into a pair of massive quarks. The results presented in this paper are suitable for the application of the method to any multipartonic process.

  12. Massive = 2 supergravity in three dimensions

    Science.gov (United States)

    Alkaç, Gökhan; Basanisi, Luca; Bergshoeff, Eric A.; Ozkan, Mehmet; Sezgin, Ergin

    2015-02-01

    There exists two distinct off-shell = 2 supergravities in three dimensions. They are also referred to as = (1, 1) and = (2, 0) supergravities, and they arise from the coupling of the Weyl multiplet to a compensating scalar or vector multiplet, respectively, followed by fixing of conformal symmetries. The = ( p, q) terminology refers to the underlying anti-de Sitter superalgebras OSp(2, p) ⊕ OSp(2, q) with R-symmetry group SO( p) × SO( q). We construct off-shell invariants of these theories up to fourth order in derivatives. As an application of these results, we determine the special combinations of the = (1, 1) invariants that admit anti-de Sitter vacuum solution about which there is a ghost-free massive spin-2 multiplet of propagating modes. We also show that the =(2,0) invariants do not allow such possibility.

  13. The most distant observable massive objects

    CERN Document Server

    Rosado, Pablo A; Thrane, Eric; Zhu, Xingjiang; Mandel, Ilya; Sesana, Alberto

    2015-01-01

    Recent non-detection of gravitational-wave backgrounds from pulsar timing arrays casts further uncertainty on the evolution of supermassive black hole binaries. We study the capabilities of current gravitational-wave observatories to detect individual binaries and demonstrate that, contrary to conventional wisdom, some are detectable throughout the Universe. In particular, a binary with rest-frame mass $\\gtrsim 10^{10}\\,M_\\odot$ can be detected by current timing arrays at arbitrarily high redshifts. The same claim will apply for less massive binaries with more sensitive future arrays. As a consequence, future searches for nanohertz gravitational waves could be expanded to target evolving high-redshift binaries. We calculate the maximum distance at which binaries can be observed with pulsar timing arrays and other detectors, properly accounting for redshift and using realistic binary waveforms.

  14. Massive photons in cosmology: a thermodynamical approach

    CERN Document Server

    Cuzinatto, R R; Medeiros, L G; de Souza, C Naldoni; Pimentel, B M

    2016-01-01

    We investigate the influence of massive photons on the evolution of the expanding universe. The analysis is performed assuming that the only relevant component in the universe is radiation. Two particular models for generalized electrodynamics are considered, namely Proca field and Podolsky electrodynamics. We obtain the equation of state (EOS) $P=P(\\varepsilon)$ for each case using the dispersion relation derived from both theories. The EOS are inputted into the Friedmann equations of a homogeneous and isotropic space-time to determine the cosmic scale factor $a(t)$. It is shown that the photon non-null mass does not alter significantly the result $a\\propto t^{1/2}$ valid for a massless photon gas; this is true either in Proca's case (where the photon mass $m$ is extremely small) or in Podolsky field (for which $m$ is extremely large).

  15. Substructure of Highly Boosted Massive Jets

    Energy Technology Data Exchange (ETDEWEB)

    Alon, Raz [Weizmann Inst. of Science, Rehovot (Israel)

    2012-10-01

    Modern particle accelerators enable researchers to study new high energy frontiers which have never been explored before. This realm opens possibilities to further examine known fields such as Quantum Chromodynamics. In addition, it allows searching for new physics and setting new limits on the existence of such. This study examined the substructure of highly boosted massive jets measured by the CDF II detector. Events from 1.96 TeV proton-antiproton collisions at the Fermilab Tevatron Collider were collected out of a total integrated luminosity of 5.95 fb$^{-1}$. They were selected to have at least one jet with transverse momentum above 400 GeV/c. The jet mass, angularity, and planar flow were measured and compared with predictions of perturbative Quantum Chromodynamics, and were found to be consistent with the theory. A search for boosted top quarks was conducted and resulted in an upper limit on the production cross section of such top quarks.

  16. Magnetic spots on hot massive stars

    CERN Document Server

    Cantiello, Matteo

    2011-01-01

    Hot luminous stars show a variety of phenomena in their photospheres and winds which still lack clear physical explanation. Among these phenomena are photospheric turbulence, line profile variability (LPV), non-thermal emission, non-radial pulsations, discrete absorption components (DACs) and wind clumping. Cantiello et al. (2009) argued that a convection zone close to the stellar surface could be responsible for some of these phenomena. This convective zone is caused by a peak in the opacity associated with iron-group elements and is referred to as the "iron convection zone" (FeCZ). Assuming dynamo action producing magnetic fields at equipartition in the FeCZ, we investigate the occurrence of subsurface magnetism in OB stars. Then we study the surface emergence of these magnetic fields and discuss possible observational signatures of magnetic spots. Simple estimates are made using the subsurface properties of massive stars, as calculated in 1D stellar evolution models. We find that magnetic fields of suffici...

  17. Topologically Massive Gravity from the Heterotic String

    CERN Document Server

    Lu, H

    2010-01-01

    Topologically massive gravity (TMG) in three dimensions provides an interesting toy model for constructing a quantum theory of gravity. Although it can be thought of as standing as a theory in its own right, it is also of interest to see whether it can be described within the larger framework of string theory or M-theory. In this paper, we show that it can be embedded within the heterotic string, via a compactification on $S^3\\times T^4$. Since all solutions of TMG can now be lifted to ten dimensions, this allows us to give a string and brane interpretation to quantities such as the central charges in the conformal field theory on the boundary of TMG, and the entropy of the BTZ black hole solution.

  18. Large-group psychodynamics and massive violence

    Directory of Open Access Journals (Sweden)

    Vamik D. Volkan

    2006-06-01

    Full Text Available Beginning with Freud, psychoanalytic theories concerning large groups have mainly focused on individuals' perceptions of what their large groups psychologically mean to them. This chapter examines some aspects of large-group psychology in its own right and studies psychodynamics of ethnic, national, religious or ideological groups, the membership of which originates in childhood. I will compare the mourning process in individuals with the mourning process in large groups to illustrate why we need to study large-group psychology as a subject in itself. As part of this discussion I will also describe signs and symptoms of large-group regression. When there is a threat against a large-group's identity, massive violence may be initiated and this violence in turn, has an obvious impact on public health.

  19. Gravito-electromagnetic Effects of Massive Rings

    CERN Document Server

    Ruggiero, Matteo Luca

    2015-01-01

    The Einstein field equations in linear post-Newtonian approximation can be written in analogy with electromagnetism, in the so-called gravito-electromagnetic formalism. We use this analogy to study the gravitational field of a massive ring: in particular, we consider a continuous mass distribution on Keplerian orbit around a central body, and we work out the gravitational field generated by this mass distribution in the intermediate zone between the central body and the ring, focusing on the gravito-magnetic component that originates from the rotation of the ring. In doing so, we generalize and complement some previous results that focused on the purely Newtonian effects of the ring (thus neglecting its rotation) or that were applied to the case of rotating spherical shells. Eventually, we study in some simple cases the effect of the the rotation of the ring, and suggest that, in principle, this approach could be used to infer information about the angular momentum of the ring.

  20. METHYL CYANIDE OBSERVATIONS TOWARD MASSIVE PROTOSTARS

    Energy Technology Data Exchange (ETDEWEB)

    Rosero, V.; Hofner, P. [Physics Department, New Mexico Tech, 801 Leroy Place, Socorro, NM 87801 (United States); Kurtz, S. [Centro de Radioastronomia y Astrofisica, Universidad Nacional Autonoma de Mexico, Morelia 58090 (Mexico); Bieging, J. [Department of Astronomy and Steward Observatory, University of Arizona, 933 North Cherry Avenue, Tucson, AZ 85721 (United States); Araya, E. D. [Physics Department, Western Illinois University, 1 University Circle, Macomb, IL 61455 (United States)

    2013-07-01

    We report the results of a survey in the CH{sub 3}CN J = 12 {yields} 11 transition toward a sample of massive proto-stellar candidates. The observations were carried out with the 10 m Submillimeter Telescope on Mount Graham, AZ. We detected this molecular line in 9 out of 21 observed sources. In six cases this is the first detection of this transition. We also obtained full beam sampled cross-scans for five sources which show that the lower K-components can be extended on the arcminute angular scale. The higher K-components, however, are always found to be compact with respect to our 36'' beam. A Boltzmann population diagram analysis of the central spectra indicates CH{sub 3}CN column densities of about 10{sup 14} cm{sup -2}, and rotational temperatures above 50 K, which confirms these sources as hot molecular cores. Independent fits to line velocity and width for the individual K-components resulted in the detection of an increasing blueshift with increasing line excitation for four sources. Comparison with mid-infrared (mid-IR) images from the SPITZER GLIMPSE/IRAC archive for six sources show that the CH{sub 3}CN emission is generally coincident with a bright mid-IR source. Our data clearly show that the CH{sub 3}CN J = 12 {yields} 11 transition is a good probe of the hot molecular gas near massive protostars, and provide the basis for future interferometric studies.

  1. Evolution and Nucleosynthesis of Very Massive Stars

    Science.gov (United States)

    Hirschi, Raphael

    In this chapter, after a brief introduction and overview of stellar evolution, we discuss the evolution and nucleosynthesis of very massive stars (VMS: M > 100 M_{odot } ) in the context of recent stellar evolution model calculations. This chapter covers the following aspects: general properties, evolution of surface properties, late central evolution, and nucleosynthesis including their dependence on metallicity, mass loss and rotation. Since very massive stars have very large convective cores during the main-sequence phase, their evolution is not so much affected by rotational mixing, but more by mass loss through stellar winds. Their evolution is never far from a homogeneous evolution even without rotational mixing. All VMS at metallicities close to solar end their life as WC(-WO) type Wolf-Rayet stars. Due to very important mass loss through stellar winds, these stars may have luminosities during the advanced phases of their evolution similar to stars with initial masses between 60 and 120 M_{odot } . A distinctive feature which may be used to disentangle Wolf-Rayet stars originating from VMS from those originating from lower initial masses is the enhanced abundances of neon and magnesium at the surface of WC stars. At solar metallicity, mass loss is so strong that even if a star is born with several hundred solar masses, it will end its life with less than 50 M_{odot } (using current mass loss prescriptions). At the metallicity of the LMC and lower, on the other hand, mass loss is weaker and might enable stars to undergo pair-instability supernovae.

  2. The Deuteration Clock for Massive Starless Cores

    Science.gov (United States)

    Kong, S.; Tan, J. C.; Caselli, P.; Fontani, F.

    2015-05-01

    To understand massive star formation requires study of its initial conditions. Two massive starless core candidates, C1-N & C1-S, have been detected in IRDC G028.37+00.07 in N2D+(3-2) with ALMA. From their line widths, either the cores are subvirial and are thus young structures on the verge of near free-fall collapse, or they are threaded by ˜1 mG B-fields that help support them in near virial equilibrium and potentially have older ages. We modeled the deuteration rate of N2H+ to constrain collapse rates of the cores. First, to measure their current deuterium fraction, D≡ [N2D+]/[N2H+], we observed multiple transitions of N2H+ and N2D+ with CARMA, SMA, JCMT, NRO 45 m and IRAM 30 m, to complement the ALMA data. For both cores we derived D ˜ 0.3, several orders of magnitude above the cosmic [D]/[H] ratio. We then carried out chemodynamical modeling, exploring how collapse rate relative to free-fall, αff, affects the level of D that is achieved from a given initial condition. To reach the observed D, most models require slow collapse with αff˜0.1, i.e., ˜1/10th of free-fall. This makes it more likely that the cores have been able to reach a near virial equilibrium state and we predict that strong B-fields will eventually be detected. The methods developed here will be useful for measurement of the pre-stellar core mass function.

  3. MASSIVE INFANT STARS ROCK THEIR CRADLE

    Science.gov (United States)

    2002-01-01

    Extremely intense radiation from newly born, ultra-bright stars has blown a glowing spherical bubble in the nebula N83B, also known as NGC 1748. A new NASA Hubble Space Telescope image has helped to decipher the complex interplay of gas and radiation of a star-forming region in a nearby galaxy. The image graphically illustrates just how these massive stars sculpt their environment by generating powerful winds that alter the shape of the parent gaseous nebula. These processes are also seen in our Milky Way in regions like the Orion Nebula. The Hubble telescope is famous for its contribution to our knowledge about star formation in very distant galaxies. Although most of the stars in the Universe were born several billions of years ago, when the Universe was young, star formation still continues today. This new Hubble image shows a very compact star-forming region in a small part of one of our neighboring galaxies - the Large Magellanic Cloud. This galaxy lies only 165,000 light-years from our Milky Way and can easily be seen with the naked eye from the Southern Hemisphere. Young, massive, ultra-bright stars are seen here just as they are born and emerge from the shelter of their pre-natal molecular cloud. Catching these hefty stars at their birthplace is not as easy as it may seem. Their high mass means that the young stars evolve very rapidly and are hard to find at this critical stage. Furthermore, they spend a good fraction of their youth hidden from view, shrouded by large quantities of dust in a molecular cloud. The only chance is to observe them just as they start to emerge from their cocoon - and then only with very high-resolution telescopes. Astronomers from France, the U.S., and Germany have used Hubble to study the fascinating interplay between gas, dust, and radiation from the newly born stars in this nebula. Its peculiar and turbulent structure has been revealed for the first time. This high-resolution study has also uncovered several individual stars

  4. Massive stars. A chemical signature of first-generation very massive stars.

    Science.gov (United States)

    Aoki, W; Tominaga, N; Beers, T C; Honda, S; Lee, Y S

    2014-08-22

    Numerical simulations of structure formation in the early universe predict the formation of some fraction of stars with several hundred solar masses. No clear evidence of supernovae from such very massive stars has, however, yet been found in the chemical compositions of Milky Way stars. We report on an analysis of a very metal-poor star SDSS J001820.5-093939.2, which possesses elemental-abundance ratios that differ significantly from any previously known star. This star exhibits low [α-element Fe] ratios and large contrasts between the abundances of odd and even element pairs, such as scandium/titanium and cobalt/nickel. Such features have been predicted by nucleosynthesis models for supernovae of stars more than 140 times as massive as the Sun, suggesting that the mass distribution of first-generation stars might extend to 100 solar masses or larger.

  5. Consumer protection

    OpenAIRE

    Štěrbová, Alena

    2010-01-01

    77 Resumé This thesis is dedicated to the consumer protection. My reason for the choice of this topic was following. A field of consumer protection is being continually developed. It is complicated for a layman to be well informed about all his rights and duties not only because the Czech legal regulation suffers from a immense fragmentation. Moreover, the implementation of EC directives ( as a source of many provisions protecting a consumer in the Civil Code) into our legal system was carrie...

  6. Protecting privacy in a clinical data warehouse.

    Science.gov (United States)

    Kong, Guilan; Xiao, Zhichun

    2015-06-01

    Peking University has several prestigious teaching hospitals in China. To make secondary use of massive medical data for research purposes, construction of a clinical data warehouse is imperative in Peking University. However, a big concern for clinical data warehouse construction is how to protect patient privacy. In this project, we propose to use a combination of symmetric block ciphers, asymmetric ciphers, and cryptographic hashing algorithms to protect patient privacy information. The novelty of our privacy protection approach lies in message-level data encryption, the key caching system, and the cryptographic key management system. The proposed privacy protection approach is scalable to clinical data warehouse construction with any size of medical data. With the composite privacy protection approach, the clinical data warehouse can be secure enough to keep the confidential data from leaking to the outside world. © The Author(s) 2014.

  7. Binary interaction dominates the evolution of massive stars

    NARCIS (Netherlands)

    Sana, H.; de Mink, S.E.; de Koter, A.; Langer, N.; Evans, C.J.; Gieles, M.; Gosset, E.; Izzard, R.G.; Le Bouquin, J.-B.; Schneider, F.R.N.

    2012-01-01

    The presence of a nearby companion alters the evolution of massive stars in binary systems, leading to phenomena such as stellar mergers, x-ray binaries, and gamma-ray bursts. Unambiguous constraints on the fraction of massive stars affected by binary interaction were lacking. We simultaneously meas

  8. A spin-4 analog of 3D massive gravity

    NARCIS (Netherlands)

    Bergshoeff, Eric A.; Kovacevic, Marija; Rosseel, Jan; Townsend, Paul K.; Yin, Yihao

    2011-01-01

    A sixth-order, but ghost-free, gauge-invariant action is found for a fourth-rank symmetric tensor potential in a three-dimensional (3D) Minkowski spacetime. It propagates two massive modes of spin 4 that are interchanged by parity and is thus a spin-4 analog of linearized 'new massive gravity'. Also

  9. Study on retrieve specified objects in massive remote sensing data

    Institute of Scientific and Technical Information of China (English)

    WANG Rongjing; CHEN Ping; ZHANG Wei

    2005-01-01

    In this paper, we show that to retrieve specified objects in massive remote sensing data set is very important in both practice and theory. An algorithm-based content retrieval in the massive data set is studied. To avoid the loss of information, the algorithm based on the Support Vector Machine classification is proposed. Also, the experiment on the real data set is made.

  10. Massive vulvar edema in 2 prepartum dairy cows.

    Science.gov (United States)

    Cheong, Soon Hon; Gilbert, Robert O

    2014-05-01

    Two late gestation Holstein cows about to begin the third lactation developed massive vulvar edema. These were the only affected animals in the herd of 500 milking cows. The vulvar edema spontaneously regressed postpartum for both cows. Massive vulvar swelling is seldom observed in dairy cows in advanced pregnancy and is not described in the literature.

  11. Interactions between massive dark halos and warped disks

    NARCIS (Netherlands)

    Kuijken, K; Persic, M; Salucci, P

    1997-01-01

    The normal mode theory for warping of galaxy disks, in which disks are assumed to be tilted with respect to the equator of a massive, flattened dark halo, assumes a rigid, fixed halo. However, consideration of the back-reaction by a misaligned disk on a massive particle halo shows there to be strong

  12. Massive weight loss-induced mechanical plasticity in obese gait

    NARCIS (Netherlands)

    Hortobagyi, Tibor; Herring, Cortney; Pories, Walter J.; Rider, Patrick; DeVita, Paul

    2011-01-01

    Hortobagyi T, Herring C, Pories WJ, Rider P, DeVita P. Massive weight loss-induced mechanical plasticity in obese gait. J Appl Physiol 111: 1391-1399, 2011. First published August 18, 2011; doi:10.1152/japplphysiol.00291.2011.-We examined the hypothesis that metabolic surgery-induced massive weight

  13. The MiMeS project: magnetism in massive stars

    NARCIS (Netherlands)

    G.A. Wade; E. Alecian; D.A. Bohlender; J.C. Bouret; J.H. Grunhut; H. Henrichs; C. Neiner; V. Petit; N. St. Louis; M. Aurière; O. Kochukhov; J. Silvester; A. ud-Doula

    2008-01-01

    The Magnetism in Massive Stars (MiMeS) Project is a consensus collaboration among the foremost international researchers of the physics of hot, massive stars, with the basic aim of understanding the origin, evolution and impact of magnetic fields in these objects. The cornerstone of the project is t

  14. The Kaluza-Klein monopole in a massive IIA background

    NARCIS (Netherlands)

    Eyras, E; Lozano, Y

    1999-01-01

    We construct the effective action of the KK monopole in a massive Spe IIA background. We follow two approaches. First we construct a massive M-theory KK monopole from which the IIA monopole is obtained by double dimensional reduction. This eleven-dimensional monopole contains two isometries: one und

  15. Massive weight loss-induced mechanical plasticity in obese gait

    NARCIS (Netherlands)

    Hortobagyi, Tibor; Herring, Cortney; Pories, Walter J.; Rider, Patrick; DeVita, Paul

    2011-01-01

    Hortobagyi T, Herring C, Pories WJ, Rider P, DeVita P. Massive weight loss-induced mechanical plasticity in obese gait. J Appl Physiol 111: 1391-1399, 2011. First published August 18, 2011; doi:10.1152/japplphysiol.00291.2011.-We examined the hypothesis that metabolic surgery-induced massive weight

  16. Limiting Accretion onto Massive Stars by Fragmentation-Induced Starvation

    Energy Technology Data Exchange (ETDEWEB)

    Peters, Thomas; /ZAH, Heidelberg; Klessen, Ralf S.; /ZAH, Heidelberg /KIPAC, Menlo Park; Mac Low, Mordecai-Mark; /Amer. Museum Natural Hist.; Banerjee, Robi; /ZAH, Heidelberg

    2010-08-25

    Massive stars influence their surroundings through radiation, winds, and supernova explosions far out of proportion to their small numbers. However, the physical processes that initiate and govern the birth of massive stars remain poorly understood. Two widely discussed models are monolithic collapse of molecular cloud cores and competitive accretion. To learn more about massive star formation, we perform simulations of the collapse of rotating, massive, cloud cores including radiative heating by both non-ionizing and ionizing radiation using the FLASH adaptive mesh refinement code. These simulations show fragmentation from gravitational instability in the enormously dense accretion flows required to build up massive stars. Secondary stars form rapidly in these flows and accrete mass that would have otherwise been consumed by the massive star in the center, in a process that we term fragmentation-induced starvation. This explains why massive stars are usually found as members of high-order stellar systems that themselves belong to large clusters containing stars of all masses. The radiative heating does not prevent fragmentation, but does lead to a higher Jeans mass, resulting in fewer and more massive stars than would form without the heating. This mechanism reproduces the observed relation between the total stellar mass in the cluster and the mass of the largest star. It predicts strong clumping and filamentary structure in the center of collapsing cores, as has recently been observed. We speculate that a similar mechanism will act during primordial star formation.

  17. First Order Actions for New Massive Dual Gravities

    CERN Document Server

    Bracho, Alexangel

    2013-01-01

    We present a first order formulation for the fourth order action of the new massive dual gravity in four dimensions. This proposal is easily generalized to arbitrary dimension. Also, we obtain the dual actions for massless and massive Curtright fields in D dimensions.

  18. Were All Massive Stars Born in OB Associations and Clusters?

    CERN Document Server

    Chu, You-Hua

    2007-01-01

    It has been commonly conjectured that all massive >10 Msun stars are born in OB associations or clusters. Many O and B stars in the Galaxy or the Magellanic Clouds appear to exist in isolation, however. While some of these field OB stars have been ejected from their birthplaces, some are too far away from massive star forming regions to be runaways. Can massive stars form in isolation? The Spitzer survey of the Large Magellanic Cloud (aka SAGE) provides a unique opportunity for us to investigate and characterize the formation sites of massive stars for an entire galaxy. We have identified all massive young stellar objects (YSOs) in the Large Magellanic Cloud. We find that ~85% of the massive YSOs are in giant molecular clouds and ~65% are in OB associations. Only ~7% of the massive YSOs are neither in OB associations nor in giant molecular clouds. This fraction of isolated massive stars in the Large Magellanic Cloud is comparable to the 5-10% found in the Galaxy.

  19. RCW36: characterizing the outcome of massive star formation

    CERN Document Server

    Ellerbroek, L E; Kaper, L; Maaskant, K M; Paalvast, M; Tramper, F; Sana, H; Waters, L B F M; Balog, Z

    2013-01-01

    Massive stars play a dominant role in the process of clustered star formation, with their feedback into the molecular cloud through ionizing radiation, stellar winds and outflows. The formation process of massive stars is poorly constrained because of their scarcity, the short formation timescale and obscuration. By obtaining a census of the newly formed stellar population, the star formation history of the young cluster and the role of the massive stars within it can be unraveled. We aim to reconstruct the formation history of the young stellar population of the massive star-forming region RCW 36. We study several dozens of individual objects, both photometrically and spectroscopically, look for signs of multiple generations of young stars and investigate the role of the massive stars in this process. We obtain a census of the physical parameters and evolutionary status of the young stellar population. Using a combination of near-infrared photometry and spectroscopy we estimate ages and masses of individual ...

  20. Protective Eyewear

    Science.gov (United States)

    ... visual disorders, mechanisms of visual function, preservation of sight, and the special health problems and requirements of ... They protect your eyes from the sun’s ultraviolet (UV) rays, which can damage your eyes. Pick sunglasses ...

  1. Protected Areas

    Data.gov (United States)

    Kansas Data Access and Support Center — This dataset shows the boundaries of properties in Kansas in public or institutional ownership that contain ecological resources that merit some level of protection....

  2. Memory protection

    Science.gov (United States)

    Denning, Peter J.

    1988-01-01

    Accidental overwriting of files or of memory regions belonging to other programs, browsing of personal files by superusers, Trojan horses, and viruses are examples of breakdowns in workstations and personal computers that would be significantly reduced by memory protection. Memory protection is the capability of an operating system and supporting hardware to delimit segments of memory, to control whether segments can be read from or written into, and to confine accesses of a program to its segments alone. The absence of memory protection in many operating systems today is the result of a bias toward a narrow definition of performance as maximum instruction-execution rate. A broader definition, including the time to get the job done, makes clear that cost of recovery from memory interference errors reduces expected performance. The mechanisms of memory protection are well understood, powerful, efficient, and elegant. They add to performance in the broad sense without reducing instruction execution rate.

  3. Radiation Protection

    Energy Technology Data Exchange (ETDEWEB)

    Loos, M

    2001-04-01

    Major achievements of SCK-CEN's Radiation Protection Department in 2000 are described. The main areas for R and D of the department remain neutron dosimetry and neutron activation analysis, safeguards information handling and non-destructive assay techniques. Further activities include low-level radioactivity measurements in environmental and biological samples and radiation protection research. Finally, achievements in decision strategy research and social sciences in nuclear research are reported.

  4. Corrosion protection

    Science.gov (United States)

    Brown, Donald W.; Wagh, Arun S.

    2003-05-27

    There has been invented a chemically bonded phosphate corrosion protection material and process for application of the corrosion protection material for corrosion prevention. A slurry of iron oxide and phosphoric acid is used to contact a warm surface of iron, steel or other metal to be treated. In the presence of ferrous ions from the iron, steel or other metal, the slurry reacts to form iron phosphates which form grains chemically bonded onto the surface of the steel.

  5. Difluoromethane preparation

    NARCIS (Netherlands)

    Wiersma, A.; Sandt, E.J.A.; Van Bekkum, H.; Makkee, M.; Moulijn, J.A.

    1996-01-01

    Abstract of NL 9401574 (A) The invention relates to a method for preparing difluoromethane, wherein dichlorodifluoromethane or monochlorodifluoromethane is brought into contact with hydrogen in the presence of palladium on activated carbon, wherein the loading of the palladium on the activated c

  6. Using Massive Multivariate NIRS Data in Ryegrass

    DEFF Research Database (Denmark)

    Edriss, Vahid; Greve-Pedersen, Morten; Jensen, Christian S

    2015-01-01

    Near infrared spectroscopy (NIRS) analytical techniques is a simple, fast and low cost method of high dimensional phenotyping compared to usual chemical techniques. To use this method there is no need for special sample preparation. The aim of this study is to use NIRS data to predict plant traits...

  7. Massive job cuts threaten East German science

    CERN Multimedia

    Hamer, M

    1990-01-01

    German reunification could result in thousands of scientists losing their jobs. At the end of this year the East German state budget for science will run out. Scientists in the East are keen to find Western support to protect their research (1 page).

  8. Massive deformations of rank-2 symmetric tensor theory (a.k.a. BRS characterization of Fierz-Pauli massive gravity)

    Science.gov (United States)

    Blasi, Alberto; Maggiore, Nicola

    2017-01-01

    In this paper we consider the issue of massive gravity from a pure field theoretical point of view, as the massive deformation of the gauge theory for a symmetric rank-2 tensor field. We look for the most general massive theory with well defined propagators, imposing the absence of unphysical poles. We find several possibilities, depending on the choice of the gauge fixing term. Amongst these, two solutions with good massless limit are found. The request of the absence of tachyons, alone, does not isolate the Fierz-Pauli case: several examples of massive theories, which may or may not include the Fierz-Pauli mass term, are given. On the other hand, the Fierz-Pauli theory can be uniquely identified by means of a symmetry: it turns out the the Fierz-Pauli massive gravity is the only element of the cohomology of a BRS operator.

  9. Massive stars in their death-throes

    CERN Document Server

    Eldridge, J J

    2008-01-01

    The study of the stars that explode as supernovae used to be a forensic study, working backwards from the remnants of the star. This changed in 1987 when the first progenitor star was identified in pre-explosion images. Currently there are 8 detected progenitors with another 21 non-detections, for which only a limit on the pre-explosion luminosity can be placed. This new avenue of supernova research has led to many interesting conclusions, most importantly that the progenitors of the most common supernovae, type IIP, are red supergiants as theory has long predicted. However no progenitors have been detected thus far for the hydrogen-free type Ib/c supernovae which, given the expected progenitors, is an unlikely result. Also observations have begun to show evidence that luminous blue variables, which are among the most massive stars, may directly explode as supernovae. These results contradict current stellar evolution theory. This suggests that we may need to update our understanding.

  10. Minimal N=4 topologically massive supergravity

    Science.gov (United States)

    Kuzenko, Sergei M.; Novak, Joseph; Sachs, Ivo

    2017-03-01

    Using the superconformal framework, we construct a new off-shell model for N=4 topologically massive supergravity which is minimal in the sense that it makes use of a single compensating vector multiplet and involves no free parameter. As such, it provides a counterexample to the common lore that two compensating multiplets are required within the conformal approach to supergravity with eight supercharges in diverse dimensions. This theory is an off-shell N=4 supersymmetric extension of chiral gravity. All of its solutions correspond to non-conformally flat superspaces. Its maximally supersymmetric solutions include the so-called critical (4,0) anti-de Sitter superspace introduced in [25], and well as warped critical (4,0) anti-de Sitter superspaces. We also propose a dual formulation for the theory in which the vector multiplet is replaced with an off-shell hypermultiplet. Upon elimination of the auxiliary fields belonging to the hypermultiplet and imposing certain gauge conditions, the dual action reduces to the one introduced in [20].

  11. Massive surgical emphysema following transanal endoscopic microsurgery

    Institute of Scientific and Technical Information of China (English)

    Geert; AAM; Simkens; Simon; W; Nienhuijs; Misha; DP; Luyer; Ignace; HJT; de; Hingh

    2014-01-01

    We describe an impressive and rare case of surgical emphysema after minimally invasive rectal surgery. This case reports on a patient who developed mas-sive retroperitoneal, intraperitoneal and subcutaneous emphysema directly following a transanal endoscopic microsurgery(TEM) procedure for a rectal intramuco-sal carcinoma. Free intra-abdominal air after gastro-intestinal surgery can be a sign of a bowel perforation or anastomotic leakage. This is a serious complication often requiring immediate surgery. In our patient an abdominal computed tomography-scan with rectal con-trast showed no signs of a rectal perforation. Therefore this emphysema was caused by the insufflation of CO2 gas in the rectum during the TEM-procedure. Conserva-tive treatment resulted in an uneventful recovery. With the increasing usage of TEM for rectal lesions we ex-pect this complication to occur more often. After ruling out a full thickness rectal wall perforation in patients with surgical emphysema following TEM, conservative treatment is the treatment of choice.

  12. Massive cortical reorganization in sighted Braille readers

    Science.gov (United States)

    Siuda-Krzywicka, Katarzyna; Bola, Łukasz; Paplińska, Małgorzata; Sumera, Ewa; Jednoróg, Katarzyna; Marchewka, Artur; Śliwińska, Magdalena W; Amedi, Amir; Szwed, Marcin

    2016-01-01

    The brain is capable of large-scale reorganization in blindness or after massive injury. Such reorganization crosses the division into separate sensory cortices (visual, somatosensory...). As its result, the visual cortex of the blind becomes active during tactile Braille reading. Although the possibility of such reorganization in the normal, adult brain has been raised, definitive evidence has been lacking. Here, we demonstrate such extensive reorganization in normal, sighted adults who learned Braille while their brain activity was investigated with fMRI and transcranial magnetic stimulation (TMS). Subjects showed enhanced activity for tactile reading in the visual cortex, including the visual word form area (VWFA) that was modulated by their Braille reading speed and strengthened resting-state connectivity between visual and somatosensory cortices. Moreover, TMS disruption of VWFA activity decreased their tactile reading accuracy. Our results indicate that large-scale reorganization is a viable mechanism recruited when learning complex skills. DOI: http://dx.doi.org/10.7554/eLife.10762.001 PMID:26976813

  13. Measuring Massive Black Hole Binaries with LISA

    Science.gov (United States)

    Lang, Ryan N.; Hughes, Scott A.; Cornish, Neil J.

    2009-01-01

    The coalescence of two massive black holes produces gravitational waves (GWs) which can be detected by the space-based detector LISA. By measuring these waves, LISA can determine the various parameters which characterize the source. Measurements of the black hole masses and spins will provide information about the growth of black holes and their host galaxies over time. Measurements of a source's sky position and distance may help astronomers identify an electromagnetic counterpart to the GW event. The counterpart's redshift, combined with the GW-measured luminosity distance, can then be used to measure the Hubble constant and the dark energy parameter $w$. Because the potential science output is so high, it is useful to know in advance how well LISA can measure source parameters for a wide range of binaries. We calculate expected parameter estimation errors using the well-known Fisher matrix method. Our waveform model includes the physics of spin precession, as well as subleading harmonics. When these higher-order effects are not included, strong degeneracies between some parameters cause them to be poorly determined by a GW measurement. When precession and subleading harmonics are properly included, the degeneracies are broken, reducing parameter errors by one to several orders of magnitude.

  14. Collective excitations of massive flavor branes

    CERN Document Server

    Itsios, Georgios; Ramallo, Alfonso V

    2016-01-01

    We study the intersections of two sets of D-branes of different dimensionalities. This configuration is dual to a supersymmetric gauge theory with flavor hypermultiplets in the fundamental representation of the gauge group which live on the defect of the unflavored theory determined by the directions common to the two types of branes. One set of branes is dual to the color degrees of freedom, while the other set adds flavor to the system. We work in the quenched approximation, i.e., where the flavor branes are considered as probes, and focus specifically on the case in which the quarks are massive. We study the thermodynamics and the speeds of first and zero sound at zero temperature and non-vanishing chemical potential. We show that the system undergoes a quantum phase transition when the chemical potential approaches its minimal value and we obtain the corresponding non-relativistic critical exponents that characterize its critical behavior. In the case of (2+1)-dimensional intersections, we further study a...

  15. Collective excitations of massive flavor branes

    Science.gov (United States)

    Itsios, Georgios; Jokela, Niko; Ramallo, Alfonso V.

    2016-08-01

    We study the intersections of two sets of D-branes of different dimensionalities. This configuration is dual to a supersymmetric gauge theory with flavor hypermultiplets in the fundamental representation of the gauge group which live on the defect of the unflavored theory determined by the directions common to the two types of branes. One set of branes is dual to the color degrees of freedom, while the other set adds flavor to the system. We work in the quenched approximation, i.e., where the flavor branes are considered as probes, and focus specifically on the case in which the quarks are massive. We study the thermodynamics and the speeds of first and zero sound at zero temperature and non-vanishing chemical potential. We show that the system undergoes a quantum phase transition when the chemical potential approaches its minimal value and we obtain the corresponding non-relativistic critical exponents that characterize its critical behavior. In the case of (2 + 1)-dimensional intersections, we further study alternative quantization and the zero sound of the resulting anyonic fluid. We finally extend these results to non-zero temperature and magnetic field and compute the diffusion constant in the hydrodynamic regime. The numerical results we find match the predictions by the Einstein relation.

  16. Evolution of Collisionally Merged Massive Stars

    CERN Document Server

    Suzuki, T K; Baumgardt, H; Ibukiyama, A; Makino, J; Ebisuzaki, & T; Suzuki, Takeru K; Nakasato, Naohito; Baumgardt, Holger; Ibukiyama, Akihiro; Makino, Junichiro

    2007-01-01

    We investigate the evolution of collisionally merged stars with mass of ~100 Msun which might be formed in dense star clusters. We assumed that massive stars with several tens Msun collide typically after ~1Myr of the formation of the cluster and performed hydrodynamical simulations of several collision events. Our simulations show that after the collisions, merged stars have extended envelopes and their radii are larger than those in the thermal equilibrium states and that their interiors are He-rich because of the stellar evolution of the progenitor stars. We also found that if the mass-ratio of merging stars is far from unity, the interior of the merger product is not well mixed and the elemental abundance is not homogeneous. We then followed the evolution of these collision products by a one dimensional stellar evolution code. After an initial contraction on the Kelvin-Helmholtz (thermal adjustment) timescale (~10^{3-4} yr), the evolution of the merged stars traces that of single homogeneous stars with co...

  17. Cosmology of the Galileon from Massive Gravity

    CERN Document Server

    de Rham, Claudia

    2011-01-01

    We covariantize the decoupling limit of massive gravity proposed in arXiv:1011.1232 and study the cosmology of this theory as a proxy, which embodies key features of the fully non-linear covariant theory. We first confirm that it exhibits a self-accelerating solution, similar to what has been found in arXiv:1010.1780, where the Hubble parameter corresponds to the graviton mass. For a certain range of parameters fluctuations relative to the self-accelerating background are stable and form an attractor solution. We also show that a degravitating solution can not be constructed in this covariantized proxy theory in a meaningful way. As for cosmic structure formation, we find that the helicity-0 mode of the graviton causes an enhancement relative to LCDM. For consistency we also compare proxy theories obtained starting from different frames in the decoupling limit and discuss the possibility of obtaining a non-representative proxy theory by choosing the wrong starting frame.

  18. Cosmology of the Galileon from massive gravity

    Science.gov (United States)

    de Rham, Claudia; Heisenberg, Lavinia

    2011-08-01

    We covariantize the decoupling limit of massive gravity proposed in [de Rham, G. Gabadadze, and A. J. Tolley, Phys. Rev. Lett. 106, 231101 (2011).PRLTAO0031-900710.1103/PhysRevLett.106.231101] and study the cosmology of this theory as a proxy, which embodies key features of the fully nonlinear covariant theory. We first confirm that it exhibits a self-accelerating solution, similar to what has been found in [C. de Rham, G. Gabadadze, L. Heisenberg, and D. Pirtskhalava, Phys. Rev. DPRVDAQ1550-7998 83, 103516 (2011).10.1103/PhysRevD.83.103516], where the Hubble parameter corresponds to the graviton mass. For a certain range of parameters fluctuations relative to the self-accelerating background are stable and form an attractor solution. We also show that a degravitating solution can not be constructed in this covariantized proxy theory in a meaningful way. As for cosmic structure formation, we find that the helicity-0 mode of the graviton causes an enhancement relative to ΛCDM. For consistency we also compare proxy theories obtained starting from different frames in the decoupling limit and discuss the possibility of obtaining a nonrepresentative proxy theory by choosing the wrong starting frame.

  19. Magnetized massive stars as magnetar progenitors

    CERN Document Server

    Hu, Ren-Yu

    2009-01-01

    The origin of ultra-intense magnetic fields on magnetars is a mystery in modern astrophysics. We model the core collapse dynamics of massive progenitor stars with high surface magnetic fields in the theoretical framework of a self-similar general polytropic magnetofluid under the self-gravity with a quasi-spherical symmetry. With the specification of physical parameters such as mass density, temperature, magnetic field and wind mass loss rate on the progenitor stellar surface and the consideration of a rebound shock breaking through the stellar interior and envelope, we find a remnant compact object (i.e. neutron star) left behind at the centre with a radius of $\\sim 10^6$ cm and a mass range of $\\sim 1-3$ solar masses. Moreover, we find that surface magnetic fields of such kind of compact objects can be $\\sim 10^{14}-10^{15}$ G, consistent with those inferred for magnetars which include soft gamma-ray repeaters (SGRs) and anomalous X-ray pulsars (AXPs). The magnetic field enhancement factor critically depend...

  20. Massive stars in their death throes.

    Science.gov (United States)

    Eldridge, John J

    2008-12-13

    The study of the stars that explode as supernovae used to be a forensic study, working backwards from the remnants of the star. This changed in 1987 when the first progenitor star was identified in pre-explosion images. Currently, there are eight detected progenitors with another 21 non-detections, for which only a limit on the pre-explosion luminosity can be placed. This new avenue of supernova research has led to many interesting conclusions, most importantly that the progenitors of the most common supernovae, type IIP, are red supergiants, as theory has long predicted. However, no progenitors have been detected thus far for the hydrogen-free type Ib/c supernovae, which, given the expected progenitors, is an unlikely result. Also, observations have begun to show evidence that luminous blue variables, which are among the most massive stars, may directly explode as supernovae. These results contradict the current stellar evolution theory. This suggests that we may need to update our understanding.

  1. Cosmology with coalescing massive black holes

    Energy Technology Data Exchange (ETDEWEB)

    Hughes, Scott A; Holz, Daniel E [Kavli Institute for Theoretical Physics, University of California, Santa Barbara, CA 93106 (United States)

    2003-05-21

    The gravitational waves generated in the coalescence of massive binary black holes will be measurable by LISA to enormous distances. Redshifts z {approx} 10 or larger (depending somewhat on the mass of the binary) can potentially be probed by such measurements, suggesting that binary coalescences can be made into cosmological tools. We discuss two particularly interesting types of probe. First, by combining gravitational-wave measurements with information about the cosmography of the universe, we can study the evolution of black-hole masses and merger rates as a function of redshift, providing information about the growth of structures at high redshift and possibly constraining hierarchical merger scenarios. Second, if it is possible to associate an 'electromagnetic' counterpart with a coalescence, it may be possible to measure both redshift and luminosity distance to an event with less than {approx}1% error. Such a measurement would constitute an amazingly precise cosmological standard candle. Unfortunately, gravitational lensing uncertainties will reduce the quality of this candle significantly. Though not as amazing as might have been hoped, such a candle would nonetheless very usefully complement other distance-redshift probes, in particular providing a valuable check on systematic effects in such measurements.

  2. Broadband monitoring simulation with massively parallel processors

    Science.gov (United States)

    Trubetskov, Mikhail; Amotchkina, Tatiana; Tikhonravov, Alexander

    2011-09-01

    Modern efficient optimization techniques, namely needle optimization and gradual evolution, enable one to design optical coatings of any type. Even more, these techniques allow obtaining multiple solutions with close spectral characteristics. It is important, therefore, to develop software tools that can allow one to choose a practically optimal solution from a wide variety of possible theoretical designs. A practically optimal solution provides the highest production yield when optical coating is manufactured. Computational manufacturing is a low-cost tool for choosing a practically optimal solution. The theory of probability predicts that reliable production yield estimations require many hundreds or even thousands of computational manufacturing experiments. As a result reliable estimation of the production yield may require too much computational time. The most time-consuming operation is calculation of the discrepancy function used by a broadband monitoring algorithm. This function is formed by a sum of terms over wavelength grid. These terms can be computed simultaneously in different threads of computations which opens great opportunities for parallelization of computations. Multi-core and multi-processor systems can provide accelerations up to several times. Additional potential for further acceleration of computations is connected with using Graphics Processing Units (GPU). A modern GPU consists of hundreds of massively parallel processors and is capable to perform floating-point operations efficiently.

  3. Binary dynamics near a massive black hole

    CERN Document Server

    Hopman, Clovis

    2009-01-01

    We analyze the dynamical evolution of binary stars that interact with a static background of single stars in the environment of a massive black hole (MBH). All stars are considered to be single mass, Newtonian point particles. We follow the evolution of the energy E and angular momentum J of the center of mass of the binaries with respect to the MBH, as well as their internal semi-major axis a, using a Monte Carlo method. For a system like the Galactic center, the main conclusions are the following: (1) The binary fraction can be of the order of a few percent outside 0.1 pc, but decreases quickly closer to the MBH. (2) Within ~0.1 pc, binaries can only exist on eccentric orbits with apocenters much further away from the MBH. (3) Far away from the MBH, loss-cone effects are the dominant mechanism that disrupts binaries with internal velocities close to the velocity dispersion. Closer to the MBH, three-body encounters are more effective in disrupting binaries. (4) The rate at which hard binaries become tighter ...

  4. A close encounter of the massive kind

    Science.gov (United States)

    Maíz Apellániz, J.; Sana, H.; Barbá, R. H.; Le Bouquin, J.-B.; Gamen, R. C.

    2017-01-01

    We have used (i) Hubble Space Telescope Advanced Camera for Surveys imaging and Space Telescope Imaging Spectrograph spectroscopy, (ii) ground-based Precision Integrated-Optics Near-infrared Imaging ExpeRiment/Very Large Telescope long-baseline interferometry, and (iii) ground-based spectroscopy from different instruments to study the orbit of the extreme multiple system HD 93 129 Aa,Ab, which is composed of (at least) two very massive stars in a long-period orbit with e > 0.92, which will pass through periastron in 2017/2018. In several ways, the system is an η Car precursor. Around the time of periastron passage, the two very strong winds will collide and generate an outburst of non-thermal hard X-ray emission without precedent in an O+O binary since astronomers have been able to observe above Earth's atmosphere. A coordinated multiwavelength monitoring in the next two years will enable a breakthrough understanding of the wind interactions in such extreme close encounters. Furthermore, we have found evidence that HD 93 129 Aa may be a binary system itself. In that case, we could witness a three-body interaction which may yield a runaway star or a stellar collision close to or shortly after the periastron passage. Either of those outcomes would be unprecedented, as they are predicted to be low-frequency events in the Milky Way.

  5. Runaway Massive Binaries and Cluster Ejection Scenarios

    CERN Document Server

    McSwain, M V; Boyajian, T S; Grundstrom, E D; Roberts, M S E; Ransom, Scott M.; Boyajian, Tabetha S.; Grundstrom, Erika D.

    2006-01-01

    The production of runaway massive binaries offers key insights into the evolution of close binary stars and open clusters. The stars HD 14633 and HD 15137 are rare examples of such runaway systems, and in this work we investigate the mechanism by which they were ejected from their parent open cluster, NGC 654. We discuss observational characteristics that can be used to distinguish supernova ejected systems from those ejected by dynamical interactions, and we present the results of a new radio pulsar search of these systems as well as estimates of their predicted X-ray flux assuming that each binary contains a compact object. Since neither pulsars nor X-ray emission are observed in these systems, we cannot conclude that these binaries contain compact companions. We also consider whether they may have been ejected by dynamical interactions in the dense environment where they formed, and our simulations of four-body interactions suggest that a dynamical origin is possible but unlikely. We recommend further X-ra...

  6. On the cosmology of massive gravity

    CERN Document Server

    De Felice, Antonio; Lin, Chunshan; Mukohyama, Shinji

    2013-01-01

    We present a review of cosmological solutions in non-linear massive gravity, focusing on the stability of perturbations. Although homogeneous and isotropic solutions have been found, these are now known to suffer from either Higuchi ghost or a new non-linear ghost instability. We discuss two approaches to alleviate this issue. By relaxing the symmetry of the background by e.g. breaking isotropy in the hidden sector, it is possible to accommodate a stable cosmological solution. Alternatively, extending the theory to allow for new dynamical degrees of freedom can also remove the conditions which lead to the instability. As examples for this case, we study the stability of self-accelerating solutions in the quasi-dilatonic extension and generic cosmological solutions in the varying mass extension. While the quasi-dilaton case turns out to be unstable, the varying mass case allows stable regimes of parameters. Viable self-accelerating solutions in the varying mass theory yet remain to be found.

  7. Massive thyroxine intoxication: evaluation of plasma extraction.

    Science.gov (United States)

    Binimelis, J; Bassas, L; Marruecos, L; Rodriguez, J; Domingo, M L; Madoz, P; Armengol, S; Mangues, M A; de Leiva, A

    1987-01-01

    Six patients were admitted after erroneous massive intake of levothyroxine (70-1200 mg over an interval of 2-12 days). All patients developed classical symptoms of thyrotoxicosis within 3 days of the first dose; five patients presented grade II-III coma and one became stuporous (days 7-10). Two patients developed left ventricular failure and three had arrhythmias (days 8-11). Total thyroid hormone levels in serum on admission ranged 935-7728 nmol/l for T4 (TT4) and 23-399 nmol/l for T3 (TT3). All patients received treatment with hydrocortisone and Propranolol. Propylthiouracil was also given in 3 cases. Extractive techniques (charcoal haemoperfusion and/or plasmapheresis) were initiated 8-14 days after the first dose of L-T4. The plasma disappearance rate (K) of TT4 with plasmapheresis was 30 times higher, on average, than under standard medical treatment (M). Also, K of TT4 under haemoperfusion was about five times higher than K under M. K changes for TT3 were higher under haemoperfusion than under plasmapheresis. Furthermore, extractive procedures shortened the average half life of TT4, (from 106.5 +/- 44.6 to 59.7 +/- 20.2 h, p less than 0.05).

  8. Massive N=2 Supergravity in Three Dimensions

    CERN Document Server

    Alkac, Gokhan; Bergshoeff, Eric A; Ozkan, Mehmet; Sezgin, Ergin

    2014-01-01

    There exists two distinct off-shell ${\\mathcal{N}}=2$ supergravities in three dimensions. They are also referred to as ${\\mathcal{N}}=(1,1)$ and ${\\mathcal{N}}=(2,0)$ supergravities, and they arise from the coupling of Weyl multiplet to a compensating scalar or vector multiplet, respectively, followed by fixing of conformal symmetries. The ${\\mathcal{N}} =(p,q)$ terminology refers to the underlying anti-de Sitter superalgebras $OSp(2,p) \\oplus OSp(2,q)$ with $R$-symmetry group $SO(p) \\times SO(q)$. We construct off-shell invariants of these theories up to fourth order in derivatives. As an application of these results, we determine the special combinations of the ${\\mathcal{N}}=(1,1)$ invariants that admit anti-de Sitter vacuum solution about which there is a ghost-free massive spin-2 multiplet of propagating modes. We also show that the ${\\mathcal{N}}=(2,0)$ invariants do not allow such possibility.

  9. Anisotropic cosmological solutions in massive vector theories

    CERN Document Server

    Heisenberg, Lavinia; Tsujikawa, Shinji

    2016-01-01

    In beyond-generalized Proca theories including the extension to theories higher than second order, we study the role of a spatial component $v$ of a massive vector field on the anisotropic cosmological background. We show that, as in the case of the isotropic cosmological background, there is no additional ghostly degrees of freedom associated with the Ostrogradski instability. In second-order generalized Proca theories we find the existence of anisotropic solutions on which the ratio between the anisotropic expansion rate $\\Sigma$ and the isotropic expansion rate $H$ remains nearly constant in the radiation-dominated epoch. In the regime where $\\Sigma/H$ is constant, the spatial vector component $v$ works as a dark radiation with the equation of state close to $1/3$. During the matter era, the ratio $\\Sigma/H$ decreases with the decrease of $v$. As long as the conditions $|\\Sigma| \\ll H$ and $v^2 \\ll \\phi^2$ are satisfied around the onset of late-time cosmic acceleration, where $\\phi$ is the temporal vector ...

  10. Planckian Interacting Massive Particles as Dark Matter

    CERN Document Server

    Garny, Mathias; Sloth, Martin S

    2016-01-01

    The Standard Model could be self-consistent up to the Planck scale according to the present measurements of the Higgs mass and top quark Yukawa coupling. It is therefore possible that new physics is only coupled to the Standard Model through Planck suppressed higher dimensional operators. In this case the WIMP miracle is a mirage, and instead minimality as dictated by Occam's razor would indicate that dark matter is related to the Planck scale, where quantum gravity is anyway expected to manifest itself. Assuming within this framework that dark matter is a Planckian Interacting Massive Particle, we show that the most natural mass larger than $0.01\\,\\textrm{M}_p$ is already ruled out by the absence of tensor modes in the CMB. This also indicates that we expect tensor modes in the CMB to be observed soon for this type of minimal dark matter model. Finally, we touch upon the KK graviton mode as a possible realization of this scenario within UV complete models, as well as further potential signatures and peculiar...

  11. A close encounter of the massive kind

    CERN Document Server

    Apellániz, J Maíz; Barbá, R H; Bouquin, J -B Le; Gamen, R C

    2016-01-01

    We have used (a) HST ACS imaging and STIS spectroscopy, (b) ground-based PIONIER/VLT long-baseline interferometry, and (c) ground-based spectroscopy from different instruments to study the orbit of the extreme multiple system HD 93 129 Aa,Ab, which is composed of (at least) two very massive stars in a long-period orbit with e>0.92 that will pass through periastron in 2017/2018. In several ways, the system is an eta Car precursor. Around the time of periastron passage the two very strong winds will collide and generate an outburst of non-thermal hard X-ray emission without precedent in an O+O binary since astronomers have been able to observe above Earth's atmosphere. A coordinated multiwavelength monitoring in the next two years will enable a breakthrough understanding of the wind interactions in such extreme close encounters. Furthermore, we have found evidence that HD 93 129 Aa may be a binary system itself. In that case, we could witness a three-body interaction that may yield a runaway star or a stellar c...

  12. Minimal $\\cal N=4$ topologically massive supergravity

    CERN Document Server

    Kuzenko, Sergei M; Sachs, Ivo

    2016-01-01

    Using the superconformal framework, we construct a new off-shell model for topologically massive $\\cal N=4$ supergravity which is minimal in the sense that it makes use of a single compensating vector multiplet. Our theory provides a counterexample to the common lore that two compensating multiplets are required within the conformal approach to supergravity with eight supercharges in diverse dimensions. All solutions in this theory correspond to non-conformally flat superspaces. Its maximally supersymmetric solutions include the so-called critical (4,0) anti-de Sitter superspace introduced in arXiv:1205.4622. Other maximally supersymmetric solutions describe warped critical (4,0) anti-de Sitter superspaces. We also propose a dual formulation for the theory in which the vector multiplet is replaced with an off-shell hypermultiplet. Upon elimination of the auxiliary fields belonging to the hypermultiplet and imposing certain gauge conditions, the dual action reduces to the one introduced in arXiv:1605.00103.

  13. Massive and massless neutrinos on unbalanced seesaws

    Institute of Scientific and Technical Information of China (English)

    XING Zhi-Zhong

    2008-01-01

    The observation of neutrino oscillations requires new physics beyond the standard model (SM).A SM-like gauge theory with p lepton families can be extended by introducing q heavy right-handed Majorana neutrinos but preserving its SU(2)L x U(1)y gauge symmetry.The overall neutrino mass matrix M turns out to be a symmetric (p+q) x (p+q) matrix.Given p>q,the rank of M is in general equal to 2q,corresponding to 2q non-zero mass eigenvalues.The existence of (p-q) massless left-handed Majorana neutrinos is an exact consequence of the model,independent of the usual approximation made in deriving the Type-I seesaw relation between the effective p x p light Majorana neutrino mass matrix M,and the q x q heavy Majorana neutrino mass matrix MR.In other words,the numbers of massive left- and right-handed neutrinos are fairly matched.A good example to illustrate this "seesaw fair play rule"is the minimal seesaw model with p = 3 and q = 2,in which one masslese neutrino sits on the unbalanced seesaw.

  14. Massive neutral particles on heterotic string theory

    CERN Document Server

    Olivares, Marco

    2013-01-01

    The motion of massive particles in the background of a charged black hole in heterotic string theory, which is characterized by a parameter $\\alpha$, is studied in detail across this paper. Since it is possible to write this space-time in the Einstein frame, we perform a quantitative analysis of the time-like geodesics by means of the standard Lagrange procedure. Thus, we obtain and solve a set of differential equations and then we describe the orbits in terms of elliptic $\\wp$-Weierstra{\\ss} function. Also, by making an elementary derivation developed by Cornbleet (Am. J. Phys. \\textbf{61} 7, (1993) 650 - 651) we obtain the correction to the angle of advance of perihelion to first order in $\\alpha$, and thus, by comparing with Mercury's data we give an estimation for the value of this parameter, which yields to an {\\it heterotic solar charge} $Q_{\\odot}\\simeq 0.728\\,[\\textrm{Km}]= 0.493\\, M_{\\odot}$. Therefore, in addition with the study on null geodesics performed by Fernando (Phys. Rev. D {\\bf 85}, (2012) ...

  15. Mass loss from very young massive stars

    Science.gov (United States)

    Henning, Th.

    The physics of mass loss from very young massive stars is reviewed, and mass-loss rates are determined for several objects on the basis of published observational data. The observational evidence for mass loss of 0.0001-0.001 solar mass/yr with velocity 10-60 km/s, dynamical timescale 1000-100,000 yr, and kinetic energy (1-100) x 10 to the 38th W from these objects is chracterized; techniques for estimating mass-loss rates from H recombination lines, CO line profiles maser data, and IR-continuum observations are described; rates for molecular outflows and ionized winds are presented in tabels; and theoretical models developed to explain the mechanism driving bipolar mass loss are examined critically. It is found that neither radiation pressure on dust grins nor the ionized winds can drive the molecular outflow. The models considered most probable are those involving production of holes by original spherical stellar winds (Canto, 1980, rotationally driven magnetic pressure (Draine, 1983), and infall from an accretion disk (Torbett, 1984).

  16. Massive Fermi gas in the expanding universe

    Science.gov (United States)

    Trautner, Andreas

    2017-03-01

    The behavior of a decoupled ideal Fermi gas in a homogeneously expanding three-dimensional volume is investigated, starting from an equilibrium spectrum. In case the gas is massless and/or completely degenerate, the spectrum of the gas can be described by an effective temperature and/or an effective chemical potential, both of which scale down with the volume expansion. In contrast, the spectrum of a decoupled massive and non-degenerate gas can only be described by an effective temperature if there are strong enough self-interactions such as to maintain an equilibrium distribution. Assuming perpetual equilibration, we study a decoupled gas which is relativistic at decoupling and then is red-shifted until it becomes non-relativistic. We find expressions for the effective temperature and effective chemical potential which allow us to calculate the final spectrum for arbitrary initial conditions. This calculation is enabled by a new expansion of the Fermi-Dirac integral, which is for our purpose superior to the well-known Sommerfeld expansion. We also compute the behavior of the phase space density under expansion and compare it to the case of real temperature and real chemical potential. Using our results for the degenerate case, we also obtain the mean relic velocity of the recently proposed non-thermal cosmic neutrino background.

  17. Massively Parallel Dimension Independent Adaptive Metropolis

    KAUST Repository

    Chen, Yuxin

    2015-05-14

    This work considers black-box Bayesian inference over high-dimensional parameter spaces. The well-known and widely respected adaptive Metropolis (AM) algorithm is extended herein to asymptotically scale uniformly with respect to the underlying parameter dimension, by respecting the variance, for Gaussian targets. The result- ing algorithm, referred to as the dimension-independent adaptive Metropolis (DIAM) algorithm, also shows improved performance with respect to adaptive Metropolis on non-Gaussian targets. This algorithm is further improved, and the possibility of probing high-dimensional targets is enabled, via GPU-accelerated numerical libraries and periodically synchronized concurrent chains (justified a posteriori). Asymptoti- cally in dimension, this massively parallel dimension-independent adaptive Metropolis (MPDIAM) GPU implementation exhibits a factor of four improvement versus the CPU-based Intel MKL version alone, which is itself already a factor of three improve- ment versus the serial version. The scaling to multiple CPUs and GPUs exhibits a form of strong scaling in terms of the time necessary to reach a certain convergence criterion, through a combination of longer time per sample batch (weak scaling) and yet fewer necessary samples to convergence. This is illustrated by e ciently sampling from several Gaussian and non-Gaussian targets for dimension d 1000.

  18. Linear growth of structure in massive bigravity

    Energy Technology Data Exchange (ETDEWEB)

    Solomon, Adam R. [DAMTP, Centre for Mathematical Sciences, University of Cambridge, Wilberforce Rd., Cambridge CB3 0WA (United Kingdom); Akrami, Yashar [Institute of Theoretical Astrophysics, University of Oslo, P.O. Box 1029 Blindern, N-0315 Oslo (Norway); Koivisto, Tomi S., E-mail: a.r.solomon@damtp.cam.ac.uk, E-mail: yashar.akrami@astro.uio.no, E-mail: tomi.koivisto@nordita.org [Nordita, KTH Royal Institute of Technology and Stockholm University, Roslagstullsbacken 23, SE-10691 Stockholm (Sweden)

    2014-10-01

    The ghost-free theory of massive gravity with two dynamical metrics has been shown to produce viable cosmological expansion, where the late-time acceleration of the Universe is due to the finite range of the gravitational interaction rather than a nonzero cosmological constant. Here the cosmological perturbations are studied in this theory. The full perturbation equations are presented in a general gauge and analyzed, focusing on subhorizon scales in the quasistatic limit during the matter-dominated era. An evolution equation for the matter inhomogeneities and the parameters quantifying the deviations from general relativistic structure formation are expressed in terms of five functions whose forms are determined directly by the coupling parameters in the theory. The evolution equation has a similar structure to Horndeski-type scalar-tensor theories, exhibiting a modified growth rate and scale-dependence at intermediate wavenumbers. Predictions of the theory are confronted with observational data on both background expansion and large-scale structure, although care must be taken to ensure a model is stable. It is found that while the stable models fit the data well, they feature deviations from the standard cosmology that could be detected or ruled out by near-future experiments.

  19. Protected Areas - Protected Federal Lands

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — The Federal Lands data consists of land areas that are run and maintained by U.S. Governmental authorities and are considered protected.The Department of Natural...

  20. Machine Protection

    CERN Document Server

    Schmidt, R

    2014-01-01

    The protection of accelerator equipment is as old as accelerator technology and was for many years related to high-power equipment. Examples are the protection of powering equipment from overheating (magnets, power converters, high-current cables), of superconducting magnets from damage after a quench and of klystrons. The protection of equipment from beam accidents is more recent. It is related to the increasing beam power of high-power proton accelerators such as ISIS, SNS, ESS and the PSI cyclotron, to the emission of synchrotron light by electron–positron accelerators and FELs, and to the increase of energy stored in the beam (in particular for hadron colliders such as LHC). Designing a machine protection system requires an excellent understanding of accelerator physics and operation to anticipate possible failures that could lead to damage. Machine protection includes beam and equipment monitoring, a system to safely stop beam operation (e.g. dumping the beam or stopping the beam at low energy) and an ...

  1. Land Protection Plan for Lower Hatchie National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This land protection plan for Lower Hatchie National Wildlife Refuge was prepared to guide Refuge staff in future actions that are necessary to protect the wildlife...

  2. Simultaneous digital quantification and fluorescence-based size characterization of massively parallel sequencing libraries.

    Science.gov (United States)

    Laurie, Matthew T; Bertout, Jessica A; Taylor, Sean D; Burton, Joshua N; Shendure, Jay A; Bielas, Jason H

    2013-08-01

    Due to the high cost of failed runs and suboptimal data yields, quantification and determination of fragment size range are crucial steps in the library preparation process for massively parallel sequencing (or next-generation sequencing). Current library quality control methods commonly involve quantification using real-time quantitative PCR and size determination using gel or capillary electrophoresis. These methods are laborious and subject to a number of significant limitations that can make library calibration unreliable. Herein, we propose and test an alternative method for quality control of sequencing libraries using droplet digital PCR (ddPCR). By exploiting a correlation we have discovered between droplet fluorescence and amplicon size, we achieve the joint quantification and size determination of target DNA with a single ddPCR assay. We demonstrate the accuracy and precision of applying this method to the preparation of sequencing libraries.

  3. Light elements in massive single and binary stars

    CERN Document Server

    Langer, N; Cantiello, M; de Mink, S E; Izzard, R G; Yoon, S -C

    2010-01-01

    We highlight the role of the light elements (Li, Be, B) in the evolution of massive single and binary stars, which is largely restricted to a diagnostic value, and foremost so for the element boron. However, we show that the boron surface abundance in massive early type stars contains key information about their foregoing evolution which is not obtainable otherwise. In particular, it allows to constrain internal mixing processes and potential previous mass transfer event for binary stars (even if the companion has disappeared). It may also help solving the mystery of the slowly rotating nitrogen-rich massive main sequence stars.

  4. Fundamental Parameters of 4 Massive Eclipsing Binaries in Westerlund 1

    Science.gov (United States)

    Bonanos, Alceste Z.; Koumpia, E.

    2011-05-01

    We present fundamental parameters of 4 massive eclipsing binaries in the young massive cluster Westerlund 1. The goal is to measure accurate masses and radii of their component stars, which provide much needed constraints for evolutionary models of massive stars. Accurate parameters can further be used to determine a dynamical lower limit for the magnetar progenitor and to obtain an independent distance to the cluster. Our results confirm and extend the evidence for a high mass for the progenitor of the magnetar. The authors acknowledge research and travel support from the European Commission Framework Program Seven under the Marie Curie International Reintegration Grant PIRG04-GA-2008-239335.

  5. Massive Black Hole Binaries: Dynamical Evolution and Observational Signatures

    Directory of Open Access Journals (Sweden)

    M. Dotti

    2012-01-01

    Full Text Available The study of the dynamical evolution of massive black hole pairs in mergers is crucial in the context of a hierarchical galaxy formation scenario. The timescales for the formation and the coalescence of black hole binaries are still poorly constrained, resulting in large uncertainties in the expected rate of massive black hole binaries detectable in the electromagnetic and gravitational wave spectra. Here, we review the current theoretical understanding of the black hole pairing in galaxy mergers, with a particular attention to recent developments and open issues. We conclude with a review of the expected observational signatures of massive binaries and of the candidates discussed in literature to date.

  6. Environments of massive stars and the upper mass limit

    CERN Document Server

    Crowther, Paul A

    2012-01-01

    The locations of massive stars (> 8 Msun) within their host galaxies is reviewed. These range from distributed OB associations to dense star clusters within giant HII regions. A comparison between massive stars and the environments of core-collapse supernovae and long duration Gamma Ray Bursts is made, both at low and high redshift. We also address the question of the upper stellar mass limit, since very massive stars (VMS, Minit >> 100 Msun) may produce exceptionally bright core-collapse supernovae or pair instability supernovae.

  7. Matter coupling in 3D "Minimal Massive Gravity"

    CERN Document Server

    Arvanitakis, Alex S; Townsend, Paul K

    2014-01-01

    The "Minimal Massive Gravity" (MMG) model of massive gravity in three spacetime dimensions (which has the same anti-de Sitter (AdS) bulk properties as "Topologically Massive Gravity" but improved boundary properties) is coupled to matter. Consistency requires a particular matter source tensor, which is quadratic in the stress tensor. The consequences are explored for an ideal fluid in the context of asymptotically de-Sitter (dS) cosmological solutions, which bounce smoothly from contraction to expansion. Various vacuum solutions are also found, including warped-(A)dS, and (for special values of parameters) static black holes and an (A)dS2 x S1 vacuum.

  8. Cosmological solutions of massive gravity on de Sitter

    CERN Document Server

    Langlois, David

    2012-01-01

    In the framework of the recently proposed models of massive gravity, but defined with respect to a de Sitter reference metric, we obtain new homogeneous and isotropic solutions for arbitrary spatial curvature. These solutions can be classified into three branches. In the first two, the massive gravity terms behave like a cosmological constant. In the third branch, the massive gravity effects can be described by a time evolving effective fluid with rather remarkable features, including the property to behave as a cosmological constant at low energy, when the Hubble parameter decreases below a critical value.

  9. Massive motion in Brans-Dicke geometry and beyond

    CERN Document Server

    Punzi, Raffaele; Wohlfarth, Mattias N R

    2009-01-01

    Gravity theories that can be viewed as dynamics for area metric manifolds, for which Brans-Dicke theory presents a recently studied example, require for their physical interpretation the identification of the distinguished curves that serve as the trajectories of light and massive matter. Complementing previous results on the propagation of light, we study effective massive point particle motion. We show that the relevant geometrical structure is a special Finsler norm determined by the area metric, and that massive point particles follow Finsler geodesics.

  10. Very early stages of massive stars

    Science.gov (United States)

    Vasyunina, Tatiana

    2010-12-01

    The goal of this thesis work is to investigate the initial conditions and the early phases of the formation of high-mass stars by means of dedicated observational studies. We consider two object classes: infrared dark clouds (IRDCs), and a subsequent stage characterized by the presence of young embedded (proto-)stellar clusters. First, we estimate masses and column densities for a completely new sample of southern IRDCs, utilizing our own millimeter continuum emission maps as well as Spitzer satellite data. The parameters we derive show that IRDCs from our sample have the potential to form not only low- and intermediate-mass stars, but can also be the birth places of massive stars. In particular, the comparison of our results with previously obtained data for low-mass starless cores shows a clear trend for IRDCs to have systematically higher column densities. The interpolated IRDC peak column densities exceed the threshold for the onset of massive star formation previously advocated by theoretical studies. We also critically evaluate the limitations of the applied emission and extinction methods. Second, we investigate the physical conditions and the chemical composition of the dense gas within the IRDCs of our sample by means of a multi-line molecular spectroscopy analysis. All the clouds have complex HCO+ line pro les, and we detect SiO emission in some clouds. These ndings mark the presence of infall and out ow motions in at least some parts of the IRDCs, and hence, ongoing star formation. In comparison with low-mass starless cores, the IRDCs have broader and more intense lines. Thus, they may be characterised by more turbulent conditions. Nevertheless, we nd a tendency for the IRDCs to have molecular abundances similar to the case of low-mass starless cores. This indicates similar chemical initial conditions for low- and high-mass star-forming regions. Finally, we study the stellar composition and environmental conditions in the young embedded cluster IRAS

  11. Scalable Machine Learning for Massive Astronomical Datasets

    Science.gov (United States)

    Ball, Nicholas M.; Gray, A.

    2014-04-01

    We present the ability to perform data mining and machine learning operations on a catalog of half a billion astronomical objects. This is the result of the combination of robust, highly accurate machine learning algorithms with linear scalability that renders the applications of these algorithms to massive astronomical data tractable. We demonstrate the core algorithms kernel density estimation, K-means clustering, linear regression, nearest neighbors, random forest and gradient-boosted decision tree, singular value decomposition, support vector machine, and two-point correlation function. Each of these is relevant for astronomical applications such as finding novel astrophysical objects, characterizing artifacts in data, object classification (including for rare objects), object distances, finding the important features describing objects, density estimation of distributions, probabilistic quantities, and exploring the unknown structure of new data. The software, Skytree Server, runs on any UNIX-based machine, a virtual machine, or cloud-based and distributed systems including Hadoop. We have integrated it on the cloud computing system of the Canadian Astronomical Data Centre, the Canadian Advanced Network for Astronomical Research (CANFAR), creating the world's first cloud computing data mining system for astronomy. We demonstrate results showing the scaling of each of our major algorithms on large astronomical datasets, including the full 470,992,970 objects of the 2 Micron All-Sky Survey (2MASS) Point Source Catalog. We demonstrate the ability to find outliers in the full 2MASS dataset utilizing multiple methods, e.g., nearest neighbors. This is likely of particular interest to the radio astronomy community given, for example, that survey projects contain groups dedicated to this topic. 2MASS is used as a proof-of-concept dataset due to its convenience and availability. These results are of interest to any astronomical project with large and/or complex

  12. Electrical properties of seafloor massive sulfides

    Science.gov (United States)

    Spagnoli, Giovanni; Hannington, Mark; Bairlein, Katharina; Hördt, Andreas; Jegen, Marion; Petersen, Sven; Laurila, Tea

    2016-06-01

    Seafloor massive sulfide (SMS) deposits are increasingly seen as important marine metal resources for the future. A growing number of industrialized nations are involved in the surveying and sampling of such deposits by drilling. Drill ships are expensive and their availability can be limited; seabed drill rigs are a cost-effective alternative and more suitable for obtaining cores for resource evaluation. In order to achieve the objectives of resource evaluations, details are required of the geological, mineralogical, and physical properties of the polymetallic deposits and their host rocks. Electrical properties of the deposits and their ore minerals are distinct from their unmineralized host rocks. Therefore, the use of electrical methods to detect SMS while drilling and recovering drill cores could decrease the costs and accelerate offshore operations by limiting the amount of drilling in unmineralized material. This paper presents new data regarding the electrical properties of SMS cores that can be used in that assessment. Frequency-dependent complex electrical resistivity in the frequency range between 0.002 and 100 Hz was examined in order to potentially discriminate between different types of fresh rocks, alteration and mineralization. Forty mini-cores of SMS and unmineralized host rocks were tested in the laboratory, originating from different tectonic settings such as the intermediate-spreading ridges of the Galapagos and Axial Seamount, and the Pacmanus back-arc basin. The results indicate that there is a clear potential to distinguish between mineralized and non-mineralized samples, with some evidence that even different types of mineralization can be discriminated. This could be achieved using resistivity magnitude alone with appropriate rig-mounted electrical sensors. Exploiting the frequency-dependent behavior of resistivity might amplify the differences and further improve the rock characterization.

  13. Parallel Impurity Spreading During Massive Gas Injection

    Science.gov (United States)

    Izzo, V. A.

    2016-10-01

    Extended-MHD simulations of disruption mitigation in DIII-D demonstrate that both pre-existing islands (locked-modes) and plasma rotation can significantly influence toroidal spreading of impurities following massive gas injection (MGI). Given the importance of successful disruption mitigation in ITER and the large disparity in device parameters, empirical demonstrations of disruption mitigation strategies in present tokamaks are insufficient to inspire unreserved confidence for ITER. Here, MHD simulations elucidate how impurities injected as a localized jet spread toroidally and poloidally. Simulations with large pre-existing islands at the q = 2 surface reveal that the magnetic topology strongly influences the rate of impurity spreading parallel to the field lines. Parallel spreading is largely driven by rapid parallel heat conduction, and is much faster at low order rational surfaces, where a short parallel connection length leads to faster thermal equilibration. Consequently, the presence of large islands, which alter the connection length, can slow impurity transport; but the simulations also show that the appearance of a 4/2 harmonic of the 2/1 mode, which breaks up the large islands, can increase the rate of spreading. This effect is seen both for simulations with spontaneously growing and directly imposed 4/2 modes. Given the prevalence of locked-modes as a cause of disruptions, understanding the effect of large islands is of particular importance. Simulations with and without islands also show that rotation can alter impurity spreading, even reversing the predominant direction of spreading, which is toward the high-field-side in the absence of rotation. Given expected differences in rotation for ITER vs. DIII-D, rotation effects are another important consideration when extrapolating experimental results. Work supported by US DOE under DE-FG02-95ER54309.

  14. Anisotropic cosmological solutions in massive vector theories

    Science.gov (United States)

    Heisenberg, Lavinia; Kase, Ryotaro; Tsujikawa, Shinji

    2016-11-01

    In beyond-generalized Proca theories including the extension to theories higher than second order, we study the role of a spatial component v of a massive vector field on the anisotropic cosmological background. We show that, as in the case of the isotropic cosmological background, there is no additional ghostly degrees of freedom associated with the Ostrogradski instability. In second-order generalized Proca theories we find the existence of anisotropic solutions on which the ratio between the anisotropic expansion rate Σ and the isotropic expansion rate H remains nearly constant in the radiation-dominated epoch. In the regime where Σ/H is constant, the spatial vector component v works as a dark radiation with the equation of state close to 1/3. During the matter era, the ratio Σ/H decreases with the decrease of v. As long as the conditions |Σ| ll H and v2 ll phi2 are satisfied around the onset of late-time cosmic acceleration, where phi is the temporal vector component, we find that the solutions approach the isotropic de Sitter fixed point (Σ = 0 = v) in accordance with the cosmic no-hair conjecture. In the presence of v and Σ the early evolution of the dark energy equation of state wDE in the radiation era is different from that in the isotropic case, but the approach to the isotropic value wDE(iso) typically occurs at redshifts z much larger than 1. Thus, apart from the existence of dark radiation, the anisotropic cosmological dynamics at low redshifts is similar to that in isotropic generalized Proca theories. In beyond-generalized Proca theories the only consistent solution to avoid the divergence of a determinant of the dynamical system corresponds to v = 0, so Σ always decreases in time.

  15. Soil pollution and soil protection.

    NARCIS (Netherlands)

    Haan, de F.A.M.; Visser-Reijneveld, M.I.

    1996-01-01

    This book was compiled from lecture handouts prepared for the international postgraduate course on soil quality, entitled 'Soil Pollution and Soil Protection' given jointly by the universities of Wageningen (The Netherlands), Gent and Leuven (Belgium), under the auspices of the international

  16. A Massive-born Neutron Star with a Massive White Dwarf Companion

    Science.gov (United States)

    Cognard, Ismaël; Freire, Paulo C. C.; Guillemot, Lucas; Theureau, Gilles; Tauris, Thomas M.; Wex, Norbert; Graikou, Eleni; Kramer, Michael; Stappers, Benjamin; Lyne, Andrew G.; Bassa, Cees; Desvignes, Gregory; Lazarus, Patrick

    2017-08-01

    We report on the results of a 4 year timing campaign of PSR J2222-0137, a 2.44 day binary pulsar with a massive white dwarf (WD) companion, with the Nançay, Effelsberg, and Lovell radio telescopes. Using the Shapiro delay for this system, we find a pulsar mass m p = 1.76 ± 0.06 M ⊙ and a WD mass m c = 1.293 ± 0.025 M ⊙. We also measure the rate of advance of periastron for this system, which is marginally consistent with the general relativity prediction for these masses. The short lifetime of the massive WD progenitor star led to a rapid X-ray binary phase with little (< 10-2 M ⊙) mass accretion onto the neutron star; hence, the current pulsar mass is, within uncertainties, its birth mass, which is the largest measured to date. We discuss the discrepancy with previous mass measurements for this system; we conclude that the measurements presented here are likely to be more accurate. Finally, we highlight the usefulness of this system for testing alternative theories of gravity by tightly constraining the presence of dipolar radiation. This is of particular importance for certain aspects of strong-field gravity, like spontaneous scalarization, since the mass of PSR J2222-0137 puts that system into a poorly tested parameter range.

  17. Massive perturber-driven interactions of stars with a massive black hole

    CERN Document Server

    Perets, H B; Alexander, T; Perets, Hagai B.; Hopman, Clovis; Alexander, Tal

    2006-01-01

    We study the role of massive perturbers (MPs) in deflecting stars and binaries to almost radial (``loss-cone'') orbits, where they pass near the central massive black hole (MBH), interact with it at periapse q, and are ultimately destroyed. MPs dominate dynamical relaxation when the ratio of the 2nd moments of the MP and star mass distributions, mu_2 = (N_p*M_p^2)/(N_star*M_star^2), satisfies mu_2>>1. The observed MPs in the nucleus of the Galaxy (giant molecular clouds and stellar clusters), and plausibly in late type galaxies generally, have 10^2<=mu_2<=10^5. MPs thus shorten the relaxation timescale by 10^2-10^5 relative to 2-body relaxation by stars alone. We show this increases by 10-1000 the rate of large-q interactions with the MBH, where loss-cone refilling by stellar 2-body relaxation is inefficient. We extend the Fokker-Planck loss-cone formalism to approximately account for relaxation by rare encounters with MPs. We show that binary-MBH exchanges driven by MPs may explain the origin of the yo...

  18. The massive monsters living deep in the Tarantula nebula: How massive are they really?

    Science.gov (United States)

    de Mink, Selma

    2013-10-01

    The recent suggestion that stars with masses in excess of about 300 solar masses exist in the dense star cluster R136 at heart of the Tarantula Nebula received wide interest. It reopened the debate about the upper stellar-mass limit of the initial mass function {IMF} and it raised the question whether pair-instability supernovae - originally thought exclusively originate from first generation of pop III stars - can occur in the vicinity of Milky Way.A major challenge hampering mass estimates of the most massive stars is crowding and unresolved companions. High-resolution imaging from the ground and with HST reaching resolutions of about 0.1 arcsec resolved the brightest source in R136 into three separate components. Unfortunately, the extreme crowding and faintness of the targets prohibits ground-based facilities to reach further towards mili-arcsecond resolution.We propose to exploit the new full two-dimensional calibration program of Fine Guidance Sensor {Nelan, Prop ID 13175} to probe the most luminous stars in R136 for previously unseen companions down to a resolution of 12 mili-arsecond, exploring the separation of about 500-5000 AU. Furthermore, we will characterize the claimed source R136-a1B and if needed revise downward the mass estimates of the most massive stars known date.

  19. How Prepared is Prepared Enough?

    Science.gov (United States)

    Porter-Levy; Macleod; Rickert

    1996-10-01

    A 17-year-old female was in the final stage in treatment of right unilateral cleft lip and palate. She had undergone a number of previous surgeries. Hearing and speech were good on evaluation, and her social and family situation were deemed excellent. After preparatory orthodontics she underwent a Lefort I maxillary advancement. Surgery was successful and she was admitted into postoperative recovery. However, the lack of adequate preoperative preparation caused traumatic reaction from the patient and her parents: anxiety over appearance, crying, refusal of oral fluids and oral care, refusal of analgesia, and refusal to mobilize. The patience and persistence of hospital staff slowly overcame all adversities and the patient moved on to full and successful recovery, but this case prompted changes in preoperative procedures and involvement of patients and their families in postoperative meal selection, planing, and preparation.

  20. Protection Myopia

    DEFF Research Database (Denmark)

    Laursen, Keld; Salter, Ammon; Li, Cher

    The strategies firms use to protect their intellectual property and knowledge can strongly influence their ability to capture the benefits of their innovative efforts. Using the attention-based theory, we explore positive and negative sides of legal appropriability. While asserting the benefits f...