WorldWideScience

Sample records for preliminary screening method

  1. A brief review on newborn screening methods for hemoglobinopathies and preliminary results selecting beta thalassemia carriers at birth by quantitative estimation of the HbA fraction.

    Science.gov (United States)

    Mantikou, Eleni; Arkesteijn, Sandra G; Beckhoven van, Jaqueline M; Kerkhoffs, Jean-Louis; Harteveld, Cornelis L; Giordano, Piero Carlo

    2009-12-01

    We present in a brief summary the basic aspects of the most rational technologies used for new born screening (NBS) of the hemoglobinopathies and we report the preliminary results for the identification of beta-thalassemia carriers at birth by measuring the expression of the HbA fraction. Separation and measurement of the Hb fractions in 1.500 cord blood samples collected among the multi-ethnic Dutch population using different methods. By using a cut of thalassemia can be preselected at birth with a reasonable degree of sensitivity and be confirmed by parent analysis.

  2. Phytochemical Screening and Preliminary Evaluation of Analgesic ...

    African Journals Online (AJOL)

    In this study, the methanolic root extract of Cissus polyantha was subjected to preliminary phytochemical screening, analgesic and anti-inflammatory studies. Phytochemical studies was carried out using standard phytochemical protocol while the analgesic studies was carried out using acetic acid-induced writhing tests in ...

  3. Preliminary Phytochemical Screening of Fresh and Dried Moringa ...

    African Journals Online (AJOL)

    The preliminary phytochemical screening of the crude aqueous extract of fresh and dried Moringa oleifera leaves, of the organic solvent and residual fractions of the extract was carried out according to the standard methods. Chemical constituents of the crude aqueous extract of the fresh leaves were found to be tannins, ...

  4. Comparison of Cardiovascular Risk Screening Methods and Mortality Data among Hungarian Primary Care Population: Preliminary Results of the First Government-Financed Managed Care Program.

    Science.gov (United States)

    Móczár, Csaba; Rurik, Imre

    2015-09-01

    Besides participation in the primary prevention, screening as secondary prevention is an important requirement for primary care services. The effect of this work is influenced by the characteristics of individual primary care practices and doctors' screening habits, as well as by the regulation of screening processes and available financial resources. Between 1999 and 2009, a managed care program was introduced and carried out in Hungary, financed by the government. This financial support and motivation gave the opportunity to increase the number of screenings. 4,462 patients of 40 primary care practices were screened on the basis of SCORE risk assessment. The results of the screening were compared on the basis of two groups of patients, namely: those who had been pre-screened (pre-screening method) for known risk factors in their medical history (smoking, BMI, age, family cardiovascular history), and those randomly screened. The authors also compared the mortality data of participating primary care practices with the regional and national data. The average score was significantly higher in the pre-screened group of patients, regardless of whether the risk factors were considered one by one or in combination. Mortality was significantly lower in the participating primary practices than had been expected on the basis of the national mortality data. This government-financed program was a big step forward to establish a proper screening method within Hungarian primary care. Performing cardiovascular screening of a selected target group is presumably more appropriate than screening within a randomly selected population. Both methods resulted in a visible improvement in regional mortality data, though it is very likely that with pre-screening a more cost-effective selection for screening may be obtained.

  5. Preliminary pharmacognostic screening of Achyranthes coynei stem

    Directory of Open Access Journals (Sweden)

    Vinayak Upadhya

    2015-01-01

    Full Text Available Achyranthes coynei is a rare, endemic perennial shrub reported from Karnataka and Maharashtra states of India. The plant is used to treat various disorders by folk healers and was proven to have antimicrobial and antioxidant properties. The present study was undertaken to evaluate microscopic and macroscopic characters of A. coynei stem, along with its physicochemical parameters. ProgRes ® CapturePro and Microsoft Excel were used for statistical analysis. Perennial, shrubby nature and woody stem were the distinguishing morphological characters observed. Transverse section (TS illustrated quadrangular outline of the stem and showed the presence of two types of trichomes on the thick-walled epidermis. TS also showed number of rosette calcium oxalates crystals; prismatic and microsphenoid crystals; conjoint, collateral open secondary vascular bundles; and two amphixylic medullary bundles in the pith. Ash and extractive values, micro and macro elements and nutritive factors were estimated in the present study. The presence of alkaloids, saponins and triterpenoids were observed in preliminary phytochemical screening. High-performance thin layer chromatographic analysis yielded different bands and also indicated the presence of oleanolic acid. The studied parameters for A. coynei stem will be useful for identification and authentication of the plant material.

  6. Preliminary pharmacognostic screening of Achyranthes coynei stem.

    Science.gov (United States)

    Upadhya, Vinayak; Ankad, Gireesh M; Pai, Sandeep R; Hegde, Shruti V; Hegde, Harsha V

    2015-01-01

    Achyranthes coynei is a rare, endemic perennial shrub reported from Karnataka and Maharashtra states of India. The plant is used to treat various disorders by folk healers and was proven to have antimicrobial and antioxidant properties. The present study was undertaken to evaluate microscopic and macroscopic characters of A. coynei stem, along with its physicochemical parameters. ProgRes(®) CapturePro and Microsoft Excel were used for statistical analysis. Perennial, shrubby nature and woody stem were the distinguishing morphological characters observed. Transverse section (TS) illustrated quadrangular outline of the stem and showed the presence of two types of trichomes on the thick-walled epidermis. TS also showed number of rosette calcium oxalates crystals; prismatic and microsphenoid crystals; conjoint, collateral open secondary vascular bundles; and two amphixylic medullary bundles in the pith. Ash and extractive values, micro and macro elements and nutritive factors were estimated in the present study. The presence of alkaloids, saponins and triterpenoids were observed in preliminary phytochemical screening. High-performance thin layer chromatographic analysis yielded different bands and also indicated the presence of oleanolic acid. The studied parameters for A. coynei stem will be useful for identification and authentication of the plant material.

  7. Methods for Rapid Screening in Woody Plant Herbicide Development

    Directory of Open Access Journals (Sweden)

    William Stanley

    2014-07-01

    Full Text Available Methods for woody plant herbicide screening were assayed with the goal of reducing resources and time required to conduct preliminary screenings for new products. Rapid screening methods tested included greenhouse seedling screening, germinal screening, and seed screening. Triclopyr and eight experimental herbicides from Dow AgroSciences (DAS 313, 402, 534, 548, 602, 729, 779, and 896 were tested on black locust, loblolly pine, red maple, sweetgum, and water oak. Screening results detected differences in herbicide and species in all experiments in much less time (days to weeks than traditional field screenings and consumed significantly less resources (<500 mg acid equivalent per herbicide per screening. Using regression analysis, various rapid screening methods were linked into a system capable of rapidly and inexpensively assessing herbicide efficacy and spectrum of activity. Implementation of such a system could streamline early-stage herbicide development leading to field trials, potentially freeing resources for use in development of beneficial new herbicide products.

  8. Proposal of a simple screening method for a rapid preliminary evaluation of ''heavy metals'' mobility in soils of contaminated sites

    Energy Technology Data Exchange (ETDEWEB)

    Pinto, Valentina; Chiusolo, Francesca; Cremisini, Carlo [ENEA - Italian Agency for New Technologies, Energy and Environment, Rome (Italy). Section PROTCHIM

    2010-09-15

    Risks associated to ''heavy metals'' (HM) soil contamination depend not only on their total content but, mostly, on their mobility. Many extraction procedures have been developed to evaluate HM mobility in contaminated soils, but they are generally time consuming (especially the sequential extraction procedures (SEPs)) and consequently applicable on a limited number of samples. For this reason, a simple screening method, applicable even ''in field'', has been proposed in order to obtain a rapid evaluation of HM mobility in polluted soils, mainly focused on the fraction associated to Fe and Mn oxide/hydroxides. A buffer solution of trisodium citrate and hydroxylamine hydrochloride was used as extractant for a single-step leaching test. The choice of this buffered solution was strictly related to the possibility of directly determining, via titration with dithizone (DZ), the content of Zn, Cu, Pb and Cd, which are among the most representative contaminants in highly mineralised soils. Moreover, the extraction solution is similar, aside from for the pH value, which is the one used in the BCR SEP second step. The analysis of bivalents ions through DZ titration was exploited in order to further simplify and quicken the whole procedure. The proposed method generically measures, in few minutes, the concentration of total extractable ''heavy metals'' expressed as molL{sup -1} without distinguishing between elements. The proposed screening method has been developed and applied on soil samples collected from rural, urban and mining areas, representing different situation of soil contamination. Results were compared with data obtained from the BCR procedure. The screening method demonstrated to be a reliable tool for a rapid evaluation of metals mobility. Therefore, it could be very useful, even ''in field'', both to guide the sampling activity on site and to monitor the efficacy of the subsequent

  9. Preliminary phytochemical and antimicrobial screening of 50 ...

    African Journals Online (AJOL)

    Ethanolic extracts of 50 plant species were screened for their antimicrobial activity against Bacillus subtilis, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa and Candida albicans. The results indicated that of the 50 plant extracts, 28 plant extracts inhibited the growth of one or more test pathogens.

  10. Preliminary screening of plant essential oils against larvae of Culex ...

    African Journals Online (AJOL)

    Preliminary screenings of 22 plant essential oils were tested for mortality of the mosquito larvae Culex quinquefasciatus under laboratory conditions. Percent (%) mortality of the mosquito larvae were obtained for each essential oil. At different exposure periods, viz. 1, 3, 6, 12 and 24 h among the 22 plant oils tested, eight ...

  11. Development and preliminary validation of a screen for ...

    African Journals Online (AJOL)

    Development and preliminary validation of a screen for interpersonal childhood trauma experiences among school-going youth in Durban, South Africa. ... validity in the sense that all scales were significantly correlated with scores on clinical measures of post-traumatic stress disorder (PTSD) and/or complex PTSD.

  12. Preliminary biological screening of microbes isolated from cow dung ...

    African Journals Online (AJOL)

    Preliminary biological screening of microbes isolated from cow dung in Kampar. KC Teo, SM Teoh. Abstract. Five distinct morphologically and physiologically isolates were isolated from cow dung at Kampar, Perak, Malaysia and cultured on nutrient agar (NA) plates. Morphological studies including microscopic examination ...

  13. Preliminary ten year results from a randomised single centre mass screening trial for abdominal aortic aneurysm

    DEFF Research Database (Denmark)

    Lindholt, Jes Sanddal; Juul, Søren; Fasting, H

    2006-01-01

    At present, several regions and countries are considering screening for abdominal aortic aneurysm (AAA). However, The Chichester Aneurysms Screening Trial has reported poor long term benefit of screening for AAA. We therefore supplement previously published data with a preliminary analysis...

  14. QSAR Methods to Screen Endocrine Disruptors

    Directory of Open Access Journals (Sweden)

    Nicola Porta

    2016-08-01

    Full Text Available The identification of endocrine disrupting chemicals (EDCs is one of the important goals of environmental chemical hazard screening. We report on in silico methods addressing toxicological studies about EDCs with a special focus on the application of QSAR models for screening purpose. Since Estrogen-like (ER activity has been extensively studied, the majority of the available models are based on ER-related endpoints. Some of these models are here reviewed and described. As example for their application, we screen an assembled dataset of candidate substitutes for some known EDCs belonging to the chemical classes of phthalates, bisphenols and parabens, selected considering their toxicological relevance and broad application, with the general aim of preliminary assessing their ED potential. The goal of the substitution processes is to advance inherently safer chemicals and products, consistent with the principles of green chemistry. Results suggest that the integration of a family of different models accounting for different endpoints can be a convenient way to describe ED as properly as possible and allow also both to increase the confidence of the predictions and to maximize the probability that most active compounds are correctly found.

  15. An Algorithm for Glaucoma Screening in Clinical Settings and Its Preliminary Performance Profile

    Directory of Open Access Journals (Sweden)

    S-Farzad Mohammadi

    2013-01-01

    Full Text Available Purpose: To devise and evaluate a screening algorithm for glaucoma in clinical settings. Methods: Screening included examination of the optic disc for vertical cupping (≥0.4 and asymmetry (≥0.15, Goldmann applanation tonometry (≥21 mmHg, adjusted or unadjusted for central corneal thickness, and automated perimetry. In the diagnostic step, retinal nerve fiber layer imaging was performed using scanning laser polarimetry. Performance of the screening protocol was assessed in an eye hospital-based program in which 124 non-physician personnel aged 40 years or above were examined. A single ophthalmologist carried out the examinations and in equivocal cases, a glaucoma subspecialist′s opinion was sought. Results: Glaucoma was diagnosed in six cases (prevalence 4.8%; 95% confidence interval, 0.01-0.09 of whom five were new. The likelihood of making a definite diagnosis of glaucoma for those who were screened positively was 8.5 times higher than the estimated baseline risk for the reference population; the positive predictive value of the screening protocol was 30%. Screening excluded 80% of the initial population. Conclusion: Application of a formal screening protocol (such as our algorithm or its equivalent in clinical settings can be helpful in detecting new cases of glaucoma. Preliminary performance assessment of the algorithm showed its applicability and effectiveness in detecting glaucoma among subjects without any visual complaint.

  16. Universal newborn hearing screening: preliminary experience at the University Hospital of Cagliari

    Directory of Open Access Journals (Sweden)

    Giulia Pinna

    2012-10-01

    Full Text Available Bilateral congenital or acquired sensorineural hearing loss is a pathological condition affecting 1-2 children per 1,000 live births; it represents a major issue in public health because its late identification can negatively affect speech and language development. The aim of hearing screening is to obtain diagnosis and management of hearing loss as soon as possible; in fact early diagnosis and treatment allow children with congenital hearing impairment to acquire adequate linguistic competence. The present study reports our preliminary experience in newborn hearing screening at Neonatology services of University of Cagliari (Italy. During the first semester of surveillance, between January 2012 and June 2012, hearing screening was performed on a total of 901 babies using two different methods, TEOAEs in healthy neonates and automated ABR in high-risk babies. All infants were screened prior to hospital discharge; in some cases, especially for preterm infants of Neonatal Intensive Care Unit and Puericulture Institute, the screening was performed after discharge, to achieve a possible better global and acoustic maturation; 5 cases of hearing impairment were found. In the present study the Authors confirmed that it is possible to start a universal hearing screening in a relatively short time reaching the percentages suggested by Joint Committee on Infant Hearing.

  17. Methods for Cervical Cancer Screening

    Directory of Open Access Journals (Sweden)

    Tatiana Vargas-Revilla

    2014-12-01

    This article is divided in three sections: the first one focuses on the general impact of cervical cancer has hadin CostaRica, these condsection gathers information about different methodologies used around the world to detect this cancer and the third one makes reference to the current development of the screening devise in Mexico that works as a monitoring system and can used by women without external assistance.

  18. Methods for simulating turbulent phase screen

    International Nuclear Information System (INIS)

    Zhang Jianzhu; Zhang Feizhou; Wu Yi

    2012-01-01

    Some methods for simulating turbulent phase screen are summarized, and their characteristics are analyzed by calculating the phase structure function, decomposing phase screens into Zernike polynomials, and simulating laser propagation in the atmosphere. Through analyzing, it is found that, the turbulent high-frequency components are well contained by those phase screens simulated by the FFT method, but the low-frequency components are little contained. The low-frequency components are well contained by screens simulated by Zernike method, but the high-frequency components are not contained enough. The high frequency components contained will be improved by increasing the order of the Zernike polynomial, but they mainly lie in the edge-area. Compared with the two methods above, the fractal method is a better method to simulate turbulent phase screens. According to the radius of the focal spot and the variance of the focal spot jitter, there are limitations in the methods except the fractal method. Combining the FFT and Zernike method or combining the FFT method and self-similar theory to simulate turbulent phase screens is an effective and appropriate way. In general, the fractal method is probably the best way. (authors)

  19. LANL seismic screening method for existing buildings

    International Nuclear Information System (INIS)

    Dickson, S.L.; Feller, K.C.; Fritz de la Orta, G.O.

    1997-01-01

    The purpose of the Los Alamos National Laboratory (LANL) Seismic Screening Method is to provide a comprehensive, rational, and inexpensive method for evaluating the relative seismic integrity of a large building inventory using substantial life-safety as the minimum goal. The substantial life-safety goal is deemed to be satisfied if the extent of structural damage or nonstructural component damage does not pose a significant risk to human life. The screening is limited to Performance Category (PC) -0, -1, and -2 buildings and structures. Because of their higher performance objectives, PC-3 and PC-4 buildings automatically fail the LANL Seismic Screening Method and will be subject to a more detailed seismic analysis. The Laboratory has also designated that PC-0, PC-1, and PC-2 unreinforced masonry bearing wall and masonry infill shear wall buildings fail the LANL Seismic Screening Method because of their historically poor seismic performance or complex behavior. These building types are also recommended for a more detailed seismic analysis. The results of the LANL Seismic Screening Method are expressed in terms of separate scores for potential configuration or physical hazards (Phase One) and calculated capacity/demand ratios (Phase Two). This two-phase method allows the user to quickly identify buildings that have adequate seismic characteristics and structural capacity and screen them out from further evaluation. The resulting scores also provide a ranking of those buildings found to be inadequate. Thus, buildings not passing the screening can be rationally prioritized for further evaluation. For the purpose of complying with Executive Order 12941, the buildings failing the LANL Seismic Screening Method are deemed to have seismic deficiencies, and cost estimates for mitigation must be prepared. Mitigation techniques and cost-estimate guidelines are not included in the LANL Seismic Screening Method

  20. Isotope angiocardiography. Method and preliminary own studies

    Energy Technology Data Exchange (ETDEWEB)

    Stepinska, J; Ruzyllo, W; Konieczny, W [Centrum Medyczne Ksztalcenia Podyplomowego, Warsaw (Poland)

    1979-01-01

    Method of technetium isotope 99 m pass through the heart recording with the aid of radioisotope scanner connected with seriograph and computer is being presented. Preliminary tests were carried out in 26 patients with coronary disease without or with previous myocardial infarction, cardiomyopathy, ventricular septal defect and in patients with artificial mitral and aortic valves. The obtained scans were evaluated qualitatively and compared with performed later contrast X-rays of the heart. Size of the right ventricle, volume and rate of left atrial evacuation, size and contractability of left ventricle were evaluated. Similarity of direct and isotope angiocardiographs, non-invasional character and repeatability of isotope angiocardiography advocate its usefulness.

  1. Smartphone-based fluorescence spectroscopy device aiding in preliminary skin screening

    Science.gov (United States)

    Sahoo, Aparajita; Wahi, Akshat; Das, Anshuman

    2018-02-01

    Preliminary diagnosis of closely resembling skin conditions can be highly subjective for dermatologists. In ambiguous cases, it often leads to performing invasive procedures like biopsies. Different skin conditions, however, have varying concentrations of fluorophores (like collagen, NADH) and chromophores (like melanin, hemoglobin) which can alter their fluorescence spectra. We demonstrate a handheld, portable, smartphone-based spectrometer that leverages these alterations in skin autofluorescence spectra for rapid screening of skin conditions. This methodology involves excitation of affected skin areas with ultraviolet (UV-A) 385 nm light, capturing the generated fluorescence spectra and sending the data wirelessly to a companion mobile application for data storage, analysis and visualization. By collecting the fluorescence spectral signals from healthy and unhealthy skin conditions, we establish that the signals collected using this portable device can be used to develop a classification method to help in differentially diagnosing these conditions. It shows promise as a useful skin screening tool for both dermatologists and primary health care workers. This device can enable quick, non-invasive and a more objective preliminary examination. We envision the device to be especially useful in primary healthcare centers of developing countries where availability of dermatologists is limited.

  2. Genealogical series method. Hyperpolar points screen effect

    International Nuclear Information System (INIS)

    Gorbatov, A.M.

    1991-01-01

    The fundamental values of the genealogical series method -the genealogical integrals (sandwiches) have been investigated. The hyperpolar points screen effect has been found. It allows one to calculate the sandwiches for the Fermion systems with large number of particles and to ascertain the validity of the iterated-potential method as well. For the first time the genealogical-series method has been realized numerically for the central spin-independent potential

  3. Screening diagnostics of antivital experiences and propensity toward impulsive, autoagressive behavior in adolescents (preliminary results

    Directory of Open Access Journals (Sweden)

    Bannikov G.S.,

    2014-08-01

    Full Text Available Development of methods for revealing antivital experiences and propensity to autoaggressive behavior in educational institutions is one of the key steps in developing strategies for the primary prevention of suicidal behavior in adolescents. The purpose of this study was to develop an effective screening diagnostic package aimed at identifying antivital experiences and propensity to autoaggressive behavior. The survey methods we used were: Beck Hopelessness Scale, Russell Loneliness Scale, A.G. Shmelev Suicide Risk Questionnaire, PDQ-IV Borderline disorder and Narcissism scales. At the first stage we examined 750 minors aged 12-18 and identified risk group (85 people – 11.4%, which included adolescents with high levels of both individual scales, and their combination. At the second stage we examined 10 adolescents at risk. In 7 of them (70% were identified antivital, suicidal thoughts of passive or compulsive nature, signs of subjective and objective socio- psychological maladjustment. Our preliminary conclusion is that high levels of hopelessness and loneliness in adolescents are stable predictors of mental and emotional distress and psychosocial maladjustment in the period of psychological crises and decompensation of character accentuation of borderline and narcissistic types. These scales can be recommended for primary screening of antivital (depressive experiences and propensity to autoaggressive behavior in adolescents.

  4. Universal Developmental Screening: Preliminary Studies in Galicia, Spain

    Science.gov (United States)

    Sarmiento Campos, Jose A.; Squires, Jane; Ponte, Jaime

    2011-01-01

    "A_Tempo" is a research project that is currently under development in Galicia, an autonomous community of Spain. Its main aim is to propose an effective universal screening procedure for early identification of developmental disorders in children from zero to three years of age who attend Galician pre-primary schools.…

  5. 1ST-TRIMESTER SCREENING FOR FETAL CHROMOSOMAL-ABNORMALITIES - PRELIMINARY-RESULTS

    NARCIS (Netherlands)

    VANLITH, JMM

    We have started a multicentre trial to study the possibilities of first-trimester maternal serum screening for fetal chromosomal abnormalities. Maternal blood samples were obtained before 13 weeks of gestation. We present the preliminary results of the first 950 patients on alpha-fetoprotein (AFP).

  6. Preliminary hazard analysis using sequence tree method

    International Nuclear Information System (INIS)

    Huang Huiwen; Shih Chunkuan; Hung Hungchih; Chen Minghuei; Yih Swu; Lin Jiinming

    2007-01-01

    A system level PHA using sequence tree method was developed to perform Safety Related digital I and C system SSA. The conventional PHA is a brainstorming session among experts on various portions of the system to identify hazards through discussions. However, this conventional PHA is not a systematic technique, the analysis results strongly depend on the experts' subjective opinions. The analysis quality cannot be appropriately controlled. Thereby, this research developed a system level sequence tree based PHA, which can clarify the relationship among the major digital I and C systems. Two major phases are included in this sequence tree based technique. The first phase uses a table to analyze each event in SAR Chapter 15 for a specific safety related I and C system, such as RPS. The second phase uses sequence tree to recognize what I and C systems are involved in the event, how the safety related systems work, and how the backup systems can be activated to mitigate the consequence if the primary safety systems fail. In the sequence tree, the defense-in-depth echelons, including Control echelon, Reactor trip echelon, ESFAS echelon, and Indication and display echelon, are arranged to construct the sequence tree structure. All the related I and C systems, include digital system and the analog back-up systems are allocated in their specific echelon. By this system centric sequence tree based analysis, not only preliminary hazard can be identified systematically, the vulnerability of the nuclear power plant can also be recognized. Therefore, an effective simplified D3 evaluation can be performed as well. (author)

  7. Preliminary pharmacological screening of Bixa orellana L. leaves.

    Science.gov (United States)

    Shilpi, Jamil Ahmad; Taufiq-Ur-Rahman, Md; Uddin, Shaikh Jamal; Alam, Md Shahanur; Sadhu, Samir Kumar; Seidel, Véronique

    2006-11-24

    Preliminary pharmacological studies were performed on the methanol extract of Bixa orellana L. (Bixaceae) leaves to investigate neuropharmacological, anticonvulsant, analgesic, antidiarrhoeal activity and effect on gastrointestinal motility. All studies were conducted in mice using doses of 125, 250 and 500 mg/kg of body weight. In the pentobarbitone-induced hypnosis test, the extract statistically reduced the time for the onset of sleep at 500 mg/kg dose and (dose-dependently) increased the total sleeping time at 250 and 500 mg/kg dose. A statistically significant decrease in locomotor activity was observed at all doses in the open-field and hole-cross tests. In the strychnine-induced anticonvulsant test, the extract increased the average survival time of the test animals (statistically significant at 250 and 500 mg/kg). The extract significantly and dose-dependently reduced the writhing reflex in the acetic acid-induced writhing test. Antidiarrhoeal activity was supported by a statistically significant decrease in the total number of stools (including wet stools) in castor oil-induced diarrhoea model. A statistically significant delay in the passage of charcoal meal was observed at 500 mg/kg in the gastrointestinal motility test. The extract was further evaluated in vitro for antioxidant and antibacterial activity. It revealed radical scavenging properties in the DPPH assay (IC(50)=22.36 microg/ml) and antibacterial activity against selected causative agents of diarrhoea and dysentery, including Shigella dysenteriae.

  8. Preliminary screening of bacterial isolates from mining wastes

    Directory of Open Access Journals (Sweden)

    Rodino S.,

    2016-05-01

    Full Text Available Developing innovative biotechnology for obtaining new resources of high tech critical metals is strongly influenced by the need to reduce the potential risk of shortages, to support the development of industry at European level. To set up these new technologies is essential to isolate strains with high potential in bioleaching of ore, tailings and mine wastes and bioaccumulation of high tech critical metals. Microorganisms are capable of mediating metal and mineral bioprecipitation. In this paper are presented preliminary studies performed for the isolation of strains existing in mining residues containing high tech critical metals. Were used samples collected from various depths in an area of mining wastes containing high tech critical metals. The samples were fine grounded and the powder was washed with sterile saline water. Exact quantities of samples were dispersed in sterile saline water, shaken for a period of 60 minutes, diluted and plated in triplicate on selective agar. After several steps were isolated 3 strains of gram negative bacteria.

  9. Tumour screening by means of tomography methods

    International Nuclear Information System (INIS)

    Diederich, S.

    2005-01-01

    Tomography methods such as computer tomography (CT), magnetic resonance tomography (MRT), and sonography/ultrasound examinations make it possible to detect small asymptomatic tumours, thus potentially preventing their manifestation at an advanced stage and improving survival prospects for the patients concerned. There are data available on various common tumours which show that modern tomography methods are capable of detecting not only small asymptomatic tumours but also their benign precursors (e.g. polyps of the large intestine). This has been demonstrated for lung cancer, colon cancer and breast cancer. However, it has not been possible to date to show for any tomography method or any type of tumour that the systematic use of such diagnostic procedures does anything to lower the mortality rate for that tumour. For other types of tumour (pancreatic cancer, kidney cancer, ovary cancer) the above named methods are either not sufficiently sensitive or the body of data that has accumulated on their respective use is too small to judge the benefit of tomography screenings. Current technical developments make it appear probable that for many types of cancer the reliability with which small tumours can be detected will improve in future. Studies aimed at clarifying the potential of screenings for reducing mortality rates are already underway for lung cancer and would be worthwhile performing for other tumour types

  10. Preliminary Phytochemical and Biological Screening of Cyclamen coum a Member of Palestinian Flora

    Directory of Open Access Journals (Sweden)

    Nidal Amin Jaradat, Motasem Al-Masri, Fatmeh Hussen, Abed Naser Zaid, Iyad Ali, Ala Tammam, Doaa Mostafa Odeh, Omaima Hussein Shakarneh, Areej Rajabi

    2017-09-01

    Full Text Available Background: Since ancient times, the treatment of various diseases has relied on medicinal plants. The replacement of chemically synthesized drugs with natural medications gave the later advantageous due to their safety for humans. This study aimed to screen and to evaluate preliminarily phytoconstituents, total contents of flavonoids, tannins, and phenols also to evaluate the antibacterial and antioxidant activities of Cyclamen coum aerial parts methanol extract. Methods: Screening of phytoconstituents, total flavonoids, tannins and phenols contents, as well as antioxidant properties, were investigated for the Cyclamen coum aerial parts by using standard phytochemical and analytical methods. Evaluation of antibacterial activity of the plant methanolic extract was performed by using broth microdilution method. American Type Culture Collections of Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus and Methicillin-Resistant Staphylococcus aureus (MRSA were utilized to evaluate antibacterial activity. Results: Preliminary phytochemical qualitative analysis of the plant methanolic extract showed that the plant aerial parts contained amino acids, reducing sugar, carbohydrate, tannin, flavonoid, phenol, saponin, cardiac glycoside, and steroids. Total flavonoids, phenols, and tannins in plant methanolic extract were 60.88 mg QUE/g, 32.7 mg GAE/g and 11.7 mg CAE/g, respectively. Meanwhile, the antioxidant activity was estimated to be 31 µg/mL and has very weak antibacterial activity on the studied pathogens. Conclusion: In the present study, evaluation of total phenolic, tannins and flavonoid content from the aerial parts of C. coum can be an antioxidant naturally potent source. The results of in-vitro antibacterial studies showed that the studied plant has very weak antibacterial activity. In addition, the presence of antioxidant compounds in C. coum makes it a good candidate for manufacturing dietary supplements and food preservatives

  11. A new screening method for discovering antibacterial agents from ...

    African Journals Online (AJOL)

    A new screening method for discovering antibacterial agents from filamentous fungi. ... African Journal of Biotechnology ... Keywords: Drug-resistant bacterial pathogens, novel antibiotics; screening method, filamentous fungi products ...

  12. Method for in vitro screening of aquatic fungicides

    Science.gov (United States)

    Bailey, T.A.

    1983-01-01

    Methods were developed for in vitro screening of candidate aquatic fungicides for efficacy against Achlya fiagellata, A. racemosa, Saprolegnia hypogyna and S. megasperma. Agar plugs containing fungal hyphae, removed from the edge of actively growing colonies, were placed in the depressions of spot plates containing 1a??0, 10a??0 and 100 mg/I of the candidate compounds for 15 or 60 min. After exposure, the plugs were transferred on to filter papers (0a??45-A?m pore) in a holder, rinsed, and then placed on cornmeal agar medium in tri-petri dishes. The plates were checked for mycelial growth after 48, 96 and 168 h of incubation in a lighted (400-800 A?m) environmental control chamber at 20A?2A?C. Criteria for the acceptance or rejection of candidate aquatic fungicides for further study were based on the antifungal spectrum index (ASI) comparisons between respective compounds and malachite green after 48 h and the concentration level producing complete growth inhibition. Candidate compounds whose ASI was less than 50% that of malachite green after 48 h or did not inhibit growth at levels less than 100 mg/l were rejected. This method provides a base from which in vivo and definitive test regimens can be developed. Preliminary in vitro screening of candidate fungicides reduces the need for costly in vivo tests on compounds that have low antifungal activity.

  13. Apparatus and method for radioactive waste screening

    Science.gov (United States)

    Akers, Douglas W.; Roybal, Lyle G.; Salomon, Hopi; Williams, Charles Leroy

    2012-09-04

    An apparatus and method relating to screening radioactive waste are disclosed for ensuring that at least one calculated parameter for the measurement data of a sample falls within a range between an upper limit and a lower limit prior to the sample being packaged for disposal. The apparatus includes a radiation detector configured for detecting radioactivity and radionuclide content of the of the sample of radioactive waste and generating measurement data in response thereto, and a collimator including at least one aperture to direct a field of view of the radiation detector. The method includes measuring a radioactive content of a sample, and calculating one or more parameters from the radioactive content of the sample.

  14. Preliminary Screening of a Classical Ayurvedic Formulation for Anticonvulsant Activity

    Directory of Open Access Journals (Sweden)

    Arnab Dhar

    2016-01-01

    Full Text Available Background: Epilepsy is a serious and complex central nervous system disorder associated with recurrent episodes of convulsive seizures due to the imbalance between excitatory (glutamatergic and inhibitory (GABAergic neurotransmitters level in the brain. The available treatments are neither competent to control the seizures nor prevent progress of disease. Since ages, Herbal medicines have remained important sources of medicines in many parts of world which is evidenced through their uses in traditional systems of medicine i.e. Ayurveda, Siddha, Unani, Homeopathy and Chinese etc. Aim: A polyherbal formulation (containing Terminalia chebula Retz., Asparagus racemosus Willd., Embelia ribes Burm. F, Acorus calamus L., Tinospora cordifolia (Willd. Miers, Convolvulus pluricaulis Choisy, Saussurea lappa C.B.Clarke, Achyranthes aspera L. is mentioned in Ayurvedic classics Bhaiṣajya Ratnāvali. The aim of the study was to evaluate the anticonvulsant activity of the formulation in Maximum electroshock and Pentylenetetrazole induced convulsions in rats. Materials and Methods: In the present study, a polyherbal formulation was developed as directed by classical text and evaluated for the anticonvulsant activity using Maximal Electroshock Shock (MES and Pentylenetetrazole (PTZ induced convulsions in rats. Statistical comparison was done by one way ANOVA followed by the Tukey's multiple comparison test. Results: The obtained results showed that the PHF had a protective role on epilepsy. Treatment with PHF significantly improves antioxidant enzymes activities of superoxide dismutase (SOD and glutathione (GSH levels significantly as compared to controls. PHF also significantly decreased malonaldialdehyde (MDA levels in the brain. Moreover, it also attenuated the PTZ-induced increase in the activity of GABA-T in the rat brain. Conclusion: These findings suggest that PHF might have possible efficacy in the treatment of epilepsy.

  15. Preliminary screening oxidative degradation methyl orange using ozone/ persulfate

    Science.gov (United States)

    Aqilah Razali, Nur; Zulzikrami Azner Abidin, Che; An, Ong Soon; Ridwan, Fahmi Muhammad; Haqi Ibrahim, Abdul; Nasuha Sabri, Siti; Huan Kow, Su

    2018-03-01

    The present study focusing on the performances of advanced oxidation process by using ozonation method towards Methyl Orange based on the efficiency of colour removal and Chemical Oxygen Demand (COD) removal. Factorial design with response surface methodology (RSM) was used to evaluate the interaction between operational conditions, such as pH, initial concentration, contact time and persulfate dosage to obtain the optimum range conditions using a semi-batch reactor. The range of independent variables investigated were pH (3-11), initial concentration (100-500mg/L), contact time (10-50min) and persulfate dosage (20-100mM) while the response variables were colour removal and COD removal of Methyl Orange. The experimental results and statistical analysis showed all the parameters were significant. Thus, from this findings, optimization of operational conditions that had been suggested from the ozone/persulfate RSM analysis were (pH 3, 100 mg/L, 50min, 60mM) that would be produced 99% Colour Removal and 80% COD Removal and help in promoting an efficient ozonation process. The effect list data that showed the most contributed effects to increase the percentages of colour removal were pH and persulfate dosage whereas the contact time and initial concentration had the highest positive effects on the COD removal. Other than that, the interaction between pH, contact time and persulfate dosage were found to be the most influencing interaction. Therefore the least influencing interaction was interaction between persulfate dosage and pH. In this study, the correlation coefficient value R2 for colour removal and COD removal of Methyl Orange were R2= 0.9976 and R2= 0.9924 which suggested a good fit of the first-order regression model with the experimental data.

  16. Breast cancer screening (BCS) chart: a basic and preliminary model for making screening mammography more productive and efficient.

    Science.gov (United States)

    Poorolajal, Jalal; Akbari, Mohammad Esmaeil; Ziaee, Fatane; Karami, Manoochehr; Ghoncheh, Mahshid

    2017-05-15

    The breast cancer screening (BCS) chart is suggested as a basic and preliminary tool to improve efficiency of screening mammography. We conducted this case-control study in 2016 and enrolled 1422 women aged 30-75 years, including 506 women with breast cancer (cases) and 916 women without breast cancer (controls). We developed the BCS chart using a multiple logistic regression analysis. We combined the risks of breast cancer to predict the individual risk of breast cancer. Then, we stratified and colored the predicted risk probabilities as follows: green), 05-09% (yellow), 10-14% (orange), 15-19% (red), 20-24% (brown) and ≥25% (black). The BCS chart provides the risk probability of breast cancer, based on age, body mass index, late menopause, having a benign breast disease and a positive family history of breast cancer among the first-degree or the second/third-degree relatives. According to this chart, an individual can be classified in a category of low risk (green), medium risk (yellow and orange), high risk (red and brown) and very high risk (black) for breast cancer. This chart is a flexible and easy to use tool that can detect high-risk subjects and make the screening program more efficient and productive. © The Author 2017. Published by Oxford University Press on behalf of Faculty of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  17. A Preliminary Rubric Design to Evaluate Mixed Methods Research

    Science.gov (United States)

    Burrows, Timothy J.

    2013-01-01

    With the increase in frequency of the use of mixed methods, both in research publications and in externally funded grants there are increasing calls for a set of standards to assess the quality of mixed methods research. The purpose of this mixed methods study was to conduct a multi-phase analysis to create a preliminary rubric to evaluate mixed…

  18. Weldon Spring, Missouri, Raffinate Pits 1, 2, 3, and 4: Preliminary grout development screening studies for in situ waste immobilization

    International Nuclear Information System (INIS)

    McDaniel, E.W.; Gilliam, T.M.; Dole, L.R.; West, G.A.

    1987-04-01

    Results of Oak Ridge National Laboratory's initial support program to develop a preliminary grout formula to solidify in situ the Weldon Spring waste are presented. The screening study developed preliminary formulas based on a simulated composite waste and then tested the formulas on actual waste samples. Future data needs are also discussed. 1 ref., 6 figs., 9 tabs

  19. Screening for Malnutrition in Community Dwelling Older Japanese: Preliminary Development and Evaluation of the Japanese Nutritional Risk Screening Tool (NRST).

    Science.gov (United States)

    Htun, N C; Ishikawa-Takata, K; Kuroda, A; Tanaka, T; Kikutani, T; Obuchi, S P; Hirano, H; Iijima, K

    2016-02-01

    Early and effective screening for age-related malnutrition is an essential part of providing optimal nutritional care to older populations. This study was performed to evaluate the adaptation of the original SCREEN II questionnaire (Seniors in the Community: Risk Evaluation for Eating and Nutrition, version II) for use in Japan by examining its measurement properties and ability to predict nutritional risk and sarcopenia in community-dwelling older Japanese people. The ultimate objective of this preliminary validation study is to develop a license granted full Japanese version of the SCREEN II. The measurement properties and predictive validity of the NRST were examined in this cross-sectional study of 1921 community-dwelling older Japanese people. Assessments included medical history, and anthropometric and serum albumin measurements. Questions on dietary habits that corresponded to the original SCREEN II were applied to Nutritional Risk Screening Tool (NRST) scoring system. Nutritional risk was assessed by the Geriatric Nutrition Risk Index (GNRI) and the short form of the Mini-Nutritional Assessment (MNA-SF). Sarcopenia was diagnosed according to the criteria of the European Working Group on Sarcopenia in Older People. The nutritional risk prevalences determined by the GNRI and MNA-SF were 5.6% and 34.7%, respectively. The prevalence of sarcopenia was 13.3%. Mean NRST scores were significantly lower in the nutritionally at-risk than in the well-nourished groups. Concurrent validity analysis showed significant correlations between NRST scores and both nutritional risk parameters (GNRI or MNA-SF) and sarcopenia. The areas under the receiver operating characteristic curves (AUC) of NRST for the prediction of nutritional risk were 0.635 and 0.584 as assessed by GNRI and MNA-SF, respectively. AUCs for the prediction of sarcopenia were 0.602 (NRST), 0.655 (age-integrated NRST), and 0.676 (age and BMI-integrated NRST). These results indicate that the NRST is a

  20. Preliminary phytochemical screening and in vitro antibacterial activity of Bauhinia variegata Linn. against human pathogens

    Directory of Open Access Journals (Sweden)

    Sonam Pandey

    2015-02-01

    Full Text Available Objective: To investigate the antimicrobial and phytochemical properties of hydromethanolic extracts of Bauhinia variegata Linn. (B. variegata (leaf, stem bark and flower to justify the traditional claim endowed upon this herbal drug as a rasayana in Ayurveda. This study thus can be further utilized to formulate the natural antioxidant which can be used as a dietary supplement to fight against several diseases such as cancer, ageing, arthrosclerosis, etc. Methods: The study showed that the number of different phytoconstituents present in the plant which makes it remarkable for its use by traditional practitioners. On the another set of experiment, the hydromethanolic extract of B. variegata (leaf, stem bark and flower were evaluated against Gram-positive and Gram-negative by using disk diffusion assay. Results: Phytochemical screening of all extracts showed the presence of alkaloids, steroids, phenolic compounds, tannins, saponin, carbohydrates, proteins, amino acids and organic acids. The antibacterial activity of all the extracts (leaf, stem bark and flower of B. variegata was determined by agar well diffusion method at four different concentrations i.e., 1 000 mg/mL, 750 mg/mL, 500 mg/mL and 250 mg/mL using Gram-positive Bacillus subtilius, Staphylococcus aureus and Streptococcus epidermidis and Gram-negative Escherichia coli, Shegilla flexineria, Pseudomonas auriginosa bacteria. Conclusions: These studies show that hydromethanolic extracts of B. variegata (leaf, stem bark and flower inhibited the growth of microorganism ’s in dose dependently. B. variegata leaf, stem bark and flower extracts have several phytochemical constituents who possess the antimicrobial activity. A tiny amount of data is presented, as the preliminary antimicrobial properties of the B. variegata here accessed, under the urgent necessity of new antibiotics in the market and in face of the increased resistance of infectious microorganisms to antimicrobials.

  1. Screening for Developmental Disorders in 3- and 4-Year-Old Italian Children: A Preliminary Study

    Directory of Open Access Journals (Sweden)

    Elena Catino

    2017-08-01

    Full Text Available BackgroundThe “Osserviamo” project, coordinated by the Municipality of Rome and the Department of Pediatrics and Child Neuropsychiatry of Sapienza University, aimed to validate an Italian version of the Ages and Stages Questionnaire-3 and to collect, for the first time in Italy, data on developmental disorders in a sample of 4,000 children aged 3 and 4 years. The present paper presents the preliminary results of the “Osserviamo” project.Methods600 parents of children between 39 and 50 months of age (divided in two age stages: 42 and 48 months were contacted from 15 kindergarden schools.Results23.35% of the whole sample scored in the risk range of at least one developmental area of the Ages and Stages Questionnaire-3rd Edition (ASQ-3 and 7.78% scored in the clinical range. Specifically, 23.97% of the children in the 42-month age stage scored in the risk range and 5.79% scored in the clinical range. Males scored lower than females in the fine motor skills and personal–social development domains. Moreover, 22.79% of the children in the 48-month age stage scored in the risk range, while 9.55% scored in the clinical range. Males scored lower than females in fine motor skills.ConclusionItalian validation of the ASQ-3 and recruitment of all 4,000 participants will allow these data on the distribution of developmental disorders to be extended to the general Italian pediatric population. One main limitation of the study is the lack of clinical confirmation of the data yielded by the screening programme, which the authors aim to obtain in later stages of the study.

  2. Preliminary design of the beam screen cooling for the Future Circular Collider of hadron beams

    Science.gov (United States)

    Kotnig, C.; Tavian, L.

    2015-12-01

    Following recommendations of the recent update of the European strategy in particle physics, CERN has undertaken an international study of possible future circular colliders beyond the LHC. This study considers an option for a very high energy (100 TeV) hadron-hadron collider located in a quasi-circular underground tunnel having a circumference of 80 to 100 km. The synchrotron radiation emitted by the high-energy hadron beam increases by more than two orders of magnitude compared to the LHC. To reduce the entropic load on the superconducting magnets’ refrigeration system, beam screens are indispensable to extract the heat load at a higher temperature level. After illustrating the decisive constraints of the beam screen's refrigeration design, this paper presents a preliminary design of the length of a continuous cooling loop comparing helium and neon, for different cooling channel geometries with emphasis on the cooling length limitations and the exergetic efficiency.

  3. Preliminary design of the beam screen cooling for the Future Circular Collider of hadron beams

    CERN Document Server

    Kotnig, C

    2015-01-01

    Following recommendations of the recent update of the European strategy in particle physics, CERN has undertaken an international study of possible future circular colliders beyond the LHC. This study considers an option for a very high energy (100 TeV) hadron-hadron collider located in a quasi-circular underground tunnel having a circumference of 80 to 100 km. The synchrotron radiation emitted by the high-energy hadron beam increases by more than two orders of magnitude compared to the LHC. To reduce the entropic load on the superconducting magnets' refrigeration system, beam screens are indispensable to extract the heat load at a higher temperature level. After illustrating the decisive constraints of the beam screen's refrigeration design, this paper presents a preliminary design of the length of a continuous cooling loop comparing helium and neon, for different cooling channel geometries with emphasis on the cooling length limitations and the exergetic efficiency.

  4. A preliminary investigation of PSA validation methods

    Energy Technology Data Exchange (ETDEWEB)

    Unwin, S D [Science Applications International Corp., (United States)

    1995-09-01

    This document has been prepared to support the initial phase of the Atomic Energy Control Board`s program to review and evaluate Probabilistic Safety Assessment (PSA) studies conducted by nuclear generating station designers and licensees. The document provides (1) a review of current and prospective applications of PSA technology in the Canadian nuclear power industry; (2) an assessment of existing practices and techniques for the review or risk and hazard identification studies in the international nuclear power sector and other technological sectors; and (3) proposed analytical framework in which to develop systematic techniques for the scrutiny and evaluation of a PSA model. These frameworks are based on consideration of the mathematical structure of a PSA model and are intended to facilitate the development of methods to evaluate a model relative to intended end-uses. (author). 34 refs., 10 tabs., 3 figs.

  5. A preliminary investigation of PSA validation methods

    International Nuclear Information System (INIS)

    Unwin, S.D.

    1995-09-01

    This document has been prepared to support the initial phase of the Atomic Energy Control Board's program to review and evaluate Probabilistic Safety Assessment (PSA) studies conducted by nuclear generating station designers and licensees. The document provides (1) a review of current and prospective applications of PSA technology in the Canadian nuclear power industry; (2) an assessment of existing practices and techniques for the review or risk and hazard identification studies in the international nuclear power sector and other technological sectors; and (3) proposed analytical framework in which to develop systematic techniques for the scrutiny and evaluation of a PSA model. These frameworks are based on consideration of the mathematical structure of a PSA model and are intended to facilitate the development of methods to evaluate a model relative to intended end-uses. (author). 34 refs., 10 tabs., 3 figs

  6. Solubility tests and the peripheral blood film method for screening ...

    African Journals Online (AJOL)

    Objective. To determine the cost benefit of screening for sicklecell disease among infants at district health centres in Uganda using sickling, solubility tests and the peripheral blood film method. Methods. Pilot screening services were established at district health centres. Cost benefit analysis (CBA) was performed in four ...

  7. High throughput screening method for assessing heterogeneity of microorganisms

    NARCIS (Netherlands)

    Ingham, C.J.; Sprenkels, A.J.; van Hylckama Vlieg, J.E.T.; Bomer, Johan G.; de Vos, W.M.; van den Berg, Albert

    2006-01-01

    The invention relates to the field of microbiology. Provided is a method which is particularly powerful for High Throughput Screening (HTS) purposes. More specific a high throughput method for determining heterogeneity or interactions of microorganisms is provided.

  8. Screening the nutritional status in oncology: a preliminary report on 1,000 outpatients.

    Science.gov (United States)

    Bozzetti, Federico

    2009-03-01

    This study presents the preliminary data of a prospective multi-centre investigation on the screening of the nutritional status of cancer outpatients with the purpose to define: (1) prevalence and rate of weight loss and nutritional risk in this patient population, and (2) to assess the association among some patient-dependent, tumour-dependent and therapy-dependent variables with the nutritional status and the nutritional risk. Seventeen centres were involved to collect demographic data (age and sex), oncologic data (site of primary tumour, stage, Eastern Cooperative Oncology Group Performance State, oncologic therapy) and presence and severity of systemic and digestive/nutritional symptoms (fatigue, anorexia, nausea/vomiting, early satiety, dysgeusia/dysosmia, dysphagia/odynophagia, diarrhoea/constipation). Furthermore, the percentage of the weight loss on the usual body weight and the body mass index were computed. The nutritional risk was assessed according to the Nutrition Risk Screening 2002 questionnaire which scores the risk from 0 to 7. On the first 1,000 screened patients, a significant weight loss (>or=10%) and a nutritional risk score >or=3 were observed in 39.7% and 33.8% of patients, respectively. Weight loss was higher in upper gastrointestinal tumours, in advanced stages of disease and in patients with a poor performance status. Similarly, the nutritional risk was higher in esophageal and pancreatic cancer and in those with a worse performance status. There was a good correlation between the severity of anorexia and the rate of the weight loss The majority of patients with no weight loss or a weight loss anorexia. Weight loss and nutritional risk are frequent in an unselected series of cancer outpatients. Site of primary tumour, stage and performance state appear to be associated, at a preliminary analysis, with significant weight loss and nutritional risk. Anorexia and weight loss are closely related, and this supports the concept that nutritional

  9. A new screening method for selection of desired recombinant ...

    African Journals Online (AJOL)

    A new screening method for selection of desired recombinant plasmids in molecular cloning. ... African Journal of Biotechnology ... Regarding the facts of this study, after digestion process, the products directly were subjected to ligation. Due to ...

  10. The evolving role of new imaging methods in breast screening.

    Science.gov (United States)

    Houssami, Nehmat; Ciatto, Stefano

    2011-09-01

    The potential to avert breast cancer deaths through screening means that efforts continue to identify methods which may enhance early detection. While the role of most new imaging technologies remains in adjunct screening or in the work-up of mammography-detected abnormalities, some of the new breast imaging tests (such as MRI) have roles in screening groups of women defined by increased cancer risk. This paper highlights the evidence and the current role of new breast imaging technologies in screening, focusing on those that have broader application in population screening, including digital mammography, breast ultrasound in women with dense breasts, and computer-aided detection. It highlights that evidence on new imaging in screening comes mostly from non-randomised studies that have quantified test detection capability as adjunct to mammography, or have compared measures of screening performance for new technologies with that of conventional mammography. Two RCTs have provided high-quality evidence on the equivalence of digital and conventional mammography and on outcomes of screen-reading complemented by CAD. Many of these imaging technologies enhance cancer detection but also increase recall and false positives in screening. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. An alternative green screen keying method for film visual effects

    OpenAIRE

    Zhi, Jin

    2015-01-01

    This study focuses on a green screen keying method developed especially for film visual effects. There are a series of ways of using existing tools for creating mattes from green or blue screen plates. However, it is still a time-consuming process, and the results vary especially when it comes to retaining tiny details, such as hair and fur. This paper introduces an alternative concept and method for retaining edge details of characters on a green screen plate, also, a number of connected mat...

  12. Targeted prostate cancer screening in men with mutations in BRCA1 and BRCA2 detects aggressive prostate cancer: preliminary analysis of the results of the IMPACT study

    DEFF Research Database (Denmark)

    Mitra, Anita V; Bancroft, Elizabeth K; Barbachano, Yolanda

    2011-01-01

    mutations were offered annual prostate specific antigen (PSA) testing, and those with PSA >3 ng/mL, were offered a prostate biopsy. Controls were men age-matched (± 5 years) who were negative for the familial mutation. RESULTS: In total, 300 men were recruited (205 mutation carriers; 89 BRCA1, 116 BRCA2......Study Type - Diagnostic (validating cohort)
Level of Evidence 1b OBJECTIVES: To evaluate the role of targeted prostate cancer screening in men with BRCA1 or BRCA2 mutations, an international study, IMPACT (Identification of Men with a genetic predisposition to ProstAte Cancer: Targeted screening...... in BRCA1/2 mutation carriers and controls), was established. This is the first multicentre screening study targeted at men with a known genetic predisposition to prostate cancer. A preliminary analysis of the data is reported. MATERIALS AND METHODS: Men aged 40-69 years from families with BRCA1 or BRCA2...

  13. Statistical methods for determining the effect of mammography screening

    DEFF Research Database (Denmark)

    Lophaven, Søren

    2016-01-01

    In an overview of five randomised controlled trials from Sweden, a reduction of 29% was found in breast cancer mortality in women aged 50-69 at randomisation after a follow up of 5-13 years. Organised, population based, mammography service screening was introduced on the basis of these resultsin...... in 2007-2008. Women aged 50-69 were invited to screening every second year. Taking advantage of the registers of population and health, we present statistical methods for evaluating the effect of mammography screening on breast cancer mortality (Olsen et al. 2005, Njor et al. 2015 and Weedon-Fekjær etal...

  14. Preliminary study on the establishment of the radionuclide declaration methods for radionuclides in LILW radioactive waste

    International Nuclear Information System (INIS)

    Hwang, K. H.; Lee, K. J.; Jung, C. W.

    2003-01-01

    The preliminary study on declaration methods has been done for each radionuclide in LILW radwaste drum in Korean NPPs. View from the preliminary establishment of radio nuclide declaration methods, The selection of assessment target nuclide through the qualitative method and preliminary criteria for routine declaration methods in each radio nuclide was derived. First of all, selection criteria and preliminary assessment method for each target radionuclide was surveyed and investigated. And, the selection criteria and selected the target radio nuclides from the basis on criteria was derived. And the preliminary suggestion about the declaration methods for each target radio nuclide was established

  15. Availability and accessibility of subsidized mammogram screening program in peninsular Malaysia: A preliminary study using travel impedance approach.

    Science.gov (United States)

    Mahmud, Aidalina; Aljunid, Syed Mohamed

    2018-01-01

    Access to healthcare is essential in the pursuit of universal health coverage. Components of access are availability, accessibility (spatial and non-spatial), affordability and acceptability. Measuring spatial accessibility is common approach to evaluating access to health care. This study aimed to determine the availability and spatial accessibility of subsidised mammogram screening in Peninsular Malaysia. Availability was determined from the number and distribution of facilities. Spatial accessibility was determined using the travel impedance approach to represent the revealed access as opposed to potential access measured by other spatial measurement methods. The driving distance of return trips from the respondent's residence to the facilities was determined using a mapping application. The travel expenditure was estimated by multiplying the total travel distance by a standardised travel allowance rate, plus parking fees. Respondents in this study were 344 breast cancer patients who received treatment at 4 referral hospitals between 2015 and 2016. In terms of availability, there were at least 6 major entities which provided subsidised mammogram programs. Facilities with mammogram involved with these programs were located more densely in the central and west coast region of the Peninsula. The ratio of mammogram facility to the target population of women aged 40-74 years ranged between 1: 10,000 and 1:80,000. In terms of accessibility, of the 3.6% of the respondents had undergone mammogram screening, their mean travel distance was 53.4 km (SD = 34.5, range 8-112 km) and the mean travel expenditure was RM 38.97 (SD = 24.00, range RM7.60-78.40). Among those who did not go for mammogram screening, the estimated travel distance and expenditure had a skewed distribution with median travel distance of 22.0 km (IQR 12.0, 42.0, range 2.0-340.0) and the median travel cost of RM 17.40 (IQR 10.40, 30.00, range 3.40-240.00). Higher travel impedance was noted among those who

  16. SCREENING METHODS FOR THE DETECTION OF CARTELS

    Directory of Open Access Journals (Sweden)

    Mihail BUŞU

    2014-06-01

    Full Text Available During their everyday activities, the economic operators conclude a multitude of agreements in tacit or written form, such as: contracts or conventions. Some of these arrangements are absolutely necessary for the development of their current activities. These are agreements which, by respecting the rules of competition, are able to bring benefits to consumers and to the entire economy, as a whole. On the other hand, the economic operators often conclude agreements which are harmful to the economy as well as to the consumers, violating the competition rules. Some examples in this respect are: operators’ agreements on price fixing, on market or customers sharing. Before investigating the violation of competition rules, the relevant authorities should identify the possibility of the existence of such illegalities. The theoretical models for detecting the cartels do represent a proactive tool concerning the antitrust activity of competition authorities. The present paper furnishes a review of the methods for detecting cartels as well as a part of their practical application.

  17. A screening method for banana weevil ( Cosmopolites sordidus ...

    African Journals Online (AJOL)

    The banana weevil (Cosmopolites sordidus Germar) is a serious pest in most banana-growing areas of the world. Host-plant resistance is considered to be the most feasible and sustainable method for its control. However, a quick and effective method for screening banana genotypes for resistance against the banana ...

  18. Screening-Level Ecological Risk Assessment Methods, Revision 3

    Energy Technology Data Exchange (ETDEWEB)

    Mirenda, Richard J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2012-08-16

    This document provides guidance for screening-level assessments of potential adverse impacts to ecological resources from release of environmental contaminants at the Los Alamos National Laboratory (LANL or the Laboratory). The methods presented are based on two objectives, namely: to provide a basis for reaching consensus with regulators, managers, and other interested parties on how to conduct screening-level ecological risk investigations at the Laboratory; and to provide guidance for ecological risk assessors under the Environmental Programs (EP) Directorate. This guidance promotes consistency, rigor, and defensibility in ecological screening investigations and in reporting those investigation results. The purpose of the screening assessment is to provide information to the risk managers so informed riskmanagement decisions can be made. This document provides examples of recommendations and possible risk-management strategies.

  19. Down syndrome screening methods in Iranian pregnant women

    Directory of Open Access Journals (Sweden)

    Azizeh Farshbaf Khalili

    2012-08-01

    Full Text Available Introduction: Down syndrome is one of the most prevalent genetic diseases. Screening methods for this syndrome are easy and safe and are recommended to all pregnant wom-en particularly mothers over 35 years of age. This study aimed to review the status of Down syndrome screening and related factors in Iranian pregnant women. Methods: This descriptive analytical study was carried out in 2011. It included 400 women who were randomly selected from those referring to Alzahra Hospital (Tabriz, Iran during their third trimester of pregnancy. Data was collected through a question-naire whose reliability and validity have been approved. The data was analyzed by chi-square test in SPSS13. Results: The results showed that while 28 and 26 women imple-mented screening tests during the first and second trimesters, respectively, only 5 sub-jects benefited from both (integrated test. Chi-square test showed significant correla-tions between the implementation of screening methods and age, education level, in-come, and the location of prenatal care (p < 0.05. Conclusion: The findings of the present study showed women to poorly implement Down syndrome screening methods. Therefore, the necessity of providing appropriate educational programs for health staff and mothers seems undeniable. Moreover, paying attention to the related factors such as income, educational level, and adequate training of mothers during pregnancy is essential.

  20. LC-MS (/MS) in clinical toxicology screening methods.

    Science.gov (United States)

    Viette, Véronique; Hochstrasser, Denis; Fathi, Marc

    2012-01-01

    Toxicological screening is the analysis of biological samples to detect and identify unknown compounds. The high selectivity and sensitivity of liquid chromatography (LC) coupled to mass spectrometry (MS) or tandem mass spectrometry (MS/MS) technology provide an attractive alternative to the current methods (LC-UV, GC/MS, etc.). For these reasons, an increasing number of applications are being published. This paper is a brief overview of LC-MS(/MS) screening methods developed for clinical toxicology in recent years. Various sample treatments, chromatographic separations and detection by mass spectrometry can be combined to obtain screening methods adapted to the constraints and needs of clinical toxicology laboratories. Currently the techniques are in the hands of specialists, mainly in academic institutions. However, the evolution in technology should allow application of these techniques as a tool in toxicology laboratories, thus allowing a more widespread exploitation of their potential.

  1. Hanford ferrocyanide waste chemistry and reactivity preliminary catalyst and initiator screening studies

    International Nuclear Information System (INIS)

    Scheele, R.D.; Bryan, S.A.; Johnston, J.W.; Tingey, J.M.; Burger, L.L.; Hallen, R.T.

    1992-05-01

    During the 1950s, ferrocyanide was used to scavenge radiocesium from aqueous nitrate-containing Hanford wastes. During the production of defense materials and while these wastes were stored in high-level waste tanks at the Hanford Site, some of these wastes were likely mixed with other waste constituents and materials. Recently, Pacific Northwest Laboratory (PNL) was commissioned by Westinghouse Hanford Company (WHC) to investigate the chemical reactivity of these ferrocyanide-bearing wastes. Because of known or potential thermal reactivity hazards associated with ferrocyanide- and nitrate-bearing wastes, and because of the potential for different materials to act as catalysts or initiators of the reactions about which there is concern, we at PNL have begun investigating the effects of the other potential waste constituents. This report presents the results of a preliminary screening study to identify classes of materials that might be in the Hanford high-level waste tanks and that could accelerate or reduce the starting temperature of the reaction(s) of concern. We plan to use the resulted of this study to determine which materials or class of materials merit additional research

  2. Preliminary Screening Assessment of the Potential Impact of the Phosphate Fertilizer Industry on Wildlife

    Energy Technology Data Exchange (ETDEWEB)

    Vandenhove, Hildegarde; Sweeck, Lieve; Vives i Batlle, Jordi [SCK.CEN, Belgian Nuclear Research Centre, Boeretang 200, B-2400 Mol (Belgium)

    2014-07-01

    The activities of the phosphate industry may lead to enhanced levels of naturally occurring radioactivity in terrestrial and freshwater ecosystems. We here perform a preliminary environmental risk assessment (ERA) of the activities of the phosphate industry (phosphate ore mining, phosphate fertilizer factories, phosphate export platforms). We evaluated the environmental impact of 5 phosphate fertilizer plants (located in Belgium, Spain, Syria, Egypt, Brazil) and one phosphate-mine and phosphate-export platforms in the harbour(both located in Syria). These sites were selected because of the enhanced concentrations of naturally occurring radionuclides in the surrounding environments. The ERICA non-human biota assessment tool was used to predict radiation dose rates to the reference organisms and associated risks. Reference organisms were those assigned as default by the ERICA Tool. Potential impact is expressed as a risk quotient (RQ) based on a radiation screening value of 10 μGy h{sup -1}. If RQ ≤ 1, the environment is unlikely at risk and further radiological assessment is deemed not to be required. For all the cases assessed, RQ exceeded 1 for at least one of the reference organisms. {sup 226}Ra or {sup 210}Po were generally the highest contributors to the dose. The aquatic ecosystems in the vicinity of the phosphate fertilizer plants in Tessenderlo (Belgium), Huelva (Spain), Goias (Brazil) and the terrestrial environment around the phosphate mine in Palmyra (Syria) are the ecosystems predicted most at risk. (authors)

  3. New method of scoliosis assessment: preliminary results using computerized photogrammetry.

    Science.gov (United States)

    Aroeira, Rozilene Maria Cota; Leal, Jefferson Soares; de Melo Pertence, Antônio Eustáquio

    2011-09-01

    A new method for nonradiographic evaluation of scoliosis was independently compared with the Cobb radiographic method, for the quantification of scoliotic curvature. To develop a protocol for computerized photogrammetry, as a nonradiographic method, for the quantification of scoliosis, and to mathematically relate this proposed method with the Cobb radiographic method. Repeated exposure to radiation of children can be harmful to their health. Nevertheless, no nonradiographic method until now proposed has gained popularity as a routine method for evaluation, mainly due to a low correspondence to the Cobb radiographic method. Patients undergoing standing posteroanterior full-length spine radiographs, who were willing to participate in this study, were submitted to dorsal digital photography in the orthostatic position with special surface markers over the spinous process, specifically the vertebrae C7 to L5. The radiographic and photographic images were sent separately for independent analysis to two examiners, trained in quantification of scoliosis for the types of images received. The scoliosis curvature angles obtained through computerized photogrammetry (the new method) were compared to those obtained through the Cobb radiographic method. Sixteen individuals were evaluated (14 female and 2 male). All presented idiopathic scoliosis, and were between 21.4 ± 6.1 years of age; 52.9 ± 5.8 kg in weight; 1.63 ± 0.05 m in height, with a body mass index of 19.8 ± 0.2. There was no statistically significant difference between the scoliosis angle measurements obtained in the comparative analysis of both methods, and a mathematical relationship was formulated between both methods. The preliminary results presented demonstrate equivalence between the two methods. More studies are needed to firmly assess the potential of this new method as a coadjuvant tool in the routine following of scoliosis treatment.

  4. Surface electromyography as a screening method for evaluation of dysphagia and odynophagia

    Science.gov (United States)

    Vaiman, Michael; Eviatar, Ephraim

    2009-01-01

    Objective Patients suspected of having swallowing disorders, could highly benefit from simple diagnostic screening before being referred to specialist evaluations. The article analyzes various instrumental methods of dysphagia assessment, introduces surface electromyography (sEMG) to carry out rapid assessment of such patients, and debates proposed suggestions for sEMG screening protocol in order to identify abnormal deglutition. Data sources Subject related books and articles from 1813 to 2007 were obtained through library search, MEDLINE (1949–2007) and EMBASE (1975–2007). Methods Specifics steps for establishing the protocol for applying the technique for screening purposes (e.g., evaluation of specific muscles), the requirements for diagnostic sEMG equipment, the sEMG technique itself, and defining the tests suitable for assessing deglutition (e.g., saliva, normal, and excessive swallows and uninterrupted drinking of water) are presented in detail. SEMG is compared with other techniques in terms of cost, timing, involvement of radiation, etc. Results According to the published data, SEMG of swallowing is a simple and reliable method for screening and preliminary differentiation among dysphagia and odynophagia of various origins. This noninvasive radiation-free examination has a low level of discomfort, and is simple, time-saving and inexpensive to perform. The major weakness of the method seems to be inability for precise diagnostic of neurologically induced dysphagia. Conclusion With standardization of the technique and an established normative database, sEMG might serve as a reliable screening method for optimal patient management but cannot serve for proper investigation of neurogenic dysphagia. PMID:19232090

  5. Neuropsychological screening as a standard of care during discharge from psychiatric hospitalization: the preliminary psychometrics of the CNS Screen.

    Science.gov (United States)

    Levy, Boaz; Celen-Demirtas, Selda; Surguladze, Tinatin; Eranio, Sara; Ellison, James

    2014-03-30

    Cost-prohibitive factors currently prevent a warranted integration of neuropsychological screenings into routine psychiatric evaluations, as a standard of care. To overcome this challenge, the current study examined the psychometric properties of a new computerized measure-the CNS Screen. One hundred and twenty six psychiatric inpatients completed the CNS Screen, the Montreal Cognitive Assessment (MoCA), and the Quick Inventory of Depressive Symptomatology-Self Rated (QIDS-SR₁₆) on the day of hospital discharge. Statistical analysis established convergent validity with a moderate correlation between the self-administered CNS Screen and the clinician-administered MoCA (r=0.64). Discriminant validity was implicated by a non-significant correlation with the QIDS-SR₁₆. Concurrent validity was supported by a moderate, negative correlation with patients' age (r=-0.62). In addition, consistent with previous findings, patients with psychotic disorders exhibited significantly poorer performance on the CNS Screen than patients with a mood disorder. Similarly, patients with a formal disability status scored significantly lower than other patients. The CNS Screen was well tolerated by all patients. With further development, this type of measure may provide a cost-effective approach to expanding neuropsychological screenings on inpatient psychiatric units. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  6. Using the Screened Coulomb Potential to Illustrate the Variational Method

    Science.gov (United States)

    Zuniga, Jose; Bastida, Adolfo; Requena, Alberto

    2012-01-01

    The screened Coulomb potential, or Yukawa potential, is used to illustrate the application of the single and linear variational methods. The trial variational functions are expressed in terms of Slater-type functions, for which the integrals needed to carry out the variational calculations are easily evaluated in closed form. The variational…

  7. Efficacy of screening methods used in breeding for black pod ...

    African Journals Online (AJOL)

    The disease affects the pods, beans, flower cushions, leaves, stems and roots. The objective of this study was to evaluate the efficacy of resistance screening methods used in breeding black pod disease resistance in cocoa. The resistance of cocoa leaves and pods to Phytophthora palmivora was investigated in twenty five ...

  8. In vitro screening methods for assessing plant disease resistance

    International Nuclear Information System (INIS)

    Lebeda, A.; Svabova, L.

    2010-01-01

    A combination of biotechnological and phytopathological techniques provides an alternative approach to classical resistance breeding methods. Such techniques have been increasingly used since the 1980s, in parallel with the progress in plant biotechnology. In the approach of resistance screening and selection in vitro, both experimental objects, i.e., the plant and the pathogen, must first be transferred to in vitro conditions, and finally, the plant material must be transferred back to in vivo conditions and adapted to the outside settings. Specific attention must be paid to the methods of pathogen preparation for use in screening and selection in vitro. The selection agents are classified according to their origin, the methods of preparation, nature and content of active substances, and effective utilisation for screening or selection in vitro. Basic principles and methodological aspects of the in vitro work (explant cultures, sources of in vitro variability, screening and selection methods, types of selection agents) as well as examples of practical applications in the breeding of different crops are critically reviewed in this chapter. (author)

  9. DEVELOPMENT OF A RISK SCREENING METHOD FOR CREDITED OPERATOR ACTIONS

    International Nuclear Information System (INIS)

    HIGGINS, J.C.; O'HARA, J.M.; LEWIS, P.M.; PERSENSKY, J.; BONGARRA, J.

    2002-01-01

    DEVELOPMENT OF A RISK SCREENING METHOD FOR CREDITED OPERATOR ACTIONS. THE U.S. NUCLEAR REGULATORY COMMISSION (NRC) REVIEWS THE HUMAN FACTORS ASPECTS OF PROPOSED LICENSE AMENDMENTS THAT IMPACT HUMAN ACTIONS THAT ARE CREDITED IN A PLANTS SAFETY ANALYSIS. THE STAFF IS COMMITTED TO A GRADED APPROACH TO THESE REVIEWS THAT FOCUS RESOURCES ON THE MOST RISK IMPORTANT CHANGES. THEREFORE, A RISK INFORMED SCREENING METHOD WAS DEVELOPED BASED ON AN ADAPTATION OF EXISTING GUIDANCE FOR RISK INFORMED REGULATION AND HUMAN FACTORS. THE METHOD USES BOTH QUANTITATIVE AND QUALITATIVE INFORMATION TO DIVIDE THE AMENDMENT REQUESTS INTO DIFFERENT LEVELS OF REVIEW. THE METHOD WAS EVALUATED USING A VARIETY OF TESTS. THIS PAPER WILL SUMMARIZE THE DEVELOPMENT OF THE METHODOLOGY AND THE EVALUATIONS THAT WERE PERFORMED TO VERIFY ITS USEFULNESS

  10. Preliminary phytochemical screening, Antibacterial potential and GC-MS analysis of two medicinal plant extracts.

    Science.gov (United States)

    Vijayaram, Seerangaraj; Kannan, Suruli; Saravanan, Konda Mani; Vasantharaj, Seerangaraj; Sathiyavimal, Selvam; P, Palanisamy Senthilkumar

    2016-05-01

    The presence study was aimed to catalyze the primary metabolites and their confirmation by using GC-MS analysis and antibacterial potential of leaf extract of two important medicinal plant viz., Eucalyptus and Azadirachta indica. The antibacterial potential of the methanol leaf extract of the studied species was tested against Escherichia coli, Pseudomonas aeruginosa, Klebsiellap neumoniae, Streptococcus pyogens, Staphylococcus aureus using by agar well diffusion method. The higher zone of inhibition (16mm) was observed against the bacterium Pseudomonas aeruginosa at 100μl concentration of methanol leaf extract. Preliminary phytochemical analysis of studied species shows that presence of phytochemical compounds like steroids, phenolic compounds and flavonoids. GC-MS analysis confirms the occurrence of 20 different compounds in the methanol leaf extract of the both studied species.

  11. A deep learning method for early screening of lung cancer

    Science.gov (United States)

    Zhang, Kunpeng; Jiang, Huiqin; Ma, Ling; Gao, Jianbo; Yang, Xiaopeng

    2018-04-01

    Lung cancer is the leading cause of cancer-related deaths among men. In this paper, we propose a pulmonary nodule detection method for early screening of lung cancer based on the improved AlexNet model. In order to maintain the same image quality as the existing B/S architecture PACS system, we convert the original CT image into JPEG format image by analyzing the DICOM file firstly. Secondly, in view of the large size and complex background of CT chest images, we design the convolution neural network on basis of AlexNet model and sparse convolution structure. At last we train our models on the software named DIGITS which is provided by NVIDIA. The main contribution of this paper is to apply the convolutional neural network for the early screening of lung cancer and improve the screening accuracy by combining the AlexNet model with the sparse convolution structure. We make a series of experiments on the chest CT images using the proposed method, of which the sensitivity and specificity indicates that the method presented in this paper can effectively improve the accuracy of early screening of lung cancer and it has certain clinical significance at the same time.

  12. Preliminary screening analysis of the off-site environment downstream of the US Department of Energy Oak Ridge Reservation

    International Nuclear Information System (INIS)

    Blaylock, B.G.; Hoffman, F.O.; Frank, M.L.

    1990-01-01

    Operations and waste disposal activities at the Y-12 Plant, the Oak Ridge National Laboratory (ORNL), and the Oak Ridge Gaseous Diffusion Plant (ORGDP), located on the US Department of Energy (DOE) Oak Ridge Reservation (ORR) in eastern Tennessee, have introduced airborne, liquid, and solid wastes into the surrounding environment. Some of these wastes may affect off-site areas by entering local streams that ultimately drain into the Clinch River. Previously reported concentrations of radionuclides, metals, and organic compounds in water, sediment, and biota of the Clinch River and Watts Bar Reservoir suggest the presence of contaminants of possible concern to the protection of human health and the environment. A preliminary screening was conducted of contaminants in the off-site surface water environments downstream of the DOE ORR. This screening analysis represents part of a scoping phase of the Clinch River Resource Conservation and Recovery Facilities Investigation (CRRFI). The purpose of this preliminary screening analysis is to use existing data on off-site contaminant concentrations to identify and prioritize potential contaminants of concern for further evaluation and investigation. The primary objective of this screening analysis is to ensure that CRRFI sampling and analysis efforts focus on those contaminants that may possibly contribute to human health or environmental risk. 8 refs., 3 figs., 6 tabs

  13. A novel test tube method of screening for hemoglobin E.

    Science.gov (United States)

    Tatu, T; Kasinrerk, W

    2012-02-01

    Hemoglobin (Hb) E is a β-structural variant common worldwide. This Hb disorder can form a compound heterozygous state with the β-thalassemia gene, leading to life-threatening hereditary hemolytic anemia, HbE/β-thalassemia. Screening of HbE has proven to be a challenging practice in prevention and control of the HbE/β-thalassemia. A novel test tube method for HbE screening using diethyl aminoethyl (DEAE)-cellulose resin was described. With the developed system, HbE/A(2) did not bind to the resin and remained dissolved in the supernatant, whereas other Hbs completely bound to the resin. The red color of the supernatant observed in the test tube indicated the presence of HbE. Colorless or markedly pale color of the supernatant indicates the absence of HbE. Accuracy and efficiency of the established method in detecting HbE was comparable with the standard cellulose acetate electrophoresis method. The developed method is cheap and simple with no requirement of sophisticated equipment. The reagent could be stored at 4 °C for up to 5 months. Hemolysate samples aged up to 5 months were still suitable for this test. The described novel test tube method could be an alternative method of mass population screening for HbE, particularly in small health care facilities. © 2011 Blackwell Publishing Ltd.

  14. Evaluating two methods of digital photography in retinopathy screening

    Directory of Open Access Journals (Sweden)

    Li Chen

    2018-02-01

    Full Text Available AIM:To evaluate the advantages of non-mydriatic fundus photography(NMFCSand mydriatic fundus photography(MFCSas eye-bottom screening and diagnosis methods in compared with gold standard fluorescein fundus angiography(FFA. METHODS: A total of 276 patients which involved in Chronic Diabetes Management Achieves within 4 streets of Pudong District Shanghai, were enrolled for diabetic retinopathy(DRexamination including NMFCS, MFCS and FFA. These DR examinations were proceeded after vision, slit-lamp and dioptroscopy tests, and reported by professionals. For those with suspicious fundus diseases, we would make appointments with specialist for further treatment. RESULTS: A total of 1104 colorful fundus images, and 1056 images(95.65%could be used to analyze. There were 408 appreciable images, 116 basically appreciable images and 28 unusable images in 552 NMFCS images. In addition, there were 432 appreciable images, 100 basically appreciable images and 20 unusable images in 552 MFCS images. There was no significant differences between NMFCS and MFCS(P>0.05. Compared with FFA with DRⅠ as the critical value, the specificity of digital photography for NMFCS was 95.71%, the sensitivity was 93.56%; however, MFCS are 95.43% and 98.02%. There was no statistically significant difference between the two screening methods(P>0.05. Compared with FFA with DRⅡ as the critical value, the specificity of digital photography for NMFCS was 95.35% and the sensitivity was 93.44%; however, for MFCS were 95.81% and 98.36%. There was no statistically significant difference between the two screening methods(P>0.05. CONCLUSION: Both NMFCS and MFCS could be used for the diagnosis and screening for eye diseases. NMFCS is easier and faster for digital photography, which is suitable for mass screening. MFCS is more likely to provide detailed information about the follow-up of the disease.

  15. Automatic teleaudiometry: a low cost method to auditory screening

    Directory of Open Access Journals (Sweden)

    Campelo, Victor Eulálio Sousa

    2010-03-01

    Full Text Available Introduction: The auditory screening' benefits has been demonstrated, however these programs has been restricted to the big centers. Objectives: (a Developing a auditory screening method to distance; (b Testing its accuracy and comparing to the screening audiometry test (AV. Method: The teleaudiometry (TA, consists in a developed software, installed in a computer with phone TDH39. It was realized a study in series in 73 individuals between 17 and 50 years, being 57,%% of the female sex, they were randomly selected between patients and companions of the Hospital das Clínicas. Before were subjected to a symptom questionnaire and otoscopy, the individuals realized the tests of TA AV, with scanning in 20dB in the frequencies of 1,2 and 4kHz following the ASHA (1997 protocol and to the gold standard test of audiometry of pure tones in soundproof booth in aleatory order. Results: the TA has lasted average 125+11s and the AV 65+18s. 69 individuals (94,5% declaring to be found difficult or very easy to performing the TA and 61 (83,6% have considered easy or very easy the AV. The accuracy results of TA and AV were respectively: sensibility (86,7% / 86,7%, specificity (75,9%/ 72,4% and negative predictive value (95,7% / 95,5%, positive predictive value (48,1% / 55,2%. Conclusion: The teleaudiometry has showed a good option as an auditory screening method, presenting accuracy next to screening audiometry. In comparison with this method, the teleaudiometry has presented a similar sensibility, major specificity, negative predictive value and endurance time and, under positive predictive value.

  16. Preliminary Groundwater Assessment using Electrical Method at Quaternary Deposits Area

    Science.gov (United States)

    Hazreek, Z. A. M.; Raqib, A. G. A.; Aziman, M.; Azhar, A. T. S.; Khaidir, A. T. M.; Fairus, Y. M.; Rosli, S.; Fakhrurrazi, I. M.; Izzaty, R. A.

    2017-08-01

    Alternative water sources using groundwater has increasingly demand in recent years. In the past, proper and systematic study of groundwater potential was varies due to several constraints. Conventionally, tube well point was drilled based on subjective judgment of several parties which may lead to the uncertainties of the project success. Hence, this study performed an electrical method to investigate the groundwater potential at quaternary deposits area particularly using resistivity and induced polarization technique. Electrical method was performed using ABEM SAS4000 equipment based on pole dipole array and 2.5 m electrode spacing. Resistivity raw data was analyzed using RES2DINV software. It was found that groundwater was able to be detected based on resistivity and chargeability values which varied at 10 - 100 Ωm and 0 - 1 ms respectively. Moreover, suitable location of tube well was able to be proposed which located at 80 m from the first survey electrode in west direction. Verification of both electrical results with established references has shown some good agreement thus able to convince the result reliability. Hence, the establishment of electrical method in preliminary groundwater assessment was able to assist several parties in term groundwater prospective at study area which efficient in term of cost, time, data coverage and sustainability.

  17. [Screening methods for mild cognitive impairment in primary care].

    Science.gov (United States)

    Freire Pérez, Alberto

    2017-06-01

    Diagnosis of mild cognitive impairment (MCI) is always clinical and screening methods only indicate that the patient has a higher risk of this condition. In MCI, there is a slight decline in some cognitive abilities that does not affect activities of daily living and therefore does not produce social or occupational disability. The definitive diagnosis of MCI requires a considerable time investment that is very rarely possible to provide in primary care (PC) consultations. Hence the need for PC physicians to employ rapid and simple screening methods (brief cognitive assessment -BCA-) that allow objective identification of patients likely to have MCI in a few minutes. This article reviews the BCA tools that can truly be applied in less than 10 minutes. The phototest is a brief screening tool that is easy to use and interpret by physicians and is well accepted by patients. Consequently, it is one of the most useful tests in PC for screening of both MCI and dementia. In addition to BCA, instrumental activities of daily living scales should also be applied to differentiate MCI from dementia. Copyright © 2017 Sociedad Española de Geriatría y Gerontología. Publicado por Elsevier España, S.L.U. All rights reserved.

  18. Intravenous DSA as a screening method for cerebral aneurysms

    International Nuclear Information System (INIS)

    Fukaya, Hiroyuki; Sunami, Kaneo; Hoshi, Seiichiro; Komiya, Hirokazu; Saeki, Naokatsu.

    1990-01-01

    Intravenous DSA (IVDSA) was evaluated as a screening method for cerebral aneurysms. It was performed 390 times in 372 cases. Clinically useful images were obtained in 94.1% in all examinations. Nineteen aneurysms were visualized in cerebral angiography among 21 cases with SAH or 3rd nerve palsy, whereas in IVDSA 15 aneurysms were noted. Aneurysms not visualized in IVDSA were all 4 mm or less in size. Therefore, aneurysms, more than 4 mm in size, which have higher risks for rupture, were detectable in IVDSA. Based on these findings, IVDSA is considered to be clinically useful in screening for aneurysms. In all 372 cases, 33 aneurysms were suspected in IVDSA findings, whereas in cerebral angiography 21 of them turned to be aneurysms. Such 12 false positive cases were distributed mainly at anterior communicating and middle cerebral arteries. Improvement of image resolution, avoidance of vessel overlapping and proper selection of screened cases should be investigated for further development of this screening method. (author)

  19. Modeling granular phosphor screens by Monte Carlo methods

    International Nuclear Information System (INIS)

    Liaparinos, Panagiotis F.; Kandarakis, Ioannis S.; Cavouras, Dionisis A.; Delis, Harry B.; Panayiotakis, George S.

    2006-01-01

    The intrinsic phosphor properties are of significant importance for the performance of phosphor screens used in medical imaging systems. In previous analytical-theoretical and Monte Carlo studies on granular phosphor materials, values of optical properties, and light interaction cross sections were found by fitting to experimental data. These values were then employed for the assessment of phosphor screen imaging performance. However, it was found that, depending on the experimental technique and fitting methodology, the optical parameters of a specific phosphor material varied within a wide range of values, i.e., variations of light scattering with respect to light absorption coefficients were often observed for the same phosphor material. In this study, x-ray and light transport within granular phosphor materials was studied by developing a computational model using Monte Carlo methods. The model was based on the intrinsic physical characteristics of the phosphor. Input values required to feed the model can be easily obtained from tabulated data. The complex refractive index was introduced and microscopic probabilities for light interactions were produced, using Mie scattering theory. Model validation was carried out by comparing model results on x-ray and light parameters (x-ray absorption, statistical fluctuations in the x-ray to light conversion process, number of emitted light photons, output light spatial distribution) with previous published experimental data on Gd 2 O 2 S:Tb phosphor material (Kodak Min-R screen). Results showed the dependence of the modulation transfer function (MTF) on phosphor grain size and material packing density. It was predicted that granular Gd 2 O 2 S:Tb screens of high packing density and small grain size may exhibit considerably better resolution and light emission properties than the conventional Gd 2 O 2 S:Tb screens, under similar conditions (x-ray incident energy, screen thickness)

  20. Simple Screening Methods for Drought and Heat Tolerance in Cowpea

    International Nuclear Information System (INIS)

    Singh, B. B.

    2000-10-01

    Success in breeding for drought tolerance has not been as pronounced as for other traits. This is partly due to lack of simple, cheap and reliable screening methods to select drought tolerant plants/progenies from the segregating populations and partly due to complexity of factors involved in drought tolerance. Measuring drought tolerance through physiological parameters is expensive, time consuming and difficult to use for screening large numbers of lines and segregating populations. Since several factors/mechanisms (in shoot and root) operate independently and/or jointly to enable plants to cope with drought stress, drought tolerance appears as a complex trait. However, if these factors/mechanisms can be separated and studied individually, the components leading to drought tolerance will appear less complex and may be easy to manipulate by breeders. We have developed a simple box screening method for shoot drought tolerance in cowpea, which eliminates the effects of roots and permits non-destructive visual identification of shoot dehydration tolerance. We have also developed a 'root-box pin-board' method to study two dimensional root architecture of individual plants. Using these methods, we have identified two mechanisms of shoot drought tolerance in cowpea which are controlled by single dominant genes and major difference for root architecture among cowpea varieties. Combining deep and dense root system with shoot dehydration tolerance results into highly drought tolerant plants

  1. Method of preliminary localization of the iris in biometric access control systems

    Science.gov (United States)

    Minacova, N.; Petrov, I.

    2015-10-01

    This paper presents a method of preliminary localization of the iris, based on the stable brightness features of the iris in images of the eye. In tests on images of eyes from publicly available databases method showed good accuracy and speed compared to existing methods preliminary localization.

  2. Two cytological methods for screening for cervical cancer

    DEFF Research Database (Denmark)

    Kirschner, B.; Simonsen, K.; Junge, J.

    2008-01-01

    -based cytology. MATERIALS AND METHODS: In 2002, the Department of Pathology, Hvidovre Hospital changed over from the conventional Papanicolaou smear screening method to SurePath liquid-based cytology. This article is based on a retrospective comparison on data from the population screening programme for cervical...... cancer in the Municipality of Copenhagen. RESULTS: The number of tests with the diagnosis of "normal cells" decreased 1% after the conversion to liquid-based cytology, whilst the number of tests with "atypical cells" and "cells suspicious for malignancy" increased by 64.3% and 41.2% respectively...... of cervical precancerous lesions with liquid-based cytology. Follow-up histology showed no increase of false positive tests, whilst the share of tests which were "unsatisfactory for evaluation" decreased significantly. Overall, the liquid-based technique would seem to have several advantages compared...

  3. A novel accelerated oxidative stability screening method for pharmaceutical solids.

    Science.gov (United States)

    Zhu, Donghua Alan; Zhang, Geoff G Z; George, Karen L S T; Zhou, Deliang

    2011-08-01

    Despite the fact that oxidation is the second most frequent degradation pathway for pharmaceuticals, means of evaluating the oxidative stability of pharmaceutical solids, especially effective stress testing, are still lacking. This paper describes a novel experimental method for peroxide-mediated oxidative stress testing on pharmaceutical solids. The method utilizes urea-hydrogen peroxide, a molecular complex that undergoes solid-state decomposition and releases hydrogen peroxide vapor at elevated temperatures (e.g., 30°C), as a source of peroxide. The experimental setting for this method is simple, convenient, and can be operated routinely in most laboratories. The fundamental parameter of the system, that is, hydrogen peroxide vapor pressure, was determined using a modified spectrophotometric method. The feasibility and utility of the proposed method in solid form selection have been demonstrated using various solid forms of ephedrine. No degradation was detected for ephedrine hydrochloride after exposure to the hydrogen peroxide vapor for 2 weeks, whereas both anhydrate and hemihydrate free base forms degraded rapidly under the test conditions. In addition, both the anhydrate and the hemihydrate free base degraded faster when exposed to hydrogen peroxide vapor at 30°C under dry condition than at 30°C/75% relative humidity (RH). A new degradation product was also observed under the drier condition. The proposed method provides more relevant screening conditions for solid dosage forms, and is useful in selecting optimal solid form(s), determining potential degradation products, and formulation screening during development. Copyright © 2011 Wiley-Liss, Inc.

  4. Circling motion and screen edges as an alternative input method for on-screen target manipulation.

    Science.gov (United States)

    Ka, Hyun W; Simpson, Richard C

    2017-04-01

    To investigate a new alternative interaction method, called circling interface, for manipulating on-screen objects. To specify a target, the user makes a circling motion around the target. To specify a desired pointing command with the circling interface, each edge of the screen is used. The user selects a command before circling the target. To evaluate the circling interface, we conducted an experiment with 16 participants, comparing the performance on pointing tasks with different combinations of selection method (circling interface, physical mouse and dwelling interface) and input device (normal computer mouse, head pointer and joystick mouse emulator). A circling interface is compatible with many types of pointing devices, not requiring physical activation of mouse buttons, and is more efficient than dwell-clicking. Across all common pointing operations, the circling interface had a tendency to produce faster performance with a head-mounted mouse emulator than with a joystick mouse. The performance accuracy of the circling interface outperformed the dwelling interface. It was demonstrated that the circling interface has the potential as another alternative pointing method for selecting and manipulating objects in a graphical user interface. Implications for Rehabilitation A circling interface will improve clinical practice by providing an alternative pointing method that does not require physically activating mouse buttons and is more efficient than dwell-clicking. The Circling interface can also work with AAC devices.

  5. Development and preliminary validation of a Family Nutrition and Physical Activity (FNPA screening tool

    Directory of Open Access Journals (Sweden)

    Eisenmann Joey C

    2009-03-01

    Full Text Available Abstract Background Parents directly influence children's physical activity and nutrition behaviors and also dictate the physical and social environments that are available to their children. This paper summarizes the development of an easy to use screening tool (The Family Nutrition and Physical Activity (FNPA Screening Tool designed to assess family environmental and behavioral factors that may predispose a child to becoming overweight. Methods The FNPA instrument was developed using constructs identified in a comprehensive evidence analysis conducted in collaboration with the American Dietetics Association. Two or three items were created for each of the ten constructs with evidence grades of II or higher. Parents of first grade students from a large urban school district (39 schools were recruited to complete the FNPA screening tool and provide permission to link results to BMI data obtained from trained nurses in each school. A total of 1085 surveys were completed out of the available sample of 2189 children in the district. Factor analysis was conducted to examine the factor structure of the scale. Mixed model analyses were conducted on the composite FNPA score to determine if patterns in home environments and behaviors matched some of the expected socio-economic (SES and ethnic patterns in BMI. Correlations among FNPA constructs and other main variables were computed to examine possible associations among the various factors. Finally, logistic regression was used to evaluate the construct validity of the FNPA scale. Results Factor analyses revealed the presence of a single factor and this unidimensional structure was supported by the correlation analyses. The correlations among constructs were consistently positive but the total score had higher correlations with child BMI than the other individual constructs. The FNPA scores followed expected demographic patterns with low income families reporting lower (less favorable scores than

  6. Preliminary screening and identification of the hepatocarcinoma cell-binding peptide

    International Nuclear Information System (INIS)

    Zhu Xiaohua; Wu Hua

    2004-01-01

    Objective: To explore the feasibility of screening and isolating homing peptides that bind specifically, or preferentially, to hepatocarcinoma cells using phage display random peptide library and to develop a new peptide which may be potentially used as targeting delivery carrier in the biological targeted diagnosis or therapy for liver cancer. Methods: A 12-mer peptide phage display library was used to screen and isolate peptides that bind to human hepatocarcinoma cells, and four rounds of subtractive panning were carried out with the human hepatocarcinoma cell line HepG2 as the target. The affinities of selected phage clones for human hepatocarcinoma cells were determined with enzyme-linked immunosorbent assay (ELISA) and compared with that to human liver cell and other tumor cells of different tissue origins, respectively. In addition, the binding site in the tumor cells was observed with immunofluorescence analysis under confocal light microscopy. The amino acid sequences of phages that bind HepG2 specifically were deduced through DNA sequencing. Based on the results of DNA sequence, a 16-mer peptide (WH16) was designed and synthesized. Binding ability of the new peptide, WH16, was determined with competitive inhibition test. Results: After four rounds of panning, the phages that were bound to and internalized in human hepatocarcinoma cells were isolated. ELISA and immunofluorescence analysis confirmed the affinity of these phages for hepatocarcinoma cells. 56.67%(17/30) of the isolated phages displayed repeated sequence FLLEPHLMDTSM, and FLEP was defined as conservative motif . Binding of the selected phage to HepG2 cells was inhibited by synthesized peptide WH16, that strongly support that cellular binding of the phage is mediated through its displayed peptide, and WH16 can also bind to HepG2. Conclusions: It is feasible to screen and isolate homing peptides that bind specifically, or preferentially, to hepatocarcinoma cells using phage display random peptide

  7. Preliminary screening and identification of the peptide binding to hepatocarcinoma cell

    International Nuclear Information System (INIS)

    Zhu Xiaohua; Wu Ha

    2004-01-01

    Objective: The present study was performed to screen and isolate homing peptides that bind specifically, or preferentially, to hepatocarcinoma cells using phage display of random peptide library with the purpose of developing a new peptide which may be potentially used as target delivery carrier in the biological target diagnosis or therapy for liver cancer. Methods: A peptide 12-mer phage display library was used to screen and isolate peptide that bind to human hepatocarcinoma cell, and four rounds subtractive panning were carried out with the human hepatocarcinoma cell line HepG2 as the target. The affinities of selected phage clones to human hepatocarcinoma cell were determined with ELISA and compared with human liver cell and other tumor cells of different tissue origins respectively. In addition, the binding site in the tumor cells was observed with immunofluorescence analysis under confocal light microscopy. The amino acid sequences of phages that bind HepG2 specifically were deduced though DNA sequencing. Based on the results of DNA sequence, a 16-mer peptide (WH16) was designed and synthesized. Binding ability of the new peptide WH16 was determined with competitive inhibition test. Results: After four rounds panning, the phages that bound to and internalized in human hepatocarcinoma cell were isolated. ELISA and immunofluorescence analysis confirmed the affinity of these phages to hepatpcarcinoma cells 56.57%(17/30) of the isolated phages displayed repeated sequence FLLEPHLMDTSM, and FLEP was defined as conservative motif. Binding of the selected phage to HepG2 cells was inhibited by synthesized peptide WH16, which strongly support that cellular binding of phage is mediated though its displayed peptide and WH16 can also bind to HepG2. Conclusion: It is feasible to screen and isolate homing peptides that bind specifically, or preferentially, to hepatocarcinoma cells using phage display of random peptide libraries. The sequence of peptide that can bind to

  8. Preliminary screening and identification of the hepatocarcinoma cell-binding peptide

    Energy Technology Data Exchange (ETDEWEB)

    Xiaohua, Zhu; Hua, Wu [Department of Nuclear Medicine, Tongji Hospital, Tongji Medical College, Huazhong Univ. of Science and Technology, Wuhan (China)

    2004-12-15

    Objective: To explore the feasibility of screening and isolating homing peptides that bind specifically, or preferentially, to hepatocarcinoma cells using phage display random peptide library and to develop a new peptide which may be potentially used as targeting delivery carrier in the biological targeted diagnosis or therapy for liver cancer. Methods: A 12-mer peptide phage display library was used to screen and isolate peptides that bind to human hepatocarcinoma cells, and four rounds of subtractive panning were carried out with the human hepatocarcinoma cell line HepG2 as the target. The affinities of selected phage clones for human hepatocarcinoma cells were determined with enzyme-linked immunosorbent assay (ELISA) and compared with that to human liver cell and other tumor cells of different tissue origins, respectively. In addition, the binding site in the tumor cells was observed with immunofluorescence analysis under confocal light microscopy. The amino acid sequences of phages that bind HepG2 specifically were deduced through DNA sequencing. Based on the results of DNA sequence, a 16-mer peptide (WH16) was designed and synthesized. Binding ability of the new peptide, WH16, was determined with competitive inhibition test. Results: After four rounds of panning, the phages that were bound to and internalized in human hepatocarcinoma cells were isolated. ELISA and immunofluorescence analysis confirmed the affinity of these phages for hepatocarcinoma cells. 56.67%(17/30) of the isolated phages displayed repeated sequence FLLEPHLMDTSM, and FLEP was defined as conservative motif . Binding of the selected phage to HepG2 cells was inhibited by synthesized peptide WH16, that strongly support that cellular binding of the phage is mediated through its displayed peptide, and WH16 can also bind to HepG2. Conclusions: It is feasible to screen and isolate homing peptides that bind specifically, or preferentially, to hepatocarcinoma cells using phage display random peptide

  9. Preliminary screening and identification of the peptide binding to hepatocarcinoma cell

    Energy Technology Data Exchange (ETDEWEB)

    Xiaohua, Zhu; Ha, Wu [Department of Nuclear Medicine, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China)

    2004-07-01

    Objective: The present study was performed to screen and isolate homing peptides that bind specifically, or preferentially, to hepatocarcinoma cells using phage display of random peptide library with the purpose of developing a new peptide which may be potentially used as target delivery carrier in the biological target diagnosis or therapy for liver cancer. Methods: A peptide 12-mer phage display library was used to screen and isolate peptide that bind to human hepatocarcinoma cell, and four rounds subtractive panning were carried out with the human hepatocarcinoma cell line HepG2 as the target. The affinities of selected phage clones to human hepatocarcinoma cell were determined with ELISA and compared with human liver cell and other tumor cells of different tissue origins respectively. In addition, the binding site in the tumor cells was observed with immunofluorescence analysis under confocal light microscopy. The amino acid sequences of phages that bind HepG2 specifically were deduced though DNA sequencing. Based on the results of DNA sequence, a 16-mer peptide (WH16) was designed and synthesized. Binding ability of the new peptide WH16 was determined with competitive inhibition test. Results: After four rounds panning, the phages that bound to and internalized in human hepatocarcinoma cell were isolated. ELISA and immunofluorescence analysis confirmed the affinity of these phages to hepatpcarcinoma cells 56.57%(17/30) of the isolated phages displayed repeated sequence FLLEPHLMDTSM, and FLEP was defined as conservative motif. Binding of the selected phage to HepG2 cells was inhibited by synthesized peptide WH16, which strongly support that cellular binding of phage is mediated though its displayed peptide and WH16 can also bind to HepG2. Conclusion: It is feasible to screen and isolate homing peptides that bind specifically, or preferentially, to hepatocarcinoma cells using phage display of random peptide libraries. The sequence of peptide that can bind to

  10. Trojan Horse Method: A tool to explore electron screening effect

    Energy Technology Data Exchange (ETDEWEB)

    Pizzone, R G; Spitaleri, C; Cherubini, S; Cognata, M La; Lamia, L; Romano, S; Sergi, M L [Laboratori Nazionali del Sud-INFN, Catania (Italy) and Dipartimento di Metodologie Fisiche e Chimiche per l' Ingegneria, Universita di Catania, Catania (Italy); Rolfs, C; Strieder, F [Ruhr Universitaet Bochum (Germany); Burjan, V; Kroha, V; Mrazek, J [Cyclotron Institute, Academy of Science, Rez (Czech Republic); Li, C; Wen, Q; Zhou, S [CIAE, Beijing (China); Tumino, A, E-mail: rgpizzone@lns.infn.i [Universita Kore, Erma (Italy)

    2010-01-01

    Owing the presence of the Coulomb barrier at astrophysically relevant energies, it is very difficult, or sometimes impossible to measure reaction rates for charged particle induced reactions. Moreover due to the presence of the electron screening effect in direct measurements, the relevant nuclear input for astrophysics, i.e. the bare nucleus S(E)-factor, can hardly be extracted. This is why different indirect techniques are being used along with direct measurements. The THM is an unique: indirect technique which allows one to measure reactions cross sections of astrophysical interest down the thermal energies typical of the different scenarios. The basic principle and a review of the main applications of the Trojan Horse Method are given. The applications aiming at the extraction of the bare S{sub b}(E) astrophysical factor and electron screening potentials U{sub e} for several two body processes are discussed.

  11. Risk Assessment of Healthcare Waste by Preliminary Hazard Analysis Method

    Directory of Open Access Journals (Sweden)

    Pouran Morovati

    2017-09-01

    Full Text Available Introduction and purpose: Improper management of healthcare waste (HCW can pose considerable risks to human health and the environment and cause serious problems in developing countries such as Iran. In this study, we sought to determine the hazards of HCW in the public hospitals affiliated to Abadan School of Medicine using the preliminary hazard analysis (PHA method. Methods: In this descriptive and analytic study, health risk assessment of HCW in government hospitals affiliated to Abadan School of Medicine (4 public hospitals was carried out by using PHA in the summer of  2016. Results: We noted the high risk of sharps and infectious wastes. Considering the dual risk of injury and disease transmission, sharps were classified in the very high-risk group, and pharmaceutical and chemical and radioactive wastes were classified in the medium-risk group. Sharps posed the highest risk, while pharmaceutical and chemical wastes had the lowest risk. Among the various stages of waste management, the waste treatment stage was the most hazardous in all the studied hospitals. Conclusion: To diminish the risks associated with healthcare waste management in the studied hospitals, adequate training of healthcare workers and care providers, provision of suitable personal protective and transportation equipment, and supervision of the environmental health manager of hospitals should be considered by the authorities.  

  12. Development of a computer-based automated pure tone hearing screening device: a preliminary clinical trial.

    Science.gov (United States)

    Gan, Kok Beng; Azeez, Dhifaf; Umat, Cila; Ali, Mohd Alauddin Mohd; Wahab, Noor Alaudin Abdul; Mukari, Siti Zamratol Mai-Sarah

    2012-10-01

    Hearing screening is important for the early detection of hearing loss. The requirements of specialized equipment, skilled personnel, and quiet environments for valid screening results limit its application in schools and health clinics. This study aimed to develop an automated hearing screening kit (auto-kit) with the capability of realtime noise level monitoring to ensure that the screening is performed in an environment that conforms to the standard. The auto-kit consists of a laptop, a 24-bit resolution sound card, headphones, a microphone, and a graphical user interface, which is calibrated according to the American National Standards Institute S3.6-2004 standard. The auto-kit can present four test tones (500, 1000, 2000, and 4000 Hz) at 25 or 40 dB HL screening cut-off level. The clinical results at 40 dB HL screening cut-off level showed that the auto-kit has a sensitivity of 92.5% and a specificity of 75.0%. Because the 500 Hz test tone is not included in the standard hearing screening procedure, it can be excluded from the auto-kit test procedure. The exclusion of 500 Hz test tone improved the specificity of the auto-kit from 75.0% to 92.3%, which suggests that the auto-kit could be a valid hearing screening device. In conclusion, the auto-kit may be a valuable hearing screening tool, especially in countries where resources are limited.

  13. Screens

    OpenAIRE

    2016-01-01

    This Sixth volume in the series The Key Debates. Mutations and Appropriations in European Film Studies investigates the question of screens in the context both of the dematerialization due to digitalization and the multiplication of media screens. Scholars offer various infomations and theories of topics such as the archeology of screen, film and media theories, contemporary art, pragmatics of new ways of screening (from home video to street screening).

  14. Methods for external event screening quantification: Risk Methods Integration and Evaluation Program (RMIEP) methods development

    International Nuclear Information System (INIS)

    Ravindra, M.K.; Banon, H.

    1992-07-01

    In this report, the scoping quantification procedures for external events in probabilistic risk assessments of nuclear power plants are described. External event analysis in a PRA has three important goals; (1) the analysis should be complete in that all events are considered; (2) by following some selected screening criteria, the more significant events are identified for detailed analysis; (3) the selected events are analyzed in depth by taking into account the unique features of the events: hazard, fragility of structures and equipment, external-event initiated accident sequences, etc. Based on the above goals, external event analysis may be considered as a three-stage process: Stage I: Identification and Initial Screening of External Events; Stage II: Bounding Analysis; Stage III: Detailed Risk Analysis. In the present report, first, a review of published PRAs is given to focus on the significance and treatment of external events in full-scope PRAs. Except for seismic, flooding, fire, and extreme wind events, the contributions of other external events to plant risk have been found to be negligible. Second, scoping methods for external events not covered in detail in the NRC's PRA Procedures Guide are provided. For this purpose, bounding analyses for transportation accidents, extreme winds and tornadoes, aircraft impacts, turbine missiles, and chemical release are described

  15. Mammography-based screening program: preliminary results from a first 2-year round in a Brazilian region using mobile and fixed units

    Directory of Open Access Journals (Sweden)

    Haikel Raphael

    2012-10-01

    Full Text Available Abstract Background Breast cancer is the most frequently diagnosed cancer and the leading cause of cancer deaths among women worldwide. The use of mobile mammography units to offer screening to women living in remote areas is a rational strategy to increase the number of women examined. This study aimed to evaluate results from the first 2 years of a government-organized mammography screening program implemented with a mobile unit (MU and a fixed unit (FU in a rural county in Brazil. The program offered breast cancer screening to women living in Barretos and the surrounding area. Methods Based on epidemiologic data, 54 238 women, aged 40 to 69 years, were eligible for breast cancer screening. The study included women examined from April 1, 2003 to March 31, 2005. The chi-square test and Bonferroni correction analyses were used to evaluate the frequencies of tumors and the importance of clinical parameters and tumor characteristics. Significance was set at p Results Overall, 17 964 women underwent mammography. This represented 33.1% of eligible women in the area. A mean of 18.6 and 26.3 women per day were examined in the FU and MU, respectively. Seventy six patients were diagnosed with breast cancer (41 (54% in the MU. This represented 4.2 cases of breast cancer per 1000 examinations. The number of cancers detected was significantly higher in women aged 60 to 69 years than in those aged 50 to 59 years (p Conclusions Preliminary results indicate that this mammography screening program is feasible for implementation in a rural Brazilian territory and favor program continuation.

  16. Preliminary phytochemical screening and in vitro antioxidant activities of the aqueous extract of Helichrysum longifolium DC.

    Science.gov (United States)

    Aiyegoro, Olayinka A; Okoh, Anthony I

    2010-05-14

    Many oxidative stress related diseases are as a result of accumulation of free radicals in the body. A lot of researches are going on worldwide directed towards finding natural antioxidants of plants origins. The aims of this study were to evaluate in vitro antioxidant activities and to screen for phytochemical constituents of Helichrysum longifolium DC. [Family Asteraceae] aqueous crude extract. We assessed the antioxidant potential and phytochemical constituents of crude aqueous extract of Helichrysum longifolium using tests involving inhibition of superoxide anions, DPPH, H2O2, NO and ABTS. The flavonoid, proanthocyanidin and phenolic contents of the extract were also determined using standard phytochemical reaction methods. Phytochemical analyses revealed the presence of tannins, flavonoids, steroids and saponins. The total phenolic content of the aqueous leaf extract was 0.499 mg gallic acid equivalent/g of extract powder. The total flavonoid and proanthocyanidin contents of the plant were 0.705 and 0.005 mg gallic acid equivalent/g of extract powder respectively. The percentage inhibition of lipid peroxide at the initial stage of oxidation showed antioxidant activity of 87% compared to those of BHT (84.6%) and gallic acid (96%). Also, the percentage inhibition of malondialdehyde by the extract showed percentage inhibition of 78% comparable to those of BHT (72.24%) and Gallic (94.82%). Our findings provide evidence that the crude aqueous extract of H. longifolium is a potential source of natural antioxidants, and this justified its uses in folkloric medicines.

  17. Preliminary phytochemical screening and In vitro antioxidant activities of the aqueous extract of Helichrysum longifolium DC

    Directory of Open Access Journals (Sweden)

    Okoh Anthony I

    2010-05-01

    Full Text Available Abstract Background Many oxidative stress related diseases are as a result of accumulation of free radicals in the body. A lot of researches are going on worldwide directed towards finding natural antioxidants of plants origins. The aims of this study were to evaluate in vitro antioxidant activities and to screen for phytochemical constituents of Helichrysum longifolium DC. [Family Asteraceae] aqueous crude extract. Methods We assessed the antioxidant potential and phytochemical constituents of crude aqueous extract of Helichrysum longifolium using tests involving inhibition of superoxide anions, DPPH, H2O2, NO and ABTS. The flavonoid, proanthocyanidin and phenolic contents of the extract were also determined using standard phytochemical reaction methods. Results Phytochemical analyses revealed the presence of tannins, flavonoids, steroids and saponins. The total phenolic content of the aqueous leaf extract was 0.499 mg gallic acid equivalent/g of extract powder. The total flavonoid and proanthocyanidin contents of the plant were 0.705 and 0.005 mg gallic acid equivalent/g of extract powder respectively. The percentage inhibition of lipid peroxide at the initial stage of oxidation showed antioxidant activity of 87% compared to those of BHT (84.6% and gallic acid (96%. Also, the percentage inhibition of malondialdehyde by the extract showed percentage inhibition of 78% comparable to those of BHT (72.24% and Gallic (94.82%. Conclusions Our findings provide evidence that the crude aqueous extract of H. longifolium is a potential source of natural antioxidants, and this justified its uses in folkloric medicines.

  18. The prevalence and screening methods of postpartum depression

    Directory of Open Access Journals (Sweden)

    Özgür Erdem

    2012-09-01

    Full Text Available Postpartum Depression is the most common complicationof the delivery and affects approximately 10%-15% ofwomen who had just gave birth. During a period in whichwomen believe that they should be happy, the depressivemood experienced by most women leads to feelings ofguilt, hiding the symptoms, and postpartum depressionto be overlooked. Although the incidence of serious psychiatricdisorders during pregnancy is low, it is reportedthat the incidence shows a dramatic increase during thepostpartum period and this risky period may continue upto six months, one year or even two years.As the onset of postpartum depression is insidious it caneasily be overlooked if the patient’s seeking help is notsupported, especially when the severity of postpartum depressionis mild or moderate. In these cases, postpartumdepression may persist for a long time and at last it can beso severe that hospitalization would be needed. Therefore,early diagnose is very important and primary carephysicians and other health care workers should be alert.Postpartum Depression should be diagnosed using reliabledescriptive methods in puerperant women. Thescales such as Postnatal Depression Screening Scale,Beck Depression Inventory, Edinburgh Postnatal DepressionScale and State-Trait Anxiety Inventory, all of whichwere tested for validity and reliability in our country can beused during follow-up of pregnant and puerperal women.Key words: Postpartum depression, screening methods,primary health care professionals

  19. 43 CFR 11.25 - Preassessment screen-preliminary identification of resources potentially at risk.

    Science.gov (United States)

    2010-10-01

    ... pathways. (1) The authorized official shall make a preliminary identification of potential exposure... toxicological properties of the oil or hazardous substance. (3) Pathways to be considered shall include, as appropriate, direct contact, surface water, ground water, air, food chains, and particulate movement. (b...

  20. The Saharan medicinal plant Limoniastrum feei: Ethnomedical survey and preliminary phytochemical screening of antibacterial extracts

    Directory of Open Access Journals (Sweden)

    S. RAHMANI

    2012-07-01

    Full Text Available Limoniastrum feei (plumbagenaceae a medicinal plant, used in Saharan ethnopharmacopeae to treat gastric tract, hepatit desorder and cought. The antibacterial extracts from leaves, stem and twig of this plant are screened for the principal classes of secondary metabolites, such as Alkaloids, Saponins, Terpenes, Tannins, Flavonoids, Steroids and Cardenolids.

  1. Preliminary Validation of a Screening Tool for Adolescent Panic Disorder in Pediatric Primary Care Clinics

    Science.gov (United States)

    Queen, Alexander H.; Ehrenreich-May, Jill; Hershorin, Eugene R.

    2012-01-01

    This study examines the validity of a brief screening tool for adolescent panic disorder (PD) in a primary care setting. A total of 165 participants (ages 12-17 years) seen in two pediatric primary care clinics completed the Autonomic Nervous System Questionnaire (ANS; Stein et al. in Psychosomatic Med 61:359-364, 40). A subset of those screening…

  2. Simplified methods and application to preliminary design of piping for elevated temperature service

    International Nuclear Information System (INIS)

    Severud, L.K.

    1975-01-01

    A number of simplified stress analysis methods and procedures that have been used on the FFTF project for preliminary design of piping operating at elevated temperatures are described. The rationale and considerations involved in developing the procedures and preliminary design guidelines are given. Applications of the simplified methods to a few FFTF pipelines are described and the success of these guidelines are measured by means of comparisons to pipeline designs that have had detailed Code type stress analyses. (U.S.)

  3. A Desktop Screen Sharing System based on Various Connection Methods

    Science.gov (United States)

    Negishi, Yuya; Kawaguchi, Nobuo

    Recently it became very common to use information devices such as PCs during presentations and discussions. In these situations, a need arises for techniques that allow a smooth switch of presenters without changing cables, or an easy screen sharing in case of remote videoconferences. In this paper, we propose a desktop screen sharing system that can be used for such purposes and situations. For that, we designed an automatic control of connections in the VNC system that can be operated remotely over the network. We also suggested an interface that assigns a role such as “Screen sender" or “Screen receiver" to each terminal. In the proposed system, while sharing a screen between multiple terminals, one can easily display and browse the screen without having to understand how the others are connected. We also implemented a “role card" using contactless IC card, where roles are assigned only by placing the card in the IC reader.

  4. Developments and the preliminary tests of Resistive GEMs manufactured by a screen printing technology

    CERN Document Server

    Agócs, G; Oliveira, R; Martinego, P; Peskov, Vladimir; Pietropaolo, P; Picchi, P

    2008-01-01

    We report promising initial results obtained with new resistive-electrode GEM (RETGEM) detectors manufactured, for the first time, using screen printing technology. These new detectors allow one to reach gas gains nearly as high as with ordinary GEM-like detectors with metallic electrodes; however, due to the high resistivity of its electrodes the RETGEM, in contrast to ordinary hole-type detectors, has the advantage of being fully spark protected. We discovered that RETGEMs can operate stably and at high gains in noble gases and in other badly quenched gases, such as mixtures of noble gases with air and in pure air; therefore, a wide range of practical applications, including dosimetry and detection of dangerous gases, is foreseeable. To promote a better understanding of RETGEM technology some comparative studies were completed with metallic-electrode thick GEMs. A primary benefit of these new RETGEMs is that the screen printing technology is easily accessible to many research laboratories. This accessibilit...

  5. Assessing traumatic event exposure: general issues and preliminary findings for the Stressful Life Events Screening Questionnaire.

    Science.gov (United States)

    Goodman, L A; Corcoran, C; Turner, K; Yuan, N; Green, B L

    1998-07-01

    This article reviews the psychometric properties of the Stressful Life Events Screening Questionnaire (SLESQ), a recently developed trauma history screening measure, and discusses the complexities involved in assessing trauma exposure. There are relatively few general measures of exposure to a variety of types of traumatic events, and most of those that exist have not been subjected to rigorous psychometric evaluation. The SLESQ showed good test-retest reliability, with a median kappa of .73, adequate convergent validity (with a lengthier interview) with a median kappa of .64, and good discrimination between Criterion A and non-Criterion A events. The discussion addresses some of the challenges of assessing traumatic event exposure along the dimensions of defining traumatic events, assessment methodologies, reporting consistency, and incident validation.

  6. Preliminary phytochemical screening of roots and aerial parts of leptadenia pyrotechnica

    International Nuclear Information System (INIS)

    Munazir, M.; Qureshi, R.; Munir, M.

    2015-01-01

    Leptadenia pyrotechnica (Forssk.) Decne is a medicinal plant that is native to hot deserts of Pakistan. This plant is sporadically known with reference to bioactivity including phytochemical screening especially from Pakistan. The present study was designed to screen out four major groups of phytochemicals such as alkaloids, flavonoids, saponins and tannins from eight solvents based roots and aerial parts extracts viz., hexane, chloroform, acetone, ethyl acetate, butanol, ethanol, methanol and water of the selected plant. The qualitative screening showed the presence of all major groups of phytochemicals in both plant parts extracts in which methanolic ones were the most efficient that extracted all the selected classes of phytochemicals. Quantitative screening revealed various concentrations of selected phytochemicals in both plant parts. The alkaloid contents were 3.267±0.643and 3±0.6 in roots and aerial parts respectively (p>0.05). The total flavonoid content was 76.867±2.266 and 139.448±8.677 QE/100g in roots and aerial parts respectively. In the case of total saponin contents, the proportions were 0.34±0.013% and 0.4 0.010% in roots and aerial parts respectively, whereas; total tannin contents were 62.713±4.841 and154.961±5.853 mg of TAE/100g of extract in roots and aerial parts, respectively. This study will serve as a benchmark for further pharmacological studies on the said plant that may be harnessed for drug development in the future. (author)

  7. A Screening Method for the ALK Fusion Gene in NSCLC

    International Nuclear Information System (INIS)

    Murakami, Yoshiko; Mitsudomi, Tetsuya; Yatabe, Yasushi

    2012-01-01

    Lung cancer research has recently made significant progress in understanding the molecular pathogenesis of lung cancer and in developing treatments for it. Such achievements are directly utilized in clinical practice. Indeed, the echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (ALK) fusion gene was first described in non-small cell lung cancer in 2007, and a molecularly targeted drug against the fusion was approved in 2011. However, lung cancer with the ALK fusion constitutes only a small fraction of lung cancers; therefore, efficient patient selection is crucial for successful treatment using the ALK inhibitor. Currently, RT-PCR, fluorescent in situ hybridization (FISH), and immunohistochemistry are commonly used to detect the ALK fusion. Although FISH is currently the gold standard technique, there are no perfect methods for detecting these genetic alterations. In this article, we discuss the advantages and disadvantages of each method and the possible criteria for selecting patients who are more likely to have the ALK fusion. If we can successfully screen patients, then ALK inhibitor treatment will be the best example of personalized therapy in terms of selecting patients with an uncommon genotype from a larger group with the same tumor phenotype. In other words, the personalized therapy may offer a new challenge for current clinical oncology.

  8. Screening method for piping wall loss by flow accelerated corrosion

    International Nuclear Information System (INIS)

    Ryu, Kyung Ha; Hwang, Il Soon; Lee, Na Young; Oh, Young Jin; Kim, Ji Hyun; Park, Jin Ho; Sohn, Chang Ho

    2008-01-01

    Flow accelerated corrosion (FAC) phenomenon has persisted its impact on plant reliability and personnel safety. Unless we change the operation condition drastically, most parameters affecting FAC will not be effectively controlled. In order to help expand piping inspection coverage, we have developed a screening approach to monitor the wall thinning by direct current potential drop (DCPD) technique. To improve the applicability to the complex piping network such as the secondary cooling water system in PWR's, we devised the equipotential control method that can eliminate undesired leakage currents outside a measurement section. In this paper, we present Wide Range Monitoring (WiRM) and Narrow Range Monitoring (NaRM) with Equipotential Switching Direct Current Potential Drop (ES-DCPD) method to rapidly monitor the thinning of piping. Based on the WiRM results, susceptible locations can be identified for further inspection by ultrasound technique (UT). On-line monitoring of a thinned location can be made by NaRM. Finite element analysis results and a closed-form resistance model are developed for the comparison with measured wall thinning by the developed DCPD technique. Verification experiments were conducted using UT as the reference. The result shows that model predictions and the experimental results agree well to confirm that both WiRM and NaRM based on ES-DCPD can be applicable to FAC management efforts

  9. Screening method for piping wall loss by flow accelerated corrosion

    International Nuclear Information System (INIS)

    Ryu, K.H.; Hwang, I.S.; Lee, N.Y.; Oh, Y.J.; Park, J.H.; Sohn, C.H.

    2007-01-01

    Flow accelerated corrosion (FAC) phenomenon has persisted in its impact on plant reliability and personnel safety. Unless we change the operation condition drastically, most parameters affecting FAC will not be effectively controlled. In order to help expand piping inspection coverage, we have developed a screening approach to monitor the wall thinning by a Direct Current Potential drop (DCPD) technique. To improve the applicability to the complex piping network such as the secondary cooling water system in PWR's, we devised the equipotential control method that can eliminate undesired leakage currents outside a measurement section. In this paper, we present Wide Range Monitoring (WiRM) and Narrow Range Monitoring (NaRM) with Equipotential Switching Direct Current Potential Drop (ES-DCPD) method to rapidly monitor the thinning of piping. Based on the WiRM results, susceptible locations can be identified for further inspection by Ultrasonic Technique (UT). On-line monitoring of a thinned location can be made by NaRM. Finite element analysis results and a closed-form resistance model are developed for the comparison with measured wall thinning by the developed DCPD technique. Verification experiments were conducted using UT as the reference. The result shows that model predictions and the experimental results agree well to confirm that both WiRM and NaRM based on ES-DCPD can be applicable to FAC management efforts. (author)

  10. A novel method for screening the glutathione transferase inhibitors

    Directory of Open Access Journals (Sweden)

    Węgrzyn Grzegorz

    2009-03-01

    Full Text Available Abstract Background Glutathione transferases (GSTs belong to the family of Phase II detoxification enzymes. GSTs catalyze the conjugation of glutathione to different endogenous and exogenous electrophilic compounds. Over-expression of GSTs was demonstrated in a number of different human cancer cells. It has been found that the resistance to many anticancer chemotherapeutics is directly correlated with the over-expression of GSTs. Therefore, it appears to be important to find new GST inhibitors to prevent the resistance of cells to anticancer drugs. In order to search for glutathione transferase (GST inhibitors, a novel method was designed. Results Our results showed that two fragments of GST, named F1 peptide (GYWKIKGLV and F2 peptide (KWRNKKFELGLEFPNL, can significantly inhibit the GST activity. When these two fragments were compared with several known potent GST inhibitors, the order of inhibition efficiency (measured in reactions with 2,4-dinitrochlorobenzene (CDNB and glutathione as substrates was determined as follows: tannic acid > cibacron blue > F2 peptide > hematin > F1 peptide > ethacrynic acid. Moreover, the F1 peptide appeared to be a noncompetitive inhibitor of the GST-catalyzed reaction, while the F2 peptide was determined as a competitive inhibitor of this reaction. Conclusion It appears that the F2 peptide can be used as a new potent specific GST inhibitor. It is proposed that the novel method, described in this report, might be useful for screening the inhibitors of not only GST but also other enzymes.

  11. Display methods of electronic patient record screens: patient privacy concerns.

    Science.gov (United States)

    Niimi, Yukari; Ota, Katsumasa

    2013-01-01

    To provide adequate care, medical professionals have to collect not only medical information but also information that may be related to private aspects of the patient's life. With patients' increasing awareness of information privacy, healthcare providers have to pay attention to the patients' right of privacy. This study aimed to clarify the requirements of the display method of electronic patient record (EPR) screens in consideration of both patients' information privacy concerns and health professionals' information needs. For this purpose, semi-structured group interviews were conducted of 78 medical professionals. They pointed out that partial concealment of information to meet patients' requests for privacy could result in challenges in (1) safety in healthcare, (2) information sharing, (3) collaboration, (4) hospital management, and (5) communication. They believed that EPRs should (1) meet the requirements of the therapeutic process, (2) have restricted access, (3) provide convenient access to necessary information, and (4) facilitate interprofessional collaboration. This study provides direction for the development of display methods that balance the sharing of vital information and protection of patient privacy.

  12. [Use of Plusoptix as a screening method for refractive ambliopia].

    Science.gov (United States)

    Bogdănici, T; Tone, Silvia; Miron, Mihaela; Boboc, Mihaela; Bogdănici, Camelia

    2012-01-01

    Highlighting the differences in the objective refraction using the Plusoptix AO9 comparing them with the refraction performed with TOPCON KR-8900 autorefractor. Prospective study for 3 months held in the Ophthalmology Clinic in Iasi, Hospital Sf. Spiridon on a total of 39 children (21 girls and 18 boys) with mean age of 10.61 +/- 5.67 years. Clinical parameters: sex, age, objective refraction obtained with Plusoptix and with autorefractor corrected visual acuity (with different methods depending on each patient age), ortoptic examination (strabic deviation, binocular vision), the presence of symetry/asymetry while measuring with Plusoptix. The results were statistically processed by F-TEST calculating the correlation coefficient, standard deviation, significance level (using the spherical equivalent of the obtained values). Age limits of the studied cases ranged between 2-23 years. Visual acuity of children who had cooperate was between 0.2-1 with correction, achieving best values on right eye than left eye. 8 cases (20.51%) had large differences between measurements made with Plusoptix and autorefractor, half of that (4 cases) had strabismus. Three of these cases were with small hypermetropia and one with small myopia (Plusoptix shows a lower value). In 2 cases occurred higher differences (about 2-2,5D) between the 2 measurements, in patients with average hypermetropia. Plusoptix refraction was not possible at high hypermetropia or high myopia. This type of determining objective refraction using Plusoptix is a useful method of screening for discovery of refractive errors that can cause refractive amblyopia in young children and in those cases with a difficult collaboration. Because there are differences betweeti this 2 methods, for children with refractive errors are recommended further exploration to determine the appropriate optical correction. Plusoptix is a limited method because it cannot detect the exact values in those cases with high hypermetropia or high

  13. A Method for Rapid Measurement of Contrast Sensitivity on Mobile Touch-Screens

    Science.gov (United States)

    Mulligan, Jeffrey B.

    2016-01-01

    Touch-screen displays in cell phones and tablet computers are now pervasive, making them an attractive option for vision testing outside of the laboratory or clinic. Here we de- scribe a novel method in which subjects use a finger swipe to indicate the transition from visible to invisible on a grating which is swept in both contrast and frequency. Because a single image can be swiped in about a second, it is practical to use a series of images to zoom in on particular ranges of contrast or frequency, both to increase the accuracy of the measurements and to obtain an estimate of the reliability of the subject. Sensitivities to chromatic and spatio-temporal modulations are easily measured using the same method. A proto- type has been developed for Apple Computer's iPad/iPod/iPhone family of devices, implemented using an open-source scripting environment known as QuIP (QUick Image Processing, http://hsi.arc.nasa.gov/groups/scanpath/research.php). Preliminary data show good agreement with estimates obtained from traditional psychophysical methods as well as newer rapid estimation techniques. Issues relating to device calibration are also discussed.

  14. Identification and evaluation of areas of interest (AOIs): A screening tool for CERCLA preliminary assessments

    International Nuclear Information System (INIS)

    Autry, A.R.; Allen, K.L.; Smith, L.A.; Schumacher, J.; McDermott, M.

    1994-01-01

    A cost-effective alternative to the traditional Preliminary Assessment (PA) procedure is to identify and evaluate potential Areas of Interest (AOIs) that may become Comprehensive Environmental Response, Liability and Compensation Act of 1980 (CERCLA) sites prior to entry into Comprehensive Environmental Response, Liability Information System (CERCLIS) and the execution of a PA. AOIs would be identified by using much of the same methodology as would be used for site discovery in a CERCLA investigation, including aerial photograph review, reviews of building drawings, a limited review of historical records, and limited interviews and site visits. Once AOIs have been identified in this manner, decision criteria can be used to ascertain the regulatory status of the AOI and, based on regulatory guidance, whether the site should be considered for further investigation under CERCLA. This approach was used at Griffiss Air Force Base to identify 463 AOIs, where the primary problem was petroleum spills

  15. Jaw-opening force test to screen for Dysphagia: preliminary results.

    Science.gov (United States)

    Hara, Koji; Tohara, Haruka; Wada, Satoko; Iida, Takatoshi; Ueda, Koichiro; Ansai, Toshihiro

    2014-05-01

    To assess the jaw-opening force test (JOFT) for dysphagia screening. Criterion standard. University dental hospital. Patients complaining of dysphagia (N=95) and with symptoms of dysphagia with chronic underlying causes (mean age ± SD, 79.3±9.61y; range, 50-94y; men: n=49; mean age ± SD, 77.03±9.81y; range, 50-94y; women: n=46; mean age ± SD, 75.42±9.73y; range, 51-93y) admitted for treatment between May 2011 and December 2012 were included. None. All patients were administered the JOFT and underwent fiberoptic endoscopic evaluation of swallowing (FEES). The mean jaw-opening strength was compared with aspiration (ASP) and pharyngeal residue observations of the FEES, which was used as the criterion standard. A receiver operating characteristic (ROC) curve analysis was performed. Forces of ≤3.2kg for men and ≤4kg for women were appropriate cutoff values for predicting ASP with a sensitivity and specificity of .57 and .79 for men and .93 and .52 for women, respectively. Based on the ROC analyses for predicting pharyngeal residue, forces of ≤5.3kg in men and ≤3.9kg in women were appropriate cutoff values, with a sensitivity and specificity of .80 and .88 for men and .83 and .81 for women, respectively. The JOFT could be a useful screening tool for predicting pharyngeal residue and could provide useful information to aid in the referral of patients for further diagnostic imaging testing. However, given its low sensitivity to ASP the JOFT should be paired with other screening tests that predict ASP. Copyright © 2014 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  16. Validating a dance-specific screening test for balance: preliminary results from multisite testing.

    Science.gov (United States)

    Batson, Glenna

    2010-09-01

    Few dance-specific screening tools adequately capture balance. The aim of this study was to administer and modify the Star Excursion Balance Test (oSEBT) to examine its utility as a balance screen for dancers. The oSEBT involves standing on one leg while lightly targeting with the opposite foot to the farthest distance along eight spokes of a star-shaped grid. This task simulates dance in the spatial pattern and movement quality of the gesturing limb. The oSEBT was validated for distance on athletes with history of ankle sprain. Thirty-three dancers (age 20.1 +/- 1.4 yrs) participated from two contemporary dance conservatories (UK and US), with or without a history of lower extremity injury. Dancers were verbally instructed (without physical demonstration) to execute the oSEBT and four modifications (mSEBT): timed (speed), timed with cognitive interference (answering questions aloud), and sensory disadvantaging (foam mat). Stepping strategies were tracked and performance strategies video-recorded. Unlike the oSEBT results, distances reached were not significant statistically (p = 0.05) or descriptively (i.e., shorter) for either group. Performance styles varied widely, despite sample homogeneity and instructions to control for strategy. Descriptive analysis of mSEBT showed an increased number of near-falls and decreased timing on the injured limb. Dancers appeared to employ variable strategies to keep balance during this test. Quantitative analysis is warranted to define balance strategies for further validation of SEBT modifications to determine its utility as a balance screening tool.

  17. Electron screening effects in (p,α) reactions induced on boron isotopes studied via the Trojan Horse Method

    International Nuclear Information System (INIS)

    Lamia, L; Spitaleri, C; Cherubini, S; Gulino, M; Puglia, S M R; Rapisarda, G G; Romano, S; Sergi, M L; Carlin, N; Gameiro Munhoz, M; Gimenez Del Santo, M; Kiss, G G; Somorjai, E; Kroha, V; Kubono, S; La Cognata, M; Pizzone, R G; Li, C; Wen, Qungang; Mukhamedzhanov, A

    2013-01-01

    The Trojan Horse Method is a powerful indirect technique allowing one to measure the bare nucleus S(E)-factor and the electron screening potential for astrophysically relevant reactions without the needs of extrapolations. The case of the (p,α) reactions induced on the two boron isotopes 10,11 B is here discussed in view of the recent Trojan Horse (TH) applications to the quasi-free 10,11 B+ 2 H reactions. The comparison between the TH and the low-energy direct data allowed us to determine the electron screening potential for the 11 B(p,α) reaction, while preliminary results on the 10 B(p,α) reaction have been extracted.

  18. A fluorescence high throughput screening method for the detection of reactive electrophiles as potential skin sensitizers

    Energy Technology Data Exchange (ETDEWEB)

    Avonto, Cristina; Chittiboyina, Amar G. [National Center for Natural Products Research, Research Institute of Pharmaceutical Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States); Rua, Diego [The Center for Food Safety and Applied Nutrition, US Food and Drug Administration, College Park, MD 20740 (United States); Khan, Ikhlas A., E-mail: ikhan@olemiss.edu [National Center for Natural Products Research, Research Institute of Pharmaceutical Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States); Division of Pharmacognosy, Department of BioMolecular Sciences, School of Pharmacy, The University of Mississippi, University, MS 38677 (United States)

    2015-12-01

    Skin sensitization is an important toxicological end-point in the risk assessment of chemical allergens. Because of the complexity of the biological mechanisms associated with skin sensitization, integrated approaches combining different chemical, biological and in silico methods are recommended to replace conventional animal tests. Chemical methods are intended to characterize the potential of a sensitizer to induce earlier molecular initiating events. The presence of an electrophilic mechanistic domain is considered one of the essential chemical features to covalently bind to the biological target and induce further haptenation processes. Current in chemico assays rely on the quantification of unreacted model nucleophiles after incubation with the candidate sensitizer. In the current study, a new fluorescence-based method, ‘HTS-DCYA assay’, is proposed. The assay aims at the identification of reactive electrophiles based on their chemical reactivity toward a model fluorescent thiol. The reaction workflow enabled the development of a High Throughput Screening (HTS) method to directly quantify the reaction adducts. The reaction conditions have been optimized to minimize solubility issues, oxidative side reactions and increase the throughput of the assay while minimizing the reaction time, which are common issues with existing methods. Thirty-six chemicals previously classified with LLNA, DPRA or KeratinoSens™ were tested as a proof of concept. Preliminary results gave an estimated 82% accuracy, 78% sensitivity, 90% specificity, comparable to other in chemico methods such as Cys-DPRA. In addition to validated chemicals, six natural products were analyzed and a prediction of their sensitization potential is presented for the first time. - Highlights: • A novel fluorescence-based method to detect electrophilic sensitizers is proposed. • A model fluorescent thiol was used to directly quantify the reaction products. • A discussion of the reaction workflow

  19. A fluorescence high throughput screening method for the detection of reactive electrophiles as potential skin sensitizers

    International Nuclear Information System (INIS)

    Avonto, Cristina; Chittiboyina, Amar G.; Rua, Diego; Khan, Ikhlas A.

    2015-01-01

    Skin sensitization is an important toxicological end-point in the risk assessment of chemical allergens. Because of the complexity of the biological mechanisms associated with skin sensitization, integrated approaches combining different chemical, biological and in silico methods are recommended to replace conventional animal tests. Chemical methods are intended to characterize the potential of a sensitizer to induce earlier molecular initiating events. The presence of an electrophilic mechanistic domain is considered one of the essential chemical features to covalently bind to the biological target and induce further haptenation processes. Current in chemico assays rely on the quantification of unreacted model nucleophiles after incubation with the candidate sensitizer. In the current study, a new fluorescence-based method, ‘HTS-DCYA assay’, is proposed. The assay aims at the identification of reactive electrophiles based on their chemical reactivity toward a model fluorescent thiol. The reaction workflow enabled the development of a High Throughput Screening (HTS) method to directly quantify the reaction adducts. The reaction conditions have been optimized to minimize solubility issues, oxidative side reactions and increase the throughput of the assay while minimizing the reaction time, which are common issues with existing methods. Thirty-six chemicals previously classified with LLNA, DPRA or KeratinoSens™ were tested as a proof of concept. Preliminary results gave an estimated 82% accuracy, 78% sensitivity, 90% specificity, comparable to other in chemico methods such as Cys-DPRA. In addition to validated chemicals, six natural products were analyzed and a prediction of their sensitization potential is presented for the first time. - Highlights: • A novel fluorescence-based method to detect electrophilic sensitizers is proposed. • A model fluorescent thiol was used to directly quantify the reaction products. • A discussion of the reaction workflow

  20. Preliminary screening of the radiosensitivity-associated genes on colorectal cancer

    International Nuclear Information System (INIS)

    Xing Chungen; Yang Xiaodong; Zhou Liying; Wu Yongyou; Jiang Yinfen; Dai Hong; Lv Xiaodong; Gong Wei

    2007-01-01

    The screening of radiosensitive genes of human colorectal cancer was made by gene chip. Two human colorectal cancer cell lines LOVO and SW480 were cultivated and the total RNA was extracted from at least lxl0 7 cells. Then the gene expression profiling was performed by HG-U133 Plus 2.0 Array and the difference of gene expression has been analyzed. The results shows that there are 16882 genes expressed in LOVO cell and 17114 genes expressed in SW480 cell through gene expression profiling. It has been found that the genes with 2-fold expressed differentially include 908 genes up-regulated and 1312 genes down-regulated. The same genes, such as Fas and NFkB which is up-regulated, Caspas6, and RAD21 which is down-regulated, have been proved to be related to radiosensitivity. The genes with high expression level including CEACAM5, THBS1, SERPINE2, ARL7, HPGD in LOVO cell may also be related to the radiosensitivity. And the genes with high expression level including SCD, NQ01, LYZ, KRT20, ATP1B1 in SW480 cell may be related to the radioresistance of human colorectal cancer. It could be concluded that the radiosensitivity of colorectal cancer can be reflected from gene and protein expression level. And gene expression profiling is a fast and sensitive tool to predict the radiosensitivity and screen radiosensitive genes of colorectal cancer. (authors)

  1. The Brief Early Childhood Screening Assessment: Preliminary Validity in Pediatric Primary Care.

    Science.gov (United States)

    Fallucco, Elise M; Wysocki, Tim; James, Lauren; Kozikowski, Chelsea; Williams, Andre; Gleason, Mary M

    Brief, well-validated instruments are needed to facilitate screening for early childhood behavioral and emotional problems (BEPs). The objectives of this study were to empirically reduce the length of the Early Childhood Screening Assessment (ECSA) and to assess the validity and reliability of this shorter tool. Using caregiver ECSA responses for 2467 children aged 36 to 60 months seen in primary care, individual ECSA items were ranked on a scale ranging from "absolutely retain" to "absolutely delete." Items were deleted sequentially beginning with "absolutely delete" and going up the item prioritization list, resulting in 35 shorter versions of the ECSA. A separate primary care sample (n = 69) of mothers of children aged 18 to 60 months was used to determine the sensitivity and specificity of each shorter ECSA version using psychiatric diagnosis on the Diagnostic Infant and Preschool Assessment as the gold standard. The version with the optimal balance of sensitivity, specificity, and length was selected as the Brief ECSA. Associations between Brief ECSA scores and other pertinent measures were evaluated to estimate reliability and validity. A 22-item measure reflected the best combination of brevity, sensitivity and specificity. A cutoff score of 9 or higher on the 22-item Brief ECSA demonstrated acceptable sensitivity (89%) and specificity (85%) for predicting a psychiatric diagnosis. Brief ECSA scores correlated significantly and in expected directions with scores on pertinent measures and with demographic variables. The results indicate that the Brief ECSA has sound psychometric properties for identifying young children with BEPs in primary care.

  2. A screening method for cardiovascular active compounds in marine algae.

    Science.gov (United States)

    Agatonovic-Kustrin, S; Kustrin, E; Angove, M J; Morton, D W

    2018-05-18

    The interaction of bioactive compounds from ethanolic extracts of selected marine algae samples, separated on chromatographic plates, with nitric/nitrous acid was investigated. The nature of bioactive compounds in the marine algae extracts was characterised using UV absorption spectra before and after reaction with diluted nitric acid, and from the characteristic colour reaction after derivatization with anisaldehyde. It was found that diterpenes from Dictyota dichotoma, an edible brown algae, and sterols from green algae Caulerpa brachypus, bind nitric oxide and may act as a nitric oxide carrier. Although the carotenoid fucoxanthin, found in all brown marine algae also binds nitric oxide, the bonds between nitrogen and the fucoxanthin molecule are much stronger. Further studies are required to evaluate the effects of diterpenes from Dictyota dichotoma and sterols from green algae Caulerpa brachypus to see if they have beneficial cardiovascular effects. The method reported here should prove useful in screening large numbers of algae species for compounds with cardiovascular activity. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Rapid screening method for plutonium in mixed waste samples

    International Nuclear Information System (INIS)

    Somers, W.; Culp, T.; Miller, R.

    1987-01-01

    A waste stream sampling program was undertaken to determine those waste streams which contained hazardous constituents, and would therefore be regulated as a hazardous waste under the Resource Conservation and Recovery Act. The waste streams also had the potential of containing radioactive material, either plutonium, americium, or depleted uranium. Because of the potential for contamination with radioactive material, a method of rapidly screening the liquid samples for radioactive material was required. A counting technique was devised to count a small aliquot of a sample, determine plutonium concentration, and allow the sample to be shipped the same day they were collected. This technique utilized the low energy photons (x-rays) that accompany α decay. This direct, non-destructive x-ray analysis was applied to quantitatively determine Pu-239 concentrations in industrial samples. Samples contained a Pu-239, Am-241 mixture; the ratio and/or concentrations of these two radionuclides was not constant. A computer program was designed and implemented to calculate Pu-239 activity and concentration (g/ml) using the 59.5 keV Am-241 peak to determine Am-241's contribution to the 17 keV region. Am's contribution was subtracted, yielding net counts in the 17 keV region due to Pu. 2 figs., 1 tab

  4. Recombinant methods for screening human DNA excision repair proficiency

    International Nuclear Information System (INIS)

    Athas, W.F.

    1988-01-01

    A method for measuring DNA excision repair in response to ultraviolet radiation (UV)-induced DNA damage has been developed, validated, and field-tested in cultured human lymphocytes. The methodology is amenable to population-based screening and should facilitate future epidemiologic studies seeking to investigate associations between excision repair proficiency and cancer susceptibility. The impetus for such endeavors derives from the belief that the high incidence of skin cancer in the genetic disorder xeroderma pigmentosum (XP) primarily is a result of the reduced capacity of patients cells to repair UV-induced DNA damage. For assay, UV-irradiated non-replicating recombinant plasmid DNA harboring a chloramphenicol acetyltransferase (CAT) indicator gene is introduced into lymphocytes using DEAE-dextran short-term transfection conditions. Exposure to UV induces transcriptionally-inactivating DNA photoproducts in the plasmid DNA which inactivate CAT gene expression. Excision repair of the damaged CAT gene is monitored indirectly as a function of reactivated CAT enzyme activity following a 40 hour repair/expression incubation period

  5. Establishment of screening method for effective vaccination using radiolabelled probe

    International Nuclear Information System (INIS)

    Nomaguchi, Hiroko; Yogi, Yasuko

    1998-01-01

    Aiming to develop a screening method for effective vaccination, an investigation was made to establish basic techniques for evaluating cytokine producing abilities of host cells after immunization to mycobacterium leprae. In this study, proliferation of the bacterium was investigated with immunodeficient mice such as BALB/cA-nu/nu, CB-scid, aly/ + and aly/aly and the respective normal mice. When the splenic cells from BALB/cA mouse sensitized with M. leprae (ip, 5 days) was challenged with its cell lysate, γ-IFN was produced, whereas its production was not observed in those from sensitive mouse BALB/cA-nu/nu. In addition, it was suggested that cells which could induce γ-IFN in response to IL-12 were extremely limited in the nude mouse. On the contrary, for IL-18, γ-IFN was inducible in the nude mouse when anti-CD3 was previously coated, indicating that it is difficult to evaluate the efficacy of vaccination only by measuring the productions of IL-12 and IL-18. Therefore, it seems better to determine the amount of γ-IFN protein induced by resensitization with the antigen in the splenic cells. (M.N.)

  6. Establishment of screening method for effective vaccination using radiolabelled probe

    Energy Technology Data Exchange (ETDEWEB)

    Nomaguchi, Hiroko; Yogi, Yasuko [National Inst. of Infectious Deseases, Tokyo (Japan)

    1998-02-01

    Aiming to develop a screening method for effective vaccination, an investigation was made to establish basic techniques for evaluating cytokine producing abilities of host cells after immunization to mycobacterium leprae. In this study, proliferation of the bacterium was investigated with immunodeficient mice such as BALB/cA-nu/nu, CB-scid, aly/{sup +} and aly/aly and the respective normal mice. When the splenic cells from BALB/cA mouse sensitized with M. leprae (ip, 5 days) was challenged with its cell lysate, {gamma}-IFN was produced, whereas its production was not observed in those from sensitive mouse BALB/cA-nu/nu. In addition, it was suggested that cells which could induce {gamma}-IFN in response to IL-12 were extremely limited in the nude mouse. On the contray, for IL-18, {gamma}-IFN was inducible in the nude mouse when anti-CD3 was previously coated, indicating that it is difficult to evaluate the efficacy of vaccination only by measuring the productions of IL-12 and IL-18. Therefore, it seems better to determine the amount of {gamma}-IFN protein induced by resensitization with the antigen in the splenic cells. (M.N.)

  7. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  8. Ultrasound screening for decentered hips in children with severe cerebral palsy: a preliminary evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Smigovec, Igor; Dapic, Tomislav [University Hospital Center Zagreb, Zagreb University School of Medicine, Department of Orthopedic Surgery, Zagreb (Croatia); Trkulja, Vladimir [Zagreb University School of Medicine, Zagreb (Croatia)

    2014-09-15

    Ultrasound (US) is routinely used for hip screening in children with developmental hip disorders, whereas standard hip surveillance in children with cerebral palsy is based on repeated X-ray assessments. To evaluate US as a diagnostic tool in screening for decentered hips in children with cerebral palsy. We conducted a prospective, diagnostic single-center assessor-blind study that included consecutive children (age 2-8 years) with cerebral palsy and severe motor disability who underwent US and X-ray hip assessment. US lateral longitudinal scans were used to determine lateral head distance. X-ray assessment was used to determine migration percentage. Diagnostic properties of lateral head distance in detecting hips with a migration percentage ≥0.33 (which requires preventive treatment) were evaluated overall (n = 100) and for hips assessed at the age 24-60 months (n = 38) or >60 to ≤96 months (n = 62). Fifty hips underwent US assessment by two investigators to evaluate inter-rater reliability and agreement. Prevalence of migration percentage ≥0.33 was 22.0% overall and 26.2% and 19.4% in the younger and older age-based subsets, respectively. Lateral head distance well discriminated hips with a migration percentage ≥0.33 (areas under the receiver operating characteristics [ROC] curves 94%, 99% and 92%, respectively). At the optimum cut-off values of lateral head distance (5.0, 5.0 and 4.8 mm, respectively), sensitivity was 95.5%, 100% and 100% overall and in the two age-based subsets, respectively, whereas specificity was 85.9%, 96.4% and 72.0%, respectively. Consequently, positive predictive value was relatively low, but negative predictive value was 98.5% (95% CI 92.1-100) overall and 100% (97.5% one-sided CI 87.2-100) and 100% (97.5 one-sided CI 90.2-100) in the two age-based subsets, respectively. Inter-rater reliability was high (intraclass correlation coefficient = 0.98, 95% CI 0.97-0.99) and 95% limits of agreement were reasonably narrow (-1.203 mm to

  9. Ultrasound screening for decentered hips in children with severe cerebral palsy: a preliminary evaluation

    International Nuclear Information System (INIS)

    Smigovec, Igor; Dapic, Tomislav; Trkulja, Vladimir

    2014-01-01

    Ultrasound (US) is routinely used for hip screening in children with developmental hip disorders, whereas standard hip surveillance in children with cerebral palsy is based on repeated X-ray assessments. To evaluate US as a diagnostic tool in screening for decentered hips in children with cerebral palsy. We conducted a prospective, diagnostic single-center assessor-blind study that included consecutive children (age 2-8 years) with cerebral palsy and severe motor disability who underwent US and X-ray hip assessment. US lateral longitudinal scans were used to determine lateral head distance. X-ray assessment was used to determine migration percentage. Diagnostic properties of lateral head distance in detecting hips with a migration percentage ≥0.33 (which requires preventive treatment) were evaluated overall (n = 100) and for hips assessed at the age 24-60 months (n = 38) or >60 to ≤96 months (n = 62). Fifty hips underwent US assessment by two investigators to evaluate inter-rater reliability and agreement. Prevalence of migration percentage ≥0.33 was 22.0% overall and 26.2% and 19.4% in the younger and older age-based subsets, respectively. Lateral head distance well discriminated hips with a migration percentage ≥0.33 (areas under the receiver operating characteristics [ROC] curves 94%, 99% and 92%, respectively). At the optimum cut-off values of lateral head distance (5.0, 5.0 and 4.8 mm, respectively), sensitivity was 95.5%, 100% and 100% overall and in the two age-based subsets, respectively, whereas specificity was 85.9%, 96.4% and 72.0%, respectively. Consequently, positive predictive value was relatively low, but negative predictive value was 98.5% (95% CI 92.1-100) overall and 100% (97.5% one-sided CI 87.2-100) and 100% (97.5 one-sided CI 90.2-100) in the two age-based subsets, respectively. Inter-rater reliability was high (intraclass correlation coefficient = 0.98, 95% CI 0.97-0.99) and 95% limits of agreement were reasonably narrow (-1.203 mm to

  10. Design and preliminary analysis of a vaginal inserter for speculum-free cervical cancer screening.

    Directory of Open Access Journals (Sweden)

    Mercy Nyamewaa Asiedu

    Full Text Available Cervical cancer screening usually requires use of a speculum to provide a clear view of the cervix. The speculum is one potential barrier to screening due to fear of pain, discomfort and embarrassment. The aim of this paper is to present and demonstrate the feasibility of a tampon-sized inserter and the POCkeT Colposcope, a miniature pen sized-colposcope, for comfortable, speculum-free and potentially self-colposcopy.We explored different designs using 3D computer-aided design (CAD software and performed mechanical testing simulations on each. Designs were rapid prototyped and tested using a custom vaginal phantom across a range of vaginal pressures and uterine tilts to select an optimal design. Two final designs were tested with fifteen volunteers to assess cervix visualization, comfort and usability compared to the speculum and the optimal design, the curved-tip inserter, was selected for testing in volunteers.We present a vaginal inserter as an alternative to the standard speculum for use with the POCkeT Colposcope. The device has a slim tubular body with a funnel-like curved tip measuring approximately 2.5 cm in diameter. The inserter has a channel through which a 2 megapixel (MP mini camera with LED illumination fits to enable image capture. Mechanical finite element testing simulations with an applied pressure of 15 cm H2O indicated a high factor of safety (90.9 for the inserter. Testing of the device with a custom vaginal phantom, across a range of supine vaginal pressures and uterine tilts (retroverted, anteverted and sideverted, demonstrated image capture with a visual area comparable to the speculum for a normal/axial positioned uteri and significantly better than the speculum for anteverted and sideverted uteri (p<0.00001. Volunteer studies with self-insertion and physician-assisted cervix image capture showed adequate cervix visualization for 83% of patients. In addition, questionnaire responses from volunteers indicated a 92

  11. Preliminary Borehole Disposal In Medium Flow Hydrogeological Condition Using IAEA Screening Tools

    International Nuclear Information System (INIS)

    Nazran Harun; Mohd Abd Wahab Yusof; Norasalwa Zakaria; Mohd Zaidi Ibrahim; Muhammad Fathi Sujan

    2014-01-01

    A screening tool developed by International Atomic Energy Agency (IAEA) has been used to provide means of improving the capacity of Malaysian Nuclear Agency (Nuclear Malaysia) in assessing the potential sites for Borehole Disposal for Disused Sealed Radioactive Sources. It allows the isolation provided by the capsule and disposal container to be evaluated. In addition, it has a conservative model of radionuclide transport with no retardation of radionuclide. Hence, rapid decisions can be made by providing an early indication of the potential suitability of sites based on their hydro-chemical characteristics. The objective of this paper is to identify and determine the types and radionuclide activities of inventory that can be disposed in the borehole. The results of the analysis show the volume of gas doses occur from the disposal and time taken for the cement to be corroded. (author)

  12. Preliminary comparison of different reduction methods of graphene ...

    Indian Academy of Sciences (India)

    diverse applications and developing a simple, green, and efficient method for the mass production of ... properties of graphene have driven the search to find methods ... Chemical reduction of GO sheets has been performed with ... efficient method for the mass production of graphene. 2. ... temperature was raised to 35.

  13. Virtual screening methods as tools for drug lead discovery from large chemical libraries.

    Science.gov (United States)

    Ma, X H; Zhu, F; Liu, X; Shi, Z; Zhang, J X; Yang, S Y; Wei, Y Q; Chen, Y Z

    2012-01-01

    Virtual screening methods have been developed and explored as useful tools for searching drug lead compounds from chemical libraries, including large libraries that have become publically available. In this review, we discussed the new developments in exploring virtual screening methods for enhanced performance in searching large chemical libraries, their applications in screening libraries of ~ 1 million or more compounds in the last five years, the difficulties in their applications, and the strategies for further improving these methods.

  14. Evaluation of Screening Methods for the Detection of Urinary Tract ...

    African Journals Online (AJOL)

    2000-05-30

    screening testsfor urinary tract infection was donefrom March 20 to May 30, 2000. A cross sectional study ... the diagnosis of urinary tract infection on the basis of pyuria alone. The minimum number of ..... infection Complicating. Pregnancy J.

  15. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  16. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    NARCIS (Netherlands)

    Kralj, S.; Geel van - Schutten, G.H.; Maarel, M.J.E.C. van der; Dijkhuizen, L.

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus. Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in α-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate

  17. Preliminary evaluation of a telephone-based smoking cessation intervention in the lung cancer screening setting: A randomized clinical trial.

    Science.gov (United States)

    Taylor, Kathryn L; Hagerman, Charlotte J; Luta, George; Bellini, Paula G; Stanton, Cassandra; Abrams, David B; Kramer, Jenna A; Anderson, Eric; Regis, Shawn; McKee, Andrea; McKee, Brady; Niaura, Ray; Harper, Harry; Ramsaier, Michael

    2017-06-01

    Incorporating effective smoking cessation interventions into lung cancer screening (LCS) programs will be essential to realizing the full benefit of screening. We conducted a pilot randomized trial to determine the feasibility and efficacy of a telephone-counseling (TC) smoking cessation intervention vs. usual care (UC) in the LCS setting. In collaboration with 3 geographically diverse LCS programs, we enrolled current smokers (61.5% participation rate) who were: registered to undergo LCS, 50-77 years old, and had a 20+ pack-year smoking history. Eligibility was not based on readiness to quit. Participants completed pre-LCS (T0) and post-LCS (T1) telephone assessments, were randomized to TC (N=46) vs. UC (N=46), and completed a final 3-month telephone assessment (T2). Both study arms received a list of evidence-based cessation resources. TC participants also received up to 6 brief counseling calls with a trained cessation counselor. Counseling calls incorporated motivational interviewing and utilized the screening result as a motivator for quitting. The outcome was biochemically verified 7-day point prevalence cessation at 3-months post-randomization. Participants (56.5% female) were 60.2 (SD=5.4) years old and reported 47.1 (SD=22.2) pack years; 30% were ready to stop smoking in the next 30 days. TC participants completed an average of 4.4 (SD=2.3) sessions. Using intent-to-treat analyses, biochemically verified quit rates were 17.4% (TC) vs. 4.3% (UC), p<.05. This study provides preliminary evidence that telephone-based cessation counseling is feasible and efficacious in the LCS setting. As millions of current smokers are now eligible for lung cancer screening, this setting represents an important opportunity to exert a large public health impact on cessation among smokers who are at very high risk for multiple tobacco-related diseases. If this evidence-based, brief, and scalable intervention is replicated, TC could help to improve the overall cost

  18. COSMIC EVOLUTION OF DUST IN GALAXIES: METHODS AND PRELIMINARY RESULTS

    International Nuclear Information System (INIS)

    Bekki, Kenji

    2015-01-01

    We investigate the redshift (z) evolution of dust mass and abundance, their dependences on initial conditions of galaxy formation, and physical correlations between dust, gas, and stellar contents at different z based on our original chemodynamical simulations of galaxy formation with dust growth and destruction. In this preliminary investigation, we first determine the reasonable ranges of the most important two parameters for dust evolution, i.e., the timescales of dust growth and destruction, by comparing the observed and simulated dust mass and abundances and molecular hydrogen (H 2 ) content of the Galaxy. We then investigate the z-evolution of dust-to-gas ratios (D), H 2 gas fraction (f H 2 ), and gas-phase chemical abundances (e.g., A O = 12 + log (O/H)) in the simulated disk and dwarf galaxies. The principal results are as follows. Both D and f H 2 can rapidly increase during the early dissipative formation of galactic disks (z ∼ 2-3), and the z-evolution of these depends on initial mass densities, spin parameters, and masses of galaxies. The observed A O -D relation can be qualitatively reproduced, but the simulated dispersion of D at a given A O is smaller. The simulated galaxies with larger total dust masses show larger H 2 and stellar masses and higher f H 2 . Disk galaxies show negative radial gradients of D and the gradients are steeper for more massive galaxies. The observed evolution of dust masses and dust-to-stellar-mass ratios between z = 0 and 0.4 cannot be reproduced so well by the simulated disks. Very extended dusty gaseous halos can be formed during hierarchical buildup of disk galaxies. Dust-to-metal ratios (i.e., dust-depletion levels) are different within a single galaxy and between different galaxies at different z

  19. COSMIC EVOLUTION OF DUST IN GALAXIES: METHODS AND PRELIMINARY RESULTS

    Energy Technology Data Exchange (ETDEWEB)

    Bekki, Kenji [ICRAR, M468, The University of Western Australia, 35 Stirling Highway, Crawley, Western Australia 6009 (Australia)

    2015-02-01

    We investigate the redshift (z) evolution of dust mass and abundance, their dependences on initial conditions of galaxy formation, and physical correlations between dust, gas, and stellar contents at different z based on our original chemodynamical simulations of galaxy formation with dust growth and destruction. In this preliminary investigation, we first determine the reasonable ranges of the most important two parameters for dust evolution, i.e., the timescales of dust growth and destruction, by comparing the observed and simulated dust mass and abundances and molecular hydrogen (H{sub 2}) content of the Galaxy. We then investigate the z-evolution of dust-to-gas ratios (D), H{sub 2} gas fraction (f{sub H{sub 2}}), and gas-phase chemical abundances (e.g., A {sub O} = 12 + log (O/H)) in the simulated disk and dwarf galaxies. The principal results are as follows. Both D and f{sub H{sub 2}} can rapidly increase during the early dissipative formation of galactic disks (z ∼ 2-3), and the z-evolution of these depends on initial mass densities, spin parameters, and masses of galaxies. The observed A {sub O}-D relation can be qualitatively reproduced, but the simulated dispersion of D at a given A {sub O} is smaller. The simulated galaxies with larger total dust masses show larger H{sub 2} and stellar masses and higher f{sub H{sub 2}}. Disk galaxies show negative radial gradients of D and the gradients are steeper for more massive galaxies. The observed evolution of dust masses and dust-to-stellar-mass ratios between z = 0 and 0.4 cannot be reproduced so well by the simulated disks. Very extended dusty gaseous halos can be formed during hierarchical buildup of disk galaxies. Dust-to-metal ratios (i.e., dust-depletion levels) are different within a single galaxy and between different galaxies at different z.

  20. 77 FR 4544 - CPSC Symposium on Phthalates Screening and Testing Methods

    Science.gov (United States)

    2012-01-30

    ... Screening and Testing Methods AGENCY: Consumer Product Safety Commission. ACTION: Notice. SUMMARY: The... symposium on phthalates screening and testing methods. The symposium will be held at the CPSC's National... submit comments, identified by Docket No. CPSC-2012-0008, by any of the following methods: Electronic...

  1. Barriers to Breast and Cervical Cancer Screening in Singapore: a Mixed Methods Analysis.

    Science.gov (United States)

    Malhotra, Chetna; Bilger, Marcel; Liu, Joy; Finkelstein, Eric

    2016-01-01

    In order to increase breast and cervical cancer screening uptake in Singapore, women's perceived barriers to screening need to be identified and overcome. Using data from both focus groups and surveys, we aimed to assess perceived barriers and motivations for breast and cervical cancer screening. We conducted 8 focus groups with 64 women, using thematic analysis to identify overarching themes related to women's attitudes towards screening. Based on recurring themes from focus groups, several hypotheses regarding potential barriers and motivations to screen were generated and tested through a national survey of 801 women aged 25-64. Focus group participants had misconceptions related to screening, believing that the procedures were painful. Cost was an issue, as well as efficacy and fatalism. By identifying barriers to and motivators for screening through a mixed-method design that has both nuance and external validity, this study offers valuable suggestions to policymakers to improve breast and cervical cancer screening uptake in Singapore.

  2. Development of thermal stress screening method. Application of green function method

    International Nuclear Information System (INIS)

    Furuhashi, Ichiro; Shibamoto, Hiroshi; Kasahara, Naoto

    2004-01-01

    This work was achieved for the development of the screening method of thermal transient stresses in FBR components. We proposed an approximation method for evaluations of thermal stress under variable heat transfer coefficients (non-linear problems) using the Green functions of thermal stresses with constant heat transfer coefficients (linear problems). Detailed thermal stress analyses provided Green functions for a skirt structure and a tube-sheet of Intermediate Heat Exchanger. The upper bound Green functions were obtained by the analyses using those upper bound heat transfer coefficients. The medium and the lower bound Green functions were got by the analyses of those under medium and the lower bound heat transfer coefficients. Conventional evaluations utilized the upper bound Green functions. On the other hand, we proposed a new evaluation method by using the upper bound, medium and the lower bound Green functions. The comparison of above results gave the results as follows. The conventional evaluations were conservative and appropriate for the cases under one fluid thermal transient structure such as the skirt. The conventional evaluations were generally conservative for the complicated structures under two or more fluids thermal transients such as the tube-sheet. But the danger locations could exists for the complicated structures under two or more fluids transients, namely the conventional evaluations were non-conservative. The proposed evaluations gave good estimations for these complicated structures. Though above results, we have made the basic documents of the screening method of thermal transient stresses using the conventional method and the new method. (author)

  3. Screening for Depression, Sleep-Related Disturbances, and Anxiety in Patients with Adenocarcinoma of the Pancreas: A Preliminary Study

    Directory of Open Access Journals (Sweden)

    Andrew D. Boyd

    2012-01-01

    Full Text Available Purpose. Screening for depression, sleep-related disturbances, and anxiety in patients with diagnosed adenocarcinoma of the pancreas. Materials and Methods. Patients were evaluated at initial consultation and subsequent visits at the multidisciplinary pancreatic cancer clinic at our University Cancer Center. Cross-sectional and longitudinal psychosocial distress was assessed utilizing Personal Health Questionnaire 9 (PHQ9 to screen for depression and monitor symptoms, the Penn State Worry Questionnaire (PSWQ for generalized anxiety, and the University of Michigan Sleep Questionnaire to monitor sleep symptoms. Results. Twenty-two patients diagnosed with pancreatic cancer participated during the 6-month pilot study with longitudinal followup for thirteen patients. In this study, mild-to-moderate depressive symptoms, anxiety, and potential sleep problems were common. The main finding of the study was 23% of the patients who were part of this pilot project screened positive for moderately severe major depressive symptoms, likely anxiety disorder or a potential sleep disorder during the study. One patient screened positive for moderately severe depressive symptoms in longitudinal followup. Conclusions. Depression, anxiety, and sleep problems are evident in patients with pancreatic cancer. Prospective, longitudinal studies, with larger groups of patients, are needed to determine if these comorbid symptoms impact outcome and clinical course.

  4. Isolation and Preliminary Screening of a Weissella confusa Strain from Giant Panda (Ailuropoda melanoleuca).

    Science.gov (United States)

    Xiong, Lvchen; Ni, Xueqin; Niu, Lili; Zhou, Yi; Wang, Qiang; Khalique, Abdul; Liu, Qian; Zeng, Yan; Shu, Gang; Pan, Kangcheng; Jing, Bo; Zeng, Dong

    2018-04-13

    Weissella confusa has recently received attention for its probiotic potential. Some W. confusa and Weissella cibaria strains isolated from fermented foods show favorable probiotic effects. However, the probiotic properties of W. confusa isolated from giant panda remain unreported to date. Thus, this study isolated a W. confusa strain from giant panda feces and then investigated its characteristics and probiotic properties. A lactic acid bacteria strain was isolated from giant panda fecal samples. The isolated strain was screened by in vitro probiotic property tests, including in vitro antimicrobial test, antioxidant test, surface hydrophobicity, and stress resistance. On the basis of biochemical identification and 16S rDNA sequencing, the W. confusa strain was identified as BSP201703. This Weissella confusa strain can survive at pH 2 and 0.3% (w/v) concentration of bile salt environment and inhibit common intestinal pathogens. It also possesses an in vitro antioxidant capacity, a high auto-aggregation ability, and a high surface hydrophobicity. BSP201703 might serve as a probiotic to giant pandas.

  5. Applying Data-driven Imaging Biomarker in Mammography for Breast Cancer Screening: Preliminary Study.

    Science.gov (United States)

    Kim, Eun-Kyung; Kim, Hyo-Eun; Han, Kyunghwa; Kang, Bong Joo; Sohn, Yu-Mee; Woo, Ok Hee; Lee, Chan Wha

    2018-02-09

    We assessed the feasibility of a data-driven imaging biomarker based on weakly supervised learning (DIB; an imaging biomarker derived from large-scale medical image data with deep learning technology) in mammography (DIB-MG). A total of 29,107 digital mammograms from five institutions (4,339 cancer cases and 24,768 normal cases) were included. After matching patients' age, breast density, and equipment, 1,238 and 1,238 cases were chosen as validation and test sets, respectively, and the remainder were used for training. The core algorithm of DIB-MG is a deep convolutional neural network; a deep learning algorithm specialized for images. Each sample (case) is an exam composed of 4-view images (RCC, RMLO, LCC, and LMLO). For each case in a training set, the cancer probability inferred from DIB-MG is compared with the per-case ground-truth label. Then the model parameters in DIB-MG are updated based on the error between the prediction and the ground-truth. At the operating point (threshold) of 0.5, sensitivity was 75.6% and 76.1% when specificity was 90.2% and 88.5%, and AUC was 0.903 and 0.906 for the validation and test sets, respectively. This research showed the potential of DIB-MG as a screening tool for breast cancer.

  6. Landscape Diversity as a Screening Tool to Assess Agroecosystems Sustainability; Preliminary Study in Central Italy

    Directory of Open Access Journals (Sweden)

    Francesco Visicchio

    2007-06-01

    Full Text Available Modernization of agricultural activities has strongly modified agricultural landscapes. Intensive agriculture, with the increased use of inorganic fertiliser and density of livestock, affects water quality discharging nutrients such as nitrogen and phosphorus in water bodies. Nutrients in rivers, subsequently, are excellent indicators to assess sustainability/ land-use intensity in agroecosystems. Landscape, however, is a dynamic system and is the product of interaction amongst the natural environment and human activities, including farming which is a main driving force. At present not much has been investigated on the predictive role of landscape on land-use intensity. Aim of this study is to determine if, in Italian agroecosystem, landscape complexity can be related to land-use intensity. Indexes of landscape complexity (i.e. edge density, number of patches, Shannon’s diversity index, Interspersion-Juxtaposition index derived by processing Corine Land Cover data (level IV, 1:25.000 of Lazio Region, were related with landuse intensity (values of compounds of nitrogen and phosphorus and other parameters found in rivers monitored in accordance to European Directives on Waste Water. Results demonstrate that some landscape indexes were related to some environment parameters. Consequently landscape complexity, with further investigation, could be an efficient screening tool, at large scale, to assess water quality and ultimately agroecosystems sustainability in the absence of monitoring stations.

  7. Preliminary Blood Pressure Screening in a Representative Sample of Extremely Obese Kuwaiti Adolescents

    Directory of Open Access Journals (Sweden)

    Rima Abdul Razzak

    2013-01-01

    Full Text Available A relationship between blood pressure (BP and obesity has been found in young adults, but no data are available for adolescents in Kuwait. 257 adolescent (11–19 years participants were categorized into two groups according to their BMI; 48 nonobese (21 males: 43.7% and 27 females: 56.3% with mean age of years and 209 obese (128 males: 61.25% and 81 females: 38.75% with mean age of years. The mean BMI was  kg/m2 for the nonobese group and  kg/m3 for the obese group. Most BP measures based on a single screening were significantly higher in the obese group. The prevalence of elevated BP was significantly higher in the obese subjects (nonobese: 13%; obese: 63%; . In the obese group, there was a significant positive correlation between total sample BMI and all BP measures except the pulse pressure. There was a similar rate of elevated blood pressure between males and females (64% versus 60%; . For both isolated systolic elevated BP and isolated diastolic elevated BP, the prevalences were comparable between the males (systolic: 42%; diastolic: 5% and females (systolic: 34%; diastolic: 14%. Only systolic BP was positively correlated with BMI in obese adolescent males (Spearman ; , with a significant correlation between BMI with diastolic (Spearman ; and mean BP (Spearman ; in females.

  8. Preliminary Design of the HiLumi-LHC Triplet Area Beam Screen

    CERN Document Server

    Kersevan, R; Kos, N

    2014-01-01

    The so-called beam screen (BS) is a proven solution for intercepting the thermal loads caused by the circulating beams in the cryogenically-cooled sections of the LHC and minimizing dynamic vacuum effects [1]. The new triplet area foreseen for the HiLumi-LHC (HL-LHC) machine upgrade [2] has the additional feature of needing internal tungsten shields to reduce the amount of collision debris which is deflected by the high-gradient triplet magnets towards the superconducting magnets' cold masses and coils. The very aggressive optics design, based on large beam separations, calls for a maximum of physical space to remain available to the counter rotating beams in the common BS. This places severe constraints to the fabrication and installation tolerances of the BS itself, in addition to affecting the design and routing of the cryogenic lines in the area. The latest version of the BS design will be shown and discussed, together with future plans for testing materials, fabrication procedures, and installation.

  9. Danish method study on cervical screening in women offered HPV vaccination as girls (Trial23)

    DEFF Research Database (Denmark)

    Thamsborg, Lise Holst; Andersen, Berit; Larsen, Lise Grupe

    2018-01-01

    arm) or present screening plus an HPV test (HPV arm). The study started 1 February 2017 and will run over three screening rounds corresponding to 7-8 years. ANALYSES: The primary endpoint is cervical intraepithelial neoplasia grade 3 or above. The trial is undertaken as a non-inferiority study......INTRODUCTION: The first birth cohorts of women offered human papillomavirus (HPV) vaccination as girls are now entering cervical screening. However, there is no international consensus on how to screen HPV vaccinated women. These women are better protected against cervical cancer and could...... vaccination as girls. METHODS: Trial23 is a method study embedded in the existing cervical screening programme in four out of five Danish regions. Without affecting the screening programme, women born in 1994 are randomised to present screening with liquid-based cytology every third year (present programme...

  10. Screening of Potential Remediation Methods for the 200-ZP-1 Operable Unit at the Hanford Site

    Energy Technology Data Exchange (ETDEWEB)

    Truex, Michael J.; Nimmons, Michael J.; Johnson, Christian D.; Dresel, P EVAN.; Murray, Christopher J.

    2006-08-07

    A screening-level evaluation of potential remediation methods for application to the contaminants of concern (COC) in the 200-ZP-1 Operable Unit at the Hanford Site was conducted based on the methods outlined in the Guidance for Conducting Remedial Investigations and Feasibility Studies under CERCLA Interim Final. The scope of this screening was to identify the most promising remediation methods for use in the more detailed analysis of remediation alternatives that will be conducted as part of the full feasibility study. The screening evaluation was conducted for the primary COC (potential major risk drivers). COC with similar properties were grouped for the screening evaluation. The screening evaluation was conducted in two primary steps. The initial screening step evaluated potential remediation methods based on whether they can be effectively applied within the environmental setting of the 200-ZP-1 Operable Unit for the specified contaminants. In the second step, potential remediation methods were screened using scoping calculations to estimate the scale of infrastructure, overall quantities of reagents, and conceptual approach for applying the method for each defined grouping of COC. Based on these estimates, each method was screened with respect to effectiveness, implementability, and relative cost categories of the CERCLA feasibility study screening process defined in EPA guidance.

  11. A preliminary study on method of saturated curve

    International Nuclear Information System (INIS)

    Cao Liguo; Chen Yan; Ao Qi; Li Huijuan

    1987-01-01

    It is an effective method to determine directly the absorption coefficient of sample with the matrix effect correction. The absorption coefficient is calculated using the relation of the characteristic X-ray intensity with the thickness of samples (saturated curve). The method explains directly the feature of the sample and the correction of the enhanced effect in certain condition. The method is not as same as the usual one in which the determination of the absorption coefficient of sample is based on the procedure of absorption of X-ray penetrating sample. The sensitivity factor KI 0 is discussed. The idea of determinating KI o by experiment and quasi-absoluted measurement of absorption coefficient μ are proposed. The experimental results with correction in different condition are shown

  12. A Survey on Physical Factors and Compressed Breast Thickness in Voluntary Mammography Screening Using FFDM System in Malaysia: Preliminary Results

    International Nuclear Information System (INIS)

    Noriah Jamal; Humairah Samad Cheung; Siti Kamariah Che Mohamad; Ellyda Muhamad Nordin

    2013-01-01

    This paper aims at presenting preliminary results of a survey on physical factors, namely tube potential (kV), tube current exposure time product (mAs) and compressed breast thickness (CBT) during voluntary mammography screening using Full-Field Digital Mammography (FFDM) System in Malaysia. Retrospective data were collected from 1128 FFDM images of 282 women from three major ethnic groups (Malay, Chinese and Indian) who underwent voluntary screening mammography at Breast Centre, International Islamic University Malaysia from January to March 2008. Results from the present study were then compared with results from the previous study on Screen-Film Mammography System (SFM) according to the ethnic group for both Cranio-caudal (CC) and Mediol-Lateral (MLO) views. We found that the mean kV for CC view for the three ethnic groups are Malay (28), Chinese (28) and Indian (28), and for MLO view are Malay (29), Chinese (28) and Indian (29). These values are higher than the kV for SFM which were Malay (26), Chinese (27) and Indian (26) for CC and Malay (26), Chinese (27) and Indian (26) for CC and MLO views respectively. The mean mAs for CC and MLO views for FFDM were lower compared to SFM systems. These values were Malay (104), Chinese (108) and Indian (91) for CC views and Malay (106), Chinese (105), and Indian (94) for MLO views for the FFDM system. The values for SFM system are for CC and MLO views were Malay (120), Chinese (106) and Indian (126), and Malay (166), Chinese (132), Indian (183) respectively. The median CBT for CC and MLO views increased by 27 % and 7 % respectively on the FFDM compared to the SFM system. In conclusion, the FFDM operates with higher kV, lower mAs, and higher CBT when compared with SFM system. Median CBT on CC and MLO view with FFDM system are 27 % and 7 % higher respectively compared to the SFM. We are currently collecting data on mean glandular dose with FFDM systems to assess how the change in local mammography practice influences this

  13. A comparison of two psychological screening methods currently used for inpatients in a UK burns service.

    Science.gov (United States)

    Shepherd, Laura; Tew, Victoria; Rai, Lovedeep

    2017-12-01

    Various types of psychological screening are currently used in the UK to identify burn patients who are experiencing psychological distress and may need additional support and intervention during their hospital admission. This audit compared two types of psychological screening in 40 burn inpatients. One screening method was an unpublished questionnaire designed to explore multiple areas of potential distress for those who have experienced burns. The other method was an indirect psychological screen via discussions within multi-disciplinary team (MDT) meetings where a Clinical Psychologist was present to guide and prompt psychological discussions. Data was collected between November 2012 and September 2016. Results suggested that both screening methods were similar in identifying patients who benefit from more formal psychological assessment. Indeed, statistical analysis reported no difference between the two screening methods (N=40, p=.424, two-tailed). In conclusion, measuring distress in burns inpatients using a burns-specific questionnaire and psychological discussions within MDT meetings are similar in their ability to identify patients in need of more thorough psychological assessment. However, both screening methods identified patients who were in need of psychological input when the other did not. This suggests that psychological screening of burns inpatients, and the psychological difficulties that they can present with, is complex. The advantages and disadvantages of both methods of screening are discussed. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  14. Preliminary comparison of different reduction methods of graphene

    Indian Academy of Sciences (India)

    The reduction of graphene oxide (GO) is a promising route to bulk produce graphene-based sheets. Different reduction processes result in reduced graphene oxide (RGO) with different properties. In this paper three reduction methods, chemical, thermal and electrochemical reduction, were compared on three aspects ...

  15. A new promising screening method for cognitive functioning in elderly patients

    NARCIS (Netherlands)

    Kuin, Y.; Nijsten, J.M.H.; Stok-Koch, E.G.H.J.; Jansen, R.W.M.M.

    1996-01-01

    The Mini Mental State Examination (MMSE) is frequently used as a screening method to detect cognitive dysfunctioning. However, the MMSE has limited sensitivity to detect mild impairment. We aimed to develop a new screening method to discriminate between normal and mild cognitive functioning in older

  16. MASS SPECTROMETRY PROTEOMICS METHOD AS A RAPID SCREENING TOOL FOR BACTERIAL CONTAMINATION OF FOOD

    Science.gov (United States)

    2017-06-01

    MASS SPECTROMETRY PROTEOMICS METHOD AS A RAPID SCREENING TOOL FOR BACTERIAL CONTAMINATION OF FOOD ECBC-TR...TITLE AND SUBTITLE Mass Spectrometry Proteomics Method as a Rapid Screening Tool for Bacterial Contamination of Food 5a. CONTRACT NUMBER 5b...the MSPM to correctly classify whether or not food samples were contaminated with Salmonella enterica serotype Newport in this blinded pilot study

  17. A simple method to estimate the episode and programme sensitivity of breast cancer screening programmes.

    Science.gov (United States)

    Zorzi, Manuel; Guzzinati, Stefano; Puliti, Donella; Paci, Eugenio

    2010-01-01

    The estimation of breast cancer screening sensitivity is a major aim in the quality assessment of screening programmes. The proportional incidence method for the estimation of the sensitivity of breast cancer screening programmes is rarely used to estimate the underlying incidence rates. We present a method to estimate episode and programme sensitivity of screening programmes, based solely on cancers detected within screening cycles (excluding breast cancer cases at prevalent screening round) and on the number of incident cases in the total target population (steady state). The assumptions, strengths and limitations of the method are discussed. An example of calculation of episode and programme sensitivities is given, on the basis of the data from the IMPACT study, a large observational study of breast cancer screening programmes in Italy. The programme sensitivity from the fifth year of screening onwards ranged between 41% and 48% of the total number of cases in the target population. At steady state episode sensitivity was 0.70, with a trend across age groups, with lowest values in women aged 50-54 years (0.52) and highest in those 65-69 (0.77). The method is a very serviceable tool for estimating sensitivity in service screening programmes, and the results are comparable with those of other methods of estimation.

  18. Three screening methods for cognitive dysfunction using the Mini-Mental State Examination and Korean Dementia Screening Questionnaire.

    Science.gov (United States)

    Choi, Seong Hye; Park, Moon Ho

    2016-02-01

    To screen for and determine cognitive dysfunction, cognitive tests and/or informant reports are commonly used. However, these cognitive tests and informant reports are not always available. The present study investigated three screening methods using the Mini-Mental State Examination (MMSE) as the cognitive test, and the Korean dementia screening questionnaire (KDSQ) as the informant report. Participants were recruited from the Korea Clinical Research Center for Dementia of South Korea, and included 2861 patients with Alzheimer's disease (dementia), 3519 patients with mild cognitive impairment and 1375 controls with no cognitive dysfunction. Three screening methods were tested: (i) MMSE alone (MMSE(cut-off) ); (ii) a conventional combination of MMSE and KDSQ (MMSE+KDSQ(cut-off) ); and (iii) a decision tree with MMSE and KDSQ (MMSE+KDSQ(decision tree) ). For discriminating any cognitive dysfunction from controls, MMSE+KDSQ(cut-off) had the highest area under the receiver operating characteristic curve (0.784). For discriminating dementia from controls, MMSE+KDSQ(cut-off) had the highest area under the receiver operating characteristic curve (0.899). For discriminating mild cognitive impairment from controls, MMSE(cut-off) had the highest area under the receiver operating characteristic curve (0.683). MMSE+KDSQ(decision tree) showed the highest sensitivity for all discriminations. For overall classification accuracy, MMSE+KDSQ(decision tree) had the highest value (70.0%). These three methods had different advantageous properties for screening and staging cognitive dysfunction. As there might be different availability across clinical settings, these three methods can be selected and used according to situational needs. © 2015 Japan Geriatrics Society.

  19. A method for calculating effective lifetime risk of radiation-induced cancer from screening mammography

    International Nuclear Information System (INIS)

    Ali, R.M.; England, A.; McEntee, M.F.; Hogg, P.

    2015-01-01

    Purpose: To propose a method for evaluating the effective lifetime risk of radiation-induced cancer from screening mammography and to present initial data for the UK National Breast Screening Programme. Material and methods: The imaging was undertaken using a Hologic Selenia full field digital mammographic unit. The proposed method utilises an ATOM phantom containing thermoluminescent dosimeters and a perspex-polyethylene breast phantom to measure organ doses during a standard four view screening mammogram. Effective dose was calculated and effective risk was modelled for a range of client ages. The total lifetime effective risk was then calculated for the UK national screening programme. Calculation of effective risk includes the radiation dose to examined and contralateral breasts in addition to other body organs; this is an advantage over the mean glandular dose. Results: The contralateral breast, thyroid, thymus, brain, lung, salivary glands, and bone marrow all receive more than 1 μGy radiation dose during screening mammography. A major difference exists for total effective lifetime risk of radiation-induced cancer between clients with average and high breast cancer risk. Differences are attributed to the commencement age of screening and time interval between screens. Conclusion: This study proposes a method to evaluate effective lifetime risk of radiation-induced cancer from screening mammography in order to compare different mammography screening programmes. - Highlights: • We proposed a method for the calculation of radiation-induced cancer from screening mammography. • We measured the radiation absorbed dose of different organs during screening mammography. • There are major differences between mammography screening programme categories with regard to radiation effective risk.

  20. Specification and Preliminary Validation of IAT (Integrated Analysis Techniques) Methods: Executive Summary.

    Science.gov (United States)

    1985-03-01

    conceptual framwork , and preliminary validation of IAT concepts. Planned work for FY85, including more extensive validation, is also described. 20...Developments: Required Capabilities .... ......... 10 2-1 IAT Conceptual Framework - FY85 (FEO) ..... ........... 11 2-2 Recursive Nature of Decomposition...approach: 1) Identify needs & requirements for IAT. 2) Develop IAT conceptual framework. 3) Validate IAT methods. 4) Develop applications materials. To

  1. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    OpenAIRE

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...

  2. Performance of machine learning methods for ligand-based virtual screening.

    Science.gov (United States)

    Plewczynski, Dariusz; Spieser, Stéphane A H; Koch, Uwe

    2009-05-01

    Computational screening of compound databases has become increasingly popular in pharmaceutical research. This review focuses on the evaluation of ligand-based virtual screening using active compounds as templates in the context of drug discovery. Ligand-based screening techniques are based on comparative molecular similarity analysis of compounds with known and unknown activity. We provide an overview of publications that have evaluated different machine learning methods, such as support vector machines, decision trees, ensemble methods such as boosting, bagging and random forests, clustering methods, neuronal networks, naïve Bayesian, data fusion methods and others.

  3. High-throughput method for optimum solubility screening for homogeneity and crystallization of proteins

    Science.gov (United States)

    Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA

    2012-01-31

    An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.

  4. "PRELIMINARY SCREENING FOR THE LEVELS OF TESTOSTERONE HORMONE IN THE MARKET MEAT IN TEHRAN "

    Directory of Open Access Journals (Sweden)

    M. R. Oveisi

    2007-06-01

    Full Text Available Many xenobiotic and natural compounds such as testosterone have been used and sometime misused to improve the growth of cattle and other livestock animals. In order to control the testosterone hormone residues in meat and to ensure the safety of Iranian consumers, a monitoring system must be put in place to address the concerns. The present study was undertaken to detect and quantify the levels of testosterone residue in the market meat. Cattle meat samples were collected randomly from the market in Tehran. A total of 120 samples of cattle meat were analyzed for the level of testosterone by Enzyme-linked immuno sorbent assay (ELISA method. The average experimental value of testosterone in cattle meat was 810.9 ng/kg. The average value of cattle meat testosterone was significantly upper than FDA (Food and Drug Administration allowable level but was in agreement with the values proposed by JESFA (Joint Expert Committee on Food Additives. So it seems that the present status of this anabolic hormone in market meat is not at risk but there is need to routinely monitor this chemical as a food quality control measure.

  5. Novel Data Mining Methods for Virtual Screening of Biological Active Chemical Compounds

    KAUST Repository

    Soufan, Othman M.

    2016-11-23

    Drug discovery is a process that takes many years and hundreds of millions of dollars to reveal a confident conclusion about a specific treatment. Part of this sophisticated process is based on preliminary investigations to suggest a set of chemical compounds as candidate drugs for the treatment. Computational resources have been playing a significant role in this part through a step known as virtual screening. From a data mining perspective, availability of rich data resources is key in training prediction models. Yet, the difficulties imposed by big expansion in data and its dimensionality are inevitable. In this thesis, I address the main challenges that come when data mining techniques are used for virtual screening. In order to achieve an efficient virtual screening using data mining, I start by addressing the problem of feature selection and provide analysis of best ways to describe a chemical compound for an enhanced screening performance. High-throughput screening (HTS) assays data used for virtual screening are characterized by a great class imbalance. To handle this problem of class imbalance, I suggest using a novel algorithm called DRAMOTE to narrow down promising candidate chemicals aimed at interaction with specific molecular targets before they are experimentally evaluated. Existing works are mostly proposed for small-scale virtual screening based on making use of few thousands of interactions. Thus, I propose enabling large-scale (or big) virtual screening through learning millions of interaction while exploiting any relevant dependency for a better accuracy. A novel solution called DRABAL that incorporates structure learning of a Bayesian Network as a step to model dependency between the HTS assays, is showed to achieve significant improvements over existing state-of-the-art approaches.

  6. Evaluation of Quantitative Environmental Stress Screening (ESS) Methods. Volume 1

    Science.gov (United States)

    1991-11-01

    required information on screening strength from the curvefitting parameters. The underlying theory and approach taken are discussed in Appendix A. To...in field 1020 arm St.,Vas AJ Ptr 0.4i Currpnt. c- ugt ~ing DU?/SYS 2.7264 Wll/IY.3 at Factory Stress- NaxiLMw outgoing W?is’ys 0.288 DrW/5?S at Field...182 125 K.W.Fertig and V.X. Murthy, Models for Reliability Growth During Burn-in: Theory and Applicat’ons,Proceedings 1978 Annual Reliability and

  7. Comparative analysis of machine learning methods in ligand-based virtual screening of large compound libraries.

    Science.gov (United States)

    Ma, Xiao H; Jia, Jia; Zhu, Feng; Xue, Ying; Li, Ze R; Chen, Yu Z

    2009-05-01

    Machine learning methods have been explored as ligand-based virtual screening tools for facilitating drug lead discovery. These methods predict compounds of specific pharmacodynamic, pharmacokinetic or toxicological properties based on their structure-derived structural and physicochemical properties. Increasing attention has been directed at these methods because of their capability in predicting compounds of diverse structures and complex structure-activity relationships without requiring the knowledge of target 3D structure. This article reviews current progresses in using machine learning methods for virtual screening of pharmacodynamically active compounds from large compound libraries, and analyzes and compares the reported performances of machine learning tools with those of structure-based and other ligand-based (such as pharmacophore and clustering) virtual screening methods. The feasibility to improve the performance of machine learning methods in screening large libraries is discussed.

  8. Time-resolved luminescence screening method for enrofloxacin in beef serum

    Science.gov (United States)

    Enrofloxacin is one of only two fluoroquinolone antibiotics approved for use in cattle in the U.S. Microbial screening methods currently used in the U.S. for monitoring veterinary drug residues are not sensitive or selective for fluoroquinolones. In this work, a luminescence-based screening assay ...

  9. Comparison of screening methods for anaemia in pregnant women in Awassa, Ethiopia

    NARCIS (Netherlands)

    Gies, S.; Brabin, B. J.; Yassin, M. A.; Cuevas, L. E.

    2003-01-01

    Screening for anaemia in pregnancy is essential for implementing and monitoring effective antenatal programmes. We compared the diagnostic accuracy of invasive and non-invasive screening methods in a cross-sectional survey of 403 pregnant women attending an urban health centre in Awassa, southern

  10. An approximate-reasoning-based method for screening high-level waste tanks for flammable gas

    International Nuclear Information System (INIS)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    1998-01-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at Hanford have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop an improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. AR models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. The authors performed a pilot study to investigate the utility of AR for flammable gas screening. They found that the effort to implement such a model was acceptable and that computational requirements were reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts

  11. An approximate reasoning-based method for screening high-level-waste tanks for flammable gas

    International Nuclear Information System (INIS)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    2000-01-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at the Hanford site have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop and improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. Approximate-reasoning models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. In a pilot study to investigate the utility of AR for flammable gas screening, the effort to implement such a model was found to be acceptable, and computational requirements were found to be reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts

  12. An Approximate Reasoning-Based Method for Screening High-Level-Waste Tanks for Flammable Gas

    International Nuclear Information System (INIS)

    Eisenhawer, Stephen W.; Bott, Terry F.; Smith, Ronald E.

    2000-01-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at the Hanford site have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop an improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. Approximate-reasoning models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. In a pilot study to investigate the utility of AR for flammable gas screening, the effort to implement such a model was found to be acceptable, and computational requirements were found to be reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts

  13. An approximate reasoning-based method for screening high-level-waste tanks for flammable gas

    Energy Technology Data Exchange (ETDEWEB)

    Eisenhawer, S.W.; Bott, T.F.; Smith, R.E.

    2000-06-01

    The in situ retention of flammable gas produced by radiolysis and thermal decomposition in high-level waste can pose a safety problem if the gases are released episodically into the dome space of a storage tank. Screening efforts at the Hanford site have been directed at identifying tanks in which this situation could exist. Problems encountered in screening motivated an effort to develop and improved screening methodology. Approximate reasoning (AR) is a formalism designed to emulate the kinds of complex judgments made by subject matter experts. It uses inductive logic structures to build a sequence of forward-chaining inferences about a subject. Approximate-reasoning models incorporate natural language expressions known as linguistic variables to represent evidence. The use of fuzzy sets to represent these variables mathematically makes it practical to evaluate quantitative and qualitative information consistently. In a pilot study to investigate the utility of AR for flammable gas screening, the effort to implement such a model was found to be acceptable, and computational requirements were found to be reasonable. The preliminary results showed that important judgments about the validity of observational data and the predictive power of models could be made. These results give new insights into the problems observed in previous screening efforts.

  14. Optical method for the screening of doping substances

    Science.gov (United States)

    Lademann, J.; Shevtsova, J.; Patzelt, A.; Richter, H.; Gladkowa, N. D.; Gelikonov, V. M.; Gonchukov, S. A.; Sterry, W.; Blume-Peytavi, U.

    2008-12-01

    During the last years, an increased misuse of doping substances in sport has been observed. The action of doping substances characterized by the stimulation of blood flow and metabolic processes is also reflected in the hair structure. In the present study it was demonstrated that optical coherent tomography is well suited for the analysis of hair parameters influenced by doping. Analyzing 20 patients, systemically treated with steroids which also represent doping substances, it was found that in all cases a significant increase in the cross-section of the hairs could be detected. The results obtained in the study are not only important for the screening of doping substances but also for medical diagnostics and control of compliance of patients.

  15. Optical method for the screening of doping substances

    International Nuclear Information System (INIS)

    Lademann, J; Patzelt, A; Richter, H; Sterry, W; Shevtsova, J; Gladkowa, N D; Gelikonov, V M; Gonchukov, S A; Blume-Peytavi, U

    2008-01-01

    During the last years, an increased misuse of doping substances in sport has been observed. The action of doping substances characterized by the stimulation of blood flow and metabolic processes is also reflected in the hair structure. In the present study it was demonstrated that optical coherent tomography is well suited for the analysis of hair parameters influenced by doping. Analyzing 20 patients, systemically treated with steroids which also represent doping substances, it was found that in all cases a significant increase in the cross-section of the hairs could be detected. The results obtained in the study are not only important for the screening of doping substances but also for medical diagnostics and control of compliance of patients

  16. Method for screening inhibitors of the toxicity of Bacillus anthracis

    Science.gov (United States)

    Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

    2001-01-01

    The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

  17. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    Science.gov (United States)

    Reynolds, Fiona; Stanistreet, Debbi; Elton, Peter

    2008-01-01

    Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning disabilities. It was carried out in Bury, Heywood-and-Middleton and Rochdale. Methods Carried out using retrospective cohort study methods, women with learning disabilities were identified by Read code; and their cervical screening records were compared with the Call-and-Recall records of women without learning disabilities in order to examine their screening histories. Analysis was carried out using case-control methods – 1:2 (women with learning disabilities: women without learning disabilities), calculating odds ratios. Results 267 women's records were compared with the records of 534 women without learning disabilities. Women with learning disabilities had an odds ratio (OR) of 0.48 (Confidence Interval (CI) 0.38 – 0.58; X2: 72.227; p.value learning disabilities. Conclusion The reasons given for ceasing and/or not screening suggest that merely being coded as having a learning disability is not the sole reason for these actions. There are training needs among smear takers regarding appropriate reasons not to screen and providing screening for women with learning disabilities. PMID:18218106

  18. Evaluating the impact of an educational intervention to increase CRC screening rates in the African American community: a preliminary study.

    Science.gov (United States)

    Philip, Errol J; DuHamel, Katherine; Jandorf, Lina

    2010-10-01

    Despite the acknowledged importance of colorectal cancer (CRC) screening and its proven prognostic benefit, African American men and women simultaneously possess the highest rates of CRC-related incidence and mortality (Swan et al. in Cancer 97(6):1528-1540, 2003) and lowest screening rates in the United States (Polite et al. in Med Clin N Am 89(4):771-793, 2005). Effective, targeted interventions that promote CRC screening for this community are therefore critical. The current study evaluated the impact of a print-based educational intervention on screening behavior and associated patient-based factors, including cancer-related knowledge, fatalism, worry, and decisional balance (pros-cons). One hundred and eighteen individuals (mean age = 56.08, SD = 5.58) who had not undergone screening were recruited from two health clinics in New York City. Each participant received educational print materials regarding the need for screening, the process of undergoing screening, and the benefits of regular CRC screening. One in four individuals had undergone post-intervention screening at a three-month follow-up. Whereas all participants reported a decrease in cancer-related worry (p benefits and barriers of screening may be critical in the decision to undergo CRC screening. Future interventions to increase CRC-screening rates for this community may be improved by focusing on these patient-based factors.

  19. DRABAL: novel method to mine large high-throughput screening assays using Bayesian active learning

    KAUST Repository

    Soufan, Othman; Ba Alawi, Wail; Afeef, Moataz A.; Essack, Magbubah; Kalnis, Panos; Bajic, Vladimir B.

    2016-01-01

    Mining high-throughput screening (HTS) assays is key for enhancing decisions in the area of drug repositioning and drug discovery. However, many challenges are encountered in the process of developing suitable and accurate methods

  20. Environmental Justice Screening Method (EJSM) Score, San Joaquin Valley CA, 2013, Occidental College and UC Berkeley

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Cumulative Impacts (CI) screening method is jointly being developed by Manuel Pastor, Jim Sadd (Occidental College), and Rachel Morello-Frosch (UC Berkeley) ....

  1. Improving Indigenous access to cancer screening and treatment services: descriptive findings and a preliminary report on the Midwest Indigenous Women’s Cancer Support Group

    Directory of Open Access Journals (Sweden)

    Lisabeth D Finn

    2008-01-01

    Full Text Available BackgroundHigher cancer morbidity and mortality rates for the Indigenous population comparedto the overall Australian population has underlined the critical need to improve accessfor Aboriginal people to cancer treatment services. This paper describes anIndigenous Women’s Cancer Support Group (IWCSG established to supportIndigenous people with cancer and their carers/relatives and to facilitate Aboriginalaccess to cancer screening and treatment. Preliminary findings from an evaluation ofthe group are presented.MethodsThe study employed qualitative research methods to describe IWCSG operations andinvestigate the group’s effectiveness. It included one-on-one interviews with 11Geraldton-based health service providers, the IWCSG coordinator, and 10 womenwho have been linked to IWCSG support, as well as observation of group meetings.ResultsDescriptive outcomes relate to group operations, group effectiveness, group benefitsand future development of the group. A cultural strength of IWCSG is its ability tooperate confidentially behind the scenes, providing emotional support and practicalhelp directly to Indigenous people concerned about privacy and shame issues. Theimportant cultural role IWCSG plays in overcoming communication and othercultural barriers to accessing cancer treatment was unanimously recognised by healthservice providers. Aboriginal women supported by IWCSG spoke about an increasedsense of safety, trust and support in accessing and navigating mainstream cancerservices. A critical issue emerging from the research is the need for further development of effective collaborative working relationships between IWCSGmembers and health service providers.ConclusionsThe IWCSG has the potential to inform an effective model for facilitating Indigenousaccess both to cancer treatment and to mainstream treatment for a variety of healthproblems. Future research is required to explore the applicability of Indigenoussupport groups and to focus on the

  2. Method of evaluation of structural (screen) and quantum graininess of X-ray pictures

    Energy Technology Data Exchange (ETDEWEB)

    Gurvich, A M; Shamanov, A A; Erofeeva, N D [Nauchno-Issledovatel' skij Inst. Rentgenologii i Radiologii, Moscow (USSR)

    1979-03-01

    Proposed is a method for quantitative determination of graininess of X-ray pictures (gamma-ray images), the graininess being conditioned by the structure of amplifying screens and quantum fluctuations. The method is based on the determination of threshold brightness at which the picture graininess becomes obvious. It is shown that at low effective quantum energy (Esub(eff.) <= 50 keV) the graininess observed is for the most part structural (screen). Its growth is connected with quantum fluctuations when increasing Esub(eff.) up to 150 keV and using screens with high output values of X-ray luminescence and the coefficient of spectral accordance to the film.

  3. Preliminary screening of Ni(II metal tolerance and dye-decolorizing by Nocardiopsis sp. SD8

    Directory of Open Access Journals (Sweden)

    Ramasamy Thangaraj

    2016-04-01

    Full Text Available Objective: To reveal the screening of metal tolerance and dye-decolorizing of Nocardiopsis sp. Methods: NiSO4 and Congo red dye were used for evaluating the metal tolerance and dyedecolorizing of the randomly selected actinobacterial isolates. Results: Nocardiopsis sp. SD8 showed a better efficiency in Ni(II tolerance, though a longer lag phase was observed for this microorganism grown for 7 days in integrated mismatch negativity. Interestingly, we also found that Nocardiopsis sp. SD8 had dye-decolorizing, hemolytic, lipase and protease activity. Conclusions: The present results revealed the bioremediation of metal resistant and diverse properties of Nocardiopsis sp. SD8 and further investigations are needed to extract and identify the potent molecule.

  4. Development and evaluation of nursing user interface screens using multiple methods.

    Science.gov (United States)

    Hyun, Sookyung; Johnson, Stephen B; Stetson, Peter D; Bakken, Suzanne

    2009-12-01

    Building upon the foundation of the Structured Narrative Electronic Health Record (EHR) model, we applied theory-based (combined Technology Acceptance Model and Task-Technology Fit Model) and user-centered methods to explore nurses' perceptions of functional requirements for an electronic nursing documentation system, design user interface screens reflective of the nurses' perspectives, and assess nurses' perceptions of the usability of the prototype user interface screens. The methods resulted in user interface screens that were perceived to be easy to use, potentially useful, and well-matched to nursing documentation tasks associated with Nursing Admission Assessment, Blood Administration, and Nursing Discharge Summary. The methods applied in this research may serve as a guide for others wishing to implement user-centered processes to develop or extend EHR systems. In addition, some of the insights obtained in this study may be informative to the development of safe and efficient user interface screens for nursing document templates in EHRs.

  5. An efficient method for qualitative screening of phosphate-solubilizing bacteria.

    Science.gov (United States)

    Mehta, S; Nautiyal, C S

    2001-07-01

    An efficient protocol was developed for qualitative screening of phosphate-solubilizing bacteria, based upon visual observation. Our results indicate that, by using our formulation containing bromophenol blue, it is possible to quickly screen on a qualitative basis the phosphate-solubilizing bacteria. Qualitative analysis of the phosphate solubilized by various groups correlated well with grouping based upon quantitative analysis of bacteria isolated from soil, effect of carbon, nitrogen, salts, and phosphate solubilization-defective transposon mutants. However, unlike quantitative analysis methods that involve time-consuming biochemical procedures, the time for screening phosphate-solubilizing bacteria is significantly reduced by using our simple protocol. Therefore, it is envisaged that usage of this formulation based upon qualitative analysis will be salutary for the quick screening of phosphate-solubilizing bacteria. Our results indicate that the formulation can also be used as a quality control test for expeditiously screening the commercial bioinoculant preparations, based on phosphate solubilizers.

  6. Preliminary Evaluation of Method to Monitor Landfills Resilience against Methane Emission

    Science.gov (United States)

    Chusna, Noor Amalia; Maryono, Maryono

    2018-02-01

    Methane emission from landfill sites contribute to global warming and un-proper methane treatment can pose an explosion hazard. Stakeholder and government in the cities in Indonesia been found significant difficulties to monitor the resilience of landfill from methane emission. Moreover, the management of methane gas has always been a challenging issue for long waste management service and operations. Landfills are a significant contributor to anthropogenic methane emissions. This study conducted preliminary evaluation of method to manage methane gas emission by assessing LandGem and IPCC method. From the preliminary evaluation, this study found that the IPCC method is based on the availability of current and historical country specific data regarding the waste disposed of in landfills while from the LandGEM method is an automated tool for estimating emission rates for total landfill gas this method account total gas of methane, carbon dioxide and other. The method can be used either with specific data to estimate emissions in the site or default parameters if no site-specific data are available. Both of method could be utilize to monitor the methane emission from landfill site in cities of Central Java.

  7. Who Gets the Job? First-Generation College Students' Perceptions of Employer Screening Methods

    Science.gov (United States)

    Parks-Yancy, Rochelle; Cooley, Delonia

    2018-01-01

    What are first-generation college students' (FGCS) perspectives of employment screening methods? The authors investigate which methods FGCS believe are likely to cause an employer to extend a job offer and which methods yield the best pool of job applicants. Survey data were collected from undergraduate business majors. They were analyzed using…

  8. A simple method of screening for metabolic bone disease

    International Nuclear Information System (INIS)

    Broughton, R.B.K.; Evans, W.D.

    1982-01-01

    The purpose of this investigation was to find a simple method -to be used as an adjunct to the conventional bone scintigram- that could differentiate between decreased bone metabolism or mass, i.e., osteoporosis -normal bone- and the group of conditions of increased bone metabolism or mass namely, osteomalacia, renal osteodystrophy, hyperparathyroidism and Paget's disease. The Fogelman's method using the bone to soft tissue ratios from region of interest analysis at 4 hours post injection, was adopted. An initial experience in measuring a value for the count rate density in lumbar vertebrae at 1 hr post injection during conventional bone scintigraphy appears to give a clear indication of the overall rate of bone metabolism. The advantage over whole body retention methods is that the scan performed at the end of the metabolic study will reveal localized bone disease that may otherwise not be anticipated

  9. High throughput screening method for identification of new lipofection reagents.

    Science.gov (United States)

    Regelin, A E; Fernholz, E; Krug, H F; Massing, U

    2001-08-01

    Lipofection, the transfer of genetic material into cells by means of cationic lipids, is of growing interest for in vitro and in vivo approaches. In order to identify ideal lipofection reagents in a HTS, we have developed an automated lipofection method for the transfer of reporter genes into cells and for determination of the lipofection results. The method has specifically been designed and optimized for 96-well microtiter plates and can successfully be carried out by a pipetting robot with accessory equipment. It consists of two separate parts: (1) pretransfection (preparation of liposomes, formation of lipoplexes, and lipoplex transfer to the cells) and (2) posttransfection (determination of the reporter enzyme activity and the protein content of the transfected cells). Individual steps of the lipofection method were specifically optimized - for example, lipoplex formation and incubation time as well as cell lysis, cell cultivating, and the reporter gene assay. The HTS method facilitates characterization of the transfection properties (efficiency and cytotoxicity) of large numbers of (cationic) lipids in various adherent cell types.

  10. efficacy of screening methods used in breeding for black pod

    African Journals Online (AJOL)

    Administrator

    inoculation necessitates waiting until a tree bears pods before its level of resistance to black pod infection can be determined. These methods, therefore, do not offer a quick means of breeding for resistance. Consequently, tests at the seedling stage that provide information about pod resistance are earnestly needed to save ...

  11. METHOD FOR NUMERICAL MODELING OF UNSTEADY SEPARATED FLOW AROUND AIRFOILS MOVING CLOSE TO FLAT SCREEN

    Directory of Open Access Journals (Sweden)

    V. Pogrebnaya Tamara

    2017-01-01

    Full Text Available In this article an attempt is made to explain the nature of differences in measurements of forces and moments, which influence an aircraft at take-off and landing when testing on different types of stands. An algorithm for numerical simulation of unsteady separated flow around airfoil is given. The algorithm is based on the combination of discrete vortex method and turbulent boundary layer equations. An unsteady flow separation modeling has been used. At each interval vortex method was used to calculate the potential flow around airfoils located near a screen. Calculated pressures and velocities were then used in boundary layer calculations to determine flow separation points and separated vortex in- tensities. After that calculation were made to determine free vortex positions to next time step and the process was fulfilled for next time step. The proposed algorithm allows using numeric visualization to understand physical picture of flow around airfoil moving close to screen. Three different ways of flow modeling (mirror method, fixed or movable screens were tested. In each case the flow separation process, which determines pressure distribution over airfoil surface and influ- ences aerodynamic performance, was viewed. The results of the calculations showed that at low atitudes of airfoil over screen mirror method over predicts lift force compared with movable screen, while fixed screen under predicts it. The data obtained can be used when designing equipment for testing in wind tunnels.

  12. A Preliminary Study of the Effectiveness of Different Recitation Teaching Methods

    Science.gov (United States)

    Endorf, Robert J.; Koenig, Kathleen M.; Braun, Gregory A.

    2006-02-01

    We present preliminary results from a comparative study of student understanding for students who attended recitation classes which used different teaching methods. Student volunteers from our introductory calculus-based physics course attended a special recitation class that was taught using one of four different teaching methods. A total of 272 students were divided into approximately equal groups for each method. Students in each class were taught the same topic, "Changes in energy and momentum," from Tutorials in Introductory Physics. The different teaching methods varied in the amount of student and teacher engagement. Student understanding was evaluated through pretests and posttests given at the recitation class. Our results demonstrate the importance of the instructor's role in teaching recitation classes. The most effective teaching method was for students working in cooperative learning groups with the instructors questioning the groups using Socratic dialogue. These results provide guidance and evidence for the teaching methods which should be emphasized in training future teachers and faculty members.

  13. Pi sampling: a methodical and flexible approach to initial macromolecular crystallization screening

    International Nuclear Information System (INIS)

    Gorrec, Fabrice; Palmer, Colin M.; Lebon, Guillaume; Warne, Tony

    2011-01-01

    Pi sampling, derived from the incomplete factorial approach, is an effort to maximize the diversity of macromolecular crystallization conditions and to facilitate the preparation of 96-condition initial screens. The Pi sampling method is derived from the incomplete factorial approach to macromolecular crystallization screen design. The resulting ‘Pi screens’ have a modular distribution of a given set of up to 36 stock solutions. Maximally diverse conditions can be produced by taking into account the properties of the chemicals used in the formulation and the concentrations of the corresponding solutions. The Pi sampling method has been implemented in a web-based application that generates screen formulations and recipes. It is particularly adapted to screens consisting of 96 different conditions. The flexibility and efficiency of Pi sampling is demonstrated by the crystallization of soluble proteins and of an integral membrane-protein sample

  14. Methods for Factor Screening in Computer Simulation Experiments

    Science.gov (United States)

    1979-03-01

    of the dat-a In a-space, impacto the variable selection problem s ign if Lrast ly. S-arch-type variable selection methods include the all-po"sible...i.iv 41.1 ti * n wt- -iu’pt-v c C it st’vt’re mu It ico11 inear it v is pro-crtnt Lind. , ii;.qt4pai tlv * Iti’lt- c- j c. tic j icivnt, art, verv

  15. PATHOS: a quick screening method for assessing sexual addiction.

    Science.gov (United States)

    Johnson, Pennie; Cashwell, Craig S; Cress, Jim; Barber, Tim; Dunn, Mary Clayton

    2013-01-01

    Pastors may understand that sex addiction exists and are frequently faced with people who need non-clinical and clinical services for the addiction. However, the pastoral counselors have no quick reliable method of assessing them. The purpose of this article is to define sexual addiction and provide information about a tool called PATHOS that can be used in clinical and non-clinical settings to identify potential sex addicts.

  16. Preliminary Phytochemical Screening, Quantitative Analysis of Alkaloids, and Antioxidant Activity of Crude Plant Extracts from Ephedra intermedia Indigenous to Balochistan.

    Science.gov (United States)

    Gul, Rahman; Jan, Syed Umer; Faridullah, Syed; Sherani, Samiullah; Jahan, Nusrat

    2017-01-01

    The aim of this study was to evaluate the antioxidant activity, screening the phytogenic chemical compounds, and to assess the alkaloids present in the E. intermedia to prove its uses in Pakistani folk medicines for the treatment of asthma and bronchitis. Antioxidant activity was analyzed by using 2,2-diphenyl-1-picryl-hydrazyl-hydrate assay. Standard methods were used for the identification of cardiac glycosides, phenolic compounds, flavonoids, anthraquinones, and alkaloids. High performance liquid chromatography (HPLC) was used for quantitative purpose of ephedrine alkaloids in E. intermedia . The quantitative separation was confirmed on Shimadzu 10AVP column (Shampack) of internal diameter (id) 3.0 mm and 50 mm in length. The extract of the solute in flow rate of 1 ml/min at the wavelength 210 nm and methanolic extract showed the antioxidant activity and powerful oxygen free radicals scavenging activities and the IC50 for the E. intermedia plant was near to the reference standard ascorbic acid. The HPLC method was useful for the quantitative purpose of ephedrine (E) and pseudoephedrine (PE) used for 45 samples of one species collected from central habitat in three districts (Ziarat, Shairani, and Kalat) of Balochistan. Results showed that average alkaloid substance in E. intermedia was as follows: PE (0.209%, 0.238%, and 0.22%) and E (0.0538%, 0.0666%, and 0.0514%).

  17. Studying Knowledge, Attitude and Behavior of Breast Cancer Screening Methods among Behshahr Dwelling Women

    Directory of Open Access Journals (Sweden)

    Abdolhasan Naghibi

    2013-09-01

    Full Text Available Background and purpose: Breast cancer is the most prevalent cancer among all widespread cancers worldwide. After lung cancer, breast cancer is the main cause of death among women. One of the best ways to detect this disease early is to do screening. This study has been done to analyze the knowledge, attitude, and behavior of women regarding the breast cancer screening methods. Materials & Methods: The study is of cross-sectional descriptive type. The participants were 500 Behshahr dwelling women above 20 years old selected based on cluster sampling. The instrument used was a 34-item questionnaire to investigate the knowledge, attitude, and behavior of the women. The data has been analyzed through inferential statistical methods. Results: The participants' age mean was 35.16. The average knowledge score of the disease and screening methods was 1.3 and 54.6. The average attitude score of was 82.5. Regarding behavior, 13.1 percent do regular self-examination, and 15.2 percent do regular clinical examination. 16.7 percent of women have one experience of doing mammography. In the present study, there was a significant relation among knowledge, attitude and behavior. Conclusion: Since the knowledge of women was at average level and the behavior of using the screening methods was weak, planning to enable and motivate women to use the screening methods is highly emphasized.

  18. Gastric Cancer Screening by Combined Determination of Serum Helicobacter pylori Antibody and Pepsinogen Concentrations: ABC Method for Gastric Cancer Screening.

    Science.gov (United States)

    Chen, Xian-Zhe; Huang, Cheng-Zhi; Hu, Wei-Xian; Liu, Ying; Yao, Xue-Qing

    2018-05-20

    Gastroscopy combined with gastric mucosa biopsies is currently regarded as a gold standard for diagnosis of gastric cancer. However, its application is restricted in clinical practice due to its invasive property. A new noninvasive population screening process combining the assay of anti-Helicobacter pylori antibody and serum pepsinogen (PG) (ABC method) is adopted to recognize the high-risk patients for further endoscopy examination, avoiding the unnecessary gastroscopy for most population and saving the cost consumption for mass screening annually. Nevertheless, controversies exist for the grouping of ABC method and the intervals of gastroscopy surveillance for each group. In this review, we summarized these popular concerned topics for providing useful references to the healthcare practitioner in clinical practice. The PubMed databases were systematically searched from the inception dates to November 22, 2017, using the keywords "Helicobacter pylori," "Pepsinogens," and "Stomach Neoplasms." Original articles and reviews on the topics were selected. Anti-H. pylori antibody and serum PG concentration showed significant changes under the different status of H. pylori infection and the progression of atrophic gastritis, which can be used for risk stratification of gastric cancer in clinic. In addition, anti-H. pylori antibody titer can be used for further risk stratification of gastric cancer contributing to determine better endoscopy surveillance interval. The early detection and diagnosis of gastric cancer benefit from the risk stratification, but the cutoff values for H. pylori antibody and serum PG concentration require further modification.

  19. Perception and Experience of Primary Care Physicians on Pap Smear Screening for Women with Intellectual Disabilities: A Preliminary Finding

    Science.gov (United States)

    Lin, Jin-Ding; Sung, Chang-Lin; Lin, Lan-Ping; Liu, Ta-Wen; Lin, Pei-Ying; Chen, Li-Mei; Chu, Cordia M.; Wu, Jia-Ling

    2010-01-01

    This study aims to establish evidence-based data to explore the perceptions and experience of primary care physicians in the Pap smear screening provision for women with intellectual disabilities (ID), and to analyze the associated factors in the delivery of screening services to women with ID in Taiwan. Data obtained by a cross-sectional survey…

  20. Novel method for screening of enteric film coatings properties with magnetic resonance imaging.

    Science.gov (United States)

    Dorożyński, Przemysław; Jamróz, Witold; Niwiński, Krzysztof; Kurek, Mateusz; Węglarz, Władysław P; Jachowicz, Renata; Kulinowski, Piotr

    2013-11-18

    The aim of the study is to present the concept of novel method for fast screening of enteric coating compositions properties without the need of preparation of tablets batches for fluid bed coating. Proposed method involves evaluation of enteric coated model tablets in specially designed testing cell with application of MRI technique. The results obtained in the testing cell were compared with results of dissolution studies of mini-tablets coated in fluid bed apparatus. The method could be useful in early stage of formulation development for screening of film coating properties that will shorten and simplify the development works. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. A virtual screening method for inhibitory peptides of Angiotensin I-converting enzyme.

    Science.gov (United States)

    Wu, Hongxi; Liu, Yalan; Guo, Mingrong; Xie, Jingli; Jiang, XiaMin

    2014-09-01

    Natural small peptides from foods have been proven to be efficient inhibitors of Angiotensin I-converting enzyme (ACE) for the regulation of blood pressure. The traditional ACE inhibitory peptides screening method is both time consuming and money costing, to the contrary, virtual screening method by computation can break these limitations. We establish a virtual screening method to obtain ACE inhibitory peptides with the help of Libdock module of Discovery Studio 3.5 software. A significant relationship between Libdock score and experimental IC(50) was found, Libdock score = 10.063 log(1/IC(50)) + 68.08 (R(2) = 0.62). The credibility of the relationship was confirmed by testing the coincidence of the estimated log(1/IC(50)) and measured log(1/IC(50)) (IC(50) is 50% inhibitory concentration toward ACE, in μmol/L) of 5 synthetic ACE inhibitory peptides, which was virtual hydrolyzed and screened from a kind of seafood, Phascolosoma esculenta. Accordingly, Libdock method is a valid IC(50) estimation tool and virtual screening method for small ACE inhibitory peptides. © 2014 Institute of Food Technologists®

  2. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    Directory of Open Access Journals (Sweden)

    Stanistreet Debbi

    2008-01-01

    Full Text Available Abstract Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning disabilities. It was carried out in Bury, Heywood-and-Middleton and Rochdale. Methods Carried out using retrospective cohort study methods, women with learning disabilities were identified by Read code; and their cervical screening records were compared with the Call-and-Recall records of women without learning disabilities in order to examine their screening histories. Analysis was carried out using case-control methods – 1:2 (women with learning disabilities: women without learning disabilities, calculating odds ratios. Results 267 women's records were compared with the records of 534 women without learning disabilities. Women with learning disabilities had an odds ratio (OR of 0.48 (Confidence Interval (CI 0.38 – 0.58; X2: 72.227; p.value X2: 24.236; p.value X2: 286.341; p.value Conclusion The reasons given for ceasing and/or not screening suggest that merely being coded as having a learning disability is not the sole reason for these actions. There are training needs among smear takers regarding appropriate reasons not to screen and providing screening for women with learning disabilities.

  3. Ionic Liquids for Absorption and Separation of Gases: An Extensive Database and a Systematic Screening Method

    DEFF Research Database (Denmark)

    Zhao, Yongsheng; Gani, Rafiqul; Afzal, Raja Muhammad

    2017-01-01

    requirements remains a challenging task. In this study, an extensive database of estimated Henry's law constants of twelve gases in more than ten thousand ILs at 313.15 K is established using the COSMO-RS method. Based on the database, a new systematic and efficient screening method for IL selection...

  4. Microbial screening methods for detection of antibiotic residues in slaughter animals

    NARCIS (Netherlands)

    Pikkemaat, M.G.

    2009-01-01

    Monitoring of food products from animal origin for the presence of antimicrobial residues is preferably done using microbial screening methods because of their high cost-effectiveness. Traditionally applied methods fail to detect the maximum residue limits which were established when EU Council

  5. Band structure engineering in van der Waals heterostructures via dielectric screening: the GΔW method

    DEFF Research Database (Denmark)

    Winther, Kirsten Trøstrup; Thygesen, Kristian Sommer

    2017-01-01

    precise magnitude is non-trivial to predict because of the non-local nature of the screening in quasi-2D crystals. Moreover, the effect is not captured by effective single-particle methods such as density functional theory. Here we present an efficient and general method for calculating the band gap...

  6. Comparison of a fluoroquinolone surface plasmon resonance biosensor screening assay with established methods

    NARCIS (Netherlands)

    Weigel, S.; Pikkemaat, M.G.; Elferink, J.W.A.; Mulder, P.P.J.; Huet, A.C.; Delahaut, P.; Schittko, S.; Flerus, R.; Nielen, M.W.F.

    2009-01-01

    The performance of a previously developed immunochemical biosensor screening method for fluoroquinolone (FQ) antibiotics in poultry muscle, fish and egg was compared with established methods. Blank sample material of the target matrices was individually spiked with the FQs at half maximum residue

  7. Screening of Plant Extracts for Antioxidant Activity: a Comparative Study on Three Testing Methods

    NARCIS (Netherlands)

    Koleva, I.; Beek, van T.A.; Linssen, J.P.H.; Groot, de Æ.; Evstatieva, L.N.

    2002-01-01

    Three methods widely employed in the evaluation of antioxidant activity, namely 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging method, static headspace gas chromatography (HS-GC) and -carotene bleaching test (BCBT), have been compared with regard to their application in the screening of

  8. Application of EU guidelines for the validation of screening methods for veterinary drugs

    NARCIS (Netherlands)

    Stolker, A.A.M.

    2012-01-01

    Commission Decision (CD) 2002/657/EC describes detailed rules for method validation within the framework of residue monitoring programmes. The approach described in this CD is based on criteria. For (qualitative) screening methods, the most important criteria is that the CCß has to be below any

  9. Survey of cyclopids (Crustacea, Copepoda in Brazil and preliminary screening of their potential as dengue vector predators

    Directory of Open Access Journals (Sweden)

    Santos Luciana Urbano dos

    1997-01-01

    Full Text Available INTRODUCTION: Cyclopid copepods are known to be good mosquito controllers, specially as regards the larvae of the dengue vectors Aedes aegypti and Ae. albopictus. MATERIAL AND METHOD: The objective of the study was to survey the local copepod fauna and search for new strains of M. longisetus var. longisetus, comparing the potential of the samples found with the current strain ML-01 against Ae. albopictus larvae, under laboratory conditions. Eleven bodies of water in Campinas, SP, Brazil, were screened for copepods by collecting 1.5 l of water from each of then. The predatory potential of adults copepods was evaluated over 24 h, in the laboratory, for groups of 5 individuals preying upon 30 first instar Ae. albopictus larvae. RESULTS AND CONCLUSION: The following cyclopid species were found: Metacyclops mendocinus, Tropocyclops prasinus, Eucyclops sp, Eucyclops serrulatus, Eucyclops solitarius, Eucyclops ensifer, Macrocyclops albidus var. albidus and Mesocyclops longisetus var. longisetus. The predatory potential of these copepods ranged from nil to 97.3%. A sample collected in the field containing only M. longisetus var. longisetus showed the best control efficiency with no significant difference from a three-year old laboratory culture (ML-01 of the same species evaluated for comparison. The sample with few M. albidus var. albidus was ranked in second place showing an average 25.9% efficiency. The use of copepods in trap tires as dengue vector controllers is discussed.

  10. Preliminary findings on the reliability and validity of the Cantonese Birmingham Cognitive Screen in patients with acute ischemic stroke

    Directory of Open Access Journals (Sweden)

    Pan X

    2015-09-01

    Full Text Available Xiaoping Pan,1,* Haobo Chen,1,2,* Wai-Ling Bickerton,2 Johnny King Lam Lau,2 Anthony Pak Hin Kong,3 Pia Rotshtein,2 Aihua Guo,1 Jianxi Hu,1 Glyn W Humphreys4 1Department of Neurology, Guangzhou First People’s Hospital, Guangzhou Medical University, Guangzhou, People’s Republic of China; 2School of Psychology, University of Birmingham, Birmingham, UK; 3Department of Communication Sciences and Disorders, University of Central Florida, Orlando, FL, USA; 4Department of Experimental Psychology, University of Oxford, Oxford, UK *These authors contributed equally to this work Background: There are no currently effective cognitive assessment tools for patients who have suffered stroke in the People’s Republic of China. The Birmingham Cognitive Screen (BCoS has been shown to be a promising tool for revealing patients’ poststroke cognitive deficits in specific domains, which facilitates more individually designed rehabilitation in the long run. Hence we examined the reliability and validity of a Cantonese version BCoS in patients with acute ischemic stroke, in Guangzhou.Method: A total of 98 patients with acute ischemic stroke were assessed with the Cantonese version of the BCoS, and an additional 133 healthy individuals were recruited as controls. Apart from the BCoS, the patients also completed a number of external cognitive tests, including the Montreal Cognitive Assessment Test (MoCA, Mini Mental State Examination (MMSE, Albert’s cancellation test, the Rey–Osterrieth Complex Figure Test, and six gesture matching tasks. Cutoff scores for failing each subtest, ie, deficits, were computed based on the performance of the controls. The validity and reliability of the Cantonese BCoS were examined, as well as interrater and test–retest reliability. We also compared the proportions of cases being classified as deficits in controlled attention, memory, character writing, and praxis, between patients with and without spoken language impairment

  11. Method for screening the Nevada Test Site and contiguous areas for nuclear waste repository locations

    International Nuclear Information System (INIS)

    Sinnock, S.; Fernandez, J.A.; Neal, J.T.; Stephens, H.P.; Hartway, B.L.; Los Alamos Technical Associates, Inc., NM)

    1982-01-01

    This paper outlines the general concepts of a technical method for systematic screening of the Nevada Test Site (NTS), Nye County, Nevada, for potentially suitable nuclear waste repository locations. After a general discussion of the organization and the purpose of the current screening activity, the paper addresses the steps of the screening method. These steps include: hierarchically organizing technical objectives for repository performance (an objectives tree); identifying and mapping pertinent physical characteristics of a site and its setting (physical attributes); relating the physical conditions to the objectives (favorability curves); identifying alternative locations and numerically evaluating their relative merits; investigating the effects of subjective judgments on the evaluations (sensitivity analyses); documenting the assumptions, logic, and results of the method. 19 references, 10 figures

  12. Inverse design-momentum, a method for the preliminary design of horizontal axis wind turbines

    International Nuclear Information System (INIS)

    Battisti, L; Soraperra, G; Fedrizzi, R; Zanne, L

    2007-01-01

    Wind turbine rotor prediction methods based on generalized momentum theory BEM routinely used in industry and vortex wake methods demand the use of airfoil tabulated data and geometrical specifications such as the blade spanwise chord distribution. They belong to the category of 'direct design' methods. When, on the other hand, the geometry is deduced from some design objective, we refer to 'inverse design' methods. This paper presents a method for the preliminary design of wind turbine rotors based on an inverse design approach. For this purpose, a generalized theory was developed without using classical tools such as BEM. Instead, it uses a simplified meridional flow analysis of axial turbomachines and is based on the assumption that knowing the vortex distribution and appropriate boundary conditions is tantamount to knowing the velocity distribution. The simple conservation properties of the vortex components consistently cope with the forces and specific work exchange expressions through the rotor. The method allows for rotor arbitrarily radial load distribution and includes the wake rotation and expansion. Radial pressure gradient is considered in the wake. The capability of the model is demonstrated first by a comparison with the classical actuator disk theory in investigating the consistency of the flow field, then the model is used to predict the blade planform of a commercial wind turbine. Based on these validations, the authors postulate the use of a different vortex distribution (i.e. not-uniform loading) for blade design and discuss the effect of such choices on blade chord and twist, force distribution and power coefficient. In addition to the method's straightforward application to the pre-design phase, the model clearly shows the link between blade geometry and performance allowing quick preliminary evaluation of non uniform loading on blade structural characteristics

  13. Validity and cost-effectiveness of methods for screening of primary open angle glaucoma

    Directory of Open Access Journals (Sweden)

    Fröschl, Barbara

    2007-02-01

    Full Text Available Health political background: About 950,000 people are affected by glaucoma in Germany, about 50% of which are undiagnosed. The German Ophthalmological Society and the German Association of Ophthalmologists recommend a screening for glaucoma according to their guidelines. The Federal Joint Committee disapproved a glaucoma-screening program on expense of the compulsory health insurance in 2004. Scientific background: Primary open angle glaucoma is diagnosed by evaluation of the optic disc, the retinal fibre layer and the visual field. The main examinations are ophthalmoscopy, scanning laser polarimetry, confocal scanning laser ophthalmoscopy, retinal thickness analysis and optical coherence tomography. Scotomas are diagnosed by perimetry (standard automated perimetry, short wavelength automated perimetry and frequency doubling perimetry. The intraocular pressure is the most important treatable risk factor and is measured by (contact or non-contact tonometry. Research questions: The aim of this HTA-report is to investigate the diagnostic validity and cost effectiveness of diagnostic techniques or combinations of these methods with respect to the use in a screening setting in Germany. Methods: A systematic literature research was performed in 35 international databases and yielded 2602 articles. Overall 57 publications were included for assessment, according to predefined selection criteria. Results: The 55 medical articles deal mainly with frequency doubling perimetry, confocal scanning laser ophthalmoscopy and scanning laser polarimetry. Few articles cover short wavelength automated perimetry, tonometry and ophalmocopic evaluations by ophthalmologists. The quality of the papers is generally low, as far as the evidence in respect of screening is concerned. No single method exists with both, high sensitivity and high specificity for screening purpose. Data are also not sufficient to recommend combinations of methods. Only two economic models on cost

  14. Reverse screening methods to search for the protein targets of chemopreventive compounds

    Science.gov (United States)

    Huang, Hongbin; Zhang, Guigui; Zhou, Yuquan; Lin, Chenru; Chen, Suling; Lin, Yutong; Mai, Shangkang; Huang, Zunnan

    2018-05-01

    This article is a systematic review of reverse screening methods used to search for the protein targets of chemopreventive compounds or drugs. Typical chemopreventive compounds include components of traditional Chinese medicine, natural compounds and Food and Drug Administration (FDA)-approved drugs. Such compounds are somewhat selective but are predisposed to bind multiple protein targets distributed throughout diverse signaling pathways in human cells. In contrast to conventional virtual screening, which identifies the ligands of a targeted protein from a compound database, reverse screening is used to identify the potential targets or unintended targets of a given compound from a large number of receptors by examining their known ligands or crystal structures. This method, also known as in silico or computational target fishing, is highly valuable for discovering the target receptors of query molecules from terrestrial or marine natural products, exploring the molecular mechanisms of chemopreventive compounds, finding alternative indications of existing drugs by drug repositioning, and detecting adverse drug reactions and drug toxicity. Reverse screening can be divided into three major groups: shape screening, pharmacophore screening and reverse docking. Several large software packages, such as Schrödinger and Discovery Studio; typical software/network services such as ChemMapper, PharmMapper, idTarget and INVDOCK; and practical databases of known target ligands and receptor crystal structures, such as ChEMBL, BindingDB and the Protein Data Bank (PDB), are available for use in these computational methods. Different programs, online services and databases have different applications and constraints. Here, we conducted a systematic analysis and multilevel classification of the computational programs, online services and compound libraries available for shape screening, pharmacophore screening and reverse docking to enable non-specialist users to quickly learn and

  15. Gain versus loss-framed messaging and colorectal cancer screening among African Americans: A preliminary examination of perceived racism and culturally targeted dual messaging.

    Science.gov (United States)

    Lucas, Todd; Hayman, Lenwood W; Blessman, James E; Asabigi, Kanzoni; Novak, Julie M

    2016-05-01

    This preliminary study examined the effect of gain versus loss-framed messaging as well as culturally targeted personal prevention messaging on African Americans' receptivity to colorectal cancer (CRC) screening. This research also examined mechanistic functions of perceived racism in response to message framing. Community samples of African Americans (N = 132) and White Americans (N = 50) who were non-compliant with recommended CRC screening completed an online education module about CRC, and were either exposed to a gain-framed or loss-framed message about CRC screening. Half of African Americans were exposed to an additional and culturally targeted self-control message about personal prevention of CRC. Theory of planned behavior measures of attitudes, normative beliefs, perceived behavioural control, and intentions to obtain a CRC screen served as primary outcomes. The effect of messaging on perceived racism was also measured as an outcome. Consistent with prior research, White Americans were more receptive to CRC screening when exposed to a loss-framed message. However, African Americans were more receptive when exposed to a gain-framed message. The contrary effect of loss-framed messaging on receptivity to screening among African Americans was mediated by an increase in perceived racism. However, including an additional and culturally targeted prevention message mitigated the adverse effect of a loss-framed message. This study identifies an important potential cultural difference in the effect of message framing on illness screening among African Americans, while also suggesting a culturally relevant linking mechanism. This study also suggests the potential for simultaneously presented and culturally targeted messaging to alter the effects of gain and loss-framed messaging on African Americans. What is already known on this subject? African Americans are at an increased risk of both developing and dying from colorectal cancer (CRC). These disparities can be

  16. Screening methods for post-stroke visual impairment: a systematic review.

    Science.gov (United States)

    Hanna, Kerry Louise; Hepworth, Lauren Rachel; Rowe, Fiona

    2017-12-01

    assess all potential post-stroke visual impairments. The current tools screen for only a number of potential stroke-related impairments, which means many visual defects may be missed. The sensitivity of those which screen for all impairments is significantly lowered when patients are unable to report their visual symptoms. Future research is required to develop a tool capable of assessing stroke patients which encompasses all potential visual deficits and can also be easily performed by both the patients and administered by health care professionals in order to ensure all stroke survivors with visual impairment are accurately identified and managed. Implications for Rehabilitation Over 65% of stroke survivors will suffer from a visual impairment, whereas 45% of stroke units do not assess vision. Visual impairment significantly reduces the quality of life, such as being unable to return to work, driving and depression. This review outlines the available screening methods to accurately identify stroke survivors with visual impairments. Identifying visual impairment after stroke can aid general rehabilitation and thus, improve the quality of life for these patients.

  17. Preliminary discussion on the application of the geological conceptual model method of uranium ore formation

    International Nuclear Information System (INIS)

    Ma Guangzhong; Wei Mingji; Luo Yiyue

    1992-01-01

    The geological conceptual model method of uranium ore formation is established on the basis of geological theory and apriorism. Variables are screened with the application of the method of mathematical geology to find out the variables which are more contributed. In combination with the practical situation in Xikang-Yunnan axis, the variables are compiled and graded so as to determine the optimal ore-controlling factor and to establish the statistical predictive model which is of geological significance. The resources evaluation work has been conducted in the Late Proterozoic geological terrain in Xikang-Yunnan axis

  18. Proposal of Screening Method of Sleep Disordered Breathing Using Fiber Grating Vision Sensor

    Science.gov (United States)

    Aoki, Hirooki; Nakamura, Hidetoshi; Nakajima, Masato

    Every conventional respiration monitoring technique requires at least one sensor to be attached to the body of the subject during measurement, thereby imposing a sense of restraint that results in aversion against measurements that would last over consecutive days. To solve this problem, we developed a respiration monitoring system for sleepers, and it uses a fiber-grating vision sensor, which is a type of active image sensor to achieve non-contact respiration monitoring. In this paper, we verified the effectiveness of the system, and proposed screening method of the sleep disordered breathing. It was shown that our system could equivalently measure the respiration with thermistor and accelerograph. And, the respiratory condition of sleepers can be grasped by our screening method in one look, and it seems to be useful for the support of the screening of sleep disordered breathing.

  19. Concurrent Driving Method with Fast Scan Rate for Large Mutual Capacitance Touch Screens

    Directory of Open Access Journals (Sweden)

    Mohamed Gamal Ahmed Mohamed

    2015-01-01

    Full Text Available A novel touch screen control technique is introduced, which scans each frame in two steps of concurrent multichannel driving and differential sensing. The proposed technique substantially increases the scan rate and reduces the ambient noise effectively. It is also extended to a multichip architecture to support excessively large touch screens with great scan rate improvement. The proposed method has been implemented using 0.18 μm CMOS TowerJazz process and tested with FPGA and AFE board connecting a 23-inch touch screen. Experimental results show a scan rate improvement of up to 23.8 times and an SNR improvement of 24.6 dB over the conventional method.

  20. A new screening method for amphetamine and methamphetamine using dansyl chloride derivatization and cartridge fluorescence.

    Science.gov (United States)

    Yamada, H; Ikeda-Wada, S; Oguri, K

    1998-07-01

    A new screening method for amphetamines was developed. It consists of derivatization with dansyl chloride, extraction of the derivative using a Sep-Pak C18 or a Bond Elut C18, solid phase extraction columns, and visualization of the fluorescence of the cartridge. A control test using drug-free urine showed no fluorescence. Amphetamine, methamphetamine and the methylenedioxy derivatives exhibited strong fluorescence, while related compounds, such as N-ethylamphetamine and fenetylline, were negative or weakly positive. The disadvantage of the present method is that it is a multi-step procedure and 20-30 min is required for screening. However, since it has a different specificity from the widely used immunochemical technique, it is suggested to be a useful screen for amphetamines.

  1. Current role of liquid chromatography coupled to mass spectrometry in clinical toxicology screening methods.

    Science.gov (United States)

    Viette, Véronique; Fathi, Marc; Rudaz, Serge; Hochstrasser, Denis; Veuthey, Jean-Luc

    2011-07-01

    Abstract Toxicological screening is the analysis of a biological specimen to detect and identify compounds in patients admitted to the hospital with acute intoxication of unknown origin. The screening of a wide range of toxicologically relevant compounds in biological samples is a serious challenge for clinical laboratories. The high selectivity and sensitivity of liquid chromatography coupled to mass spectrometry or tandem mass spectrometry technology provides an attractive alternative to the current methods. For these reasons, an increasing number of applications for multi-target screening or general screening of unknown compounds in biological matrices are being published. This paper is an overview of sample clean-up, chromatographic separation and mass spectrometry detection procedures which can be combined to obtain screening methods adapted to the constraints and needs of various laboratories, and none specifically in clinical toxicology. Currently the techniques are in the hands of specialists, principally in academic institutes. However, the evolution in technology should allow application of the techniques as a tool in toxicology laboratories and thus more widespread exploitation of their potential.

  2. Cancer screening using 18F-FDG PET/CT in Korean asymptomatic volunteers. A preliminary report

    International Nuclear Information System (INIS)

    Lee, Jeong-Won; Kang, Keon-Wook; Paeng, Jin-Chul; Lee, Sang-Mi; Jang, Su-Jin; Chung, June-Key; Lee, Myung-Chul; Lee, Dong-Soo

    2009-01-01

    This study was performed to evaluate the clinical value of 18 F-fluorodeoxyglucose (FDG) positron-emission tomography (PET)/computed tomography (CT) for cancer screening in Korean asymptomatic people. Between February 2004 and December 2006, 1,587 asymptomatic individuals underwent FDG PET/CT as part of a cancer screening program with some other diagnostic tests at the healthcare center of our hospital. After excluding patients with a history of malignant tumor, 1,336 subjects were enrolled. All PET/CT images were visually analyzed. In subjects showing positive findings for PET/CT or other screening tests, further diagnostic tests and pathological confirmation were performed. Of the 1,336 subjects, malignant tumors were found in 16 participants (1.2%, thyroid cancer: 9, lung cancer: 2, stomach cancer: 2, and others: 4). There were 47 cases (3.6%) of positive PET/CT findings- 11 cases were true positive (thyroid cancer: 8, lung cancer: 1, renal cancer: 1, and invasive thymoma), and 36 false positive, and five cases were false negative. The overall detection rate of PET/CT was 0.8%, and the sensitivity, specificity, positive-predictive value, and negative-predictive value of PET/CT were 68.8, 97.2, 23.4, and 99.6%, respectively. Fluorodeoxyglucose positron-emission tomography has the potential to detect various kinds of malignant tumors in cancer screening test, and the overall detection rate of PET/CT was 0.8%. FDG PET/CT can be a useful cancer screening modality with the selection of high-risk group and appropriate combination with other screening modalities. (author)

  3. Preliminary studies for the determination of alpha emitters using the gross alpha coprecipitation methods

    International Nuclear Information System (INIS)

    Suarez-Navarro, J. A.; Pujol, L.; Suarez, J. A.; Pablo, M. A. de

    2003-01-01

    The radiological quality of drinking water in Spain is regulated by Nuclear Security Guideline No, 7.7 (Rev.1) of the Nuclear Security Council (NSC). this guideline establishes the protocol to follow when the radiological level exceeds 0,1 Bq.l''1. When this level is passed, the responsible alpha emitter must be identified; ''210 Po, ''226Ra, ''230Th, ''239Pu, ''224Ra, ''234 U and ''138 U. Activity due to these isotopes is usually determined using alpha spectrometry with semiconductor detectors. This method allows the activity of the alpha emitters to be determined with a good sensitivity. however, it requires long radiochemical isolations and long counting times, so the method is not suitable for rough estimate radiological analysis. In this preliminary work, we present the conditioning of the sample-precipitate that is essential for further radiochemical isolations. (Author) 9 refs

  4. Development of methods to measure hemoglobin adducts by gel electrophoresis - Preliminary results

    International Nuclear Information System (INIS)

    Sun, J.D.; McBride, S.M.

    1988-01-01

    Chemical adducts formed on blood hemoglobin may be a useful biomarker for assessing human exposures to these compounds. This paper reports preliminary results in the development of methods to measure such adducts that may be generally applicable for a wide variety of chemicals. Male F344/N rats were intraperitoneally injected with 14 C-BaP dissolved in corn oil. Twenty-four hours later, the rats were sacrificed. Blood samples were collected and globin was isolated. Globin protein was then cleaved into peptide fragments using cyanogen bromide and the fragments separated using 2-dimensional gel electrophoresis. The results showed that the adducted 14 C-globin fragments migrated to different areas of the gel than did unadducted fragments. Further research is being conducted to develop methods that will allow quantitation of separated adducted globin fragments from human blood samples without the use of a radiolabel. (author)

  5. Rapid in vivo screening method for the evaluation of new anti ...

    African Journals Online (AJOL)

    Rapid in vivo screening method for the evaluation of new anti helicobacter ... Six to eight week-old mice pre-treated (7 days) with Amoxicillin/Metronidazole (25 ... These findings were used as a mouse model of Helicobacter pylori infection to ...

  6. Development of automatic image analysis methods for high-throughput and high-content screening

    NARCIS (Netherlands)

    Di, Zi

    2013-01-01

    This thesis focuses on the development of image analysis methods for ultra-high content analysis of high-throughput screens where cellular phenotype responses to various genetic or chemical perturbations that are under investigation. Our primary goal is to deliver efficient and robust image analysis

  7. Estimation of effectiveness of interventions for malaria control in pregnancy using the screening method

    NARCIS (Netherlands)

    Msyamboza, K.; Senga, E.; Tetteh-Ashong, E.; Kazembe, P.; Brabin, B. J.

    2007-01-01

    BACKGROUND: The evaluation of the effectiveness of antimalarial drugs and bed net use in pregnant women is an important aspect of monitoring and surveillance of malaria control in pregnancy. In principle the screening method for assessing vaccine efficacy can be applied in non-vaccine settings for

  8. Validation of cervical cancer screening methods in HIV positive women from Johannesburg South Africa.

    Directory of Open Access Journals (Sweden)

    Cynthia Firnhaber

    Full Text Available HIV-infected women are at increased risk for developing cervical cancer. Women living in resource-limited countries are especially at risk due to poor access to cervical cancer screening and treatment. We evaluated three cervical cancer screening methods to detect cervical intraepithelial neoplasia grade 2 and above (CIN 2+ in HIV-infected women in South Africa; Pap smear, visual inspection with 5% acetic acid (VIA and human papillomavirus detection (HPV.HIV-infected women aged 18-65 were recruited in Johannesburg. A cross-sectional study evaluating three screening methods for the detection of the histologically-defined gold standard CIN-2 + was performed. Women were screened for cervical abnormalities with the Digene HC2 assay (HPV, Pap smear and VIA. VIA was performed by clinic nurses, digital photographs taken and then later reviewed by specialist physicians. The sensitivity, specificity and predictive valves for CIN-2 + were calculated using maximum likelihood estimators.1,202 HIV-infected women participated, with a median age of 38 years and CD4 counts of 394 cells/mm(3. One third of women had a high grade lesion on cytology. VIA and HPV were positive in 45% and 61% of women respectively. Estimated sensitivity/specificity for HPV, Pap smear and VIA for CIN 2+ was 92%/51.4%, 75.8%/83.4% and 65.4/68.5% (nurse reading, respectively. Sensitivities were similar, and specificities appeared significantly lower for the HPV test, cytology and VIA among women with CD4 counts ≤200 cells/mm(3 as compared to CD4 counts >350 cells/mm(3.Although HPV was the most sensitive screening method for detecting CIN 2+, it was less specific than conventional cytology and VIA with digital imaging review. Screening programs may need to be individualized in context of the resources and capacity in each area.

  9. Creation and preliminary validation of the screening for self-medication safety post-stroke scale (S-5).

    Science.gov (United States)

    Kaizer, Franceen; Kim, Angela; Van, My Tram; Korner-Bitensky, Nicol

    2010-03-01

    Patients with stroke should be screened for safety prior to starting a self-medication regime. An extensive literature review revealed no standardized self-medication tool tailored to the multi-faceted needs of the stroke population. The aim of this study was to create and validate a condition-specific tool to be used in screening for self-medication safety in individuals with stroke. Items were generated using expert consultation and review of the existing tools. The draft tool was pilot-tested on expert stroke clinicians to receive feedback on content, clarity, optimal cueing and domain omissions. The final version was piloted on patients with stroke using a structured interviewer-administered interview. The tool was progressively refined and validated according to feedback from the 11 expert reviewers. The subsequent version was piloted on patients with stroke. The final version includes 16 questions designed to elicit information on 5 domains: cognition, communication, motor, visual-perception and, judgement/executive function/self-efficacy. The Screening for Safe Self-medication post-Stroke Scale (S-5) has been created and validated for use by health professionals to screen self-medication safety readiness of patients after stroke. Its use should also help to guide clinicians' recommendations and interventions aimed at enhancing self-medication post-stroke.

  10. Material characterisation and preliminary mechanical design for the HL-LHC shielded beam screens operating at cryogenic temperatures

    International Nuclear Information System (INIS)

    Garion, C; Dufay-Chanat, L; Koettig, T; Machiocha, W; Morrone, M

    2015-01-01

    The High Luminosity LHC project (HL-LHC) aims at increasing the luminosity (rate of collisions) in the Large Hadron Collider (LHC) experiments by a factor of 10 beyond the original design value (from 300 to 3000 fb -1 ). It relies on new superconducting magnets, installed close to the interaction points, equipped with new beam screen. This component has to ensure the vacuum performance together with shielding the cold mass from physics debris and screening the cold bore cryogenic system from beam induced heating. The beam screen operates in the range 40-60 K whereas the magnet cold bore temperature is 1.9 K. A tungsten-based material is used to absorb the energy of particles. In this paper, measurements of the mechanical and physical properties of such tungsten material are shown at room and cryogenic temperature. In addition, the design and the thermal mechanical behaviour of the beam screen assembly are presented also. They include the heat transfer from the tungsten absorbers to the cooling pipes and the supporting system that has to minimise the heat inleak into the cold mass. The behaviour during a magnet quench is also presented. (paper)

  11. Material characterisation and preliminary mechanical design for the HL-LHC shielded beam screens operating at cryogenic temperatures

    CERN Document Server

    Garion, C; Koettig, T; Machiocha, W; Morrone, M

    2015-01-01

    The High Luminosity LHC project (HL-LHC) aims at increasing the luminosity (rate of collisions) in the Large Hadron Collider (LHC) experiments by a factor of 10 beyond the original design value (from 300 to 3000 fb-1). It relies on new superconducting magnets, installed close to the interaction points, equipped with new beam screen. This component has to ensure the vacuum performance together with shielding the cold mass from physics debris and screening the cold bore cryogenic system from beam induced heating. The beam screen operates in the range 40-60 K whereas the magnet cold bore temperature is 1.9 K. A tungsten-based material is used to absorb the energy of particles. In this paper, measurements of the mechanical and physical properties of such tungsten material are shown at room and cryogenic temperature. In addition, the design and the thermal mechanical behaviour of the beam screen assembly are presented also. They include the heat transfer from the tungsten absorbers to the cooling pipes and the sup...

  12. Material characterisation and preliminary mechanical design for the HL-LHC shielded beam screens operating at cryogenic temperatures.

    Science.gov (United States)

    Garion, C.; Dufay-Chanat, L.; Koettig, T.; Machiocha, W.; Morrone, M.

    2015-12-01

    The High Luminosity LHC project (HL-LHC) aims at increasing the luminosity (rate of collisions) in the Large Hadron Collider (LHC) experiments by a factor of 10 beyond the original design value (from 300 to 3000 fb-1). It relies on new superconducting magnets, installed close to the interaction points, equipped with new beam screen. This component has to ensure the vacuum performance together with shielding the cold mass from physics debris and screening the cold bore cryogenic system from beam induced heating. The beam screen operates in the range 40-60 K whereas the magnet cold bore temperature is 1.9 K. A tungsten-based material is used to absorb the energy of particles. In this paper, measurements of the mechanical and physical properties of such tungsten material are shown at room and cryogenic temperature. In addition, the design and the thermal mechanical behaviour of the beam screen assembly are presented also. They include the heat transfer from the tungsten absorbers to the cooling pipes and the supporting system that has to minimise the heat inleak into the cold mass. The behaviour during a magnet quench is also presented.

  13. A Multi-Projector Calibration Method for Virtual Reality Simulators with Analytically Defined Screens

    Directory of Open Access Journals (Sweden)

    Cristina Portalés

    2017-06-01

    Full Text Available The geometric calibration of projectors is a demanding task, particularly for the industry of virtual reality simulators. Different methods have been developed during the last decades to retrieve the intrinsic and extrinsic parameters of projectors, most of them being based on planar homographies and some requiring an extended calibration process. The aim of our research work is to design a fast and user-friendly method to provide multi-projector calibration on analytically defined screens, where a sample is shown for a virtual reality Formula 1 simulator that has a cylindrical screen. The proposed method results from the combination of surveying, photogrammetry and image processing approaches, and has been designed by considering the spatial restrictions of virtual reality simulators. The method has been validated from a mathematical point of view, and the complete system—which is currently installed in a shopping mall in Spain—has been tested by different users.

  14. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  15. Study on a noninvasive method for rapid screening Human Serum albumin injectables by Raman spectroscopy

    Directory of Open Access Journals (Sweden)

    Yu Zhao

    2017-01-01

    Full Text Available Human serum albumin (HSA injectable product is a severely afflicted area on drug safety due to its high price and restricted supply. Raman spectroscopy performances high specificity on HSA detection and it is even possible to determine HSA injectable products noninvasively. In this study, we developed a noninvasive rapid screening method for of HSA injectable products by using portable Raman spectrometer. Qualitative models were established by using principal component analysis combined with classical least squares (PCA-CLS algorithm, while quantitative model was established by using partial least squares (PLS algorithm. Model transfer in different instruments of both the same and different apparatus modules was further discussed in this paper. A total of 34 HSA injectable samples collected from markets were used for verification. The identification results showed 100% accuracy and the predicted concentrations of those identified as true HSA were consistent with their labeled concentrations. The quantitative results also indicated that model transfer was excellent in the same apparatus modules of Raman spectrometer at all concentration levels, and still good enough in the different apparatus modules although the relative standard deviation (RSD value showed a little increasing trend at low HSA concentration level. In conclusion, the method was proved to be feasible and efficient for screening HSA injections, especially on its screening speed and the consideration of glass containers. Moreover, with inspiring results on the model transfer, the method could be used as a universal screening mean to different Raman instruments.

  16. The effectiveness of scoliosis screening programs: methods for systematic review and expert panel recommendations formulation

    Science.gov (United States)

    2013-01-01

    Background Literature on scoliosis screening is vast, however because of the observational nature of available data and methodological flaws, data interpretation is often complex, leading to incomplete and sometimes, somewhat misleading conclusions. The need to propose a set of methods for critical appraisal of the literature about scoliosis screening, a comprehensive summary and rating of the available evidence appeared essential. Methods To address these gaps, the study aims were: i) To propose a framework for the assessment of published studies on scoliosis screening effectiveness; ii) To suggest specific questions to be answered on screening effectiveness instead of trying to reach a global position for or against the programs; iii) To contextualize the knowledge through expert panel consultation and meaningful recommendations. The general methodological approach proceeds through the following steps: Elaboration of the conceptual framework; Formulation of the review questions; Identification of the criteria for the review; Selection of the studies; Critical assessment of the studies; Results synthesis; Formulation and grading of recommendations in response to the questions. This plan follows at best GRADE Group (Grades of Recommendation, Assessment, Development and Evaluation) requirements for systematic reviews, assessing quality of evidence and grading the strength of recommendations. Conclusions In this article, the methods developed in support of this work are presented since they may be of some interest for similar reviews in scoliosis and orthopaedic fields. PMID:23883346

  17. Screening, sensitivity, and uncertainty for the CREAM method of Human Reliability Analysis

    International Nuclear Information System (INIS)

    Bedford, Tim; Bayley, Clare; Revie, Matthew

    2013-01-01

    This paper reports a sensitivity analysis of the Cognitive Reliability and Error Analysis Method for Human Reliability Analysis. We consider three different aspects: the difference between the outputs of the Basic and Extended methods, on the same HRA scenario; the variability in outputs through the choices made for common performance conditions (CPCs); and the variability in outputs through the assignment of choices for cognitive function failures (CFFs). We discuss the problem of interpreting categories when applying the method, compare its quantitative structure to that of first generation methods and discuss also how dependence is modelled with the approach. We show that the control mode intervals used in the Basic method are too narrow to be consistent with the Extended method. This motivates a new screening method that gives improved accuracy with respect to the Basic method, in the sense that (on average) halves the uncertainty associated with the Basic method. We make some observations on the design of a screening method that are generally applicable in Risk Analysis. Finally, we propose a new method of combining CPC weights with nominal probabilities so that the calculated probabilities are always in range (i.e. between 0 and 1), while satisfying sensible properties that are consistent with the overall CREAM method

  18. Ethnobotanical Survey, Preliminary Physico-Chemical and Phytochemical Screening of Salvia argentea (L.) Used by Herbalists of the Saïda Province in Algeria.

    Science.gov (United States)

    Benabdesslem, Yasmina; Hachem, Kadda; Kahloula, Khaled; Slimani, Miloud

    2017-12-05

    An ethnobotanical study was carried out in the Saïda region among herbalists to evaluate the use of Salvia argentea (L.), a plant species native from North Africa belonging to the Lamiaceae family. Forty-two herbalists were interviewed individually, aged between 30 and 70 years, all males, 52.38% of them having received a secondary education level and having performing their duties for more than a decade. This study showed that Salvia argentea is used specifically in the treatment of diseases of the respiratory system. The leaves are the most commonly used part, usually in the form of powder and exclusively administered orally. The preliminary results of the physicochemical characterization and the phytochemical screening of the powdered leaves of Salvia argentea attest to their safety and confer them a guarantee of phytotherapeutic quality.

  19. Development of methods for screening pesticide residues in plant matrices in Ghana

    International Nuclear Information System (INIS)

    Lowor, Samuel Tetteh

    1999-12-01

    TLC has been used in combination with micro-extraction and clean-up methods to provide an alternative cost effective analytical procedure for screening pesticide residues in plant matrices. Thirty-five (35) agrochemicals, which are used in priority crops in Ghana, were used in this study. Ethylacetate extraction in the presence of anhydrous sodium sulphate, followed by gel permeation chromatographic clean up and additional purification on silica gel cartridges provided clean extracts enabling the application of 300mg sample equivalent on the TLC plates. Detection method involving the use of O-tolidine was found to be suitable for general screening of residues, having medium sensitivity for several compounds. The method involving the use of silver nitrate was the only one found to be most suitable for detecting the organo chlorine pesticides. Lindane was the most sensitive to this reagent and had a Minimum Detectable Quantity (MDQ) value of 5ng/5 uL. This method was suitable for use on only alumina plates and detection was also possible even under sunlight. The enzyme inhibition methods were very sensitive to the carbamate and phosphoric acid type insecticides with MDQ values between 0.2 and 2000ng. Other detection methods involving p-nitrobenzene, p-dimethylaminobenzaldehyde and photosynthesis inhibition were also tried and discussed. The database developed has been successfully used for screening and semiquantitative determination of some ranges of pesticide residue in soil and plant matrices. (au)

  20. Added value, decreased cost: the evolving role of the cytotechnologist for preliminary screening and triage of thyroid aspirates.

    Science.gov (United States)

    Wotruba, Angelean L; Stewart, Jimmie; Scheberl, Thomas; Selvaggi, Suzanne M

    2011-12-01

    Immediate adequacy assessment for thyroid fine-needle aspirations (FNAs) is standard practice in many cytopathology laboratories. A pathologist is usually present for these time consuming assessments. The purpose of this 5 month study (January 2008-May 2008) was to show that cytotechnologists can accurately provide the majority of immediate adequacy assessments for thyroid FNAs, saving both time and money for pathologists, clinicians, and patients. The study consisted of 167 thyroid nodule FNAs performed in twice weekly thyroid FNA clinics. A comparison was made of the immediate assessments by five participating cytotechnologists and the preliminary and final diagnoses by three pathologists. The cytotechnologist prepared the slides, assessed the air-dried Hema-Diff™ stained slides for adequacy, and the pathologist viewed the slides remotely via real-time video streaming. Results were recorded in an Excel spreadsheet. There was a discordance rate of 1.2% when comparing the cytotechnologist's adequacy interpretation and the pathologist's preliminary diagnosis; both clinically insignificant. By cytotechnologist assessment, 79.0% of the cases were benign and 6.6% were nondiagnostic. 14.4% of the cases were assessed as cellular nodule or neoplastic lesion; all requiring pathologist's preliminary diagnosis. Utilizing a cytotechnologist to provide adequacy, instead of a pathologist, saved $464.10/case (2.38 passes/case) based on current gross technical and professional charges. On the basis of our findings, cytotechnologists can accurately provide immediate onsite adequacy assessments for thyroid nodule FNAs. Affording cytotechnologists the opportunity to preliminarily assess FNAs for adequacy also creates a new role in the laboratory. Furthermore, cost-savings are realized for patients and the health care system. Copyright © 2010 Wiley Periodicals, Inc.

  1. Cost and effectiveness comparison of two methods for screening potential blood donors for anaemia in Vietnam.

    Science.gov (United States)

    Tyrrell, A; Worrall, E; Que, T N; Bates, I

    2011-06-01

    To compare the cost and effectiveness of Copper Sulphate (CS) and HemoCue (HC) methods for screening blood donors for anaemia. Robust information from developing countries about cost and effectiveness of anaemia screening methods for blood donors is scarce. In such countries there are widespread shortages of blood, so the most cost-effective method should maximise blood supply without compromising donor safety. Economic data (e.g. staff time, equipment and buildings) were collected from direct observation of procedures and purchase data from Hanoi's Central Blood Bank administrative department. A framework for comparing the cost and effectiveness of anaemia screening methods was developed and a cost per effective (i.e. usable and accurate) test was generated for each method. Samples from 100 potential donors from the Hanoi Central Blood Bank (static) and 198 from two mobile units were tested. The mean probability of an ineffective anaemia test was 0·1 (0·05-0·2). The average cost of an HC test was $0·75 (static $0·61 and mobile $0·89) and a CS test was $0·31 (static $0·17 and mobile $0·45). The difference between static and mobile units was predominantly due to transport costs; the difference between the two methods was predominantly due to the HC microcuvettes. In this setting the CS yields greater value for money than the HC method for screening blood donors. The relative cost and effectiveness of CS and HC may be different in places with higher staff turnover, lower test accuracy, higher anaemia prevalence or lower workload than in Vietnam. © 2010 Liverpool School of Tropical Medicine. Transfusion Medicine © 2010 British Blood Transfusion Society.

  2. Elastic and inelastic methods of piping systems analysis: a preliminary review

    International Nuclear Information System (INIS)

    Reich, M.; Esztergar, E.P.; Spence, J.; Boyle, J.; Chang, T.Y.

    1975-02-01

    A preliminary review of the methods used for elastic and inelastic piping system analysis is presented. The following principal conclusions are reached: techniques for the analysis of complex piping systems operating in the high temperature creep regime should be further developed; accurate analysis of a complete pipework system in creep using the ''complete shell finite element methods'' is not feasible at the present, and the ''reduced shell finite element method'' still requires excessive computer time and also requires further investigation regarding the compatibility problems associated with the pipe bend element, particularly when applied to cases involving general loading conditions; and with the current size of proposed high temperature systems requiring the evaluation of long-term operating life (30 to 40 years), it is important to adopt a simplified analysis method. A design procedure for a simplified analysis method based on currently available techniques applied in a three-stage approach is outlined. The work required for implementation of these procedures together with desirable future developments are also briefly discussed. Other proposed simplified approximations also are reviewed in the text. 101 references. (U.S.)

  3. A sensitive immunoblotting method for screening of microalbuminuria in diabetic patient's urine

    International Nuclear Information System (INIS)

    Abdolkhaleg, D.; Behrooz, S.

    2005-01-01

    Urinary albumin excretion is a useful marker in the prognosis of diabetic nephropathy and microvascular diseases. Methods such as enzyme linked immunosorbent assay (ELISA), radio immunoassay(RIA), radial immunodiffusion, albu screen, micro bumin and micral test are usually used for detection and screening of microalbuminuria in these patients. With consideration to the cost of an assay, methods such as ELISA and RIA are not suitable methods for screening purpose. Therefore, the aim of this work is to set a dot immunoblotting method for the measurement and screening of microalbumin in urine samples. The study was conducted during the period August 2001 to June 2003 at the National Research Center for Genetic Engineering and Biotechnology (NRCGEB) and Pars Hospital Laboratory of Tehran, Iran on 96 diabetic patients urine samples. First, anti human albumin antibodies (Abs) were produced in rabbit and immunoglobulin G (IgG) fraction was purified by protein-A affinity chromatography. Titer of Abs and optimum incubation conditions were tested by direct ELISA. Then different concentration of human albumin (0-300 mg/l) was loaded to nitrocellulose membranes and was assayed by dot immunoblotting method. The specificity and cross reactivity of Abs was tested by SDS-PAGE electrophoresis and western immunoblotting. The sensitivity of the method was calculated from human albumin calibration curve and compared with commercial immunoturbidimetric assays. Our results indicates that in using IgG with the concentrations 0.5-1 ug/ml (2 x 10-5 to 10-4 dilutions) the intensity of color directly increased with the increase of human albumin standards in blots. Western immunoblotting of urine samples did not show any cross reactivity with other urine proteins. Comparison of results of this method by commercial immunoturbidimetric methods indicates the correlation regression of approximately 0.979. The sensitivity of the method was approximately 5 mg/L of human albumin. This simple

  4. A new screening method to identify inhibitors of the Lol (localization of lipoproteins) system, a novel antibacterial target.

    Science.gov (United States)

    Ito, Hideaki; Ura, Atsushi; Oyamada, Yoshihiro; Yoshida, Hiroaki; Yamagishi, Jun-Ichi; Narita, Shin-Ichiro; Matsuyama, Shin-Ichi; Tokuda, Hajime

    2007-01-01

    As the Lol system, which is involved in localization of lipoproteins, is essential for Escherichia coli growth and widely conserved among gram-negative bacteria, it is considered to be a promising target for the development of anti-gram-negative bacterial agents. However, no high-throughput screening method has so far been developed to screen for Lol system inhibitors. By combining three assay systems (anucleate cell blue assay, Lpp assay, and LolA-dependent release inhibition assay) and a drug susceptibility test, we have successfully developed a new screening method for identification of compounds that inhibit the Lol system. Using this new screening method, we screened 23,600 in-house chemical compounds and found 2 Lol system inhibitors. We therefore conclude that our new screening method can efficiently identify new antibacterial agents that target the Lol system.

  5. Preliminary experiment of fast neutron imaging with direct-film method

    International Nuclear Information System (INIS)

    Pei Yuyang; Tang Guoyou; Guo Zhiyu; Zhang Guohui

    2005-01-01

    A preliminary experiment is conducted with direct-film method under the condition that fast neutron is generated by the reaction of 9 Be(d, n) on the Beijing University 4.5 MV Van de Graaff, whose energy is lower than 7 MeV. Basic characteristics of direct-film neutron radiography system are investigated with the help of samples in different materials, different thickness and holes of different diameter. The fast neutron converter, which is vital for fast neutron imaging, is produced with the materials made in China. The result indicates that fast neutron converter can meet the requirement of fast neutron imaging; further research of fast neutron imaging can be conducted on the accelerator and neutron-generator in China. (authors)

  6. A method to screen obstructive sleep apnea using multi-variable non-intrusive measurements

    International Nuclear Information System (INIS)

    De Silva, S; Abeyratne, U R; Hukins, C

    2011-01-01

    Obstructive sleep apnea (OSA) is a serious sleep disorder. The current standard OSA diagnosis method is polysomnography (PSG) testing. PSG requires an overnight hospital stay while physically connected to 10–15 channels of measurement. PSG is expensive, inconvenient and requires the extensive involvement of a sleep technologist. As such, it is not suitable for community screening. OSA is a widespread disease and more than 80% of sufferers remain undiagnosed. Simplified, unattended and cheap OSA screening methods are urgently needed. Snoring is commonly associated with OSA but is not fully utilized in clinical diagnosis. Snoring contains pseudo-periodic packets of energy that produce characteristic vibrating sounds familiar to humans. In this paper, we propose a multi-feature vector that represents pitch information, formant information, a measure of periodic structure existence in snore episodes and the neck circumference of the subject to characterize OSA condition. Snore features were estimated from snore signals recorded in a sleep laboratory. The multi-feature vector was applied to a neural network for OSA/non-OSA classification and K-fold cross-validated using a random sub-sampling technique. We also propose a simple method to remove a specific class of background interference. Our method resulted in a sensitivity of 91 ± 6% and a specificity of 89 ± 5% for test data for AHI THRESHOLD = 15 for a database consisting of 51 subjects. This method has the potential as a non-intrusive, unattended technique to screen OSA using snore sound as the primary signal

  7. Rapid screening of guar gum using portable Raman spectral identification methods.

    Science.gov (United States)

    Srivastava, Hirsch K; Wolfgang, Steven; Rodriguez, Jason D

    2016-01-25

    Guar gum is a well-known inactive ingredient (excipient) used in a variety of oral pharmaceutical dosage forms as a thickener and stabilizer of suspensions and as a binder of powders. It is also widely used as a food ingredient in which case alternatives with similar properties, including chemically similar gums, are readily available. Recent supply shortages and price fluctuations have caused guar gum to come under increasing scrutiny for possible adulteration by substitution of cheaper alternatives. One way that the U.S. FDA is attempting to screen pharmaceutical ingredients at risk for adulteration or substitution is through field-deployable spectroscopic screening. Here we report a comprehensive approach to evaluate two field-deployable Raman methods--spectral correlation and principal component analysis--to differentiate guar gum from other gums. We report a comparison of the sensitivity of the spectroscopic screening methods with current compendial identification tests. The ability of the spectroscopic methods to perform unambiguous identification of guar gum compared to other gums makes them an enhanced surveillance alternative to the current compendial identification tests, which are largely subjective in nature. Our findings indicate that Raman spectral identification methods perform better than compendial identification methods and are able to distinguish guar gum from other gums with 100% accuracy for samples tested by spectral correlation and principal component analysis. Published by Elsevier B.V.

  8. School Locations and Traffic Emissions — Environmental (InJustice Findings Using a New Screening Method

    Directory of Open Access Journals (Sweden)

    Philine Gaffron

    2015-02-01

    Full Text Available It has been shown that the location of schools near heavily trafficked roads can have detrimental effects on the health of children attending those schools. It is therefore desirable to screen both existing school locations and potential new school sites to assess either the need for remedial measures or suitability for the intended use. Current screening tools and public guidance on school siting are either too coarse in their spatial resolution for assessing individual sites or are highly resource intensive in their execution (e.g., through dispersion modeling. We propose a new method to help bridge the gap between these two approaches. Using this method, we also examine the public K-12 schools in the Sacramento Area Council of Governments Region, California (USA from an environmental justice perspective. We find that PM2.5 emissions from road traffic affecting a school site are significantly positively correlated with the following metrics: percent share of Black, Hispanic and multi-ethnic students, percent share of students eligible for subsidized meals. The emissions metric correlates negatively with the schools’ Academic Performance Index, the share of White students and average parental education levels. Our PM2.5 metric also correlates with the traffic related, census tract level screening indicators from the California Communities Environmental Health Screening Tool and the tool’s tract level rate of asthma related emergency department visits.

  9. Abdominal ultrasound-scanning versus non-contrast computed tomography as screening method for abdominal aortic aneurysm

    DEFF Research Database (Denmark)

    Liisberg, Mads; Diederichsen, Axel C.; Lindholt, Jes S.

    2017-01-01

    Background: Validating non-contrast-enhanced computed tomography (nCT) compared to ultrasound sonography (US) as screening method for abdominal aortic aneurysm (AAA) screening. Methods: Consecutively attending men (n = 566) from the pilot study of the randomized Danish CardioVascular Screening......CT seems superior to US concerning sensitivity, and is able to detect aneurysmal lesions not detectable with US. Finally, the prevalence of AAA in Denmark seems to remain relatively high, in this small pilot study group....

  10. SCREENING METHODS FOR SELECTION OF SURFACTANT FORMULATIONS FOR IOR FROM FRACTURED CARBONATE RESERVOIRS

    Energy Technology Data Exchange (ETDEWEB)

    William A. Goddard III; Yongchun Tang; Patrick Shuler; Mario Blanco; Yongfu Wu; Seung Soon Jang

    2005-07-01

    This topical report presents details of the laboratory work performed to complete Task 1 of this project; developing rapid screening methods to assess surfactant performance for IOR (Improved Oil Recovery) from fractured carbonate reservoirs. The desired outcome is to identify surfactant formulations that increase the rate and amount of aqueous phase imbibition into oil-rich, oil-wet carbonate reservoir rock. Changing the wettability from oil-wet to water-wet is one key to enhancing this water-phase imbibition process that in turn recovers additional oil from the matrix portion of a carbonate reservoir. The common laboratory test to evaluate candidate surfactant formulations is to measure directly the aqueous imbibition rate and oil recovery from small outcrop or reservoir cores, but this procedure typically requires several weeks. Two methods are presented here for the rapid screening of candidate surfactant formulations for their potential IOR performance in carbonate reservoirs. One promising surfactant screening protocol is based on the ability of a surfactant solution to remove aged crude oil that coats a clear calcite crystal (Iceland Spar). Good surfactant candidate solutions remove the most oil the quickest from the chips, plus change the apparent contact angle of the remaining oil droplets on the surface that thereby indicate increased water-wetting. The other fast surfactant screening method is based on the flotation behavior of powdered calcite in water. In this test protocol, first the calcite power is pre-treated to make the surface oil-wet. The next step is to add the pre-treated powder to a test tube and add a candidate aqueous surfactant formulation; the greater the percentage of the calcite that now sinks to the bottom rather than floats, the more effective the surfactant is in changing the solids to become now preferentially water-wet. Results from the screening test generally are consistent with surfactant performance reported in the literature.

  11. Real-time and online screening method for materials emitting volatile organic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Changhyuk [University of Minnesota, Department of Mechanical Engineering (United States); Sul, Yong Tae [Hoseo University (Korea, Republic of); Pui, David Y. H., E-mail: dyhpui@umn.edu [University of Minnesota, Department of Mechanical Engineering (United States)

    2016-09-15

    In the semiconductor industry, volatile organic compounds (VOCs) in the cleanroom air work as airborne molecular contamination, which reduce the production yield of semiconductor chips by forming nanoparticles and haze on silicon wafers and photomasks under ultraviolet irradiation during photolithography processes. Even though VOCs in outdoor air are removed by gas filters, VOCs can be emitted from many kinds of materials used in cleanrooms, such as organic solvents and construction materials (e.g., adhesives, flame retardants and sealants), threatening the production of semiconductors. Therefore, finding new replacements that emit lower VOCs is now essential in the semiconductor industry. In this study, we developed a real-time and online method to screen materials for developing the replacements by converting VOCs into nanoparticles under soft X-ray irradiation. This screening method was applied to measure VOCs emitted from different kinds of organic solvents and adhesives. Our results showed good repeatability and high sensitivity for VOCs, which come from aromatic compounds, some alcohols and all tested adhesives (Super glue and cleanroom-use adhesives). In addition, the overall trend of measured VOCs from cleanroom-use adhesives was well matched with those measured by a commercial thermal desorption–gas chromatography–mass spectrometry, which is a widely used off-line method for analyzing VOCs. Based on the results, this screening method can help accelerate the developing process for reducing VOCs in cleanrooms.

  12. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment

    Energy Technology Data Exchange (ETDEWEB)

    Li, Juan, E-mail: lijuan@craes.org.cn [College of Water Sciences, Beijing Normal University, Beijing 100875 (China); Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Yang, Yang [College of Environment, Beijing Normal University, Beijing 100875 (China); Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Huan, Huan; Li, Mingxiao [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Xi, Beidou, E-mail: xibd413@yeah.net [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Lanzhou Jiaotong University, Lanzhou 730070 (China); Lv, Ningqing [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China); Wu, Yi [Guizhou Academy of Environmental Science and Designing, Guizhou 550000 (China); Xie, Yiwen, E-mail: qin3201@126.com [School of Chemical and Environmental Engineering, Dongguan University of Technology, Dongguan, 523808 (China); Li, Xiang; Yang, Jinjin [Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); State Environmental Protection Key Laboratory of Simulation and Control of Groundwater Pollution, Beijing, 100012 (China)

    2016-05-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. - Highlights: • An

  13. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment

    International Nuclear Information System (INIS)

    Li, Juan; Yang, Yang; Huan, Huan; Li, Mingxiao; Xi, Beidou; Lv, Ningqing; Wu, Yi; Xie, Yiwen; Li, Xiang; Yang, Jinjin

    2016-01-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. - Highlights: • An

  14. HIGH THROUGHPUT SCREENING METHOD AND APPARATUS FOR ANALYSING INTERACTIONS BETWEEN SURFACES WITH DIFFERENT TOPOGRAPHY AND THE ENVIRONMENT

    NARCIS (Netherlands)

    de Boer, Jan; van Blitterswijk, Clemens; Unadkat, H.V.; Stamatialis, Dimitrios; Papenburg, B.J.; Wessling, Matthias

    2009-01-01

    The invention is directed to a high throughput screening method for analysing and interaction between a surface of a material and an environment. The screening method of the invention comprises: providing a micro-array comprising said material and having a multitude of units at least part of which

  15. Optimal Methods to Screen Men and Women for Intimate Partner Violence: Results from an Internal Medicine Residency Continuity Clinic

    Science.gov (United States)

    Kapur, Nitin A.; Windish, Donna M.

    2011-01-01

    Contradictory data exist regarding optimal methods and instruments for intimate partner violence (IPV) screening in primary care settings. The purpose of this study was to determine the optimal method and screening instrument for IPV among men and women in a primary-care resident clinic. We conducted a cross-sectional study at an urban, academic,…

  16. A novel two-step method for screening shade tolerant mutant plants via dwarfism

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-10-01

    Full Text Available When subjected to shade, plants undergo rapid shoot elongation, which often makes them more prone to disease and mechanical damage. Shade-tolerant plants can be difficult to breed; however, they offer a substantial benefit over other varieties in low-light areas. Although perennial ryegrass (Lolium perenne L. is a popular species of turf grasses because of their good appearance and fast establishment, the plant normally does not perform well under shade conditions. It has been reported that, in turfgrass, induced dwarfism can enhance shade tolerance. Here we describe a two-step procedure for isolating shade tolerant mutants of perennial ryegrass by first screening for dominant dwarf mutants, and then screening dwarf plants for shade tolerance. The two-step screening process to isolate shade tolerant mutants can be done efficiently with limited space at early seedling stages, which enables quick and efficient isolation of shade tolerant mutants, and thus facilitates development of shade tolerant new cultivars of turfgrasses. Using the method, we isolated 136 dwarf mutants from 300,000 mutagenized seeds, with 65 being shade tolerant (0.022%. When screened directly for shade tolerance, we recovered only four mutants from a population of 150,000 (0.003% mutagenized seeds. One shade tolerant mutant, shadow-1, was characterized in detail. In addition to dwarfism, shadow-1 and its sexual progeny displayed high degrees of tolerance to both natural and artificial shade. We showed that endogenous gibberellin (GA content in shadow-1 was higher than wild-type controls, and shadow-1 was also partially GA insensitive. Our novel, simple and effective two-step screening method should be applicable to breeding shade tolerant cultivars of turfgrasses, ground covers, and other economically important crop plants that can be used under canopies of existing vegetation to increase productivity per unit area of land.

  17. Using stable isotopes to monitor forms of sulfur during desulfurization processes: A quick screening method

    Science.gov (United States)

    Liu, Chao-Li; Hackley, Keith C.; Coleman, D.D.; Kruse, C.W.

    1987-01-01

    A method using stable isotope ratio analysis to monitor the reactivity of sulfur forms in coal during thermal and chemical desulfurization processes has been developed at the Illinois State Geological Survey. The method is based upon the fact that a significant difference exists in some coals between the 34S/32S ratios of the pyritic and organic sulfur. A screening method for determining the suitability of coal samples for use in isotope ratio analysis is described. Making these special coals available from coal sample programs would assist research groups in sorting out the complex sulfur chemistry which accompanies thermal and chemical processing of high sulfur coals. ?? 1987.

  18. Ultra-high-throughput screening method for the directed evolution of glucose oxidase.

    Science.gov (United States)

    Ostafe, Raluca; Prodanovic, Radivoje; Nazor, Jovana; Fischer, Rainer

    2014-03-20

    Glucose oxidase (GOx) is used in many industrial processes that could benefit from improved versions of the enzyme. Some improvements like higher activity under physiological conditions and thermal stability could be useful for GOx applications in biosensors and biofuel cells. Directed evolution is one of the currently available methods to engineer improved GOx variants. Here, we describe an ultra-high-throughput screening system for sorting the best enzyme variants generated by directed evolution that incorporates several methodological refinements: flow cytometry, in vitro compartmentalization, yeast surface display, fluorescent labeling of the expressed enzyme, delivery of glucose substrate to the reaction mixture through the oil phase, and covalent labeling of the cells with fluorescein-tyramide. The method enables quantitative screening of gene libraries to identify clones with improved activity and it also allows cells to be selected based not only on the overall activity but also on the specific activity of the enzyme. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Methods for efficient high-throughput screening of protein expression in recombinant Pichia pastoris strains.

    Science.gov (United States)

    Camattari, Andrea; Weinhandl, Katrin; Gudiminchi, Rama K

    2014-01-01

    The methylotrophic yeast Pichia pastoris is becoming one of the favorite industrial workhorses for protein expression. Due to the widespread use of integration vectors, which generates significant clonal variability, screening methods allowing assaying hundreds of individual clones are of particular importance. Here we describe methods to detect and analyze protein expression, developed in a 96-well format for high-throughput screening of recombinant P. pastoris strains. The chapter covers essentially three common scenarios: (1) an enzymatic assay for proteins expressed in the cell cytoplasm, requiring cell lysis; (2) a whole-cell assay for a fungal cytochrome P450; and (3) a nonenzymatic assay for detection and quantification of tagged protein secreted into the supernatant.

  20. A method of measuring and correcting tilt of anti - vibration wind turbines based on screening algorithm

    Science.gov (United States)

    Xiao, Zhongxiu

    2018-04-01

    A Method of Measuring and Correcting Tilt of Anti - vibration Wind Turbines Based on Screening Algorithm is proposed in this paper. First of all, we design a device which the core is the acceleration sensor ADXL203, the inclination is measured by installing it on the tower of the wind turbine as well as the engine room. Next using the Kalman filter algorithm to filter effectively by establishing a state space model for signal and noise. Then we use matlab for simulation. Considering the impact of the tower and nacelle vibration on the collected data, the original data and the filtering data are classified and stored by the Screening algorithm, then filter the filtering data to make the output data more accurate. Finally, we eliminate installation errors by using algorithm to achieve the tilt correction. The device based on this method has high precision, low cost and anti-vibration advantages. It has a wide range of application and promotion value.

  1. Application of NMR Screening Methods with 19F Detection to Fluorinated Compounds Bound to Proteins

    Directory of Open Access Journals (Sweden)

    Kazuo Furihata

    2017-12-01

    Full Text Available The combinational use of one-dimensional (1D NMR-based screening techniques with 1H and 19F detections were applied to a human serum albumin–diflunisal complex. Since most NMR screening methods observe 1H spectra, the overlapped 1H signals were unavailable in the binding epitope mapping. However, the NMR experiments with 19F detection can be used as an effective complementary method. For the purpose of identifying the 1H and 19F binding epitopes of diflunisal, this paper carries out a combinatorial analysis using 1H{1H} and 19F{1H} saturation transfer difference experiments. The differences of the 1H-inversion recovery rates with and without target irradiation are also analyzed for a comprehensive interpretation of binding epitope mapping.

  2. Use of the blue cotton screen method with endoscopy to detect occult esophageal foreign bodies.

    Science.gov (United States)

    Xia, Yan; Zhang, Fan; Xu, Hong; Xu, Weiran

    2017-12-01

    More than 20,000 cases of upper gastrointestinal foreign bodies (FBs) have been reported in the last 5 years in China. Early detection and treatment is vital in these patients. Differential diagnosis of esophageal injury and occult esophageal foreign bodies is challenging, particularly in the case of non-radio-opaque foreign bodies. A diagnostic technique with high accuracy and low risk is needed for clinical practice. We describe successful use of the "blue cotton screen method" to detect esophageal foreign bodies in 2 patients. The advantages and disadvantages of various diagnostic modalities in the management of patients with foreign body ingestion are presented. This technique is safer and more effective than traditional methods for foreign body impaction in the esophageal cavity. It could be applied for screening and in the differential diagnosis of esophageal injury and FBs in the esophageal lumen.

  3. A study on asymptomatic bacteriuria in pregnancy: prevalence, etiology and comparison of screening methods

    OpenAIRE

    Kheya Mukherjee; Saroj Golia; Vasudha CL; Babita; Debojyoti Bhattacharjee; Goutam Chakroborti

    2014-01-01

    Background: Asymptomatic bacteriuria is common in women with prevalence of 4-7% in pregnancy. The traditional reference test for bacteriuria is quantitative culture of urine which is relatively expensive time consuming and laborious. The aim of this study was to know the prevalence of asymptomatic bacteriuria in pregnancy, to identify pathogens and their antibiotic susceptibility patterns and to device a single or combined rapid screening method as an acceptable alternative to urine culture. ...

  4. A rapid colorimetric screening method for vanillic acid and vanillin-producing bacterial strains.

    Science.gov (United States)

    Zamzuri, N A; Abd-Aziz, S; Rahim, R A; Phang, L Y; Alitheen, N B; Maeda, T

    2014-04-01

    To isolate a bacterial strain capable of biotransforming ferulic acid, a major component of lignin, into vanillin and vanillic acid by a rapid colorimetric screening method. For the production of vanillin, a natural aroma compound, we attempted to isolate a potential strain using a simple screening method based on pH change resulting from the degradation of ferulic acid. The strain Pseudomonas sp. AZ10 UPM exhibited a significant result because of colour changes observed on the assay plate on day 1 with a high intensity of yellow colour. The biotransformation of ferulic acid into vanillic acid by the AZ10 strain provided the yield (Yp/s ) and productivity (Pr ) of 1·08 mg mg(-1) and 53·1 mg L(-1) h(-1) , respectively. In fact, new investigations regarding lignin degradation revealed that the strain was not able to produce vanillin and vanillic acid directly from lignin; however, partially digested lignin by mixed enzymatic treatment allowed the strain to produce 30·7 mg l(-1) and 1·94 mg l(-1) of vanillic acid and biovanillin, respectively. (i) The rapid colorimetric screening method allowed the isolation of a biovanillin producer using ferulic acid as the sole carbon source. (ii) Enzymatic treatment partially digested lignin, which could then be utilized by the strain to produce biovanillin and vanillic acid. To the best of our knowledge, this is the first study reporting the use of a rapid colorimetric screening method for bacterial strains producing vanillin and vanillic acid from ferulic acid. © 2013 The Society for Applied Microbiology.

  5. Method for screening prevention and control measures and technologies based on groundwater pollution intensity assessment.

    Science.gov (United States)

    Li, Juan; Yang, Yang; Huan, Huan; Li, Mingxiao; Xi, Beidou; Lv, Ningqing; Wu, Yi; Xie, Yiwen; Li, Xiang; Yang, Jinjin

    2016-05-01

    This paper presents a system for determining the evaluation and gradation indices of groundwater pollution intensity (GPI). Considering the characteristics of the vadose zone and pollution sources, the system decides which anti-seepage measures should be implemented at the contaminated site. The pollution sources hazards (PSH) and groundwater intrinsic vulnerability (GIV) are graded by the revised Nemerow Pollution Index and an improved DRTAS model, respectively. GPI is evaluated and graded by a double-sided multi-factor coupling model, which is constructed by the matrix method. The contaminated sites are categorized as prior, ordinary, or common sites. From the GPI results, we develop guiding principles for preventing and removing pollution sources, procedural interruption and remediation, and end treatment and monitoring. Thus, we can select appropriate prevention and control technologies (PCT). To screen the technological schemes and optimize the traditional analytical hierarchy process (AHP), we adopt the technique for order preference by the similarity to ideal solution (TOPSIS) method. Our GPI approach and PCT screening are applied to three types of pollution sites: the refuse dump of a rare earth mine development project (a potential pollution source), a chromium slag dump, and a landfill (existing pollution sources). These three sites are identified as ordinary, prior, and ordinary sites, respectively. The anti-seepage materials at the refuse dump should perform as effectively as a 1.5-m-thick clay bed. The chromium slag dump should be preferentially treated by soil flushing and in situ chemical remediation. The landfill should be treated by natural attenuation technology. The proposed PCT screening approach was compared with conventional screening methods results at the three sites and proved feasible and effective. The proposed method can provide technical support for the monitoring and management of groundwater pollution in China. Copyright © 2015

  6. Microengineering methods for cell-based microarrays and high-throughput drug-screening applications

    International Nuclear Information System (INIS)

    Xu Feng; Wu Jinhui; Wang Shuqi; Gurkan, Umut Atakan; Demirci, Utkan; Durmus, Naside Gozde

    2011-01-01

    Screening for effective therapeutic agents from millions of drug candidates is costly, time consuming, and often faces concerns due to the extensive use of animals. To improve cost effectiveness, and to minimize animal testing in pharmaceutical research, in vitro monolayer cell microarrays with multiwell plate assays have been developed. Integration of cell microarrays with microfluidic systems has facilitated automated and controlled component loading, significantly reducing the consumption of the candidate compounds and the target cells. Even though these methods significantly increased the throughput compared to conventional in vitro testing systems and in vivo animal models, the cost associated with these platforms remains prohibitively high. Besides, there is a need for three-dimensional (3D) cell-based drug-screening models which can mimic the in vivo microenvironment and the functionality of the native tissues. Here, we present the state-of-the-art microengineering approaches that can be used to develop 3D cell-based drug-screening assays. We highlight the 3D in vitro cell culture systems with live cell-based arrays, microfluidic cell culture systems, and their application to high-throughput drug screening. We conclude that among the emerging microengineering approaches, bioprinting holds great potential to provide repeatable 3D cell-based constructs with high temporal, spatial control and versatility.

  7. Microengineering methods for cell-based microarrays and high-throughput drug-screening applications

    Energy Technology Data Exchange (ETDEWEB)

    Xu Feng; Wu Jinhui; Wang Shuqi; Gurkan, Umut Atakan; Demirci, Utkan [Department of Medicine, Demirci Bio-Acoustic-MEMS in Medicine (BAMM) Laboratory, Center for Biomedical Engineering, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Durmus, Naside Gozde, E-mail: udemirci@rics.bwh.harvard.edu [School of Engineering and Division of Biology and Medicine, Brown University, Providence, RI (United States)

    2011-09-15

    Screening for effective therapeutic agents from millions of drug candidates is costly, time consuming, and often faces concerns due to the extensive use of animals. To improve cost effectiveness, and to minimize animal testing in pharmaceutical research, in vitro monolayer cell microarrays with multiwell plate assays have been developed. Integration of cell microarrays with microfluidic systems has facilitated automated and controlled component loading, significantly reducing the consumption of the candidate compounds and the target cells. Even though these methods significantly increased the throughput compared to conventional in vitro testing systems and in vivo animal models, the cost associated with these platforms remains prohibitively high. Besides, there is a need for three-dimensional (3D) cell-based drug-screening models which can mimic the in vivo microenvironment and the functionality of the native tissues. Here, we present the state-of-the-art microengineering approaches that can be used to develop 3D cell-based drug-screening assays. We highlight the 3D in vitro cell culture systems with live cell-based arrays, microfluidic cell culture systems, and their application to high-throughput drug screening. We conclude that among the emerging microengineering approaches, bioprinting holds great potential to provide repeatable 3D cell-based constructs with high temporal, spatial control and versatility.

  8. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  9. Screening for Cd-Safe Cultivars of Chinese Cabbage and a Preliminary Study on the Mechanisms of Cd Accumulation

    Directory of Open Access Journals (Sweden)

    Jingjie Wang

    2017-04-01

    Full Text Available With the rapid progress of industrialization, the effects of environmental contamination on plant toxicity, and subsequently on human health, is a growing concern. For example, the heavy metal pollution of soil such as that caused by cadmium (Cd is a serious threat. Therefore, screening for pollution-safe edible plants is an essential approach for growing plants under heavy metal-contaminated soils. In the current study, 35 Chinese cabbage (Brassica pekinensis L. cultivars were selected with the aim of screening for Cd-safe cultivars (CSCs, analyzing their safety, and exploring the mechanism of Cd accumulation. Our field-culture experiments revealed that the Cd content in the edible parts of the cultivars were varied and were determined to possibly be CSCs. Hydroponics experiments were used to simulate six different degrees of soil contamination (high and low Cd concentrations on possible CSCs. The results indicated a significant difference (p < 0.05 in Cd concentration in the cultivars, and verified the safety of these possible CSCs. The analyses of the transport coefficient and expression levels showed that the differences in Cd accumulation among the Chinese cabbage cultivars were related to the expression of genes involved in absorption and transport rather than a root-to-shoot translocation limitation.

  10. Comparison of different screening methods for blood pressure disorders in children and adolescents

    Directory of Open Access Journals (Sweden)

    Felipe Alves Mourato

    2015-06-01

    Full Text Available OBJECTIVE: To compare different methods of screening for blood pressure disorders in children and adolescents. METHOD: A database with 17,083 medical records of patients from a pediatric cardiology clinic was used. After analyzing the inclusion and exclusion criteria, 5,650 were selected. These were divided into two age groups: between 5 and 13 years and between 13 and 18 years. The blood pressure measurement was classified as normal, pre-hypertensive, or hypertensive, consistent with recent guidelines and the selected screening methods. Sensitivity, specificity, and accuracy were then calculated according to gender and age range. RESULTS: The formulas proposed by Somu and Ardissino's table showed low sensitivity in identifying pre-hypertension in all age groups, whereas the table proposed by Kaelber showed the best results. The ratio between blood pressure and height showed low specificity in the younger age group, but showed good performance in adolescents. CONCLUSION: Screening tools used for the assessment of blood pressure disorders in children and adolescents may be useful to decrease the current rate of underdiagnosis of this condition. The table proposed by Kaelber showed the best results; however, the ratio between BP and height demonstrated specific advantages, as it does not require tables.

  11. Comparison of three noninvasive methods for hemoglobin screening of blood donors.

    Science.gov (United States)

    Ardin, Sergey; Störmer, Melanie; Radojska, Stela; Oustianskaia, Larissa; Hahn, Moritz; Gathof, Birgit S

    2015-02-01

    To prevent phlebotomy of anemic individuals and to ensure hemoglobin (Hb) content of the blood units, Hb screening of blood donors before donation is essential. Hb values are mostly evaluated by measurement of capillary blood obtained from fingerstick. Rapid noninvasive methods have recently become available and may be preferred by donors and staff. The aim of this study was to evaluate for the first time all different noninvasive methods for Hb screening. Blood donors were screened for Hb levels in three different trials using three different noninvasive methods (Haemospect [MBR Optical Systems GmbH & Co. KG], NBM 200 [LMB Technology GmbH], Pronto-7 [Masimo Europe Ltd]) in comparison to the established fingerstick method (CompoLab Hb [Fresenius Kabi GmbH]) and to levels obtained from venous samples on a cell counter (Sysmex [Sysmex Europe GmbH]) as reference. The usability of the noninvasive methods was assessed with an especially developed survey. Technical failures occurred by using the Pronto-7 due to nail polish, skin color, or ambient light. The NBM 200 also showed a high sensitivity to ambient light and noticeably lower Hb levels for women than obtained from the Sysmex. The statistical analysis showed the following bias and standard deviation of differences of all methods in comparison to the venous results: Haemospect, -0.22 ± 1.24; NBM, 200 -0.12 ± 1.14; Pronto-7, -0.50 ± 0.99; and CompoLab Hb, -0.53 ± 0.81. Noninvasive Hb tests represent an attractive alternative by eliminating pain and reducing risks of blood contamination. The main problem for generating reliable results seems to be preanalytical variability in sampling. Despite the sensitivity to environmental stress, all methods are suitable for Hb measurement. © 2014 AABB.

  12. Performance Evaluation of a Novel Chemiluminescence Assay Detecting Treponema Pallidum Antibody as a Syphilis Screening Method.

    Science.gov (United States)

    Chen, Qixia; An, Jingna; Rao, Chenli; Wang, Tingting; Li, Dongdong; Feng, Shu; Tao, Chuanmin

    2016-01-01

    Syphilis is a major concern to global public health with increasing incidence. So its screening test should have sufficient sensitivity and specificity. We evaluated the performance of the Lumipulse G TP-N assay detection for syphilis screening and compared it with the InTec ELISA test kit for TP, which is widely used. Samples of several patient groups including 133 clinical and serologically characterized syphilitic sera, 175 samples containing potentially interfering agents, and 2290 unselected samples submitted for routine screening were detected by both the Lumipulse G TP-N assay and the InTec ELISA test kit for TP. Inconsistent samples were confirmed by RecomLine Treponema IgG, IgM immunoblot. Coefficient of variations of the Lumipulseo G TP-N assay at both levels were below 5% and of the InTec ELISA test kit for TP both over 5%. The sensitivity of the Lumipulse G TP-N assay and the InTec ELISA test kit for TP were 100% for all stages of syphilis. The two methods had consistent analytical specificity of 100% (95% CI: 97.21 - 100.00), while the clinical specificity was 100% (95% CI: 99.79 - 100.00) and 99.82% (95% CI: 99.51 - 99.94), respectively. Between them, Spearman's correlation coefficient was 0.455 and kappa value was 0.986. The overall sensitivity and specificity of the Lumipulse G TP-N assay was higher than the InTec ELISA test kit for TP (sensitivity: 100.0 versus 99.5, specificity: 100.0 versus 99.8). The automated Lumipulse G TP-N assay demonstrated excellent diagnostic sensitivity and specificity when evaluated as a screening test for syphilis. Thus, it can be an alternative to the treponemal screening test.

  13. Rainfall assimilation in RAMS by means of the Kuo parameterisation inversion: method and preliminary results

    Science.gov (United States)

    Orlandi, A.; Ortolani, A.; Meneguzzo, F.; Levizzani, V.; Torricella, F.; Turk, F. J.

    2004-03-01

    In order to improve high-resolution forecasts, a specific method for assimilating rainfall rates into the Regional Atmospheric Modelling System model has been developed. It is based on the inversion of the Kuo convective parameterisation scheme. A nudging technique is applied to 'gently' increase with time the weight of the estimated precipitation in the assimilation process. A rough but manageable technique is explained to estimate the partition of convective precipitation from stratiform one, without requiring any ancillary measurement. The method is general purpose, but it is tuned for geostationary satellite rainfall estimation assimilation. Preliminary results are presented and discussed, both through totally simulated experiments and through experiments assimilating real satellite-based precipitation observations. For every case study, Rainfall data are computed with a rapid update satellite precipitation estimation algorithm based on IR and MW satellite observations. This research was carried out in the framework of the EURAINSAT project (an EC research project co-funded by the Energy, Environment and Sustainable Development Programme within the topic 'Development of generic Earth observation technologies', Contract number EVG1-2000-00030).

  14. Preliminary study of elemental analysis of hydroxyapatite used neutron activation analysis method

    International Nuclear Information System (INIS)

    Yustinus Purwamargapratala; Rina Mulyaningsih

    2010-01-01

    Preliminary study has been carried out elemental analysis of hydroxyapatite synthesized using the method of neutron activation analysis. Hydroxyapatite is the main component constituent of bones and teeth which can be synthesized from limestone and phosphoric acid. Hydroxyapatite can be used as a bone substitute material and human and animal teeth. Tests on the metal content is necessary to prevent the risk of damage to bones and teeth due to contamination. Results of analysis using neutron activation analysis method with samples irradiated at the neutron flux 10"3 n.det"-"1cm"-"2 for one minute, the impurities of Al (48.60±6.47 mg/kg), CI (38.00±7.47 mg/kg), Mn (1.05±0.19 mg/kg), and Mg (2095.30±203.66 mg/kg), were detected, whereas with irradiation time for 10 minutes and 40 minutes with a time decay of three days there were K (103.89 ± 26.82 mg/kg), Br (1617.06 ± 193.66 mg/kg), and Na (125.10±9.57 mg/kg). These results indicate that there is impurity Al, CI, Mn, Mg, Br, K and Na, although in very small amounts and do not cause damage to bones and teeth. (author)

  15. The use of comprehensive two-dimensional gas chromatography and structure-activity modeling for screening and preliminary risk assessment of organic contaminants in soil, sediment, and surface water

    Energy Technology Data Exchange (ETDEWEB)

    Moreira Bastos, Patricia; Haglund, Peter [Umeaa Univ. (Sweden). Dept. of Chemistry

    2012-08-15

    Purpose: This article aims to investigate the use and benefits of using comprehensive two-dimensional gas chromatography (GC x GC) and structure-activity relationship modeling for screening and prioritization of organic contaminants in complex matrices. The benefit of applying comprehensive screening techniques to samples with high organic contaminant content is primarily that compounds with diverse physicochemical properties can be analyzed simultaneously. Here, a heavily contaminated industrial area was surveyed for organic pollutants by analyzing soil, sediment, and surface water samples. The hazard of the pollutants were ranked using SARs. Material and methods: The water samples were liquid-liquid extracted using dichloromethane and directly analyzed by GC x GC-time-of-flight mass spectrometry (GC x GC-TofMS). Soil and sediment samples were extracted with dichloromethane in an ultrasonic bath and subjected to gel permeation chromatography to eliminate lipids and humic matter. The low molecular weight fraction was then analyzed with GC x GC-TofMS. Results and discussion: More than 10,000 components were found in each sample, of which ca. 300 individual compounds were unambiguously identified using the National Institute of Standards and Technology mass spectra library and authentic reference standards. Alkanes, polycyclic aromatic hydrocarbons, and phthalates were generally the most abundant and were found in all matrices. In contrast, chlorinated compounds such as chlorophenols, biphenyls, and chlorinated pesticides were only detected in samples from a few hotspot regions. The toxicities of the most frequently detected compounds and of the compounds detected at the highest concentrations in samples from hotspot regions were estimated by ecological structure-activity relationships. The ratio of the measured concentration to the predicted toxicity level was then calculated for each compound and used for an initial risk assessment in order to prioritize compounds

  16. Evaluation of a fluorescence-based method for antibabesial drug screening.

    Science.gov (United States)

    Guswanto, Azirwan; Sivakumar, Thillaiampalam; Rizk, Mohamed Abdo; Elsayed, Shimaa Abd Elsalam; Youssef, Mohamed Ahmed; ElSaid, ElSaid El Shirbini; Yokoyama, Naoaki; Igarashi, Ikuo

    2014-08-01

    In vitro evaluation of chemotherapeutic agents against Babesia and Theileria parasites has become routine, and the effectiveness of these chemicals is usually determined by comparing the parasitemia dynamics of untreated and treated parasites. Although microscopy is widely used to calculate parasitemia, several disadvantages are associated with this technique. The present study evaluated a fluorescence-based method using SYBR green I stain (SG I) to screen antibabesial agents in in vitro cultures of Babesia bovis. The linearity between relative fluorescence units (RFU) and parasitemia was found to be well correlated with a 0.9944 goodness-of-fit (r(2)) value. Subsequently, 50% inhibitory concentration (IC50) values were calculated for 3 antiprotozoan agents, diminazene aceturate, nimbolide, and gedunin, by this method. For diminazene aceturate and nimbolide, the IC(50)s determined by the fluorescence-based method (408 nM and 8.13 μM, respectively) and microscopy (400.3 nM and 9.4 μM, respectively) were in agreement. Furthermore, the IC50 of gedunin determined by the fluorescence-based method (19 μM) was similar to the recently described microscopy-based value (21.7 μM) for B. bovis. Additionally, the Z' factor (0.80 to 0.90), signal-to-noise (S/N) ratio (44.15 to 87.64), coefficient of variation at the maximum signal (%CVmax) (0.50 to 2.85), and coefficient of variation at the minimum signal (%CVmin) (1.23 to 2.21) calculated for the fluorescence method using diminazene aceturate were comparable to those previously determined in malaria research for this assay. These findings suggest that the fluorescence-based method might be useful for antibabesial drug screening and may have potential to be developed into a high-throughput screening (HTS) assay. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  17. A preliminary investigation into the relationship between functional movement screen scores and athletic physical performance in female team sport athletes

    Science.gov (United States)

    Schultz, AB; Callaghan, SJ; Jordan, CA; Luczo, TM; Jeffriess, MD

    2014-01-01

    There is little research investigating relationships between the Functional Movement Screen (FMS) and athletic performance in female athletes. This study analyzed the relationships between FMS (deep squat; hurdle step [HS]; in-line lunge [ILL]; shoulder mobility; active straight-leg raise [ASLR]; trunk stability push-up; rotary stability) scores, and performance tests (bilateral and unilateral sit-and-reach [flexibility]; 20-m sprint [linear speed]; 505 with turns from each leg; modified T-test with movement to left and right [change-of-direction speed]; bilateral and unilateral vertical and standing broad jumps; lateral jumps [leg power]). Nine healthy female recreational team sport athletes (age = 22.67 ± 5.12 years; height = 1.66 ± 0.05 m; body mass = 64.22 ± 4.44 kilograms) were screened in the FMS and completed the afore-mentioned tests. Percentage between-leg differences in unilateral sit-and-reach, 505 turns and the jumps, and difference between the T-test conditions, were also calculated. Spearman's correlations (p ≤ 0.05) examined relationships between the FMS and performance tests. Stepwise multiple regressions (p ≤ 0.05) were conducted for the performance tests to determine FMS predictors. Unilateral sit-and-reach positive correlated with the left-leg ASLR (r = 0.704-0.725). However, higher-scoring HS, ILL, and ASLR related to poorer 505 and T-test performance (r = 0.722-0.829). A higher-scored left-leg ASLR related to a poorer unilateral vertical and standing broad jump, which were the only significant relationships for jump performance. Predictive data tended to confirm the correlations. The results suggest limitations in using the FMS to identify movement deficiencies that could negatively impact athletic performance in female team sport athletes. PMID:25729149

  18. A preliminary investigation into the relationship between functional movement screen scores and athletic physical performance in female team sport athletes

    Directory of Open Access Journals (Sweden)

    Robert G Lockie

    2014-11-01

    Full Text Available There is little research investigating relationships between the Functional Movement Screen (FMS and athletic performance in female athletes. This study analyzed the relationships between FMS (deep squat; hurdle step [HS]; in-line lunge [ILL]; shoulder mobility; active straight-leg raise [ASLR]; trunk stability push-up; rotary stability scores, and performance tests (bilateral and unilateral sit-and-reach [flexibility]; 20-m sprint [linear speed]; 505 with turns from each leg; modified T-test with movement to left and right [change-of-direction speed]; bilateral and unilateral vertical and standing broad jumps; lateral jumps [leg power]. Nine healthy female recreational team sport athletes (age = 22.67 ± 5.12 years; height = 1.66 ± 0.05 m; body mass = 64.22 ± 4.44 kilograms were screened in the FMS and completed the afore-mentioned tests. Percentage between-leg differences in unilateral sit-and-reach, 505 turns and the jumps, and difference between the T-test conditions, were also calculated. Spearman’s correlations (p ≤ 0.05 examined relationships between the FMS and performance tests. Stepwise multiple regressions (p ≤ 0.05 were conducted for the performance tests to determine FMS predictors. Unilateral sit-and-reach positive correlated with the left-leg ASLR (r = 0.704-0.725. However, higher-scoring HS, ILL, and ASLR related to poorer 505 and T-test performance (r = 0.722-0.829. A higher-scored left-leg ASLR related to a poorer unilateral vertical and standing broad jump, which were the only significant relationships for jump performance. Predictive data tended to confirm the correlations. The results suggest limitations in using the FMS to identify movement deficiencies that could negatively impact athletic performance in female team sport athletes.

  19. Preliminary findings on the reliability and validity of the Cantonese Birmingham Cognitive Screen in patients with acute ischemic stroke.

    Science.gov (United States)

    Pan, Xiaoping; Chen, Haobo; Bickerton, Wai-Ling; Lau, Johnny King Lam; Kong, Anthony Pak Hin; Rotshtein, Pia; Guo, Aihua; Hu, Jianxi; Humphreys, Glyn W

    2015-01-01

    There are no currently effective cognitive assessment tools for patients who have suffered stroke in the People's Republic of China. The Birmingham Cognitive Screen (BCoS) has been shown to be a promising tool for revealing patients' poststroke cognitive deficits in specific domains, which facilitates more individually designed rehabilitation in the long run. Hence we examined the reliability and validity of a Cantonese version BCoS in patients with acute ischemic stroke, in Guangzhou. A total of 98 patients with acute ischemic stroke were assessed with the Cantonese version of the BCoS, and an additional 133 healthy individuals were recruited as controls. Apart from the BCoS, the patients also completed a number of external cognitive tests, including the Montreal Cognitive Assessment Test (MoCA), Mini Mental State Examination (MMSE), Albert's cancellation test, the Rey-Osterrieth Complex Figure Test, and six gesture matching tasks. Cutoff scores for failing each subtest, ie, deficits, were computed based on the performance of the controls. The validity and reliability of the Cantonese BCoS were examined, as well as interrater and test-retest reliability. We also compared the proportions of cases being classified as deficits in controlled attention, memory, character writing, and praxis, between patients with and without spoken language impairment. Analyses showed high test-retest reliability and agreement across independent raters on the qualitative aspects of measurement. Significant correlations were observed between the subtests of the Cantonese BCoS and the other external cognitive tests, providing evidence for convergent validity of the Cantonese BCoS. The screen was also able to generate measures of cognitive functions that were relatively uncontaminated by the presence of aphasia. This study suggests good reliability and validity of the Cantonese version of the BCoS. The Cantonese BCoS is a very promising tool for the detection of cognitive problems in

  20. Orthorexia nervosa in the general population: a preliminary screening using a self-administered questionnaire (ORTO-15).

    Science.gov (United States)

    Ramacciotti, C E; Perrone, P; Coli, E; Burgalassi, A; Conversano, C; Massimetti, G; Dell'Osso, L

    2011-06-01

    Orthorexia, from the Greek words orthos (straight, proper) and orexis (appetite), is a newly conceptualized disorder characterized by distorted eating habits and cognitions concerning supposedly healthy nutrition. In this article we present preliminary results of a wider research aimed to investigate the diffusion of Orthorexia in the general population and to highlight its characteristics and particularly the relationship with Eating Disorder and Obsessive-Compulsive Disorder. One-hundred and seventy seven adult subjects from the general population, were administered the ORTO-15 test, a selfadministered questionnaire specifically designed to assess orthorexic symptomatology; note that statistical analyses were repeated twice, referring to different diagnostic thresholds (40/35). Orthorexia had a 57.6% prevalence in our sample, using the 40-point threshold, with a female/male ratio 2:1; the figure was sensibly lower with the 35-point threshold (21%). The results of this study highlight the diffusion of Orthorexia which may constitute an important risk factor for mental and physical health, but also the opportunity of more specific diagnostic instruments, so to facilitate a thorough understanding of this disorder.

  1. Benchmarking Data Sets for the Evaluation of Virtual Ligand Screening Methods: Review and Perspectives.

    Science.gov (United States)

    Lagarde, Nathalie; Zagury, Jean-François; Montes, Matthieu

    2015-07-27

    Virtual screening methods are commonly used nowadays in drug discovery processes. However, to ensure their reliability, they have to be carefully evaluated. The evaluation of these methods is often realized in a retrospective way, notably by studying the enrichment of benchmarking data sets. To this purpose, numerous benchmarking data sets were developed over the years, and the resulting improvements led to the availability of high quality benchmarking data sets. However, some points still have to be considered in the selection of the active compounds, decoys, and protein structures to obtain optimal benchmarking data sets.

  2. Development of nondestructive screening methods for single kernel characterization of wheat

    DEFF Research Database (Denmark)

    Nielsen, J.P.; Pedersen, D.K.; Munck, L.

    2003-01-01

    predictability. However, by applying an averaging approach, in which single seed replicate measurements are mathematically simulated, a very good NIT prediction model was achieved. This suggests that the single seed NIT spectra contain hardness information, but that a single seed hardness method with higher......The development of nondestructive screening methods for single seed protein, vitreousness, density, and hardness index has been studied for single kernels of European wheat. A single kernel procedure was applied involving, image analysis, near-infrared transmittance (NIT) spectroscopy, laboratory...

  3. Comparison of different screening methods for blood pressure disorders in children and adolescents.

    Science.gov (United States)

    Mourato, Felipe Alves; Lima Filho, José Luiz; Mattos, Sandra da Silva

    2015-01-01

    To compare different methods of screening for blood pressure disorders in children and adolescents. A database with 17,083 medical records of patients from a pediatric cardiology clinic was used. After analyzing the inclusion and exclusion criteria, 5,650 were selected. These were divided into two age groups: between 5 and 13 years and between 13 and 18 years. The blood pressure measurement was classified as normal, pre-hypertensive, or hypertensive, consistent with recent guidelines and the selected screening methods. Sensitivity, specificity, and accuracy were then calculated according to gender and age range. The formulas proposed by Somu and Ardissino's table showed low sensitivity in identifying pre-hypertension in all age groups, whereas the table proposed by Kaelber showed the best results. The ratio between blood pressure and height showed low specificity in the younger age group, but showed good performance in adolescents. Screening tools used for the assessment of blood pressure disorders in children and adolescents may be useful to decrease the current rate of underdiagnosis of this condition. The table proposed by Kaelber showed the best results; however, the ratio between BP and height demonstrated specific advantages, as it does not require tables. Copyright © 2014 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

  4. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  5. Survey of the Role of Combined Screening Method with Ultrasonography in the Diagnosis of Breast Cancer

    Directory of Open Access Journals (Sweden)

    F. Gharekhanloo

    2011-01-01

    Full Text Available Introduction & Objective: The breast cancer is the most common malignancy in women and in recent years it is seen in younger ages. Because of dense breast tissue in these ages, the mammography sensitivity for breast cancer detection is reduced, so high quality ultrasonography (US as a combined screening method is effective. The aim of this study is the evaluation of the mammographic finding with the positive finding of ultrasonogarphy.Materials & Methods: In this cross-sectional study 300 cases were referred to the Mehr Medical Imaging Center for breast US and sonography of breast and axilla was performed. Mammography before or after US was also performed by another radiologist. All suspicious patients were referred for biopsy or surgery.Results: Mean age of patients was 46 y/o with the range of 32-76 y/o. Pathologic specimens approved malignancy in 21 patients and abscess in 1 patient. The most frequent symptom was palpable breast mass with mean diameter of 29 mm. Mean diameter of lymph nodes was 17.3 mm. Positive mammographic findings were seen in 85.7%and negative findings or only an asymmetric density in 14.3%.Conclusion: According to dense breast tissue especially in young women sensitivity of single screening by mammography is reduced in breast cancer detection, so combined screening with sonography and mammography especially in younger women improves the detection rate of breast carcinoma. (Sci J Hamadan Univ Med Sci 2011;17(4:57-60

  6. Non-destructive screening method for radiation hardened performance of large scale integration

    International Nuclear Information System (INIS)

    Zhou Dong; Xi Shanbin; Guo Qi; Ren Diyuan; Li Yudong; Sun Jing; Wen Lin

    2013-01-01

    The space radiation environment could induce radiation damage on the electronic devices. As the performance of commercial devices is generally superior to that of radiation hardened devices, it is necessary to screen out the devices with good radiation hardened performance from the commercial devices and applying these devices to space systems could improve the reliability of the systems. Combining the mathematical regression analysis with the different physical stressing experiments, we investigated the non-destructive screening method for radiation hardened performance of the integrated circuit. The relationship between the change of typical parameters and the radiation performance of the circuit was discussed. The irradiation-sensitive parameters were confirmed. The pluralistic linear regression equation toward the prediction of the radiation performance was established. Finally, the regression equations under stress conditions were verified by practical irradiation. The results show that the reliability and accuracy of the non-destructive screening method can be elevated by combining the mathematical regression analysis with the practical stressing experiment. (authors)

  7. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  8. Pathophysiology, risk factors, and screening methods for prediabetes in women with polycystic ovary syndrome.

    Science.gov (United States)

    Gourgari, Evgenia; Spanakis, Elias; Dobs, Adrian Sandra

    2016-01-01

    Polycystic ovary syndrome (PCOS) is a syndrome associated with insulin resistance (IR), obesity, infertility, and increased cardiometabolic risk. This is a descriptive review of several mechanisms that can explain the IR among women with PCOS, other risk factors for the development of diabetes, and the screening methods used for the detection of glucose intolerance in women with PCOS. Few mechanisms can explain IR in women with PCOS such as obesity, insulin receptor signaling defects, and inhibition of insulin-mediated glucose uptake in adipocytes. Women with PCOS have additional risk factors for the development of glucose intolerance such as family history of diabetes, use of oral contraceptives, anovulation, and age. The Androgen Society in 2007 and the Endocrine Society in 2013 recommended using oral glucose tolerance test as a screening tool for abnormal glucose tolerance in all women with PCOS. The approach to detection of glucose intolerance among women with PCOS varies among health care providers. Large prospective studies are still needed for the development of guidelines with strong evidence. When assessing risk of future diabetes in women with PCOS, it is important to take into account the method used for screening as well as other risk factors that these women might have.

  9. From Classical to High Throughput Screening Methods for Feruloyl Esterases: A Review.

    Science.gov (United States)

    Ramírez-Velasco, Lorena; Armendáriz-Ruiz, Mariana; Rodríguez-González, Jorge Alberto; Müller-Santos, Marcelo; Asaff-Torres, Ali; Mateos-Díaz, Juan Carlos

    2016-01-01

    Feruloyl esterases (FAEs) are a diverse group of hydrolases widely distributed in plants and microorganisms which catalyzes the cleavage and formation of ester bonds between plant cell wall polysaccharides and phenolic acids. FAEs have gained importance in biofuel, medicine and food industries due to their capability of acting on a large range of substrates for cleaving ester bonds and synthesizing highadded value molecules through esterification and transesterification reactions. During the past two decades extensive studies have been carried out on the production, characterization and classification of FAEs, however only a few reports of suitable High Throughput Screening assays for this kind of enzymes have been reported. This review is focused on a concise but complete revision of classical to High Throughput Screening methods for FAEs, highlighting its advantages and disadvantages, and finally suggesting future perspectives for this important research field.

  10. Danish method study on cervical screening in women offered HPV vaccination as girls (Trial23): a study protocol.

    Science.gov (United States)

    Thamsborg, Lise Holst; Andersen, Berit; Larsen, Lise Grupe; Christensen, Jette; Johansen, Tonje; Hariri, Jalil; Christiansen, Sanne; Rygaard, Carsten; Lynge, Elsebeth

    2018-05-26

    The first birth cohorts of women offered human papillomavirus (HPV) vaccination as girls are now entering cervical screening. However, there is no international consensus on how to screen HPV vaccinated women. These women are better protected against cervical cancer and could therefore be offered less intensive screening. Primary HPV testing is more sensitive than cytology, allowing for a longer screening interval. The aim of Trial23 is to investigate if primary HPV testing with cytology triage of HPV positive samples is a reasonable screening scheme for women offered HPV vaccination as girls. Trial23 is a method study embedded in the existing cervical screening programme in four out of five Danish regions. Without affecting the screening programme, women born in 1994 are randomised to present screening with liquid-based cytology every third year (present programme arm) or present screening plus an HPV test (HPV arm). The study started 1 February 2017 and will run over three screening rounds corresponding to 7-8 years. The primary endpoint is cervical intraepithelial neoplasia grade 3 or above. The trial is undertaken as a non-inferiority study including intention-to-treat and per-protocol analyses. The potential effect of primary HPV screening with a 6-year interval will be calculated from the observed data. The study protocol has been submitted to the ethical committee and deemed a method study. All women are screened according to routine guidelines. The study will contribute new evidence on the future screening of HPV vaccinated birth cohorts of women. All results will be published in open-access journal. NCT03049553; Pre-results. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  11. Survey of South African fruit juices using a fast screening HILIC-MS method.

    Science.gov (United States)

    Stander, Marietjie A; Kühn, Wernich; Hiten, Nicholas F

    2013-01-01

    Adulteration of fruit juices--by the addition of sugar or other less expensive fruit juices as well as preservatives, artificial sweeteners and colours--was tested for by using a developed screening method. The method employs hydrophilic interaction liquid chromatography-mass spectrometry (HILIC-MS) using electrospray ionisation in the negative mode and ultraviolet light detection. Different fruit juices can be differentiated by the content of marker compounds like sorbitol, certain phenolic molecules and their saccharide profile. This method was used to test 46 fruit juice samples from the retail market as well as 12 control samples. The study focused on the main types of fruit juices consumed on the South African market including apple, orange, grape and blends of these juices with other fruits like mango, pear and guava. Overall, the 46 samples tested mostly agreed with label claims. One grape juice sample was adulterated, probably with apple juice. Natamycin above the legal limits was found in two samples. In addition, two samples contained natamycin and one sample benzoate without it being indicated on the label. The method is well suited as a quick screening method for fruit juice adulteration and if used routinely would reduce fruit juice adulteration without the cost of the current array of tests needed for authenticity testing.

  12. Screening of groundwater remedial alternatives for brownfield sites: a comprehensive method integrated MCDA with numerical simulation.

    Science.gov (United States)

    Li, Wei; Zhang, Min; Wang, Mingyu; Han, Zhantao; Liu, Jiankai; Chen, Zhezhou; Liu, Bo; Yan, Yan; Liu, Zhu

    2018-06-01

    Brownfield sites pollution and remediation is an urgent environmental issue worldwide. The screening and assessment of remedial alternatives is especially complex owing to its multiple criteria that involves technique, economy, and policy. To help the decision-makers selecting the remedial alternatives efficiently, the criteria framework conducted by the U.S. EPA is improved and a comprehensive method that integrates multiple criteria decision analysis (MCDA) with numerical simulation is conducted in this paper. The criteria framework is modified and classified into three categories: qualitative, semi-quantitative, and quantitative criteria, MCDA method, AHP-PROMETHEE (analytical hierarchy process-preference ranking organization method for enrichment evaluation) is used to determine the priority ranking of the remedial alternatives and the solute transport simulation is conducted to assess the remedial efficiency. A case study was present to demonstrate the screening method in a brownfield site in Cangzhou, northern China. The results show that the systematic method provides a reliable way to quantify the priority of the remedial alternatives.

  13. Spectroscopic and Spectrometric Methods Used for the Screening of Certain Herbal Food Supplements Suspected of Adulteration.

    Science.gov (United States)

    Mateescu, Cristina; Popescu, Anca Mihaela; Radu, Gabriel Lucian; Onisei, Tatiana; Raducanu, Adina Elena

    2017-06-01

    Purpose: This study was carried out in order to find a reliable method for the fast detection of adulterated herbal food supplements with sexual enhancement claims. As some herbal products are advertised as "all natural", their "efficiency" is often increased by addition of active pharmaceutical ingredients such as PDE-5 inhibitors, which can be a real health threat for the consumer. Methodes: Adulterants, potentially present in 50 herbal food supplements with sexual improvement claims, were detected using 2 spectroscopic methods - Raman and Fourier Transform Infrared - known for reliability, reproductibility, and an easy sample preparation. GC-MS technique was used to confirm the potential adulterants spectra. Results: About 22% (11 out of 50 samples) of herbal food supplements with sexual enhancement claims analyzed by spectroscopic and spectrometric methods proved to be "enriched" with active pharmaceutical compounds such as: sildenafil and two of its analogues, tadalafil and phenolphthalein. The occurence of phenolphthalein could be the reason for the non-relevant results obtained by FTIR method in some samples. 91% of the adulterated herbal food supplements were originating from China. Conclusion: The results of this screening highlighted the necessity for an accurate analysis of all alleged herbal aphrodisiacs on the Romanian market. This is a first such a screening analysis carried out on herbal food supplements with sexual enhancement claims.

  14. A Rapid and Efficient Screening Method for Antibacterial Compound-Producing Bacteria.

    Science.gov (United States)

    Hettiarachchi, Sachithra; Lee, Su-Jin; Lee, Youngdeuk; Kwon, Young-Kyung; De Zoysa, Mahanama; Moon, Song; Jo, Eunyoung; Kim, Taeho; Kang, Do-Hyung; Heo, Soo-Jin; Oh, Chulhong

    2017-08-28

    Antibacterial compounds are widely used in the treatment of human and animal diseases. The overuse of antibiotics has led to a rapid rise in the prevalence of drug-resistant bacteria, making the development of new antibacterial compounds essential. This study focused on developing a fast and easy method for identifying marine bacteria that produce antibiotic compounds. Eight randomly selected marine target bacterial species ( Agrococcus terreus, Bacillus algicola, Mesoflavibacter zeaxanthinifaciens, Pseudoalteromonas flavipulchra, P. peptidolytica, P. piscicida, P. rubra , and Zunongwangia atlantica ) were tested for production of antibacterial compounds against four strains of test bacteria ( B. cereus, B. subtilis, Halomonas smyrnensis , and Vibrio alginolyticus ). Colony picking was used as the primary screening method. Clear zones were observed around colonies of P. flavipulchra, P. peptidolytica, P. piscicida , and P. rubra tested against B. cereus, B. subtilis , and H. smyrnensis . The efficiency of colony scraping and broth culture methods for antimicrobial compound extraction was also compared using a disk diffusion assay. P. peptidolytica, P. piscicida , and P. rubra showed antagonistic activity against H. smyrnensis, B. cereus , and B. subtilis , respectively, only in the colony scraping method. Our results show that colony picking and colony scraping are effective, quick, and easy methods of screening for antibacterial compound-producing bacteria.

  15. Combining Pathway Identification and Breast Cancer Survival Prediction via Screening-Network Methods

    Directory of Open Access Journals (Sweden)

    Antonella Iuliano

    2018-06-01

    Full Text Available Breast cancer is one of the most common invasive tumors causing high mortality among women. It is characterized by high heterogeneity regarding its biological and clinical characteristics. Several high-throughput assays have been used to collect genome-wide information for many patients in large collaborative studies. This knowledge has improved our understanding of its biology and led to new methods of diagnosing and treating the disease. In particular, system biology has become a valid approach to obtain better insights into breast cancer biological mechanisms. A crucial component of current research lies in identifying novel biomarkers that can be predictive for breast cancer patient prognosis on the basis of the molecular signature of the tumor sample. However, the high dimension and low sample size of data greatly increase the difficulty of cancer survival analysis demanding for the development of ad-hoc statistical methods. In this work, we propose novel screening-network methods that predict patient survival outcome by screening key survival-related genes and we assess the capability of the proposed approaches using METABRIC dataset. In particular, we first identify a subset of genes by using variable screening techniques on gene expression data. Then, we perform Cox regression analysis by incorporating network information associated with the selected subset of genes. The novelty of this work consists in the improved prediction of survival responses due to the different types of screenings (i.e., a biomedical-driven, data-driven and a combination of the two before building the network-penalized model. Indeed, the combination of the two screening approaches allows us to use the available biological knowledge on breast cancer and complement it with additional information emerging from the data used for the analysis. Moreover, we also illustrate how to extend the proposed approaches to integrate an additional omic layer, such as copy number

  16. The relationship between team climate and interprofessional collaboration: Preliminary results of a mixed methods study.

    Science.gov (United States)

    Agreli, Heloise F; Peduzzi, Marina; Bailey, Christopher

    2017-03-01

    Relational and organisational factors are key elements of interprofessional collaboration (IPC) and team climate. Few studies have explored the relationship between IPC and team climate. This article presents a study that aimed to explore IPC in primary healthcare teams and understand how the assessment of team climate may provide insights into IPC. A mixed methods study design was adopted. In Stage 1 of the study, team climate was assessed using the Team Climate Inventory with 159 professionals in 18 interprofessional teams based in São Paulo, Brazil. In Stage 2, data were collected through in-depth interviews with a sample of team members who participated in the first stage of the study. Results from Stage 1 provided an overview of factors relevant to teamwork, which in turn informed our exploration of the relationship between team climate and IPC. Preliminary findings from Stage 2 indicated that teams with a more positive team climate (in particular, greater participative safety) also reported more effective communication and mutual support. In conclusion, team climate provided insights into IPC, especially regarding aspects of communication and interaction in teams. Further research will provide a better understanding of differences and areas of overlap between team climate and IPC. It will potentially contribute for an innovative theoretical approach to explore interprofessional work in primary care settings.

  17. Accelerated stress testing of thin film solar cells: Development of test methods and preliminary results

    Science.gov (United States)

    Lathrop, J. W.

    1985-01-01

    If thin film cells are to be considered a viable option for terrestrial power generation their reliability attributes will need to be explored and confidence in their stability obtained through accelerated testing. Development of a thin film accelerated test program will be more difficult than was the case for crystalline cells because of the monolithic construction nature of the cells. Specially constructed test samples will need to be fabricated, requiring committment to the concept of accelerated testing by the manufacturers. A new test schedule appropriate to thin film cells will need to be developed which will be different from that used in connection with crystalline cells. Preliminary work has been started to seek thin film schedule variations to two of the simplest tests: unbiased temperature and unbiased temperature humidity. Still to be examined are tests which involve the passage of current during temperature and/or humidity stress, either by biasing in the forward (or reverse) directions or by the application of light during stress. Investigation of these current (voltage) accelerated tests will involve development of methods of reliably contacting the thin conductive films during stress.

  18. Experimental method and preliminary studies of the passive containment water film evaporation mass transfer

    Energy Technology Data Exchange (ETDEWEB)

    Li, Cheng [State Nuclear Power Technology Research, Beijing (China). Development Center; State Nuclear Power Research Institute, Beijing (China); Yang, Lin; Zhao, Wei; Zhou, Shan; Du, Wangfang; Gao, Zhan; Li, Honegsen [State Nuclear Power Technology Research, Beijing (China). Development Center

    2017-05-15

    For larger containments and higher operation parameters, characteristics of the outside cooling of the PCCS are very important for the analysis on the containment integrity. A preliminary analysis was made and a four-step experimental method was used to numerically analyze the falling water film evaporation for the advanced passive containment. Then, the water flow stability along the outside wall of the containment was studied. The results fit well with those correlations without airflow when the air velocity is less than 5.0 m/s. However, when the air velocity is larger than 5.0 m/s, the influence of the air velocity on the water film will appear and the mean water film thickness will be thicker. Based on the prototype operation parameters, experimental studies were carried and the results were compared with the Dittus-Boelter correlation within the operation ranges. A modification factor was proposed for the conservative application of this correlation for nuclear safety analysis.

  19. Preliminary screening of some traditional zulu medicinal plants for anti-inflammatory and anti-microbial activities.

    Science.gov (United States)

    Lin, J; Opoku, A R; Geheeb-Keller, M; Hutchings, A D; Terblanche, S E; Jäger, A K; van Staden, J

    1999-12-15

    Aqueous and methanolic extracts from different parts of nine traditional Zulu medicinal plants, of the Vitaceae from KwaZulu-Natal, South Africa were evaluated for therapeutic potential as anti-inflammatory and anti-microbial agents. Of the twenty-nine crude extracts assayed for prostaglandin synthesis inhibitors, only five methanolic extracts of Cyphostemma natalitium-root, Rhoicissus digitata-leaf, R. rhomboidea-root, R. tomentosa-leaf/stem and R. tridentata-root showed significant inhibition of cyclo-oxygenase (COX-1). The extracts of R. digitata-leaf and of R. rhomboidea-root exhibited the highest inhibition of prostaglandin synthesis with 53 and 56%, respectively. The results suggest that Rhoicissus digitata leaves and of Rhoicissus rhomboidea roots may have the potential to be used as anti-inflammatory agents. All the screened plant extracts showed some degrees of anti-microbial activity against gram-positive and gram-negative microorganisms. The methanolic extracts of C. natalitium-stem and root, R. rhomboidea-root, and R. tomentosa-leaf/stem, showed different anti-microbial activities against almost all micro-organisms tested. Generally, these plant extracts inhibited the gram-positive micro-organisms more than the gram-negative ones. Several plant extracts inhibited the growth of Candida albicans while only one plant extract showed inhibitory activity against Saccharomyces cerevisiae. All the plant extracts which demonstrated good anti-inflammatory activities also showed better inhibitory activity against Candida albicans.

  20. The flora and fauna of a proposed wind turbine site near Royal Road, Prince Edward County, Ontario : preliminary screening of the natural environment

    Energy Technology Data Exchange (ETDEWEB)

    Holder, M.; Leggett, A. [Jacques Whitford Environment Ltd., Markham, ON (Canada)

    2002-07-15

    Calgary based Vision Quest Windelectric has been given zoning approval to install a 22 MW windfarm in Ontario's Prince Edward County. Following a preliminary screening to determine the effect of the windfarm on the natural environment, the Royal Road Windfarm will be developed in stages with up to 32 turbines. Jacques Whitford Environment Ltd. conducted an environmental study which showed that an exploratory wind turbine in the area is not likely to cause major adverse impacts on local fauna and flora. The proposed location of the wind turbine is not in an important bird area (IBA). An IBA is defined as a site providing essential habitat for one of more species of breeding or non-breeding birds. In 1999, Vision Quest initiated a program to examine bird interactions with wind turbines in southern Alberta. It was shown that most species choose flight paths to avoid turbines. The Royal Road site hosts rare alvars which are naturally open landscapes found in shallow soils on flat limestones. The alvars are subject to seasonal drought and flooding and have specific types of vegetation and animals. Since the exploratory wind turbine will be placed outside the IBA area, its impact on birds will be minimized, and it will have minimal effect on migrant, breeding and wintering birds. It was recommended that monitoring take place at the site during the first year of operation. It is also presumed that the wind turbine will not have any impact on mammals, reptiles and amphibians, or insects. However, it was recommended that more information be gathered on bat movement in the area. If placed appropriately, the wind turbine is not expected to impact on rare plants. It was emphasized that in the past, Vision Quest Windelectric has conducted environmental screening activities, and has acted on recommendations to place wind turbines in locations where environmental impact will be minimized. 26 refs., 5 tabs., 2 figs., 2 appendices.

  1. Development of a first-principles code based on the screened KKR method for large super-cells

    International Nuclear Information System (INIS)

    Doi, S; Ogura, M; Akai, H

    2013-01-01

    The procedures of performing first-principles electronic structure calculation using the Korringa-Kohn-Rostoker (KKR) and the screened KKR methods are reviewed with an emphasis put on their numerical efficiency. It is shown that an iterative matrix inversion combined with a suitable preconditioning greatly improves the computational time of screened KKR method. The method is well parallelized and also has an O(N) scaling property

  2. The minisequencing method: a simple strategy for genetic screening of MEN 2 families

    Directory of Open Access Journals (Sweden)

    Domingues Rita

    2002-05-01

    Full Text Available Abstract Background Multiple endocrine neoplasia type 2 is an autosomal dominant disorder. MEN 2A is characterized by medullary thyroid carcinoma, pheochromocytoma and hyperparathyroidism; MEN 2B by medullary thyroid carcinoma, pheochromocytoma and characteristic stigmata. Activating germline mutations of the RET proto oncogene are responsible for this hereditary syndrome. Codon 634 mutations are the most common mutations occurring in MEN 2A families whereas a specific mutation at codon 918 is observed in the great majority of MEN 2B families. Analysis of these codons will provide a final diagnosis in the great majority of affected families making unnecessary further studies. To specifically study the codons 634 and 918 we used a minisequencing method as an alternative method to complete sequencing. Results Using this mutation detection method we were able to reproduce in all cases, representative of 7 families, the information previously obtained by direct sequencing of PCR products. Depending on the number of primers used in the minisequencing reaction, we were able to interrogate either only one nucleotide of the target codon or the three nucleotides simultaneously. Conclusions This technique appears as a simple, rapid and efficient method for genetic screening of MEN 2 families. It can be utilized to seek for unknown mutations at specific codons or to screen for previously identified mutations and is therefore of interest to study index cases or individuals at risk. Results suggest that complete sequencing is unnecessary.

  3. Method for rapid screening analysis of Sr-90 in edible plant samples collected near Fukushima, Japan

    International Nuclear Information System (INIS)

    Amano, Hikaru; Sakamoto, Hideaki; Shiga, Norikatsu; Suzuki, Kaori

    2016-01-01

    A screening method for measuring 90 Sr in edible plant samples by focusing on 90 Y in equilibrium with 90 Sr is reported. 90 Y was extracted from samples with acid, co-precipitated with iron hydroxide, and precipitated with oxalic acid. The dissolved oxalate precipitate was loaded on an extraction chromatography resin, and the 90 Y-enriched eluate was analyzed by Cherenkov counting with a TDCR liquid scintillation counter. 90 Sr ( 90 Y) concentration was determined in plant samples collected near the damaged Fukushima Daiichi Nuclear Power Plants with this method. - Highlights: • A screening method for measuring 90 Sr in edible plant samples by focusing on 90 Y in equilibrium with 90 Sr is reported. • 90 Y was extracted from samples with acid, co-precipitated with iron hydroxide, and precipitated with oxalic acid. • The dissolved oxalate precipitate was loaded on an extraction chromatography resin. • 90 Y-enriched eluate was analyzed by Cherenkov counting with a TDCR liquid scintillation counter. • 90 Sr ( 90 Y) concentration was determined in edible plant samples collected near the damaged Fukushima Daiichi NPPs with this method.

  4. Colorimetric method for enzymatic screening assay of ATP using Fe(III)-xylenol orange complex formation.

    Science.gov (United States)

    Ishida, Akihiko; Yamada, Yasuko; Kamidate, Tamio

    2008-11-01

    In hygiene management, recently there has been a significant need for screening methods for microbial contamination by visual observation or with commonly used colorimetric apparatus. The amount of adenosine triphosphate (ATP) can serve as the index of a microorganism. This paper describes the development of a colorimetric method for the assay of ATP, using enzymatic cycling and Fe(III)-xylenol orange (XO) complex formation. The color characteristics of the Fe(III)-XO complexes, which show a distinct color change from yellow to purple, assist the visual observation in screening work. In this method, a trace amount of ATP was converted to pyruvate, which was further amplified exponentially with coupled enzymatic reactions. Eventually, pyruvate was converted to the Fe(III)-XO complexes through pyruvate oxidase reaction and Fe(II) oxidation. As the assay result, yellow or purple color was observed: A yellow color indicates that the ATP concentration is lower than the criterion of the test, and a purple color indicates that the ATP concentration is higher than the criterion. The method was applied to the assay of ATP extracted from Escherichia coli cells added to cow milk.

  5. Carbamazepine-Fumaric Acid Co-Crystal Screening Using Solution Based Method

    Directory of Open Access Journals (Sweden)

    Abd Rahim Syarifah

    2016-01-01

    Full Text Available Co-crystals is a multi-component system which connected by non-covalent interactions, present physically as a solid form under ambient conditions. Nowadays, co-crystal has becoming as an alternative approach to improve the bioavailability of poor water soluble drugs especially for a weakly ionisable groups or neutral compounds. In this study the co-crystal screening was carried out for carbamazepine (CBZ and fumaric acid (FUM co-crystal former (CCF using non-stoichiometric method (addition of CBZ to CCF saturated solution and stoichiometric method (evaporation of 1:1 molar ratio of CBZ to CCF in acetonitrile, ethyl acetate, propanol, ethanol and formic acid solvent systems. The crystals produced from the screening were characterized using Powder X-ray Diffraction (PXRD, Differential Scanning Calorimetry (DSC and Fourier Transform Infrared (FT-IR. The PXRD analysis had confirmed that the co-crystal was successfully formed in both methods for all of the solvent system studied with an exception to formic acid in the stoichiometric method where no crystal was found precipitate. The findings from this study revealed that Form A and Form B of CBZ-FUM co-crystal had been successfully formed from different solvent systems.

  6. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Science.gov (United States)

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  7. High prevalence of bacteriuria in pregnancy and its screening methods in north India.

    Science.gov (United States)

    Bandyopadhyay, Sutapa; Thakur, J S; Ray, Pallab; Kumar, Rajesh

    2005-05-01

    The study aims at finding out the prevalence of bacteruria in pregnancy in an urban setting and ascertaining methods to screen them in primary care clinics. A total of 1 61 pregnant ladies visiting a primary care clinic were screened for bacteriuria based on the symptomatology. Urine culture was done to know the prevalence of bacteriuria. Sensitivities and specificities were calculated for each symptom and risk assessment. A score card was developed based on combination of positive risk assessment and constellation of symptoms. Prevalence of symptomatic and asymptomatic bacteriuria was found to be 19.87% and 4.34% respectively. Prevalence of bacteriuria was significantly high among those who had intercourse more frequently and those with less water intake. Those with a score of more than or equal to 4, as per score card were 60% more likely to suffer from bacteriuria. When combined with microscopic examination for leucocytes on positively screened, the positive predictive value was found to be 89%. It is concluded that prevalence of symptomatic bacteriuria is common among pregnant women. Syndromic management of cases on the basis of score card is helpful in resource constraint areas. This may be combined with microscopic examination of urine to entail rational use of antibiotics.

  8. Trojan Horse Method: a useful tool for electron screening effect investigation

    Energy Technology Data Exchange (ETDEWEB)

    Pizzone, R.G.; Spitaleri, C.; Cherubini, S.; La Cognata, M.; Lamia, L.; Romano, S.; Sergi, M.L. [Laboratori Nazionali del Sud-INFN and DMFCI Universita di Catania, Catania (Italy); Tumino, A. [Universita Kore, Enna (Italy); Li, C.; Wen, Q.; Zhou, S. [Department of Nuclear Physics, CIAE, Beijing (China); Burjan, V.; Kroha, V.; Mrazek, J. [Cyclotron Institute, Academy of Science, Rez, Czech Rep. (Czech Republic); Carlin, N.; Gimenez del Santo, M.; Szanto de Toledo, A. [Departamento de Fisica, Universidad de Sao Paulo (Brazil); Kubono, S.; Wakabayashi, T.; Yamaguchi, H. [CNS, University of Tokyo, Wako (Japan)

    2010-03-01

    Direct measurements in the last decades have highlighted a new problem related to the lowering of the Coulomb barrier between the interacting nuclei due to the presence of the 'electron screening' in the laboratory measurements. It was systematically observed that the presence of the electronic cloud around the interacting ions in measurements of nuclear reactions cross sections at astrophysical energies gives rise to an enhancement of the astrophysical S(E)-factor as lower and lower energies are explored [H. Assenbaum, K. Langanke, C. Rolfs, Z. Phys. 327 (1987) 461]. Moreover, at present such an effect is not well understood as the value of the potential for screening extracted from these measurements is higher than the upper limit of theoretical predictions (adiabatic limit). On the other hand, the electron screening potential in laboratory measurement is different from that occurring in stellar plasmas thus the quantity of interest in astrophysics is the so-called 'bare nucleus cross section'. This quantity can only be extrapolated in direct measurements. These are the reasons that led to a considerable growth on interest in indirect measurement techniques and in particular the Trojan Horse Method (THM) [G. Baur, Phys. Lett. B 178, (1986) 135; S. Cherubini et al. Ap. J. 457, (1996) 855] Results concerning the bare nucleus cross sections measurements will be shown in several cases of astrophysical interest. In those cases the screening potential evaluated by means of the THM will be compared with the adiabatic limit and results arising from extrapolation in direct measurements.

  9. Repetitive transcranial magnetic stimulation as an adjuvant method in the treatment of depression: Preliminary results

    Directory of Open Access Journals (Sweden)

    Jovičić Milica

    2014-01-01

    Full Text Available Introduction. Repetitive transcranial magnetic stimulation (rTMS is a method of brain stimulation which is increasingly used in both clinical practice and research. Up-to-date studies have pointed out a potential antidepressive effect of rTMS, but definitive superiority over placebo has not yet been confirmed. Objective. The aim of the study was to examine the effect of rTMS as an adjuvant treatment with antidepressants during 18 weeks of evaluation starting from the initial application of the protocol. Methods. Four patients with the diagnosis of moderate/severe major depression were included in the study. The protocol involved 2000 stimuli per day (rTMS frequency of 10 Hz, intensity of 120% motor threshold administered over the left dorsolateral prefrontal cortex (DLPFC for 15 days. Subjective and objective depressive symptoms were measured before the initiation of rTMS and repeatedly evaluated at week 3, 6, 12 and 18 from the beginning of the stimulation. Results. After completion of rTMS protocol two patients demonstrated a reduction of depressive symptoms that was sustained throughout the 15-week follow-up period. One patient showed a tendency of remission during the first 12 weeks of the study, but relapsed in week 18. One patient showed no significant symptom reduction at any point of follow-up. Conclusion. Preliminary findings suggest that rTMS has a good tolerability and can be efficient in accelerating the effect of antidepressants, particularly in individuals with shorter duration of depressive episodes and moderate symptom severity. [Projekat Ministarstva nauke Republike Srbije, br. III41029 i br. ON175090

  10. Cost-effectiveness of lung cancer screening and treatment methods: a systematic review of systematic reviews.

    Science.gov (United States)

    Azar, Farbod Ebadifard; Azami-Aghdash, Saber; Pournaghi-Azar, Fatemeh; Mazdaki, Alireza; Rezapour, Aziz; Ebrahimi, Parvin; Yousefzadeh, Negar

    2017-06-19

    Due to extensive literature in the field of lung cancer and their heterogeneous results, the aim of this study was to systematically review of systematic reviews studies which reviewed the cost-effectiveness of various lung cancer screening and treatment methods. In this systematic review of systematic reviews study, required data were collected searching the following key words which selected from Mesh: "lung cancer", "lung oncology", "lung Carcinoma", "lung neoplasm", "lung tumors", "cost- effectiveness", "systematic review" and "Meta-analysis". The following databases were searched: PubMed, Cochrane Library electronic databases, Google Scholar, and Scopus. Two reviewers (RA and A-AS) evaluated the articles according to the checklist of "assessment of multiple systematic reviews" (AMSTAR) tool. Overall, information of 110 papers was discussed in eight systematic reviews. Authors focused on cost-effectiveness of lung cancer treatments in five systematic reviews. Targeted therapy options (bevacizumab, Erlotinib and Crizotinib) show an acceptable cost-effectiveness. Results of three studies failed to show cost-effectiveness of screening methods. None of the studies had used the meta-analysis method. The Quality of Health Economic Studies (QHES) tool and Drummond checklist were mostly used in assessing the quality of articles. Most perspective was related to the Payer (64 times) and the lowest was related to Social (11times). Most cases referred to Incremental analysis (82%) and also the lowest point of referral was related to Discounting (in 49% of the cases). The average quality score of included studies was calculated 9.2% from 11. Targeted therapy can be an option for the treatment of lung cancer. Evaluation of the cost-effectiveness of computerized tomographic colonography (CTC) in lung cancer screening is recommended. The perspective of the community should be more taken into consideration in studies of cost-effectiveness. Paying more attention to the topic of

  11. Non invasive diagnostic methods for better screening of peripheral arterial disease.

    Science.gov (United States)

    Nirala, Neelamshobha; Periyasamy, R; Kumar, Awanish

    2018-05-16

    Peripheral arterial disease (PAD) is a common circulatory problem in which narrowed arteries reduce blood flow to extremities usually legs. It does not receive enough blood flow to keep up with demand. This causes symptoms, most notably leg pain while walking which is known as claudication. It is a common manifestation of type II Diabetes, but the relationship between other vascular diseases and lower limb (LL)-PAD has been poorly understood and investigated. When assessing a patient with clinically LLPAD, two questions are in order to establish a diagnosis: one is non-invasive testing and other is invasive. Invasive methods are painful and get so bad that some people need to have a leg surgery. People with Diabetes are at increased risk for amputation and it is used only when the damage is very severe. Diagnosis of LLPAD begins with a physical examination, patient history, certain questionnaire and non invasive mode of diagnosis is started for the screening of patients. Clinicians check for weak pulses in the legs and then decide for further diagnosis. Paper discusses the prevalence of LLPAD worldwide and in India along with the clinical effectiveness and limitations of these methods in case of Diabetes. The focus of this review is to discuss only those non invasive methods which are widely used for screening of LLPAD like Ankle brachial index (ABI), Toe brachial Index (TBI), and use of photoplethysmogram (PPG) specially in case of Diabetic patients. Also, this paper gives an overview of the work done using ABI, TBI, and PPG for detection of LLPAD. These tests are not painful and could be performed in a cost-effective manner to avoid delays in screening/diagnosis and also reduce costs. Copyright © 2018. Published by Elsevier Inc.

  12. Preliminary Phytochemical Screening and Biological Activities of Bulbine abyssinica Used in the Folk Medicine in the Eastern Cape Province, South Africa.

    Science.gov (United States)

    Kibiti, Cromwell Mwiti; Afolayan, Anthony Jide

    2015-01-01

    Bulbine abyssinica A. Rich. is used in traditional medicine to treat rheumatism, dysentery, bilharzia, cracked lips, back pain, infertility, diabetes mellitus, and gastrointestinal, vaginal, and bladder infections. Therefore, preliminary phytochemical screening, antioxidant, anti-inflammatory, and antibacterial properties of the whole plant (acetone and aqueous extracts) were determined using standard procedures. The in vitro antioxidant model assays revealed that the plant possesses free radical scavenging potential varying with free radical species. The species showed significant protein denaturation inhibitory activity with good protection against erythrocyte membrane lysis indicating anti-inflammatory potential. The results also showed that the species was active against the growth of all the selected eight diabetic status opportunistic bacteria except one. Moreover, the species is characterized by appreciable amounts of total phenols, flavonoids, flavanols, proanthocyanidins, and alkaloids. Traces amounts of saponins and tannins were also observed. Amongst the identified phytochemicals present, empirical searches identified them being antioxidant, anti-inflammatory, and antimicrobial agents. The identification of these phytochemical constituents with their known pharmacological properties indicates that this plant is a good source of the free radical scavenging, anti-inflammatory, and antimicrobial agents. These findings also account for the multipharmacological use of B. abyssinica in fork medicine.

  13. Screening method for Staphylococcus aureus identification in subclinical bovine mastitis from dairy farms

    Directory of Open Access Journals (Sweden)

    Natapol Pumipuntu

    2017-07-01

    Full Text Available Background: Staphylococcus aureus is one of the most important contagious bacteria causing subclinical bovine mastitis. This bacterial infection is commonly identified by determine the pathogen in bovine milk samples through conventional technique including coagulase test. However, this test has several disadvantages as low sensitivity, risk of biohazard, cost expensive, and limited preparation especially in local area. Aim: Aim of this study was to compare and assess the screening method, Mannitol fermentation test (Mannitol salt agar [MSA], and deoxyribonuclease (DNase test, for S. aureus identification in milk samples. Materials and Methods: A total of 224 subclinical bovine mastitis milk samples were collected from four provinces of Thailand and determined S. aureus using conventional method and also subjected to the screening test, MSA and DNase test. The sensitivity, specificity, positive predictive value (PPV, and negative predictive value (NPV among both tests were analyzed and compared to the tube coagulase test (TCT, as reference method. Immunological test by latex agglutination and molecular assay by determined spa gene were also used to identify and differentiate S. aureus. Results: A total of 130 staphylococci were isolated by selective media, Gram-stain, and catalase test. The number of S. aureus which identified using TCT, MSA and DNase test were 32, 102, and 74 isolates, respectively. All TCT results were correlated to results of latex agglutination and spa gene which were 32 S. aureus. MSA showed 100% sensitivity, 28.57% specificity, 31.37% PPV, and 100% NPV, whereas DNase showed 53.13% sensitivity, 41.84% specificity, 22.97% PPV, and 73.21% NPV. DNase test showed higher specificity value than MSA but the test presented 26.79% false negative results whereas no false-negative result from MSA when comparing to TCT. Conclusion: MSA had a tendency to be a good preference for screening S. aureus because of its high sensitivity and

  14. Resistive wall impedance of the LHC beam screen without slots calculated by boundary element method

    CERN Document Server

    Tsutsui, H

    2002-01-01

    In order to calculate the resistive wall impedance of the LHC beam screen without slots, the Boundary Element Method (BEM) is used. The result at 1 GHz is Re(ZL/L) = 6.689×10−3 Ω/m, Re(Zx/L) = 1.251 Ω/m2, Re(Zy/L) = 1.776 Ω/m2, andRe(2Z0,2 cos/kL) = −0.525 Ω/m2, assuming σ = 5.8 × 109 /Ωm.

  15. Gravimetric screening method for fungal decay of paper: inoculation with Trametes versicolor.

    Science.gov (United States)

    Råberg, Ulrika; Hafrén, Jonas

    2009-10-01

    The European standard test EN 113 for fungal degradation of solid wood has been adapted for degradation of paper by white rot fungus (Trametes versicolor). Fungal degradation of paper sheets may potentially be used for screening different wood preservatives on paper instead of solid wood. The paper samples showed higher relative mass losses compared to wood, and samples pretreated with boric acid, copper sulfate and polymerized linseed oil were successfully tested for biodegradation using the paper sheet method. The results on paper degradation were compared with wood, both as wood blocks (according to standard test) and wood cut in sections forming layered structures mimicking paper layers.

  16. The validity of ultrasonographic scanning as screening method for abdominal aortic aneurysm

    DEFF Research Database (Denmark)

    Lindholt, Jes Sanddal; Vammen, Sten; Juul, Søren

    1999-01-01

    the sensitivity and specificity of screening for abdominal aortic aneurysms (AAAs) with ultrasonographic scanning (US) is unknown. The aim of the study was to validate US as screening test for AAAs.......the sensitivity and specificity of screening for abdominal aortic aneurysms (AAAs) with ultrasonographic scanning (US) is unknown. The aim of the study was to validate US as screening test for AAAs....

  17. Review of Dosimetric Methods for Mammography in the UK Breast Screening Programme

    International Nuclear Information System (INIS)

    Young, K.C.; Ramsdale, M.L.; Bignell, F.

    1998-01-01

    The two methods used to monitor dose in mammography in the UK Breast Screening Programme are reviewed. The first is the measurement of mean glandular dose to a standard breast. The second is the estimation of mean glandular dose for individual women using the X ray exposure factors. Neither method takes account of variations in breast composition and the effect of this on estimates of glandular dose are reported. Applying the standard breast model using PMMA resulted in substantial overestimates of breast doses for women with large compressed breast thicknesses because they tend to have low glandular content. Conversely the use of post-exposure data to estimate the MGDs in women attending screening with large breasts resulted in underestimates of their doses unless the relatively low levels of glandularity were taken into account. When estimating the MGDs for breasts of different sizes, it is important that the models and methods used take account of the strong variation in breast composition with compressed thickness. (author)

  18. Materials and methods for higher performance screen-printed flexible MRI receive coils.

    Science.gov (United States)

    Corea, Joseph R; Lechene, P Balthazar; Lustig, Michael; Arias, Ana C

    2017-08-01

    To develop methods for characterizing materials used in screen-printed MRI coils and improve signal-to-noise ratio (SNR) with new lower-loss materials. An experimental apparatus was created to characterize dielectric properties of plastic substrates used in receive coils. Coils were fabricated by screen printing conductive ink onto several plastic substrates. Unloaded and sample loaded quality factor (Q Unloaded /Q Loaded ) measurements and scans on a 3T scanner were used to characterize coil performance. An experimental method was developed to describe the relationship between a coil's Q Unloaded and the SNR it provides in images of a phantom. In addition, 3T scans of a phantom and the head of a volunteer were obtained with a proof-of-concept printed eight-channel array, and the results were compared with a commercial 12-channel array. Printed coils with optimized substrates exhibited up to 97% of the image SNR when compared with a traditional coil on a loading phantom. Q Unloaded and the SNR of coils were successfully correlated. The printed array resulted in images comparable to the quality given by the commercial array. Using the proposed methods and materials, the SNR of printed coils approached that of commercial coils while using a new fabrication technique that provided more flexibility and close contact with the patient's body. Magn Reson Med 78:775-783, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  19. The novel measuring method for screening and assessing chromium content in clothes and shoes materials

    Science.gov (United States)

    Salerno-Kochan, R.

    2017-10-01

    The aim of this paper is to propose the bioindicative measuring method for screening and assessing the safety of textile and leather materials in relation to chemical threats. This method is based on toxicological assay in which Tetrahymena pyriformis, unicellular organism belonging to protozoans, is used as a test organism. For the realization of the research goal the sensitivity threshold of test organisms to chromium(VI) solutions was identified. The changes in cell development of test organisms in chromium solutions were registered by colorimetric measurements in the presence of alamarBlue® cell viability reagent. Empirical data enabled to fit logistic curves on the base of which the level of chromium toxicity was estimated. In the second step, harmfulness of aqueous extracts obtained from textile and leather samples containing chromium in relation to test organisms was evaluated. The performed research confirmed the high efficiency of the proposed method in screening and assessing chromium content in clothes and shoes materials and showed possibilities of using it in safety assessment of products with regard to chemical risks.

  20. Intelligent screening of electrofusion-polyethylene joints based on a thermal NDT method

    Science.gov (United States)

    Doaei, Marjan; Tavallali, M. Sadegh

    2018-05-01

    The combinations of infrared thermal images and artificial intelligence methods have opened new avenues for pushing the boundaries of available testing methods. Hence, in the current study, a novel thermal non-destructive testing method for polyethylene electrofusion joints was combined with k-means clustering algorithms as an intelligent screening tool. The experiments focused on ovality of pipes in the coupler, as well as misalignment of pipes-couplers in 25 mm diameter joints. The temperature responses of each joint to an internal heat pulse were recorded by an IR thermal camera, and further processed to identify the faulty joints. The results represented clustering accuracy of 92%, as well as more than 90% abnormality detection capabilities.

  1. Validity of a method for the self-screening of cardiovascular risk

    Directory of Open Access Journals (Sweden)

    Barroso M

    2018-05-01

    Full Text Available María Barroso,1–3 Silvia Pérez-Fernández,1,4 M Mar Vila,1,4,5 M Dolors Zomeño,6,7 Ruth Martí-Lluch,8 Ferran Cordon,9 Rafel Ramos,8,10,11 Roberto Elosua,1,4 Irene R Degano,1,4 Montse Fitó,5,12 Carmen Cabezas,13 Gemma Salvador,13 Conxa Castell,13 María Grau1,4,14 1Cardiovascular Epidemiology and Genetics Research Group, IMIM-Hospital del Mar Research Institute, 2Centre d’Atenció Primària La Marina, Direcció d’Atenció Primària Barcelona, Institut Català de la Salut, 3Department of Pediatrics, Obstetrics, Gynecology and Preventive Medicine, School of Medicine, Autonomous University of Barcelona, 4Consortium for Biomedical Research in Cardiovascular Disease (CIBERCV, 5Department of Mathematics and Computer Science, University of Barcelona, 6Cardiovascular Risk and Nutrition, IMIM-Hospital del Mar Research Institute, 7School of Health Sciences, Blanquerna-Ramon Llull University, Barcelona, Spain; 8Unitat de Suport a la Recerca de Girona, Institut Universitari d’Investigació en Atenció Primària Jordi Gol, 9Centre d’Atenció Primària Montilivi, Direcció d’Atenció Primària Girona, Institut Català de la Salut, 10Department of Medical Sciences, School of Medicine, University of Girona, 11Girona Biomedical Research Institute, Girona, Spain; 12Consortium for Biomedical Research in Obesity and Nutrition (CIBEROBN, 13Catalan Agency of Public Health, 14Department of Medicine, University of Barcelona, Barcelona, Spain Background: The validity of a cardiovascular risk self-screening method was assessed. The results obtained for self-measurement of blood pressure, a point-of-care system’s assessment of lipid profile and glycated hemoglobin, and a self-administered questionnaire (sex, age, diabetes, tobacco consumption were compared with the standard screening (gold standard conducted by a health professional. Methods: Crossover clinical trial on a population-based sample from Girona (north-eastern Spain, aged 35–74, with no

  2. Chronic kidney disease screening methods and its implication for Malaysia: an in depth review.

    Science.gov (United States)

    Almualm, Yasmin; Zaman Huri, Hasniza

    2015-01-01

    Chronic Kidney Disease has become a public health problem, imposing heath, social and human cost on societies worldwide. Chronic Kidney Disease remains asymptomatic till late stage when intervention cannot stop the progression of the disease. Therefore, there is an urgent need to detect the disease early. Despite the high prevalence of Chronic Kidney Disease in Malaysia, screening is still lacking behind. This review discusses the strengths and limitations of current screening methods for Chronic Kidney Disease from a Malaysian point of view. Diabetic Kidney Disease was chosen as focal point as Diabetes is the leading cause of Chronic Kidney Disease in Malaysia. Screening for Chronic Kidney Disease in Malaysia includes a urine test for albuminuria and a blood test for serum creatinine. Recent literature indicates that albuminuria is not always present in Diabetic Kidney Disease patients and serum creatinine is only raised after substantial kidney damage has occurred.  Recently, cystatin C was proposed as a potential marker for kidney disease but this has not been studied thoroughly in Malaysia.  Glomerular Filtration Rate is the best method for measuring kidney function and is widely estimated using the Modification of Diet for Renal Disease equation. Another equation, the Chronic Kidney Disease Epidemiology Collaboration Creatinine equation was introduced in 2009. The new equation retained the precision and accuracy of the Modification of Diet for Renal Disease equation at GFR 60ml/min/1.73m2. In Asian countries, adding an ethnic coefficient to the equation enhanced its performance. In Malaysia, a multi-ethnic Asian population, the Chronic Kidney Disease Epidemiology Collaboration equation should be validated and the Glomerular Filtration Rate should be reported whenever serum creatinine is ordered. Reporting estimated Glomerular Filtration Rate will help diagnose patients who would have been otherwise missed if only albuminuria and serum creatinine are measured.

  3. A Study of Applications of Machine Learning Based Classification Methods for Virtual Screening of Lead Molecules.

    Science.gov (United States)

    Vyas, Renu; Bapat, Sanket; Jain, Esha; Tambe, Sanjeev S; Karthikeyan, Muthukumarasamy; Kulkarni, Bhaskar D

    2015-01-01

    The ligand-based virtual screening of combinatorial libraries employs a number of statistical modeling and machine learning methods. A comprehensive analysis of the application of these methods for the diversity oriented virtual screening of biological targets/drug classes is presented here. A number of classification models have been built using three types of inputs namely structure based descriptors, molecular fingerprints and therapeutic category for performing virtual screening. The activity and affinity descriptors of a set of inhibitors of four target classes DHFR, COX, LOX and NMDA have been utilized to train a total of six classifiers viz. Artificial Neural Network (ANN), k nearest neighbor (k-NN), Support Vector Machine (SVM), Naïve Bayes (NB), Decision Tree--(DT) and Random Forest--(RF). Among these classifiers, the ANN was found as the best classifier with an AUC of 0.9 irrespective of the target. New molecular fingerprints based on pharmacophore, toxicophore and chemophore (PTC), were used to build the ANN models for each dataset. A good accuracy of 87.27% was obtained using 296 chemophoric binary fingerprints for the COX-LOX inhibitors compared to pharmacophoric (67.82%) and toxicophoric (70.64%). The methodology was validated on the classical Ames mutagenecity dataset of 4337 molecules. To evaluate it further, selectivity and promiscuity of molecules from five drug classes viz. anti-anginal, anti-convulsant, anti-depressant, anti-arrhythmic and anti-diabetic were studied. The TPC fingerprints computed for each category were able to capture the drug-class specific features using the k-NN classifier. These models can be useful for selecting optimal molecules for drug design.

  4. Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

    Science.gov (United States)

    Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

    2017-08-12

    Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

  5. Pathophysiology, risk factors, and screening methods for prediabetes in women with polycystic ovary syndrome

    Directory of Open Access Journals (Sweden)

    Gourgari E

    2016-08-01

    Full Text Available Evgenia Gourgari,1 Elias Spanakis,2 Adrian Sandra Dobs3 1Division of Pediatric Endocrinology, Georgetown University School of Medicine, Washington, DC, 2Division of Endocrinology, University of Maryland School of Medicine, 3Department of Endocrinology, Johns Hopkins University School of Medicine, Baltimore, MD, USA Abstract: Polycystic ovary syndrome (PCOS is a syndrome associated with insulin resistance (IR, obesity, infertility, and increased cardiometabolic risk. This is a descriptive review of several mechanisms that can explain the IR among women with PCOS, other risk factors for the development of diabetes, and the screening methods used for the detection of glucose intolerance in women with PCOS. Few mechanisms can explain IR in women with PCOS such as obesity, insulin receptor signaling defects, and inhibition of insulin-mediated glucose uptake in adipocytes. Women with PCOS have additional risk factors for the development of glucose intolerance such as family history of diabetes, use of oral contraceptives, anovulation, and age. The Androgen Society in 2007 and the Endocrine Society in 2013 recommended using oral glucose tolerance test as a screening tool for abnormal glucose tolerance in all women with PCOS. The approach to detection of glucose intolerance among women with PCOS varies among health care providers. Large prospective studies are still needed for the development of guidelines with strong evidence. When assessing risk of future diabetes in women with PCOS, it is important to take into account the method used for screening as well as other risk factors that these women might have. Keywords: IR, OGTT, obesity, hyperandrogenism, anovulation, BMI, insulin resistance, PCOS

  6. Development of Efficient Screening Methods for Resistant Cucumber Plants to Meloidogyne incognita

    Directory of Open Access Journals (Sweden)

    Sung Min Hwang

    2014-06-01

    Full Text Available Root-knot nematodes represent a significant problem in cucumber, causing reduction in yield and quality. To develop screening methods for resistance of cucumber to root-knot nematode Meloidogyne incognita, development of root-knot nematode of four cucumber cultivars (‘Dragonsamchuk’, ‘Asiastrike’, ‘Nebakja’ and ‘Hanelbakdadaki’ according to several conditions such as inoculum concentration, plant growth stage and transplanting period was investigated by the number of galls and egg masses produced in each seedling 45 days after inoculation. There was no difference in galls and egg masses according to the tested condition except for inoculum concentration. Reproduction of the nematode on all the tested cultivars according to inoculum concentration increased in a dose-dependent manner. On the basis of the result, the optimum conditions for root-knot development on the cultivars is to transplant period of 1 week, inoculum concentration of 5,000 eggs/plant and plant growth stage of 3-week-old in a greenhouse (25 ± 5°C. In addition, under optimum conditions, resistance of 45 commercial cucumber cultivars was evaluated. One rootstock cultivar, Union was moderately resistant to the root-knot nematode. However, no significant difference was in the resistance of the others cultivar. According to the result, we suggest an efficient screening method for new resistant cucumber to the root-knot nematode, M. incognita.

  7. Prospective memory tasks: a more sensitive method for screening cognitive impairment in ALS?

    Directory of Open Access Journals (Sweden)

    Ji Ying

    2012-11-01

    Full Text Available Abstract Background Cognitive change is prevalent in patients with amyotrophic lateral sclerosis (ALS, but still lack a widely accepted and sensitive screening method. In this study, we try to find a sensitive screening battery for detecting subtle cognitive deficits in patients with ALS. Methods Eighty consecutive ALS patients and 57 matched normal controls underwent the Mini-Mental Status Examination (MMSE, the verbal fluency test (VFT, the Stroop Color Word Interference Test (CWT, and the prospective memory (PM tests, including event-based (EBPM and time-based (TBPM. Results The patients did not differ from the controls in the MMSE, the VFT and the CWT. By contrast, statistically significant differences were found in the PM tests (EBPM: P=0.043; TBPM: P Conclusions Prefrontal lobar dysfunction does exist among ALS patients and may spread from the medial to the lateral region. The PM tests seem more sensitive in ALS patients with frontotemporal dysfunction than are the classical cognitive measures.

  8. Agreement Between Visual Inspection with Acetic Acid and Papanicolaous Smear as Screening Methods for Cervical Cancer

    International Nuclear Information System (INIS)

    Naz, U.; Hanif, S.

    2014-01-01

    Objective: To determine degree of agreement between visual inspection with acetic acid (VIA) and Papanicolaous (Pap) smear as screening methods for cervical cancer. Study Design: A cross-sectional study. Place and Duration of Study: Department of Obstetrics and Gynaecology, Sir Ganga Ram Hospital, Lahore, from July to December 2012. Methodology: Two hundred and fifty women in reproductive age group presenting with various gynaecological complaints were included in the study. A Papanicolaous smear was taken and visual inspection with 5% acetic acid was done. VIA was reported as positive or negative according to acetowhite changes and cytology result was graded as CIN 1, 2, 3 and squamous carcinoma. Those women who showed positive result with either VIA or Pap smear or both were further subjected to colposcopic directed biopsy which was taken as gold standard. Results were computed using Statistical Package for Social Sciences (SPSS) version 16 and statistical test used was kappa. Results: Out of 250 women, VIA was positive in 55 (22%) patients and Pap smear was abnormal in 27 (10.8%). Histological diagnosis of CIN/cancer was made in 36 out of a total 62 patients who underwent biopsy. Conclusion: There was a fair agreement between VIA and Pap smear, with VIA detecting more abnormalities than cytology. In the absence of Pap smear availability, VIA may be a reasonable cervical cancer screening method, especially in low resource settings. (author)

  9. Development of Convenient Screening Method for Resistant Radish to Plasmodiophora brassicae

    Directory of Open Access Journals (Sweden)

    Su-Jung Jo

    2011-08-01

    Full Text Available To establish simple and reliable screening method for resistant radish to Plasmodiophora brassicae Woron. using soil-drenching inoculation, the development of clubroot on radish seedlings inoculated with P. brassicae GN-1 isolate according to several conditions such as inoculum concentration, plant growth stage and incubation period after inoculation was studied. To select resistant radish against clubroot, 10-day-old seedlings were inoculated with P. brassicae by drenching the roots with the spore suspension of the pathogen to give 1×10(9 spores/pot. The inoculated seedlings were incubated in a growth chamber at 20℃ for 3 days then cultivated in a greenhouse (20±5℃ for 6 weeks. Under the optimum conditions, 46 commercial cultivars of radish were tested for resistance to YC-1 (infecting 15 clubroot-resistant cultivars of Chinese cabbage and GN-1 (wild type isolates of P. brassicae. Among them, thirty-five cultivars showed resistance to both isolates and one cultivar represented susceptible response to the pathogens. On the other hand, the other cultivars showed different responses against the tested P. brassicae pathogens. The results suggest that this method is an efficient system for screening radish with resistance to clubroot.

  10. Robust Microplate-Based Methods for Culturing and in Vivo Phenotypic Screening of Chlamydomonas reinhardtii

    Directory of Open Access Journals (Sweden)

    Timothy C. Haire

    2018-03-01

    Full Text Available Chlamydomonas reinhardtii (Cr, a unicellular alga, is routinely utilized to study photosynthetic biochemistry, ciliary motility, and cellular reproduction. Its minimal culture requirements, unicellular morphology, and ease of transformation have made it a popular model system. Despite its relatively slow doubling time, compared with many bacteria, it is an ideal eukaryotic system for microplate-based studies utilizing either, or both, absorbance as well as fluorescence assays. Such microplate assays are powerful tools for researchers in the areas of toxicology, pharmacology, chemical genetics, biotechnology, and more. However, while microplate-based assays are valuable tools for screening biological systems, these methodologies can significantly alter the conditions in which the organisms are cultured and their subsequent physiology or morphology. Herein we describe a novel method for the microplate culture and in vivo phenotypic analysis of growth, viability, and photosynthetic pigments of C. reinhardtii. We evaluated the utility of our assay by screening silver nanoparticles for their effects on growth and viability. These methods are amenable to a wide assortment of studies and present a significant advancement in the methodologies available for research involving this model organism.

  11. Pharmacy diabetes care program: analysis of two screening methods for undiagnosed type 2 diabetes in Australian community pharmacy.

    Science.gov (United States)

    Krass, I; Mitchell, B; Clarke, P; Brillant, M; Dienaar, R; Hughes, J; Lau, P; Peterson, G; Stewart, K; Taylor, S; Wilkinson, J; Armour, C

    2007-03-01

    To compare the efficacy and cost-effectiveness of two methods of screening for undiagnosed type 2 diabetes in Australian community pharmacy. A random sample of 30 pharmacies were allocated into two groups: (i) tick test only (TTO); or (ii) sequential screening (SS) method. Both methods used the same initial risk assessment for type 2 diabetes. Subjects with one or more risk factors in the TTO group were offered a referral to their general practitioner (GP). Under the SS method, patients with risk factors were offered a capillary blood glucose test and those identified as being at risk referred to a GP. The effectiveness and cost-effectiveness of these approaches was assessed. A total of 1286 people were screened over a period of 3 months. The rate of diagnosis of diabetes was significantly higher for SS compared with the TTO method (1.7% versus 0.2%; p=0.008). The SS method resulted in fewer referrals to the GP and a higher uptake of referrals than the TTO method and so was the more cost-effective screening method. SS is the superior method from a cost and efficacy perspective. It should be considered as the preferred option for screening by community based pharmacists in Australia.

  12. A rapid screening method for heavy metals in biological materials by emission spectroscopy.

    Science.gov (United States)

    Blacklock, E C; Sadler, P A

    1981-06-02

    A semi-quantitative screening method for heavy metals in biological material is described. The metals are complexed with ammonium pyrrolidine dithiocarbamate, sodium diethyl dithiocarbamate and potassium sodium tartrate. The solutions are adjusted to pH 4 and then extracted into chloroform. The chloroform phase is evaporated onto a matrix mixture of lithium fluoride and graphite. The sample is analysed by direct current arc emission spectroscopy using a 3 metre grating spectrograph. The spectra are recorded on a photographic plate. The method is developed on aqueous and spiked samples and then applied to in vivo samples containing toxic levels of heavy metals. Atomic absorption spectroscopy is used to check standard concentrations and to monitor the efficiency of the extraction procedure.

  13. Research on atmospheric transmission distortion of Gauss laser using multiple phase screen method

    Science.gov (United States)

    Zhang, Yizhuo; Wang, Qiushi; Gu, Haidong

    2018-02-01

    The laser beam is attenuated, broadened, defocused and may even be deflected from its initial propagation direction as it propagates through the atmosphere. It leads to the decrease of the laser intensity of the receiving surface. Gauss beam is the fundamental components of all possible laser waveforms. Therefore, research on the transmission of the Gauss laser has far-reaching consequences in optical communication, weaponry, target designation, ranging, remote sensing and other applications that require transmission of laser beams through the atmosphere. In this paper, we propose a laboratory simulation method using multi-phase screen to calculate the effects of atmospheric turbulence. Theoretical analysis of Gauss laser transmission in the atmosphere is given. By calculating the propagation of the Gauss beam TEM00, the far field intensity and phase distribution is shown. By the given method, the optical setup is presented and used for optimizing the adaptive optics algorithm.

  14. Qualitative screening method for pesticide residues detection in fruits and vegetables

    Directory of Open Access Journals (Sweden)

    Iván Mauricio Huérfano Barco

    2018-01-01

    Full Text Available Because of the importance of developing methodologies that allow agricultural residues analysis, a rapid screening qualitative method for the determination of pesticides residues in fruits and vegetables was validated. The methodology was based on the European QuEChERS extraction method with an additional cleaning step by gel permeation chromatography (GPC, which helped to reduce the number of matrix components in the final extract. The analysis was carried out by gas chromatography coupled to mass spectrometry with a single quadrupole analyzer. The methodology was appropriate for the qualitative analysis of 31 pesticides at their respective maximum residue limits. Consistent results were obtained with respect to a quantitative routine methodology in the analysis of real samples, hence the methodology was proven to be a good alternative for the fast analysis of these contaminants in fruits and vegetables.

  15. A randomized controlled trial of Human Papillomavirus (HPV testing for cervical cancer screening: trial design and preliminary results (HPV FOCAL Trial

    Directory of Open Access Journals (Sweden)

    Smith Laurie W

    2010-03-01

    Full Text Available Abstract Background In the HPV FOCAL trial, we will establish the efficacy of hr-HPV DNA testing as a stand-alone screening test followed by liquid based cytology (LBC triage of hr-HPV-positive women compared to LBC followed by hr-HPV triage with ≥ CIN3 as the outcome. Methods/Design HPV-FOCAL is a randomized, controlled, three-armed study over a four year period conducted in British Columbia. It will recruit 33,000 women aged 25-65 through the province's population based cervical cancer screening program. Control arm: LBC at entry and two years, and combined LBC and hr-HPV at four years among those with initial negative results and hr-HPV triage of ASCUS cases; Two Year Safety Check arm: hr-HPV at entry and LBC at two years in those with initial negative results with LBC triage of hr-HPV positives; Four Year Intervention Arm: hr-HPV at entry and combined hr-HPV and LBC at four years among those with initial negative results with LBC triage of hr-HPV positive cases Discussion To date, 6150 participants have a completed sample and epidemiologic questionnaire. Of the 2019 women enrolled in the control arm, 1908 (94.5% were cytology negative. Women aged 25-29 had the highest rates of HSIL (1.4%. In the safety arm 92.2% of women were hr-HPV negative, with the highest rate of hr-HPV positivity found in 25-29 year old women (23.5%. Similar results were obtained in the intervention arm HPV FOCAL is the first randomized trial in North America to examine hr-HPV testing as the primary screen for cervical cancer within a population-based cervical cancer screening program. Trial Registration International Standard Randomised Controlled Trial Number Register, ISRCTN79347302

  16. Evaluation of Dried Urine Spot Method to Screen Cotinine among Tobacco Dependents: An Exploratory Study.

    Science.gov (United States)

    Jain, Raka; Quraishi, Rizwana; Verma, Arpita

    2017-01-01

    Assessment of cotinine, a metabolite of nicotine in body fluids, is an important approach for validating the self-report among tobacco users. Adaptation of assays on dried urine spots (DUSs) has advantages of ease of collection, transportation, minimal invasiveness, and requirement of small volume. The aim of the present study was to develop an efficient method for testing cotinine in DUSs and evaluating its clinical applicability. This involved optimization of conditions for detection, recovery, and stability of cotinine from dried urine, spotted on filter paper. Enzyme-linked immunosorbent assay was used for screening, whereas confirmation was done by gas chromatography. For clinical applicability, urine samples of tobacco users were tested. Water was found to be a suitable extracting solvent as compared to carbonate-bicarbonate buffer (pH 9.2) and saline. Screening was achieved by two punches taken from a 20 μl (diameter 1.3 cm) spotted urine samples, and confirmation was achieved by five complete circles each of 20 μl sample volume. The recovery was found to be 97% in water. Limit of detection for the method was found to be 100 ng/ml. No signs of significant degradation were found under all storage conditions. All the urine samples of tobacco users were found to be positive by a conventional method as well as DUSs, and the method proved to be efficient. DUS samples are a useful alternative for biological monitoring of recent nicotine use, especially in developing countries where sample logistics could be an important concern.

  17. Ultrasound surface probe as a screening method for evaluating the patients with blunt abdominal trauma

    Directory of Open Access Journals (Sweden)

    Mohammad Nasr-Esfahani

    2014-01-01

    Full Text Available Background: Blunt abdominal trauma is one of the causes of mortality in emergency department. Free fluid in the abdomen due to intra-abdominal blunt trauma can be determined by the surface probe of ultrasound. Since the importance of this free fluid in hemodynamic stable patients with blunt trauma is associated with the unknown outcome for surgeons, this study was performed to evaluate the role of ultrasound surface probe as a screening method in evaluating the patients with blunt abdominal trauma. Materials and Methods: A descriptive-analytical study was done on 45 patients with blunt abdominal trauma and hemodynamic stability. The patients were evaluated twice during the three-hours, including repeated ultrasound surface probe and clinical examinations. Computerized tomography was also performed. The patients were divided based on the amount of the free fluid in the abdomen during the evaluations into two groups: Fixed or increased, and decreased free fluid. The results of the different evaluated methods were compared using the sensitivity and specificity. Results: From 17 patients with CT abnormalities, free fluid increased in 14 patients (82.4%. Free fluid was decreased in three patients who were discharged well from the surgery service without any complication. Surface probe in prognosis detection had a sensitivity of 82.4% and specificity of 92.9%. The percentage of false positive and negative ultrasound compared with CT scan was 7.1% and 17.6%. Also, positive and negative predictive value of the ultrasound with surface probe was 87.5% and 89.7% respectively. Conclusion: The use of the ultrasound with surface probe in the diagnosis of free fluid in blunt abdominal trauma in hemodynamic stable patients can be considered as a useful screening method.

  18. DRABAL: novel method to mine large high-throughput screening assays using Bayesian active learning

    KAUST Repository

    Soufan, Othman

    2016-11-10

    Background Mining high-throughput screening (HTS) assays is key for enhancing decisions in the area of drug repositioning and drug discovery. However, many challenges are encountered in the process of developing suitable and accurate methods for extracting useful information from these assays. Virtual screening and a wide variety of databases, methods and solutions proposed to-date, did not completely overcome these challenges. This study is based on a multi-label classification (MLC) technique for modeling correlations between several HTS assays, meaning that a single prediction represents a subset of assigned correlated labels instead of one label. Thus, the devised method provides an increased probability for more accurate predictions of compounds that were not tested in particular assays. Results Here we present DRABAL, a novel MLC solution that incorporates structure learning of a Bayesian network as a step to model dependency between the HTS assays. In this study, DRABAL was used to process more than 1.4 million interactions of over 400,000 compounds and analyze the existing relationships between five large HTS assays from the PubChem BioAssay Database. Compared to different MLC methods, DRABAL significantly improves the F1Score by about 22%, on average. We further illustrated usefulness and utility of DRABAL through screening FDA approved drugs and reported ones that have a high probability to interact with several targets, thus enabling drug-multi-target repositioning. Specifically DRABAL suggests the Thiabendazole drug as a common activator of the NCP1 and Rab-9A proteins, both of which are designed to identify treatment modalities for the Niemann–Pick type C disease. Conclusion We developed a novel MLC solution based on a Bayesian active learning framework to overcome the challenge of lacking fully labeled training data and exploit actual dependencies between the HTS assays. The solution is motivated by the need to model dependencies between existing

  19. An alternative method to record rising temperatures during dental implant site preparation: a preliminary study using bovine bone

    Directory of Open Access Journals (Sweden)

    Domenica Laurito

    2010-12-01

    Full Text Available Overheating is constantly mentioned as a risk factor for bone necrosis that could compromise the dental implant primary stability. Uncontrolled thermal injury can result in a fibrous tissue, interpositioned at the implant-bone interface, compromising the long-term prognosis. The methods used to record temperature rise include either direct recording by thermocouple instruments or indirect estimating by infrared thermography. This preliminary study was carried out using bovine bone and a different method of temperatures rising estimation is presented. Two different types of drills were tested using fluoroptic thermometer and the effectiveness of this alternative temperature recording method was evaluated.

  20. Preliminary phytochemical screening, antifungal and cytotoxic activities of leaves extract of moringa oleifera lam. from salt range, pakistan

    International Nuclear Information System (INIS)

    Maqsood, M.; Qureshi, R.; Arshad, M.; Ahmed, M.E.; Ikram, M.

    2017-01-01

    Moringa oleifera Lam. is a miraculous plant that endowed with variety of medicinal properties and traditionally used as herbal drug as well as nutraceutical agent. There is sporadic information on phytochemical and antifungal activity of various solvents based leaves extracts. Therefore, the present study was designed to explore In vitro antifungal activity of M. oleifera leaves against Aspergillus fumigatus, A. niger and Candida albicans at four different concentrations (50-300 mg/ml) by ager well diffusion method. Leaves of this plant were collected from the Thal Desert, Pakistan, dried under shade, powdered and kept in air tight sterilized bottles. Polarity based solvent extraction of powdered samples were carried out with different solvents. The ethanolic and methanolic extracts were found the most effective against all selected fungal strains. The maximum zone of inhibition was recorded in the case of methanolic leaves extract (16 mm) against A. niger at a concentration of 300 mg/ml, which was at par to the standard antibiotic. Methanolic extract showed the highest MIC value (70 mg/ml) against A. niger. There was very strong activity in terms of IC50 against MCF-7, INS-1, RG2 and HeLa (<5 mu gmL-1). The quantitative phytochemical analysis revealed that leaves possessed high amount of flavonoids (21.76+-0.68), followed tannins (14.3+-0.26), saponins (12.56+-0.51) and alkaloids (2.4+-0.85). This piece of research would be used as benchmark to carry-out further detailed study ranging from isolation, characterization, pharmacological diagnosis and clinical trials prior to launching marketable drug. (author)

  1. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia

    Science.gov (United States)

    Smyrnakis, Ioannis; Andreadakis, Vassilios; Selimis, Vassilios; Kalaitzakis, Michail; Bachourou, Theodora; Kaloutsakis, Georgios; Kymionis, George D.; Smirnakis, Stelios; Aslanides, Ioannis M.

    2017-01-01

    Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR) that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic) curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS) that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6%) and 30 out of 32 readers with dyslexia (sensitivity 93.8%) were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score) where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a novel

  2. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia.

    Science.gov (United States)

    Smyrnakis, Ioannis; Andreadakis, Vassilios; Selimis, Vassilios; Kalaitzakis, Michail; Bachourou, Theodora; Kaloutsakis, Georgios; Kymionis, George D; Smirnakis, Stelios; Aslanides, Ioannis M

    2017-01-01

    Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR) that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic) curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS) that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6%) and 30 out of 32 readers with dyslexia (sensitivity 93.8%) were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score) where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a novel

  3. RADAR: A novel fast-screening method for reading difficulties with special focus on dyslexia.

    Directory of Open Access Journals (Sweden)

    Ioannis Smyrnakis

    Full Text Available Dyslexia is a developmental learning disorder of single word reading accuracy and/or fluency, with compelling research directed towards understanding the contributions of the visual system. While dyslexia is not an oculomotor disease, readers with dyslexia have shown different eye movements than typically developing students during text reading. Readers with dyslexia exhibit longer and more frequent fixations, shorter saccade lengths, more backward refixations than typical readers. Furthermore, readers with dyslexia are known to have difficulty in reading long words, lower skipping rate of short words, and high gaze duration on many words. It is an open question whether it is possible to harness these distinctive oculomotor scanning patterns observed during reading in order to develop a screening tool that can reliably identify struggling readers, who may be candidates for dyslexia. Here, we introduce a novel, fast, objective, non-invasive method, named Rapid Assessment of Difficulties and Abnormalities in Reading (RADAR that screens for features associated with the aberrant visual scanning of reading text seen in dyslexia. Eye tracking parameter measurements that are stable under retest and have high discriminative power, as indicated by their ROC (receiver operating characteristic curves, were obtained during silent text reading. These parameters were combined to derive a total reading score (TRS that can reliably separate readers with dyslexia from typical readers. We tested TRS in a group of school-age children ranging from 8.5 to 12.5 years of age. TRS achieved 94.2% correct classification of children tested. Specifically, 35 out of 37 control (specificity 94.6% and 30 out of 32 readers with dyslexia (sensitivity 93.8% were classified correctly using RADAR, under a circular validation condition (see section Results/Total Reading Score where the individual evaluated was not included in the test construction group. In conclusion, RADAR is a

  4. OSO paradigm--A rapid behavioral screening method for acute psychosocial stress reactivity in mice.

    Science.gov (United States)

    Brzózka, M M; Unterbarnscheidt, T; Schwab, M H; Rossner, M J

    2016-02-09

    Chronic psychosocial stress is an important environmental risk factor for the development of psychiatric diseases. However, studying the impact of chronic psychosocial stress in mice is time consuming and thus not optimally suited to 'screen' increasing numbers of genetically manipulated mouse models for psychiatric endophenotypes. Moreover, many studies focus on restraint stress, a strong physical stressor with limited relevance for psychiatric disorders. Here, we describe a simple and a rapid method based on the resident-intruder paradigm to examine acute effects of mild psychosocial stress in mice. The OSO paradigm (open field--social defeat--open field) compares behavioral consequences on locomotor activity, anxiety and curiosity before and after exposure to acute social defeat stress. We first evaluated OSO in male C57Bl/6 wildtype mice where a single episode of social defeat reduced locomotor activity, increased anxiety and diminished exploratory behavior. Subsequently, we applied the OSO paradigm to mouse models of two schizophrenia (SZ) risk genes. Transgenic mice with neuronal overexpression of Neuregulin-1 (Nrg1) type III showed increased risk-taking behavior after acute stress exposure suggesting that NRG1 dysfunction is associated with altered affective behavior. In contrast, Tcf4 transgenic mice displayed a normal stress response which is in line with the postulated predominant contribution of TCF4 to cognitive deficits of SZ. In conclusion, the OSO paradigm allows for rapid screening of selected psychosocial stress-induced behavioral endophenotypes in mouse models of psychiatric diseases. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  5. An effective method to screen sodium-based layered materials for sodium ion batteries

    Science.gov (United States)

    Zhang, Xu; Zhang, Zihe; Yao, Sai; Chen, An; Zhao, Xudong; Zhou, Zhen

    2018-03-01

    Due to the high cost and insufficient resource of lithium, sodium-ion batteries are widely investigated for large-scale applications. Typically, insertion-type materials possess better cyclic stability than alloy-type and conversion-type ones. Therefore, in this work, we proposed a facile and effective method to screen sodium-based layered materials based on Materials Project database as potential candidate insertion-type materials for sodium ion batteries. The obtained Na-based layered materials contains 38 kinds of space group, which reveals that the credibility of our screening approach would not be affected by the space group. Then, some important indexes of the representative materials, including the average voltage, volume change and sodium ion mobility, were further studied by means of density functional theory computations. Some materials with extremely low volume changes and Na diffusion barriers are promising candidates for sodium ion batteries. We believe that our classification algorithm could also be used to search for other alkali and multivalent ion-based layered materials, to accelerate the development of battery materials.

  6. Benchmarking Methods and Data Sets for Ligand Enrichment Assessment in Virtual Screening

    Science.gov (United States)

    Xia, Jie; Tilahun, Ermias Lemma; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2014-01-01

    Retrospective small-scale virtual screening (VS) based on benchmarking data sets has been widely used to estimate ligand enrichments of VS approaches in the prospective (i.e. real-world) efforts. However, the intrinsic differences of benchmarking sets to the real screening chemical libraries can cause biased assessment. Herein, we summarize the history of benchmarking methods as well as data sets and highlight three main types of biases found in benchmarking sets, i.e. “analogue bias”, “artificial enrichment” and “false negative”. In addition, we introduced our recent algorithm to build maximum-unbiased benchmarking sets applicable to both ligand-based and structure-based VS approaches, and its implementations to three important human histone deacetylase (HDAC) isoforms, i.e. HDAC1, HDAC6 and HDAC8. The Leave-One-Out Cross-Validation (LOO CV) demonstrates that the benchmarking sets built by our algorithm are maximum-unbiased in terms of property matching, ROC curves and AUCs. PMID:25481478

  7. Benchmarking methods and data sets for ligand enrichment assessment in virtual screening.

    Science.gov (United States)

    Xia, Jie; Tilahun, Ermias Lemma; Reid, Terry-Elinor; Zhang, Liangren; Wang, Xiang Simon

    2015-01-01

    Retrospective small-scale virtual screening (VS) based on benchmarking data sets has been widely used to estimate ligand enrichments of VS approaches in the prospective (i.e. real-world) efforts. However, the intrinsic differences of benchmarking sets to the real screening chemical libraries can cause biased assessment. Herein, we summarize the history of benchmarking methods as well as data sets and highlight three main types of biases found in benchmarking sets, i.e. "analogue bias", "artificial enrichment" and "false negative". In addition, we introduce our recent algorithm to build maximum-unbiased benchmarking sets applicable to both ligand-based and structure-based VS approaches, and its implementations to three important human histone deacetylases (HDACs) isoforms, i.e. HDAC1, HDAC6 and HDAC8. The leave-one-out cross-validation (LOO CV) demonstrates that the benchmarking sets built by our algorithm are maximum-unbiased as measured by property matching, ROC curves and AUCs. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Statistical methods for the analysis of a screening test for chronic beryllium disease

    Energy Technology Data Exchange (ETDEWEB)

    Frome, E.L.; Neubert, R.L. [Oak Ridge National Lab., TN (United States). Mathematical Sciences Section; Smith, M.H.; Littlefield, L.G.; Colyer, S.P. [Oak Ridge Inst. for Science and Education, TN (United States). Medical Sciences Div.

    1994-10-01

    The lymphocyte proliferation test (LPT) is a noninvasive screening procedure used to identify persons who may have chronic beryllium disease. A practical problem in the analysis of LPT well counts is the occurrence of outlying data values (approximately 7% of the time). A log-linear regression model is used to describe the expected well counts for each set of test conditions. The variance of the well counts is proportional to the square of the expected counts, and two resistant regression methods are used to estimate the parameters of interest. The first approach uses least absolute values (LAV) on the log of the well counts to estimate beryllium stimulation indices (SIs) and the coefficient of variation. The second approach uses a resistant regression version of maximum quasi-likelihood estimation. A major advantage of the resistant regression methods is that it is not necessary to identify and delete outliers. These two new methods for the statistical analysis of the LPT data and the outlier rejection method that is currently being used are applied to 173 LPT assays. The authors strongly recommend the LAV method for routine analysis of the LPT.

  9. A cost-effective screening method for pesticide residue analysis in fruits, vegetables, and cereal grains.

    Science.gov (United States)

    Ambrus, A; Füzesi, I; Susán, M; Dobi, D; Lantos, J; Zakar, F; Korsós, I; Oláh, J; Beke, B B; Katavics, L

    2005-01-01

    This paper reports the results of studies performed to investigate the potential of applying thin layer chromatography (TLC) detection in combination with selected extraction and cleanup methods, for providing an alternative cost-effective analytical procedure for screening and confirmation of pesticide residues in plant commodities. The extraction was carried out with ethyl acetate and an on-line extraction method applying an acetone-dichloromethane mixture. The extracts were cleaned up with SX-3 gel, an adsorbent mixture of active carbon, magnesia, and diatomaceous earth, and on silica micro cartridges. The Rf values of 118 pesticides were tested in eleven elution systems with UV, and eight biotest methods and chemical detection reagents. Cabbage, green peas, orange, and tomatoes were selected as representative sample matrices for fruits and vegetables, while maize, rice, and wheat represented cereal grains. As an internal quality control measure, marker compounds were applied on each plate to verify the proper elution and detection conditions. The Rf values varied in the different elution systems. The best separation (widest Rf range) was achieved with silica gel (SG)--ethyl acetate (0.05-0.7), SG--benzene, (0.02-0.7) and reverse phase RP-18 F-254S layer with acetone: methanol: water/30:30:30 (v/v) (0.1-0.8). The relative standard deviation of Rf values (CV(Rf)) within laboratory reproducibility was generally less than 20%, except below 0.2 Rf, where the CVRf rapidly increased with decreasing Rf values. The fungi spore inhibition, chloroplast inhibition, and enzyme inhibition were found most suitable for detection of pesticides primarily for confirming their identity or screening for known substances. Their use for determination of pesticide residues in samples of unknown origin is not recommended.

  10. An Improved Method for P2X7R Antagonist Screening.

    Directory of Open Access Journals (Sweden)

    Rômulo José Soares-Bezerra

    Full Text Available ATP physiologically activates the P2X7 receptor (P2X7R, a member of the P2X ionotropic receptor family. When activated by high concentrations of ATP (i.e., at inflammation sites, this receptor is capable of forming a pore that allows molecules of up to 900 Da to pass through. This receptor is upregulated in several diseases, particularly leukemia, rheumatoid arthritis and Alzheimer's disease. A selective antagonist of this receptor could be useful in the treatment of P2X7R activation-related diseases. In the present study, we have evaluated several parameters using in vitro protocols to validate a high-throughput screening (HTS method to identify P2X7R antagonists. We generated dose-response curves to determine the EC50 value of the known agonist ATP and the ICs50 values for the known antagonists Brilliant Blue G (BBG and oxidized ATP (OATP. The values obtained were consistent with those found in the literature (0.7 ± 0.07 mM, 1.3-2.6 μM and 173-285 μM for ATP, BBG and OATP, respectively [corrected].The Z-factor, an important statistical tool that can be used to validate the robustness and suitability of an HTS assay, was 0.635 for PI uptake and 0.867 for LY uptake. No inter-operator variation was observed, and the results obtained using our improved method were reproducible. Our data indicate that our assay is suitable for the selective and reliable evaluation of P2X7 activity in multiwell plates using spectrophotometry-based methodology. This method might improve the high-throughput screening of conventional chemical or natural product libraries for possible candidate P2X7R antagonist or agonist.

  11. Screening for depression in epilepsy clinics. A comparison of conventional and visual-analog methods.

    Science.gov (United States)

    Rampling, Jeremy; Mitchell, Alex J; Von Oertzen, Tim; Docker, James; Jackson, Jemima; Cock, Hannah; Agrawal, Niruj

    2012-10-01

    Depression is an important but underdiagnosed complication of epilepsy. This study compares potentially suitable screening tools head-to-head. We enrolled 266 attendees with a confirmed diagnosis of epilepsy at a specialized neurologic epilepsy service in London and compared verbal self-report and visual analog (VAS) screening methods for depression. These included two generic depression scales (Hospital Anxiety and Depression Scale [HADS], Beck Depression Inventory II [BDI-II]), one epilepsy specific scale (Neurological Disorders Depression Inventory for Epilepsy [NDDI-E]) and one new visual-analog scale (Emotional Thermometers [ET]). We used Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria for major depression and International Classification of Diseases, Tenth Revision (ICD-10) criteria for depressive episode as the reference standard. Against ICD-10-defined depression the most accurate scales by receiver operating characteristic (ROC) curve area were HADS Total (HADS-T, 0.924), BDI-II (0.898) and NDDI-E (0.897). New visual-analog methods had similar accuracy measured either in combination or individually. Although no test performed well in a case-finding role, several performed well as a rule-out initial step, owing to high negative predictive value and specificity. In this role, the optimal performing conventional tools were the HADS depression subsscale (HADS-D) and the NDDI-E and the optimal single VAS were the depression thermometer (DepT) and the distress thermometer (DT). Against DSM-IV- defined major depression, results were similar with optimal performance by the HADS-T, BDI-II, and NDDI-E, but here the anxiety thermometer (AnxT) as well as DepT and DT also offered good performance. Given that no test performed well in a case-finding role, we suggest that these tests are used as an initial first step to rule out patients who are unlikely to have depression. We suggest that the six-item NDDI-E or seven-item HADS

  12. The use of graph theory in the sensitivity analysis of the model output: a second order screening method

    International Nuclear Information System (INIS)

    Campolongo, Francesca; Braddock, Roger

    1999-01-01

    Sensitivity analysis screening methods aim to isolate the most important factors in experiments involving a large number of significant factors and interactions. This paper extends the one-factor-at-a-time screening method proposed by Morris. The new method, in addition to the 'overall' sensitivity measures already provided by the traditional Morris method, offers estimates of the two-factor interaction effects. The number of model evaluations required is O(k 2 ), where k is the number of model input factors. The efficient sampling strategy in the parameter space is based on concepts of graph theory and on the solution of the 'handcuffed prisoner problem'

  13. Gabor Deconvolution as Preliminary Method to Reduce Pitfall in Deeper Target Seismic Data

    Science.gov (United States)

    Oktariena, M.; Triyoso, W.

    2018-03-01

    Anelastic attenuation process during seismic wave propagation is the trigger of seismic non-stationary characteristic. An absorption and a scattering of energy are causing the seismic energy loss as the depth increasing. A series of thin reservoir layers found in the study area is located within Talang Akar Fm. Level, showing an indication of interpretation pitfall due to attenuation effect commonly occurred in deeper level seismic data. Attenuation effect greatly influences the seismic images of deeper target level, creating pitfalls in several aspect. Seismic amplitude in deeper target level often could not represent its real subsurface character due to a low amplitude value or a chaotic event nearing the Basement. Frequency wise, the decaying could be seen as the frequency content diminishing in deeper target. Meanwhile, seismic amplitude is the simple tool to point out Direct Hydrocarbon Indicator (DHI) in preliminary Geophysical study before a further advanced interpretation method applied. A quick-look of Post-Stack Seismic Data shows the reservoir associated with a bright spot DHI while another bigger bright spot body detected in the North East area near the field edge. A horizon slice confirms a possibility that the other bright spot zone has smaller delineation; an interpretation pitfall commonly occurs in deeper level of seismic. We evaluates this pitfall by applying Gabor Deconvolution to address the attenuation problem. Gabor Deconvolution forms a Partition of Unity to factorize the trace into smaller convolution window that could be processed as stationary packets. Gabor Deconvolution estimates both the magnitudes of source signature alongside its attenuation function. The enhanced seismic shows a better imaging in the pitfall area that previously detected as a vast bright spot zone. When the enhanced seismic is used for further advanced reprocessing process, the Seismic Impedance and Vp/Vs Ratio slices show a better reservoir delineation, in which the

  14. A Novel Yeast Surface Display Method for Large-Scale Screen Inhibitors of Sortase A.

    Science.gov (United States)

    Wu, Lin; Li, Huijun; Tang, Tianle

    2017-01-24

    Fluorescence resonance energy transfer substrates of sortase A are too expensive to be used to roughly screen high-throughput sortase A inhibitors. This makes therapeutic strategies difficult to realize in a clinical therapeutic use. Instead, we design here an LPETG-EGFP (leucine, proline, glutamic, threonine and glycine-enhanced green fluorescence) protein displayed on a yeast surface as a substrate by adaptively reducing the cost. We do this by optimizing the induction conditions of sortase A expression in Escherichia coli DE3(BL21) and catalyzing LPETG proteins, which are displayed on surface of Pichia pastoris . Different expression conditions of sortase A include: induction temperature (22 °C, 28 °C, 37 °C and 40 °C), induction time (4 h, 5 h, 6 h and 7 h) and induction concentration of isopropyl β-d-thiogalactoside IPTG (0.25 mmol/L, 0.5 mmol/L, 1 mmol/L, and 2 mmol/L). The fluorescence change of the LPETG-EGFP protein on the surface of P. pastoris over time was detected by flow cytometry and fluorescence spectrophotometry, and then the sensitivities of the two methods were compared. Using berberine chloride as an inhibitor, the activity of sortase A was investigated with the substrates of LPETG-EGFP protein, and compared to Dabcyl-QALPETGEE-Edans. A high yield of sortase A was achieved by inducing 1.0 mmol/L IPTG at 28 °C for 6 h. The intensity of green fluorescence of substrates displayed on the yeast surface was increased over time, while the stability was decreased slightly. Both fluorescence spectrophotometery and flow cytometry were fit for detection because of their high sensitivity. We utilized two different substrates of sortase A to investigate sortase A activity, which resulted in the increase of fluorescence intensity with respect to the increased time of growth. However, the method with Dabcyl-QALPETGEE-Edans as its substrate was more robust. Thus, the method described in this paper is a simple and cheap method which is very suitable for

  15. A Novel Yeast Surface Display Method for Large-Scale Screen Inhibitors of Sortase A

    Directory of Open Access Journals (Sweden)

    Lin Wu

    2017-01-01

    Full Text Available Fluorescence resonance energy transfer substrates of sortase A are too expensive to be used to roughly screen high-throughput sortase A inhibitors. This makes therapeutic strategies difficult to realize in a clinical therapeutic use. Instead, we design here an LPETG-EGFP (leucine, proline, glutamic, threonine and glycine-enhanced green fluorescence protein displayed on a yeast surface as a substrate by adaptively reducing the cost. We do this by optimizing the induction conditions of sortase A expression in Escherichia coli DE3(BL21 and catalyzing LPETG proteins, which are displayed on surface of Pichia pastoris. Different expression conditions of sortase A include: induction temperature (22 °C, 28 °C, 37 °C and 40 °C, induction time (4 h, 5 h, 6 h and 7 h and induction concentration of isopropyl β-d-thiogalactoside IPTG (0.25 mmol/L, 0.5 mmol/L, 1 mmol/L, and 2 mmol/L. The fluorescence change of the LPETG-EGFP protein on the surface of P. pastoris over time was detected by flow cytometry and fluorescence spectrophotometry, and then the sensitivities of the two methods were compared. Using berberine chloride as an inhibitor, the activity of sortase A was investigated with the substrates of LPETG-EGFP protein, and compared to Dabcyl-QALPETGEE-Edans. A high yield of sortase A was achieved by inducing 1.0 mmol/L IPTG at 28 °C for 6 h. The intensity of green fluorescence of substrates displayed on the yeast surface was increased over time, while the stability was decreased slightly. Both fluorescence spectrophotometery and flow cytometry were fit for detection because of their high sensitivity. We utilized two different substrates of sortase A to investigate sortase A activity, which resulted in the increase of fluorescence intensity with respect to the increased time of growth. However, the method with Dabcyl-QALPETGEE-Edans as its substrate was more robust. Thus, the method described in this paper is a simple and cheap method which is very

  16. Use of a screening method to determine excipients which optimize the extent and stability of supersaturated drug solutions and application of this system to solid formulation design.

    Science.gov (United States)

    Vandecruys, Roger; Peeters, Jef; Verreck, Geert; Brewster, Marcus E

    2007-09-05

    Assessing the effect of excipients on the ability to attain and maintain supersaturation of drug-based solution may provide useful information for the design of solid formulations. Judicious selection of materials that affect either the extent or stability of supersaturating drug delivery systems may be enabling for poorly soluble drug candidates or other difficult-to-formulate compounds. The technique suggested herein is aimed at providing a screening protocol to allow preliminary assessment of these factors based on small to moderate amounts of drug substance. A series of excipients were selected that may, by various mechanisms, affect supersaturation including pharmaceutical polymers such as HMPC and PVP, surfactants such as Polysorbate 20, Cremophor RH40 and TPGS and hydrophilic cyclodextrins such as HPbetaCD. Using a co-solvent based method and 25 drug candidates, the data suggested, on the whole, that the surfactants and the selected cyclodextrin seemed to best augment the extent of supersaturation but had variable benefits as stabilizers, while the pharmaceutical polymers had useful effect on supersaturation stability but were less helpful in increasing the extent of supersaturation. Using these data, a group of simple solid dosage forms were prepared and tested in the dog for one of the drug candidates. Excipients that gave the best extent and stability for the formed supersaturated solution in the screening assay also gave the highest oral bioavailability in the dog.

  17. Multi-laboratory testing of a screening method for world trade center (WTC) collapse dust

    International Nuclear Information System (INIS)

    Rosati, Jacky A.; Bern, Amy M.; Willis, Robert D.; Blanchard, Fredrick T.; Conner, Teri L.; Kahn, Henry D.; Friedman, David

    2008-01-01

    The September 11, 2001 attack on the World Trade Center (WTC) covered a large area of downtown New York City with dust and debris. This paper describes the testing of an analytical method designed to evaluate whether sampled dust contains dust that may have originated from the collapse of the WTC. Using dust samples collected from locations affected and not affected (referred to as 'background' locations) by the collapse, a scanning electron microscopy (SEM) analysis method was developed to screen for three materials that are believed to be present in large quantities in WTC dusts: slag wool, concrete, and gypsum. An inter-laboratory evaluation of the method was implemented by having eight laboratories analyze a number of 'blind' dust samples, consisting of confirmed background dust and confirmed background dust spiked with varying amounts of dust affected by the WTC collapse. The levels of gypsum and concrete in the spiked samples were indistinguishable from the levels in the background samples. Measurements of slag wool in dust demonstrated potential for distinguishing between spiked and background samples in spite of considerable within and between laboratory variability. Slag wool measurements appear to be sufficiently sensitive to distinguish dust spiked with 5% WTC-affected dust from 22 out of 25 background dust samples. Additional development work and inter-laboratory testing of the slag wool component will be necessary to improve the precision and accuracy of the method and reduce inter- and intra-laboratory variability from levels observed in the inter-laboratory evaluation

  18. Reconstruction of on-axis lensless Fourier transform digital hologram with the screen division method

    Science.gov (United States)

    Jiang, Hongzhen; Liu, Xu; Liu, Yong; Li, Dong; Chen, Zhu; Zheng, Fanglan; Yu, Deqiang

    2017-10-01

    An effective approach for reconstructing on-axis lensless Fourier Transform digital hologram by using the screen division method is proposed. Firstly, the on-axis Fourier Transform digital hologram is divided into sub-holograms. Then the reconstruction result of every sub-hologram is obtained according to the position of corresponding sub-hologram in the hologram reconstruction plane with Fourier transform operation. Finally, the reconstruction image of on-axis Fourier Transform digital hologram can be acquired by the superposition of the reconstruction result of sub-holograms. Compared with the traditional reconstruction method with the phase shifting technology, in which multiple digital holograms are required to record for obtaining the reconstruction image, this method can obtain the reconstruction image with only one digital hologram and therefore greatly simplify the recording and reconstruction process of on-axis lensless Fourier Transform digital holography. The effectiveness of the proposed method is well proved with the experimental results and it will have potential application foreground in the holographic measurement and display field.

  19. Establishment of cocrystal cocktail grinding method for rational screening of pharmaceutical cocrystals.

    Science.gov (United States)

    Yamamoto, Katsuhiko; Tsutsumi, Shunichirou; Ikeda, Yukihiro

    2012-11-01

    Cocrystals (CCs) used in the pharmaceutical industry are defined as complex crystals formed by reaction between an API and a cocrystal former (CCF); unlike salts, CCs do not show proton transfer. Recently, pharmaceutical CCs have been used to improve the drug-likeness of APIs, such as solubility and stability. Grinding is more effective for CC synthesis than crystallization from solution because in the former case, the API can predominantly interact with the CCF without being affected by solvents. However, this method is tedious because the API is ground with only one CCF at a time. We developed a cocktail cocrystal grinding (CCG) method, in which a mixture of CCFs having the same functional group was used. No false negatives/positives were observed in CCG when carbamazepine was used as the model compound. This method could be used to obtain CCs of piroxicam and spironolactone. False negatives were observed for only one compound from among three model compounds, indicating that CCG facilitates efficient CC detection and that it has higher throughput than does the conventional method. Further, CCG is fast and suitable for rational CC screening, and it helps identify the partial structure of CCFs that forms synthons with an API. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Gas evolution as a rapid screening method for detection of irradiated foods

    International Nuclear Information System (INIS)

    Roberts, P.B.; Chambers, D.M.; Brailsford, G.W.

    1996-01-01

    A number of detection methods for irradiated foods are in advanced state of development. No single method is likely to be universally applicable but a battery of tests such as thermoluminescence, electron spin resonance and analysis of lipid radiolytic products may soon be available for most foods and technical uses of irradiation. Most of these proposed tests require relatively sophisticated equipment or technical skills and are often time consuming and costly. There would be value in relatively simple tests which could be used as a rapid screening system or confirmatory method. The literature on the use of radiolytic gases as a detection method is limited and this paper extends the above studies. In particular, it extends the work to frozen shellfish, for which irradiation has been used as a commercial decontaminant technique for many years, and considers the effect of storage temperature. Work on poultry is also reported as a cross-reference to earlier work and because irradiated poultry has recently been released into the US retail trade. (author)

  1. A method for screening for the risk of chronic effects of surface water pollution.

    Science.gov (United States)

    Soldán, Přemysl; Badurová, Jana

    2013-01-01

    The article describes a method for screening for the risk of chronic surface water pollution which was developed at the T. G. Masaryk Water Research Institute. The approach, which is based on exotoxicological analyses, can be classed as a rapid method of assessment. The degree of risk of chronic effects surface water pollution is determined from an evaluation of two major parameters-toxicity and genotoxicity. As the method utilizes relative simple procedures for sample collection, pretreatment of the sample, chemical analyses, bioassays and results assessment, this approach is suitable for widespread practical use. Extensive utilization of this approach for assessing river basins in the Czech Republic has proved its suitability for a more sophisticated detection of the biological impact of surface water pollution. This is documented in the article where the method is used in a study of the Bílina River, and in the overview of the results of the risk assessment of chronic effects of surface water pollution in selected sections of three international river basins in the Czech Republic.

  2. Quick screening for new flux pinning materials in YBCO films with the combinatorial-PLD method

    International Nuclear Information System (INIS)

    Yoshimura, T.; Ichino, Y.; Yoshida, Y.; Takai, Y.; Kita, R.; Suzuki, K.; Takeuchi, T.

    2011-01-01

    An effective way to improve the superconducting properties in REBa 2 Cu 3 O y (REBCO) films under a magnetic field is to dope artificial pinning centers (APC). The pinning performance depends on the content of the APC materials. Usually, the optimal APC content is explored by preparing films one at a time from the REBCO target using different APC material content, which is an extremely time-consuming process. The combinatorial-PLD (C-PLD) method allowed us to prepare films that continuously changed in composition across a single substrate. In this study, we used the C-PLD method to prepare BaSnO 3 (BSO)-doped YBCO films. The films were deposited on SrTiO 3 substrate using a fourth-harmonic Nd:YAG laser. From the results of the J c -B curves at 77 K and B//c, the film that contained 3.2 vol.% of BSO exhibited the best pinning performance in this study. We showed that the C-PLD method was efficient for quick screening of the optimal APC content with only one deposition. We also used the C-PLD method to explore new APC materials, and proved that it can quickly evaluate the new APC materials Ba 3 Cu 3 In 4 O 12 and BaTbO 3 .

  3. Infrared thermography based on artificial intelligence as a screening method for carpal tunnel syndrome diagnosis.

    Science.gov (United States)

    Jesensek Papez, B; Palfy, M; Mertik, M; Turk, Z

    2009-01-01

    This study further evaluated a computer-based infrared thermography (IRT) system, which employs artificial neural networks for the diagnosis of carpal tunnel syndrome (CTS) using a large database of 502 thermal images of the dorsal and palmar side of 132 healthy and 119 pathological hands. It confirmed the hypothesis that the dorsal side of the hand is of greater importance than the palmar side when diagnosing CTS thermographically. Using this method it was possible correctly to classify 72.2% of all hands (healthy and pathological) based on dorsal images and > 80% of hands when only severely affected and healthy hands were considered. Compared with the gold standard electromyographic diagnosis of CTS, IRT cannot be recommended as an adequate diagnostic tool when exact severity level diagnosis is required, however we conclude that IRT could be used as a screening tool for severe cases in populations with high ergonomic risk factors of CTS.

  4. Fast method and ultra fast screening for determination of 90Sr in milk and dairy products

    International Nuclear Information System (INIS)

    Kabai, E.; Hornung, L.; Savkin, B.T.; Poppitz-Spuhler, A.; Hiersche, L.

    2011-01-01

    In emergency situation or in case of defence against nuclear hazards, the rapid analysis of radioisotopes in food products is essential. Radiostrontium is one of the most interesting isotopes in case of emergency. The determination of radiostrontium in milk and dairy products plays an important role especially for infants. The procedures described here were tested for fast determination of 90 Sr. The typical chemical recovery of the proposed fast procedure for determination of strontium from milk and dairy products was 90% and the time needed for analysis was one working day. The achieved detection limit for milk is 0.8 Bq/l. An ultra fast screening method allows the determination of radiostrontium with quantitative recovery within 1 hour. The minimum detectable activity in this case is 230 Bq/l.

  5. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  6. Noninvasive Assessment of Excessive Erythrocytosis as a Screening Method for Chronic Mountain Sickness at High Altitude.

    Science.gov (United States)

    Vyas, Kaetan J; Danz, David; Gilman, Robert H; Wise, Robert A; León-Velarde, Fabiola; Miranda, J Jaime; Checkley, William

    2015-06-01

    Vyas, Kaetan J., David Danz, Robert H. Gilman, Robert A. Wise, Fabiola León-Velarde, J. Jaime Miranda, and William Checkley. Noninvasive assessment of excessive erythrocytosis as a screening method for chronic mountain sickness at high altitude. High Alt Med Biol 16:162-168, 2015.--Globally, over 140 million people are at risk of developing chronic mountain sickness, a common maladaptation to life at high altitude (>2500 meters above sea level). The diagnosis is contingent upon the identification of excessive erythrocytosis (EE). Current best practices to identify EE require a venous blood draw, which is cumbersome for large-scale surveillance. We evaluated two point-of-care biomarkers to screen for EE: noninvasive spot-check tests of total hemoglobin and oxyhemoglobin saturation (Pronto-7, Masimo Corporation). We conducted paired evaluations of total serum hemoglobin from a venous blood draw and noninvasive, spot-check testing of total hemoglobin and oxyhemoglobin saturation with the Pronto-7 in 382 adults aged ≥35 years living in Puno, Peru (3825 meters above sea level). We used the Bland-Altman method to measure agreement between the noninvasive hemoglobin assessment and the gold standard lab hemoglobin analyzer. Mean age was 58.8 years and 47% were male. The Pronto-7 test was unsuccessful in 21 (5%) participants. Limits of agreement between total hemoglobin measured via venous blood draw and the noninvasive, spot-check test ranged from -2.8 g/dL (95% CI -3.0 to -2.5) to 2.5 g/dL (95% CI 2.2 to 2.7), with a bias of -0.2 g/dL (95% CI -0.3 to -0.02) for the difference between total hemoglobin and noninvasive hemoglobin concentrations. Overall, the noninvasive spot-check test of total hemoglobin had a better area under the receiver operating characteristic curve compared to oxyhemoglobin saturation for the identification of EE as measured by a gold standard laboratory hemoglobin analyzer (0.96 vs. 0.82; p<0.001). Best cut-off values to screen for EE with

  7. A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

    Science.gov (United States)

    Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

    2017-02-10

    Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (Pthalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the

  8. Towards understanding household-level forest reliance in Cambodia - study sites, methods, and preliminary findings

    DEFF Research Database (Denmark)

    Ra, Koy; Pichdara, Lonn; Dararath, Yem

    There is growing international interest in the role of forests in poverty prevention and reduction. In consequence, this broad area of investigation has been subject to increased research; one major international research project is that facilitated by the Poverty Environment Network (PEN). This ......). This project covers a large number of sites in 26 countries throughout the tropics. The present report contains contextual details, methodological information and preliminary findings for the PEN sites in Cambodia....

  9. Rapid, convenient method for screening imidazole-containing compounds for heme oxygenase inhibition.

    Science.gov (United States)

    Vlahakis, Jason Z; Rahman, Mona N; Roman, Gheorghe; Jia, Zongchao; Nakatsu, Kanji; Szarek, Walter A

    2011-01-01

    Sensitive assays for measuring heme oxygenase activity have been based on the gas-chromatographic detection of carbon monoxide using elaborate, expensive equipment. The present study describes a rapid and convenient method for screening imidazole-containing candidates for inhibitory activity against heme oxygenase using a plate reader, based on the spectroscopic evaluation of heme degradation. A PowerWave XS plate reader was used to monitor the absorbance (as a function of time) of heme bound to purified truncated human heme oxygenase-1 (hHO-1) in the individual wells of a standard 96-well plate (with or without the addition of a test compound). The degradation of heme by heme oxygenase-1 was initiated using l-ascorbic acid, and the collected relevant absorbance data were analyzed by three different methods to calculate the percent control activity occurring in wells containing test compounds relative to that occurring in control wells with no test compound present. In the cases of wells containing inhibitory compounds, significant shifts in λ(max) from 404 to near 412 nm were observed as well as a decrease in the rate of heme degradation relative to that of the control. Each of the three methods of data processing (overall percent drop in absorbance over 1.5h, initial rate of reaction determined over the first 5 min, and estimated pseudo first-order reaction rate constant determined over 1.5h) gave similar and reproducible results for percent control activity. The fastest and easiest method of data analysis was determined to be that using initial rates, involving data acquisition for only 5 min once reactions have been initiated using l-ascorbic acid. The results of the study demonstrate that this simple assay based on the spectroscopic detection of heme represents a rapid, convenient method to determine the relative inhibitory activity of candidate compounds, and is useful in quickly screening a series or library of compounds for heme oxygenase inhibition

  10. Development and exploitation of the slit method for the characterization of x-ray screen-film combinations

    International Nuclear Information System (INIS)

    Hoeschen, D.

    1987-01-01

    For the determination of the modulation transfer function (MTF) of screen-film combinations which are used in medical x-ray diagnostics a measuring method has been developed: the screen-film combination is exposed to x-rays behind a thin slit and the modulation transfer function is calculated from the resulting rather broad slit images on the film. After solving many technical and photographic problems, the slit method provides high precision in the MTF determination. The only objection against this method is the necessary high dose variation which has to be provided by the x-ray machine

  11. Screening possible solid electrolytes by calculating the conduction pathways using Bond Valence method

    Science.gov (United States)

    Gao, Jian; Chu, Geng; He, Meng; Zhang, Shu; Xiao, RuiJuan; Li, Hong; Chen, LiQuan

    2014-08-01

    Inorganic solid electrolytes have distinguished advantages in terms of safety and stability, and are promising to substitute for conventional organic liquid electrolytes. However, low ionic conductivity of typical candidates is the key problem. As connective diffusion path is the prerequisite for high performance, we screen for possible solid electrolytes from the 2004 International Centre for Diffraction Data (ICDD) database by calculating conduction pathways using Bond Valence (BV) method. There are 109846 inorganic crystals in the 2004 ICDD database, and 5295 of them contain lithium. Except for those with toxic, radioactive, rare, or variable valence elements, 1380 materials are candidates for solid electrolytes. The rationality of the BV method is approved by comparing the existing solid electrolytes' conduction pathways we had calculated with those from experiments or first principle calculations. The implication for doping and substitution, two important ways to improve the conductivity, is also discussed. Among them Li2CO3 is selected for a detailed comparison, and the pathway is reproduced well with that based on the density functional studies. To reveal the correlation between connectivity of pathways and conductivity, α/ γ-LiAlO2 and Li2CO3 are investigated by the impedance spectrum as an example, and many experimental and theoretical studies are in process to indicate the relationship between property and structure. The BV method can calculate one material within a few minutes, providing an efficient way to lock onto targets from abundant data, and to investigate the structure-property relationship systematically.

  12. Screening of alternative methods for the disposal of low-level radioactive wastes

    International Nuclear Information System (INIS)

    Macbeth, P.J.; Thamer, B.J.; Christensen, D.E.; Wehmann, G.

    1978-10-01

    A systematic method for categorizing these disposal alternatives which provides assurance that no viable alternatives are overlooked is reported. Alternatives are categorized by (1) the general media in which disposal occurs, (2) by whether the disposal method can be considered as dispersal, containment or elimination of the wastes, and (3) by the applicability of the disposal method to the possible physical waste forms. A literature survey was performed and pertinent references listed for the various alternatives discussed. A bibliography is given which provides coverage of published information on low-level radioactive waste management options. The extensive list of disposal alternatives identified was screened and the most viable choices were selected for further evaluation. A Technical Advisory Panel met and reviewed the results. Suggestions from that meeting and other comments are discussed. The most viable options selected for further evaluation are: (1) improving present shallow land burial practices; (2) deeper depth burial; (3) disposal in cavities; (4) disposal in exposed or buried structures; and (5) ocean disposal. 42 references

  13. Screening natural antioxidants in peanut shell using DPPH-HPLC-DAD-TOF/MS methods.

    Science.gov (United States)

    Qiu, Jiying; Chen, Leilei; Zhu, Qingjun; Wang, Daijie; Wang, Wenliang; Sun, Xin; Liu, Xiaoyong; Du, Fangling

    2012-12-15

    Peanut shell, a byproduct in oil production, is rich in natural antioxidants. Here, a rapid and efficient method using DPPH-HPLC-DAD-TOF/MS was used for the first time to screen antioxidants in peanut shell. The method is based on the hypothesis that upon reaction with 1, 1-diphenyl-2-picrylhydrazyl (DPPH), the peak areas of compounds with potential antioxidant activities in the HPLC chromatogram will be significantly reduced or disappeared, and the identity confirmation could be achieved by HPLC-DAD-TOF/MS technique. With this method, three compounds possessing potential antioxidant activities were found abundantly in the methanolic extract of peanut shell. They were identified as 5,7-dihydroxychromone, eriodictyol, and luteolin. The contents of these compounds were 0.59, 0.92, and 2.36 mg/g, respectively, and luteolin possessed the strongest radical scavenging capacity. DPPH-HPLC-DAD-TOF/MS assay facilitated rapid identification and determination of natural antioxidants in peanut shell, which may be helpful for value-added utilization of peanut processing byproducts. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. A human reliability assessment screening method for the NRU upgrade project

    International Nuclear Information System (INIS)

    Bremner, F.M.; Alsop, C.J.

    1997-01-01

    The National Research Universal (NRU) reactor is a 130MW, low pressure, heavy water cooled and moderated research reactor. The reactor is used for research, both in support of Canada's CANDU development program, and for a wide variety of other research applications. In addition, NRU plays an important part in the production of medical isotopes, e.g., generating 80% of worldwide supplies of Molybdenum-99. NRU is owned and operated by Atomic Energy of Canada Ltd. (AECL), and is currently undergoing upgrading as part of AECL's continuing commitment to operate their facilities in a safe manner. As part of these upgrades both deterministic and probabilistic safety assessments are being carried out. It was recognized that the assignment of Human Error Probabilities (HEPs) is an important part of the Probabilistic Safety Assessment (PSA) studies, particularly for a facility whose design predates modern ergonomic practices, and which will undergo a series of backfitted modifications whilst continuing to operate. A simple Human Reliability Assessment (HRA) screening method, looking at both pre- and post-accident errors, was used in the initial safety studies. However, following review of this method within AECL and externally by the regulator, it was judged that benefits could be gained for future error reduction by including additional features, as later described in this document. The HRA development project consisted of several stages; needs analysis, literature review, development of method (including testing and evaluation), and implementation. This paper discusses each of these stages in further detail. (author)

  15. Confidence from uncertainty - A multi-target drug screening method from robust control theory

    Directory of Open Access Journals (Sweden)

    Petzold Linda R

    2010-11-01

    Full Text Available Abstract Background Robustness is a recognized feature of biological systems that evolved as a defence to environmental variability. Complex diseases such as diabetes, cancer, bacterial and viral infections, exploit the same mechanisms that allow for robust behaviour in healthy conditions to ensure their own continuance. Single drug therapies, while generally potent regulators of their specific protein/gene targets, often fail to counter the robustness of the disease in question. Multi-drug therapies offer a powerful means to restore disrupted biological networks, by targeting the subsystem of interest while preventing the diseased network from reconciling through available, redundant mechanisms. Modelling techniques are needed to manage the high number of combinatorial possibilities arising in multi-drug therapeutic design, and identify synergistic targets that are robust to system uncertainty. Results We present the application of a method from robust control theory, Structured Singular Value or μ- analysis, to identify highly effective multi-drug therapies by using robustness in the face of uncertainty as a new means of target discrimination. We illustrate the method by means of a case study of a negative feedback network motif subject to parametric uncertainty. Conclusions The paper contributes to the development of effective methods for drug screening in the context of network modelling affected by parametric uncertainty. The results have wide applicability for the analysis of different sources of uncertainty like noise experienced in the data, neglected dynamics, or intrinsic biological variability.

  16. Methods for transforming and expression screening of filamentous fungal cells with a DNA library

    Science.gov (United States)

    Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

    2015-06-02

    The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

  17. Screening method for the detection of a range of nitrofurans in avian eyes by optical biosensor

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Colin S., E-mail: colin.thompson@afbini.gov.uk [Agri-Food and Biosciences Institute, Veterinary Sciences Division, Stormont, Belfast BT4 3SD, Northern Ireland (United Kingdom); Traynor, Imelda M.; Fodey, Terence L.; Crooks, Steven R.H.; Kennedy, D. Glenn [Agri-Food and Biosciences Institute, Veterinary Sciences Division, Stormont, Belfast BT4 3SD, Northern Ireland (United Kingdom)

    2011-08-26

    An immunobiosensor assay was developed for the multi-residue screening of a range of nitrofuran compounds in avian eyes. A polyclonal antibody which binds at least 5 of the major parent nitrofurans was raised in a rabbit after inoculation with a nitrofuran mimic-protein conjugate. Sample homogenates were extracted into 0.1 M hydrochloric acid and subjected to clean-up by solid phase extraction and micro-centrifugation prior to biosensor analysis. Validation data obtained from the analysis of 21 fortified samples has shown that the method has a detection capability (CC{beta}) of less than 1 ng eye{sup -1} for nitrofurazone (NFZ). In addition, cross-reactivity data and the analysis of a smaller number of fortified samples have shown that the method will also detect a range of other major parent nitrofurans including furazolidone (FZD), furaltadone (FTD), nitrofurantoin (NFA) and nifursol (NFS). Intra-assay variation (n = 10) was calculated at 12.9% and 10.1% at concentrations of 1 ng eye{sup -1} and 2 ng eye{sup -1} NFZ respectively. Inter-assay variation (n = 3) was determined to be 10.8% and 4.7% at the same NFZ concentrations respectively. The cross-reactivity profile and validation data for the detection of these nitrofurans are presented together with the results obtained following the analysis of a small number of incurred samples using the developed method.

  18. From CBCL to DSM: A Comparison of Two Methods to Screen for DSM-IV Diagnoses Using CBCL Data

    Science.gov (United States)

    Krol, Nicole P. C. M.; De Bruyn, Eric E. J.; Coolen, Jolanda C.; van Aarle, Edward J. M.

    2006-01-01

    The screening efficiency of 2 methods to convert Child Behavior Checklist (CBCL) assessment data into Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]; American Psychiatric Association, 1994) diagnoses was compared. The Machine-Aided Diagnosis (MAD) method converts CBCL input data directly into DSM-IV symptom criteria. The…

  19. From CBCL to DSM: A Comparison of Two Methods to Screen for DSM–IV Diagnoses Using CBCL Data

    NARCIS (Netherlands)

    Krol, N.P.C.M.; Bruyn, E.E.J. De; Coolen, J.C.; Aarle, E.J.M. van

    2006-01-01

    The screening efficiency of 2 methods to convert Child Behavior Checklist (CBCL) assessment data into Diagnostic and Statistical Manual of Mental Disorders (4th ed. [DSM-IV]; American Psychiatric Association, 1994) diagnoses was compared. The Machine-Aided Diagnosis (MAD) method converts CBCL input

  20. Screening for Microalbuminuria in the early detection of diabetic nephropathy: A cheap and simple method

    Directory of Open Access Journals (Sweden)

    "Larijani B

    2002-06-01

    Full Text Available Prompt detection of renal involvement through evaluation of microalbuminuria can both reduce mortality in diabetic patients and significantly reduce the cost of managing these patients. To this end, Micral test strips have been used as a screeing tool in this group of patients though not yet in our country. The present study aimed to evaluate this test and to abtain a simpler and less expensive method of screening for microlbuminuria. In this study, 200 type 1 and type 2 diabetic patients referred to the Endocrine & Metabolims Research Center of the Tehran university of medical Sciences were evaluated for microabluminuria. Entry criteria consisted of a history of recognized diabetes longer than or equal to 5 years. Exclusion criteria included development of urinary tract infection, pyrexia, and a history of uncontrolled hypertension. Every patient first completed a data questionnaire and then provided a first-void urine sample, which was tested for microalbuminuria with a urinary protein test strip (an Iranian-made Uri-Yab and a German-made BM-test-GP strip and the sulphasalicylic acid chemical method. Negative samples were tested further using Micral test strips (based on gold-lable immunochromatograpy and the microalbumin measurement kit manufactured by Dako. Germany (based on turbidometry using a Hitachi autoanalyser. 126 women and 74 men were recruited into the study. The average age of the sample was 40.7 years (range=16 to 63 years; 17 patients had IDDM and 173, NIDDM. Average duration of recognized diabetes was 8.75 years. Based on results obtained using chemical analysis and foreign-made tests strips, 46 patients (23% had macroalbuminuria, though the detection rate using Iranian-made test strips was 18 percent (36 patients. A further 16.2 percent of patients had microalbuminuria, with an average urinary albumin excertion of 28.7 mg per liter. Compared with colorimetric methos, the Micral test yieled a sensitivity of 93% and a specificity

  1. Instrument to screen cases of pervasive developmental disorder: a preliminary indication of validity Instrumento para rastreamento dos casos de transtorno invasivo do desenvolvimento: estudo preliminar de validação

    Directory of Open Access Journals (Sweden)

    Fábio Pinato Sato

    2009-03-01

    Full Text Available OBJECTIVE: To translate into Portuguese, back-translate, culturally adapt and validate a screening instrument for pervasive developmental disorder, the Autism Screening Questionnaire, for use in Brazil. METHOD: A sample of 120 patients was selected based on three groups of 40: patients with a clinical diagnosis of pervasive developmental disorder, Down syndrome, or other psychiatric disorders. The self-administered questionnaire was applied to the patients' legal guardians. Psychometric measures of the final version of the translated questionnaire were tested. RESULTS: The score of 15 had sensitivity of 92.5% and specificity of 95.5% as a cut-off point for the diagnosis of pervasive developmental disorder. Internal validity for a total of 40 questions was 0.895 for alpha and 0.896 for KR-20, ranging from 0.6 to 0.8 for both coefficients. Test and retest reliability values showed strong agreement for most questions. CONCLUSIONS: The final version of this instrument, translated into Portuguese and adapted to the Brazilian culture, had satisfactory measurement properties, suggesting preliminary validation proprieties. It was an easy-to-apply, useful tool for the diagnostic screening of individuals with pervasive developmental disorder.OBJETIVO: Tradução, retro-versão, adaptação cultural e validação do Autism Screening Questionnaire para a língua portuguesa e para o seu uso no Brasil. MÉTODO: Foi selecionada uma amostra inicial de 120 pacientes, encaminhados de duas clínicas privadas e uma pública, divida em três grupos de 40 pacientes distintos: pacientes com diagnóstico clínico de transtornos globais do desenvolvimento ou transtornos invasivos do desenvolvimento; de síndrome de Down e de outros transtornos psiquiátricos. O questionário foi aplicado aos responsáveis legais dos pacientes seguindo os padrões de um questionário auto-aplicável. As medidas psicométricas do questionário traduzido, na sua versão final, foram

  2. Women with learning disabilities and access to cervical screening: retrospective cohort study using case control methods

    OpenAIRE

    Reynolds, Fiona; Stanistreet, Debbi; Elton, Peter

    2008-01-01

    Abstract Background Several studies in the UK have suggested that women with learning disabilities may be less likely to receive cervical screening tests and a previous local study in had found that GPs considered screening unnecessary for women with learning disabilities. This study set out to ascertain whether women with learning disabilities are more likely to be ceased from a cervical screening programme than women without; and to examine the reasons given for ceasing women with learning ...

  3. How to benchmark methods for structure-based virtual screening of large compound libraries.

    Science.gov (United States)

    Christofferson, Andrew J; Huang, Niu

    2012-01-01

    Structure-based virtual screening is a useful computational technique for ligand discovery. To systematically evaluate different docking approaches, it is important to have a consistent benchmarking protocol that is both relevant and unbiased. Here, we describe the designing of a benchmarking data set for docking screen assessment, a standard docking screening process, and the analysis and presentation of the enrichment of annotated ligands among a background decoy database.

  4. Assessment of Sediment Heavy Metals Pollution Using Screening Methods (XRF, TGA/MS, XRPD and Earthworms Bioassay)

    Science.gov (United States)

    Findoráková, Lenka; Šestinová, Ol'ga; Hančul'ák, Jozef; Fedorová, Erika; Zorkovská, Anna

    2016-10-01

    The aim of this study is focused on the use of screening methods (TG/DTA coupled with MS, XRF, AAS, XRPD and earthworm bioassay) for sediments pollution assessing by heavy metals (Cu, Zn, Pb, Hg) coming from the former mining workloads in the central Spis, Eastern Slovakia. The screening methods (XRF, AAS) indicated pollution of studied sediments by Cu, Zn, Pb, Hg. The earthworms Dendrobaena veneta caused in some studied samples decrease of heavy metals concentration after their 7 days’ exposure in sediments. The other screening methods such as thermal analysis and XRPD analysis, does not confirm the specifically changes in physicochemical properties comparing the properties before and after 7 days’ earthworm's exposure.

  5. Developing the clinical components of a complex intervention for a glaucoma screening trial: a mixed methods study

    Directory of Open Access Journals (Sweden)

    2011-04-01

    Full Text Available Abstract Background Glaucoma is a leading cause of avoidable blindness worldwide. Open angle glaucoma is the most common type of glaucoma. No randomised controlled trials have been conducted evaluating the effectiveness of glaucoma screening for reducing sight loss. It is unclear what the most appropriate intervention to be evaluated in any glaucoma screening trial would be. The purpose of this study was to develop the clinical components of an intervention for evaluation in a glaucoma (open angle screening trial that would be feasible and acceptable in a UK eye-care service. Methods A mixed-methods study, based on the Medical Research Council (MRC framework for complex interventions, integrating qualitative (semi-structured interviews with 46 UK eye-care providers, policy makers and health service commissioners, and quantitative (economic modelling methods. Interview data were synthesised and used to revise the screening interventions compared within an existing economic model. Results The qualitative data indicated broad based support for a glaucoma screening trial to take place in primary care, using ophthalmic trained technical assistants supported by optometry input. The precise location should be tailored to local circumstances. There was variability in opinion around the choice of screening test and target population. Integrating the interview findings with cost-effectiveness criteria reduced 189 potential components to a two test intervention including either optic nerve photography or screening mode perimetry (a measure of visual field sensitivity with or without tonometry (a measure of intraocular pressure. It would be more cost-effective, and thus acceptable in a policy context, to target screening for open angle glaucoma to those at highest risk but for both practicality and equity arguments the optimal strategy was screening a general population cohort beginning at age forty. Conclusions Interventions for screening for open angle

  6. A screening method for the optimal selection of plate heat exchanger configurations

    Directory of Open Access Journals (Sweden)

    Pinto J.M.

    2002-01-01

    Full Text Available An optimization method for determining the best configuration(s of gasketed plate heat exchangers is presented. The objective is to select the configuration(s with the minimum heat transfer area that still satisfies constraints on the number of channels, the pressure drop of both fluids, the channel flow velocities and the exchanger thermal effectiveness. The configuration of the exchanger is defined by six parameters, which are as follows: the number of channels, the numbers of passes on each side, the fluid locations, the feed positions and the type of flow in the channels. The resulting configuration optimization problem is formulated as the minimization of the exchanger heat transfer area and a screening procedure is proposed for its solution. In this procedure, subsets of constraints are successively applied to eliminate infeasible and nonoptimal solutions. Examples show that the optimization method is able to successfully determine a set of optimal configurations with a minimum number of exchanger evaluations. Approximately 5 % of the pressure drop and channel velocity calculations and 1 % of the thermal simulations are required for the solution.

  7. Comparison of transvagianl ultrasonography with hysterosonography as a screening method in patients with abnormal uterine bleeding

    International Nuclear Information System (INIS)

    Ryu, Jeong Ah; Kim, Bo Hyun; Lee, Jong Mee; Kim, Soo Ah; Lee, Sang Hoon

    2004-01-01

    To assess the utility of hysterosonography (HS) as a screening method in patients with abnormal uterine bleeding. We retrospectively reviewed transvaginal ultrasonography (TVS) and HS for 105 patients whose diagnosis was confirmed pathologically. All 105 patients were initially evaluated on the same day with both TVS and HS. On TVS and HS examination. endometrial cavitary lesions were classified as diffuse hyperplasis, endometrial polyp, endometrial cancer, uterine synechia and submucosal leiomyoma. Hysteroscopy with biopsy (n=35), curettage (n=60) or hysterectomy (n=10) was performed, and the results of TVS and HS examination were correlated with the pathological findings. The sensitivity and specificity were 79.0% and 45.8% for TVS, and 95.1% and 83.3% for HS, respectively. The positive and negative predictive values were 83.0% and 39.3% for TVS, and 95.1% and 83.3% for HS, respectively. Twenty-seven showed a discrepancy between the TVS and HS, and eight cases showed a discrepancy between HS and the pathologic diagnosis. TVS is a sensitive method to evaluate the endometrial cavitary lesions, but it often does not provide the physician with sufficient diagnostic information. With its higher sensitivities, specificities and positive and negative predictive values, HS can be better used than TVS in evaluating those patients with abnormal uterine bleeding

  8. Comparison of transvagianl ultrasonography with hysterosonography as a screening method in patients with abnormal uterine bleeding

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jeong Ah; Kim, Bo Hyun; Lee, Jong Mee; Kim, Soo Ah [Sungkyunkwan University, Seoul (Korea, Republic of); Lee, Sang Hoon [University of Ulsan College of Medicine, Seoul (Korea, Republic of)

    2004-03-15

    To assess the utility of hysterosonography (HS) as a screening method in patients with abnormal uterine bleeding. We retrospectively reviewed transvaginal ultrasonography (TVS) and HS for 105 patients whose diagnosis was confirmed pathologically. All 105 patients were initially evaluated on the same day with both TVS and HS. On TVS and HS examination. endometrial cavitary lesions were classified as diffuse hyperplasis, endometrial polyp, endometrial cancer, uterine synechia and submucosal leiomyoma. Hysteroscopy with biopsy (n=35), curettage (n=60) or hysterectomy (n=10) was performed, and the results of TVS and HS examination were correlated with the pathological findings. The sensitivity and specificity were 79.0% and 45.8% for TVS, and 95.1% and 83.3% for HS, respectively. The positive and negative predictive values were 83.0% and 39.3% for TVS, and 95.1% and 83.3% for HS, respectively. Twenty-seven showed a discrepancy between the TVS and HS, and eight cases showed a discrepancy between HS and the pathologic diagnosis. TVS is a sensitive method to evaluate the endometrial cavitary lesions, but it often does not provide the physician with sufficient diagnostic information. With its higher sensitivities, specificities and positive and negative predictive values, HS can be better used than TVS in evaluating those patients with abnormal uterine bleeding.

  9. A rapid sample screening method for authenticity control of whiskey using capillary electrophoresis with online preconcentration.

    Science.gov (United States)

    Heller, Melina; Vitali, Luciano; Oliveira, Marcone Augusto Leal; Costa, Ana Carolina O; Micke, Gustavo Amadeu

    2011-07-13

    The present study aimed to develop a methodology using capillary electrophoresis for the determination of sinapaldehyde, syringaldehyde, coniferaldehyde, and vanillin in whiskey samples. The main objective was to obtain a screening method to differentiate authentic samples from seized samples suspected of being false using the phenolic aldehydes as chemical markers. The optimized background electrolyte was composed of 20 mmol L(-1) sodium tetraborate with 10% MeOH at pH 9.3. The study examined two kinds of sample stacking, using a long-end injection mode: normal sample stacking (NSM) and sample stacking with matrix removal (SWMR). In SWMR, the optimized injection time of the samples was 42 s (SWMR42); at this time, no matrix effects were observed. Values of r were >0.99 for the both methods. The LOD and LOQ were better than 100 and 330 mg mL(-1) for NSM and better than 22 and 73 mg L(-1) for SWMR. The CE-UV reliability in the aldehyde analysis in the real sample was compared statistically with LC-MS/MS methodology, and no significant differences were found, with a 95% confidence interval between the methodologies.

  10. Spatial screening methods for evaluating environmental contaminant hazards and exposure vulnerability

    Science.gov (United States)

    Jones, D. K.

    2016-12-01

    Human and biotic communities are becoming increasingly vulnerable to sea-level rise and severe storms due to climate change. These events enhance the dispersion and concentration of natural and anthropogenic chemicals and pathogenic microorganisms, which could adversely impact the health and resilience of coastal communities and ecosystems in coming years. The U.S. Geological Survey (USGS) has developed spatial screening methods to identify and map contaminant sources and potential exposure pathways for human and ecological receptors. These methods have been applied within the northeastern U.S. to document contaminants of emerging concern, highlight vulnerable communities, and prioritize locations for future sampling campaigns. Integration of this information provides a means to better assess the baseline status of a complex system and the significance of changes in contaminant hazards due to storm-induced (episodic) and sea-level rise (incremental) disturbances. This presentation will provide an overview of a decision support tool developed by the USGS to document contaminants in the environment relative to key receptor populations and historic storm vulnerabilities. The support tool is designed to accommodate a broad array of geologic, land-use, and climatic variables and utilizes public, nationally available data sources to define contaminant sources and storm vulnerabilities. By employing a flexible and adaptable strategy built upon publicly available data, the method can readily be applied to other site selection or landscape evaluation efforts. Examples will be presented including the Sediment-bound Contaminant Resiliency and Response pilot study (see http://toxics.usgs.gov/scorr/), and investigations of endocrine disruption in the Chesapeake Bay. Key limitations and future applications will be discussed in addition to ongoing method developments to accommodate non-coastal disaster scenarios and more refined contaminant definitions.

  11. Complex polarimetric and spectral techniques in diagnostics of blood plasma of patients with ovarian cancer as a preliminary stage molecular genetic screening

    Science.gov (United States)

    Grzegorzewski, B.; Peresunko, O. P.; Yermolenko, S. B.

    2018-01-01

    This work is devoted to the substantiation and selection of patients with ovarian cancer (OC) for the purpose of conducting expensive molecular genetic studies on genotyping. As diagnostic methods have been used ultraviolet spectrometry samples of blood plasma in the liquid state, infrared spectroscopy middle range (2,5 - 25 microns) dry residue of plasma polarization and laser diagnostic technique of thin histological sections of biological tissues. Obtained results showed that the use of spectrophotometry in the range of 1000-3000 cm-1 allowed to establish quantitative parameters of the plasma absorption rate of blood of patients in the third group in different ranges, which would allow in the future to conduct an express analysis of the patient's condition (procedure screening) for further molecular-genetic typing on BRCA I and II.

  12. School-Based BMI and Body Composition Screening and Parent Notification in California: Methods and Messages

    Science.gov (United States)

    Madsen, Kristine A.; Linchey, Jennifer

    2012-01-01

    Background: School-based body mass index (BMI) or body composition screening is increasing, but little is known about the process of parent notification. Since 2001, California has required annual screening of body composition via the FITNESSGRAM, with optional notification. This study sought to identify the prevalence of parental notification…

  13. Preliminary Axial Flow Turbine Design and Off-Design Performance Analysis Methods for Rotary Wing Aircraft Engines. Part 1; Validation

    Science.gov (United States)

    Chen, Shu-cheng, S.

    2009-01-01

    For the preliminary design and the off-design performance analysis of axial flow turbines, a pair of intermediate level-of-fidelity computer codes, TD2-2 (design; reference 1) and AXOD (off-design; reference 2), are being evaluated for use in turbine design and performance prediction of the modern high performance aircraft engines. TD2-2 employs a streamline curvature method for design, while AXOD approaches the flow analysis with an equal radius-height domain decomposition strategy. Both methods resolve only the flows in the annulus region while modeling the impact introduced by the blade rows. The mathematical formulations and derivations involved in both methods are documented in references 3, 4 for TD2-2) and in reference 5 (for AXOD). The focus of this paper is to discuss the fundamental issues of applicability and compatibility of the two codes as a pair of companion pieces, to perform preliminary design and off-design analysis for modern aircraft engine turbines. Two validation cases for the design and the off-design prediction using TD2-2 and AXOD conducted on two existing high efficiency turbines, developed and tested in the NASA/GE Energy Efficient Engine (GE-E3) Program, the High Pressure Turbine (HPT; two stages, air cooled) and the Low Pressure Turbine (LPT; five stages, un-cooled), are provided in support of the analysis and discussion presented in this paper.

  14. Current and emerging screening methods to identify post-head-emergence frost adaptation in wheat and barley.

    Science.gov (United States)

    Frederiks, T M; Christopher, J T; Harvey, G L; Sutherland, M W; Borrell, A K

    2012-09-01

    Cereal crops can suffer substantial damage if frosts occur at heading. Identification of post-head-emergence frost (PHEF) resistance in cereals poses a number of unique and difficult challenges. Many decades of research have failed to identify genotypes with PHEF resistance that could offer economically significant benefit to growers. Research and breeding gains have been limited by the available screening systems. Using traditional frost screening systems, genotypes that escape frost injury in trials due to spatial temperature differences and/or small differences in phenology can be misidentified as resistant. We believe that by improving techniques to minimize frost escapes, such 'false-positive' results can be confidently identified and eliminated. Artificial freezing chambers or manipulated natural frost treatments offer many potential advantages but are not yet at the stage where they can be reliably used for frost screening in breeding programmes. Here we describe the development of a novel photoperiod gradient method (PGM) that facilitates screening of genotypes of different phenology under natural field frosts at matched developmental stages. By identifying frost escapes and increasing the efficiency of field screening, the PGM ensures that research effort can be focused on finding genotypes with improved PHEF resistance. To maximize the likelihood of identifying PHEF resistance, we propose that the PGM form part of an integrated strategy to (i) source germplasm;(ii) facilitate high throughput screening; and (iii) permit detailed validation. PGM may also be useful in other studies where either a range of developmental stages and/or synchronized development are desired.

  15. The Importance of Context in Screening in Occupational Health Interventions in Organizations: A Mixed Methods Study

    Directory of Open Access Journals (Sweden)

    Michela Vignoli

    2017-08-01

    Full Text Available In occupational health interventions, there is a debate as to whether standardized or tailored measures should be used to identify which aspects of the psychosocial work environment should be targeted in order to improve employees’ well-being. Using the Job Demands-Resources model, the main aim of the present study is to demonstrate how a mixed methods approach to conducting screening enables the identification of potential context-dependent demands and resources in the workplace, which should to be targeted by the intervention. Specifically, we used a mixed methods exploratory sequential research design. First, we conducted four focus groups (N = 37 in a sample of employees working in grocery stores in Italy. The qualitative results allowed to identify one possible context-specific job demand: the use of a work scheduling IT software, whose implementation resulted in a high rotation between different market’s departments. From the qualitative results, this context-specific demand seemed to be related to workers’ well-being. Thus, in a subsequent questionnaire survey (N = 288, we included this demand together with generic measures of social support and psychological well-being. Results confirmed that this context-specific job demand was related to emotional exhaustion. Furthermore, it was found that social support moderated the relationship between this specific job demand and emotional exhaustion showing among employees whose activities depended on the IT software, employees that perceived higher levels of social support from colleagues experienced lower levels of emotional exhaustion with respect to their colleagues who perceived lower levels of social support. The present study confirms that mixed methods approach is useful in occupational health intervention research and offers a way forward on helping organizations prioritize their intervention activities.

  16. Systematic hybrid LOH: a new method to reduce false positives and negatives during screening of yeast gene deletion libraries

    DEFF Research Database (Denmark)

    Alvaro, D.; Sunjevaric, I.; Reid, R. J.

    2006-01-01

    We have developed a new method, systematic hybrid loss of heterozygosity, to facilitate genomic screens utilizing the yeast gene deletion library. Screening is performed using hybrid diploid strains produced through mating the library haploids with strains from a different genetic background......, to minimize the contribution of unpredicted recessive genetic factors present in the individual library strains. We utilize a set of strains where each contains a conditional centromere construct on one of the 16 yeast chromosomes that allows the destabilization and selectable loss of that chromosome. After...... complementation of any spurious recessive mutations in the library strain, facilitating attribution of the observed phenotype to the documented gene deletion and dramatically reducing false positive results commonly obtained in library screens. The systematic hybrid LOH method can be applied to virtually any...

  17. Temperature-controlled micro-TLC: a versatile green chemistry and fast analytical tool for separation and preliminary screening of steroids fraction from biological and environmental samples.

    Science.gov (United States)

    Zarzycki, Paweł K; Slączka, Magdalena M; Zarzycka, Magdalena B; Bartoszuk, Małgorzata A; Włodarczyk, Elżbieta; Baran, Michał J

    2011-11-01

    This paper is a continuation of our previous research focusing on development of micro-TLC methodology under temperature-controlled conditions. The main goal of present paper is to demonstrate separation and detection capability of micro-TLC technique involving simple analytical protocols without multi-steps sample pre-purification. One of the advantages of planar chromatography over its column counterpart is that each TLC run can be performed using non-previously used stationary phase. Therefore, it is possible to fractionate or separate complex samples characterized by heavy biological matrix loading. In present studies components of interest, mainly steroids, were isolated from biological samples like fish bile using single pre-treatment steps involving direct organic liquid extraction and/or deproteinization by freeze-drying method. Low-molecular mass compounds with polarity ranging from estetrol to progesterone derived from the environmental samples (lake water, untreated and treated sewage waters) were concentrated using optimized solid-phase extraction (SPE). Specific bands patterns for samples derived from surface water of the Middle Pomerania in northern part of Poland can be easily observed on obtained micro-TLC chromatograms. This approach can be useful as simple and non-expensive complementary method for fast control and screening of treated sewage water discharged by the municipal wastewater treatment plants. Moreover, our experimental results show the potential of micro-TLC as an efficient tool for retention measurements of a wide range of steroids under reversed-phase (RP) chromatographic conditions. These data can be used for further optimalization of SPE or HPLC systems working under RP conditions. Furthermore, we also demonstrated that micro-TLC based analytical approach can be applied as an effective method for the internal standard (IS) substance search. Generally, described methodology can be applied for fast fractionation or screening of the

  18. Is preimplantation genetic diagnosis the ideal embryo selection method in aneuploidy screening?

    Directory of Open Access Journals (Sweden)

    Levent Sahin

    2014-10-01

    Full Text Available To select cytogenetically normal embryos, preimplantation genetic diagnosis (PGD aneuploidy screening (AS is used in numerous centers around the world. Chromosomal abnormalities lead to developmental problems, implantation failure, and early abortion of embryos. The usefulness of PGD in identifying single-gene diseases, human leukocyte antigen typing, X-linked diseases, and specific genetic diseases is well-known. In this review, preimplantation embryo genetics, PGD research studies, and the European Society of Human Reproduction and Embryology PGD Consortium studies and reports are examined. In addition, criteria for embryo selection, technical aspects of PGD-AS, and potential noninvasive embryo selection methods are described. Indications for PGD and possible causes of discordant PGD results between the centers are discussed. The limitations of fluorescence in situ hybridization, and the advantages of the array comparative genomic hybridization are included in this review. Although PGD-AS for patients of advanced maternal age has been shown to improve in vitro fertilization outcomes in some studies, to our knowledge, there is not sufficient evidence to use advanced maternal age as the sole indication for PGD-AS. PGD-AS might be harmful and may not increase the success rates of in vitro fertilization. At the same time PGD, is not recommended for recurrent implantation failure and unexplained recurrent pregnancy loss.

  19. Photoionization study of the F2+ ion via the screening constant by unit nuclear charge method

    Science.gov (United States)

    Dieng, M.; Tine, M.; Sow, M.; Diop, B.; Guèye, M.; Faye, M.; Sakho, I.; Biaye, M.; Wagué, A.

    2014-03-01

    In this paper, we have tabulated energy resonances of the 2s22p2 (1D)nd (2L), 2s22p2 (1S)nd (2L) and 2s22p3 (3D)np Rydberg series originating from the 2s22p3(2Po) and from the 2s22p3 (2Do) metastable states of F2+. In addition, energy resonances of the 2s2p3(5So)np (4P) Rydberg series originating from the 2s22p3 (4So) ground-state of F2+are also reported. Calculations are performed using the Screening constant by unit nuclear charge (SCUNC) method. Analysis of the present data is achieved by calculating the quantum defects and the effective nuclear charges for each series. The present results agree very well with the Advanced Light Source experiments on F2+ (Aguilar et al., 2005). Upto n=30, the present quantum defects are almost constant and the effective charge decreases regularly toward the electric charge of the F3+ core ion along each series.

  20. Optimization of Biochemical Screening Methods for Volatile and Unstable Sesquiterpenoids Using HS-SPME-GC-MS

    Directory of Open Access Journals (Sweden)

    Trine Bundgaard Andersen

    2015-06-01

    Full Text Available HS-SPME-GC-MS has been suggested as a fast and robust analytical platform for the product characterization of sesquiterpene synthases. The choice of fiber and injection temperature can have a significant effect on the observed product profile, due to the chemical rearrangements that can occur on the fiber material. Here we present a systematic study on the effects of fiber choice and injection port temperature on the observed sesquiterpenoid profile of four sesquiterpene synthases expressed in Nicotiana benthamiana. We found that the absorbent material PDMS was much less likely to support acid-induced rearrangement of sesquiterpenoids when compared to the adsorbent materials PDMS/DVB, PDMS/CAR, and PDMS/CAR/DVB. Furthermore, utilizing an injection port temperature at 160 °C almost eliminated the inherent thermal instability of germacrene sesquiterpenoids. Thus, for fast screening of sesquiterpene synthases, the results suggest that PDMS fibers and an injection temperature of 160 °C provide a fast and reproducible HS-SPME GC-MS method when using H2 as carrier gas.

  1. IN SEARCH OF A FAST SCREENING METHOD FOR DETECTING THE MALINGERING OF COGNITIVE IMPAIRMENT

    Directory of Open Access Journals (Sweden)

    Amada Ampudia

    2012-07-01

    Full Text Available Forensic settings demand expedient and conclusive forensic psychological assessment. The aim of this study was to design a simple and fast, but reliable psychometric instrument for detecting the malingering of cognitive impairment. In a quasi-experimental design, 156 individuals were divided into three groups: a normal group with no cognitive impairment; a Mild Cognitive Impairment (MCI group; and a group of informed malingerers with no MCI who feigned cognitive impairment. Receiver Operating Curve (ROC analysis of the Test of Memory Malingering (TOMM, and of several subtests of the Wechsler Memory Scale (WMS-III revealed that the WMS-III was as reliable and accurate as the TOMM in discriminating malingerers from the honest. The results revealed that the diagnostic accuracy, sensitivity and specificity of the WMS-III Auditory Recognition Delayed of Verbal Paired Associates subtest was similar to the TOMM in discriminating malingering from genuine memory impairment. In conclusion, the WMS-III Recognition of Verbal Paired Associates subtest and the TOMM provide a fast, valid and reliable screening method for detecting the malingering of cognitive impairment.

  2. Development of RNAi method for screening candidate genes to control emerald ash borer, Agrilus planipennis.

    Science.gov (United States)

    Rodrigues, Thais B; Rieske, Lynne K; J Duan, Jian; Mogilicherla, Kanakachari; Palli, Subba R

    2017-08-07

    The ingestion of double-strand RNAs (dsRNA) targeting essential genes in an insect could cause mortality. Based on this principle, a new generation of insect control methods using RNA interference (RNAi) are being developed. In this work, we developed a bioassay for oral delivery of dsRNA to an invasive forest and urban tree pest, the emerald ash borer (EAB, Agrilus planipennis). EAB feeds and develops beneath the bark, killing trees rapidly. This behavior, coupled with the lack of a reliable artificial diet for rearing larvae and adults, make them difficult to study. We found that dsRNA is transported and processed to siRNAs by EAB larvae within 72 h after ingestion. Also, feeding neonate larvae with IAP (inhibitor of apoptosis) or COP (COPI coatomer, β subunit) dsRNA silenced their target genes and caused mortality. Both an increase in the concentration of dsRNA fed and sequential feeding of two different dsRNAs increased mortality. Here we provide evidence for successful RNAi in EAB, and demonstrate the development of a rapid and effective bioassay for oral delivery of dsRNA to screen additional genes.

  3. Screening method for detection of immediate amino acid decarboxylases--producing bacteria implicated in food poisoning.

    Science.gov (United States)

    Hussain, Husniza; Mohd Fuat, A R; Vimala, B; Ghazali, H M

    2011-08-01

    Assessment of amino acid decarboxylase activity can be conducted using tubed broth or plated agar. In this study, the test was carried out in microtitre plates containing lysine, ornithine, arginine, tyrosine, tryptophan, phenylalanine or histidine as biogenic amine precursors. Møller decarboxylase base broth (MDB) with or without 1% of a known amino acid were added to wells of a 96 well-microtitre plate. The wells were inoculated with Escherichia coli, Klebsiella pneumoniae, Acinetobacter anitratus or Staphylococcus aureus to the final concentration of 6.0 x 10(7) cfu/ml and incubated at 35ºC. The absorbance of the culture broth was read at 570 nm at 0, 1.0, 2.0, 3.0, 4.0, 5.5, 6.5 and 7.5 hour. Comparison of means of A'(570) between 0 hour and a specified incubation time was determined statistically. Positive decarboxylase activities were detected in the media inoculated with E. coli and K. pneumoniae in less than 6 hours. The current method is suitable for immediate producers of amino acid decarboxylase enzymes. It costs less as it uses less amino acid and it has the potential to be used for screening aliquots of food materials for amino acid decarboxylase activities.

  4. Polarimetry at 1.3 mm using MILLIPOL - methods and preliminary results for Orion

    International Nuclear Information System (INIS)

    Barvainis, R.; Clemens, D.P.; Leach, R.

    1988-01-01

    This paper describes a polarimeter for use at wavelengths near 1 mm, designed to be self-contained and portable. Only minor modifications should be required to adapt this instrument for use on any of several millimeter and submillimeter telescopes. The polarimeter system and data-taking techniques are described, and a preliminary measurement is reported of the polarized dust emission from the Orion KL region at 1.3 mm using the NRAO 12 m telescope. The results are similar to previous polarization measurements of Orion at far-infrared and submillimeter wavelengths. The magnetic field direction implied by the polarization position angle is parallel to that found in the surrounding Orion region using optical and near- to midinfrared polarimetric techniques. 17 references

  5. In vitro preliminary cytotoxicity testing of vegetal extracts, using colorimetric methods

    Directory of Open Access Journals (Sweden)

    Claudia Patricia Cordero Camacho

    2002-01-01

    Full Text Available To advance in the study of the Colombian vegetal biodiversity, considered as a potential source of pharmacologically active products, the establishment of biological activity evaluation systems is necessary, which allow the detection of active products against pathologies with high social and economical impact, such as cancer. This work describes the implementation of a preliminary in vitro methodology for the determination of potential anticancer activity in vegetal extracts, by cytotoxicity testing upon human tumor cell lines, measuring the cellular mass indirectly with the colorimetric assays of MTT (methyl tetrazolium tiazole reduction and SRB (sulforhodamine Bstaining. HT-29, MCF-7, SiHa and HEp-2 cell lines cultures were adapted, MTT concentration, cellular density and treatment period parameters for the cytotoxicity assay were selected. Cell lines sensitivity to the chemotherapeutic agent Doxorubicin HCl was determined. Colombian vegetal species extracts cytotoxicity was tested and usefulness of the assay as a tool to bioguide the search of active products was evidenced.

  6. In vitro preliminary cytotoxicity testing of vegetal extracts, using colorimetric methods

    Directory of Open Access Journals (Sweden)

    Claudia Patricia Cordero Camacho

    2011-12-01

    Full Text Available To advance in the study of the Colombian vegetal biodiversity, considered as a potential source of pharmacologically active products, the establishment of biological activity evaluation systems is necessary, which allow the detection of active products against pathologies with high social and economical impact, such as cancer. This work describes the implementation of a preliminary in vitro methodology for the determination of potential anticancer activity in vegetal extracts, by cytotoxicity testing upon human tumor cell lines, measuring the cellular mass indirectly with the colorimetric assays of MTT (methyl tetrazolium tiazole reduction and SRB (sulforhodamine Bstaining. HT-29, MCF-7, SiHa and HEp-2 cell lines cultures were adapted, MTT concentration, cellular density and treatment period parameters for the cytotoxicity assay were selected. Cell lines sensitivity to the chemotherapeutic agent Doxorubicin HCl was determined. Colombian vegetal species extracts cytotoxicity was tested and usefulness of the assay as a tool to bioguide the search of active products was evidenced.

  7. Robust high-throughput batch screening method in 384-well format with optical in-line resin quantification.

    Science.gov (United States)

    Kittelmann, Jörg; Ottens, Marcel; Hubbuch, Jürgen

    2015-04-15

    High-throughput batch screening technologies have become an important tool in downstream process development. Although continuative miniaturization saves time and sample consumption, there is yet no screening process described in the 384-well microplate format. Several processes are established in the 96-well dimension to investigate protein-adsorbent interactions, utilizing between 6.8 and 50 μL resin per well. However, as sample consumption scales with resin volumes and throughput scales with experiments per microplate, they are limited in costs and saved time. In this work, a new method for in-well resin quantification by optical means, applicable in the 384-well format, and resin volumes as small as 0.1 μL is introduced. A HTS batch isotherm process is described, utilizing this new method in combination with optical sample volume quantification for screening of isotherm parameters in 384-well microplates. Results are qualified by confidence bounds determined by bootstrap analysis and a comprehensive Monte Carlo study of error propagation. This new approach opens the door to a variety of screening processes in the 384-well format on HTS stations, higher quality screening data and an increase in throughput. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Portable non-destructive assay methods for screening and segregation of radioactive waste

    International Nuclear Information System (INIS)

    Simpson, Alan; Jones, Stephanie; Clapham, Martin; Lucero, Randy

    2011-01-01

    Significant cost-savings and operational efficiency may be realised by performing rapid non-destructive classification of radioactive waste at or near its point of retrieval or generation. There is often a need to quickly categorize and segregate bulk containers (drums, crates etc.) into waste streams defined at various boundary levels (based on its radioactive hazard) in order to meet disposal regulations and consignor waste acceptance criteria. Recent improvements in gamma spectroscopy technologies have provided the capability to perform rapid in-situ analysis using portable and hand-held devices such as battery-operated medium and high resolution detectors including lanthanum halide and high purity germanium (HPGe). Instruments and technologies that were previously the domain of complex lab systems are now widely available as touch-screen 'off-the-shelf' units. Despite such advances, the task of waste stream screening and segregation remains a complex exercise requiring a detailed understanding of programmatic requirements and, in particular, the capability to ensure data quality when operating in the field. This is particularly so when surveying historical waste drums and crates containing heterogeneous debris of unknown composition. The most widely used portable assay method is based upon far-field High Resolution Gamma Spectroscopy (HRGS) assay using HPGe detectors together with a well engineered deployment cart (such as the PSC TechniCART TM technology). Hand-held Sodium Iodide (NaI) detectors are often also deployed and may also be used to supplement the HPGe measurements in locating hot spots. Portable neutron slab monitors may also be utilised in cases where gamma measurements alone are not suitable. Several case histories are discussed at various sites where this equipment has been used for in-situ characterization of debris waste, sludge, soil, high activity waste, depleted and enriched uranium, heat source and weapons grade plutonium, fission products

  9. Alternative global goodness metrics and sensitivity analysis: heuristics to check the robustness of conclusions from studies comparing virtual screening methods.

    Science.gov (United States)

    Sheridan, Robert P

    2008-02-01

    We introduce two ways of testing the robustness of conclusions from studies comparing virtual screening methods: alternative "global goodness" metrics and sensitivity analysis. While the robustness tests cannot eliminate all biases in virtual screening comparisons, they are useful as a "reality check" for any given study. To illustrate this, we apply them to a set of enrichments published in McGaughey et al. (J. Chem. Inf. Model. 2007, 47, 1504-1519) where 11 target protein/ligand combinations are tested on 2D and 3D similarity methods, plus docking. The major conclusions in that paper, for instance, that ligand-based methods are better than docking methods, hold up. However, some minor conclusions, such as Glide being the best docking method, do not.

  10. Oscillometric blood pressure measurement: a simple method in screening for peripheral arterial disease

    DEFF Research Database (Denmark)

    Mehlsen, Jesper; Wiinberg, Niels; Bruce, Christopher

    2008-01-01

    Blood pressure at the ankle level is a reliable indicator of peripheral arterial disease (PAD) and the ankle brachial index (ABI) is a useful non-invasive screening tool for the early detection of atherosclerosis. In the first part of the study, systolic blood pressures obtained by oscillometry...... of PAD was sufficiently high in subjects over the age of 60 years to warrant screening. The ankle brachial index based on measurements with an oscillometric device was shown reliable in the exclusion of PAD, thereby fulfilling an important criterion for the use in screening....

  11. A streamlined risk screening method for managing reutilization of abandoned factories in Taiwan

    Directory of Open Access Journals (Sweden)

    I-Chun Chen

    2017-05-01

    Full Text Available An integrated management strategy that considers the competing relationships between land values and associated risks in the process of land-use conversion is needed to assess and manage the reutilization of brownfields. However, the often large number of individual brownfields renders it difficult to conduct a completed risk assessment for all sites, and a streamlined risk screening method would facilitate prioritization of the redevelopment of those factories. This methodology takes into account the spatial heterogeneity of contaminated lands and produces risk mapping that compiles complex risk-related information. Using abandoned factories in Taiwan as a case study, the method considers 40 points (50% accumulated probability as the threshold of acceptable risk. Emergency risk should be over 90% of accumulated probability. For the sustainability of brownfield reutilization in Taiwan, this research uses a risk matrix to identify the low, middle, and high risk for brownfield reutilization. It can indicate zones with a high risk level or low economic incentive as areas of concern for future decision making. In Taiwan, high-risk sites with high incentive account for only 21.3% of the sites. In contrast, the sites with the lowest incentive and low risk account for 57.6% of the sites. To avoid failure in the brownfield market, three strategies are suggested: (1 flexible land management with urban planning is a feasible option for protecting the receptor's health; (2 the government could provide the tool or brownfield funds to reduce the uncertainty of investment risk; and (3 risk monitoring and management can reduce the possible pitfalls associated with brownfield reutilization.

  12. Phene Plate (PhP) biochemical fingerprinting. A screening method for epidemiological typing of enterococcal isolates.

    Science.gov (United States)

    Saeedi, B; Tärnberg, M; Gill, H; Hällgren, A; Jonasson, J; Nilsson, L E; Isaksson, B; Kühn, I; Hanberger, H

    2005-09-01

    Pulsed-field gel electrophoresis (PFGE) is currently considered the gold standard for genotyping of enterococci. However, PFGE is both expensive and time-consuming. The purpose of this study was to investigate whether the PhP system can be used as a reliable clinical screening method for detection of genetically related isolates of enterococci. If so, it should be possible to minimize the number of isolates subjected to PFGE typing, which would save time and money. Ninety-nine clinical enterococcal isolates were analysed by PhP (similarity levels 0.90-0.975) and PFGE (similarity levels PhP also belong to the same cluster according to PFGE, i.e. p(A(PFGE)=B(PFGE) * A(PhP)=B(PhP)), and the probability that a pair of isolates of different types according to PhP also belong to different clusters according to PFGE, i.e. p(A(PFGE) not equalB(PFGE) * A(PhP) not equalB(PhP)), was relatively high for E. faecalis (0.86 and 0.96, respectively), but was lower for E. faecium (0.51 and 0.77, respectively). The concordance which shows the probability that PhP and PFGE agree on match or mismatch was 86%-93% for E. faecalis and 54%-66% for E. faecium, which indicates that the PhP method may be useful for epidemiological typing of E. faecalis in the current settings but not for E. faecium.

  13. A simple phenotypic method for screening of MCR-1-mediated colistin resistance.

    Science.gov (United States)

    Coppi, M; Cannatelli, A; Antonelli, A; Baccani, I; Di Pilato, V; Sennati, S; Giani, T; Rossolini, G M

    2018-02-01

    To evaluate a novel method, the colistin-MAC test, for phenotypic screening of acquired colistin resistance mediated by transferable mcr-1 resistance determinants, based on colistin MIC reduction in the presence of dipicolinic acid (DPA). The colistin-MAC test consists in a broth microdilution method, in which colistin MIC is tested in the absence or presence of DPA (900 μg/mL). Overall, 74 colistin-resistant strains of Enterobacteriaceae (65 Escherichia coli and nine other species), including 61 strains carrying mcr-1-like genes and 13 strains negative for mcr genes, were evaluated with the colistin-MAC test. The presence of mcr-1-like and mcr-2-like genes was assessed by real-time PCR and end-point PCR. For 20 strains, whole-genome sequencing data were also available. A ≥8-fold reduction of colistin MIC in the presence of DPA was observed with 59 mcr-1-positive strains, including 53 E. coli of clinical origin, three E. coli transconjugants carrying MCR-1-encoding plasmids, one Enterobacter cloacae complex and two Citrobacter spp. Colistin MICs were unchanged, increased or at most reduced by twofold with the 13 mcr-negative colistin-resistant strains (nine E. coli and four Klebsiella pneumoniae), but also with two mcr-1-like-positive K. pneumoniae strains. The colistin-MAC test could be a simple phenotypic test for presumptive identification of mcr-1-positive strains among isolates of colistin-resistant E. coli, based on a ≥8-fold reduction of colistin MIC in the presence of DPA. Evaluation of the test with a larger number of strains, species and mcr-type resistance determinants would be of interest. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  14. A Quantitative Method to Screen Common Bean Plants for Resistance to Bean common mosaic necrosis virus.

    Science.gov (United States)

    Strausbaugh, C A; Myers, J R; Forster, R L; McClean, P E

    2003-11-01

    ABSTRACT A quantitative method to screen common bean (Phaseolus vulgaris) plants for resistance to Bean common mosaic necrosis virus (BCMNV) is described. Four parameters were assessed in developing the quantitative method: symptoms associated with systemic virus movement, plant vigor, virus titer, and plant dry weight. Based on these parameters, two rating systems (V and VV rating) were established. Plants from 21 recombinant inbred lines (RILs) from a Sierra (susceptible) x Olathe (partially resistant) cross inoculated with the BCMNV-NL-3 K strain were used to evaluate this quantitative approach. In all, 11 RILs exhibited very susceptible reactions and 10 RILs expressed partially resistant reactions, thus fitting a 1:1 susceptible/partially resistant ratio (chi(2) = 0.048, P = 0.827) and suggesting that the response is mediated by a single gene. Using the classical qualitative approach based only on symptom expression, the RILs were difficult to separate into phenotypic groups because of a continuum of responses. By plotting mean percent reduction in either V (based on visual symptoms) or VV (based on visual symptoms and vigor) rating versus enzyme-linked immunosorbent assay (ELISA) absorbance values, RILs could be separated clearly into different phenotypic groups. The utility of this quantitative approach also was evaluated on plants from 12 cultivars or pure lines inoculated with one of three strains of BCMNV. Using the mean VV rating and ELISA absorbance values, significant differences were established not only in cultivar and pure line comparisons but also in virus strain comparisons. This quantitative system should be particularly useful for the evaluation of the independent action of bc genes, the discovery of new genes associated with partial resistance, and assessing virulence of virus strains.

  15. Electrostatic Dust Cloth: A Passive Screening Method to Assess Occupational Exposure to Organic Dust in Bakeries

    Directory of Open Access Journals (Sweden)

    Carla Viegas

    2018-02-01

    Full Text Available Organic dust is widespread in the environment including occupational settings, such as bakeries. Recently, a new collection device—the electrostatic dust cloth (EDC—has been described for the assessment of occupational exposures. The aim of this study was to investigate the suitability of EDC for identifying the distribution patterns and exposure concentrations of particulate matter and microbial contaminants such as fungi and bacteria in bakeries. Twelve bakeries were selected, and dust was allowed to settle for 13 to 16 days on EDCs (a total of 33 samples. Particle counts and size distribution (0.3 µm, 0.5 µm, 1 µm, 2.5 µm, 5 µm and 10 µm were measured with direct-reading equipment. Higher EDC mass was significantly correlated (p values < 0.05 with higher fungal load on dichloran glycerol (DG18 and with particle size distribution in the 0.3 µm, 0.5 µm, 1.0 µm and 10.0 µm range. Fungal levels on malt extract agar (MEA ranged from 0 to 2886 CFU/m2 EDC in the warehouse setting, 0 to 500 CFU/m2 EDC in the production setting, and 0 to 3135 CFU/m2 EDC in the store. Penicillium sp. (42.56% was the most frequent fungi. Total bacterial load ranged from 0 to 18,859 CFU/m2 EDC in the warehouse, 0 to 71,656 CFU/m2 EDC in production, and 0 to 21,746 CFU/m2 EDC in the store. EDC assessment provided a longer-term integrated sample of organic dust, useful for identifying critical worksites in which particulate matter and bio-burden exposures are elevated. These findings suggest that EDC can be applied as a screening method for particulate matter-exposure assessment and as a complementary method to quantify exposures in occupational environments.

  16. LC-ESI/MS/MS method for rapid screening and confirmation of 44 exogenous anabolic steroids in human urine.

    Science.gov (United States)

    Jeon, Byoung Wook; Yoo, Hye Hyun; Jeong, Eun Sook; Kim, Ho Jun; Jin, Changbae; Kim, Dong Hyun; Lee, Jaeick

    2011-09-01

    A sensitive and rapid method based on liquid chromatography-triple-quadrupole tandem mass spectrometry (LC-MS/MS) with electrospray ionization (ESI) has been developed and validated for the screening and confirmation of 44 exogenous anabolic steroids (29 parent steroids and 15 metabolites) in human urine. The method involves an enzymatic hydrolysis, liquid-liquid extraction, and detection by LC-MS/MS. A triple-quadrupole mass spectrometer was operated in positive ESI mode with selected reaction monitoring (SRM) mode for the screening and product ion scan mode for the confirmation. The protonated molecular ions were used as precursor ions for the SRM analysis and product ion scan. The intraday and interday precisions of the target analytes at concentrations of the minimum required performance levels for the screening were 2-14% and 2-15%, respectively. The limits of detection for the screening and confirmation method were 0.1-10 ng/mL and 0.2-10 ng/mL, respectively, for 44 steroids. This method was successfully applied to analysis of urine samples from suspected anabolic steroid abusers.

  17. A new microplate screening method for the simultaneous activity quantification of feruloyl esterases, tannases, and chlorogenate esterases.

    Science.gov (United States)

    Ramírez, L; Arrizon, J; Sandoval, G; Cardador, A; Bello-Mendoza, R; Lappe, P; Mateos-Díaz, J C

    2008-12-01

    Feruloyl, chlorogenate esterases, and tannases are enzymes useful in phenolic modifications of pharmaceutical relevance as protectors against several degenerative human diseases. Therefore, there is a growing interest in discovering new sources of these enzymes. However, traditional methods for their activity measurements are time-consuming and poorly adapted for high-throughput screening. In this study, a successful new microplate high-throughput screening method for the simultaneous quantification of all mentioned activities is demonstrated. This method allows the detection of activities as low as 1.7 mU ml(-1). Furthermore, reaction rates increased proportionally with the amount of enzyme added, and no interferences with the other commercial hydrolases tested were found. The utility of the method was demonstrated after simultaneously screening feruloyl, chlorogenate esterase, and tannase activities in solid state fermentation extracts obtained during the kinetics of production of 20 fungal strains. Among these, seven strains were positive for at least one of the esterase activities tested. This result shows the potential for the rapid routine screening assays for multiple samples of moderate low to high enzymatic levels.

  18. Novel Data Mining Methods for Virtual Screening of Biological Active Chemical Compounds

    KAUST Repository

    Soufan, Othman

    2016-01-01

    compounds as candidate drugs for the treatment. Computational resources have been playing a significant role in this part through a step known as virtual screening. From a data mining perspective, availability of rich data resources is key in training

  19. Preliminary Screening Analysis for the Environmental Risk Evaluation System: Task 2.1.1: Evaluating Effects of Stressors – Fiscal Year 2010 Progress Report: Environmental Effects of Marine and Hydrokinetic Energy

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Richard M.; Copping, Andrea E.; Van Cleve, Frances B.

    2010-11-15

    Possible environmental effects of marine and hydrokinetic (MHK) energy development are not well understood, and yet regulatory agencies are required to make decisions in spite of substantial uncertainty about environmental impacts and their long-term effects. An understanding of risk associated with likely interactions between MHK installations and aquatic receptors, including animals, habitats, and ecosystems, can help reduce the level of uncertainty and focus regulatory actions and scientific studies on interactions of most concern. As a first step in developing the Pacific Northwest National Laboratory (PNNL) Environmental Risk Evaluation System (ERES), PNNL scientists conducted a preliminary risk screening analysis on three initial MHK cases - a tidal project in Puget Sound using Open Hydro turbines, a wave project off the coast of Oregon using Ocean Power Technologies point attenuator buoys, and a riverine current project in the Mississippi River using Free Flow turbines. Through an iterative process, the screening analysis revealed that top-tier stressors in all three cases were the effects of the dynamic physical presence of the device (e.g., strike), accidents, and effects of the static physical presence of the device (e.g., habitat alteration). Receptor interactions with these stressors at the four highest tiers of risk were dominated by marine mammals (cetaceans and pinnipeds) and birds (diving and non-diving); only the riverine case (Free Flow) included different receptors in the third tier (fish) and the fourth tier (benthic invertebrates). Although this screening analysis provides a preliminary analysis of vulnerability of environmental receptors to stressors associated with MHK installations, probability analysis, especially of risk associated with chemical toxicity and accidents such as oil spills or lost gear, will be necessary to further understand high-priority risks. Subject matter expert review of this process and results is required and is

  20. Analysis of errors in the measurement of unattached fractions of radon and thoron progeny in a Canadian uranium mine using wire screen methods

    International Nuclear Information System (INIS)

    Khan, A.; Phillips, C.R.

    1987-01-01

    The unattached fraction of radon/thoron progeny in uranium mines is generally small and therefore difficult to measure accurately. The simple wire screen method provides a direct estimate of the unattached fraction from the screen count, or an indirect estimate from the difference between the reference and back-up filter counts. Wire screen method results are often difficult to analyse, especially when the unattached activity is small. Experimental data obtained in Canadian uranium mines are presented here, together with a detailed error analysis. The method consisting of counting the wire screen and the back-up filter is found to be the most precise method for unattached fraction determination. (author)

  1. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    Science.gov (United States)

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  2. A QUANTITATIVE METHOD FOR ANALYSING 3-D BRANCHING IN EMBRYONIC KIDNEYS: DEVELOPMENT OF A TECHNIQUE AND PRELIMINARY DATA

    Directory of Open Access Journals (Sweden)

    Gabriel Fricout

    2011-05-01

    Full Text Available The normal human adult kidney contains between 300,000 and 1 million nephrons (the functional units of the kidney. Nephrons develop at the tips of the branching ureteric duct, and therefore ureteric duct branching morphogenesis is critical for normal kidney development. Current methods for analysing ureteric branching are mostly qualitative and those quantitative methods that do exist do not account for the 3- dimensional (3D shape of the ureteric "tree". We have developed a method for measuring the total length of the ureteric tree in 3D. This method is described and preliminary data are presented. The algorithm allows for performing a semi-automatic segmentation of a set of grey level confocal images and an automatic skeletonisation of the resulting binary object. Measurements of length are automatically obtained, and numbers of branch points are manually counted. The final representation can be reconstructed by means of 3D volume rendering software, providing a fully rotating 3D perspective of the skeletonised tree, making it possible to identify and accurately measure branch lengths. Preliminary data shows the total length estimates obtained with the technique to be highly reproducible. Repeat estimates of total tree length vary by just 1-2%. We will now use this technique to further define the growth of the ureteric tree in vitro, under both normal culture conditions, and in the presence of various levels of specific molecules suspected of regulating ureteric growth. The data obtained will provide fundamental information on the development of renal architecture, as well as the regulation of nephron number.

  3. CALF CIRCUMFERENCE AT BIRTH: A SCREENING METHOD FOR DETECTION OF LOW BIRTH WEIGHT

    Directory of Open Access Journals (Sweden)

    Sandip Kumar

    2012-12-01

    Full Text Available Background: Low Birth Weight (LBW babies run a higher risk of morbidity and mortality in the perinatal period. However, in our country where almost 70-80% births take place at home and peripheral hospitals, taking accurate weight is a problem due to unavailability of weighing scale and trained personnel. Hence there is a constant search for newer methods to detect LBW babies so that early interventions can be instituted. Various authors have used different surrogate anthropometric measurements from different parts of our country. In the present study, an attempt was made to validate the feasibility of using calf circumference as a predictor of LBW babies that can be used by a trained or untrained person. Objectives: To study various anthropometric measurements including calf circumference in newborns and to correlate various measurements with birth weight. Methods: The present study was conducted in the department of Social & Preventive Medicine, MLB Medical College, Jhansi (UP for a period of one year. The study included 1100 consecutively delivered neonates in the maternity ward of MLB Medical College Hospital, Jhansi (UP. The birth weight (Wt, crown heel length (CHL, crown rump length (CRL, head circumference (HC, chest circumference (CC, mid arm circumference (MAC, thigh circumference (TC and calf circumference (CC by standard techniques. All the measurements were taken by a single person throughout the study period with in 24 hours of delivery. Standard statistical methods were adopted for determination of critical limit, sensitivity, specificity and correlation coefficient of different anthropometric measurements in relation to birth weight. Results: Analysis of data indicates that out of 1100 newborns, 55.64% were low birth weight. The percentage of newborns > 2500gm was 44.36. Overall average birth weight was 2348 ± 505gm. Out of 1100 newborns, 608 (55.27% were males and 492 (44.73% were females. Average birth weight for males was 2412

  4. Development of a cloud-screening method for MAX-DOAS measurements

    Science.gov (United States)

    Gielen, Clio; Van Roozendael, Michel; Hendrik, Francois; Fayt, Caroline; Hermans, Christian; Pinardi, Gaia; Vlemmix, Tim

    2013-04-01

    is easily detectable. Additional information is derived from the O4 DSCD measurements, since they are quite sensitive to the change of the light paths due to scattering at different altitudes. For example, thick clouds at low altitude show a very strong increase in the DSCD values due to scattering, combined with a low colour index value due to the intensity screening. In general, our method shows promising results to qualify the sky and cloud conditions of MAX- DOAS measurements, without the need for other external cloud-detection systems such as Brewer instruments or pyrheliometers.

  5. A method of simultaneous no-screen X-ray film taking with direct twofold magnification of hands and feet

    International Nuclear Information System (INIS)

    Zajgner, J.; Szymanska-Prach, H.

    1978-01-01

    The authors propose an original method of X-ray examination of hands and feet which makes possible simultaneous radiography without screen and direct twofold magnified film taking. The method is not connected with the necessity of exposing the patient to an additional dose of X-rays. It has been tried in 20 patients with suspected rheumatoid arthritis. It requires an X-ray tube with 0.3 x 0.3 mm microfocus. (author)

  6. A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

    Science.gov (United States)

    Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

    2013-03-11

    Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

  7. Investigation of toxigenic potential of fungal species by the use of simple screening method

    Directory of Open Access Journals (Sweden)

    Bočarov-Stančić Aleksandra S.

    2009-01-01

    Full Text Available Potential for the biosynthesis of aflatoxin B1 (AFLB1, ochratoxin A (OTA, diacetoxyscirpenol (DAS, T-2 toxin (T2, and zearalenone (ZON was investigated in different fungal species belonging to the genera: Aspergillus, Fusarium and Penicillium. The majority of investigated isolates originated from cereal grains, crushed oil soybean seed and fodder mixtures. The simple screening method developed by Filtenborg et al. (1983 was applied with few modifications concerning the type of the medium and cultivation temperature. In order to optimise the biosynthetic conditions for different mycotoxins, the following control cultures, known as mycotin producers were used: OTA - A. ochraceus CBS 108.08, DAS - F. semitectum (SL-B i SL-C, T2 - F. sporotrichioides (ITM-391, M-1-1, R-2301 and ZON - F. graminearum (GZ-LES. The fungi were cultivated on the standard medium (YESA - 2% yeast extract, 15% sucrose and 2% agar, pH 6.5, three modifications of the basic medium (YESAZn - the standard medium supplemented with 0.23 mg/l ZnSO4 x 5 H2O; PPSA - the medium in which yeast extract was replaced with peptone-1; PPSAZn - the medium in which yeast extract was replaced with peptone-1 and supplemented with 0.23 mg/l ZnSO4 x 5 H2O, and the potato-dextrose agar (PDA. The earlier biosynthesis of tested mycotoxins was recorded under the following cultivation conditions of fungal species: AFLB1 - after 14 days on PDA at 27±1°C, OTA - after 10 days on YESA and YESAZn at 27±1°C, DAS - after 10 days on PPSA and PPSAZn at 27±1°C, T2 - after 7 days on PPSAZn and PPSA at room temperature (20-24°C, and ZON - after 1 week on YESA and YESAZn at room temperature (21-24°C.

  8. Preliminary Design of Industrial Symbiosis of Smes Using Material Flow Cost Accounting (MFCA) Method

    Science.gov (United States)

    Astuti, Rahayu Siwi Dwi; Astuti, Arieyanti Dwi; Hadiyanto

    2018-02-01

    Industrial symbiosis is a collaboration of several industries to share their necessities such material, energy, technology as well as waste management. As a part of industrial ecology, in principle, this system attempts to emulate ecosystem where waste of an organism is being used by another organism, therefore there is no waste in the nature. This system becomes an effort to optimize resources (material and energy) as well as minimize waste. Considerable, in a symbiosis incure material and energy flows among industries. Material and energy in an industry are known as cost carriers, thus flow analysis in this system can be conducted in perspective of material, energy and cost, or called as material flow cost accounting (MFCA) that is an economic and ecological appraisal approach. Previous researches shown that MFCA implementation could be used to evaluate an industry's environmental-related efficiency as well as in planning, business control and decision making. Moreover, the MFCA has been extended to assess environmental performance of SMEs Cluster or industrial symbiosis in SMEs Cluster, even to make preliminary design of an industrial symbiosis base on a major industry. This paper describes the use of MFCA to asses performance of SMEs industrial symbiosis and to improve the performance.

  9. Application of a PCR method for the diagnosis of ulcerative enteritis: preliminary results

    Directory of Open Access Journals (Sweden)

    Fabrizio Agnoletti

    2010-01-01

    Full Text Available Ulcerative enteritis or “quail disease” is an acute clostridial infection of young birds reported in many avian species, chicken and turkey included. Clostridium colinum is the causative agent of ulcerative enteritis and because of the difficulties bound to the isolation and identification of this bacterium by means of classic bacteriological techniques, its detection appears very hard and the prevalence of this disease could be underestimated. To investigate the diffusion of C. colinum in enteric disease of birds, a recently developed PCR protocol was applied to 42 cultural broths previously inoculated with organs and intestinal samples collected from diseased subjects. PCR-positive broths were cultivated to attempt the isolation of C. colinum. Samples collected from positive birds were subjected to histological examinations. 4 birds (3 broilers chickens and 1 pigeon resulted PCR-positive and, in one case, C. colinum was isolated. Gross and histological lesions of positive birds were compatible with those described in other ulcerative enteritis outbreaks. These preliminary results demonstrates that C. colinum is sporadically implicated in enteric diseases of broiler chickens (14.2%. In addition, the PCR assay proved to be an useful and reliable instrument to support the diagnosis of ulcerative enteritis and to facilitate the isolation of C. colinum.

  10. Preliminary estimations on the heat recovery method for hydrogen production by the high temperature steam electrolysis

    International Nuclear Information System (INIS)

    Koh, Jae Hwa; Yoon, Duck Joo

    2009-01-01

    As a part of the project 'development of hydrogen production technologies by high temperature electrolysis using very high temperature reactor', we have developed an electrolyzer model for high temperature steam electrolysis (HTSE) system and carried out some preliminary estimations on the effects of heat recovery on the HTSE hydrogen production system. To produce massive hydrogen by using nuclear energy, the HTSE process is one of the promising technologies with sulfur-iodine and hybrid sulfur process. The HTSE produces hydrogen through electrochemical reaction within the solid oxide electrolysis cell (SOEC), which is a reverse reaction of solid oxide fuel cell (SOFC). The HTSE system generally operates in the temperature range of 700∼900 .deg. C. Advantages of HTSE hydrogen production are (a) clean hydrogen production from water without carbon oxide emission, (b) synergy effect due to using the current SOFC technology and (c) higher thermal efficiency of system when it is coupled nuclear reactor. Since the HTSE system operates over 700 .deg. C, the use of heat recovery is an important consideration for higher efficiency. In this paper, four different heat recovery configurations for the HTSE system have been investigated and estimated

  11. Preliminary Design of Industrial Symbiosis of Smes Using Material Flow Cost Accounting (MFCA Method

    Directory of Open Access Journals (Sweden)

    Siwi Dwi Astuti Rahayu

    2018-01-01

    Full Text Available Industrial symbiosis is a collaboration of several industries to share their necessities such material, energy, technology as well as waste management. As a part of industrial ecology, in principle, this system attempts to emulate ecosystem where waste of an organism is being used by another organism, therefore there is no waste in the nature. This system becomes an effort to optimize resources (material and energy as well as minimize waste. Considerable, in a symbiosis incure material and energy flows among industries. Material and energy in an industry are known as cost carriers, thus flow analysis in this system can be conducted in perspective of material, energy and cost, or called as material flow cost accounting (MFCA that is an economic and ecological appraisal approach. Previous researches shown that MFCA implementation could be used to evaluate an industry’s environmental-related efficiency as well as in planning, business control and decision making. Moreover, the MFCA has been extended to assess environmental performance of SMEs Cluster or industrial symbiosis in SMEs Cluster, even to make preliminary design of an industrial symbiosis base on a major industry. This paper describes the use of MFCA to asses performance of SMEs industrial symbiosis and to improve the performance.

  12. Using video games for volcanic hazard education and communication: an assessment of the method and preliminary results

    Science.gov (United States)

    Mani, Lara; Cole, Paul D.; Stewart, Iain

    2016-07-01

    This paper presents the findings from a study aimed at understanding whether video games (or serious games) can be effective in enhancing volcanic hazard education and communication. Using the eastern Caribbean island of St. Vincent, we have developed a video game - St. Vincent's Volcano - for use in existing volcano education and outreach sessions. Its twin aims are to improve residents' knowledge of potential future eruptive hazards (ash fall, pyroclastic flows and lahars) and to integrate traditional methods of education in a more interactive manner. Here, we discuss the process of game development including concept design through to the final implementation on St. Vincent. Preliminary results obtained from the final implementation (through pre- and post-test knowledge quizzes) for both student and adult participants provide indications that a video game of this style may be effective in improving a learner's knowledge. Both groups of participants demonstrated a post-test increase in their knowledge quiz score of 9.3 % for adults and 8.3 % for students and, when plotted as learning gains (Hake, 1998), show similar overall improvements (0.11 for adults and 0.09 for students). These preliminary findings may provide a sound foundation for the increased integration of emerging technologies within traditional education sessions. This paper also shares some of the challenges and lessons learnt throughout the development and testing processes and provides recommendations for researchers looking to pursue a similar study.

  13. Preliminary application of maximum likelihood method in HL-2A Thomson scattering system

    International Nuclear Information System (INIS)

    Yao Ke; Huang Yuan; Feng Zhen; Liu Chunhua; Li Enping; Nie Lin

    2010-01-01

    Maximum likelihood method to process the data of HL-2A Thomson scattering system is presented. Using mathematical statistics, this method maximizes the possibility of the likeness between the theoretical data and the observed data, so that we could get more accurate result. It has been proved to be applicable in comparison with that of the ratios method, and some of the drawbacks in ratios method do not exist in this new one. (authors)

  14. A Preliminary Survey of the Preferred Learning Methods for Interpretation Students

    Science.gov (United States)

    Heinz, Michael

    2013-01-01

    There are many different methods that individuals use to learn languages like reading books or writing essays. Not all methods are equally successful for second language learners but nor do all successful learners of a second language show identical preferences for learning methods. Additionally, at the highest level of language learning various…

  15. Development of an analytical method coupling cell membrane chromatography with gas chromatography-mass spectrometry via microextraction by packed sorbent and its application in the screening of volatile active compounds in natural products.

    Science.gov (United States)

    Li, Miao; Wang, Sicen; He, Langchong

    2015-01-01

    Natural products (NPs) are important sources of lead compounds in modern drug discovery. To facilitate the screening of volatile active compounds in NPs, we have developed a new biochromatography method that uses rat vascular smooth muscle cells (VSMC), which are rich in L-type calcium channels (LCC), to prepare the stationary phase. This integrated method, which couples cell membrane chromatography (CMC) with gas chromatography-mass spectrometry (GC-MS) via microextraction by packed sorbent (MEPS) technology, has been termed VSMC/CMC-MEPS-GC-MS. Methodological validation confirmed its specificity, reliability and convenience. Screening results for Radix Angelicae Dahuricae and Fructus Cnidii obtained using VSMC/CMC-MEPS-GC-MS were consistent with those obtained using VSMC/CMC-offline-GC-MS. MEPS connection plays as simplified solid-phase extraction and replaces the uncontrollable evaporation operation in reported offline connections, so our new method is supposed to be more efficient and reliable than the offline ones, especially for compounds that are volatile, thermally unstable or difficult to purify. In application, senkyunolide A and ligustilide were preliminary identified as the volatile active components in Rhizoma Chuanxiong. We have thus confirmed the suitability of VSMC/CMC-MEPS-GC-MS for volatile active compounds screening in NP. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Evaluation of high packing density powder X-ray screens by Monte Carlo methods

    International Nuclear Information System (INIS)

    Liaparinos, P.; Kandarakis, I.; Cavouras, D.; Kalivas, N.; Delis, H.; Panayiotakis, G.

    2007-01-01

    Phosphor materials are employed in intensifying screens of both digital and conventional X-ray imaging detectors. High packing density powder screens have been developed (e.g. screens in ceramic form) exhibiting high-resolution and light emission properties, and thus contributing to improved image transfer characteristics and higher radiation to light conversion efficiency. For the present study, a custom Monte Carlo simulation program was used in order to examine the performance of ceramic powder screens, under various radiographic conditions. The model was developed using Mie scattering theory for the description of light interactions, based on the physical characteristics (e.g. complex refractive index, light wavelength) of the phosphor material. Monte Carlo simulations were carried out assuming: (a) X-ray photon energy ranging from 18 up to 49 keV, (b) Gd 2 O 2 S:Tb phosphor material with packing density of 70% and grain size of 7 μm and (c) phosphor thickness ranging between 30 and 70 mg/cm 2 . The variation of the Modulation Transfer Function (MTF) and the Luminescence Efficiency (LE) with respect to the X-ray energy and the phosphor thickness was evaluated. Both aforementioned imaging characteristics were shown to take high values at 49 keV X-ray energy and 70 mg/cm 2 phosphor thickness. It was found that high packing density screens may be appropriate for use in medical radiographic systems

  17. Development of a method for efficient cost-effective screening of Aspergillus niger mutants having increased production of glucoamylase.

    Science.gov (United States)

    Zhu, Xudong; Arman, Bessembayev; Chu, Ju; Wang, Yonghong; Zhuang, Yingping

    2017-05-01

    To develop an efficient cost-effective screening process to improve production of glucoamylase in Aspergillus niger. The cultivation of A. niger was achieved with well-dispersed morphology in 48-deep-well microtiter plates, which increased the throughput of the samples compared to traditional flask cultivation. There was a close negative correlation between glucoamylase and its pH of the fermentation broth. A novel high-throughput analysis method using Methyl Orange was developed. When compared to the conventional analysis method using 4-nitrophenyl α-D-glucopyranoside as substrate, a correlation coefficient of 0.96 by statistical analysis was obtained. Using this novel screening method, we acquired a strain with an activity of 2.2 × 10 3  U ml -1 , a 70% higher yield of glucoamylase than its parent strain.

  18. Overview of a workshop on screening methods for detecting potential (anti-) estrogenic/androgenic chemicals in wildlife

    Science.gov (United States)

    Ankley, Gerald T.; Mihaich, Ellen; Stahl, Ralph G.; Tillitt, Donald E.; Colborn, Theo; McMaster, Suzzanne; Miller, Ron; Bantle, John; Campbell, Pamela; Denslow, Nancy; Dickerson, Richard L.; Folmar, Leroy C.; Fry, Michael; Giesy, John P.; Gray, L. Earl; Guiney, Patrick; Hutchinson, Thomas; Kennedy, Sean W.; Kramer, Vincent; LeBlanc, Gerald A.; Mayes, Monte; Nimrod, Alison; Patino, Reynaldo; Peterson, Richard; Purdy, Richard; Ringer, Robert; Thomas, Peter C.; Touart, Les; Van Der Kraak, Glen; Zacharewski, Tim

    1998-01-01

    The U.S. Congress has passed legislation requiring the U.S. Environmental Protection Agency (U.S. EPA) to develop, validate, and implement screening tests for identifying potential endocrine-disrupting chemicals within 3 years. To aid in the identification of methods suitable for this purpose, the U.S. EPA, the Chemical Manufacturers Association, and the World Wildlife Fund sponsored several workshops, including the present one, which dealt with wildlife species. This workshop was convened with 30 international scientists representing multiple disciplines in March 1997 in Kansas City, Missouri, USA. Participants at the meeting identified methods in terms of their ability to indicate (anti-) estrogenic/androgenic effects, particularly in the context of developmental and reproductive processes. Data derived from structure-activity relationship models and in vitro test systems, although useful in certain contexts, cannot at present replace in vivo tests as the sole basis for screening. A consensus was reached that existing mammalian test methods (e.g., with rats or mice) generally are suitable as screens for assessing potential (anti-) estrogenic/ androgenic effects in mammalian wildlife. However, due to factors such as among-class variation in receptor structure and endocrine function, it is uncertain if these mammalian assays would be of broad utility as screens for other classes of vertebrate wildlife. Existing full and partial life-cycle tests with some avian and fish species could successfully identify chemicals causing endocrine disruption; however, these long-term tests are not suitable for routine screening. However, a number of short-term tests with species from these two classes exist that could serve as effective screening tools for chemicals inducing (anti-) estrogenic/androgenic effects. Existing methods suitable for identifying chemicals with these mechanisms of action in reptiles and amphibians are limited, but in the future, tests with species from

  19. Bimanual elbow robotic orthoses: preliminary investigations on an impairment force feedback rehabilitation method

    Directory of Open Access Journals (Sweden)

    Gil eHerrnstadt

    2015-03-01

    Full Text Available Modern rehabilitation practices have begun integrating robots, recognizing their significant role in recovery. New and alternative stroke rehabilitation treatments are essential to enhance efficacy and mitigate associated health costs. Today’s robotic interventions can play a significant role in advancing rehabilitation. In addition, robots have an inherent ability to perform tasks accurately and reliably and are typically well suited to measure and quantify performance.Most rehabilitation strategies predominantly target activation of the paretic arm. However, bimanual upper limb rehabilitation research suggests potential in enhancing functional recovery. Moreover studies suggest limb coordination and synchronization can improve treatment efficacy.In this preliminary study, we aimed to investigate and validate our user-driven bimanual system in a reduced intensity rehab practice. A Bimanual Wearable Robotic Device (BWRD with a Master-Slave configuration for the elbow joint was developed to carry out the investigation. The BWRD incorporates position and force sensors for which respective control loops are implemented, and offers varying modes of operation ranging from passive to active training. The proposed system enables the perception of the movements, as well as the forces applied by the hemiparetic arm, with the non-hemiparetic arm. Eight participants with chronic unilateral stroke were recruited to participate in a total of three one-hour sessions per participant, delivered in a week. Participants underwent pre and post training functional assessments along with proprioceptive measures. The post assessment was performed at the end of the last training session.The protocol was designed to engage the user in an assortment of static and dynamic arm matching and opposing tasks. The training incorporates force feedback movements, force feedback positioning, and force matching tasks with same and opposite direction movements. We are able to

  20. Non-invasive coronary angiography with multislice computed tomography. Technology, methods, preliminary experience and prospects.

    Science.gov (United States)

    Traversi, Egidio; Bertoli, Giuseppe; Barazzoni, Giancarlo; Baldi, Maurizia; Tramarin, Roberto

    2004-02-01

    The recent technical developments in multislice computed tomography (MSCT), with ECG retro-gated image reconstruction, have elicited great interest in the possibility of accurate non-invasive imaging of the coronary arteries. The latest generation of MSCT systems with 8-16 rows of detectors permits acquisition of the whole cardiac volume during a single 15-20 s breath-hold with a submillimetric definition of the images and an outstanding signal-to-noise ratio. Thus the race which, between MSCT, electron beam computed tomography and cardiac magnetic resonance imaging, can best provide routine and reliable imaging of the coronary arteries in clinical practice has recommenced. Currently available MSCT systems offer different options for both cardiac image acquisition and reconstruction, including multiplanar and curved multiplanar reconstruction, three-dimensional volume rendering, maximum intensity projection, and virtual angioscopy. In our preliminary experience including 176 patients suffering from known or suspected coronary artery disease, MSCT was feasible in 161 (91.5%) and showed a sensitivity of 80.4% and a specificity of 80.3%, with respect to standard coronary angiography, in detecting critical stenosis in coronary arteries and artery or venous bypass grafts. These results correspond to a positive predictive value of 58.6% and a negative predictive value of 92.2%. The true role that MSCT is likely to play in the future in non-invasive coronary imaging is still to be defined. Nevertheless, the huge amount of data obtainable by MSCT along with the rapid technological advances, shorter acquisition times and reconstruction algorithm developments will make the technique stronger, and possible applications are expected not only for non-invasive coronary angiography, but also for cardiac function and myocardial perfusion evaluation, as an all-in-one examination.

  1. Measuring background by the DIN-1M spectrometer using the oscillating absorbing screen method

    International Nuclear Information System (INIS)

    Glazkov, Yu.Yu.; Liforov, V.G.; Novikov, A.G.; Parfenov, V.A.; Semenov, V.A.

    1982-01-01

    Technique for measuring background by a double pulse slow neutron spectrometer is described. To measure the background on oscillating absorbing screen (OAS) periodically overlapping primary neutron beam at the input of a mechanical interrupter was used. During the overlapping monochromatic neutrons conditioned the effect are removed out of the beam and general background conditions are not practically applied. Screen oscillation permits to realize the condition of simultaneous measurement of effect and background neutrons. The optimal period of oscillations amounts to approximately 3 min. Analysis of neutron spectra scattered with different materials and corresponding background curves measured by means of the OAS technique shows that the share of monochromatic neutrons passing through the screen constitutes less than 1% of elastic peak and relative decrease of the total background level doesn't exceed 1.5-2%

  2. Virtual screening applications: a study of ligand-based methods and different structure representations in four different scenarios.

    Science.gov (United States)

    Hristozov, Dimitar P; Oprea, Tudor I; Gasteiger, Johann

    2007-01-01

    Four different ligand-based virtual screening scenarios are studied: (1) prioritizing compounds for subsequent high-throughput screening (HTS); (2) selecting a predefined (small) number of potentially active compounds from a large chemical database; (3) assessing the probability that a given structure will exhibit a given activity; (4) selecting the most active structure(s) for a biological assay. Each of the four scenarios is exemplified by performing retrospective ligand-based virtual screening for eight different biological targets using two large databases--MDDR and WOMBAT. A comparison between the chemical spaces covered by these two databases is presented. The performance of two techniques for ligand--based virtual screening--similarity search with subsequent data fusion (SSDF) and novelty detection with Self-Organizing Maps (ndSOM) is investigated. Three different structure representations--2,048-dimensional Daylight fingerprints, topological autocorrelation weighted by atomic physicochemical properties (sigma electronegativity, polarizability, partial charge, and identity) and radial distribution functions weighted by the same atomic physicochemical properties--are compared. Both methods were found applicable in scenario one. The similarity search was found to perform slightly better in scenario two while the SOM novelty detection is preferred in scenario three. No method/descriptor combination achieved significant success in scenario four.

  3. Estimation of Pap-test coverage in an area with an organised screening program: challenges for survey methods

    Directory of Open Access Journals (Sweden)

    Raggi Patrizio

    2006-03-01

    Full Text Available Abstract Background The cytological screening programme of Viterbo has completed the second round of invitations to the entire target population (age 25–64. From a public health perspective, it is important to know the Pap-test coverage rate and the use of opportunistic screening. The most commonly used study design is the survey, but the validity of self-reports and the assumptions made about non respondents are often questioned. Methods From the target population, 940 women were sampled, and responded to a telephone interview about Pap-test utilisation. The answers were compared with the screening program registry; comparing the dates of Pap-tests reported by both sources. Sensitivity analyses were performed for coverage over a 36-month period, according to various assumptions regarding non respondents. Results The response rate was 68%. The coverage over 36 months was 86.4% if we assume that non respondents had the same coverage as respondents, 66% if we assume they were not covered at all, and 74.6% if we adjust for screening compliance in the non respondents. The sensitivity and specificity of the question, "have you ever had a Pap test with the screening programme" were 84.5% and 82.2% respectively. The test dates reported in the interview tended to be more recent than those reported in the registry, but 68% were within 12 months of each other. Conclusion Surveys are useful tools to understand the effectiveness of a screening programme and women's self-report was sufficiently reliable in our setting, but the coverage estimates were strongly influenced by the assumptions we made regarding non respondents.

  4. Revision of FMM-Yukawa: An adaptive fast multipole method for screened Coulomb interactions

    Science.gov (United States)

    Zhang, Bo; Huang, Jingfang; Pitsianis, Nikos P.; Sun, Xiaobai

    2010-12-01

    FMM-YUKAWA is a mathematical software package primarily for rapid evaluation of the screened Coulomb interactions of N particles in three dimensional space. Since its release, we have revised and re-organized the data structure, software architecture, and user interface, for the purpose of enabling more flexible, broader and easier use of the package. The package and its documentation are available at http://www.fastmultipole.org/, along with a few other closely related mathematical software packages. New version program summaryProgram title: FMM-Yukawa Catalogue identifier: AEEQ_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEEQ_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: GNU GPL 2.0 No. of lines in distributed program, including test data, etc.: 78 704 No. of bytes in distributed program, including test data, etc.: 854 265 Distribution format: tar.gz Programming language: FORTRAN 77, FORTRAN 90, and C. Requires gcc and gfortran version 4.4.3 or later Computer: All Operating system: Any Classification: 4.8, 4.12 Catalogue identifier of previous version: AEEQ_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2331 Does the new version supersede the previous version?: Yes Nature of problem: To evaluate the screened Coulomb potential and force field of N charged particles, and to evaluate a convolution type integral where the Green's function is the fundamental solution of the modified Helmholtz equation. Solution method: The new version of fast multipole method (FMM) that diagonalizes the multipole-to-local translation operator is applied with the tree structure adaptive to sample particle locations. Reasons for new version: To handle much larger particle ensembles, to enable the iterative use of the subroutines in a solver, and to remove potential contention in assignments for parallelization. Summary of revisions: The software package FMM-Yukawa has been

  5. Preliminary Structural Design Using Topology Optimization with a Comparison of Results from Gradient and Genetic Algorithm Methods

    Science.gov (United States)

    Burt, Adam O.; Tinker, Michael L.

    2014-01-01

    In this paper, genetic algorithm based and gradient-based topology optimization is presented in application to a real hardware design problem. Preliminary design of a planetary lander mockup structure is accomplished using these methods that prove to provide major weight savings by addressing the structural efficiency during the design cycle. This paper presents two alternative formulations of the topology optimization problem. The first is the widely-used gradient-based implementation using commercially available algorithms. The second is formulated using genetic algorithms and internally developed capabilities. These two approaches are applied to a practical design problem for hardware that has been built, tested and proven to be functional. Both formulations converged on similar solutions and therefore were proven to be equally valid implementations of the process. This paper discusses both of these formulations at a high level.

  6. Aviation security : preliminary observations on TSA's progress and challenges in meeting the statutory mandate for screening air cargo on passenger aircraft.

    Science.gov (United States)

    2009-03-01

    The Implementing : Recommendations of the 9/11 : Commission Act of 2007 mandates : the Department of Homeland : Security (DHS) to establish a : system to physically screen 50 : percent of cargo transported on : passenger aircraft by February : 2009 a...

  7. Evaluation of whole-body cancer screening using 18F-2-deoxy-2-fluoro-D-glucose positron emission tomography. A preliminary report

    International Nuclear Information System (INIS)

    Terauchi, Takashi; Murano, Takeshi; Daisaki, Hiromitsu; Kanou, Daisuke; Shoda, Hiroko; Kakinuma, Ryutaro; Hamashima, Chisato; Moriyama, Noriyuki; Kakizoe, Tadao

    2008-01-01

    18 F-2-deoxy-2-fluoro-d-glucose positron emission tomography (FDG-PET) is a promising screening modality targeting whole body. However, the validity of PET cancer screening remains to be assessed. Even the screening accuracy for whole-body screening using FDG-PET has not been evaluated. In this study, we investigated the screening accuracy of PET cancer screening. A total of 2911 asymptomatic participants (1629 men and 1282 women, mean age 59.79 years) underwent both FDG-PET and other thorough examinations for multiple organs (gastrofiberscopy, total colonofiberscopy or barium enema, low-dose thin section computed tomography and sputum cytology, abdominal ultrasonography, an assay of prostate-specific antigen, mammography, mammary ultrasonography, Pap smear for the uterine cervix, and magnetic resonance imaging for the endometrium and ovaries) between February 2004 and January 2005, and followed sufficiently. The detection rate, sensitivity, specificity, and positive predictive value of FDG-PET were calculated using cancer data obtained from all examinations along with a 1 year follow-up. From among 2911 participants FDG-PET found 28 cancers, 129 cancers were PET negative. PET-positive cancers comprised seven colorectal cancers, four lung cancers, four thyroid cancers, three breast cancers, two gastric cancers, two prostate cancers, two small intestinal sarcomas (gastrointestinal stromal tumors), one malignant lymphoma, one head and neck malignancy (nasopharyngeal carcinoid tumor), one thymoma, and one hepatocellular carcinoma. PET-negative cancers included 22 gastric cancers and 20 prostate cancers that were essentially difficult to detect using FDG-PET. The overall detection rate, sensitivity, specificity, and positive predictive value were estimated to be 0.96%, 17.83%, 95.15%, and 11.20%, respectively. FDG-PET can detect a variety of cancers at an early stage as part of a whole-body screening modality. The detection rate of PET cancer screening was higher than

  8. Nondestructive methods for the structural evaluation of wood floor systems in historic buildings : preliminary results : [abstract

    Science.gov (United States)

    Zhiyong Cai; Michael O. Hunt; Robert J. Ross; Lawrence A. Soltis

    1999-01-01

    To date, there is no standard method for evaluating the structural integrity of wood floor systems using nondestructive techniques. Current methods of examination and assessment are often subjective and therefore tend to yield imprecise or variable results. For this reason, estimates of allowable wood floor loads are often conservative. The assignment of conservatively...

  9. A novel automatic quantification method for high-content screening analysis of DNA double strand-break response.

    Science.gov (United States)

    Feng, Jingwen; Lin, Jie; Zhang, Pengquan; Yang, Songnan; Sa, Yu; Feng, Yuanming

    2017-08-29

    High-content screening is commonly used in studies of the DNA damage response. The double-strand break (DSB) is one of the most harmful types of DNA damage lesions. The conventional method used to quantify DSBs is γH2AX foci counting, which requires manual adjustment and preset parameters and is usually regarded as imprecise, time-consuming, poorly reproducible, and inaccurate. Therefore, a robust automatic alternative method is highly desired. In this manuscript, we present a new method for quantifying DSBs which involves automatic image cropping, automatic foci-segmentation and fluorescent intensity measurement. Furthermore, an additional function was added for standardizing the measurement of DSB response inhibition based on co-localization analysis. We tested the method with a well-known inhibitor of DSB response. The new method requires only one preset parameter, which effectively minimizes operator-dependent variations. Compared with conventional methods, the new method detected a higher percentage difference of foci formation between different cells, which can improve measurement accuracy. The effects of the inhibitor on DSB response were successfully quantified with the new method (p = 0.000). The advantages of this method in terms of reliability, automation and simplicity show its potential in quantitative fluorescence imaging studies and high-content screening for compounds and factors involved in DSB response.

  10. Effect of Leadership Styles, Social Capital, and Social Entrepreneurship on Organizational Effectiveness of Social Welfare Organization in Malaysia: Data Screening and Preliminary Analysis

    OpenAIRE

    Won, Ng Chun; Wan, Chong Yen; Sharif, Mohmad Yazam

    2017-01-01

    The purpose of this paper is to discuss the process of screening, editing and preparation of initial data before any further multivariate analysis of the study concerning effect of leadership styles, social capital and social entrepreneurship on organizational effectiveness of social welfare organization in Malaysia. It is vital to conduct data screening to identify any potential violation of the basic assumptions related to the application of multivariate techniques. Moreover, initial data e...

  11. Uptake of community-based, self-collected HPV testing vs. visual inspection with acetic acid for cervical cancer screening in Kampala, Uganda: preliminary results of a randomised controlled trial.

    Science.gov (United States)

    Moses, Erin; Pedersen, Heather N; Mitchell, Sheona M; Sekikubo, Musa; Mwesigwa, David; Singer, Joel; Biryabarema, Christine; Byamugisha, Josaphat K; Money, Deborah M; Ogilvie, Gina S

    2015-10-01

    To compare two cervical cancer screening methods: community-based self-collection of high-risk human papillomavirus (HR-HPV) testing and visual inspection with acetic acid (VIA). Pilot randomised controlled trial of 500 women aged 30-65 in the community of Kisenyi, Uganda. Women randomised to self-collection-based HR-HPV testing provided a cervico-vaginal swab for HR-HPV, and results were provided by phone after laboratory testing. Women who tested HPV positive were referred for VIA at the local health unit. Women randomised to VIA underwent screening at the local health unit, where women who tested positive with VIA were provided cryotherapy at time of screening, as per local standard of care. Women were referred for colposcopy when indicated. Outcome measures were uptake of screening, HR-HPV prevalence, VIA result and treatment rates. In the HR-HPV arm, 248 of 250 (p < 0.01) women provided samples, while in the VIA arm, 121 of 250 (48.4%) women attended screening. Among the 73 of 248 HR-HPV-positive women, 45.2% (N = 33) attended VIA screening for follow-up, 21.2% (N = 7) of whom screened positive; five received treatment and two were missing clinical follow-up records. Of the 121 women in the VIA arm who attended screening, 13.2% (N = 16) screened positive; seven received cryotherapy, three refused treatment, five were referred to colposcopy; and one woman had suspected cervical cancer and received treatment after confirmatory testing. This pilot study demonstrated trial feasibility and willingness of the women to participate and be randomised successfully into the two arms. Self-collection-based cervical cancer screening had a higher uptake than VIA. © 2015 John Wiley & Sons Ltd.

  12. Preliminary Tests For Development Of A Non-Pertechnetate Analysis Method

    Energy Technology Data Exchange (ETDEWEB)

    Diprete, D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); McCabe, D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2016-09-28

    The objective of this task was to develop a non-pertechnetate analysis method that 222-S lab could easily implement. The initial scope involved working with 222-S laboratory personnel to adapt the existing Tc analytical method to fractionate the non-pertechnetate and pertechnetate. SRNL then developed and tested a method using commercial sorbents containing Aliquat® 336 to extract the pertechnetate (thereby separating it from non-pertechnetate), followed by oxidation, extraction, and stripping steps, and finally analysis by beta counting and Mass Spectroscopy. Several additional items were partially investigated, including impacts of a 137Cs removal step. The method was initially tested on SRS tank waste samples to determine its viability. Although SRS tank waste does not contain non-pertechnetate, testing with it was useful to investigate the compatibility, separation efficiency, interference removal efficacy, and method sensitivity.

  13. Testing a Preliminary Live with Love Conceptual Framework for cancer couple dyads: A mixed-methods study.

    Science.gov (United States)

    Li, Qiuping; Xu, Yinghua; Zhou, Huiya; Loke, Alice Yuen

    2015-12-01

    The purpose of this study was to test the previous proposed Preliminary Live with Love Conceptual Framework (P-LLCF) that focuses on spousal caregiver-patient couples in their journey of coping with cancer as dyads. A mixed-methods study that included qualitative and quantitative approaches was conducted. Methods of concept and theory analysis, and structural equation modeling (SEM) were applied in testing the P-LLCF. In the qualitative approach in testing the concepts included in the P-LLCF, a comparison was made between the P-LLCF with a preliminary conceptual framework derived from focus group interviews among Chinese couples' coping with cancer. The comparison showed that the concepts identified in the P-LLCF are relevant to the phenomenon under scrutiny, and attributes of the concepts are consistent with those identified among Chinese cancer couple dyads. In the quantitative study, 117 cancer couples were recruited. The findings showed that inter-relationships exist among the components included in the P-LLCF: event situation, dyadic mediators, dyadic appraisal, dyadic coping, and dyadic outcomes. In that the event situation will impact the dyadic outcomes directly or indirectly through Dyadic Mediators. The dyadic mediators, dyadic appraisal, and dyadic coping are interrelated and work together to benefit the dyadic outcomes. This study provides evidence that supports the interlinked components and the relationship included in the P-LLCF. The findings of this study are important in that they provide healthcare professionals with guidance and directions according to the P-LLCF on how to plan supportive programs for couples coping with cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. An analysis of normalization methods for Drosophila RNAi genomic screens and development of a robust validation scheme

    Science.gov (United States)

    Wiles, Amy M.; Ravi, Dashnamoorthy; Bhavani, Selvaraj; Bishop, Alexander J.R.

    2010-01-01

    Genome-wide RNAi screening is a powerful, yet relatively immature technology that allows investigation into the role of individual genes in a process of choice. Most RNAi screens identify a large number of genes with a continuous gradient in the assessed phenotype. Screeners must then decide whether to examine just those genes with the most robust phenotype or to examine the full gradient of genes that cause an effect and how to identify the candidate genes to be validated. We have used RNAi in Drosophila cells to examine viability in a 384-well plate format and compare two screens, untreated control and treatment. We compare multiple normalization methods, which take advantage of different features within the data, including quantile normalization, background subtraction, scaling, cellHTS2 1, and interquartile range measurement. Considering the false-positive potential that arises from RNAi technology, a robust validation method was designed for the purpose of gene selection for future investigations. In a retrospective analysis, we describe the use of validation data to evaluate each normalization method. While no normalization method worked ideally, we found that a combination of two methods, background subtraction followed by quantile normalization and cellHTS2, at different thresholds, captures the most dependable and diverse candidate genes. Thresholds are suggested depending on whether a few candidate genes are desired or a more extensive systems level analysis is sought. In summary, our normalization approaches and experimental design to perform validation experiments are likely to apply to those high-throughput screening systems attempting to identify genes for systems level analysis. PMID:18753689

  15. Wastewater screening method for evaluating applicability of zero-valent iron to industrial wastewater

    International Nuclear Information System (INIS)

    Lee, J.W.; Cha, D.K.; Oh, Y.K.; Ko, K.B.; Jin, S.H.

    2010-01-01

    This study presents a screening protocol to evaluate the applicability of the ZVI pretreatment to various industrial wastewaters of which major constituents are not identified. The screening protocol consisted of a sequential analysis of UV-vis spectrophotometry, high-performance liquid chromatograph (HPLC), and bioassay. The UV-vis and HPLC analyses represented the potential reductive transformation of unknown constituents in wastewater by the ZVI. The UV-vis and HPLC results were quantified using principal component analysis (PCA) and Euclidian distance (ED). The short-term bioassay was used to assess the increased biodegradability of wastewater constituents after ZVI treatment. The screening protocol was applied to seven different types of real industrial wastewaters. After identifying one wastewater as the best candidate for the ZVI treatment, the benefit of ZVI pretreatment was verified through continuous operation of an integrated iron-sequencing batch reactor (SBR) resulting in the increased organic removal efficiency compared to the control. The iron pretreatment was suggested as an economical option to modify some costly physico-chemical processes in the existing wastewater treatment facility. The screening protocol could be used as a robust strategy to estimate the applicability of ZVI pretreatment to a certain wastewater with unknown composition.

  16. A high-throughput screening method for determining the substrate scope of nitrilases.

    Science.gov (United States)

    Black, Gary W; Brown, Nicola L; Perry, Justin J B; Randall, P David; Turnbull, Graeme; Zhang, Meng

    2015-02-14

    Nitrile compounds are intermediates in the synthesis of pharmaceuticals such as atorvastatin. We have developed a chromogenic reagent to screen for nitrilase activity as an alternative to Nessler's reagent. It produces a semi-quantifiable blue colour and hydrolysis of 38 nitrile substrates by 23 nitrilases as cell-free extracts has been shown.

  17. A simple DNA recombination screening method by RT-PCR as an alternative to Southern blot

    DEFF Research Database (Denmark)

    Albers, Eliene; Sbroggiò, Mauro; Martin Gonzalez, Javier

    2017-01-01

    The generation of genetically engineered mouse models (GEMMs), including knock-out (KO) and knock-in (KI) models, often requires genomic screening of many mouse ES cell (mESC) clones by Southern blot. The use of large targeting constructs facilitates the recombination of exogenous DNA in a specific...

  18. New methods for the screening of antioxidants in three Sideritis species

    NARCIS (Netherlands)

    Koleva, I.

    2007-01-01

    This thesis describes the rapid and robust evaluation of antioxidant activity of complex mixtures such as plant extracts. The study was directed to establish the best screening and isolation procedures for components with antioxidative properties to ensure the development of an “algorithm” for

  19. Using pre-screening methods for an effective and reliable site characterization at megasites

    DEFF Research Database (Denmark)

    Nielsen, Mette Algreen; Kalisz, Mariusz; Stalder, Marcel

    2015-01-01

    also expanded the applicabilityof tree coring to BTEX compounds and tested the use ofhigh-resolution direct-push sensors for light hydrocarbons.Comparison of screening results to results from conventionalsoil and groundwater sampling yielded in most cases high rankcorrelation and confirmed the findings...

  20. Evaluating Method Engineer Performance: an error classification and preliminary empirical study

    Directory of Open Access Journals (Sweden)

    Steven Kelly

    1998-11-01

    Full Text Available We describe an approach to empirically test the use of metaCASE environments to model methods. Both diagrams and matrices have been proposed as a means for presenting the methods. These different paradigms may have their own effects on how easily and well users can model methods. We extend Batra's classification of errors in data modelling to cover metamodelling, and use it to measure the performance of a group of metamodellers using either diagrams or matrices. The tentative results from this pilot study confirm the usefulness of the classification, and show some interesting differences between the paradigms.

  1. Preliminary experimental study on the deterioration of cementitious materials by an acceleration method

    International Nuclear Information System (INIS)

    Saito, H.; Nakane, S.; Ikari, S.; Fujiwara, A.

    1992-01-01

    Development of a deterioration model for cementitious materials is important in assessing long-term integrity of nuclear waste repositories. The authors preliminarily examined a new test method for acceleration of aging of mortar specimens by application of electrical potential gradients and observed whether the method could throw light on the deterioration process of cementitious materials under repository conditions. As a result, it was concluded that the application of a potential gradient to a mortar specimen might be useful as an accelerated test method for assessing the deterioration behavior of cementitious materials due to leaching. (orig.)

  2. Developing and validating a perinatal depression screening tool in Kenya blending Western criteria with local idioms: A mixed methods study.

    Science.gov (United States)

    Green, Eric P; Tuli, Hawa; Kwobah, Edith; Menya, D; Chesire, Irene; Schmidt, Christina

    2018-03-01

    Routine screening for perinatal depression is not common in most primary health care settings. The U.S. Preventive Services Task Force only recently updated their recommendation on depression screening to specifically recommend screening during the pre- and postpartum periods. While practitioners in high-income countries can respond to this new recommendation by implementing one of several existing depression screening tools developed in Western contexts, such as the Edinburgh Postnatal Depression Scale (EPDS) or the Patient Health Questionnaire-9 (PHQ-9), these tools lack strong evidence of cross-cultural equivalence, validity for case finding, and precision in measuring response to treatment in developing countries. Thus, there is a critical need to develop and validate new screening tools for perinatal depression that can be used by lay health workers, primary health care personnel, and patients. Working in rural Kenya, we used free listing, card sorting, and item analysis methods to develop a locally-relevant screening tool that blended Western psychiatric concepts with local idioms of distress. We conducted a validation study with a random sample of 193 pregnant women and new mothers to test the diagnostic accuracy of this scale along with the EPDS and PHQ-9. The sensitivity/specificity of the EPDS and PHQ-9 was estimated to be 0.70/0.72 and 0.70/0.73, respectively. This compared to sensitivity/specificity of 0.90/0.90 for a new 9-item locally-developed tool called the Perinatal Depression Screening (PDEPS). Across these three tools, internal consistency reliability ranged from 0.77 to 0.81 and test-retest reliability ranged from 0.57 to 0.67. The prevalence of depression ranges from 5.2% to 6.2% depending on the clinical reference standard. The EPDS and PHQ-9 are valid and reliable screening tools for perinatal depression in rural Western Kenya, the PDEPS may be a more useful alternative. At less than 10%, the prevalence of depression in this region appears

  3. A highly sensitive and specific method for the screening detection of genetically modified organisms based on digital PCR without pretreatment.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang

    2015-08-04

    Digital PCR has developed rapidly since it was first reported in the 1990 s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products.

  4. Species identification in meat products: A new screening method based on high resolution melting analysis of cyt b gene.

    Science.gov (United States)

    Lopez-Oceja, A; Nuñez, C; Baeta, M; Gamarra, D; de Pancorbo, M M

    2017-12-15

    Meat adulteration by substitution with lower value products and/or mislabeling involves economic, health, quality and socio-religious issues. Therefore, identification and traceability of meat species has become an important subject to detect possible fraudulent practices. In the present study the development of a high resolution melt (HRM) screening method for the identification of eight common meat species is reported. Samples from Bos taurus, Ovis aries, Sus scrofa domestica, Equus caballus, Oryctolagus cuniculus, Gallus gallus domesticus, Meleagris gallopavo and Coturnix coturnix were analyzed through the amplification of a 148 bp fragment from the cyt b gene with a universal primer pair in HRM analyses. Melting profiles from each species, as well as from several DNA mixtures of these species and blind samples, allowed a successful species differentiation. The results demonstrated that the HRM method here proposed is a fast, reliable, and low-cost screening technique. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Scatter correction method with primary modulator for dual energy digital radiography: a preliminary study

    Science.gov (United States)

    Jo, Byung-Du; Lee, Young-Jin; Kim, Dae-Hong; Jeon, Pil-Hyun; Kim, Hee-Joung

    2014-03-01

    In conventional digital radiography (DR) using a dual energy subtraction technique, a significant fraction of the detected photons are scattered within the body, resulting in the scatter component. Scattered radiation can significantly deteriorate image quality in diagnostic X-ray imaging systems. Various methods of scatter correction, including both measurement and non-measurement-based methods have been proposed in the past. Both methods can reduce scatter artifacts in images. However, non-measurement-based methods require a homogeneous object and have insufficient scatter component correction. Therefore, we employed a measurement-based method to correct for the scatter component of inhomogeneous objects from dual energy DR (DEDR) images. We performed a simulation study using a Monte Carlo simulation with a primary modulator, which is a measurement-based method for the DEDR system. The primary modulator, which has a checkerboard pattern, was used to modulate primary radiation. Cylindrical phantoms of variable size were used to quantify imaging performance. For scatter estimation, we used Discrete Fourier Transform filtering. The primary modulation method was evaluated using a cylindrical phantom in the DEDR system. The scatter components were accurately removed using a primary modulator. When the results acquired with scatter correction and without correction were compared, the average contrast-to-noise ratio (CNR) with the correction was 1.35 times higher than that obtained without correction, and the average root mean square error (RMSE) with the correction was 38.00% better than that without correction. In the subtraction study, the average CNR with correction was 2.04 (aluminum subtraction) and 1.38 (polymethyl methacrylate (PMMA) subtraction) times higher than that obtained without the correction. The analysis demonstrated the accuracy of scatter correction and the improvement of image quality using a primary modulator and showed the feasibility of

  6. Preliminary results of a screening program for anal cancer and its precursors for HIV-infected men who have sex with men in Vigo-Spain

    Directory of Open Access Journals (Sweden)

    Mauricio Iribarren-Díaz

    Full Text Available Background and aims: Men who have sex with men (MSM infected with human immunodeficiency virus (HIV have the highest risk of developing anal cancer (AC. The objective of this study was to describe our screening implementation program in this population, and report the prevalence of human papillomavirus (HPV anal infection, and cytological and histological findings in a Spanish medium-size community (Vigo, Spain. Method: Prospective cohort analysis of 240 HIV-infected MSM. Cellular anal sample and high risk HPV (HR-HPV-tests were performed to study cytological changes and HPV genotyping. High resolution anoscopy (HRA was performed in 209 patients. Results were analyzed with respect to epidemiological, clinical and analytical factors. Results: Of 209 patients selected for HRA, the prevalence of HR-HPV anal infection, cytological and histological alterations was 85.6%, 47.5%, and 39.8%, respectively. Sensitivity and specificity for ≥ ASCUS (atypia of squamous cells of undetermined significance cytology in relation to histological alterations were 61% and 85%, (OR: 8.7; IC 95%: 4.4-17.2, respectively. Observed concordance between high-grade squamous intraepithelial lesion (HSIL cytology and HSIL anal intraepithelial neoplasia types 2 and 3 (AIN-2/3 histology was 64% (OR: 11.4; IC 95%: 3.6-36.7. One patient with HSIL cytology presented a prevalent anal squamous carcinoma. Conclusions: HRA was feasible with similar results to relevant groups. There was a high prevalence of anal HR-HPV infection, and cytological and histological alterations.

  7. Development and implementation of a screening method to categorise the greenhouse gas mitigation potential of 91 landfills

    DEFF Research Database (Denmark)

    Fredenslund, Anders Michael; Mønster, Jacob; Kjeldsen, Peter

    2018-01-01

    A cost-effective screening method for assessing methane emissions was developed and employed to categorise 91 older Danish landfills into three categories defined by the magnitude of their emissions. The overall aim was to assess whether these landfills were relevant or irrelevant with respect...... to variations in input parameters. Of the 91 landfills in the survey, 25 were found to be relevant for biocover construction when the methane emission threshold was set at 2 kg CH4 h−1....

  8. Determination of the Modulation Transfer Function of Screen-Film Combinations in X-ray photography by the grating method

    International Nuclear Information System (INIS)

    Hoeschen, D.

    1987-01-01

    An intercomparison experiment concerning the determination of the Modulation Transfer Function (MTF) of Screen-Film Combinations in x-ray photography by the grating method was made. Six laboratories located in four countries participated. Each laboratory has used its own, individually developed measurement procedure. The results have shown a surprisingly good agreement, the standard deviation (1 σ value) of MTF values reported by the different laboratories was about ± 0.02

  9. High Throughput Screening Method for Systematic Surveillance of Drugs of Abuse by Multisegment Injection-Capillary Electrophoresis-Mass Spectrometry.

    Science.gov (United States)

    DiBattista, Alicia; Rampersaud, Dianne; Lee, Howard; Kim, Marcus; Britz-McKibbin, Philip

    2017-11-07

    New technologies are urgently required for reliable drug screening given a worldwide epidemic of prescription drug abuse and its devastating socioeconomic impacts on public health. Primary screening of drugs of abuse (DoA) currently relies on immunoassays that are prone to bias and are not applicable to detect an alarming array of psychoactive stimulants, tranquilizers, and synthetic opioids. These limitations impact patient safety when monitoring for medication compliance, drug substitution, or misuse/abuse and require follow-up confirmatory testing by more specific yet lower throughput instrumental methods. Herein, we introduce a high throughput platform for nontargeted screening of a broad spectrum of DoA and their metabolites based on multisegment injection-capillary electrophoresis-mass spectrometry (MSI-CE-MS). We demonstrate that MSI-CE-MS enables serial injections of 10 samples within a single run (high resolution MS with full-scan data acquisition. Unambiguous drug identification was achieved by four or more independent parameters, including comigration with a deuterated internal standard or in silico prediction of electromigration behavior together with accurate mass, most likely molecular formula, as well as MS/MS as required for confirmation testing. Acceptable precision was demonstrated for over 50 DoA at 3 concentration levels over 4 days (median coefficient of variance = 13%, n = 117) with minimal ion suppression, isobaric interferences, and sample carry-over (screening cutoff levels in human urine while allowing for systematic surveillance, specimen verification, and retrospective testing of designer drugs that elude conventional drug tests.

  10. A Systematic Protein Refolding Screen Method using the DGR Approach Reveals that Time and Secondary TSA are Essential Variables.

    Science.gov (United States)

    Wang, Yuanze; van Oosterwijk, Niels; Ali, Ameena M; Adawy, Alaa; Anindya, Atsarina L; Dömling, Alexander S S; Groves, Matthew R

    2017-08-24

    Refolding of proteins derived from inclusion bodies is very promising as it can provide a reliable source of target proteins of high purity. However, inclusion body-based protein production is often limited by the lack of techniques for the detection of correctly refolded protein. Thus, the selection of the refolding conditions is mostly achieved using trial and error approaches and is thus a time-consuming process. In this study, we use the latest developments in the differential scanning fluorimetry guided refolding approach as an analytical method to detect correctly refolded protein. We describe a systematic buffer screen that contains a 96-well primary pH-refolding screen in conjunction with a secondary additive screen. Our research demonstrates that this approach could be applied for determining refolding conditions for several proteins. In addition, it revealed which "helper" molecules, such as arginine and additives are essential. Four different proteins: HA-RBD, MDM2, IL-17A and PD-L1 were used to validate our refolding approach. Our systematic protocol evaluates the impact of the "helper" molecules, the pH, buffer system and time on the protein refolding process in a high-throughput fashion. Finally, we demonstrate that refolding time and a secondary thermal shift assay buffer screen are critical factors for improving refolding efficiency.

  11. IAEA intercomparison of methods for processing Ge(Li) gamma-ray spectra: a preliminary report

    International Nuclear Information System (INIS)

    Parr, R.M.; Houtermans, H.; Schaerf, K.

    1979-01-01

    Nine spectra were provided, each covering an energy range of about 1 MeV and, with one exception, containing only well-separated single peaks; the exception was a spectrum containing double peaks. The intercomparison enables the user to test the ability of his methods: (1) to detect small peaks near the limit of detectability, (2) to determine the positions and areas of more easily detectable peaks, and (3) to determine the positions and areas of overlapping double peaks. A total of 212 sets of results was finally received for evaluation from 163 laboratories in 34 member states of the IAEA. For all the different types of tests involved, the methods reported covered a wide range of performance. Classification of these methods did not reveal any group offering a significantly restricted range of performance, though some groups of methods did appear, in the best hands, to be capable of producing better results than others: (1) for peak detection: visual methods and the use of the second derivative, (2) for peak-position (single peaks) determination: the fitting of a parabola or modified Gaussian function, and (3) for peak-area (single peaks) and peak-position and area (double peaks) determination: the fitting of a modified Gaussian function. Many methods reported gave either no estimates or poor estimates of error. With the exception of manual methods, the operating environment (e.g., large or small computer) did not appear to have any significant influence on the results. A comparison of four commonly used computer programs showed that the best results were obtained by SAMPO

  12. Large-scale systematic analysis of 2D fingerprint methods and parameters to improve virtual screening enrichments.

    Science.gov (United States)

    Sastry, Madhavi; Lowrie, Jeffrey F; Dixon, Steven L; Sherman, Woody

    2010-05-24

    A systematic virtual screening study on 11 pharmaceutically relevant targets has been conducted to investigate the interrelation between 8 two-dimensional (2D) fingerprinting methods, 13 atom-typing schemes, 13 bit scaling rules, and 12 similarity metrics using the new cheminformatics package Canvas. In total, 157 872 virtual screens were performed to assess the ability of each combination of parameters to identify actives in a database screen. In general, fingerprint methods, such as MOLPRINT2D, Radial, and Dendritic that encode information about local environment beyond simple linear paths outperformed other fingerprint methods. Atom-typing schemes with more specific information, such as Daylight, Mol2, and Carhart were generally superior to more generic atom-typing schemes. Enrichment factors across all targets were improved considerably with the best settings, although no single set of parameters performed optimally on all targets. The size of the addressable bit space for the fingerprints was also explored, and it was found to have a substantial impact on enrichments. Small bit spaces, such as 1024, resulted in many collisions and in a significant degradation in enrichments compared to larger bit spaces that avoid collisions.

  13. Evaluation of the usefulness of visceral fat area measurement by the bioelectrical impedance method during workplace health screening

    International Nuclear Information System (INIS)

    Igarashi, Chiyo

    2008-01-01

    In the field of occupational health, health guidance concerning obesity is often conducted in order to prevent lifestyle-related diseases. With recent awareness of the concept of metabolic syndrome, measurement of the visceral fat area (VFA) by CT has been useful for health guidance, but it is difficult in workplace health screening. Presently, the BMI (Body Mass Index), body fat percentage measured by the bioelectrical impedance method, and waist girth at the umbilical level (abdominal girth) are practical indices of obesity used in such health screening. In this study, VAF was measured in 590 clerical or sales workers in the manufacturing industry using a body fat meter capable of a visceral fat measurement by the bioelectrical impedance method. The relationship of this value to the results of biochemical tests and lifestyle was then evaluated using analysis of covariance structures. Analysis indicated that the risk of lifestyle-related disease was closely related to the degree of obesity. Among indices of the degree of obesity, VFA was more closely related than BMI or body fat percentage, and only slightly less closely related than abdominal girth to the risk of lifestyle-related diseases. Since VFA is effective in screening for latent obesity, health guidance based on digital data, and the subjects' body imaging, its measurement by the bioelectrical impedance method is considered useful for workplace health management. (author)

  14. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening.

    Science.gov (United States)

    Köferle, Anna; Worf, Karolina; Breunig, Christopher; Baumann, Valentin; Herrero, Javier; Wiesbeck, Maximilian; Hutter, Lukas H; Götz, Magdalena; Fuchs, Christiane; Beck, Stephan; Stricker, Stefan H

    2016-11-14

    The bacterial CRISPR system is fast becoming the most popular genetic and epigenetic engineering tool due to its universal applicability and adaptability. The desire to deploy CRISPR-based methods in a large variety of species and contexts has created an urgent need for the development of easy, time- and cost-effective methods enabling large-scale screening approaches. Here we describe CORALINA (comprehensive gRNA library generation through controlled nuclease activity), a method for the generation of comprehensive gRNA libraries for CRISPR-based screens. CORALINA gRNA libraries can be derived from any source of DNA without the need of complex oligonucleotide synthesis. We show the utility of CORALINA for human and mouse genomic DNA, its reproducibility in covering the most relevant genomic features including regulatory, coding and non-coding sequences and confirm the functionality of CORALINA generated gRNAs. The simplicity and cost-effectiveness make CORALINA suitable for any experimental system. The unprecedented sequence complexities obtainable with CORALINA libraries are a necessary pre-requisite for less biased large scale genomic and epigenomic screens.

  15. Preliminary Structural Sensitivity Study of Hypersonic Inflatable Aerodynamic Decelerator Using Probabilistic Methods

    Science.gov (United States)

    Lyle, Karen H.

    2014-01-01

    Acceptance of new spacecraft structural architectures and concepts requires validated design methods to minimize the expense involved with technology validation via flighttesting. This paper explores the implementation of probabilistic methods in the sensitivity analysis of the structural response of a Hypersonic Inflatable Aerodynamic Decelerator (HIAD). HIAD architectures are attractive for spacecraft deceleration because they are lightweight, store compactly, and utilize the atmosphere to decelerate a spacecraft during re-entry. However, designers are hesitant to include these inflatable approaches for large payloads or spacecraft because of the lack of flight validation. In the example presented here, the structural parameters of an existing HIAD model have been varied to illustrate the design approach utilizing uncertainty-based methods. Surrogate models have been used to reduce computational expense several orders of magnitude. The suitability of the design is based on assessing variation in the resulting cone angle. The acceptable cone angle variation would rely on the aerodynamic requirements.

  16. Preliminary report on an intercomparison of methods for processing Ge(Li) gamma-ray spectra

    International Nuclear Information System (INIS)

    Parr, R.M.; Houtermans, H.; Schaerf, K.

    1978-01-01

    An intercomparison has been organized by the IAEA for the purpose of evaluating methods for processing Ge(Li) gamma-ray spectra. These spectra cover an energy range of about 1MeV and, with one exception, contain only well separated single peaks; another spectrum contains double peaks with various relative intensities and degrees of overlap. The spectra were prepared in such a way that the areas and positions of all peaks, relative to a standard spectrum which is also provided, are known exactly. The intercomparison enables the user to test the ability of his methods (1) to detect small peaks near the limit of detectability; (2) to determine the position and area of more easily detectable peaks, and (3) to determine the position and area of overlapping double peaks. The method of preparation of the spectra and the organization of the intercomparison are described in this report. (author)

  17. Preliminary assessment of a method utilizing carbon dioxide and steelmaking slags to produce precipitated calcium carbonate

    International Nuclear Information System (INIS)

    Eloneva, Sanni; Said, Arshe; Fogelholm, Carl-Johan; Zevenhoven, Ron

    2012-01-01

    Highlights: ► An NH 4 -salt-based method utilizes CO 2 and steelmaking slags to produce pure CaCO 3 . ► It was determined if its economic potential warrants moving forward. ► Despite small solvent losses, the method was found to have economical potential. ► The method has significant CO 2 emissions reduction potential. ► Scaling up the reactor will allow for a more detailed design for the process. -- Abstract: One of the options that can contribute to the reduction of carbon dioxide emissions for climate change mitigation is the so-called CO 2 sequestration by mineral carbonation, or CO 2 mineral sequestration. Steel manufacturing could benefit from this option by utilizing its own by-products, i.e. steelmaking slags to combine with CO 2 . We have recently studied a method, where aqueous solution of ammonium salt (e.g. ammonium acetate, ammonium nitrate and ammonium chloride) is used to extract calcium selectively from the steel converter slag, followed by precipitation of pure calcium carbonate by bubbling CO 2 through the produced solution. The ammonium salt solution is recovered and re-used. The purpose of this research was to determine if the economic potential of the method warrants moving forward to large-scale application. Despite the small solvent losses, the method was found to have economical potential. In addition, it has significant CO 2 emission reduction potential as well. Scaling up the reactor from the small laboratory scale will allow more detailed design for the process to be made followed by a full economical evaluation including all of the important operational and capital investment costs.

  18. Semiautomatic volume of interest drawing for 18F-FDG image analysis - method and preliminary results

    International Nuclear Information System (INIS)

    Green, A.J.; Baig, S.; Begent, R.H.J.; Francis, R.J.

    2008-01-01

    Functional imaging of cancer adds important information to the conventional measurements in monitoring response. Serial 18 F-fluorodeoxyglucose (FDG) positron emission tomography (PET), which indicates changes in glucose metabolism in tumours, shows great promise for this. However, there is a need for a method to quantitate alterations in uptake of FDG, which accounts for changes in tumour volume and intensity of FDG uptake. Selection of regions or volumes [ROI or volumes of interest (VOI)] by hand drawing, or simple thresholding, suffers from operator-dependent drawbacks. We present a simple, robust VOI growing method for this application. The method requires a single seed point within the visualised tumour and another in relevant normal tissue. The drawn tumour VOI is insensitive to the operator inconsistency and is, thus, a suitable basis for comparative measurements. The method is validated using a software phantom. We demonstrate the use of the method in the assessment of tumour response in 31 patients receiving chemotherapy for various carcinomas. Valid assessment of tumour response could be made 2-4 weeks after starting chemotherapy, giving information for clinical decision making which would otherwise have taken 9-12 weeks. Survival was predicted from FDG-PET 2-4 weeks after starting chemotherapy (p = 0.04) and after 9-12 weeks FDG-PET gave a better prediction of survival (p = 0.002) than CT or MRI (p = 0.015). FDG-PET using this method of analysis has potential as a routine tool for optimising use of chemotherapy and improving its cost effectiveness. It also has potential for increasing the accuracy of response assessment in clinical trials of novel therapies. (orig.)

  19. Preliminary analysis of resonance effect by Helmholtz-Schrödinger method

    International Nuclear Information System (INIS)

    Er-Yan, Yan; Fan-Bao, Meng; Hong-Ge, Ma; Chao-Yang, Chen

    2010-01-01

    The Helmholtz-Schrödinger method is employed to study the electric field standing wave caused by coupling through a simple slot. There is a good agreement between the numerical results and the resonant conditions presented by the Helmholtz—Schrödinger method. Thus, it can be used in similar cases where the amplitude of the electric field is the important quantity or eigenfunctions of the Schrödinger equation are needed for complicated quantum structures with hard wall boundary conditions. (general)

  20. Structural analysis of salt cavities formed by solution mining: I. Method of analysis and preliminary results for spherical cavities

    International Nuclear Information System (INIS)

    Fossum, A.F.

    1976-01-01

    The primary objective of this effort is an analysis of the structural stability of cavities formed by solution mining in salt domes. In particular, the effects of depth (i.e. initial state of in situ stress), shape, volume (i.e. physical dimensions of the cavity), and sequence of salt excavation/fluid evacuation on the timewise structural stability of a cavity are of interest. It is anticipated that an assessment can be made of the interrelation between depth, cavern size, and cavern shape or of the practical limits therewith. In general, the cavity shape is assumed to be axisymmetric and the salt is assumed to exhibit nonlinear creep behavior. The primary emphasis is placed on the methodology of the finite element analysis, and the results of preliminary calculations for a spherically shaped cavity. It is common practice for engineers to apply elasticity theory to the behavior of rock in order to obtain near field stresses and displacements around an underground excavation in an effort to assess structural stability. Rock masses, particularly at depth, may be subjected to a rather complex state of initial stress, and may be nonhomogeneous and anisotropic. If one also includes complex geometrical excavation shape, the use of analytical techniques as an analysis tool is practically impossible. Thus, it is almost a necessity that approximate solution techniques be employed. In this regard, the finite element method is ideal as it can handle complex geometries and nonlinear material behavior with relative ease. An unusual feature of the present study is the incorporation into the finite element code of a procedure for handling the gradual creation or excavation of an underground cavity. During the excavation sequence, the salt is permitted to exhibit nonlinear stress-strain-time dependence. The bulk of this report will be devoted to a description of the analysis procedures, together with a preliminary calculation for a spherically shaped cavity

  1. Preliminary Proceedings First International Workshop on Formal Methods for WirelessSystems

    DEFF Research Database (Denmark)

    The FMWS workshops aim at bringing together researchers interested in formal methods for wireless systems, more specifically in theories for semantics, logics, and verification techniques for wireless systems. Wireless systems are rapidly increasing their success in real-world applications while...

  2. Establishing even-age northern hardwood regeneration by the shelterwood method--a preliminary guide.

    Science.gov (United States)

    Richard M. Godman; Carl H. Tubbs

    1973-01-01

    The shelterwood system of regeneration with northern hardwoods is a reliable method of obtaining even-age stands of both tolerant and moderately tolerant species. Details of applying the two-cut system are described along with the necessary modifications for encouraging moderately tolerant species.

  3. Preliminary research on quantitative methods of water resources carrying capacity based on water resources balance sheet

    Science.gov (United States)

    Wang, Yanqiu; Huang, Xiaorong; Gao, Linyun; Guo, Biying; Ma, Kai

    2018-06-01

    Water resources are not only basic natural resources, but also strategic economic resources and ecological control factors. Water resources carrying capacity constrains the sustainable development of regional economy and society. Studies of water resources carrying capacity can provide helpful information about how the socioeconomic system is both supported and restrained by the water resources system. Based on the research of different scholars, major problems in the study of water resources carrying capacity were summarized as follows: the definition of water resources carrying capacity is not yet unified; the methods of carrying capacity quantification based on the definition of inconsistency are poor in operability; the current quantitative research methods of water resources carrying capacity did not fully reflect the principles of sustainable development; it is difficult to quantify the relationship among the water resources, economic society and ecological environment. Therefore, it is necessary to develop a better quantitative evaluation method to determine the regional water resources carrying capacity. This paper proposes a new approach to quantifying water resources carrying capacity (that is, through the compilation of the water resources balance sheet) to get a grasp of the regional water resources depletion and water environmental degradation (as well as regional water resources stock assets and liabilities), figure out the squeeze of socioeconomic activities on the environment, and discuss the quantitative calculation methods and technical route of water resources carrying capacity which are able to embody the substance of sustainable development.

  4. Determination of molybdenum (VI) in sea water with preliminary concentration by the method of ion flotation

    International Nuclear Information System (INIS)

    Andreeva, I. Yu.; Drapchinskaya, O.L.; Lebedeva, L.I.

    1985-01-01

    The purpose of this paper is to assess the feasibility of using the method of ion flotation for the concentration of microamounts of molybdenum (VI) during determination in sea water. The ion flotation method is used for the purification of industrial sewage from the ions of nonferrous metals, including molybdenum (VI) with its content of up to 50 mg/liter. A 1.10 -4 M solution of sodium molybdate in 0.1M NaOH was used. The effect of different factors on the ion flotation process of molybdenum (VI) was investigated: pH of the solution, flotation times, concentrations of surface-active substances (SAS), molybdenum (IV), extraneous salts. Data presented show that the ion flotation method in conjunction with the photometric method of determining molybdenum with brompyrogallol red (BPR) and cetylpridinium chloride (CP) (limit of detection 0.02 micrograms/liter) allows the content of molybdenum (VI) in sea water to be established with sufficient reliability and reproducibility

  5. Preliminary assessment of alternative dry storage methods for the storage of commercial spent nuclear fuel

    International Nuclear Information System (INIS)

    1981-11-01

    This report presents the results of an assessment of the (1) state of technology, (2) licensability, (3) implementation schedule, and (4) costs of alternative dry methods for storage of spent fuel at a reactor location when used to supplement reactor pool storage facilities. The methods of storage that were considered included storage in casks, drywells, concrete silos and air-cooled vaults. The impact of disassembly of spent fuel and storage of consolidated fuel rods was also determined. The economic assessments were made based on the current projected storage requirements of Virginia Electric and Power Company's Surry Station for the period 1985 to 2009, which has two operating pressurized water reactors (824 MWe each). It was estimated that the unit cost for storage of spent fuel in casks would amount to $117/kgU and that such costs for storage in drywells would amount to $137/kgU. However, based on the overall assessment it was concluded both storage methods were equal in merit. Modular methods of storage were generally found to be more economic than those requiring all or most of the facilities to be constructed prior to commencement of storage operations

  6. Visual Research Methods: A Novel Approach To Understanding The Experiences of Compulsive Hoarders: A Preliminary Study

    Directory of Open Access Journals (Sweden)

    Satwant Singh

    2012-04-01

    Conclusion: The study concluded that the experience of hoarding is both psychologically and physically distressing with numerous impacts upon everyday living and relationships. The study also concluded that visual research methods may be particularly helpful when generating qualitative evidence within this specialist field. [JCBPR 2012; 1(1.000: 36-42

  7. Comparison of three radiographic methods in screening of temporomandibular joint involvement in patients with psoriatic arthritis

    International Nuclear Information System (INIS)

    Koenoenen, M.; Kilpinen, E.

    1990-01-01

    Fifty-three randomly selected subjects with psoriatic arthritis (PA) were examined radiographically by means of orthopantomography, transcranial radiography, and transmaxillary radiography. Two examiners graded the radiographic signs of flattening, osteophytes, erosion, and sclerosis. The findings obtained were then compared to determine the best technique for screening of temporomandibular joint (TMJ) bone changes. Together the techniques showed definite (24%) and possible (6%) changes, suggesting TMJ involvement in 31 of 106 joints. In all projections, radiographic signs suggesting TMJ involvement were most frequent in the condyle. Erosion in the condyle was the most frequent finding. Agreement with regard to definite changes in the condyle was found in only one-third to half of the cases. It is concluded that in radiography of the TMJ in subjects with PA, a combination of radiographic techniques should be used to obtain maximum information. However, orthopantomography is well suited for screening of TMJ involvement in subjects with PA. 30 refs., 2 figs., 3 tabs

  8. Method for Screening Compounds That Influence Virulence Gene Expression in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Nielsen, A.; Nielsen, Kristian Fog; Frees, D.

    2010-01-01

    We present a simple assay to examine effects of compounds on virulence gene expression in the human pathogen Staphylococcus aureus. The assay employs transcriptional reporter strains carrying lacZ fused to central virulence genes. Compounds affecting virulence gene expression and activity...... of the agr locus are scored based on color change in the presence of a chromogenic beta-galactosidase substrate. The assay can be used to screen for novel antivirulence compounds from many different sources, such as fungi, as demonstrated here....

  9. Multiparameter telemetry as a sensitive screening method to detect vaccine reactogenicity in mice.

    Directory of Open Access Journals (Sweden)

    Margarete Arras

    Full Text Available Refined vaccines and adjuvants are urgently needed to advance immunization against global infectious challenges such as HIV, hepatitis C, tuberculosis and malaria. Large-scale