SARDA HITL Preliminary Human Factors Measures and Analyses

Science.gov (United States)

Hyashi, Miwa; Dulchinos, Victoria

2012-01-01

Human factors data collected during the SARDA HITL Simulation Experiment include a variety of subjective measures, including the NASA TLX, questionnaire questions regarding situational awareness, advisory usefulness, UI usability, and controller trust. Preliminary analysis of the TLX data indicate that workload may not be adversely affected by use of the advisories, additionally, the controller's subjective ratings of the advisories may suggest acceptance of the tool.

The arabidopsis cyclic nucleotide interactome

KAUST Repository

Donaldson, Lara Elizabeth

2016-05-11

Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

Preliminary Analyses Showed Short-Term Mental Health Improvements after a Single-Day Manager Training.

Science.gov (United States)

Boysen, Elena; Schiller, Birgitta; Mörtl, Kathrin; Gündel, Harald; Hölzer, Michael

2018-01-10

Psychosocial working conditions attract more and more attention when it comes to mental health in the workplace. Trying to support managers to deal with their own as well as their employees' psychological risk factors, we conducted a specific manager training. Within this investigation, we wanted to learn about the training's effects and acceptance. A single-day manager training was provided in a large industrial company in Germany. The participants were asked to fill out questionnaires regarding their own physical and mental health condition as well as their working situation. Questionnaires were distributed at baseline, 3-month, and 12-month follow-up. At this point of time the investigation is still ongoing. The current article focuses on short-term preliminary effects. Analyses only included participants that already completed baseline and three months follow-up. Preliminary results from three-month follow-up survey ( n = 33, nmale = 30, Mage = 47.5) indicated positive changes in the manager's mental health condition measured by the Patient Health Questionnaire for depression (PHQ-9: Mt1 = 3.82, Mt2 = 3.15). Training managers about common mental disorders and risk factors at the workplace within a single-day workshop seems to promote positive effects on their own mental health. Especially working with the managers on their own early stress symptoms might have been an important element.

A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

Science.gov (United States)

Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

2012-01-01

Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

Science.gov (United States)

Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

2012-02-03

Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.

Science.gov (United States)

Woolfitt, A R; Kellett, G L; Hoggett, J G

1988-01-29

The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-10-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

Estimate at the nucleotide resolution level of genetic changes in the humans residing in the ecologically unfavourable regions of the Techa river

International Nuclear Information System (INIS)

Sojfer, V.N.; Petrova, N.V.; Timofeeva, O.A.; Filipenko, M.L.; Solov'eva, N.A.; Popovskij, A.V.; Vlasko, V.V.

1998-01-01

To study DNA at the nucleotide level of resolution in residents of settlements located along the Techa river, studies are performed by direct sequencing of gene sequences preliminary amplified and selected by means of analysis of changes of the conformation of DNA unifilament fragments (SSCP-method). Results are presented in details [ru

The arabidopsis cyclic nucleotide interactome

KAUST Repository

Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

2016-01-01

Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

Science.gov (United States)

Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

2017-09-01

In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

Science.gov (United States)

Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

2017-09-01

In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

Long-term gas and brine migration at the Waste Isolation Pilot Plant: Preliminary sensitivity analyses for post-closure 40 CFR 268 (RCRA), May 1992

International Nuclear Information System (INIS)

1992-12-01

This report describes preliminary probabilistic sensitivity analyses of long term gas and brine migration at the Waste Isolation Pilot Plant (WIPP). Because gas and brine are potential transport media for organic compounds and heavy metals, understanding two-phase flow in the repository and the surrounding Salado Formation is essential to evaluating long-term compliance with 40 CFR 268.6, which is the portion of the Land Disposal Restrictions of the Hazardous and Solid Waste Amendments to the Resource Conservation and Recovery Act that states the conditions for disposal of specified hazardous wastes. Calculations described here are designed to provide guidance to the WIPP Project by identifying important parameters and helping to recognize processes not yet modeled that may affect compliance. Based on these analyses, performance is sensitive to shaft-seal permeabilities, parameters affecting gas generation, and the conceptual model used for the disturbed rock zone surrounding the excavation. Brine migration is less likely to affect compliance with 40 CFR 268.6 than gas migration. However, results are preliminary, and additional iterations of uncertainty and sensitivity analyses will be required to provide the confidence needed for a defensible compliance evaluation. Specifically, subsequent analyses will explicitly include effects of salt creep and, when conceptual and computational models are available, pressure-dependent fracturing of anhydrite marker beds

Cyclic nucleotides and radioresistnace

International Nuclear Information System (INIS)

Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

1982-01-01

The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

Preliminary analyses of scenarios for potential human interference for repositories in three salt formations

International Nuclear Information System (INIS)

1985-10-01

Preliminary analyses of scenarios for human interference with the performance of a radioactive waste repository in a deep salt formation are presented. The following scenarios are analyzed: (1) the U-Tube Connection Scenario involving multiple connections between the repository and the overlying aquifer system; (2) the Single Borehole Intrusion Scenario involving penetration of the repository by an exploratory borehole that simultaneously connects the repository with overlying and underlying aquifers; and (3) the Pressure Release Scenario involving inflow of water to saturate any void space in the repository prior to creep closure with subsequent release under near lithostatic pressures following creep closure. The methodology to evaluate repository performance in these scenarios is described and this methodology is applied to reference systems in three candidate formations: bedded salt in the Palo Duro Basin, Texas; bedded salt in the Paradox Basin, Utah; and the Richton Salt Dome, Mississippi, of the Gulf Coast Salt Dome Basin

Preliminary Study on the Single Nucleotide Polymorphism (SNP of XRCC1 Gene Identificationto Improve the Outcomes of Radiotherapy for Cervical Cancer

Directory of Open Access Journals (Sweden)

Devita Tetriana

2015-09-01

Full Text Available Cervical cancer is the most fatal disease among Indonesian women. In recognition of the substantial variation in the intrinsic response of individuals to radiation, an effort had been done to identify the genetic markers, primarily Single Nucleotide polymorphisms (SNPs, which are associated with responsiveness of cancer cells to radiation therapy. One of these SNPs is X-ray repair cross-complementing protein 1 (XRCC1 that is one of the most important genes in deoxyribonucleic acid (DNA repair pathways. Meta-analysis in the determination of the association of XRCC1 polymorphisms with cervical cancer revealed the potential role of XRCC1 polymorphisms in predicting cell response to radiotherapy.Our preliminary study with real-time polymerase chain reaction (RT-PCR showed that radiotherapy affected the XRCC1 gene analyzed in blood of cervical cancer patient. Other published study found three SNPs of XRCC1 (Arg194Trp, Arg280His, and Arg399Gln that cause amino acid substitutions. Arg194Trp is only SNPs that associated with high risk of cervical cancer but not others. Additionally, structure and function of this protein can be altered by functional SNPs, which may lead to the susceptibility of individuals to cancers. Anotherstudy found G399A polymorphisms. We concluded that SNP of this DNA repair genes have been found to be good predictors of efficacy of radiotherapy.Kanker serviks adalah penyakit yang paling fatal pada perempuan di Indonesia. Untuk memahami variasi substansial respon intrinsik individual terhadap radiasi, suatu usaha telah dilakukan untuk mengidentifikasi petanda genetik, terutama Single Nucleotide polymorphism (SNP, yang berkaitan dengan responsel kanker terhadap terapi radiasi. Satu dari SNP tersebut adalah X-ray repair cross-complementing protein 1 (XRCC1 yang merupakan satu dari gen paling penting dalam lajur perbaikan asam deoksiribonukleat (DNA. Meta-analysis dalam penentuan hubungan polimorfisme XRCC1 dengan kanker serviks

Nucleotide sequence preservation of human mitochondrial DNA

International Nuclear Information System (INIS)

Monnat, R.J. Jr.; Loeb, L.A.

1985-01-01

Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

Nucleotide diversity and gene expression of Catalase and Glutathione peroxidase in irradiated Scots pine (Pinus sylvestris L.) from the Chernobyl exclusion zone

International Nuclear Information System (INIS)

Vornam, Barbara; Arkhipov, Andrey; Finkeldey, Reiner

2012-01-01

In the Chernobyl exclusion zone forest trees have to tolerate and to adapt to ionizing radiation, therefore the molecular basis of their adaptive responses is of the utmost interest. Based on SNP analysis and real time PCR nucleotide diversity and expression profiles of gene fragments of catalase (Cat) and glutathione peroxidase (GPx), which are known as radical scavenging genes, were analysed in the needles of irradiated pine trees of the Chernobyl exclusion zone. In acutely and chronically irradiated trees (50 years old) planted before the accident a higher nucleotide diversity of Cat and more somatic mutations were found compared to their control. Chronically irradiated trees (20 years old) planted after the accident showed a similar nucleotide diversity of Cat compared to their control and in both collectives one somatic mutation was found. The nucleotide diversity of GPx was higher in all analysed trees compared to Cat. No somatic mutation events were found in GPx. For both gene fragments, no association between the received dose in a tree and the nucleotide diversity and mutation events was detected. The expression profiles of Cat and GPx in acutely and chronically and in chronically irradiated trees were similar. Compared to their corresponding control collectives, Cat was up-regulated and GPx slightly down-regulated.

Palindromic nucleotide analysis in human T cell receptor rearrangements.

Directory of Open Access Journals (Sweden)

Santosh K Srivastava

Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

Development and preliminary analyses of material balance evaluation model in nuclear fuel cycle

International Nuclear Information System (INIS)

Matsumura, Tetsuo

1994-01-01

Material balance evaluation model in nuclear fuel cycle has been developed using ORIGEN-2 code as basic engine. This model has feature of: It can treat more than 1000 nuclides including minor actinides and fission products. It has flexibility of modeling and graph output using a engineering work station. I made preliminary calculation of LWR fuel high burnup effect (reloading fuel average burnup of 60 GWd/t) on nuclear fuel cycle. The preliminary calculation shows LWR fuel high burnup has much effect on Japanese Pu balance problem. (author)

Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

Directory of Open Access Journals (Sweden)

Andy Hesketh

2017-07-01

Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.

Preliminary Accident Analyses for Conversion of the Massachusetts Institute of Technology Reactor (MITR) from Highly Enriched to Low Enriched Uranium

Energy Technology Data Exchange (ETDEWEB)

Dunn, Floyd E. [Argonne National Lab. (ANL), Argonne, IL (United States); Olson, Arne P. [Argonne National Lab. (ANL), Argonne, IL (United States); Wilson, Erik H. [Argonne National Lab. (ANL), Argonne, IL (United States); Sun, Kaichao S. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Newton, Jr., Thomas H. [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States); Hu, Lin-wen [Massachusetts Inst. of Technology (MIT), Cambridge, MA (United States)

2013-09-30

The Massachusetts Institute of Technology Reactor (MITR-II) is a research reactor in Cambridge, Massachusetts designed primarily for experiments using neutron beam and in-core irradiation facilities. It delivers a neutron flux comparable to current LWR power reactors in a compact 6 MW core using Highly Enriched Uranium (HEU) fuel. In the framework of its non-proliferation policies, the international community presently aims to minimize the amount of nuclear material available that could be used for nuclear weapons. In this geopolitical context most research and test reactors, both domestic and international, have started a program of conversion to the use of LEU fuel. A new type of LEU fuel based on an alloy of uranium and molybdenum (U-Mo) is expected to allow the conversion of U.S. domestic high performance reactors like MITR. This report presents the preliminary accident analyses for MITR cores fueled with LEU monolithic U-Mo alloy fuel with 10 wt% Mo. Preliminary results demonstrate adequate performance, including thermal margin to expected safety limits, for the LEU accident scenarios analyzed.

Supplementary Material for: The arabidopsis cyclic nucleotide interactome

KAUST Repository

Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

2016-01-01

Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

Isolation, preliminary characterization, and full-genome analyses of tick-borne encephalitis virus from Mongolia.

Science.gov (United States)

Frey, Stefan; Mossbrugger, Ilona; Altantuul, Damdin; Battsetseg, Jigjav; Davaadorj, Rendoo; Tserennorov, Damdindorj; Buyanjargal, Tsoodol; Otgonbaatar, Dashdavaa; Zöller, Lothar; Speck, Stephanie; Wölfel, Roman; Dobler, Gerhard; Essbauer, Sandra

2012-12-01

Tick-borne encephalitis virus (TBEV) causes one of the most important inflammatory diseases of the central nervous system, namely severe encephalitis in Europe and Asia. Since the 1980s tick-borne encephalitis is known in Mongolia with increasing numbers of human cases reported during the last years. So far, however, data on TBEV strains are still sparse. We herein report the isolation of a TBEV strain from Ixodes persulcatus ticks collected in Mongolia in 2010. Phylogenetic analysis of the E-gene classified this isolate as Siberian subtype of TBEV. The Mongolian TBEV strain showed differences in virus titers, plaque sizes, and growth properties in two human neuronal cell-lines. In addition, the 10,242 nucleotide long open-reading frame and the corresponding polyprotein sequence were revealed. The isolate grouped in the genetic subclade of the Siberian subtype. The strain Zausaev (AF527415) and Vasilchenko (AF069066) had 97 and 94 % identity on the nucleotide level. In summary, we herein describe first detailed data regarding TBEV from Mongolia. Further investigations of TBEV in Mongolia and adjacent areas are needed to understand the intricate dispersal of this virus.

Preliminary design report for the NAC combined transport cask

International Nuclear Information System (INIS)

1990-04-01

Nuclear Assurance Corporation (NAC) is under contract to the United States Department of Energy (DOE) to design, license, develop and test models, and fabricate a prototype cask transportation system for nuclear spent fuel. The design of this combined transport (rail/barge) transportation system has been divided into two phases, a preliminary design phase and a final design phase. This Preliminary Design Package (PDP) describes the NAC Combined Transport Cask (NAC-CTC), the results of work completed during the preliminary design phase and identifies the additional detailed analyses, which will be performed during final design. Preliminary analytical results are presented in the appropriate sections and supplemented by summaries of procedures and assumptions for performing the additional detailed analyses of the final design. 60 refs., 1 fig., 2 tabs

Preliminary conceptual design and analysis on KALIMER reactor structures

International Nuclear Information System (INIS)

Kim, Jong Bum

1996-10-01

The objectives of this study are to perform preliminary conceptual design and structural analyses for KALIMER (Korea Advanced Liquid Metal Reactor) reactor structures to assess the design feasibility and to identify detailed analysis requirements. KALIMER thermal hydraulic system analysis results and neutronic analysis results are not available at present, only-limited preliminary structural analyses have been performed with the assumptions on the thermal loads. The responses of reactor vessel and reactor internal structures were based on the temperature difference of core inlet and outlet and on engineering judgments. Thermal stresses from the assumed temperatures were calculated using ANSYS code through parametric finite element heat transfer and elastic stress analyses. While, based on the results of preliminary conceptual design and structural analyses, the ASME Code limits for the reactor structures were satisfied for the pressure boundary, the needs for inelastic analyses were indicated for evaluation of design adequacy of the support barrel and the thermal liner. To reduce thermal striping effects in the bottom are of UIS due to up-flowing sodium form reactor core, installation of Inconel-718 liner to the bottom area was proposed, and to mitigate thermal shock loads, additional stainless steel liner was also suggested. The design feasibilities of these were validated through simplified preliminary analyses. In conceptual design phase, the implementation of these results will be made for the design of the reactor structures and the reactor internal structures in conjunction with the thermal hydraulic, neutronic, and seismic analyses results. 4 tabs., 24 figs., 4 refs. (Author)

Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene

Directory of Open Access Journals (Sweden)

Yang Ming

2012-07-01

Full Text Available Abstract Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have

Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

Science.gov (United States)

Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

2017-07-25

We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

International Nuclear Information System (INIS)

Aalto, T.K.; Raivio, K.O.

1990-01-01

Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

Main: Nucleotide Analysis [KOME

Lifescience Database Archive (English)

Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

Conceptual aspects: analyses law, ethical, human, technical, social factors of development ICT, e-learning and intercultural development in different countries setting out the previous new theoretical model and preliminary findings

NARCIS (Netherlands)

Kommers, Petrus A.M.; Smyrnova-Trybulska, Eugenia; Morze, Natalia; Issa, Tomayess; Issa, Theodora

2015-01-01

This paper, prepared by an international team of authors focuses on the conceptual aspects: analyses law, ethical, human, technical, social factors of ICT development, e-learning and intercultural development in different countries, setting out the previous and new theoretical model and preliminary

YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA

DEFF Research Database (Denmark)

Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M

2009-01-01

The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation...... at nucleotide C2498. The loss of ygdE function causes a slight reduction in bacterial fitness. Methylation at C2498 was restored by complementing the knock-out strain with a recombinant copy of ygdE. The recombinant YgdE methyltransferase modifies C2498 in naked 23S rRNA, but not in assembled 50S subunits...

GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

Science.gov (United States)

Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

2010-11-19

Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

Bacterial nucleotide-based second messengers.

Science.gov (United States)

Pesavento, Christina; Hengge, Regine

2009-04-01

In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

Science.gov (United States)

Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

2015-05-30

Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

Directory of Open Access Journals (Sweden)

Andréia B. Poletto

2008-01-01

Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

A QUANTITATIVE METHOD FOR ANALYSING 3-D BRANCHING IN EMBRYONIC KIDNEYS: DEVELOPMENT OF A TECHNIQUE AND PRELIMINARY DATA

Directory of Open Access Journals (Sweden)

Gabriel Fricout

2011-05-01

Full Text Available The normal human adult kidney contains between 300,000 and 1 million nephrons (the functional units of the kidney. Nephrons develop at the tips of the branching ureteric duct, and therefore ureteric duct branching morphogenesis is critical for normal kidney development. Current methods for analysing ureteric branching are mostly qualitative and those quantitative methods that do exist do not account for the 3- dimensional (3D shape of the ureteric "tree". We have developed a method for measuring the total length of the ureteric tree in 3D. This method is described and preliminary data are presented. The algorithm allows for performing a semi-automatic segmentation of a set of grey level confocal images and an automatic skeletonisation of the resulting binary object. Measurements of length are automatically obtained, and numbers of branch points are manually counted. The final representation can be reconstructed by means of 3D volume rendering software, providing a fully rotating 3D perspective of the skeletonised tree, making it possible to identify and accurately measure branch lengths. Preliminary data shows the total length estimates obtained with the technique to be highly reproducible. Repeat estimates of total tree length vary by just 1-2%. We will now use this technique to further define the growth of the ureteric tree in vitro, under both normal culture conditions, and in the presence of various levels of specific molecules suspected of regulating ureteric growth. The data obtained will provide fundamental information on the development of renal architecture, as well as the regulation of nephron number.

The role of nucleotides in augmentation of lymphocyte locomotion: Adaptional countermeasure development in microgravity analog environments

Science.gov (United States)

Sundaresan, Alamelu; Kulkarni, Anil D.; Yamauchi, Keiko; Pellis, Neal R.

2006-09-01

Space travel and long-term space residence such as envisaged in the exploration era implicates burdens on the immune system. An optimal immune response is required to countered and with-stand exposure to pathogens. Countermeasure development is an important avenue in space research especially for long-term space exploration. Microgravity exposure causes detrimental effects in lymphocyte functions which may impair immune response. Impaired lymphocyte function can be remedied by bypassing cell membrane events. This is done by using compounds such as Phorbol Myristate Acetate (PMA). Since activation in mouse splenocytes was augmented using nucleotides, it was essential to observe their effects on human lymphocyte locomotion. A nucleotide/nucleoside (NT/NT) mixture from Otsuka Pharmaceuticals (Naruto, Japan) was used at recommended doses. In lymphocytes cultured in modeled microgravity, the NT/NT mixture used orchestrated locomotion recovery by more than 87%, similar to the response documented with PMA in lymphocytes. Both 12µM and 120µM doses worked similarly. These are preliminary results leading to the possible use of the NT/NT mixture to mitigate immune suppression in micro-gravity. More studies in this direction are required to delineate the role of NT/NT on the immune response in microgravity.

Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

Science.gov (United States)

Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

2017-12-14

A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reproduction of the Yucca Mountain Project TSPA-LA Uncertainty and Sensitivity Analyses and Preliminary Upgrade of Models

Energy Technology Data Exchange (ETDEWEB)

Hadgu, Teklu [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States). Nuclear Waste Disposal Research and Analysis; Appel, Gordon John [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States). Nuclear Waste Disposal Research and Analysis

2016-09-01

Sandia National Laboratories (SNL) continued evaluation of total system performance assessment (TSPA) computing systems for the previously considered Yucca Mountain Project (YMP). This was done to maintain the operational readiness of the computing infrastructure (computer hardware and software) and knowledge capability for total system performance assessment (TSPA) type analysis, as directed by the National Nuclear Security Administration (NNSA), DOE 2010. This work is a continuation of the ongoing readiness evaluation reported in Lee and Hadgu (2014) and Hadgu et al. (2015). The TSPA computing hardware (CL2014) and storage system described in Hadgu et al. (2015) were used for the current analysis. One floating license of GoldSim with Versions 9.60.300, 10.5 and 11.1.6 was installed on the cluster head node, and its distributed processing capability was mapped on the cluster processors. Other supporting software were tested and installed to support the TSPA-type analysis on the server cluster. The current tasks included verification of the TSPA-LA uncertainty and sensitivity analyses, and preliminary upgrade of the TSPA-LA from Version 9.60.300 to the latest version 11.1. All the TSPA-LA uncertainty and sensitivity analyses modeling cases were successfully tested and verified for the model reproducibility on the upgraded 2014 server cluster (CL2014). The uncertainty and sensitivity analyses used TSPA-LA modeling cases output generated in FY15 based on GoldSim Version 9.60.300 documented in Hadgu et al. (2015). The model upgrade task successfully converted the Nominal Modeling case to GoldSim Version 11.1. Upgrade of the remaining of the modeling cases and distributed processing tasks will continue. The 2014 server cluster and supporting software systems are fully operational to support TSPA-LA type analysis.

78 FR 13563 - Energy Conservation Program: Availability of the Preliminary Technical Support Document for...

Science.gov (United States)

2013-02-28

... identify and resolve issues involved in the preliminary analyses. Chapter 2 of the preliminary technical... DOE conducted in-depth technical analyses in the following areas for GSFLs and IRLs currently under... also begun work on the manufacturer impact analysis and identified the methods to be used for the LCC...

Identification of cyclic nucleotide gated channels using regular expressions

KAUST Repository

Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.

2013-01-01

Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

Nucleotide Metabolism and its Control in Lactic Acid Bacteria

DEFF Research Database (Denmark)

Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

2005-01-01

Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

African Journals Online (AJOL)

PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

Science.gov (United States)

E, Chao; Duan, Baogen; Yu, Jin

2017-04-20

Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

Single Nucleotide Polymorphism

DEFF Research Database (Denmark)

Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

2014-01-01

Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

Multilocus analysis of nucleotide variation and speciation in three closely related Populus (Salicaceae) species.

Science.gov (United States)

Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo

2015-10-01

Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and then into Europe. Molecular dating results confirmed that the divergence of these three species coincided with the sundering of the Bering land bridge in the late Miocene and a rapid uplift of the Qinghai-Tibetan Plateau around the Miocene/Pliocene boundary. Vicariance-driven successful allopatric speciation resulting from historical tectonism and climate oscillations most likely played roles in the formation of the disjunct distributions and divergence of these three Populus species. © 2015 John Wiley & Sons Ltd.

Condensing the information in DNA with double-headed nucleotides

DEFF Research Database (Denmark)

Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

2017-01-01

A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

Coalescent-based genome analyses resolve the early branches of the euarchontoglires.

Directory of Open Access Journals (Sweden)

Vikas Kumar

Full Text Available Despite numerous large-scale phylogenomic studies, certain parts of the mammalian tree are extraordinarily difficult to resolve. We used the coding regions from 19 completely sequenced genomes to study the relationships within the super-clade Euarchontoglires (Primates, Rodentia, Lagomorpha, Dermoptera and Scandentia because the placement of Scandentia within this clade is controversial. The difficulty in resolving this issue is due to the short time spans between the early divergences of Euarchontoglires, which may cause incongruent gene trees. The conflict in the data can be depicted by network analyses and the contentious relationships are best reconstructed by coalescent-based analyses. This method is expected to be superior to analyses of concatenated data in reconstructing a species tree from numerous gene trees. The total concatenated dataset used to study the relationships in this group comprises 5,875 protein-coding genes (9,799,170 nucleotides from all orders except Dermoptera (flying lemurs. Reconstruction of the species tree from 1,006 gene trees using coalescent models placed Scandentia as sister group to the primates, which is in agreement with maximum likelihood analyses of concatenated nucleotide sequence data. Additionally, both analytical approaches favoured the Tarsier to be sister taxon to Anthropoidea, thus belonging to the Haplorrhine clade. When divergence times are short such as in radiations over periods of a few million years, even genome scale analyses struggle to resolve phylogenetic relationships. On these short branches processes such as incomplete lineage sorting and possibly hybridization occur and make it preferable to base phylogenomic analyses on coalescent methods.

Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

Science.gov (United States)

Hendershot, Jenna M.; O'Brien, Patrick J.

2014-01-01

Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

A set of tetra-nucleotide core motif SSR markers for efficient identification of potato (Solanum tuberosum) cultivars.

Science.gov (United States)

Kishine, Masahiro; Tsutsumi, Katsuji; Kitta, Kazumi

2017-12-01

Simple sequence repeat (SSR) is a popular tool for individual fingerprinting. The long-core motif (e.g. tetra-, penta-, and hexa-nucleotide) simple sequence repeats (SSRs) are preferred because they make it easier to separate and distinguish neighbor alleles. In the present study, a new set of 8 tetra-nucleotide SSRs in potato ( Solanum tuberosum ) is reported. By using these 8 markers, 72 out of 76 cultivars obtained from Japan and the United States were clearly discriminated, while two pairs, both of which arose from natural variation, showed identical profiles. The combined probability of identity between two random cultivars for the set of 8 SSR markers was estimated to be 1.10 × 10 -8 , confirming the usefulness of the proposed SSR markers for fingerprinting analyses of potato.

Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

Directory of Open Access Journals (Sweden)

Tobias Fromme

2018-02-01

Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

Multilocus analysis of nucleotide variation in Drosophila madeirensis, an endemic species of the Laurisilva forest in Madeira.

Science.gov (United States)

Khadem, M; Munté, A; Camacho, R; Aguadé, M; Segarra, C

2012-04-01

Drosophila madeirensis is an endemic species of Madeira that inhabits the island Laurisilva forest. Nucleotide variation in D. madeirensis is analysed in six genomic regions and compared to that previously reported for the same regions in Drosophila subobscura, an abundant species in the Palearctic region that is closely related to D. madeirensis. The gene regions analysed are distributed along the O(3) inversion. The O(3) arrangement is monomorphic in D. madeirensis, and it was present in ancestral populations of D. subobscura but went extinct in this species after the origin of the derived O(ST) and O(3+4) arrangements. Levels of nucleotide polymorphism in D. madeirensis are similar to those present in the O(ST) and O(3+4) arrangements of D. subobscura, and the frequency spectrum is skewed towards rare variants. Purifying selection against deleterious nonsynonymous mutations is less effective in D. madeirensis. Although D. madeirensis and D. subobscura coexist at present in Madeira, no clear evidence of introgression was detected in the studied regions. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

DNA Nucleotides Detection via capacitance properties of Graphene

Science.gov (United States)

Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

2016-05-01

In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

Directory of Open Access Journals (Sweden)

Desirée Villahermosa

2017-05-01

Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

African Journals Online (AJOL)

Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

New Blood Pressure-Associated Loci Identified in Meta-Analyses of 475 000 Individuals

DEFF Research Database (Denmark)

Kraja, Aldi T.; Cook, James P.; Warren, Helen R.

2017-01-01

Background - Genome-wide association studies have recently identified >400 loci that harbor DNA sequence variants that influence blood pressure (BP). Our earlier studies identified and validated 56 single nucleotide variants (SNVs) associated with BP from meta-analyses of exome chip genotype data...

Statistical properties and fractals of nucleotide clusters in DNA sequences

International Nuclear Information System (INIS)

Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

2004-01-01

Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

DNA Nucleotide Sequence Restricted by the RI Endonuclease

Science.gov (United States)

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

Detection of DNA nucleotides on pretreated boron doped diamond electrodes

Energy Technology Data Exchange (ETDEWEB)

Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica

2011-07-01

The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

Science.gov (United States)

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

International Nuclear Information System (INIS)

Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

1977-01-01

In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

OpenAIRE

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

Electrical detection and quantification of single and mixed DNA nucleotides in suspension

Science.gov (United States)

Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

2016-09-01

High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

The possible role of human milk nucleotides as sleep inducers.

Science.gov (United States)

Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

2009-02-01

Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.

The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

Energy Technology Data Exchange (ETDEWEB)

Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

2014-02-26

For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

Science.gov (United States)

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

Preliminary thermal/thermomechanical analyses of the Site Characterization Plan's Conceptual Design for a repository containing horizontally emplaced waste packages at the Deaf Smith County site

International Nuclear Information System (INIS)

Ghantous, N.Y.; Raines, G.E.

1987-10-01

This report presents thermal/thermomechanical analyses of the Site Characterization Plan Conceptual Design for horizontal package emplacement at the Deaf Smith County site, Texas. The repository was divided into three geometric regions. Then two-dimensional finite-element models were set up to approximate the three-dimensional nature of each region. Thermal and quasistatic thermomechanical finite-element analyses were performed to evaluate the thermal/thermomechanical responses of the three regions. The exponential-time creep law was used to represent the creep behavior of salt rock. The repository design was evaluated by comparing the thermal/thermomechanical responses obtained for the three regions with interim performance constraints. The preliminary results show that all the performance constraints are met except for those of the waste package. The following factors were considered in interpreting these results: (1) the qualitative description of the analytical responses; (2) the limitations of the analyses; and (3) either the conclusions based on overall evaluation of limitations and analytical results or the conclusions based on the fact that the repository design may be evaluated only after further analyses. Furthermore, a parametric analysis was performed to estimate the effect of material parameters on the predicted thermal/thermomechanical response. 23 refs., 34 figs., 9 tabs

Nucleotide excision repair in yeast

NARCIS (Netherlands)

Eijk, Patrick van

2012-01-01

Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

Recovering probabilities for nucleotide trimming processes for T cell receptor TRA and TRG V-J junctions analyzed with IMGT tools

Directory of Open Access Journals (Sweden)

Lefranc Marie-Paule

2008-10-01

Full Text Available Abstract Background Nucleotides are trimmed from the ends of variable (V, diversity (D and joining (J genes during immunoglobulin (IG and T cell receptor (TR rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT® sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output". However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." Results A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA and TR gamma (TRG V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT®, the international ImMunoGeneTics information system®, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. Conclusion By

Recovering probabilities for nucleotide trimming processes for T cell receptor TRA and TRG V-J junctions analyzed with IMGT tools.

Science.gov (United States)

Bleakley, Kevin; Lefranc, Marie-Paule; Biau, Gérard

2008-10-02

Nucleotides are trimmed from the ends of variable (V), diversity (D) and joining (J) genes during immunoglobulin (IG) and T cell receptor (TR) rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides) of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output"). However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA) and TR gamma (TRG) V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT, the international ImMunoGeneTics information system, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. By using trimming of rearranged TR genes as a benchmark, we

The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

Science.gov (United States)

Štambuk, Nikola

The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

Nucleotide diversity and phylogenetic relationships among ...

Indian Academy of Sciences (India)

2017-03-03

Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

Science.gov (United States)

Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

2018-05-01

Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

Complexes of Escherichia coli adenylate kinase and nucleotides: 1H NMR studies of the nucleotide sites in solution

International Nuclear Information System (INIS)

Vetter, I.R.; Reinstein, J.; Roesch, P.

1990-01-01

One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+

Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.

Science.gov (United States)

Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela

2013-07-01

Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.

Expression, purification and preliminary X-ray diffraction studies of the transcriptional factor PyrR from Bacillus halodurans

Energy Technology Data Exchange (ETDEWEB)

Arreola, Rodrigo [Departamento de Bioquímica, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, Circuito Exterior s/n, Ciudad Universitaria, Apartado Postal 70-243, Mexico City 04510 (Mexico); Vega-Miranda, Anita [Instituto Nacional de Enfermedades Respiratorias, Calzada de Tlalpan 4502, México DF 14080 (Mexico); Gómez-Puyou, Armando; Pérez-Montfort, Ruy [Departamento de Bioquímica, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, Circuito Exterior s/n, Ciudad Universitaria, Apartado Postal 70-243, Mexico City 04510 (Mexico); Merino-Pérez, Enrique [Departamento de Microbiología Molecular, Instituto de Biotecnología, Universidad Nacional Autónoma de México, Apartado Postal 510-3, Cuernavaca, Morelos (Mexico); Torres-Larios, Alfredo, E-mail: torres@ifc.unam.mx [Departamento de Bioquímica, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, Circuito Exterior s/n, Ciudad Universitaria, Apartado Postal 70-243, Mexico City 04510 (Mexico)

2008-08-01

The gene-regulation factor PyrR from B. halodurans has been crystallized in two crystal forms. Preliminary crystallographic analysis showed that the protein forms tetramers in both space groups. The PyrR transcriptional regulator is widely distributed in bacteria. This RNA-binding protein is involved in the control of genes involved in pyrimidine biosynthesis, in which uridyl and guanyl nucleotides function as effectors. Here, the crystallization and preliminary X-ray diffraction analysis of two crystal forms of Bacillus halodurans PyrR are reported. One of the forms belongs to the monoclinic space group P2{sub 1} with unit-cell parameters a = 59.7, b = 87.4, c = 72.1 Å, β = 104.4°, while the other form belongs to the orthorhombic space group P22{sub 1}2{sub 1} with unit-cell parameters a = 72.7, b = 95.9, c = 177.1 Å. Preliminary X-ray diffraction data analysis and molecular-replacement solution revealed the presence of four and six monomers per asymmetric unit; a crystallographic tetramer is formed in both forms.

Expression, purification and preliminary X-ray diffraction studies of the transcriptional factor PyrR from Bacillus halodurans

International Nuclear Information System (INIS)

Arreola, Rodrigo; Vega-Miranda, Anita; Gómez-Puyou, Armando; Pérez-Montfort, Ruy; Merino-Pérez, Enrique; Torres-Larios, Alfredo

2008-01-01

The gene-regulation factor PyrR from B. halodurans has been crystallized in two crystal forms. Preliminary crystallographic analysis showed that the protein forms tetramers in both space groups. The PyrR transcriptional regulator is widely distributed in bacteria. This RNA-binding protein is involved in the control of genes involved in pyrimidine biosynthesis, in which uridyl and guanyl nucleotides function as effectors. Here, the crystallization and preliminary X-ray diffraction analysis of two crystal forms of Bacillus halodurans PyrR are reported. One of the forms belongs to the monoclinic space group P2 1 with unit-cell parameters a = 59.7, b = 87.4, c = 72.1 Å, β = 104.4°, while the other form belongs to the orthorhombic space group P22 1 2 1 with unit-cell parameters a = 72.7, b = 95.9, c = 177.1 Å. Preliminary X-ray diffraction data analysis and molecular-replacement solution revealed the presence of four and six monomers per asymmetric unit; a crystallographic tetramer is formed in both forms

Preliminary results of statistical dynamic experiments on a heat exchanger

International Nuclear Information System (INIS)

Corran, E.R.; Cummins, J.D.

1962-10-01

The inherent noise signals present in a heat exchanger have been recorded and analysed in order to determine some of the statistical dynamic characteristics of the heat exchanger. These preliminary results show that the primary side temperature frequency response may be determined by analysing the inherent noise. The secondary side temperature frequency response and cross coupled temperature frequency responses between primary and secondary are poorly determined because of the presence of a non-stationary noise source in the secondary circuit of this heat exchanger. This may be overcome by correlating the dependent variables with an externally applied noise signal. Some preliminary experiments with an externally applied random telegraph type of signal are reported. (author)

Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

DEFF Research Database (Denmark)

Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

2011-01-01

A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

Directory of Open Access Journals (Sweden)

Simon Reed

2012-09-01

Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

Science.gov (United States)

Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

2009-01-01

The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

Nucleotide excision repair in the test tube.

NARCIS (Netherlands)

N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

1995-01-01

textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

Neutronic analyses of the preliminary design of a DCLL blanket for the EUROfusion DEMO power plant

Energy Technology Data Exchange (ETDEWEB)

Palermo, Iole, E-mail: iole.palermo@ciemat.es; Fernández, Iván; Rapisarda, David; Ibarra, Angel

2016-11-01

Highlights: • We perform neutronic calculations for the preliminary DCLL Blanket design. • We study the tritium breeding capability of the reactor. • We determine the nuclear heating in the main components. • We verify if the shielding of the TF coil is maintained. - Abstract: In the frame of the newly established EUROfusion WPBB Project for the period 2014–2018, four breeding blanket options are being investigated to be used in the fusion power demonstration plant DEMO. CIEMAT is leading the development of the conceptual design of the Dual Coolant Lithium Lead, DCLL, breeding blanket. The primary role of the blanket is of energy extraction, tritium production, and radiation shielding. With this aim the DCLL uses LiPb as primary coolant, tritium breeder and neutron multiplier and Eurofer as structural material. Focusing on the achievement of the fundamental neutronic responses a preliminary blanket model has been designed. Thus detailed 3D neutronic models of the whole blanket modules have been generated, arranged in a specific DCLL segmentation and integrated in the generic DEMO model. The initial design has been studied to demonstrate its viability. Thus, the neutronic behaviour of the blanket and of the shield systems in terms of tritium breeding capabilities, power generation and shielding efficiency has been assessed in this paper. The results demonstrate that the primary nuclear performances are already satisfactory at this preliminary stage of the design, having obtained the tritium self-sufficiency and an adequate shielding.

Preliminary sensitivity analyses of corrosion models for BWIP [Basalt Waste Isolation Project] container materials

International Nuclear Information System (INIS)

Anantatmula, R.P.

1984-01-01

A preliminary sensitivity analysis was performed for the corrosion models developed for Basalt Waste Isolation Project container materials. The models describe corrosion behavior of the candidate container materials (low carbon steel and Fe9Cr1Mo), in various environments that are expected in the vicinity of the waste package, by separate equations. The present sensitivity analysis yields an uncertainty in total uniform corrosion on the basis of assumed uncertainties in the parameters comprising the corrosion equations. Based on the sample scenario and the preliminary corrosion models, the uncertainty in total uniform corrosion of low carbon steel and Fe9Cr1Mo for the 1000 yr containment period are 20% and 15%, respectively. For containment periods ≥ 1000 yr, the uncertainty in corrosion during the post-closure aqueous periods controls the uncertainty in total uniform corrosion for both low carbon steel and Fe9Cr1Mo. The key parameters controlling the corrosion behavior of candidate container materials are temperature, radiation, groundwater species, etc. Tests are planned in the Basalt Waste Isolation Project containment materials test program to determine in detail the sensitivity of corrosion to these parameters. We also plan to expand the sensitivity analysis to include sensitivity coefficients and other parameters in future studies. 6 refs., 3 figs., 9 tabs

The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

Science.gov (United States)

Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

1989-04-01

The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

Bioinformatic Analysis of Deleterious Non-Synonymous Single Nucleotide Polymorphisms (nsSNPs in the Coding Regions of Human Prion Protein Gene (PRNP

Directory of Open Access Journals (Sweden)

Kourosh Bamdad

2016-12-01

Full Text Available Background & Objective: Single nucleotide polymorphisms are the cause of genetic variation to living organisms. Single nucleotide polymorphisms alter residues in the protein sequence. In this investigation, the relationship between prion protein gene polymorphisms and its relevance to pathogenicity was studied. Material & Method: Amino acid sequence of the main isoform from the human prion protein gene (PRNP was extracted from UniProt database and evaluated by FoldAmyloid and AmylPred servers. All non-synonymous single nucleotide polymorphisms (nsSNPs from SNP database (dbSNP were further analyzed by bioinformatics servers including SIFT, PolyPhen-2, I-Mutant-3.0, PANTHER, SNPs & GO, PHD-SNP, Meta-SNP, and MutPred to determine the most damaging nsSNPs. Results: The results of the first structure analyses by FoldAmyloid and AmylPerd servers implied that regions including 5-15, 174-178, 180-184, 211-217, and 240-252 were the most sensitive parts of the protein sequence to amyloidosis. Screening all nsSNPs of the main protein isoform using bioinformatic servers revealed that substitution of Aspartic acid with Valine at position 178 (ID code: rs11538766 was the most deleterious nsSNP in the protein structure. Conclusion:  Substitution of the Aspartic acid with Valine at position 178 (D178V was the most pathogenic mutation in the human prion protein gene. Analyses from the MutPred server also showed that beta-sheets’ increment in the secondary structure was the main reason behind the molecular mechanism of the prion protein aggregation.

Preliminary study to characterize plastic polymers using elemental analyser/isotope ratio mass spectrometry (EA/IRMS).

Science.gov (United States)

Berto, Daniela; Rampazzo, Federico; Gion, Claudia; Noventa, Seta; Ronchi, Francesca; Traldi, Umberto; Giorgi, Giordano; Cicero, Anna Maria; Giovanardi, Otello

2017-06-01

Plastic waste is a growing global environmental problem, particularly in the marine ecosystems, in consideration of its persistence. The monitoring of the plastic waste has become a global issue, as reported by several surveillance guidelines proposed by Regional Sea Conventions (OSPAR, UNEP) and appointed by the EU Marine Strategy Framework Directive. Policy responses to plastic waste vary at many levels, ranging from beach clean-up to bans on the commercialization of plastic bags and to Regional Plans for waste management and recycling. Moreover, in recent years, the production of plant-derived biodegradable plastic polymers has assumed increasing importance. This study reports the first preliminary characterization of carbon stable isotopes (δ 13 C) of different plastic polymers (petroleum- and plant-derived) in order to increase the dataset of isotopic values as a tool for further investigation in different fields of polymers research as well as in the marine environment surveillance. The δ 13 C values determined in different packaging for food uses reflect the plant origin of "BIO" materials, whereas the recycled plastic materials displayed a δ 13 C signatures between plant- and petroleum-derived polymers source. In a preliminary estimation, the different colours of plastic did not affect the variability of δ 13 C values, whereas the abiotic and biotic degradation processes that occurred in the plastic materials collected on beaches and in seawater, showed less negative δ 13 C values. A preliminary experimental field test confirmed these results. The advantages offered by isotope ratio mass spectrometry with respect to other analytical methods used to characterize the composition of plastic polymers are: high sensitivity, small amount of material required, rapidity of analysis, low cost and no limitation in black/dark samples compared with spectroscopic analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Phylogenomic analyses data of the avian phylogenomics project

DEFF Research Database (Denmark)

Jarvis, Erich D; Mirarab, Siavash; Aberer, Andre J

2015-01-01

BACKGROUND: Determining the evolutionary relationships among the major lineages of extant birds has been one of the biggest challenges in systematic biology. To address this challenge, we assembled or collected the genomes of 48 avian species spanning most orders of birds, including all Neognathae...... and two of the five Palaeognathae orders. We used these genomes to construct a genome-scale avian phylogenetic tree and perform comparative genomic analyses. FINDINGS: Here we present the datasets associated with the phylogenomic analyses, which include sequence alignment files consisting of nucleotides......ML algorithm or when using statistical binning with the coalescence-based MP-EST algorithm (which we refer to as MP-EST*). Other data sets, such as the coding sequence of some exons, revealed other properties of genome evolution, namely convergence. CONCLUSIONS: The Avian Phylogenomics Project is the largest...

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

Science.gov (United States)

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-10-11

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.

Science.gov (United States)

Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric

2017-12-01

Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

Directory of Open Access Journals (Sweden)

Dina A Moustafa

Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

Directory of Open Access Journals (Sweden)

Arehart Eric

2009-03-01

Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays

Science.gov (United States)

Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse

2013-11-01

Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

Pathway-based analyses.

Science.gov (United States)

Kent, Jack W

2016-02-03

New technologies for acquisition of genomic data, while offering unprecedented opportunities for genetic discovery, also impose severe burdens of interpretation and penalties for multiple testing. The Pathway-based Analyses Group of the Genetic Analysis Workshop 19 (GAW19) sought reduction of multiple-testing burden through various approaches to aggregation of highdimensional data in pathways informed by prior biological knowledge. Experimental methods testedincluded the use of "synthetic pathways" (random sets of genes) to estimate power and false-positive error rate of methods applied to simulated data; data reduction via independent components analysis, single-nucleotide polymorphism (SNP)-SNP interaction, and use of gene sets to estimate genetic similarity; and general assessment of the efficacy of prior biological knowledge to reduce the dimensionality of complex genomic data. The work of this group explored several promising approaches to managing high-dimensional data, with the caveat that these methods are necessarily constrained by the quality of external bioinformatic annotation.

Vacuum ultraviolet photoionization of carbohydrates and nucleotides

Energy Technology Data Exchange (ETDEWEB)

Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

2014-01-28

Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

Vacuum ultraviolet photoionization of carbohydrates and nucleotides

International Nuclear Information System (INIS)

Shin, Joong-Won; Bernstein, Elliot R.

2014-01-01

Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

Science.gov (United States)

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

The International Nucleotide Sequence Database Collaboration.

Science.gov (United States)

Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

2011-01-01

Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

Science.gov (United States)

Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

2016-01-01

Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

Science.gov (United States)

Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

2016-01-15

Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Subnanomole detection and quantitation of high specific activity 32P-nucleotides

International Nuclear Information System (INIS)

Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.

1991-01-01

Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

Nucleotide supplementation: a randomised double-blind placebo controlled trial of IntestAidIB in people with Irritable Bowel Syndrome [ISRCTN67764449

Directory of Open Access Journals (Sweden)

Attree EA

2006-06-01

Full Text Available Abstract Background Dietary nucleotide supplementation has been shown to have important effects on the growth and development of cells which have a rapid turnover such as those in the immune system and the gastrointestinal tract. Work with infants has shown that the incidence and duration of diarrhoea is lower when nucleotide supplementation is given, and animal work shows that villi height and crypt depth in the intestine is increased as a result of dietary nucleotides. Dietary nucleotides may be semi-essential under conditions of ill-health, poor diet or stress. Since people with Irritable Bowel Syndrome tend to fulfil these conditions, we tested the hypothesis that symptoms would be improved with dietary nucleotide supplementation. Methods Thirty-seven people with a diagnosis of Irritable Bowel gave daily symptom severity ratings for abdominal pain, diarrhoea, urgency to have a bowel movement, incomplete feeling of evacuation after a bowel movement, bloating, flatulence and constipation for 28 days (baseline. They were then assigned to either placebo (56 days followed by experimental (56 days or the reverse. There was a four week washout period before crossover. During the placebo and experimental conditions participants took one 500 mg capsule three times a day; in the experimental condition the capsule contained the nutroceutical substances. Symptom severity ratings and psychological measures (anxiety, depression, illness intrusiveness and general health were obtained and analysed by repeated measures ANOVAs. Results Symptom severity for all symptoms (except constipation were in the expected direction of baseline>placebo>experimental condition. Symptom improvement was in the range 4 – 6%. A feeling of incomplete evacuation and abdominal pain showed the most improvement. The differences between conditions for diarrhoea, bloating and flatulence were not significant at the p Conclusion Dietary nucleotide supplementation improves some of the

Novel Nucleotide Variations, Haplotypes Structure and Associations with Growth Related Traits of Goat AT Motif-Binding Factor ( Gene

Directory of Open Access Journals (Sweden)

Xiaoyan Zhang

2015-10-01

Full Text Available The AT motif-binding factor (ATBF1 not only interacts with protein inhibitor of activated signal transducer and activator of transcription 3 (STAT3 (PIAS3 to suppress STAT3 signaling regulating embryo early development and cell differentiation, but is required for early activation of the pituitary specific transcription factor 1 (Pit1 gene (also known as POU1F1 critically affecting mammalian growth and development. The goal of this study was to detect novel nucleotide variations and haplotypes structure of the ATBF1 gene, as well as to test their associations with growth-related traits in goats. Herein, a total of seven novel single nucleotide polymorphisms (SNPs (SNP 1-7 within this gene were found in two well-known Chinese native goat breeds. Haplotypes structure analysis demonstrated that there were four haplotypes in Hainan black goat while seventeen haplotypes in Xinong Saanen dairy goat, and both breeds only shared one haplotype (hap1. Association testing revealed that the SNP2, SNP5, SNP6, and SNP7 loci were also found to significantly associate with growth-related traits in goats, respectively. Moreover, one diplotype in Xinong Saanen dairy goats significantly linked to growth related traits. These preliminary findings not only would extend the spectrum of genetic variations of the goat ATBF1 gene, but also would contribute to implementing marker-assisted selection in genetics and breeding in goats.

De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

International Nuclear Information System (INIS)

Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.

1988-01-01

Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis

A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

NARCIS (Netherlands)

Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

1996-01-01

A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

Science.gov (United States)

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

NU-IN: Nucleotide evolution and input module for the EvolSimulator genome simulation platform

Directory of Open Access Journals (Sweden)

Barker Michael S

2010-08-01

Full Text Available Abstract Background There is increasing demand to test hypotheses that contrast the evolution of genes and gene families among genomes, using simulations that work across these levels of organization. The EvolSimulator program was developed recently to provide a highly flexible platform for forward simulations of amino acid evolution in multiple related lineages of haploid genomes, permitting copy number variation and lateral gene transfer. Synonymous nucleotide evolution is not currently supported, however, and would be highly advantageous for comparisons to full genome, transcriptome, and single nucleotide polymorphism (SNP datasets. In addition, EvolSimulator creates new genomes for each simulation, and does not allow the input of user-specified sequences and gene family information, limiting the incorporation of further biological realism and/or user manipulations of the data. Findings We present modified C++ source code for the EvolSimulator platform, which we provide as the extension module NU-IN. With NU-IN, synonymous and non-synonymous nucleotide evolution is fully implemented, and the user has the ability to use real or previously-simulated sequence data to initiate a simulation of one or more lineages. Gene family membership can be optionally specified, as well as gene retention probabilities that model biased gene retention. We provide PERL scripts to assist the user in deriving this information from previous simulations. We demonstrate the features of NU-IN by simulating genome duplication (polyploidy in the presence of ongoing copy number variation in an evolving lineage. This example is initiated with real genomic data, and produces output that we analyse directly with existing bioinformatic pipelines. Conclusions The NU-IN extension module is a publicly available open source software (GNU GPLv3 license extension to EvolSimulator. With the NU-IN module, users are now able to simulate both drift and selection at the nucleotide

Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

Science.gov (United States)

Dunn, Joshua G; Weissman, Jonathan S

2016-11-22

Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

Science.gov (United States)

Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

2015-09-01

An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

Science.gov (United States)

Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

2015-01-01

An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

AVP-stimulated nucleotide secretion in perfused mouse medullary thick ascending limb and cortical collecting duct

DEFF Research Database (Denmark)

Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg

2009-01-01

is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...

The preparation of nucleotides uniformly labelled with carbon-14 by biosinthetic methods. Isolation of adenilic, uridilic, cytidilic and guanlic acids, from the alkaline hydrolisate of escherichia coli RNA

International Nuclear Information System (INIS)

Garcia Pineda, D.; Pacheco Lopez, J.

1978-01-01

A method is described for the preparation and analysis of adenilic, uridilic, cytidylic and guanilic acids, labelled with carbon 14. Escherichia coli cells have been labelled by growing them in media containing glucose-carbon 14 as their only source of carbon. RNA is isolated from the cells, and after hydrolisis of the molecule the resulting nucleotides are separated by gel filtration and exchange chromatography. Chemical and radiochemical purity of the isolated nucleotides is determined and also its specific radioactivity. The distribution of radioactivity incorporated in the cell among different groups of molecular species is analyse. (author)

Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

Science.gov (United States)

Wolf, P

1997-10-01

Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

Levels of adenine nucleotides (ATP, ADP, AMP) and of inorganic phosphate in needles of Picea abies, representing different stages of development and of pollution dependence

Energy Technology Data Exchange (ETDEWEB)

Benz, T; Hampp, R; Horsch, F; Filby, G; Fund, N; Gross, S; Hanisch, B; Kilz, E; Seidel, A [comps.

1986-04-01

Levels of adenine nucleotides (ATP, ADP, AMP) and of inorganic phosphate in needles of Picea abies, representing different stages of development and of pollution dependence. Lyophilized needles of Picea abies (Kaelbelescheuer, southern Black Forest) were analyzed for their content of adenine nucleotides (ATP, ADP, AMP: AdN) and of inorganic phosphate (Psub(i)). The metabolite levels were related to needle age, vegetation period and degree of damage (chlorophyll content). The results were as follows: 1) With increasing needle age there is a general decrease in the total AdN-pool. This decrease is most pronounced in very young needles and occurs in both healthy and damaged tissue. 2) The ATP/ADP-ratio of damaged needle is significantly higher than that of healthy ones. 3) Both phosphorylation potential (ATP.(ADP.Psub(i))/sup -1/) and adenylate energy charge ((ATP + 0.5.ADP).(AdN)/sup -1/) are significantly reduced in damaged needles. This is due to relatively higher levels of Psub(i) and of AMP. The results, although incomplete and preliminary, indicate metabolic alterations which have been described for other tissues in response to pollution by photooxidants.

Nucleotide sequence of tomato ringspot virus RNA-2.

Science.gov (United States)

Rott, M E; Tremaine, J H; Rochon, D M

1991-07-01

The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

Optimization time synthesis of nucleotide labelled [γ-32P]-ATP

International Nuclear Information System (INIS)

Rahman, Wira Y; Sarmini, Endang; Herlina; Lubis, Hotman; Triyanto; Hambali

2013-01-01

Adenosine triphosphate-labelled with γ- 32 P([γ- 32 p]-ATP) has been widely used in the biotechnology research, usually as a tracer to study aspects of physiological and pathological processes. In order to support biotechnology research in Indonesia, a process for production of [γ- 32 P]-ATP with enzymatic reaction was used as precursors DL-glyceraldehydde 3-phosphate, Adenosine Diphosphate (ADP) and H 3 32 PO 4 , and enzyme glyceraldehid 3-phosphate dehydrogenase, 3-phosphoglyceryc phosphokinase and lactate dehydrogenase. Optimization of incubation time labeled nucleotide synthesis process is performed to find the optimum conditions, in terms of the most advantageous time in the synthesis process. With the success of the synthesis and optimization is done incubation time of synthesis labeled nucleotide, the result suggested can be used for producing [γ- 32 P] -ATP to support the provision of radiolabeled nucleotide for biotechnology research in Indonesia. (author)

WEB-server for search of a periodicity in amino acid and nucleotide sequences

Science.gov (United States)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

DivStat: a user-friendly tool for single nucleotide polymorphism analysis of genomic diversity.

Directory of Open Access Journals (Sweden)

Inês Soares

Full Text Available Recent developments have led to an enormous increase of publicly available large genomic data, including complete genomes. The 1000 Genomes Project was a major contributor, releasing the results of sequencing a large number of individual genomes, and allowing for a myriad of large scale studies on human genetic variation. However, the tools currently available are insufficient when the goal concerns some analyses of data sets encompassing more than hundreds of base pairs and when considering haplotype sequences of single nucleotide polymorphisms (SNPs. Here, we present a new and potent tool to deal with large data sets allowing the computation of a variety of summary statistics of population genetic data, increasing the speed of data analysis.

Sewage Solids Irradiator Transportation System (SSITS) cask: preliminary design description

International Nuclear Information System (INIS)

Eakes, R.G.; Kempka, S.N.; Lamoreaux, G.H.; Sutherland, S.H.

1983-02-01

The preliminary design of the Sewage Solids Irradiator Transportation System (SSITS) Cask is presented in this document. The SSITS cask is to be used for the transport of radioactive cesium chloride and strontium fluoride capsules which are of use in irradiators or as heat sources. The SSITS cask is approximately 1.4 m in diameter, 1.3 m high, weighs roughly 9 t, provides 33 cm of steel shielding, and can dissipate up to 5.2 kW of decay heat. The cask design criteria are identified and a description of the cask design and operation is provided. Detailed analyses of the design were performed to demonstrate licensability of the cask by the Nuclear Regulatory Commission (NRC). Results of the analyses indicate that the preliminary design is in compliance with the pertinent regulatory requirements for licensing of a radioactive material transportation container

A single nucleotide polymorphism (SNP) assay for population ...

African Journals Online (AJOL)

A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

Practical Recommendations for the Preliminary Design Analysis of ...

African Journals Online (AJOL)

Interior-to-exterior shear ratios for equal and unequal bay frames, as well as column inflection points were obtained to serve as practical aids for preliminary analysis/design of fixed-feet multistory sway frames. Equal and unequal bay five story frames were analysed to show the validity of the recommended design ...

Scambio, a novel guanine nucleotide exchange factor for Rho

Directory of Open Access Journals (Sweden)

Groffen John

2004-04-01

Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

International Nuclear Information System (INIS)

Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.

1986-01-01

14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

Directory of Open Access Journals (Sweden)

Elaine C Thomas

Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

Study on the change of cyclic nucleotide in mice with yang vacuity disease

International Nuclear Information System (INIS)

Zhu Xinhua; Shen Ling; Wang Shuguang

2002-01-01

To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism

International Nuclear Information System (INIS)

Welin, Martin; Nordlund, Paer

2010-01-01

Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.

A review of bioinformatic methods for forensic DNA analyses.

Science.gov (United States)

Liu, Yao-Yuan; Harbison, SallyAnn

2018-03-01

Short tandem repeats, single nucleotide polymorphisms, and whole mitochondrial analyses are three classes of markers which will play an important role in the future of forensic DNA typing. The arrival of massively parallel sequencing platforms in forensic science reveals new information such as insights into the complexity and variability of the markers that were previously unseen, along with amounts of data too immense for analyses by manual means. Along with the sequencing chemistries employed, bioinformatic methods are required to process and interpret this new and extensive data. As more is learnt about the use of these new technologies for forensic applications, development and standardization of efficient, favourable tools for each stage of data processing is being carried out, and faster, more accurate methods that improve on the original approaches have been developed. As forensic laboratories search for the optimal pipeline of tools, sequencer manufacturers have incorporated pipelines into sequencer software to make analyses convenient. This review explores the current state of bioinformatic methods and tools used for the analyses of forensic markers sequenced on the massively parallel sequencing (MPS) platforms currently most widely used. Copyright © 2017 Elsevier B.V. All rights reserved.

Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

Science.gov (United States)

Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

2006-03-01

Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

Science.gov (United States)

Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

2014-09-12

The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

Science.gov (United States)

Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

2014-01-01

The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

A preliminary study on the relevancy of sustainable building design ...

African Journals Online (AJOL)

This preliminary study aims to explore the relationship between sustainable building design paradigms and commercial property depreciation, to assist in the understanding of sustainable building design impact towards commercial building value and rental de employs the qualitative method and analyses valuers' current ...

Comparative genomic analyses of Mycoplasma hyopneumoniae pathogenic 168 strain and its high-passaged attenuated strain

Science.gov (United States)

2013-01-01

Background Mycoplasma hyopneumoniae is the causative agent of porcine enzootic pneumonia (EP), a mild, chronic pneumonia of swine. Despite presenting with low direct mortality, EP is responsible for major economic losses in the pig industry. To identify the virulence-associated determinants of M. hyopneumoniae, we determined the whole genome sequence of M. hyopneumoniae strain 168 and its attenuated high-passage strain 168-L and carried out comparative genomic analyses. Results We performed the first comprehensive analysis of M. hyopneumoniae strain 168 and its attenuated strain and made a preliminary survey of coding sequences (CDSs) that may be related to virulence. The 168-L genome has a highly similar gene content and order to that of 168, but is 4,483 bp smaller because there are 60 insertions and 43 deletions in 168-L. Besides these indels, 227 single nucleotide variations (SNVs) were identified. We further investigated the variants that affected CDSs, and compared them to reported virulence determinants. Notably, almost all of the reported virulence determinants are included in these variants affected CDSs. In addition to variations previously described in mycoplasma adhesins (P97, P102, P146, P159, P216, and LppT), cell envelope proteins (P95), cell surface antigens (P36), secreted proteins and chaperone protein (DnaK), mutations in genes related to metabolism and growth may also contribute to the attenuated virulence in 168-L. Furthermore, many mutations were located in the previously described repeat motif, which may be of primary importance for virulence. Conclusions We studied the virulence attenuation mechanism of M. hyopneumoniae by comparative genomic analysis of virulent strain 168 and its attenuated high-passage strain 168-L. Our findings provide a preliminary survey of CDSs that may be related to virulence. While these include reported virulence-related genes, other novel virulence determinants were also detected. This new information will form

Biochemistry of an olfactory purinergic system: dephosphorylation of excitatory nucleotides and uptake of adenosine

Energy Technology Data Exchange (ETDEWEB)

Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A

1987-10-01

The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.

Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

DEFF Research Database (Denmark)

Leonardsen, L; DeClue, J E; Lybaek, H

1996-01-01

The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

Livebearing or egg-laying mammals: 27 decisive nucleotides of FAM168.

Science.gov (United States)

Pramanik, Subrata; Kutzner, Arne; Heese, Klaus

2017-05-23

In the present study, we determine comprehensive molecular phylogenetic relationships of the novel myelin-associated neurite-outgrowth inhibitor (MANI) gene across the entire eukaryotic lineage. Combined computational genomic and proteomic sequence analyses revealed MANI as one of the two members of the novel family with sequence similarity 168 member (FAM168) genes, consisting of FAM168A and FAM168B, having distinct genetic differences that illustrate diversification in its biological function and genetic taxonomy across the phylogenetic tree. Phylogenetic analyses based on coding sequences of these FAM168 genes revealed that they are paralogs and that the earliest emergence of these genes occurred in jawed vertebrates such as Callorhinchus milii. Surprisingly, these two genes are absent in other chordates that have a notochord at some stage in their lives, such as branchiostoma and tunicates. In the context of phylogenetic relationships among eukaryotic species, our results demonstrate the presence of FAM168 orthologs in vertebrates ranging from Callorhinchus milii to Homo sapiens, displaying distinct taxonomic clusters, comprised of fish, amphibians, reptiles, birds, and mammals. Analyses of individual FAM168 exons in our sample provide new insights into the molecular relationships between FAM168A and FAM168B (MANI) on the one hand and livebearing and egg-laying mammals on the other hand, demonstrating that a distinctive intermediate exon 4, comprised of 27 nucleotides, appears suddenly only in FAM168A and there in the livebearing mammals only but is absent from all other species including the egg-laying mammals.

YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407

DEFF Research Database (Denmark)

Andersen, Niels Møller; Douthwaite, Stephen

2006-01-01

generally require specific enzymes, and only one m5C rRNA methyltransferase, RsmB (formerly Fmu) that methylates nucleotide C967, has previously been identified. BLAST searches of the E.coli genome revealed a single gene, yebU, with sufficient similarity to rsmB to encode a putative m5C RNA...... methyltransferase. This suggested that the yebU gene product modifies C1407 and/or C1962. Here, we analysed the E.coli rRNAs by matrix assisted laser desorption/ionization mass spectrometry and show that inactivation of the yebU gene leads to loss of methylation at C1407 in 16 S rRNA, but does not interfere...

Preliminary analysis of a 1:4 scale prestressed concrete containment vessel model

International Nuclear Information System (INIS)

Dameron, R.A.; Rashid, Y.R.; Luk, V.K.; Hessheimer, M.F.

1997-01-01

Sandia National Laboratories is conducting a research program to investigate the integrity of nuclear containment structures. As part of the program Sandia will construct an instrumented 1:4 scale model of a prestressed concrete containment vessel (PCCV) for pressurized water reactors (PWR), which will be pressure tested up to its ultimate capacity. One of the key program objectives is to develop validated methods to predict the structural performance of containment vessels when subjected to beyond design basis loadings. Analytical prediction of structural performance requires a stepwise, systematic approach that addresses all potential failure modes. The analysis effort includes two and three-dimensional nonlinear finite element analyses of the PCCV test model to evaluate its structural performance under very high internal pressurization. Such analyses have been performed using the nonlinear concrete constitutive model, ANACAP-U, in conjunction with the ABAQUS general purpose finite element code. The analysis effort is carried out in three phases: preliminary analysis; pretest prediction; and post-test data interpretation and analysis evaluation. The preliminary analysis phase serves to provide instrumentation support and identify candidate failure modes. The associated tasks include the preliminary prediction of failure pressure and probable failure locations and the development of models to be used in the detailed failure analyses. This paper describes the modeling approaches and some of the results obtained in the first phase of the analysis effort

Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

Science.gov (United States)

Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

2015-11-01

The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

VCS: Tool for Visualizing Copy Number Variation and Single Nucleotide Polymorphism

Directory of Open Access Journals (Sweden)

HyoYoung Kim

2014-12-01

Full Text Available Copy number variation (CNV or single nucleotide phlyorphism (SNP is useful genetic resource to aid in understanding complex phenotypes or deseases susceptibility. Although thousands of CNVs and SNPs are currently avaliable in the public databases, they are somewhat difficult to use for analyses without visualization tools. We developed a web-based tool called the VCS (visualization of CNV or SNP to visualize the CNV or SNP detected. The VCS tool can assist to easily interpret a biological meaning from the numerical value of CNV and SNP. The VCS provides six visualization tools: i the enrichment of genome contents in CNV; ii the physical distribution of CNV or SNP on chromosomes; iii the distribution of log2 ratio of CNVs with criteria of interested; iv the number of CNV or SNP per binning unit; v the distribution of homozygosity of SNP genotype; and vi cytomap of genes within CNV or SNP region.

Licensing Support System: Preliminary data scope analysis

International Nuclear Information System (INIS)

1989-01-01

The purpose of this analysis is to determine the content and scope of the Licensing Support System (LSS) data base. Both user needs and currently available data bases that, at least in part, address those needs have been analyzed. This analysis, together with the Preliminary Needs Analysis (DOE, 1988d) is a first effort under the LSS Design and Implementation Contract toward developing a sound requirements foundation for subsequent design work. These reports are preliminary. Further refinements must be made before requirements can be specified in sufficient detail to provide a basis for suitably specific system specifications. This document provides a baseline for what is known at this time. Additional analyses, currently being conducted, will provide more precise information on the content and scope of the LSS data base. 23 refs., 4 figs., 8 tabs

Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

DEFF Research Database (Denmark)

Golan, O; Issan, Y; Isak, A

2011-01-01

assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

Preliminary results of an oilspill risk analysis for the Bombay High Region

Digital Repository Service at National Institute of Oceanography (India)

Mascarenhas, A.A.M.Q.; Gouveia, A.D.; Sitaraman, R.

oil were analysed, covering estimates of the time between spill occurrence and contact with resources. The combined results yielded estimates of the overall risks associated with production within the developmental area. Preliminary results...

EXPLOSION POTENTIAL ASSESSMENT OF HEAT EXCHANGER NETWORK AT THE PRELIMINARY DESIGN STAGE

Directory of Open Access Journals (Sweden)

MOHSIN PASHA

2016-07-01

Full Text Available The failure of Shell and Tube Heat Exchangers (STHE is being extensively observed in the chemical process industries. This failure can cause enormous production loss and have a potential of dangerous consequences such as an explosion, fire and toxic release scenarios. There is an urgent need for assessing the explosion potential of shell and tube heat exchanger at the preliminary design stage. In current work, inherent safety index based approach is used to resolve the highlighted issue. Inherent Safety Index for Shell and Tube Heat Exchanger (ISISTHE is a newly developed index for assessing the inherent safety level of a STHE at the preliminary design stage. This index is composed of preliminary design variables and integrated with the process design simulator (Aspen HYSYS. Process information can easily be transferred from process design simulator to MS Excel spreadsheet owing to this integration. This index could potentially facilitate the design engineer to analyse the worst heat exchanger in the heat exchanger network. Typical heat exchanger network of the steam reforming process is presented as a case study and the worst heat exchanger of this network has been identified. It is inferred from this analysis that shell and tube heat exchangers possess high operating pressure, corrected mean temperature difference (CMTD and flammability and reactive potential needs to be critically analysed at the preliminary design stage.

Psychophysiological deficits in young adolescents with psychosis or ADHD: Preliminary findings

DEFF Research Database (Denmark)

Rydkjær, Jacob; Jepsen, Jens Richardt Møllegaard; Fagerlund, Birgitte

add valuable information on how to differentiate premature stages of early onset psychosis from ADHD. Aim: To characterize psychophysiological deficits in young adolescents with psychosis or ADHD and compare the profiles of impariments between the two groups. Materials and methods: A cohort of young...... and low intensity prepulse trials, Mismatch Negativity (MMN), Selective Attention (SA) and P50. Results: Preliminary analyses of 18 patients with psychosis and 12 patients with ADHD showed significantly less PPI in the higher intensity prepulse trials in the psychosis group than in the ADHD group....... No significant group difference was found in the lower intensity prepulse trials. Conclusion: The preliminary results indicate lower levels of PPI in adolescents with early onset psychosis than in young patients with ADHD. If these results hold in the final analyses then this knowledge may contribute to better...

APPLYING SPECTROSCOPIC METHODS ON ANALYSES OF HAZARDOUS WASTE

OpenAIRE

Dobrinić, Julijan; Kunić, Marija; Ciganj, Zlatko

2000-01-01

Abstract The paper presents results of measuring the content of heavy and other metals in waste samples from the hazardous waste disposal site of Sovjak near Rijeka. The preliminary design elaboration and the choice of the waste disposal sanification technology were preceded by the sampling and physico-chemical analyses of disposed waste, enabling its categorization. The following spectroscopic methods were applied on metal content analysis: Atomic absorption spectroscopy (AAS) and plas...

Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

Science.gov (United States)

Schechinger, Linda Sue

I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

NONSPECIFIC IMMUNE RESPONSE AND RESISTANCE OF Litopenaeus vannamei FED WITH NUCLEOTIDE, β-GLUCAN, AND PROTAGEN DIETS

Directory of Open Access Journals (Sweden)

Henky Manoppo

2010-06-01

Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.

Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides

Science.gov (United States)

Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.

1978-01-01

Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

Nucleotide excision repair II: From yeast to mammals

NARCIS (Netherlands)

J.H.J. Hoeijmakers (Jan)

1993-01-01

textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

Science.gov (United States)

Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

2018-03-01

Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

Caveolin-1 single nucleotide polymorphism in antineutrophil cytoplasmic antibody associated vasculitis.

Directory of Open Access Journals (Sweden)

Sourabh Chand

Full Text Available Immunosuppression is cornerstone treatment of antineutrophil cytoplasmic antibody associated vasculitis (AAV but is later complicated by infection, cancer, cardiovascular and chronic kidney disease. Caveolin-1 is an essential structural protein for small cell membrane invaginations known as caveolae. Its functional role has been associated with these complications. For the first time, caveolin-1 (CAV1 gene variation is studied in AAV.CAV1 single nucleotide polymorphism rs4730751 was analysed in genomic DNA from 187 white patients with AAV from Birmingham, United Kingdom. The primary outcome measure was the composite endpoint of time to all-cause mortality or renal replacement therapy. Secondary endpoints included time to all-cause mortality, death from sepsis or vascular disease, cancer and renal replacement therapy. Validation of results was sought from 589 white AAV patients, from two European cohorts.The primary outcome occurred in 41.7% of Birmingham patients. In a multivariate model, non-CC genotype variation at the studied single nucleotide polymorphism was associated with increased risk from: the primary outcome measure [HR 1.86; 95% CI: 1.14-3.04; p=0.013], all-cause mortality [HR:1.83; 95% CI: 1.02-3.27; p=0.042], death from infection [HR:3.71; 95% CI: 1.28-10.77; p=0.016], death from vascular disease [HR:3.13; 95% CI: 1.07-9.10; p=0.037], and cancer [HR:5.55; 95% CI: 1.59-19.31; p=0.007]. In the validation cohort, the primary outcome rate was far lower (10.4%; no association between genotype and the studied endpoints was evident.The presence of a CC genotype in Birmingham is associated with protection from adverse outcomes of immunosuppression treated AAV. Lack of replication in the European cohort may have resulted from low clinical event rates. These findings are worthy of further study in larger cohorts.

Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

Directory of Open Access Journals (Sweden)

Charikleia Papadopoulou

2015-12-01

Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

Fluorinated Nucleotide Modifications Modulate Allele Selectivity of SNP-Targeting Antisense Oligonucleotides

Directory of Open Access Journals (Sweden)

Michael E. Østergaard

2017-06-01

Full Text Available Antisense oligonucleotides (ASOs have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT and wild-type HTT (wtHTT mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important.

Preliminary performance assessment for the Waste Isolation Pilot Plant, December 1992. Volume 5, Uncertainty and sensitivity analyses of gas and brine migration for undisturbed performance

Energy Technology Data Exchange (ETDEWEB)

1993-08-01

Before disposing of transuranic radioactive waste in the Waste Isolation Pilot Plant (WIPP), the United States Department of Energy (DOE) must evaluate compliance with applicable long-term regulations of the United States Environmental Protection Agency (EPA). Sandia National Laboratories is conducting iterative performance assessments (PAs) of the WIPP for the DOE to provide interim guidance while preparing for a final compliance evaluation. This volume of the 1992 PA contains results of uncertainty and sensitivity analyses with respect to migration of gas and brine from the undisturbed repository. Additional information about the 1992 PA is provided in other volumes. Volume 1 contains an overview of WIPP PA and results of a preliminary comparison with 40 CFR 191, Subpart B. Volume 2 describes the technical basis for the performance assessment, including descriptions of the linked computational models used in the Monte Carlo analyses. Volume 3 contains the reference data base and values for input parameters used in consequence and probability modeling. Volume 4 contains uncertainty and sensitivity analyses with respect to the EPA`s Environmental Standards for the Management and Disposal of Spent Nuclear Fuel, High-Level and Transuranic Radioactive Wastes (40 CFR 191, Subpart B). Finally, guidance derived from the entire 1992 PA is presented in Volume 6. Results of the 1992 uncertainty and sensitivity analyses indicate that, conditional on the modeling assumptions and the assigned parameter-value distributions, the most important parameters for which uncertainty has the potential to affect gas and brine migration from the undisturbed repository are: initial liquid saturation in the waste, anhydrite permeability, biodegradation-reaction stoichiometry, gas-generation rates for both corrosion and biodegradation under inundated conditions, and the permeability of the long-term shaft seal.

Preparation of protected nucleotides usable in oligonucleotide synthesis

International Nuclear Information System (INIS)

Debiard, Jean-Pascal

1983-01-01

After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

Preliminary Seismic Response and Fragility Analysis for DACS Cabinet

Energy Technology Data Exchange (ETDEWEB)

Oh, Jinho; Kwag, Shinyoung; Lee, Jongmin; Kim, Youngki [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2013-05-15

A DACS cabinet is installed in the main control room. The objective of this paper is to perform seismic analyses and evaluate the preliminary structural integrity and seismic capacity of the DACS cabinet. For this purpose, a 3-D finite element model of the DACS cabinet was developed and its modal analyses are carried out to analyze the dynamic characteristics. The response spectrum analyses and the related safety evaluation are then performed for the DACS cabinet subject to seismic loads. Finally, the seismic margin and seismic fragility of the DACS cabinet are investigated. A seismic analysis and preliminary structural integrity of the DACS cabinet under self weight and SSE load have been evaluated. For this purpose, 3-D finite element models of the DACS cabinet were developed. A modal analysis, response spectrum analysis, and seismic fragility analysis were then performed. From the structural analysis results, the DACS cabinet is below the structural design limit of under SSE 0.3g, and can structurally withstand until less than SSE 3g based on an evaluation of the maximum effective stresses. The HCLPF capacity for the DGRS of the SSE 0.3g is 0.55g. A modal analysis, response spectrum analysis, and seismic fragility analysis were then performed. From the structural analysis results, the DACS cabinet is below the structural design limit of under SSE 0.3g, and can structurally withstand until less than SSE 3g based on an evaluation of the maximum effective stresses. The HCLPF capacity for the DGRS of the SSE 0.3g is 0.55g. Therefore, it is concluded that the DACS cabinet was safely designed in that no damage to the preliminary structural integrity and sufficient seismic margin is expected.

Preliminary Seismic Response and Fragility Analysis for DACS Cabinet

International Nuclear Information System (INIS)

Oh, Jinho; Kwag, Shinyoung; Lee, Jongmin; Kim, Youngki

2013-01-01

A DACS cabinet is installed in the main control room. The objective of this paper is to perform seismic analyses and evaluate the preliminary structural integrity and seismic capacity of the DACS cabinet. For this purpose, a 3-D finite element model of the DACS cabinet was developed and its modal analyses are carried out to analyze the dynamic characteristics. The response spectrum analyses and the related safety evaluation are then performed for the DACS cabinet subject to seismic loads. Finally, the seismic margin and seismic fragility of the DACS cabinet are investigated. A seismic analysis and preliminary structural integrity of the DACS cabinet under self weight and SSE load have been evaluated. For this purpose, 3-D finite element models of the DACS cabinet were developed. A modal analysis, response spectrum analysis, and seismic fragility analysis were then performed. From the structural analysis results, the DACS cabinet is below the structural design limit of under SSE 0.3g, and can structurally withstand until less than SSE 3g based on an evaluation of the maximum effective stresses. The HCLPF capacity for the DGRS of the SSE 0.3g is 0.55g. A modal analysis, response spectrum analysis, and seismic fragility analysis were then performed. From the structural analysis results, the DACS cabinet is below the structural design limit of under SSE 0.3g, and can structurally withstand until less than SSE 3g based on an evaluation of the maximum effective stresses. The HCLPF capacity for the DGRS of the SSE 0.3g is 0.55g. Therefore, it is concluded that the DACS cabinet was safely designed in that no damage to the preliminary structural integrity and sufficient seismic margin is expected

Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

Energy Technology Data Exchange (ETDEWEB)

Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica

2013-12-01

Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats.

Science.gov (United States)

Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M

1999-03-01

The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

Histone displacement during nucleotide excision repair

DEFF Research Database (Denmark)

Dinant, C.; Bartek, J.; Bekker-Jensen, S.

2012-01-01

Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

Analyses of single nucleotide polymorphisms in selected nutrient-sensitive genes in weight-regain prevention: the DIOGENES study.

Science.gov (United States)

Larsen, Lesli H; Angquist, Lars; Vimaleswaran, Karani S; Hager, Jörg; Viguerie, Nathalie; Loos, Ruth J F; Handjieva-Darlenska, Teodora; Jebb, Susan A; Kunesova, Marie; Larsen, Thomas M; Martinez, J Alfredo; Papadaki, Angeliki; Pfeiffer, Andreas F H; van Baak, Marleen A; Sørensen, Thorkild Ia; Holst, Claus; Langin, Dominique; Astrup, Arne; Saris, Wim H M

2012-05-01

Differences in the interindividual response to dietary intervention could be modified by genetic variation in nutrient-sensitive genes. This study examined single nucleotide polymorphisms (SNPs) in presumed nutrient-sensitive candidate genes for obesity and obesity-related diseases for main and dietary interaction effects on weight, waist circumference, and fat mass regain over 6 mo. In total, 742 participants who had lost ≥ 8% of their initial body weight were randomly assigned to follow 1 of 5 different ad libitum diets with different glycemic indexes and contents of dietary protein. The SNP main and SNP-diet interaction effects were analyzed by using linear regression models, corrected for multiple testing by using Bonferroni correction and evaluated by using quantile-quantile (Q-Q) plots. After correction for multiple testing, none of the SNPs were significantly associated with weight, waist circumference, or fat mass regain. Q-Q plots showed that ALOX5AP rs4769873 showed a higher observed than predicted P value for the association with less waist circumference regain over 6 mo (-3.1 cm/allele; 95% CI: -4.6, -1.6; P/Bonferroni-corrected P = 0.000039/0.076), independently of diet. Additional associations were identified by using Q-Q plots for SNPs in ALOX5AP, TNF, and KCNJ11 for main effects; in LPL and TUB for glycemic index interaction effects on waist circumference regain; in GHRL, CCK, MLXIPL, and LEPR on weight; in PPARC1A, PCK2, ALOX5AP, PYY, and ADRB3 on waist circumference; and in PPARD, FABP1, PLAUR, and LPIN1 on fat mass regain for dietary protein interaction. The observed effects of SNP-diet interactions on weight, waist, and fat mass regain suggest that genetic variation in nutrient-sensitive genes can modify the response to diet. This trial was registered at clinicaltrials.gov as NCT00390637.

Socioeconomic issues and analyses for radioactive waste disposal facilities

International Nuclear Information System (INIS)

Ulland, L.

1988-01-01

Radioactive Waste facility siting and development can raise major social and economic issues in the host area. Initial site screening and analyses have been conducted for both potential high-level and low-level radioactive waste facilities; more detailed characterization and analyses are being planned. Results of these assessments are key to developing community plans that identify and implement measures to mitigate adverse socioeconomic impacts. Preliminary impact analyses conducted at high-level sites in Texas and Nevada, and site screening activities for low-level facilities in Illinois and California have identified a number of common socioeconomic issues and characteristics as well as issues and characteristics that differ between the sites and the type of facilities. Based on these comparisons, implications for selection of an appropriate methodology for impact assessment and elements of impact mitigation are identified

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

Science.gov (United States)

Nishizawa, M; Nishizawa, K

2000-10-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

Simplified methods and application to preliminary design of piping for elevated temperature service

International Nuclear Information System (INIS)

Severud, L.K.

1975-01-01

A number of simplified stress analysis methods and procedures that have been used on the FFTF project for preliminary design of piping operating at elevated temperatures are described. The rationale and considerations involved in developing the procedures and preliminary design guidelines are given. Applications of the simplified methods to a few FFTF pipelines are described and the success of these guidelines are measured by means of comparisons to pipeline designs that have had detailed Code type stress analyses. (U.S.)

Genetic variation in Hyperpolarization-activated cyclic nucleotide-gated (HCN channels and its relationship with neuroticism, cognition and risk of depression

Directory of Open Access Journals (Sweden)

Andrew Mark Mcintosh

2012-07-01

Full Text Available Hyperpolarization-activated cyclic nucleotide-gated (HCN channels are encoded by four genes (HCN1-4 and, through activation by cyclic AMP (cAMP, represent a point of convergence for several psychosis risk genes. On the basis of positive preliminary data, we sought to test whether genetic variation in HCN1-4 conferred risk of depression or cognitive impairment in the Generation Scotland: Scottish Family Health Study. HCN1, HCN2, HCN3 and HCN4 were genotyped for 43 haplotype-tagging SNPs and tested for association with DSM-IV depression, neuroticism and a battery of cognitive tests assessing cognitive ability, memory, verbal fluency and psychomotor performance. No association was found between any HCN channel gene SNP and risk of depression, neuroticism or on any cognitive measure. The current study does not support a genetic role for HCN channels in conferring risk of depression or cognitive impairment in human subjects within the Scottish population.

Prediction of peripheral neuropathy in multiple myeloma patients receiving bortezomib and thalidomide: a genetic study based on a single nucleotide polymorphism array.

Science.gov (United States)

García-Sanz, Ramón; Corchete, Luis Antonio; Alcoceba, Miguel; Chillon, María Carmen; Jiménez, Cristina; Prieto, Isabel; García-Álvarez, María; Puig, Noemi; Rapado, Immaculada; Barrio, Santiago; Oriol, Albert; Blanchard, María Jesús; de la Rubia, Javier; Martínez, Rafael; Lahuerta, Juan José; González Díaz, Marcos; Mateos, María Victoria; San Miguel, Jesús Fernando; Martínez-López, Joaquín; Sarasquete, María Eugenia

2017-12-01

Bortezomib- and thalidomide-based therapies have significantly contributed to improved survival of multiple myeloma (MM) patients. However, treatment-induced peripheral neuropathy (TiPN) is a common adverse event associated with them. Risk factors for TiPN in MM patients include advanced age, prior neuropathy, and other drugs, but there are conflicting results about the role of genetics in predicting the risk of TiPN. Thus, we carried out a genome-wide association study based on more than 300 000 exome single nucleotide polymorphisms in 172 MM patients receiving therapy involving bortezomib and thalidomide. We compared patients developing and not developing TiPN under similar treatment conditions (GEM05MAS65, NCT00443235). The highest-ranking single nucleotide polymorphism was rs45443101, located in the PLCG2 gene, but no significant differences were found after multiple comparison correction (adjusted P = .1708). Prediction analyses, cytoband enrichment, and pathway analyses were also performed, but none yielded any significant findings. A copy number approach was also explored, but this gave no significant results either. In summary, our study did not find a consistent genetic component associated with TiPN under bortezomib and thalidomide therapies that could be used for prediction, which makes clinical judgment essential in the practical management of MM treatment. Copyright © 2016 John Wiley & Sons, Ltd.

Computational identification of candidate nucleotide cyclases in higher plants

KAUST Repository

Wong, Aloysius Tze; Gehring, Christoph A

2013-01-01

In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs

Preliminary design report: Babcock and Wilcox BR-100 100-ton rail/barge spent fuel shipping cask

International Nuclear Information System (INIS)

1990-02-01

The purpose of this document is to provide information on burnup credit as applied to the preliminary design of the BR-100 shipping cask. There is a brief description of the preliminary basket design and the features used to maintain a critically safe system. Following the basket description is a discussion of various criticality analyses used to evaluate burnup credit. The results from these analyses are then reviewed in the perspective of fuel burnups expected to be shipped to either the final repository or a Monitored Retrievable Storage (MRS) facility. The hurdles to employing burnup credit in the certification of any cask are then outlines and reviewed. the last section gives conclusions reached as to burnup credit for the BR-100 cask, based on our analyses and experience. All information in this study refers to the cask configured to transport PWR fuel. Boiling Water Reactor (BWR) fuel satisfies the criticality requirements so that burnup credit is not needed. All calculations generated in the preparation of this report were based upon the preliminary design which will be optimized during the final design. 8 refs., 19 figs., 16 tabs

A preliminary analysis of the reactor-based plutonium disposition alternative deployment schedules

International Nuclear Information System (INIS)

Zurn, R.M.

1997-09-01

This paper discusses the preliminary analysis of the implementation schedules of the reactor-based plutonium disposition alternatives. These schedule analyses are a part of a larger process to examine the nine decision criteria used to determine the most appropriate method of disposing of U.S. surplus weapons plutonium. The preliminary analysis indicates that the mission durations for the reactor-based alternatives range from eleven years to eighteen years and the initial mission fuel assemblies containing surplus weapons-usable plutonium could be loaded into the reactors between nine and fourteen years after the Record of Decision

Preliminary design analysis of hot gas ducts and a intermediate heat exchanger for the nuclear hydrogen reactor

International Nuclear Information System (INIS)

Song, K. N.; Kim, Y. W.

2008-01-01

Korea Atomic Energy Research Institute (KAERI) is in the process of carrying out a nuclear hydrogen system by considering the indirect cycle gas cooled reactors that produce heat at temperatures in the order of 950 .deg. C. Primary and secondary hot gas ducts with coaxial double tubes and are key components connecting a reactor pressure vessel and a intermediate heat exchanger for the nuclear hydrogen system. In this study, preliminary design analyses on the hot gas ducts and the intermediate heat exchanger were carried out. These preliminary design activities include a preliminary design on the geometric dimensions, a preliminary strength evaluation, thermal sizing, and an appropriate material selection

Licensing support system preliminary needs analysis: Volume 1

International Nuclear Information System (INIS)

1989-01-01

This Preliminary Needs Analysis, together with the Preliminary Data Scope Analysis (next in this series of reports), is a first effort under the LSS Design and Implementation Contract toward developing a sound requirements foundation for subsequent design work. Further refinements must be made before requirements can be specified in sufficient detail to provide a basis for suitably specific system specifications. This preliminary analysis of the LSS requirements has been divided into a ''needs'' and a ''data scope'' portion only for project management and scheduling reasons. The Preliminary Data Scope Analysis will address all issues concerning the content and size of the LSS data base; providing the requirements basis for data acquisition, cataloging and storage sizing specifications. This report addresses all other requirements for the LSS. The LSS consists of both computer subsystems and non-computer archives. This study addresses only the computer subsystems, focusing on the Access Subsystems. After providing background on previous LSS-related work, this report summarizes the findings from previous examinations of needs and describes a number of other requirements that have an impact on the LSS. The results of interviews conducted for this report are then described and analyzed. The final section of the report brings all of the key findings together and describes how these needs analyses will continue to be refined and utilized in on-going design activities. 14 refs., 2 figs., 1 tab

Preliminary Seismic Performance Evaluation of RPS Cabinet in a Research Reactor

Energy Technology Data Exchange (ETDEWEB)

Kwag, Shinyoung; Oh, Jinho; Lee, Jongmin; Kim, Youngki [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2013-05-15

This RPS cabinet mainly provides the operators with the physical interface to monitor and handle the RPS. The objective of this paper is to perform seismic analyses and evaluate the preliminary structural integrity and seismic capacity of the RPS cabinet. For this purpose, a 3-D finite element model of the RPS cabinet is developed and its modal analyses are carried out for analyzing the dynamic characteristics. Response time history analyses and related safety evaluation are performed for the RPS cabinet subjected to seismic loads. Finally, the seismic margin and seismic fragility of the RPS cabinet are investigated. The seismic analysis, and preliminary structural integrity and seismic margin of the RPS cabinet under self weight and seismic load have been evaluated. For this purpose, 3-D finite element models of the RPS cabinet were developed. A modal analysis, response time history analysis, and seismic fragility analysis were then performed. From the structural analysis results, the RPS cabinet is below the structural design limit under PGA 0.3g (hor.) and 0.2g (ver.) and structurally withstands until PGA 3g (hor.) and 2g (ver.)

Classifying Coding DNA with Nucleotide Statistics

Directory of Open Access Journals (Sweden)

Nicolas Carels

2009-10-01

Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-01-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

African Journals Online (AJOL)

STORAGESEVER

2009-06-17

Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

Statistical properties of nucleotides in human chromosomes 21 and 22

International Nuclear Information System (INIS)

Zhang Linxi; Sun Tingting

2005-01-01

In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

Ras conformational switching: simulating nucleotide-dependent conformational transitions with accelerated molecular dynamics.

Directory of Open Access Journals (Sweden)

Barry J Grant

2009-03-01

Full Text Available Ras mediates signaling pathways controlling cell proliferation and development by cycling between GTP- and GDP-bound active and inactive conformational states. Understanding the complete reaction path of this conformational change and its intermediary structures is critical to understanding Ras signaling. We characterize nucleotide-dependent conformational transition using multiple-barrier-crossing accelerated molecular dynamics (aMD simulations. These transitions, achieved for the first time for wild-type Ras, are impossible to observe with classical molecular dynamics (cMD simulations due to the large energetic barrier between end states. Mapping the reaction path onto a conformer plot describing the distribution of the crystallographic structures enabled identification of highly populated intermediate structures. These structures have unique switch orientations (residues 25-40 and 57-75 intermediate between GTP and GDP states, or distinct loop3 (46-49, loop7 (105-110, and alpha5 C-terminus (159-166 conformations distal from the nucleotide-binding site. In addition, these barrier-crossing trajectories predict novel nucleotide-dependent correlated motions, including correlations of alpha2 (residues 66-74 with alpha3-loop7 (93-110, loop2 (26-37 with loop10 (145-151, and loop3 (46-49 with alpha5 (152-167. The interconversion between newly identified Ras conformations revealed by this study advances our mechanistic understanding of Ras function. In addition, the pattern of correlated motions provides new evidence for a dynamic linkage between the nucleotide-binding site and the membrane interacting C-terminus critical for the signaling function of Ras. Furthermore, normal mode analysis indicates that the dominant collective motion that occurs during nucleotide-dependent conformational exchange, and captured in aMD (but absent in cMD simulations, is a low-frequency motion intrinsic to the structure.

Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

Directory of Open Access Journals (Sweden)

Kouki Yonezawa

Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

Building the library of RNA 3D nucleotide conformations using the clustering approach

Directory of Open Access Journals (Sweden)

Zok Tomasz

2015-09-01

Full Text Available An increasing number of known RNA 3D structures contributes to the recognition of various RNA families and identification of their features. These tasks are based on an analysis of RNA conformations conducted at different levels of detail. On the other hand, the knowledge of native nucleotide conformations is crucial for structure prediction and understanding of RNA folding. However, this knowledge is stored in structural databases in a rather distributed form. Therefore, only automated methods for sampling the space of RNA structures can reveal plausible conformational representatives useful for further analysis. Here, we present a machine learning-based approach to inspect the dataset of RNA three-dimensional structures and to create a library of nucleotide conformers. A median neural gas algorithm is applied to cluster nucleotide structures upon their trigonometric description. The clustering procedure is two-stage: (i backbone- and (ii ribose-driven. We show the resulting library that contains RNA nucleotide representatives over the entire data, and we evaluate its quality by computing normal distribution measures and average RMSD between data points as well as the prototype within each cluster.

A fluorimetric readout reporting the kinetics of nucleotide-induced human ribonucleotide reductase oligomerization.

Science.gov (United States)

Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon

2014-11-24

Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Preliminary ECLSS waste water model

Science.gov (United States)

Carter, Donald L.; Holder, Donald W., Jr.; Alexander, Kevin; Shaw, R. G.; Hayase, John K.

1991-01-01

A preliminary waste water model for input to the Space Station Freedom (SSF) Environmental Control and Life Support System (ECLSS) Water Processor (WP) has been generated for design purposes. Data have been compiled from various ECLSS tests and flight sample analyses. A discussion of the characterization of the waste streams comprising the model is presented, along with a discussion of the waste water model and the rationale for the inclusion of contaminants in their respective concentrations. The major objective is to establish a methodology for the development of a waste water model and to present the current state of that model.

Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

International Nuclear Information System (INIS)

Amborski, Andrew N.; Johnson, Philip E.

2008-01-01

We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

Reversal of Proximal Renal Tubular Dysfunction after Nucleotide Analogue Withdrawal in Chronic Hepatitis B

Directory of Open Access Journals (Sweden)

Abhasnee Sobhonslidsuk

2017-01-01

Full Text Available Aims. Proximal renal tubular dysfunction (PRTD is an infrequent complication after nucleotide analogue therapy. We evaluated the outcomes of PRTD and nephrotoxicity after nucleotide analogue withdrawal in chronic hepatitis B (CHB. Methods. A longitudinal follow-up study was performed in patients with PRTD after nucleotide analogue discontinuation. Serum and urine were collected at baseline and every 3 months for one year. The fractional excretion of phosphate (PO4, uric acid (UA, and potassium and tubular maximal reabsorption rate of PO4 to glomerular filtration rate (TmPO4/GFR were calculated. Renal losses were defined based on the criteria of substance losses. Subclinical PRTD and overt PRTD were diagnosed when 2 and ≥3 criteria were identified. Results. Eight subclinical and eight overt PRTD patients were enrolled. After nucleotide analogue withdrawal, there were overall improvements in GFR, serum PO4, and UA. Renal loss of PO4, UA, protein, and β2-microglobulin reduced over time. At one year, complete reversal of PRTD was seen in 13 patients (81.2%. Improvements in PRTD were seen in all but one patient. Conclusion. One year after nucleotide analogue withdrawal, PRTD was resolved in most patients. Changes in TmPO4/GFR, urinary protein, and β2-microglobulin indicate that urinary biomarkers may represent an early sign of PRTD recovery.

Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

International Nuclear Information System (INIS)

Boulias, C.; Moscarello, M.A.

1989-01-01

Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides

Nucleotide Manipulatives to Illustrate the Central Dogma

OpenAIRE

Sonja B. Yung; Todd P. Primm

2015-01-01

The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

Pyrrolidine nucleotide analogs with a tunable conformation

Czech Academy of Sciences Publication Activity Database

Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

2014-01-01

Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

Science.gov (United States)

Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

1989-10-11

The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

Preliminary design analysis of the ALT-II limiter for TEXTOR

International Nuclear Information System (INIS)

Koski, J.A.; Boyd, R.D.; Kempka, S.M.; Romig, A.D. Jr.; Smith, M.F.; Watson, R.D.; Whitley, J.B.; Conn, R.W.; Grotz, S.P.

1984-01-01

Installation of a large toroidal belt pump limiter, Advanced Limiter Test II (ALT-II), on the TEXTOR tokamak at Juelich, FRG is anticipated for early 1986. This paper discusses the preliminary mechanical design and materials considerations undertaken as part of the feasibility study phase for ALT-II. Since the actively cooled limiter blade is the component in direct contact with the plasma edge, and thus subject to the severe plasma environment, most preliminary design efforts have concentrated on analysis of the blade. The screening process which led to the recommended preliminary design consisting of a dispersion strenghthened copper or OFHC copper cover plate over an austenitic stainless steel base plate is discussed. A 1 to 3 mm thick low atomic number coating consisting of a graded plasma-sprayed Silicon Carbide-Aluminium composite is recommended subject to further experiment and evaluation. Thermal-hydraulic and stress analyses of the limiter blade are also discussed. (orig.)

Genetic variation of classical swine fever virus based on palindromic nucleotide substitutions, a genetic marker in the 5' untranslated region of RNA

Directory of Open Access Journals (Sweden)

Massimo Giangaspero

2008-06-01

Full Text Available Forty-three strains of classical swine fever (hog cholera virus (CSFV from outbreaks in pigs in Europe, Asia and America, two strains from commercial CSFV modified live vaccines and a strain isolated from a diseased lamb from Spain were subjected to analyses of nucleotide sequence variations in the 5’ terminal region of the genome. These isolates were divided into three clusters, namely: CSFV-1, CSFV-2, and CSFV-3, based on palindromic nucleotide substitutions in the 5’ untranslated region (UTR. The homology degree, according to nucleotide base pairing variation in the secondary palindromic structure of the three variable loci V1, V2 and V3, was 60% in the CSFV species, with a mean divergence value of 6.19 base pairs (bp. relatedness within genotypes ranged from 71.11% to 100%, with mean divergence values from 5.5 to 0.73 base pairs. Subgenotypes showed a divergence ranging from 1 to 9 base pairs within the genotype. Genotype CSFV-1 revealed 15 base pair combinations with 13 divergent base pairs, resulting in 4 subgenotypes with 6 variants in subgenotype CSFV-1.1, including the reference strain Brescia and 6 variants in subgenotype CSFV-1.2, including the Alfort reference strain. Subgenotypes CSFV-1.3 and CSFV-1.4 comprised one and two variants, respectively. Genotype CSFV-2 was represented by the Spanish ovine isolate 5440/99 and the genotype CSFV-3 included the Japanese strains Okinawa/86 and Kanagawa/74. CSFV genotypes revealed a strong relationship with Border disease virus strains, showing relatively low divergence values when compared to other pestivirus species. Evaluation of nucleotide base pair divergence among genotypes and expression of evolutionary changes in the CSFV species led to the construction of a phylogenetic tree based on secondary structure.

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

Science.gov (United States)

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

The nucleotide sequences of two leghemoglobin genes from soybean

DEFF Research Database (Denmark)

Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

1982-01-01

We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

Nucleotide Manipulatives to Illustrate the Central Dogma

Directory of Open Access Journals (Sweden)

Sonja B. Yung

2015-08-01

Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

Guanylic nucleotide starvation affects Saccharomyces cerevisiae mother-daughter separation and may be a signal for entry into quiescence

Directory of Open Access Journals (Sweden)

Sagot Isabelle

2005-05-01

Full Text Available Abstract Background Guanylic nucleotides are both macromolecules constituents and crucial regulators for a variety of cellular processes. Therefore, their intracellular concentration must be strictly controlled. Consistently both yeast and mammalian cells tightly correlate the transcription of genes encoding enzymes critical for guanylic nucleotides biosynthesis with the proliferation state of the cell population. Results To gain insight into the molecular relationships connecting intracellular guanylic nucleotide levels and cellular proliferation, we have studied the consequences of guanylic nucleotide limitation on Saccharomyces cerevisiae cell cycle progression. We first utilized mycophenolic acid, an immunosuppressive drug that specifically inhibits inosine monophosphate dehydrogenase, the enzyme catalyzing the first committed step in de novo GMP biosynthesis. To approach this system physiologically, we next developed yeast mutants for which the intracellular guanylic nucleotide pools can be modulated through changes of growth conditions. In both the pharmacological and genetic approaches, we found that guanylic nucleotide limitation generated a mother-daughter separation defect, characterized by cells with two unseparated daughters. We then showed that this separation defect resulted from cell wall perturbations but not from impaired cytokinesis. Importantly, cells with similar separation defects were found in a wild type untreated yeast population entering quiescence upon nutrient limitation. Conclusion Our results demonstrate that guanylic nucleotide limitation slows budding yeast cell cycle progression, with a severe pause in telophase. At the cellular level, guanylic nucleotide limitation causes the emergence of cells with two unseparated daughters. By fluorescence and electron microscopy, we demonstrate that this phenotype arises from defects in cell wall partition between mother and daughter cells. Because cells with two unseparated

Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

International Nuclear Information System (INIS)

Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.

1987-01-01

Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced 125 I-[Tyr 1 ]somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate [Gpp(NH)p]>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg 2+ . When pancreatic acini were treated with 1 μg/ml pertussis toxin for 4 h, subsequent 125 I-[Tyr 1 ]somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor

Preliminary result on trabecular bone score (TBS in lumbar vertebrae with experimentally altered microarchitecture

Directory of Open Access Journals (Sweden)

M. Di Stefano

2013-01-01

Full Text Available The aim of this preliminary research is to investigate the reliability of a new qualitative parameter, called Trabecular Bone Score (TBS, recently proposed for evaluating the microarchitectural arrangement of cancellous bone in scans carried out by dual energy X-ray absorptiometry (DXA. Vertebral bodies of 15 fresh samples of lumbar spines of adult pig were analysed either in basal conditions and with altered microarchitecture of the cancellous bone obtained by progressive drilling. The examined bony areas do not show changes in bone mineral density (BMD, whereas TBS values decrease with the increasing alteration of the vertebral microtrabecular structure. Our preliminary data seem to confirm the reliability of TBS as a qualitative parameter useful for evaluating the microarchitectural strength in bony areas quantitatively analysed by DXA.

Nucleotide excision repair I: from E.coli to yeast.

NARCIS (Netherlands)

J.H.J. Hoeijmakers (Jan)

1993-01-01

textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

Development of a single nucleotide polymorphism (SNP) marker for ...

African Journals Online (AJOL)

The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

Effects of Dietary Nucleotides on Growth Rate and Disease ...

African Journals Online (AJOL)

Nucleotides are low molecular weight biological compounds, which are ... nutrition and disease aspects of crustaceans (Overton and Bland 1981 .... additives on growth and disease resistance. Effects of ... metabolically active cells during stressful conditions ... in humans supplemented with Uracyl, which resulted in optimal ...

[Complete genome sequencing and analyses of rabies viruses isolated from wild animals (Chinese Ferret-Badger) in Zhejiang province].

Science.gov (United States)

Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing

2009-08-01

Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers

Design basis event consequence analyses for the Yucca Mountain project

International Nuclear Information System (INIS)

Orvis, D.D.; Haas, M.N.; Martin, J.H.

1997-01-01

Design basis event (DBE) definition and analysis is an ongoing and integrated activity among the design and analysis groups of the Yucca Mountain Project (YMP). DBE's are those that potentially lead to breach of the waste package and waste form (e.g., spent fuel rods) with consequent release of radionuclides to the environment. A Preliminary Hazards Analysis (PHA) provided a systematic screening of external and internal events that were candidate DBE's that will be subjected to analyses for radiological consequences. As preparation, pilot consequence analyses for the repository subsurface and surface facilities have been performed to define the methodology, data requirements, and applicable regulatory limits

Safety performance of preliminary KALIMER conceptual design

Energy Technology Data Exchange (ETDEWEB)

Hahn Dohee; Kim Kyoungdoo; Kwon Youngmin; Chang Wonpyo; Suk Soodong [Korea atomic Energy Resarch Inst., Taejon (Korea)

1999-07-01

The Korea Atomic Energy Research Institute (KAERI) is developing KALIMER (Korea Advanced Liquid Metal Reactor), which is a sodium cooled, 150 MWe pool-type reactor. The safety design of KALIMER emphasizes accident prevention by using passive processes, which can be accomplished by the safety design objectives including the utilization of inherent safety features. In order to assess the effectiveness of the inherent safety features in achieving the safety design objectives, a preliminary evaluation of ATWS performance for the KALIMER design has been performed with SSC-K code, which is a modified version of SSC-L code. KAERI's modification of the code includes development of reactivity feedback models for the core and a pool model for KALIMER reactor vessel. This paper describes the models for control rod driveline expansion, gas expansion module and the thermal hydraulic model for reactor pool and the results of preliminary analyses for unprotected loss of flow and loss o heat sink. (author)

Safety performance of preliminary KALIMER conceptual design

International Nuclear Information System (INIS)

Hahn Dohee; Kim Kyoungdoo; Kwon Youngmin; Chang Wonpyo; Suk Soodong

1999-01-01

The Korea Atomic Energy Research Institute (KAERI) is developing KALIMER (Korea Advanced Liquid Metal Reactor), which is a sodium cooled, 150 MWe pool-type reactor. The safety design of KALIMER emphasizes accident prevention by using passive processes, which can be accomplished by the safety design objectives including the utilization of inherent safety features. In order to assess the effectiveness of the inherent safety features in achieving the safety design objectives, a preliminary evaluation of ATWS performance for the KALIMER design has been performed with SSC-K code, which is a modified version of SSC-L code. KAERI's modification of the code includes development of reactivity feedback models for the core and a pool model for KALIMER reactor vessel. This paper describes the models for control rod driveline expansion, gas expansion module and the thermal hydraulic model for reactor pool and the results of preliminary analyses for unprotected loss of flow and loss o heat sink. (author)

cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

Energy Technology Data Exchange (ETDEWEB)

Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

1983-01-01

Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

Science.gov (United States)

Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

2017-09-01

There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

Science.gov (United States)

Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

2010-11-01

Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

Simulation of the coupling between nucleotide binding and transmembrane domains in the ABC transporter BtuCD

DEFF Research Database (Denmark)

Sonne, Jacob; Kandt, C.; Peters, Günther H.j.

2007-01-01

The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B12 importer BtuCD using perturbed elastic network calculations and biased molecular...

Identification of cyclic nucleotide gated channels using regular expressions

KAUST Repository

Zelman, Alice K.

2013-09-03

Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

Science.gov (United States)

Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

2016-06-01

As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

Science.gov (United States)

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

Preliminary ATWS analysis for the IRIS PRA

International Nuclear Information System (INIS)

Maddalena Barra; Marco S Ghisu; David J Finnicum; Luca Oriani

2005-01-01

Full text of publication follows: The pressurized light water cooled, medium power (1000 MWt) IRIS (International Reactor Innovative and Secure) has been under development for four years by an international consortium of over 21 organizations from ten countries. The plant conceptual design was completed in 2001 and the preliminary design is nearing completion. The pre-application licensing process with NRC started in October, 2002. IRIS has been primarily focused on establishing a design with innovative safety characteristics. The first line of defense in IRIS is to eliminate event initiators that could potentially lead to core damage. In IRIS, this concept is implemented through the 'safety by design' approach, which allows to minimize the number and complexity of the safety systems and required operator actions. The end result is a design with significantly reduced complexity and improved operability, and extensive plant simplifications to enhance construction. To support the optimization of the plant design and confirm the effectiveness of the safety by design approach in mitigating or eliminating events and thus providing a significant reduction in the probability of severe accidents, the PRA is being used as an integral part of the design process. A preliminary but extensive Level 1 PRA model has been developed to support the pre-application licensing of the IRIS design. As a result of the Preliminary IRIS PRA, an optimization of the design from a reliability point of view was completed, and an extremely low (about 1.2 E -8 ) core damage frequency (CDF) was assessed to confirm the impact of the safety by design approach. This first assessment is a result of a PRA model including internal initiating events. During this assessment, several assumptions were necessary to complete the CDF evaluation. In particular Anticipated Transients Without Scram (ATWS) were not included in this initial assessment, because their contribution to core damage frequency was assumed

Preliminary result and upgrade from WISPDMX Phase II

Energy Technology Data Exchange (ETDEWEB)

Nguyen, Le Hoang; Horns, Dieter [Institut fur Experimentalphysik, Universitat Hamburg (Germany); Lobanov, Andrei [Institut fur Experimentalphysik, Universitat Hamburg (Germany); Max-Planck-Institut fur Radioastronomie, Bonn (Germany)

2016-07-01

The microwave cavity experiment WISPDMX is the first direct WISP (Weakly interactive slim particles) dark matter search experiment probing the particle masses in the 0.8-2.0 eV range. The first stage of WISPDMX measurements has been completed at nominal resonant frequencies of the cavity. The upgrading of the data acquisition and analysing has been done to increase the sensitivity of the experiment. We report preliminary result from the cavity tuning at second stage of WISPDMX.

Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

African Journals Online (AJOL)

The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

Preliminary uncertainty analysis of pre-waste-emplacement groundwater travel times for a proposed repository in basalt

International Nuclear Information System (INIS)

Clifton, P.M.; Arnett, R.C.

1984-01-01

Preliminary uncertainty analyses of pre-waste-emplacement groundwater travel times are presented for a potential high-level nuclear waste repository in the deep basalts beneath the Hanford Site, Washington State. The uncertainty analyses are carried out by means of a Monte Carlo technique, which requires the uncertain inputs to be described as either random variables or spatial stochastic processes. Pre-waste-emplacement groundwater travel times are modeled in a continuous, flat-lying basalt flow top that is assumed to overlie the repository horizon. Two-dimensional, steady state groundwater flow is assumed, and transmissivity, effective thickness, and regional hydraulic gradient are considered as uncertain inputs. Groundwater travel time distributions corresponding to three groundwater models are presented and compared. Limitations of these preliminary simulation results are discussed in detail

Preliminary verification of structure design for CN HCCB TBM with 1 × 4 configuration

Energy Technology Data Exchange (ETDEWEB)

Zhao, Zhou, E-mail: zhaozhou@swip.ac.cn; Zhou, Bing; Wang, Qijie; Cao, Qixiang; Feng, Kaiming; Wang, Xiaoyu; Zhang, Guoshu

2016-02-15

Highlights: • A new and simplification structural design scheme with 1 × 4 configuration is proposed for CN HCCB TBM. • The detail conceptual structural design for 1 × 4 TBM is completed. • The preliminary hydraulic analysis, thermo-hydraulic analysis and structural analysis for 1 × 4 TBM had been carried out. - Abstract: Based on the conceptual design of CN HCCB TBM with 1 × 4 configuration, the preliminary hydraulic analysis, thermo-hydraulic analysis and structural analysis had been carried out for it. Hydraulic and thermo-hydraulic analyses show that the coolant manifold system could meet the fluid design requirement preliminarily and the temperature of RAFMs structural parts, Be and Li{sub 4}SiO{sub 4} pebble beds are within the allowable range, and no zone shows a stress higher than the allowable limit in the preliminary structural analysis. These results indicate the design for CN HCCB TBM with 1 × 4 configuration is preliminary reasonable.

Preliminary verification of structure design for CN HCCB TBM with 1 × 4 configuration

International Nuclear Information System (INIS)

Zhao, Zhou; Zhou, Bing; Wang, Qijie; Cao, Qixiang; Feng, Kaiming; Wang, Xiaoyu; Zhang, Guoshu

2016-01-01

Highlights: • A new and simplification structural design scheme with 1 × 4 configuration is proposed for CN HCCB TBM. • The detail conceptual structural design for 1 × 4 TBM is completed. • The preliminary hydraulic analysis, thermo-hydraulic analysis and structural analysis for 1 × 4 TBM had been carried out. - Abstract: Based on the conceptual design of CN HCCB TBM with 1 × 4 configuration, the preliminary hydraulic analysis, thermo-hydraulic analysis and structural analysis had been carried out for it. Hydraulic and thermo-hydraulic analyses show that the coolant manifold system could meet the fluid design requirement preliminarily and the temperature of RAFMs structural parts, Be and Li_4SiO_4 pebble beds are within the allowable range, and no zone shows a stress higher than the allowable limit in the preliminary structural analysis. These results indicate the design for CN HCCB TBM with 1 × 4 configuration is preliminary reasonable.

Building-related symptoms among U.S. office workers and risks factors for moisture and contamination: Preliminary analyses of U.S. EPA BASE Data

Energy Technology Data Exchange (ETDEWEB)

Mendell, Mark J.; Cozen, Myrna

2002-09-01

dirty cooling coils were associated with a nonsignificant increase in lower respiratory symptoms. These preliminary findings suggest that some factors that indicate risks for moisture or contamination in office buildings may have adverse effects on respiratory or neurologic health of office workers. More refined analyses are underway that will include these risk factors in simultaneous multivariate models along with additional risk factors that may be confounders, such as ventilation rate and indoor temperature. Future analyses will also use more refined metrics for both health outcomes and environmental risks, as well as assess risk in susceptible sub-groups.

Preservation of photographic and cinematographic films by gamma radiation: Preliminary analyses

Energy Technology Data Exchange (ETDEWEB)

Nagai, Maria Luiza E.; Santos, Paulo S.; Otubo, Larissa; Oliveira, Maria José A.; Vasquez, Pablo A.S., E-mail: malunagai@usp.br, E-mail: pavsalva@ipen.br [Instituto de Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil)

2017-07-01

Brazilian weather conditions affect directly tangible materials causing deterioration notably getting worse by insects and fungi attack. In this sense, gamma radiation provided from the cobalt-60 is an excellent alternative tool to the traditional preservation process mainly because it has biocidal action. Radiation processing using gamma radiation for cultural heritage materials for disinfection has been widely used around the world in the last decades. Many cultural heritage objects especially made on paper and wood were studied in scientific publications aiming mechanical, physical and chemical properties changes. Over the last fifteen years, the Multipurpose Gamma Irradiation Facility of the Nuclear and Energy Research Institute located inside the Sao Paulo University campus has been irradiated many collections of archived materials, books, paintings and furniture. Adequate storage of photographic and cinematographic materials is a challenge for conservators from preservation institutions. Contamination by fungi is one of leading causes of problem in photographic and cinematographic collections. Several Sao Paulo University libraries have been affected by fungi in their photographic and cinematographic collections making it impossible to research on these materials either manipulate them for health and safety reasons. In this work are presented preliminary results of effects of the ionizing radiation in photographic and cinematographic films. Selected film samples made on cellulose acetate were prepared and characterized by FTIR-ATR spectroscopy. Samples were irradiated by gamma rays with absorbed dose between 2 kGy and 50 kGy. Irradiated samples were analyzed by UV-VIS spectroscopy and electron microscopy techniques. Results shown that disinfection by gamma radiation can be achieved safely applying the disinfection dose between 6 kGy to 15 kGy with no significant change or modification of main properties of the constitutive materials. (author)

Preservation of photographic and cinematographic films by gamma radiation: Preliminary analyses

International Nuclear Information System (INIS)

Nagai, Maria Luiza E.; Santos, Paulo S.; Otubo, Larissa; Oliveira, Maria José A.; Vasquez, Pablo A.S.

2017-01-01

Brazilian weather conditions affect directly tangible materials causing deterioration notably getting worse by insects and fungi attack. In this sense, gamma radiation provided from the cobalt-60 is an excellent alternative tool to the traditional preservation process mainly because it has biocidal action. Radiation processing using gamma radiation for cultural heritage materials for disinfection has been widely used around the world in the last decades. Many cultural heritage objects especially made on paper and wood were studied in scientific publications aiming mechanical, physical and chemical properties changes. Over the last fifteen years, the Multipurpose Gamma Irradiation Facility of the Nuclear and Energy Research Institute located inside the Sao Paulo University campus has been irradiated many collections of archived materials, books, paintings and furniture. Adequate storage of photographic and cinematographic materials is a challenge for conservators from preservation institutions. Contamination by fungi is one of leading causes of problem in photographic and cinematographic collections. Several Sao Paulo University libraries have been affected by fungi in their photographic and cinematographic collections making it impossible to research on these materials either manipulate them for health and safety reasons. In this work are presented preliminary results of effects of the ionizing radiation in photographic and cinematographic films. Selected film samples made on cellulose acetate were prepared and characterized by FTIR-ATR spectroscopy. Samples were irradiated by gamma rays with absorbed dose between 2 kGy and 50 kGy. Irradiated samples were analyzed by UV-VIS spectroscopy and electron microscopy techniques. Results shown that disinfection by gamma radiation can be achieved safely applying the disinfection dose between 6 kGy to 15 kGy with no significant change or modification of main properties of the constitutive materials. (author)

Subpicosecond Dynamics in Nucleotides Measured by Spontaneous Raman Spectroscopy

NARCIS (Netherlands)

Terpstra, P.A.; Terpstra, P.A.; Otto, Cornelis; Greve, Jan

1997-01-01

The band widths in Raman spectra are sensitive to dynamics active on a time scale from 0.1 to 10 ps. The band widths of nucleotide vibrations and their dependence on temperature, concentration, and structure are reported. From the experimental band widths and second moments, it is derived that the

Hydrogen Gas Retention and Release from WTP Vessels: Summary of Preliminary Studies

Energy Technology Data Exchange (ETDEWEB)

Gauglitz, Phillip A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Bontha, Jagannadha R. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Daniel, Richard C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Mahoney, Lenna A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Rassat, Scot D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Wells, Beric E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Bao, Jie [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Boeringa, Gregory K. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Buchmiller, William C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Burns, Carolyn A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Chun, Jaehun [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Karri, Naveen K. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Li, Huidong [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Tran, Diana N. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

2015-07-01

The Hanford Waste Treatment and Immobilization Plant (WTP) is currently being designed and constructed to pretreat and vitrify a large portion of the waste in the 177 underground waste storage tanks at the Hanford Site. A number of technical issues related to the design of the pretreatment facility (PTF) of the WTP have been identified. These issues must be resolved prior to the U.S. Department of Energy (DOE) Office of River Protection (ORP) reaching a decision to proceed with engineering, procurement, and construction activities for the PTF. One of the issues is Technical Issue T1 - Hydrogen Gas Release from Vessels (hereafter referred to as T1). The focus of T1 is identifying controls for hydrogen release and completing any testing required to close the technical issue. In advance of selecting specific controls for hydrogen gas safety, a number of preliminary technical studies were initiated to support anticipated future testing and to improve the understanding of hydrogen gas generation, retention, and release within PTF vessels. These activities supported the development of a plan defining an overall strategy and approach for addressing T1 and achieving technical endpoints identified for T1. Preliminary studies also supported the development of a test plan for conducting testing and analysis to support closing T1. Both of these plans were developed in advance of selecting specific controls, and in the course of working on T1 it was decided that the testing and analysis identified in the test plan were not immediately needed. However, planning activities and preliminary studies led to significant technical progress in a number of areas. This report summarizes the progress to date from the preliminary technical studies. The technical results in this report should not be used for WTP design or safety and hazards analyses and technical results are marked with the following statement: “Preliminary Technical Results for Planning – Not to be used for WTP Design

Prediction of Seismic Slope Displacements by Dynamic Stick-Slip Analyses

International Nuclear Information System (INIS)

Ausilio, Ernesto; Costanzo, Antonio; Silvestri, Francesco; Tropeano, Giuseppe

2008-01-01

A good-working balance between simplicity and reliability in assessing seismic slope stability is represented by displacement-based methods, in which the effects of deformability and ductility can be either decoupled or coupled in the dynamic analyses. In this paper, a 1D lumped mass ''stick-slip'' model is developed, accounting for soil heterogeneity and non-linear behaviour, with a base sliding mechanism at a potential rupture surface. The results of the preliminary calibration show a good agreement with frequency-domain site response analysis in no-slip conditions. The comparison with rigid sliding block analyses and with the decoupled approach proves that the stick-slip procedure can result increasingly unconservative for soft soils and deep sliding depths

Plasmodium falciparum Hsp70-z, an Hsp110 homologue, exhibits independent chaperone activity and interacts with Hsp70-1 in a nucleotide-dependent fashion.

Science.gov (United States)

Zininga, Tawanda; Achilonu, Ikechukwu; Hoppe, Heinrich; Prinsloo, Earl; Dirr, Heini W; Shonhai, Addmore

2016-05-01

The role of molecular chaperones, among them heat shock proteins (Hsps), in the development of malaria parasites has been well documented. Hsp70s are molecular chaperones that facilitate protein folding. Hsp70 proteins are composed of an N-terminal nucleotide binding domain (NBD), which confers them with ATPase activity and a C-terminal substrate binding domain (SBD). In the ADP-bound state, Hsp70 possesses high affinity for substrate and releases the folded substrate when it is bound to ATP. The two domains are connected by a conserved linker segment. Hsp110 proteins possess an extended lid segment, a feature that distinguishes them from canonical Hsp70s. Plasmodium falciparum Hsp70-z (PfHsp70-z) is a member of the Hsp110 family of Hsp70-like proteins. PfHsp70-z is essential for survival of malaria parasites and is thought to play an important role as a molecular chaperone and nucleotide exchange factor of its cytosolic canonical Hsp70 counterpart, PfHsp70-1. Unlike PfHsp70-1 whose functions are fairly well established, the structure-function features of PfHsp70-z remain to be fully elucidated. In the current study, we established that PfHsp70-z possesses independent chaperone activity. In fact, PfHsp70-z appears to be marginally more effective in suppressing protein aggregation than its cytosol-localized partner, PfHsp70-1. Furthermore, based on coimmunoaffinity chromatography and surface plasmon resonance analyses, PfHsp70-z associated with PfHsp70-1 in a nucleotide-dependent fashion. Our findings suggest that besides serving as a molecular chaperone, PfHsp70-z could facilitate the nucleotide exchange function of PfHsp70-1. These dual functions explain why it is essential for parasite survival.

Adenylate Nucleotides and 2,3-Biphosphoglycerate Concentration in Erythrocytes of Growing Wielkopolska Stallions

OpenAIRE

M. Suska; E. Skotnicka; W. Dudzińska; W. Orowicz; M. Brzezinska

2006-01-01

The aim of this study was to examine the relationships between the concentrations of adenylate nucleotides (ATP, ADP, AMP), total nucleotide pool (TAN), adenylate energy charge (AEC) and 2,3-biphosphoglycerate (2,3-BPG) in the erythrocytes of young horses in the period of their rapid growth and development. The studies were conducted on 10 young Wielkopolska breed stallions for two years; Group A: 1-month-old, Group B: 3-month-old, Group C: 6-month-old, Group D: 1-year-old, and Group E: 2-yea...

The nucleotide sequence of a Polish isolate of Tomato torrado virus.

Science.gov (United States)

Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

2008-12-01

A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

Science.gov (United States)

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

De novo synthesis of purine nucleotides in different fiber types of rat skeletal muscle

International Nuclear Information System (INIS)

Tullson, P.C.; John-Alder, H.; Hood, D.A.; Terjung, R.L.

1986-01-01

The contribution of de novo purine nucleotide synthesis to nucleotide metabolism in skeletal muscles is not known. The authors have determined rates of de novo synthesis in soleus (slow-twitch red), red gastrocnemius (fast-twitch red), and white gastrocnemius (fast-twitch white) using the perfused rat hindquarter. 14 C glycine incorporation into ATP was linear after 1 and 2 hours of perfusion with 0.2 mM added glycine. The intracellular (I) and extracellular (E) specific activity of 14 C glycine was determined by HPLC of phenylisothiocyanate derivatives of neutralized PCA extracts. The rates of de novo synthesis when expressed relative to muscle ATP content show slow and fast-twitch red muscles to be similar and about twice as great as fast-twitch white muscles. This could represent a greater turnover of the adenine nucleotide pool in more oxidative red muscle types

Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.

Science.gov (United States)

Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana

2016-05-01

Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

International Nuclear Information System (INIS)

Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

2006-01-01

Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

International Nuclear Information System (INIS)

Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.

1988-01-01

The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity [ 3 H]fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity [ 3 H]fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils

Four new single nucleotide polymorphisms (SNPs) of toll-like ...

African Journals Online (AJOL)

In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

Preliminary analyses of Li jet flows for the IFMIF target

International Nuclear Information System (INIS)

Ida, Mizuho; Kato, Yoshio; Nakamura, Hideo; Maekawa, Hiroshi

1997-03-01

The characteristics of liquid lithium (Li) plane jet flowing along a concave wall were studied using a multi-dimensional numerical code, FLOW-3D, as part of the two-year conceptual design activity (CDA) of the International Fusion Materials Irradiation Facility (IFMIF) that started in February 1995. The IFMIF will provide high flux, high energy (∼14MeV) neutron irradiation field by deuteron-Li reaction in the Li jet target for testing and development of low-activation and damage-resistant fusion materials. The Li jet target flow at high-velocity (≤ 20m/s) in vacuum, and should adequately remove the intense deuteron beam power (≤ 10MW). The two-dimensional analyses on the thermal and hydraulic responses of the target flow, under the conditions proposed in the IFMIF-CDA, indicated enough temperature margins to avoid significant vaporization and voiding respectively at the jet free surface and the peak temperature location in the jet by keeping the flow stability. (author)

OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

Science.gov (United States)

Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

2016-02-01

Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

Novel nucleotide and amino acid covariation between the 5'UTR and the NS2/NS3 proteins of hepatitis C virus: bioinformatic and functional analyses.

Directory of Open Access Journals (Sweden)

Hung-Yu Sun

Full Text Available Molecular covariation of highly polymorphic viruses is thought to have crucial effects on viral replication and fitness. This study employs association rule data mining of hepatitis C virus (HCV sequences to search for specific evolutionary covariation and then tests functional relevance on HCV replication. Data mining is performed between nucleotides in the untranslated regions 5' and 3'UTR, and the amino acid residues in the non-structural proteins NS2, NS3 and NS5B. Results indicate covariance of the 243(rd nucleotide of the 5'UTR with the 14(th, 41(st, 76(th, 110(th, 211(th and 212(th residues of NS2 and with the 71(st, 175(th and 621(st residues of NS3. Real-time experiments using an HCV subgenomic system to quantify viral replication confirm replication regulation for each covariant pair between 5'UTR₂₄₃ and NS2-41, -76, -110, -211, and NS3-71, -175. The HCV subgenomic system with/without the NS2 region shows that regulatory effects vanish without NS2, so replicative modulation mediated by HCV 5'UTR₂₄₃ depends on NS2. Strong binding of the NS2 variants to HCV RNA correlates with reduced HCV replication whereas weak binding correlates with restoration of HCV replication efficiency, as determined by RNA-protein immunoprecipitation assay band intensity. The dominant haplotype 5'UTR₂₄₃-NS2-41-76-110-211-NS3-71-175 differs according to the HCV genotype: G-Ile-Ile-Ile-Gly-Ile-Met for genotype 1b and A-Leu-Val-Leu-Ser-Val-Leu for genotypes 1a, 2a and 2b. In conclusion, 5'UTR₂₄₃ co-varies with specific NS2/3 protein amino acid residues, which may have significant structural and functional consequences for HCV replication. This unreported mechanism involving HCV replication possibly can be exploited in the development of advanced anti-HCV medication.

Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

Science.gov (United States)

Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

2017-04-18

Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

NARCIS (Netherlands)

Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

Involvement of cyclic nucleotides in locust flight muscle metabolism

NARCIS (Netherlands)

Worm, R.A.A.

1980-01-01

1. Flight had no significant effect on the levels of c-AMP of c-GMP in the flight muscles of Locusta migratoria. 2. Injections of 0.01 or 0.1 corpus cardiacum equivalents into the abdominal cavity did not elicit any effect on cyclic nucleotide levels either. 3. Injection of A23187 resulted in

Effects of Dietary Nucleotides on Growth Rate and Disease ...

African Journals Online (AJOL)

Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

Remarkable nanoconfinement effects on chemical equilibrium manifested in nucleotide dimerization and H-D exchange reactions.

Science.gov (United States)

Polak, Micha; Rubinovich, Leonid

2011-10-06

Nanoconfinement entropic effects on chemical equilibrium involving a small number of molecules, which we term NCECE, are revealed by two widely diverse types of reactions. Employing statistical-mechanical principles, we show how the NCECE effect stabilizes nucleotide dimerization observed within self-assembled molecular cages. Furthermore, the effect provides the basis for dimerization even under an aqueous environment inside the nanocage. Likewise, the NCECE effect is pertinent to a longstanding issue in astrochemistry, namely the extra deuteration commonly observed for molecules reacting on interstellar dust grain surfaces. The origin of the NCECE effect is elucidated by means of the probability distributions of the reaction extent and related variations in the reactant-product mixing entropy. Theoretical modelling beyond our previous preliminary work highlights the role of the nanospace size in addition to that of the nanosystem size, namely the limited amount of molecules in the reaction mixture. Furthermore, the NCECE effect can depend also on the reaction mechanism, and on deviations from stoichiometry. The NCECE effect, leading to enhanced, greatly variable equilibrium "constants", constitutes a unique physical-chemical phenomenon, distinguished from the usual thermodynamical properties of macroscopically large systems. Being significant particularly for weakly exothermic reactions, the effects should stabilize products in other closed nanoscale structures, and thus can have notable implications for the growing nanotechnological utilization of chemical syntheses conducted within confined nanoreactors.

Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

Directory of Open Access Journals (Sweden)

Suravajhala P

2017-06-01

Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

Preliminary Performance Assessment for Disposal of APT and CLWR/TEF Wastes at SRS

International Nuclear Information System (INIS)

Wilhite, E.L.

1998-01-01

This section provides the descriptive information for understanding the analyses presented in this preliminary performance assessment. This section addresses the approach taken in the PA, provides a general description of the Savannah River Site E-Area low-level waste facility, and discusses the performance criteria used for evaluating performance

Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

Directory of Open Access Journals (Sweden)

Joon-Ho Lee

2014-09-01

Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

Complete nucleotide sequences of avian metapneumovirus subtype B genome.

Science.gov (United States)

Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

2010-12-01

Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

Junctional transfer in cultured vascular endothelium: II. Dye and nucleotide transfer

International Nuclear Information System (INIS)

Larson, D.M.; Sheridan, J.D.

1985-01-01

Vascular endothelial cultures, derived from large vessels, retain many of the characteristics of their in vivo counterparts. However, the observed reduction in size and complexity of intercellular gap and tight junctions in these cultured cells suggests that important functions, thought to be mediated by these structures, may be altered in vitro. In continuing studies on intercellular communication in vessel wall cells, the authors have quantitated the extent of junctional transfer of small molecular tracers (the fluorescent dye Lucifer Yellow CH and tritiated uridine nucleotides) in confluent cultures of calf aortic (BAEC) and umbilical vein (BVEC) endothelium. Both BAEC and BVEC show extensive (and quantitatively equivalent) dye and nucleotide transfer. As an analogue of intimal endothelium, the authors have also tested dye transfer in freshly isolated sheets of endothelium. Transfer in BAEC and BVEC sheets was more rapid, extensive and homogeneous than in the cultured cells, implying a reduction in molecular coupling as endothelium adapts to culture conditions. In addition, they have documented heterocellular nucleotide transfer between cultured endothelium and vascular smooth muscle cells, of particular interest considering the prevalence of ''myo-endothelial'' junctions in vivo. These data yield further information on junctional transfer in cultured vascular endothelium and have broad implications for the functional integration of the vessel wall in the physiology and pathophysiology of the vasculature

Multilocus Patterns of Nucleotide Diversity, Population Structure and Linkage Disequilibrium in Boechera stricta, a Wild Relative of Arabidopsis

Science.gov (United States)

Song, Bao-Hua; Windsor, Aaron J.; Schmid, Karl J.; Ramos-Onsins, Sebastian; Schranz, M. Eric; Heidel, Andrew J.; Mitchell-Olds, Thomas

2009-01-01

Information about polymorphism, population structure, and linkage disequilibrium (LD) is crucial for association studies of complex trait variation. However, most genomewide studies have focused on model systems, with very few analyses of undisturbed natural populations. Here, we sequenced 86 mapped nuclear loci for a sample of 46 genotypes of Boechera stricta and two individuals of B. holboellii, both wild relatives of Arabidopsis. Isolation by distance was significant across the species range of B. stricta, and three geographic groups were identified by structure analysis, principal coordinates analysis, and distance-based phylogeny analyses. The allele frequency spectrum indicated a genomewide deviation from an equilibrium neutral model, with silent nucleotide diversity averaging 0.004. LD decayed rapidly, declining to background levels in ∼10 kb or less. For tightly linked SNPs separated by <1 kb, LD was dependent on the reference population. LD was lower in the specieswide sample than within populations, suggesting that low levels of LD found in inbreeding species such as B. stricta, Arabidopsis thaliana, and barley may result from broad geographic sampling that spans heterogeneous genetic groups. Finally, analyses also showed that inbreeding B. stricta and A. thaliana have ∼45% higher recombination per kilobase than outcrossing A. lyrata. PMID:19104077

Porous silicon surfaces for metabonomics: Detection and identification of nucleotides without matrix interference

Energy Technology Data Exchange (ETDEWEB)

Gomez, D.; Azcarate, Sabino [Dpto. de Micro y Nanotecnologias, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain); Fernandez, Jose A.; Astigarraga, Egoitz [Dpto. de Quimica Fisica, Universidad del Pais Vasco, Campus de Lejona, Lejona (Spain); Marcaide, Arrate [Dpto. de Procesos de Fabricacion, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain)

2007-07-01

In present work, porous silicon surfaces (PSS) have been developed for time of flight mass spectrometric experiments (TOF-MS) in the monitoring of nucleotides, commonly found as metabolites in the cell. The mass range of the studied molecules ({proportional_to} 400 amu) is common to several important messengers and other metabolites. Different porosified surfaces have been developed by means of electrochemical etching and different degree of porosity and pore size achieved as function of silicon dopant concentration, silicon resistivity, current density and the presence or absence of illumination along the process. As main conclusion, it can be said that an interesting commercial nucleotide (Cyclic adenosine monophosphate, c-AMP) has been detected on low concentrations ({proportional_to}hundreds of femtomols) for some of the fabricated porous surfaces. Taking into account that these concentrations are similar to the ones found in real samples, this result opens the possibility to the fabrication of DIOS (Desorption Ionization On Silicon) chips for the detection of nucleotides in biological fluids. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Larva-mediated chalkbrood resistance-associated single nucleotide polymorphism markers in the honey bee Apis mellifera.

Science.gov (United States)

Liu, Y; Yan, L; Li, Z; Huang, W-F; Pokhrel, S; Liu, X; Su, S

2016-06-01

Chalkbrood is a disease affecting honey bees that seriously impairs brood growth and productivity of diseased colonies. Although honey bees can develop chalkbrood resistance naturally, the details underlying the mechanisms of resistance are not fully understood, and no easy method is currently available for selecting and breeding resistant bees. Finding the genes involved in the development of resistance and identifying single nucleotide polymorphisms (SNPs) that can be used as molecular markers of resistance is therefore a high priority. We conducted genome resequencing to compare resistant (Res) and susceptible (Sus) larvae that were selected following in vitro chalkbrood inoculation. Twelve genomic libraries, including 14.4 Gb of sequence data, were analysed using SNP-finding algorithms. Unique SNPs derived from chromosomes 2 and 11 were analysed in this study. SNPs from resistant individuals were confirmed by PCR and Sanger sequencing using in vitro reared larvae and resistant colonies. We found strong support for an association between the C allele at SNP C2587245T and chalkbrood resistance. SNP C2587245T may be useful as a genetic marker for the selection of chalkbrood resistance and high royal jelly production honey bee lines, thereby helping to minimize the negative effects of chalkbrood on managed honey bees. © 2016 The Royal Entomological Society.

2′-O-methyl nucleotide modified DNA substrates influence the ...

Indian Academy of Sciences (India)

2014-07-18

Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.

SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

DEFF Research Database (Denmark)

Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin

2015-01-01

XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

Single nucleotide polymorphisms in the 5'-flanking region of the ...

African Journals Online (AJOL)

Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

Kinetic mechanism and nucleotide specificity of NADH peroxidase

International Nuclear Information System (INIS)

Stoll, V.S.; Blanchard, J.S.

1988-01-01

NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols

Modification of synthesis nucleotides [γ-32P] ATP

International Nuclear Information System (INIS)

Wira Y Rahman; Endang Sarmini; Herlina; Triyanto; Hambali; Abdul Mutalib; Santi Nurbaiti

2013-01-01

In molecular biology, radionuclides in the form of radiolabeled compounds have been widely used as deoxyribonucleic acid (DNA) / ribonucleic acid (RNA) tracer in order to explore a wide range of physiological and pathological processes. One of such compounds is [γ- 32 P]-adenosine triphosphate {[γ- 32 P]-ATP} [γ- 32 P]-ATP which has been widely used in the biotechnology research. In order to support the biotechnology research in Indonesia in this project, [γ- 32 P]- ATP had been synthesized by enzymatic reactions with modifying the method of synthesis using the precursor DL-glyceraldehyde 3-phosphate, nucleotides Adenosine Diphosphate (ADP) and H 3 32 PO 4 and enzymes glyceraldehyde 3-phosphate dehydrogenase, 3-phosphoroglyceric phosphokinase and lactate dehydrogenase. The purification of the synthesized [γ- 32 P]-ATP, by using DEAE Sephadex column chromatography. The synthesis and purification process that had been performed were able in producing of [γ- 32 P]-ATP with radioactivity of 1,175 mCi and radiochemical purity of 99,49%.. Having successfully prepared the [γ- 32 P]-ATP and application, in the near future the Radioisotopes and Radiopharmaceuticals Centre is expected to be able in providing the above-mentioned radiolabeled nucleotide for biotechnology research in Indonesia. (author)

Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

International Nuclear Information System (INIS)

Edenbrandt, C.M.; Murphy, S.

1990-01-01

Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation

Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

Energy Technology Data Exchange (ETDEWEB)

Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.

2016-12-21

Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.

Preliminary analyses for HTTR's start-up physics tests by Monte Carlo code MVP

International Nuclear Information System (INIS)

Nojiri, Naoki; Nakano, Masaaki; Ando, Hiroei; Fujimoto, Nozomu; Takeuchi, Mitsuo; Fujisaki, Shingo; Yamashita, Kiyonobu

1998-08-01

Analyses of start-up physics tests for High Temperature Engineering Test Reactor (HTTR) have been carried out by Monte Carlo code MVP based on continuous energy method. Heterogeneous core structures were modified precisely, such as the fuel compacts, fuel rods, coolant channels, burnable poisons, control rods, control rod insertion holes, reserved shutdown pellet insertion holes, gaps between graphite blocks, etc. Such precise modification of the core structures was difficult with diffusion calculation. From the analytical results, the followings were confirmed; The first criticality will be achieved around 16 fuel columns loaded. The reactivity at the first criticality can be controlled by only one control rod located at the center of the core with other fifteen control rods fully withdrawn. The excess reactivity, reactor shutdown margin and control rod criticality positions have been evaluated. These results were used for planning of the start-up physics tests. This report presents analyses of start-up physics tests for HTTR by MVP code. (author)

Random mutagenesis of the nucleotide-binding domain of NRC1 (NB-LRR Required for Hypersensitive Response-Associated Cell Death-1), a downstream signalling nucleotide-binding, leucine-rich repeat (NB-LRR) protein, identifies gain-of-function mutations in the nucleotide-binding pocket

NARCIS (Netherlands)

Sueldo, D.J.; Shimels, M.Z.; Spiridon, L.N.; Caldararu, O.; Petrescu, A.J.; Joosten, M.H.A.J.; Tameling, W.I.L.

2015-01-01

•Plant nucleotide-binding, leucine-rich repeat (NB-LRR) proteins confer immunity to pathogens possessing the corresponding avirulence proteins. Activation of NB-LRR proteins is often associated with induction of the hypersensitive response (HR), a form of programmed cell death. •NRC1 (NB-LRR

Nucleobases, nucleosides, and nucleotides: versatile biomolecules for generating functional nanomaterials.

Science.gov (United States)

Pu, Fang; Ren, Jinsong; Qu, Xiaogang

2018-02-21

The incorporation of biomolecules into nanomaterials generates functional nanosystems with novel and advanced properties, presenting great potential for applications in various fields. Nucleobases, nucleosides and nucleotides, as building blocks of nucleic acids and biological coenzymes, constitute necessary components of the foundation of life. In recent years, as versatile biomolecules for the construction or regulation of functional nanomaterials, they have stimulated interest in researchers, due to their unique properties such as structural diversity, multiplex binding sites, self-assembly ability, stability, biocompatibility, and chirality. In this review, strategies for the synthesis of nanomaterials and the regulation of their morphologies and functions using nucleobases, nucleosides, and nucleotides as building blocks, templates or modulators are summarized alongside selected applications. The diverse applications range from sensing, bioimaging, and drug delivery to mimicking light-harvesting antenna, the construction of logic gates, and beyond. Furthermore, some perspectives and challenges in this emerging field are proposed. This review is directed toward the broader scientific community interested in biomolecule-based functional nanomaterials.

Sensitivity analyses of fast reactor systems including thorium and uranium

International Nuclear Information System (INIS)

Marable, J.H.; Weisbin, C.R.

1978-01-01

The Cross Section Evaluation Working Group (CSEWG) has, in conjunction with the development of the fifth version of ENDF/B, assembled new evaluations for 232 Th and 233 U. It is the purpose of this paper to describe briefly some of the more important features of these evaluations relative to ENDF/B-4 to project the change in reactor performance based upon the newer evaluated files and sensitivity coefficients for interesting design problems, and to indicate preliminary results from ongoing uncertainty analyses

Lack of effect of dietary nucleotide supplementation on erythrocyte 2,3-diphosphoglycerate concentration. A study on preterm neonates.

Science.gov (United States)

Scopesi, Fabio; Canini, Silvana; Arioni, Cesare; Mazzella, Massimo; Gazzolo, Diego; Lantieri, Pasquale B; Bonacci, Wanda; Serra, Giovanni

2006-06-01

Recently we demonstrated an increased 2,3-diphosphoglycerate (2,3-DPG) erythrocyte concentration in rat pups subjected to nucleotide-enriched artificial feeding. The present study was carried out to test the hypothesis that a possible increase in 2,3-DPG concentration can also be obtained in human neonates who are fed nucleotide-enriched formula. Preterm neonates born or referred to the neonatal intensive care unit of the G. Gaslini Hospital, Genoa University, with a gestational age >30 weeks and <37 weeks were enrolled in our randomized trial. Recruitment took place within 48-72 hours from birth. Only newborns of mothers deciding not to breast-feed were eligible to be randomized for the supplemented group (FN) or non-supplemented group (RF). Breast-fed newborns were considered the control group (C). The study window (for supplementation and blood samples) was restricted to the first two weeks following birth (from the 2nd (t1) to the 16th (t2) day of life). At the end of our study, only 21 neonates were eligible for statistical analysis. The stimulating action of dietary nucleotides on 2,3-DPG concentration failed to be demonstrated; increases in 2,3-DPG concentration that were observed in newborns fed with nucleotide supplemented formula (FN) were comparable to those observed in newborns fed with regular formula (RF) and breast-fed newborns. The EC recommendation for the amount of nucleotides allowed in formula milk does not seem to be high enough to have positive effects on 2,3-DPG synthesis. Whether this possible 'pharmacological' effect can be achieved by a higher intake of ingested nucleotides and/or a change in the proportions of single nucleotides contained in milk formulas remain interesting end points to be elucidated.

Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.

Science.gov (United States)

Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka

2014-01-01

Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.

Analysis of single nucleotide polymorphisms in case-control studies.

Science.gov (United States)

Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

2011-01-01

Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

Pulmonary preservation studies: effects on endothelial function and pulmonary adenine nucleotides.

Science.gov (United States)

Paik, Hyo Chae; Hoffmann, Steven C; Egan, Thomas M

2003-02-27

Lung transplantation is an effective therapy plagued by a high incidence of early graft dysfunction, in part because of reperfusion injury. The optimal preservation solution for lung transplantation is unknown. We performed experiments using an isolated perfused rat lung model to test the effect of lung preservation with three solutions commonly used in clinical practice. Lungs were retrieved from Sprague-Dawley rats and flushed with one of three solutions: modified Euro-Collins (MEC), University of Wisconsin (UW), or low potassium dextran and glucose (LPDG), then stored cold for varying periods before reperfusion with Earle's balanced salt solution using the isolated perfused rat lung model. Outcome measures were capillary filtration coefficient (Kfc), wet-to-dry weight ratio, and lung tissue levels of adenine nucleotides and cyclic AMP. All lungs functioned well after 4 hr of storage. By 6 hr, UW-flushed lungs had a lower Kfc than LPDG-flushed lungs. After 8 hr of storage, only UW-flushed lungs had a measurable Kfc. Adenine nucleotide levels were higher in UW-flushed lungs after prolonged storage. Cyclic AMP levels correlated with Kfc in all groups. Early changes in endothelial permeability seemed to be better attenuated in lungs flushed with UW compared with LPDG or MEC; this was associated with higher amounts of adenine nucleotides. MEC-flushed lungs failed earlier than LPDG-flushed or UW-flushed lungs. The content of the solution may be more important for lung preservation than whether the ionic composition is intracellular or extracellular.

Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

Science.gov (United States)

Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

2010-01-01

DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

Detection of new single nucleotide polymorphisms by means of real ...

Indian Academy of Sciences (India)

Unknown

amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

Non-nucleotide Agonists Triggering P2X7 Receptor Activation and Pore Formation

Directory of Open Access Journals (Sweden)

Francesco Di Virgilio

2018-02-01

Full Text Available The P2X7 receptor (P2X7R is a ligand-gated plasma membrane ion channel belonging to the P2X receptor subfamily activated by extracellular nucleotides. General consensus holds that the physiological (and maybe the only agonist is ATP. However, scattered evidence generated over the last several years suggests that ATP might not be the only agonist, especially at inflammatory sites. Solid data show that NAD+ covalently modifies the P2X7R of mouse T lymphocytes, thus lowering the ATP threshold for activation. Other structurally unrelated agents have been reported to activate the P2X7R via a poorly understood mechanism of action: (a the antibiotic polymyxin B, possibly a positive allosteric P2X7R modulator, (b the bactericidal peptide LL-37, (c the amyloidogenic β peptide, and (d serum amyloid A. Some agents, such as Alu-RNA, have been suggested to activate the P2X7R acting on the intracellular N- or C-terminal domains. Mode of P2X7R activation by these non-nucleotide ligands is as yet unknown; however, these observations raise the intriguing question of how these different non-nucleotide ligands may co-operate with ATP at inflammatory or tumor sites. New information obtained from the cloning and characterization of the P2X7R from exotic mammalian species (e.g., giant panda and data from recent patch-clamp studies are strongly accelerating our understanding of P2X7R mode of operation, and may provide hints to the mechanism of activation of P2X7R by non-nucleotide ligands.

Nucleotide homeostasis and purinergic nociceptive signaling in rat meninges in migraine-like conditions.

Science.gov (United States)

Yegutkin, Gennady G; Guerrero-Toro, Cindy; Kilinc, Erkan; Koroleva, Kseniya; Ishchenko, Yevheniia; Abushik, Polina; Giniatullina, Raisa; Fayuk, Dmitriy; Giniatullin, Rashid

2016-09-01

Extracellular ATP is suspected to contribute to migraine pain but regulatory mechanisms controlling pro-nociceptive purinergic mechanisms in the meninges remain unknown. We studied the peculiarities of metabolic and signaling pathways of ATP and its downstream metabolites in rat meninges and in cultured trigeminal cells exposed to the migraine mediator calcitonin gene-related peptide (CGRP). Under resting conditions, meningeal ATP and ADP remained at low nanomolar levels, whereas extracellular AMP and adenosine concentrations were one-two orders higher. CGRP increased ATP and ADP levels in meninges and trigeminal cultures and reduced adenosine concentration in trigeminal cells. Degradation rates for exogenous nucleotides remained similar in control and CGRP-treated meninges, indicating that CGRP triggers nucleotide release without affecting nucleotide-inactivating pathways. Lead nitrate-based enzyme histochemistry of whole mount meninges revealed the presence of high ATPase, ADPase, and AMPase activities, primarily localized in the medial meningeal artery. ATP and ADP induced large intracellular Ca(2+) transients both in neurons and in glial cells whereas AMP and adenosine were ineffective. In trigeminal glia, ATP partially operated via P2X7 receptors. ATP, but not other nucleotides, activated nociceptive spikes in meningeal trigeminal nerve fibers providing a rationale for high degradation rate of pro-nociceptive ATP. Pro-nociceptive effect of ATP in meningeal nerves was reproduced by α,β-meATP operating via P2X3 receptors. Collectively, extracellular ATP, which level is controlled by CGRP, can persistently activate trigeminal nerves in meninges which considered as the origin site of migraine headache. These data are consistent with the purinergic hypothesis of migraine pain and suggest new targets against trigeminal pain.

High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification

Directory of Open Access Journals (Sweden)

Sun Zhenyu

2001-08-01

Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the foundation of powerful complex trait and pharmacogenomic analyses. The availability of large SNP databases, however, has emphasized a need for inexpensive SNP genotyping methods of commensurate simplicity, robustness, and scalability. We describe a solution-based, microtiter plate method for SNP genotyping of human genomic DNA. The method is based upon allele discrimination by ligation of open circle probes followed by rolling circle amplification of the signal using fluorescent primers. Only the probe with a 3' base complementary to the SNP is circularized by ligation. Results SNP scoring by ligation was optimized to a 100,000 fold discrimination against probe mismatched to the SNP. The assay was used to genotype 10 SNPs from a set of 192 genomic DNA samples in a high-throughput format. Assay directly from genomic DNA eliminates the need to preamplify the target as done for many other genotyping methods. The sensitivity of the assay was demonstrated by genotyping from 1 ng of genomic DNA. We demonstrate that the assay can detect a single molecule of the circularized probe. Conclusions Compatibility with homogeneous formats and the ability to assay small amounts of genomic DNA meets the exacting requirements of automated, high-throughput SNP scoring.

Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

Directory of Open Access Journals (Sweden)

Stylianos Michalakis

2018-03-01

Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

KAUST Repository

Gehring, Christoph A; Turek, Ilona S.

2017-01-01

The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

KAUST Repository

Gehring, Christoph A.

2017-10-04

The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

The low-dose combination preparation Vertigoheel activates cyclic nucleotide pathways and stimulates vasorelaxation.

Science.gov (United States)

Heinle, H; Tober, C; Zhang, D; Jäggi, R; Kuebler, W M

2010-01-01

Vertigo of various and often unknown aetiologies has been associated with and attributed to impaired microvascular perfusion in the inner ear or the vertebrobasilar system. Vertigoheel is a low-dose combination preparation of proven value in the symptomatic treatment of vertigo. In the present study we tested the hypothesis that Vertigoheel's anti-vertiginous properties may in part be due to a vasodilatory effect exerted via stimulation of the adenylate and/or guanylate cyclase pathways. Thus, the influence of Vertigoheel or its single constituents on synthesis and degradation of cyclic nucleotides was measured. Furthermore, vessel myography was used to observe the effect of Vertigoheel on the vasoreactivity of rat carotid arteries. Vertigoheel and one of its constituents, Anamirta cocculus, stimulated adenylate cyclase activity, while another constituent, Conium maculatum, inhibited phosphodiesterase 5, suggesting that the individual constituents of Vertigoheel contribute differentially to a synergistic stimulation of cyclic nucleotide signalling pathways. In rat carotid artery rings, Vertigoheel counteracted phenylephrine-induced tonic vasoconstriction. The present data demonstrate a vasorelaxant effect of Vertigoheel that goes along with a synergistic stimulation of cyclic nucleotide pathways and may provide a mechanistic basis for the documented anti-vertiginous effects of this combination preparation.

Endogenous adenosine produced during hypoxia attenuates neutrophil accumulation: coordination by extracellular nucleotide metabolism.

Science.gov (United States)

Eltzschig, Holger K; Thompson, Linda F; Karhausen, Jorn; Cotta, Richard J; Ibla, Juan C; Robson, Simon C; Colgan, Sean P

2004-12-15

Hypoxia is a well-documented inflammatory stimulus and results in tissue polymorphonuclear leukocyte (PMN) accumulation. Likewise, increased tissue adenosine levels are commonly associated with hypoxia, and given the anti-inflammatory properties of adenosine, we hypothesized that adenosine production via adenine nucleotide metabolism at the vascular surface triggers an endogenous anti-inflammatory response during hypoxia. Initial in vitro studies indicated that endogenously generated adenosine, through activation of PMN adenosine A(2A) and A(2B) receptors, functions as an antiadhesive signal for PMN binding to microvascular endothelia. Intravascular nucleotides released by inflammatory cells undergo phosphohydrolysis via hypoxia-induced CD39 ectoapyrase (CD39 converts adenosine triphosphate/adenosine diphosphate [ATP/ADP] to adenosine monophosphate [AMP]) and CD73 ecto-5'-nucleotidase (CD73 converts AMP to adenosine). Extensions of our in vitro findings using cd39- and cd73-null animals revealed that extracellular adenosine produced through adenine nucleotide metabolism during hypoxia is a potent anti-inflammatory signal for PMNs in vivo. These findings identify CD39 and CD73 as critical control points for endogenous adenosine generation and implicate this pathway as an innate mechanism to attenuate excessive tissue PMN accumulation.

Approach to analysis of single nucleotide polymorphisms by automated constant denaturant capillary electrophoresis

International Nuclear Information System (INIS)

Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.

2003-01-01

Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification

Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

KAUST Repository

Zelman, Alice K.; Dawe, Adam; Gehring, Christoph A; Berkowitz, Gerald A.

2012-01-01

, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a

Novel tetra-nucleotide microsatellite DNA markers for assessing the evolutionary genetics and demographics of Northern Snakehead (Channa argus) invading North America

Science.gov (United States)

King, Timothy L.; Johnson, Robin L.

2011-01-01

We document the isolation and characterization of 19 tetra-nucleotide microsatellite DNA markers in northern snakehead (Channa argus) fish that recently colonized Meadow Lake, New York City, New York. These markers displayed moderate levels of allelic diversity (averaging 6.8 alleles/locus) and heterozygosity (averaging 74.2%). Demographic analyses suggested that the Meadow Lake collection has not achieved mutation-drift equilibrium. These results were consistent with instances of deviations from Hardy–Weinberg equilibrium and the presence of some linkage disequilibrium. A comparison of individual pair-wise distances suggested the presence of multiple differentiated groups of related individuals. Results of all analyses are consistent with a pattern of multiple, recent introductions. The microsatellite markers developed for C. argus yielded sufficient genetic diversity to potentially: (1) delineate kinship; (2) elucidate fine-scale population structure; (3) define management (eradication) units; (4) estimate dispersal rates; (5) estimate population sizes; and (6) provide unique demographic perspectives of control or eradication effectiveness.

Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

Science.gov (United States)

Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

2015-11-01

Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

Directory of Open Access Journals (Sweden)

Shui-Lian He

Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

Science.gov (United States)

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

GRIST-2 preliminary test plan and requirements for fuel fabrication and preirradiation

International Nuclear Information System (INIS)

Tang, I.M.; Harmon, D.P.; Torri, A.

1978-12-01

The preliminary version of the GRIST-2 test plan has been developed for the planned initial 5 years (1984 to 1989) of TREAT-Upgrade in-pile tests. These tests will be employed to study the phenomenology and integral behavior of GCFR core disruptive accidents (CDAs) and to support the Final Safety Analysis Report (FSAR) CDA analyses for the demonstration plant licensing. The preliminary test plan is outlined. Test Phases I and II are for the fresh fuel (preconditioned or not) CDA behavior at the beginning-of-life (BOL) reactor state. Phase III is for the reactor state that contains irradiated fuel with a saturated content of helium and fission gas. Phase IV is for larger bundle tests and scaling effects

DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma

DEFF Research Database (Denmark)

Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob

2010-01-01

To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...

Preliminary tank characterization report for single-shell tank 241-TX-101: best-basis inventory

International Nuclear Information System (INIS)

Kupfer, M.J.

1997-01-01

This document is a preliminary Tank Characterization Report (TCR). It only contains the current best-basis inventory (Appendix D) for single-shell tank 241-TX-101. No TCRs have been previously issued for this tank, and current core sample analyses are not available. The best-basis inventory, therefore, is based on an engineering assessment of waste type, process flowsheet data, early sample data, and/or other available information. The Standard Inventories of Chemicals and Radionuclides in Hanford Site Tank Wastes describes standard methodology used to derive the tank-by-tank best-basis inventories. This preliminary TCR will be updated using this same methodology when additional data on tank contents become available

Preliminary tank characterization report for single-shell tank 241-TY-102: best-basis inventory

International Nuclear Information System (INIS)

Place, D.E.

1997-01-01

This document is a preliminary Tank Characterization Report (TCR). It only contains the current best-basis inventory (Appendix D) for single-shell tank 241-TY-102. No TCRs have been previously issued for this tank, and current core sample analyses are not available. The best-basis inventory, therefore, is based on an engineering assessment of waste type, process flowsheet data, early sample data, and/or other available information. The Standard Inventories of Chemicals and Radionuclides in Hanford Site Tank Wastes describes standard methodology used to derive the tank-by-tank best-basis inventories. This preliminary TCR will be updated using this same methodology when additional data on tank contents become available

Preliminary tank characterization report for single-shell tank 241-TX-113: best-basis inventory

International Nuclear Information System (INIS)

Place, D.E.

1997-01-01

This document is a preliminary Tank Characterization Report (TCR). It only contains the current best-basis inventory (Appendix D) for single-shell tank 241-TX-113. No TCRs have been previously issued for this tank, and current core sample analyses are not available. The best-basis inventory, therefore, is based on an engineering assessment of waste type, process flowsheet data, early sample data, and/or other available information. The Standard Inventories of Chemicals and Radionuclides in Hanford Site Tank Wastes describes standard methodology used to derive the tank-by-tank best-basis inventories. This preliminary TCR will be updated using this same methodology when additional data on tank contents become available

Association between nucleotide mutation of eNOS gene and serum ...

African Journals Online (AJOL)

Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

Influence of GDP on interaction of transducin with cyclic nucleotide phosphodiesterase and rhodopsin from bovine retinal rods

International Nuclear Information System (INIS)

Rybin, V.O.

1986-01-01

In the presence of guanine nucleotides and rhodopsin-containing membranes from bovine retinal rod outer segments transducin stimulates light-sensitive cyclic nucleotide phosphodiesterase 5.5- to 7-fold. The activation constant (K/sub act/) for GTP and Gpp(NH)p is equal to 0.25 μM, while that for GDP and GDPβS is 14 and 110 μM, respectively. GDP free of admixtures of other nucleotides does not activate phosphodiesterase at concentrations up to 1 mM, but is bound to transducin and inhibits the Gpp(NH)p-dependent activation of phosphodiesterase. The nature of the interaction of transducin with depolarized rhodopsin also depends on the type of guanine nucleotide bound: in the presence of GDP rhodopsin-containing membranes bind 70-100% of the transducin, whereas in the presence of Gpp(NH)p only 13% of the protein is bound. The data obtained indicate that GDP and GTP convert transducin to two different functional states: the transducin-GTP complex is bound to phosphodiesterase and activates it, while the transducin-GDP complex is bound primarily to rhodopsin

Overview of cooperative international piping benchmark analyses

International Nuclear Information System (INIS)

McAfee, W.J.

1982-01-01

This paper presents an overview of an effort initiated in 1976 by the International Working Group on Fast Reactors (IWGFR) of the International Atomic Energy Agency (IAEA) to evaluate detailed and simplified inelastic analysis methods for piping systems with particular emphasis on piping bends. The procedure was to collect from participating member IAEA countries descriptions of tests and test results for piping systems or bends (with emphasis on high temperature inelastic tests), to compile, evaluate, and issue a selected number of these problems for analysis, and to compile and make a preliminary evaluation of the analyses results. Of the problem descriptions submitted three were selected to be used: a 90 0 -elbow at 600 0 C with an in-plane transverse force; a 90 0 -elbow with an in-plane moment; and a 180 0 -elbow at room temperature with a reversed, cyclic, in-plane transverse force. A variety of both detailed and simplified analysis solutions were obtained. A brief comparative assessment of the analyses is contained in this paper. 15 figures

Design, Synthesis and Antiviral Activity of 5-Hydroxymethyl-3-phosphonyl-4,5-dihydrofuran Analogs of Nucleotides

International Nuclear Information System (INIS)

Lee, Hee Yoon; Lee, Ki Ho; Hah, Jung Hwan; Moon, Deuk Kyu; Lee, Chong Kyo

2010-01-01

We have designed and synthesized functionalized dihydrofurylphosphonates that are constrained analogs of 1-alkenyl-phosphonate derivatives of purine/pyrimidine nucleotides as they bear phosphonyl groups at the 3-position and bases at the methyl group of the 5-position of the furan ring. This newly designed dihydrofurylphosphonate analogs of nucleotide showed antiviral activity. Through the current synthetic strategy, structural diversification can be easily attainable for structure activity relationship study and for the better antiviral compounds. Phosphonate esters play an important role in studying the biological system as a hydrolytically stable replacement of phosphate groups and as prodrugs of phosphonates. In continuation of our study on the chemistry of 1-alkenylphosphonates, we were interested in designing and developing versatile synthetic routes to conformationally constrained structures of al-kenylphosphonate nucleotide analogs

Estimating the Nucleotide Diversity in Ceratodon purpureus (Ditrichaceae from 218 Conserved Exon-Primed, Intron-Spanning Nuclear Loci

Directory of Open Access Journals (Sweden)

Stuart F. McDaniel

2013-04-01

Full Text Available Premise of the study: We developed and tested primers for 218 nuclear loci for studying population genetics, phylogeography, and genome evolution in bryophytes. Methods and Results: We aligned expressed sequence tags (ESTs from Ceratodon purpureus to the Physcomitrella patens genome sequence, and designed primers that are homologous to conserved exons but span introns in the P. patens genome. We tested these primers on four isolates from New York, USA; Otavalo, Ecuador; and two laboratory isolates from Austria (WT4 and GG1. The median genome-wide nucleotide diversity was 0.008 substitutions/site, but the range was large (0–0.14, illustrating the among-locus heterogeneity in the species. Conclusions: These loci provide a valuable resource for finely resolved, genome-wide population genetic and species-level phylogenetic analyses of C. purpureus and its relatives.

Horizontal gene transfer and nucleotide compositional anomaly in large DNA viruses

Directory of Open Access Journals (Sweden)

Ogata Hiroyuki

2007-12-01

Full Text Available Abstract Background DNA viruses have a wide range of genome sizes (5 kb up to 1.2 Mb, compared to 0.16 Mb to 1.5 Mb for obligate parasitic bacteria that do not correlate with their virulence or the taxonomic distribution of their hosts. The reasons for such large variation are unclear. According to the traditional view of viruses as gifted "gene pickpockets", large viral genome sizes could originate from numerous gene acquisitions from their hosts. We investigated this hypothesis by studying 67 large DNA viruses with genome sizes larger than 150 kb, including the recently characterized giant mimivirus. Given that horizontally transferred DNA often have anomalous nucleotide compositions differing from the rest of the genome, we conducted a detailed analysis of the inter- and intra-genome compositional properties of these viruses. We then interpreted their compositional heterogeneity in terms of possible causes, including strand asymmetry, gene function/expression, and horizontal transfer. Results We first show that the global nucleotide composition and nucleotide word usage of viral genomes are species-specific and distinct from those of their hosts. Next, we identified compositionally anomalous (cA genes in viral genomes, using a method based on Bayesian inference. The proportion of cA genes is highly variable across viruses and does not exhibit a significant correlation with genome size. The vast majority of the cA genes were of unknown function, lacking homologs in the databases. For genes with known homologs, we found a substantial enrichment of cA genes in specific functional classes for some of the viruses. No significant association was found between cA genes and compositional strand asymmetry. A possible exogenous origin for a small fraction of the cA genes could be confirmed by phylogenetic reconstruction. Conclusion At odds with the traditional dogma, our results argue against frequent genetic transfers to large DNA viruses from their

Preliminary design report: Prototypical Spent Fuel Consolidation Equipment Demonstration Project: Phase 1

International Nuclear Information System (INIS)

Blissell, W.H.; Ciez, A.P.; Mitchell, J.L.; Winkler, C.J.

1986-12-01

This document describes the Westinghouse Preliminary Design for the Prototypical Consolidation Demonstration Project per Department of Energy (DOE) Contract No. DE-AC07-86ID12649 and under direction of the DOE Idaho Operations Office. The preliminary design is the first step to providing the Department of Energy with a fully qualified, licensable, cost-effective spent fuel rod consolidation system. The design was developed using proven technologies and equipment to create an innovative approach to previous rod consolidation concepts. These innovations will better enable the Westinghouse system to: consolidate fuel rods in a precise, fully-controlled, accountable manner; package all rods from two PWR fuel assemblies or from four BWR fuel assemblies in one 8.5 inch square consolidated rods canister; meet all functional requirements; operate with all fuel types common to the US commercial nuclear industry with minimal tooling changeouts; and meet consolidation production process rates, while maintaining operator and public health and safety. This Preliminary Design Report provides both detailed descriptions of the equipment required to perform the rod consolidation process and the supporting analyses to validate the design

Grinding up Wheat: a Massive Loss of Nucleotide Diversity Since Domestication

DEFF Research Database (Denmark)

Haudry, Anabelle; Cenci, Alberto; Ravel, Catherine

2007-01-01

Several demographic and selective events occurred during the domestication of wheat from the allotetraploid wild emmer (Triticum turgidum ssp. dicoccoides). Cultivated wheat has since been affected by other historical events. We analyzed nucleotide diversity at 21 loci in a sample of 101 individu...

Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

DEFF Research Database (Denmark)

Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

2017-01-01

Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

Science.gov (United States)

Zeng, Lingwen; Xiao, Zhuo

2017-01-01

A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

Active cooling for downhole instrumentation: Preliminary analysis and system selection

Energy Technology Data Exchange (ETDEWEB)

Bennett, G.A.

1988-03-01

A feasibility study and a series of preliminary designs and analyses were done to identify candidate processes or cycles for use in active cooling systems for downhole electronic instruments. A matrix of energy types and their possible combinations was developed and the energy conversion process for each pari was identified. The feasibility study revealed conventional as well as unconventional processes and possible refrigerants and identified parameters needing further clarifications. A conceptual design or series od oesigns for each system was formulated and a preliminary analysis of each design was completed. The resulting coefficient of performance for each system was compared with the Carnot COP and all systems were ranked by decreasing COP. The system showing the best combination of COP, exchangeability to other operating conditions, failure mode, and system serviceability is chosen for use as a downhole refrigerator. 85 refs., 48 figs., 33 tabs.

Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Madura, K.; Prakash, S.

1986-01-01

The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

Mesenchymal stem cells from different murine tissues have differential capacity to metabolize extracellular nucleotides.

Science.gov (United States)

Iser, Isabele C; Bracco, Paula A; Gonçalves, Carlos E I; Zanin, Rafael F; Nardi, Nance B; Lenz, Guido; Battastini, Ana Maria O; Wink, Márcia R

2014-10-01

Mesenchymal stem cells (MSCs) have shown a great potential for cell-based therapy and many different therapeutic purposes. Despite the recent advances in the knowledge of MSCs biology, their biochemical and molecular properties are still poorly defined. Ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) and ecto-5'-nucleotidase (eNT/CD73) are widely expressed enzymes that hydrolyze extracellular nucleotides, generating an important cellular signaling cascade. Currently, studies have evidenced the relationship between the purinergic system and the development, maintenance, and differentiation of stem cells. The objective of this study is to identify the NTPDases and eNT/CD73 and compare the levels of nucleotide hydrolysis on MSCs isolated from different murine tissues (bone marrow, lung, vena cava, kidney, pancreas, spleen, skin, and adipose tissue). MSCs from all tissues investigated expressed the ectoenzymes at different levels. In MSCs from pancreas and adipose tissue, the hydrolysis of triphosphonucleosides was significantly higher when compared to the other cells. The diphosphonucleosides were hydrolyzed at a higher rate by MSC from pancreas when compared to MSC from other tissues. The differential nucleotide hydrolysis activity and enzyme expression in these cells suggests that MSCs play different roles in regulating the purinergic system in these tissues. Overall MSCs are an attractive adult-derived cell population for therapies, however, the fact that ecto-nucleotide metabolism can affect the microenvironment, modulating important events, such as immune response, makes the assessment of this metabolism an important part of the characterization of MSCs to be applied therapeutically. © 2014 Wiley Periodicals, Inc.

Roles of phosphorylation and nucleotide binding domains in calcium transport by sarcoplasmic reticulum adenosinetriphosphatase

International Nuclear Information System (INIS)

Teruel, J.A.; Inesi, G.

1988-01-01

The roles of the phosphorylation (phosphorylated enzyme intermediate) and nucleotide binding domains in calcium transport were studied by comparing acetyl phosphate and ATP as substrates for the Ca 2+ -ATPase of sarcoplasmic reticulum vesicles. The authors found that the maximal level of phosphoenzyme obtained with either substrate is approximately 4 nmol/mg of protein, corresponding to the stoichiometry of catalytic sites in their preparation. The initial burst of phosphoenzyme formation observed in the transient state, following addition of either substrate, is accompanied by internalization of 2 mol of calcium per mole of phosphoenzyme. The internalized calcium is then translocated with a sequential pattern, independent of the substrate used. Following a rate-limiting step, the phosphoenzyme undergoes hydrolytic cleavage and proceeds to the steady-state activity which is soon back inhibited by the rise of Ca 2+ concentration in the lumen of the vesicles. When the back inhibition is released by the addition of oxalate, substrate utilization and calcium transport occur with a ratio of 1:2, independent of the substrate and its concentration. When the nucleotide binding site is derivatized with FITP, the enzyme can still utilize acetyl phosphate (but not ATP) for calcium transport. These observations demonstrate that the basic coupling mechanism of catalysis and calcium transport involves the phosphorylation and calcium binding domains, and not the nucleotide binding domain. On the other hand, occupancy of the FITC-sensitive nucleotide site is involved in kinetic regulation not only with respect to utilization of substrate for the phosphoryl transfer reaction but also for subsequent steps related to calcium translocation and phosphoenzyme turnover

MELCOR 1.8.2 Analyses in Support of ITER's RPrS

International Nuclear Information System (INIS)

Brad J Merrill

2008-01-01

The International Thermonuclear Experimental Reactor (ITER) Program is performing accident analyses for ITER's 'Rapport Preliminaire de Surete' (Report Preliminary on Safety - RPrS) with a modified version of the MELCOR 1.8.2 code. The RPrS is an ITER safety document required in the ITER licensing process to obtain a 'Decret Autorisation de Construction' (a Decree Authorizing Construction - DAC) for the ITER device. This report documents the accident analyses performed by the US with the MELCOR 1.8.2 code in support of the ITER RPrS effort. This work was funded through an ITER Task Agreement for MELCOR Quality Assurance and Safety Analyses. Under this agreement, the US was tasked with performing analyses for three accident scenarios in the ITER facility. Contained within the text of this report are discussions that identify the cause of these accidents, descriptions of how these accidents are likely to proceed, the method used to analyze the consequences of these accidents, and discussions of the transient thermal hydraulic and radiological release results for these accidents

Comprehensive identification of single nucleotide polymorphisms associated with beta-lactam resistance within pneumococcal mosaic genes.

Directory of Open Access Journals (Sweden)

Claire Chewapreecha

2014-08-01

Full Text Available Traditional genetic association studies are very difficult in bacteria, as the generally limited recombination leads to large linked haplotype blocks, confounding the identification of causative variants. Beta-lactam antibiotic resistance in Streptococcus pneumoniae arises readily as the bacteria can quickly incorporate DNA fragments encompassing variants that make the transformed strains resistant. However, the causative mutations themselves are embedded within larger recombined blocks, and previous studies have only analysed a limited number of isolates, leading to the description of "mosaic genes" as being responsible for resistance. By comparing a large number of genomes of beta-lactam susceptible and non-susceptible strains, the high frequency of recombination should break up these haplotype blocks and allow the use of genetic association approaches to identify individual causative variants. Here, we performed a genome-wide association study to identify single nucleotide polymorphisms (SNPs and indels that could confer beta-lactam non-susceptibility using 3,085 Thai and 616 USA pneumococcal isolates as independent datasets for the variant discovery. The large sample sizes allowed us to narrow the source of beta-lactam non-susceptibility from long recombinant fragments down to much smaller loci comprised of discrete or linked SNPs. While some loci appear to be universal resistance determinants, contributing equally to non-susceptibility for at least two classes of beta-lactam antibiotics, some play a larger role in resistance to particular antibiotics. All of the identified loci have a highly non-uniform distribution in the populations. They are enriched not only in vaccine-targeted, but also non-vaccine-targeted lineages, which may raise clinical concerns. Identification of single nucleotide polymorphisms underlying resistance will be essential for future use of genome sequencing to predict antibiotic sensitivity in clinical microbiology.

Adsorption of nucleotides onto ferromagnesian phyllosilicates: Significance for the origin of life

Science.gov (United States)

Pedreira-Segade, Ulysse; Feuillie, Cécile; Pelletier, Manuel; Michot, Laurent J.; Daniel, Isabelle

2016-03-01

The concentration of prebiotic organic building blocks may have promoted the formation of biopolymers in the environment of the early Earth. We therefore studied the adsorption of RNA monomers AMP, GMP, CMP, and UMP, and DNA monomers dGMP, dCMP, and TMP, on minerals that were abundant in the early Earth environment as the result of aqueous or hydrothermal alteration of the primitive oceanic crust. We focused our study on swelling clays, i.e. nontronite and montmorillonite, and non-swelling phyllosilicates, i.e. pyrophyllite, chlorite, lizardite and chrysotile suspended in an aqueous saline solution analog to seawater. In this reference study, adsorption experiments were carried out under standard conditions of pressure and temperature and controlled pH. Under such conditions, this work is also relevant to the preservation of nucleic acids in Fe-Mg-rich terrestrial and Martian soils. We compared the adsorption of the different monomers on individual minerals, as well as the adsorption of single monomers on the whole suite of minerals. We found that DNA monomers adsorb much more strongly than RNA monomers, and that any monomer containing the G nucleobase adsorbed more strongly than one containing the C nucleobase. At high surface loadings (greater than about 1 mM monomer in aqueous solution) we also found a dramatic increase in the slope of adsorption isotherm on the swelling clays, leading to large increases in the amounts adsorbed. Data were processed in order to understand the adsorption mechanism of nucleotides onto mineral surfaces. We infer that all nucleotides behave as homologous molecules in regard to their adsorption onto the studied mineral surfaces. At low to moderate surface loadings, their adsorption is best explained by a single mechanism common to the suite of minerals of the present study. At pH 7, adsorption certainly proceeds by ligand exchange between the phosphate group and the hydroxyls of the broken edges of phyllosilicates leading to the

Loss-of-coolant accident analyses of the Advanced Neutron Source Reactor

International Nuclear Information System (INIS)

Chen, N.C.J.; Yoder, G.L.; Wendel, M.W.

1991-01-01

Currently in the conceptual design stage, the Advanced Neutron Source Reactor (ANSR) will operate at a high heat flux, a high mass flux, an a high degree of coolant subcooling. Loss-of-coolant accident (LOCA) analyses using RELAP5 have been performed as part of an early evaluation of ANSR safety issues. This paper discusses the RELAP5 ANSR conceptual design system model and preliminary LOCA simulation results. Some previous studies were conducted for the preconceptual design. 12 refs., 7 figs

Role of Metal Oxides in Chemical Evolution: Interaction of Ribose Nucleotides with Alumina

Science.gov (United States)

Arora, Avnish Kumar; Kamaluddin

2009-03-01

Interaction of ribonucleotides—namely, 5‧-AMP, 5‧-GMP, 5‧-CMP, and 5‧-UMP—with acidic, neutral, and basic alumina has been studied. Purine nucleotides showed higher adsorption on alumina in comparison with pyrimidine nucleotides under acidic conditions. Adsorption data obtained followed Langmuir adsorption isotherm, and Xm and KL values were calculated. On the basis of infrared spectral studies of ribonucleotides, alumina, and ribonucleotide-alumina adducts, we propose that the nitrogen base and phosphate moiety of the ribonucleotides interact with the positive charge surface of alumina. Results of the present study may indicate the importance of alumina in concentrating organic molecules from dilute aqueous solutions in primeval seas in the course of chemical evolution on Earth.

Translation of the Manchester Clinical Supervision Scale (MCSS) into Danish and a preliminary psychometric validation

DEFF Research Database (Denmark)

Buus, Niels; Gonge, Henrik

2013-01-01

for the translation of the MCSS from English into Danish and to present a preliminary psychometric validation of the Danish version of the scale. Methods included a formal translation/back-translation procedure and statistical analyses. The sample consisted of MCSS scores from 139 Danish mental health nursing staff...

Preliminary corrosion models for BWIP [Basalt Waste Isolation Project] canister materials

International Nuclear Information System (INIS)

Fish, R.L.; Anantatmula, R.P.

1983-01-01

Waste package development for the Basalt Waste Isolation Project (BWIP) requires the generation of materials degradation data under repository relevant conditions. These data are used to develop predictive models for the behavior of each component of waste package. The component models are exercised in performance analyses to optimize the waste package design. This document presents all repository relevant canister materials corrosion data that the BWIP and others have developed to date, describes the methodology used to develop preliminary corrosion models and provides the mathematical description of the models for both low carbon steel and Fe9Cr1Mo steel. Example environment/temperature history and model application calculations are presented to aid in understanding the models. The models are preliminary in nature and will be updated as additional corrosion data become available. 6 refs., 5 tabs

Selective fluorescence quenching of 2,3-diazabicyclo[2.2.2]oct-2-ene by nucleotides.

Science.gov (United States)

Marquez, Cesar; Pischel, Uwe; Nau, Werner M

2003-10-16

[reaction: see text] The fluorescence quenching of 2,3-diazabicyclo[2.2.2]oct-2-ene (DBO) by nucleotides has been studied. The quenching mechanism was analyzed on the basis of deuterium isotope effects, tendencies for exciplex formation, and the quenching efficiency in the presence of a molecular container (cucurbit[7]uril). Exciplex-induced quenching appears to prevail for adenosine, cytidine, and uridine, while hydrogen abstraction becomes competitive for thymidine and guanosine. Compared to other fluorescent probes, DBO responds very selectively to the type of nucleotide.

The effect of exhaustive exercise on the concentration of purine nucleotides and their metabolites in erythrocytes

OpenAIRE

E Skotnicka; I Baranowska-Bosiacka; W Dudzińska; M Suska; R Nowak; K Krupecki; AJ Hłyńczak

2008-01-01

In this study we tried to obtain a complete overview of purine nucleotide metabolism in erythrocytes before and during an incremental, intermittent exhaustive exercise bout protocol for sportsmen (high-performance rowers) and untrained, healthy, active volunteers. Erythrocyte levels of the main nucleotides (ATP, ADP, AMP, GTP, GDP, GMP, IMP, NAD and NADP ), nucleosides (Ado, Guo, Ino) and the base Hyp were measured using the HPLC method. The parameters that can be deducted from their concent...

Ethanol-induced activation of adenine nucleotide turnover. Evidence for a role of acetate

International Nuclear Information System (INIS)

Puig, J.G.; Fox, I.H.

1984-01-01

Consumption of alcohol causes hyperuricemia by decreasing urate excretion and increasing its production. Our previous studies indicate that ethanol administration increases uric acid production by increasing ATP degradation to uric acid precursors. To test the hypothesis that ethanol-induced increased urate production results from acetate metabolism and enhanced adenosine triphosphate turnover, we gave intravenous sodium acetate, sodium chloride and ethanol (0.1 mmol/kg per min for 1 h) to five normal subjects. Acetate plasma levels increased from 0.04 +/- 0.01 mM (mean +/- SE) to peak values of 0.35 +/- 0.07 mM and to 0.08 +/- 0.01 mM during acetate and ethanol infusions, respectively. Urinary oxypurines increased to 223 +/- 13% and 316 +/- 44% of the base-line values during acetate and ethanol infusions, respectively. Urinary radioactivity from the adenine nucleotide pool labeled with [8-14C] adenine increased to 171 +/- 27% and to 128 +/- 8% of the base-line values after acetate and ethanol infusions. These data indicate that both ethanol and acetate increase purine nucleotide degradation by enhancing the turnover of the adenine nucleotide pool. They support the hypothesis that acetate metabolism contributes to the increased production of urate associated with ethanol intake

Assessing antiquity and turnover of terrestrial ecosystems in eastern North America using fossil pollen data: A preliminary study

International Nuclear Information System (INIS)

Liu Yao; Jackson, Stephen T; Brewer, Simon; Williams, John W

2010-01-01

We explored formal approaches to identifying and interpreting the antiquity and turnover of terrestrial ecosystems in eastern North America using pollen records. Preliminary results of cluster analyses, receiver-operating characteristic (ROC) analyses, and likelihood estimation of ecosystem analog in a simple Bayesian model allow assessment of modern ecosystem antiquities and past ecosystem turnovers. Approaches discussed in this study thus provide a vehicle for further studies.

On the biased nucleotide composition of the human coronavirus RNA genome

NARCIS (Netherlands)

Berkhout, Ben; van Hemert, Formijn

2015-01-01

We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and

Genetic homogeneity of the invasive lionfish across the Northwestern Atlantic and the Gulf of Mexico based on Single Nucleotide Polymorphisms.

Science.gov (United States)

Pérez-Portela, R; Bumford, A; Coffman, B; Wedelich, S; Davenport, M; Fogg, A; Swenarton, M K; Coleman, F; Johnston, M A; Crawford, D L; Oleksiak, M F

2018-03-22

Despite the devastating impact of the lionfish (Pterois volitans) invasion on NW Atlantic ecosystems, little genetic information about the invasion process is available. We applied Genotyping by Sequencing techniques to identify 1,220 single nucleotide polymorphic sites (SNPs) from 162 lionfish samples collected between 2013 and 2015 from two areas chronologically identified as the first and last invaded areas in US waters: the east coast of Florida and the Gulf of Mexico. We used population genomic analyses, including phylogenetic reconstruction, Bayesian clustering, genetic distances, Discriminant Analyses of Principal Components, and coalescence simulations for detection of outlier SNPs, to understand genetic trends relevant to the lionfish's long-term persistence. We found no significant differences in genetic structure or diversity between the two areas (F ST p-values > 0.01, and t-test p-values > 0.05). In fact, our genomic analyses showed genetic homogeneity, with enough gene flow between the east coast of Florida and Gulf of Mexico to erase previous signals of genetic divergence detected between these areas, secondary spreading, and bottlenecks in the Gulf of Mexico. These findings suggest rapid genetic changes over space and time during the invasion, resulting in one panmictic population with no signs of divergence between areas due to local adaptation.

Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

Science.gov (United States)

Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

2017-01-01

Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

Lack of nucleotide variability in a beetle pest with extreme inbreeding.

Science.gov (United States)

Andreev, D; Breilid, H; Kirkendall, L; Brun, L O; ffrench-Constant, R H

1998-05-01

The coffee berry borer beetle Hypothenemus hampei (Ferrari) (Curculionidae: Scolytinae) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an unusual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occurring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation in nuclear and mitochondrial genomes of this beetle worldwide. Here we show that two nuclear loci (Resistance to dieldrin and ITS2) are completely invariant, whereas some variability is maintained at a mitochondrial locus (COI), probably corresponding to a higher mutation rate in the mitochondrial genome. Phylogenetic analysis of the mitochondrial data shows only two clades of beetle haplotypes outside of Kenya, the proposed origin of the species. These data confirm that inbreeding greatly reduces nucleotide variation and suggest the recent global spread of only two inbreeding lines of this bark beetle.

Incorporating Single-nucleotide Polymorphisms Into the Lyman Model to Improve Prediction of Radiation Pneumonitis

Energy Technology Data Exchange (ETDEWEB)

Tucker, Susan L., E-mail: sltucker@mdanderson.org [Department of Bioinformatics and Computational Biology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Li Minghuan [Department of Radiation Oncology, Shandong Cancer Hospital, Jinan, Shandong (China); Xu Ting; Gomez, Daniel [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Yuan Xianglin [Department of Oncology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Yu Jinming [Department of Radiation Oncology, Shandong Cancer Hospital, Jinan, Shandong (China); Liu Zhensheng; Yin Ming; Guan Xiaoxiang; Wang Lie; Wei Qingyi [Department of Epidemiology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Mohan, Radhe [Department of Radiation Physics, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Vinogradskiy, Yevgeniy [University of Colorado School of Medicine, Aurora, Colorado (United States); Martel, Mary [Department of Radiation Physics, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Liao Zhongxing [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

2013-01-01

Purpose: To determine whether single-nucleotide polymorphisms (SNPs) in genes associated with DNA repair, cell cycle, transforming growth factor-{beta}, tumor necrosis factor and receptor, folic acid metabolism, and angiogenesis can significantly improve the fit of the Lyman-Kutcher-Burman (LKB) normal-tissue complication probability (NTCP) model of radiation pneumonitis (RP) risk among patients with non-small cell lung cancer (NSCLC). Methods and Materials: Sixteen SNPs from 10 different genes (XRCC1, XRCC3, APEX1, MDM2, TGF{beta}, TNF{alpha}, TNFR, MTHFR, MTRR, and VEGF) were genotyped in 141 NSCLC patients treated with definitive radiation therapy, with or without chemotherapy. The LKB model was used to estimate the risk of severe (grade {>=}3) RP as a function of mean lung dose (MLD), with SNPs and patient smoking status incorporated into the model as dose-modifying factors. Multivariate analyses were performed by adding significant factors to the MLD model in a forward stepwise procedure, with significance assessed using the likelihood-ratio test. Bootstrap analyses were used to assess the reproducibility of results under variations in the data. Results: Five SNPs were selected for inclusion in the multivariate NTCP model based on MLD alone. SNPs associated with an increased risk of severe RP were in genes for TGF{beta}, VEGF, TNF{alpha}, XRCC1 and APEX1. With smoking status included in the multivariate model, the SNPs significantly associated with increased risk of RP were in genes for TGF{beta}, VEGF, and XRCC3. Bootstrap analyses selected a median of 4 SNPs per model fit, with the 6 genes listed above selected most often. Conclusions: This study provides evidence that SNPs can significantly improve the predictive ability of the Lyman MLD model. With a small number of SNPs, it was possible to distinguish cohorts with >50% risk vs <10% risk of RP when they were exposed to high MLDs.

Molecular Comparison and Evolutionary Analyses of VP1 Nucleotide Sequences of New African Human Enterovirus 71 Isolates Reveal a Wide Genetic Diversity

Science.gov (United States)

Nougairède, Antoine; Joffret, Marie-Line; Deshpande, Jagadish M.; Dubot-Pérès, Audrey; Héraud, Jean-Michel

2014-01-01

Most circulating strains of Human enterovirus 71 (EV-A71) have been classified primarily into three genogroups (A to C) on the basis of genetic divergence between the 1D gene, which encodes the VP1 capsid protein. The aim of the present study was to provide further insights into the diversity of the EV-A71 genogroups following the recent description of highly divergent isolates, in particular those from African countries, including Madagascar. We classified recent EV-A71 isolates by a large comparison of 3,346 VP1 nucleotidic sequences collected from GenBank. Analysis of genetic distances and phylogenetic investigations indicated that some recently-reported isolates did not fall into the genogroups A-C and clustered into three additional genogroups, including one Indian genogroup (genogroup D) and 2 African ones (E and F). Our Bayesian phylogenetic analysis provided consistent data showing that the genogroup D isolates share a recent common ancestor with the members of genogroup E, while the isolates of genogroup F evolved from a recent common ancestor shared with the members of the genogroup B. Our results reveal the wide diversity that exists among EV-A71 isolates and suggest that the number of circulating genogroups is probably underestimated, particularly in developing countries where EV-A71 epidemiology has been poorly studied. PMID:24598878

Enhanced activity of the purine nucleotide cycle of the exercising muscle in patients with hyperthyroidism.

Science.gov (United States)

Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C

2001-05-01

Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.

Preliminary Monthly Climatological Summaries

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Preliminary Local Climatological Data, recorded since 1970 on Weather Burean Form 1030 and then National Weather Service Form F-6. The preliminary climate data pages...

Three-dimensional structures of the mammalian multidrug resistance P-glycoprotein demonstrate major conformational changes in the transmembrane domains upon nucleotide binding.

Science.gov (United States)

Rosenberg, Mark F; Kamis, Alhaji Bukar; Callaghan, Richard; Higgins, Christopher F; Ford, Robert C

2003-03-07

P-glycoprotein is an ATP-binding cassette transporter that is associated with multidrug resistance and the failure of chemotherapy in human patients. We have previously shown, based on two-dimensional projection maps, that P-glycoprotein undergoes conformational changes upon binding of nucleotide to the intracellular nucleotide binding domains. Here we present the three-dimensional structures of P-glycoprotein in the presence and absence of nucleotide, at a resolution limit of approximately 2 nm, determined by electron crystallography of negatively stained crystals. The data reveal a major reorganization of the transmembrane domains throughout the entire depth of the membrane upon binding of nucleotide. In the absence of nucleotide, the two transmembrane domains form a single barrel 5-6 nm in diameter and about 5 nm deep with a central pore that is open to the extracellular surface and spans much of the membrane depth. Upon binding nucleotide, the transmembrane domains reorganize into three compact domains that are each 2-3 nm in diameter and 5-6 nm deep. This reorganization opens the central pore along its length in a manner that could allow access of hydrophobic drugs (transport substrates) directly from the lipid bilayer to the central pore of the transporter.

Mitochondria as determinant of nucleotide pools and chromosomal stability

DEFF Research Database (Denmark)

Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

2007-01-01

Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

International Nuclear Information System (INIS)

Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

1998-01-01

To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

National Data Center Preparedness Exercise 2015 (NPE 2015): MY-NDC Preliminary Analysis Result

International Nuclear Information System (INIS)

Faisal Izwan Abdul Rashid; Muhammed Zulfakar Zolkaffly

2016-01-01

Malaysia has established the CTBT National Data Centre (MY-NDC) in December 2005. MY-NDC is tasked to perform Comprehensive Nuclear-Test-Ban-Treaty (CTBT) data management as well as provide information for Treaty related events to Nuclear Malaysia as CTBT National Authority. In 2015, MY-NDC has participated in the National Data Centre Preparedness Exercise 2015 (NPE 2015). This paper aims at presenting MY-NDC preliminary analysis result of NPE 2015. In NPE 2015, MY-NDC has performed five different analyses, namely, radionuclide, atmospheric transport modelling (ATM), data fusion, seismic analysis and site forensics. The preliminary findings show the hypothetical scenario in NPE 2015 most probably is an uncontained event resulted high release of radionuclide to the air. (author)

Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA.

Directory of Open Access Journals (Sweden)

Anna-Karin Berglund

2017-02-01

Full Text Available Previous work has demonstrated the presence of ribonucleotides in human mitochondrial DNA (mtDNA and in the present study we use a genome-wide approach to precisely map the location of these. We find that ribonucleotides are distributed evenly between the heavy- and light-strand of mtDNA. The relative levels of incorporated ribonucleotides reflect that DNA polymerase γ discriminates the four ribonucleotides differentially during DNA synthesis. The observed pattern is also dependent on the mitochondrial deoxyribonucleotide (dNTP pools and disease-causing mutations that change these pools alter both the absolute and relative levels of incorporated ribonucleotides. Our analyses strongly suggest that DNA polymerase γ-dependent incorporation is the main source of ribonucleotides in mtDNA and argues against the existence of a mitochondrial ribonucleotide excision repair pathway in human cells. Furthermore, we clearly demonstrate that when dNTP pools are limiting, ribonucleotides serve as a source of building blocks to maintain DNA replication. Increased levels of embedded ribonucleotides in patient cells with disturbed nucleotide pools may contribute to a pathogenic mechanism that affects mtDNA stability and impair new rounds of mtDNA replication.

Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA.

Science.gov (United States)

Berglund, Anna-Karin; Navarrete, Clara; Engqvist, Martin K M; Hoberg, Emily; Szilagyi, Zsolt; Taylor, Robert W; Gustafsson, Claes M; Falkenberg, Maria; Clausen, Anders R

2017-02-01

Previous work has demonstrated the presence of ribonucleotides in human mitochondrial DNA (mtDNA) and in the present study we use a genome-wide approach to precisely map the location of these. We find that ribonucleotides are distributed evenly between the heavy- and light-strand of mtDNA. The relative levels of incorporated ribonucleotides reflect that DNA polymerase γ discriminates the four ribonucleotides differentially during DNA synthesis. The observed pattern is also dependent on the mitochondrial deoxyribonucleotide (dNTP) pools and disease-causing mutations that change these pools alter both the absolute and relative levels of incorporated ribonucleotides. Our analyses strongly suggest that DNA polymerase γ-dependent incorporation is the main source of ribonucleotides in mtDNA and argues against the existence of a mitochondrial ribonucleotide excision repair pathway in human cells. Furthermore, we clearly demonstrate that when dNTP pools are limiting, ribonucleotides serve as a source of building blocks to maintain DNA replication. Increased levels of embedded ribonucleotides in patient cells with disturbed nucleotide pools may contribute to a pathogenic mechanism that affects mtDNA stability and impair new rounds of mtDNA replication.

Preliminary Safety Analysis Report for the Tokamak Physics Experiment

International Nuclear Information System (INIS)

Motloch, C.G.; Bonney, R.F.; Levine, J.D.; Masson, L.S.; Commander, J.C.

1995-04-01

This Preliminary Safety Analysis Report (PSAR), includes an indication of the magnitude of facility hazards, complexity of facility operations, and the stage of the facility life-cycle. It presents the results of safety analyses, safety assurance programs, identified vulnerabilities, compensatory measures, and, in general, the rationale describing why the Tokamak Physics Experiment (TPX) can be safely operated. It discusses application of the graded approach to the TPX safety analysis, including the basis for using Department of Energy (DOE) Order 5480.23 and DOE-STD-3009-94 in the development of the PSAR

Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.

Directory of Open Access Journals (Sweden)

Waikhom Bimolata

Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.

DMPD: Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of health and disease. [Dynamic Macrophage Pathway CSML Database

Lifescience Database Archive (English)

Full Text Available and nucleotide oligomerisation domain inthe regulation of health and disease. Pu...bmedID 17535871 Title Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of health...17535871 Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of heal...th and disease. Mitchell JA, Paul-Clark MJ, Clarke GW, McMaster SK, Cartwright N. J

A single nucleotide change affects fur-dependent regulation of sodB in H. pylori.

Directory of Open Access Journals (Sweden)

Beth M Carpenter

Full Text Available Helicobacter pylori is a significant human pathogen that has adapted to survive the many stresses found within the gastric environment. Superoxide Dismutase (SodB is an important factor that helps H. pylori combat oxidative stress. sodB was previously shown to be repressed by the Ferric Uptake Regulator (Fur in the absence of iron (apo-Fur regulation [1]. Herein, we show that apo regulation is not fully conserved among all strains of H. pylori. apo-Fur dependent changes in sodB expression are not observed under iron deplete conditions in H. pylori strains G27, HPAG1, or J99. However, Fur regulation of pfr and amiE occurs as expected. Comparative analysis of the Fur coding sequence between G27 and 26695 revealed a single amino acid difference, which was not responsible for the altered sodB regulation. Comparison of the sodB promoters from G27 and 26695 also revealed a single nucleotide difference within the predicted Fur binding site. Alteration of this nucleotide in G27 to that of 26695 restored apo-Fur dependent sodB regulation, indicating that a single base difference is at least partially responsible for the difference in sodB regulation observed among these H. pylori strains. Fur binding studies revealed that alteration of this single nucleotide in G27 increased the affinity of Fur for the sodB promoter. Additionally, the single base change in G27 enabled the sodB promoter to bind to apo-Fur with affinities similar to the 26695 sodB promoter. Taken together these data indicate that this nucleotide residue is important for direct apo-Fur binding to the sodB promoter.

The effect of nucleotides and adenosine on stimulus-evoked glutamate release from rat brain cortical slices

OpenAIRE

Bennett, Gillian C; Boarder, Michael R

2000-01-01

Evidence has previously been presented that P1 receptors for adenosine, and P2 receptors for nucleotides such as ATP, regulate stimulus-evoked release of biogenic amines from nerve terminals in the brain. Here we investigated whether adenosine and nucleotides exert presynaptic control over depolarisation-elicited glutamate release.Slices of rat brain cortex were perfused and stimulated with pulses of 46 mM K+ in the presence of the glutamate uptake inhibitor L-trans-pyrrolidine-2,4-dicarboxyl...

Preliminary analyses for HTTR`s start-up physics tests by Monte Carlo code MVP

Energy Technology Data Exchange (ETDEWEB)

Nojiri, Naoki [Science and Technology Agency, Tokyo (Japan); Nakano, Masaaki; Ando, Hiroei; Fujimoto, Nozomu; Takeuchi, Mitsuo; Fujisaki, Shingo; Yamashita, Kiyonobu

1998-08-01

Analyses of start-up physics tests for High Temperature Engineering Test Reactor (HTTR) have been carried out by Monte Carlo code MVP based on continuous energy method. Heterogeneous core structures were modified precisely, such as the fuel compacts, fuel rods, coolant channels, burnable poisons, control rods, control rod insertion holes, reserved shutdown pellet insertion holes, gaps between graphite blocks, etc. Such precise modification of the core structures was difficult with diffusion calculation. From the analytical results, the followings were confirmed; The first criticality will be achieved around 16 fuel columns loaded. The reactivity at the first criticality can be controlled by only one control rod located at the center of the core with other fifteen control rods fully withdrawn. The excess reactivity, reactor shutdown margin and control rod criticality positions have been evaluated. These results were used for planning of the start-up physics tests. This report presents analyses of start-up physics tests for HTTR by MVP code. (author)

Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.

Directory of Open Access Journals (Sweden)

Enying Zhang

Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.

A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.

Science.gov (United States)

Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I

2016-01-01

We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.

Nucleotide Excision DNA Repair is Associated with Age-Related Vascular Dysfunction

Science.gov (United States)

Durik, Matej; Kavousi, Maryam; van der Pluijm, Ingrid; Isaacs, Aaron; Cheng, Caroline; Verdonk, Koen; Loot, Annemarieke E.; Oeseburg, Hisko; Musterd-Bhaggoe, Usha; Leijten, Frank; van Veghel, Richard; de Vries, Rene; Rudez, Goran; Brandt, Renata; Ridwan, Yanto R.; van Deel, Elza D.; de Boer, Martine; Tempel, Dennie; Fleming, Ingrid; Mitchell, Gary F.; Verwoert, Germaine C.; Tarasov, Kirill V.; Uitterlinden, Andre G.; Hofman, Albert; Duckers, Henricus J.; van Duijn, Cornelia M.; Oostra, Ben A.; Witteman, Jacqueline C.M.; Duncker, Dirk J.; Danser, A.H. Jan; Hoeijmakers, Jan H.; Roks, Anton J.M.

2012-01-01

Background Vascular dysfunction in atherosclerosis and diabetes, as observed in the aging population of developed societies, is associated with vascular DNA damage and cell senescence. We hypothesized that cumulative DNA damage during aging contributes to vascular dysfunction. Methods and Results In mice with genomic instability due to the defective nucleotide excision repair genes ERCC1 and XPD (Ercc1d/− and XpdTTD mice), we explored age-dependent vascular function as compared to wild-type mice. Ercc1d/− mice showed increased vascular cell senescence, accelerated development of vasodilator dysfunction, increased vascular stiffness and elevated blood pressure at very young age. The vasodilator dysfunction was due to decreased endothelial eNOS levels as well as impaired smooth muscle cell function, which involved phosphodiesterase (PDE) activity. Similar to Ercc1d/− mice, age-related endothelium-dependent vasodilator dysfunction in XpdTTD animals was increased. To investigate the implications for human vascular disease, we explored associations between single nucleotide polymorphisms (SNPs) of selected nucleotide excision repair genes and arterial stiffness within the AortaGen Consortium, and found a significant association of a SNP (rs2029298) in the putative promoter region of DDB2 gene with carotid-femoral pulse wave velocity. Conclusions Mice with genomic instability recapitulate age-dependent vascular dysfunction as observed in animal models and in humans, but with an accelerated progression, as compared to wild type mice. In addition, we found associations between variations in human DNA repair genes and markers for vascular stiffness which is associated with aging. Our study supports the concept that genomic instability contributes importantly to the development of cardiovascular disease. PMID:22705887

Preliminary study of soil permeability properties using principal component analysis

Science.gov (United States)

Yulianti, M.; Sudriani, Y.; Rustini, H. A.

2018-02-01

Soil permeability measurement is undoubtedly important in carrying out soil-water research such as rainfall-runoff modelling, irrigation water distribution systems, etc. It is also known that acquiring reliable soil permeability data is rather laborious, time-consuming, and costly. Therefore, it is desirable to develop the prediction model. Several studies of empirical equations for predicting permeability have been undertaken by many researchers. These studies derived the models from areas which soil characteristics are different from Indonesian soil, which suggest a possibility that these permeability models are site-specific. The purpose of this study is to identify which soil parameters correspond strongly to soil permeability and propose a preliminary model for permeability prediction. Principal component analysis (PCA) was applied to 16 parameters analysed from 37 sites consist of 91 samples obtained from Batanghari Watershed. Findings indicated five variables that have strong correlation with soil permeability, and we recommend a preliminary permeability model, which is potential for further development.

Cyclic nucleotide specific phosphodiesterases of Leishmania major

Directory of Open Access Journals (Sweden)

Linder Markus

2006-03-01

Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics

NARCIS (Netherlands)

Corradini, E.

2015-01-01

Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.

Hydrolytic and alcoholytic dephosphorylation of nucleotides by acid phosphatase in the presence of ethanol.

Science.gov (United States)

Tomaszewski, M; Buchowicz, J

1971-08-01

The effect of ethanol on the activity of acid phosphatase from wheat germ was studied, by using ribonucleoside monophosphates as the enzyme substrates. The nucleotides were effectively degraded to the corresponding nucleosides in the presence of ethanol at all concentrations tested, including a 96% (v/v) solution. However, the nucleotide dephosphorylation was accompanied by the liberation of orthophosphate only when the concentration of ethanol in the assay mixture did not exceed 15%. No inorganic phosphate was liberated when ethanol was present at higher concentrations. Instead, monoethyl phosphate was formed in quantities expected for orthophosphate. The results are explained in terms of phosphatase-catalysed alcoholysis.

Assessment of Genetic Diversity in Faba Bean Based on Single Nucleotide Polymorphism

Directory of Open Access Journals (Sweden)

Sukhjiwan Kaur

2014-01-01

Full Text Available Detection of genetic diversity is important for characterisation of crop plant collections in order to detect the presence of valuable trait variation for use in breeding programs. A collection of faba bean (Vicia faba L. genotypes was evaluated for intra- and inter-population diversity using a set of 768 genome-wide distributed single nucleotide polymorphism (SNP markers, of which 657 obtained successful amplification and detected polymorphisms. Gene diversity and polymorphism information content (PIC values varied between 0.022–0.500 and 0.023–1.00, with averages of 0.363 and 0.287, respectively. The genetic structure of the germplasm collection was analysed and a neighbour-joining (NJ dendrogram was constructed. The faba bean accessions grouped into two major groups, with several additional smaller sub-groups, predominantly on the basis of geographical origin. These results were further supported by principal co-ordinate analysis (PCoA, deriving two major groupings which were differentiated on the basis of site of origin and pedigree relationships. In general, high levels of heterozygosity were observed, presumably due to the partially allogamous nature of the species. The results will facilitate targeted crossing strategies in future faba bean breeding programs in order to achieve genetic gain.

Molecular Characterization of Five Potyviruses Infecting Korean Sweet Potatoes Based on Analyses of Complete Genome Sequences

Directory of Open Access Journals (Sweden)

Hae-Ryun Kwak

2015-12-01

Full Text Available Sweet potatoes (Ipomea batatas L. are grown extensively, in tropical and temperate regions, and are important food crops worldwide. In Korea, potyviruses, including Sweet potato feathery mottle virus (SPFMV, Sweet potato virus C (SPVC, Sweet potato virus G (SPVG, Sweet potato virus 2 (SPV2, and Sweet potato latent virus (SPLV, have been detected in sweet potato fields at a high (~95% incidence. In the present work, complete genome sequences of 18 isolates, representing the five potyviruses mentioned above, were compared with previously reported genome sequences. The complete genomes consisted of 10,081 to 10,830 nucleotides, excluding the poly-A tails. Their genomic organizations were typical of the Potyvirus genus, including one target open reading frame coding for a putative polyprotein. Based on phylogenetic analyses and sequence comparisons, the Korean SPFMV isolates belonged to the strains RC and O with >98% nucleotide sequence identity. Korean SPVC isolates had 99% identity to the Japanese isolate SPVC-Bungo and 70% identity to the SPFMV isolates. The Korean SPVG isolates showed 99% identity to the three previously reported SPVG isolates. Korean SPV2 isolates had 97% identity to the SPV2 GWB-2 isolate from the USA. Korean SPLV isolates had a relatively low (88% nucleotide sequence identity with the Taiwanese SPLV-TW isolates, and they were phylogenetically distantly related to SPFMV isolates. Recombination analysis revealed that possible recombination events occurred in the P1, HC-Pro and NIa-NIb regions of SPFMV and SPLV isolates and these regions were identified as hotspots for recombination in the sweet potato potyviruses.

C-terminal β9-strand of the cyclic nucleotide-binding homology domain stabilizes activated states of Kv11.1 channels.

Directory of Open Access Journals (Sweden)

Chai Ann Ng

Full Text Available Kv11.1 potassium channels are important for regulation of the normal rhythm of the heartbeat. Reduced activity of Kv11.1 channels causes long QT syndrome type 2, a disorder that increases the risk of cardiac arrhythmias and sudden cardiac arrest. Kv11.1 channels are members of the KCNH subfamily of voltage-gated K(+ channels. However, they also share many similarities with the cyclic nucleotide gated ion channel family, including having a cyclic nucleotide-binding homology (cNBH domain. Kv11.1 channels, however, are not directly regulated by cyclic nucleotides. Recently, crystal structures of the cNBH domain from mEAG and zELK channels, both members of the KCNH family of voltage-gated potassium channels, revealed that a C-terminal β9-strand in the cNBH domain occupied the putative cyclic nucleotide-binding site thereby precluding binding of cyclic nucleotides. Here we show that mutations to residues in the β9-strand affect the stability of the open state relative to the closed state of Kv11.1 channels. We also show that disrupting the structure of the β9-strand reduces the stability of the inactivated state relative to the open state. Clinical mutations located in this β9-strand result in reduced trafficking efficiency, which suggests that binding of the C-terminal β9-strand to the putative cyclic nucleotide-binding pocket is also important for assembly and trafficking of Kv11.1 channels.

Tools and drugs for uracil nucleotide-activated P2Y receptors.

Science.gov (United States)

Rafehi, Muhammad; Müller, Christa E

2018-04-13

P2Y receptors (P2YRs) are a family of G protein-coupled receptors activated by extracellular nucleotides. Physiological P2YR agonists include purine and pyrimidine nucleoside di- and triphosphates, such as ATP, ADP, UTP, UDP, nucleotide sugars, and dinucleotides. Eight subtypes exist, P2Y 1 , P2Y 2 , P2Y 4 , P2Y 6 , P2Y 11 , P2Y 12 , P2Y 13 , and P2Y 14 , which represent current or potential future drug targets. Here we provide a comprehensive overview of ligands for the subgroup of the P2YR family that is activated by uracil nucleotides: P2Y 2 (UTP, also ATP and dinucleotides), P2Y 4 (UTP), P2Y 6 (UDP), and P2Y 14 (UDP, UDP-glucose, UDP-galactose). The physiological agonists are metabolically unstable due to their fast hydrolysis by ectonucleotidases. A number of agonists with increased potency, subtype-selectivity and/or enzymatic stability have been developed in recent years. Useful P2Y 2 R agonists include MRS2698 (6-01, highly selective) and PSB-1114 (6-05, increased metabolic stability). A potent and selective P2Y 2 R antagonist is AR-C118925 (10-01). For studies of the P2Y 4 R, MRS4062 (3-15) may be used as a selective agonist, while PSB-16133 (10-06) represents a selective antagonist. Several potent P2Y 6 R agonists have been developed including 5-methoxyuridine 5'-O-((R p )α-boranodiphosphate) (6-12), PSB-0474 (3-11), and MRS2693 (3-26). The isocyanate MRS2578 (10-08) is used as a selective P2Y 6 R antagonist, although its reactivity and low water-solubility are limiting. With MRS2905 (6-08), a potent and metabolically stable P2Y 14 R agonist is available, while PPTN (10-14) represents a potent and selective P2Y 14 R antagonist. The radioligand [ 3 H]UDP can be used to label P2Y 14 Rs. In addition, several fluorescent probes have been developed. Uracil nucleotide-activated P2YRs show great potential as drug targets, especially in inflammation, cancer, cardiovascular and neurodegenerative diseases. Copyright © 2018. Published by Elsevier Inc.

The Nucleotide-Free State of the Multidrug Resistance ABC Transporter LmrA: Sulfhydryl Cross-Linking Supports a Constant Contact, Head-to-Tail Configuration of the Nucleotide-Binding Domains.

Directory of Open Access Journals (Sweden)

Peter M Jones

Full Text Available ABC transporters are integral membrane pumps that are responsible for the import or export of a diverse range of molecules across cell membranes. ABC transporters have been implicated in many phenomena of medical importance, including cystic fibrosis and multidrug resistance in humans. The molecular architecture of ABC transporters comprises two transmembrane domains and two ATP-binding cassettes, or nucleotide-binding domains (NBDs, which are highly conserved and contain motifs that are crucial to ATP binding and hydrolysis. Despite the improved clarity of recent structural, biophysical, and biochemical data, the seemingly simple process of ATP binding and hydrolysis remains controversial, with a major unresolved issue being whether the NBD protomers separate during the catalytic cycle. Here chemical cross-linking data is presented for the bacterial ABC multidrug resistance (MDR transporter LmrA. These indicate that in the absence of nucleotide or substrate, the NBDs come into contact to a significant extent, even at 4°C, where ATPase activity is abrogated. The data are clearly not in accord with an inward-closed conformation akin to that observed in a crystal structure of V. cholerae MsbA. Rather, they suggest a head-to-tail configuration 'sandwich' dimer similar to that observed in crystal structures of nucleotide-bound ABC NBDs. We argue the data are more readily reconciled with the notion that the NBDs are in proximity while undergoing intra-domain motions, than with an NBD 'Switch' mechanism in which the NBD monomers separate in between ATP hydrolysis cycles.

Factor 11 single-nucleotide variants in women with heavy menstrual bleeding

NARCIS (Netherlands)

Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene

2017-01-01

In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical

Nucleotide variation in ATHK1 region of Arabidopsis thaliana and its ...

African Journals Online (AJOL)

The ATHK1 gene in Arabidopsis encodes a putative histidine kinase that is transcriptionally upregulated in response to changes in external osmolarity. In this work, we investigated the nucleotide variability of the ATHK1 gene in a sample of 32 core Arabidopsis accessions originating from different ecoclimatic regions and ...

Synthesis and degradation of cyclic nucleotides in brain after a high dose of ionizing radiation

International Nuclear Information System (INIS)

Hunt, W.A.; Dalton, T.K.

1981-01-01

Previous data from our laboratory have indicated that a high dose of ionizing radiation can deplete the cyclic nucleotides guanosine 3',5'-cyclic monophosphate (cGMP) and adenosine 3',5'-cyclic monophosphate (cAMP) on several areas of the rat brain. cGMP is more sensitive to radiation than cAMP and does not recover for at least 24 h after irradiation. The response of cAMP is transient and recovery occurs within 4 h. The purpose of the present paper is to determine whether alternations in the activity of the synthetic and degradative enzymes that regulate cyclic nucleotide levels could account for the observed effects. Guanylate and adenylate cyclase and cGMP and cAMP phosphodiesterase activities were determined 10 min after irradiation with 10,000 rad of high-energy electrons. No alteration was detected under these experimental conditions. The data suggest that the reduction in cyclic nucleotides is not a direct effect on their metabolic enzymes and is probably secondary to some as yet-undefined action of radiation on the brain

Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

Directory of Open Access Journals (Sweden)

Cheng-Chong Chou

2004-11-01

Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

Preliminary safety analysis of the HTTR-IS nuclear hydrogen production system

International Nuclear Information System (INIS)

Sato, Hiroyuki; Ohashi, Hirofumi; Tazawa, Yujiro; Tachibana, Yukio; Sakaba, Nariaki

2010-06-01

Japan Atomic Energy Agency is planning to demonstrate hydrogen production by thermochemical water-splitting IS process utilizing heat from the high-temperature gas-cooled reactor HTTR (HTTR-IS system). The previous study identified that the HTTR modification due to the coupling of hydrogen production plant requires an additional safety review since the scenario and quantitative values of the evaluation items would be altered from the original HTTR safety review. Hence, preliminary safety analyses are conducted by using the system analysis code. Calculation results showed that evaluation items such as a coolant pressure, temperatures of heat transfer tubes at the pressure boundary, etc., did not exceed allowable values. Also, the peak fuel temperature did not exceed allowable value and therefore the reactor core was not damaged and cooled sufficiently. This report compiles calculation conditions, event scenarios and the calculation results of the preliminary safety analysis. (author)

Identification of a novel BRCA1 nucleotide 4803delCC/c.4684delCC mutation and a nucleotide 249T>A/c.130T>A (p.Cys44Ser) mutation in two Greenlandic Inuit families

DEFF Research Database (Denmark)

Hansen, Thomas van Overeem; Jønson, Lars; Albrechtsen, Anders

2010-01-01

Germ-line mutations in the tumour suppressor proteins BRCA1 and BRCA2 predispose to breast and ovarian cancer. We have recently identified a Greenlandic Inuit BRCA1 nucleotide 234T>G/c.115T>G (p.Cys39Gly) founder mutation, which at that time was the only disease-causing BRCA1/BRCA2 mutation...... identified in this population. Here, we describe the identification of a novel disease-causing BRCA1 nucleotide 4803delCC/c.4684delCC mutation in a Greenlandic Inuit with ovarian cancer. The mutation introduces a frameshift and a premature stop at codon 1572. We have also identified a BRCA1 nucleotide 249T......>A/c.130T>A (p.Cys44Ser) mutation in another Greenlandic individual with ovarian cancer. This patient share a 1-2 Mb genomic fragment, containing the BRCA1 gene, with four Danish families harbouring the same mutation, suggesting that the 249T>A/c.130T>A (p.Cys44Ser) mutation originates from a Danish...

The first 3':5'-cyclic nucleotide-amino acid complex: L-His-cIMP.

Science.gov (United States)

Slepokura, Katarzyna

2012-08-01

In the crystal structure of the L-His-cIMP complex, i.e. L-histidinium inosine 3':5'-cyclic phosphate [systematic name: 5-(2-amino-2-carboxyethyl)-1H-imidazol-3-ium 7-hydroxy-2-oxo-6-(6-oxo-6,9-dihydro-1H-purin-9-yl)-4a,6,7,7a-tetrahydro-4H-1,3,5,2λ(5)-furo[3,2-d][1,3,2λ(5)]dioxaphosphinin-2-olate], C(6)H(10)N(3)O(2)(+)·C(10)H(10)N(4)O(7)P(-), the Hoogsteen edge of the hypoxanthine (Hyp) base of cIMP and the Hyp face are engaged in specific amino acid-nucleotide (His···cIMP) recognition, i.e. by abutting edge-to-edge and by π-π stacking, respectively. The Watson-Crick edge of Hyp and the cIMP phosphate group play a role in nonspecific His···cIMP contacts. The interactions between the cIMP anions (anti/C3'-endo/trans-gauche/chair conformers) are realized mainly between riboses and phosphate groups. The results for this L-His-cIMP complex, compared with those for the previously reported solvated L-His-IMP crystal structure, indicate a different nature of amino acid-nucleotide recognition and interactions upon the 3':5'-cyclization of the nucleotide phosphate group.

Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes

Directory of Open Access Journals (Sweden)

McGuire Patrick E

2010-12-01

Full Text Available Abstract Background A genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into their respective genomes. The same requirements complicate the development and deployment of single nucleotide polymorphism (SNP markers in polyploid species. We report here a strategy that satisfies these requirements and deploy it in the sequencing of genes in cultivated hexaploid wheat (Triticum aestivum, genomes AABBDD and wild tetraploid wheat (Triticum turgidum ssp. dicoccoides, genomes AABB from the putative site of wheat domestication in Turkey. Data are used to assess the distribution of diversity among and within wheat genomes and to develop a panel of SNP markers for polyploid wheat. Results Nucleotide diversity was estimated in 2114 wheat genes and was similar between the A and B genomes and reduced in the D genome. Within a genome, diversity was diminished on some chromosomes. Low diversity was always accompanied by an excess of rare alleles. A total of 5,471 SNPs was discovered in 1791 wheat genes. Totals of 1,271, 1,218, and 2,203 SNPs were discovered in 488, 463, and 641 genes of wheat putative diploid ancestors, T. urartu, Aegilops speltoides, and Ae. tauschii, respectively. A public database containing genome-specific primers, SNPs, and other information was constructed. A total of 987 genes with nucleotide diversity estimated in one or more of the wheat genomes was placed on an Ae. tauschii genetic map, and the map was superimposed on wheat deletion-bin maps. The agreement between the maps was assessed. Conclusions In a young polyploid, exemplified by T. aestivum, ancestral species are the primary source of genetic diversity. Low effective recombination due to self-pollination and a genetic mechanism precluding homoeologous chromosome pairing during polyploid meiosis can lead to the loss of diversity from large

Regulatory analyses for severe accident issues: an example

International Nuclear Information System (INIS)

Burke, R.P.; Strip, D.R.; Aldrich, D.C.

1984-09-01

This report presents the results of an effort to develop a regulatory analysis methodology and presentation format to provide information for regulatory decision-making related to severe accident issues. Insights and conclusions gained from an example analysis are presented. The example analysis draws upon information generated in several previous and current NRC research programs (the Severe Accident Risk Reduction Program (SARRP), Accident Sequence Evaluation Program (ASEP), Value-Impact Handbook, Economic Risk Analyses, and studies of Vented Containment Systems and Alternative Decay Heat Removal Systems) to perform preliminary value-impact analyses on the installation of either a vented containment system or an alternative decay heat removal system at the Peach Bottom No. 2 plant. The results presented in this report are first-cut estimates, and are presented only for illustrative purposes in the context of this document. This study should serve to focus discussion on issues relating to the type of information, the appropriate level of detail, and the presentation format which would make a regulatory analysis most useful in the decisionmaking process

Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

Science.gov (United States)

Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

2017-12-01

The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

Directory of Open Access Journals (Sweden)

Ian R Kelsall

Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

African Journals Online (AJOL)

Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

Slow spontaneous [Ca2+]i oscillations reflect nucleotide release from renal epithelia

DEFF Research Database (Denmark)

Geyti, Christine Stride; Odgaard, Elvin V. P.; Overgaard, Morten Thaarup

2008-01-01

Renal epithelia can be provoked mechanically to release nucleotides, which subsequently increases the intracellular Ca(2+) concentration [Ca(2+)](i) through activation of purinergic (P2) receptors. Cultured cells often show spontaneous [Ca(2+)](i) oscillations, a feature suggested to involve nucl...

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

International Nuclear Information System (INIS)

Lo, A.; Yang, H.L.

1990-01-01

This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

Regulation of nucleotide excision repair through ubiquitination

Institute of Scientific and Technical Information of China (English)

Jia Li; Audesh Bhat; Wei Xiao

2011-01-01

Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

Stable isotope variations in benthic primary producers along the Bosphorus (Turkey): A preliminary study

International Nuclear Information System (INIS)

Calizza, Edoardo; Aktan, Yelda; Costantini, Maria Letizia; Rossi, Loreto

2015-01-01

Highlights: • Nitrogen pollution along the Bosphorus Strait was investigated. • C and N isotopic and elemental analyses on benthic primary producers were performed. • δ 15 N decreased, while δ 13 C and N% increased from north to south along the Strait. • Ulva lactuca was more useful than epiphytes as indicator of nitrogen pollution. • Preliminary isotopic analyses on resident organisms are useful monitoring tools. - Abstract: The Bosphorus Strait is a dynamic and complex system. Recent evidences showed nitrogen and heavy metal concentrations to follow opposite patterns across the Strait, suggesting a complex spatial organisation of the anthropogenic disturbance in this system. Here, we provide isotopic information on the origin and transportation of dissolved nitrogen along the Bosphorus. C and N isotopic and elemental analyses were performed on specimens of Ulva lactuca and associated epiphytes sampled in five locations across the Strait. Variations in C and N isotopic signatures were observed in U. lactuca, pointing to a decrease in the availability of anthropogenic organic dissolved nitrogen along a north-south direction. Conversely, epiphytes did not show isotopic or elemental patterns across the Strait. These results suggest that preliminary stable isotope surveys in extended costal systems basing on U. lactuca can represent a valuable tool to focus meaningful targets and hypotheses for pollution studies in the Mediterranean region

The single-nucleotide polymorphisms in CHD5 affect the prognosis of patients with hepatocellular carcinoma

Science.gov (United States)

Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui

2018-01-01

Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352

Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

Science.gov (United States)

Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

2010-12-01

Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

The Role of Vitamin D Level and Related Single Nucleotide Polymorphisms in Crohn’s Disease

Directory of Open Access Journals (Sweden)

Wen J. Lam

2013-09-01

Full Text Available New Zealand has one of the highest rates of Crohn’s Disease (CD in the world, and there is much speculation as to why this might be. A high risk of CD has been associated with deficient or insufficient levels of Vitamin D (Vit D, lifestyle as well as various genetic polymorphisms. In this study we sought to analyse the relevance of serum Vit D levels, lifestyle and genotype to CD status. Serum samples were analysed for 25-OH-Vitamin D levels. DNA was isolated from blood and cheek-swabs, and Sequenom and ImmunoChip techniques were used for genotyping. Serum Vit D levels were significantly lower in CD patients (mean = 49.5 mg/L than those found in controls (mean = 58.9 mg/L, p = 4.74 × 10−6. A total of seven single nucleotide polymorphisms were examined for effects on serum Vit D levels, with adjustment for confounding variables. Two variants: rs731236[A] (VDR and rs732594[A] (SCUBE3 showed a significant association with serum Vit D levels in CD patients. Four variants: rs7975232[A] (VDR, rs732594[A] (SCUBE3, and rs2980[T] and rs2981[A] (PHF-11 showed a significant association with serum Vit D levels in the control group. This study demonstrates a significant interaction between Vit D levels and CD susceptibility, as well as a significant association between Vit D levels and genotype.

FY01 Supplemental Science and Performance Analyses, Volume 1: Scientific Bases and Analyses, Part 1 and 2

International Nuclear Information System (INIS)

Dobson, David

2001-01-01

The U.S. Department of Energy (DOE) is considering the possible recommendation of a site at Yucca Mountain, Nevada, for development as a geologic repository for the disposal of high-level radioactive waste and spent nuclear fuel. To facilitate public review and comment, in May 2001 the DOE released the Yucca Mountain Science and Engineering Report (S and ER) (DOE 2001 [DIRS 153849]), which presents technical information supporting the consideration of the possible site recommendation. The report summarizes the results of more than 20 years of scientific and engineering studies. A decision to recommend the site has not been made: the DOE has provided the S and ER and its supporting documents as an aid to the public in formulating comments on the possible recommendation. When the S and ER (DOE 2001 [DIRS 153849]) was released, the DOE acknowledged that technical and scientific analyses of the site were ongoing. Therefore, the DOE noted in the Federal Register Notice accompanying the report (66 FR 23 013 [DIRS 155009], p. 2) that additional technical information would be released before the dates, locations, and times for public hearings on the possible recommendation were announced. This information includes: (1) the results of additional technical studies of a potential repository at Yucca Mountain, contained in this FY01 Supplemental Science and Performance Analyses: Vol. 1, Scientific Bases and Analyses; and FY01 Supplemental Science and Performance Analyses: Vol. 2, Performance Analyses (McNeish 2001 [DIRS 155023]) (collectively referred to as the SSPA) and (2) a preliminary evaluation of the Yucca Mountain site's preclosure and postclosure performance against the DOE's proposed site suitability guidelines (10 CFR Part 963 [64 FR 67054] [DIRS 124754]). By making the large amount of information developed on Yucca Mountain available in stages, the DOE intends to provide the public and interested parties with time to review the available materials and to formulate

Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

Science.gov (United States)

Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

2015-03-04

Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

PRELIMINARY FACTOR ANALYSIS OF VISUAL COGNITION AND MEMORY. STUDIES IN CINE-PSYCHOMETRY, FINAL REPORT, PART I.

Science.gov (United States)

SEIBERT, WARREN F.; AND OTHERS

PRELIMINARY ANALYSES WERE UNDERTAKEN TO DETERMINE THE POTENTIAL CONTRIBUTION OF MOTION PICTURE FILMS TO FACTOR ANALYTIC STUDIES OF HUMAN INTELLECT. OF PRIMARY CONCERN WERE THE OPERATIONS OF COGNITION AND MEMORY, FORMING TWO OF THE FIVE OPERATION COLUMNS OF GUILFORD'S "STRUCTURE OF INTELLECT." THE CORE REFERENCE FOR THE STUDY WAS DEFINED…

An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

Directory of Open Access Journals (Sweden)

Tautz Diethard

2002-03-01

Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

Single nucleotide polymorphism isolated from a novel EST dataset in garden asparagus (Asparagus officinalis L.).

Science.gov (United States)

Mercati, Francesco; Riccardi, Paolo; Leebens-Mack, Jim; Abenavoli, Maria Rosa; Falavigna, Agostino; Sunseri, Francesco

2013-04-01

Single nucleotide polymorphisms (SNPs) and simple sequence repeats (SSR) are abundant and evenly distributed co-dominant molecular markers in plant genomes. SSRs are valuable for marker assisted breeding and positional cloning of genes associated traits of interest. Although several high throughput platforms have been developed to identify SNP and SSR markers for analysis of segregant plant populations, breeding in garden asparagus (Asparagus officinalis L.) has been limited by a low content of such markers. In this study massively parallel GS-FLX pyro-sequencing technology (454 Life Sciences) has been used to sequence and compare transcriptome from two genotypes: a rust tolerant male (1770) and a susceptible female (G190). A total of 122,963 and 99,368 sequence reads, with an average length of 245.7bp, have been recovered from accessions 1770 and 190 respectively. A computational pipeline has been used to predict and visually inspect putative SNPs and SSR sequences. Analysis of Gene Ontology (GO) slim annotation assignments for all assembled uniscripts indicated that the 24,403 assemblies represent genes from a broad array of functions. Further, over 1800 putative SNPs and 1000 SSRs were detected. One hundred forty-four SNPs together with 60 selected SSRs were validated and used to develop a preliminary genetic map by using a large BC(1) population, derived from 1770 and G190. The abundance of SNPs and SSRs provides a foundation for the development of saturated genetic maps and their utilization in assisted asparagus breeding programs. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Univariate and multiple linear regression analyses for 23 single nucleotide polymorphisms in 14 genes predisposing to chronic glomerular diseases and IgA nephropathy in Han Chinese.

Science.gov (United States)

Wang, Hui; Sui, Weiguo; Xue, Wen; Wu, Junyong; Chen, Jiejing; Dai, Yong

2014-09-01

Immunoglobulin A nephropathy (IgAN) is a complex trait regulated by the interaction among multiple physiologic regulatory systems and probably involving numerous genes, which leads to inconsistent findings in genetic studies. One possibility of failure to replicate some single-locus results is that the underlying genetics of IgAN nephropathy is based on multiple genes with minor effects. To learn the association between 23 single nucleotide polymorphisms (SNPs) in 14 genes predisposing to chronic glomerular diseases and IgAN in Han males, the 23 SNPs genotypes of 21 Han males were detected and analyzed with a BaiO gene chip, and their associations were analyzed with univariate analysis and multiple linear regression analysis. Analysis showed that CTLA4 rs231726 and CR2 rs1048971 revealed a significant association with IgAN. These findings support the multi-gene nature of the etiology of IgAN and propose a potential gene-gene interactive model for future studies.

Iron from haemoglobin and haemin modulates nucleotide hydrolysis in Trichomonas vaginalis.

Science.gov (United States)

Vieira, Patrícia de Brum; Silva, Nícolas Luiz Feijó; Kist, Luiza Wilges; Oliveira, Giovanna Medeiros Tavares de; Bogo, Maurício Reis; Carli, Geraldo Atillio de; Macedo, Alexandre José; Tasca, Tiana

2015-04-01

Extracellular ATP may act as a danger signalling molecule, inducing inflammation and immune responses in infection sites. The ectonucleotidases NTPDase and ecto-5'-nucleotidase are enzymes that modulate extracellular nucleotide levels; these enzymes have been previously characterised in Trichomonas vaginalis. Iron plays an important role in the complex trichomonal pathogenesis. Herein, the effects of iron on growth, nucleotide hydrolysis and NTPDase gene expression in T. vaginalis isolates from female and male patients were evaluated. Iron from different sources sustained T. vaginalis growth. Importantly, iron from haemoglobin (HB) and haemin (HM) enhanced NTPDase activity in isolates from female patients and conversely reduced the enzyme activity in isolates from male patients. Iron treatments could not alter the NTPDase transcript levels in T. vaginalis. Furthermore, our results reveal a distinct ATP, ADP and AMP hydrolysis profile between isolates from female and male patients influenced by iron from HB and HM. Our data indicate the participation of NTPDase and ecto-5'-nucleotidase in the establishment of trichomonas infection through ATP degradation and adenosine production influenced by iron.

Iron from haemoglobin and haemin modulates nucleotide hydrolysis in Trichomonas vaginalis

Directory of Open Access Journals (Sweden)

Patrícia de Brum Vieira

2015-04-01

Full Text Available Extracellular ATP may act as a danger signalling molecule, inducing inflammation and immune responses in infection sites. The ectonucleotidases NTPDase and ecto-5’-nucleotidase are enzymes that modulate extracellular nucleotide levels; these enzymes have been previously characterised in Trichomonas vaginalis. Iron plays an important role in the complex trichomonal pathogenesis. Herein, the effects of iron on growth, nucleotide hydrolysis and NTPDase gene expression in T. vaginalis isolates from female and male patients were evaluated. Iron from different sources sustained T. vaginalis growth. Importantly, iron from haemoglobin (HB and haemin (HM enhanced NTPDase activity in isolates from female patients and conversely reduced the enzyme activity in isolates from male patients. Iron treatments could not alter the NTPDase transcript levels in T. vaginalis. Furthermore, our results reveal a distinct ATP, ADP and AMP hydrolysis profile between isolates from female and male patients influenced by iron from HB and HM. Our data indicate the participation of NTPDase and ecto-5’-nucleotidase in the establishment of trichomonas infection through ATP degradation and adenosine production influenced by iron.

Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

OpenAIRE

Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

2009-01-01

We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

Science.gov (United States)

Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

2013-01-01

Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

Science.gov (United States)

Chen, Sherry Xi; Seelig, Georg

2016-04-20

Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

Science.gov (United States)

Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

2017-01-01

Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

Science.gov (United States)

Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

2011-12-01

Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Biosynthesis of a hypermodified nucleotide in Saccharomyces carlsbergensis 17S and HeLa-cell 18S ribosomal ribonucleic acid.

Science.gov (United States)

Brand, R C; Klootwijk, J; Planta, R J; Maden, B E

1978-01-01

The biosynthesis of a hypermodified nucleotide, similar to or identical with 3-(3-amino-3-carboxypropyl)-1-methylpseudouridine monophosphate, present in Saccharomyces carlsbergensis 17S and HeLa-cell 18S rRNA, was investigated with respect to the sequence of reactions required for synthesis and their timing in ribosome maturation. In both yeast and HeLa cells methylation precedes attachment of the 3-amino-3-carboxypropyl group. In yeast the methylated precursor nucleotide was tentatively characterized as 1-methylpseudouridine. This precursor nucleotide was demonstrated in both 37S and most of the cytoplasmic 18S pre-rRNA (rRNA precursor) molecules. The synthesis of the hypermodified nucleotide is completed just before the final cleavage of 18S pre-rRNA to give 17S rRNA, so that the final addition of the 3-amino-3-carboxypropyl group is a cytoplasmic event. Comparable experiments with HeLa cells indicated that formation of 1-methylpseudouridine occurs at the level of 45S RNA and addition of the 3-amino-3-carboxypropyl group occurs in the cytoplasm on newly synthesized 18S RNA.

Whole genome sequencing analyses of Listeria monocytogenes that persisted in a milkshake machine for a year and caused illnesses in Washington State

OpenAIRE

Li, Zhen; P?rez-Osorio, Ailyn; Wang, Yu; Eckmann, Kaye; Glover, William A.; Allard, Marc W.; Brown, Eric W.; Chen, Yi

2017-01-01

Background In 2015, in addition to a United States multistate outbreak linked to contaminated ice cream, another outbreak linked to ice cream was reported in the Pacific Northwest of the United States. It was a hospital-acquired outbreak linked to milkshakes, made from contaminated ice cream mixes and milkshake maker, served to patients. Here we performed multiple analyses on isolates associated with this outbreak: pulsed-field gel electrophoresis (PFGE), whole genome single nucleotide polymo...

BIPS-FS preliminary design, miscellaneous notes

International Nuclear Information System (INIS)

1976-01-01

A compendium of flight system preliminary design internal memos and progress report extracts for the Brayton Isotope Power System Preliminary Design Review to be held July 20, 21, and 22, 1975 is presented. The purpose is to bring together those published items which relate only to the preliminary design of the Flight System, Task 2 of Phase I. This preliminary design effort was required to ensure that the Ground Demonstration System will represent the Flight System as closely as possible

Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types

Directory of Open Access Journals (Sweden)

Stefania Dall'Olio

2010-01-01

Full Text Available Myostatin (MSTN is a negative modulator of muscle mass. We characterized the horse (Equus caballus MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type than in light breeds (dolichomorphic type such as Italian Trotter breed. The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds.

Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types

Science.gov (United States)

Dall'Olio, Stefania; Fontanesi, Luca; Nanni Costa, Leonardo; Tassinari, Marco; Minieri, Laura; Falaschini, Adalberto

2010-01-01

Myostatin (MSTN) is a negative modulator of muscle mass. We characterized the horse (Equus caballus) MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs) in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif) were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type) than in light breeds (dolichomorphic type such as Italian Trotter breed). The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA) on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds. PMID:20706663

45 CFR 150.217 - Preliminary determination.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Preliminary determination. 150.217 Section 150.217... Are Failing To Substantially Enforce HIPAA Requirements § 150.217 Preliminary determination. If, at... designees). (b) Notifies the State of CMS's preliminary determination that the State has failed to...

Calcium-dependent, cyclic nucleotide-independent steroidogenesis in the bovine placenta.

OpenAIRE

Shemesh, M; Hansel, W; Strauss, J F

1984-01-01

Dispersed bovine placental cells (fetal cotyledon and maternal caruncle) were shown to synthesize progesterone. To determine if their steroidogenic activity could be modulated by a cyclic nucleotide-mediated process, we added luteinizing hormone, 8-bromoadenosine 3',5'-monophosphate, 8-bromoguanosine 3',5'-monophosphate, adenosine, or cholera toxin to dispersed cells from placentomes of 100-283 days gestational age and examined progesterone synthesis during 3-to 16-hr incubation periods. Net ...

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

Energy Technology Data Exchange (ETDEWEB)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

Second preliminary design of JAERI experimental fusion reactor (JXFR)

International Nuclear Information System (INIS)

Sako, Kiyoshi; Tone, Tatsuzo; Seki, Yasushi; Iida, Hiromasa; Yamato, Harumi

1979-06-01

Second preliminary design of a tokamak experimental fusion reactor to be built in the near future has been performed. This design covers overall reactor system including plasma characteristics, reactor structure, blanket neutronics radiation shielding, superconducting magnets, neutral beam injector, electric power supply system, fuel recirculating system, reactor cooling and tritium recovery systems and maintenance scheme. Safety analyses of the reactor system have been also performed. This paper gives a brief description of the design as of January, 1979. The feasibility study of raising the power density has been also studied and is shown as appendix. (author)

Plasma Membrane-Located Purine Nucleotide Transport Proteins Are Key Components for Host Exploitation by Microsporidian Intracellular Parasites

Science.gov (United States)

Heinz, Eva; Hacker, Christian; Dean, Paul; Mifsud, John; Goldberg, Alina V.; Williams, Tom A.; Nakjang, Sirintra; Gregory, Alison; Hirt, Robert P.; Lucocq, John M.; Kunji, Edmund R. S.; Embley, T. Martin

2014-01-01

Microsporidia are obligate intracellular parasites of most animal groups including humans, but despite their significant economic and medical importance there are major gaps in our understanding of how they exploit infected host cells. We have investigated the evolution, cellular locations and substrate specificities of a family of nucleotide transport (NTT) proteins from Trachipleistophora hominis, a microsporidian isolated from an HIV/AIDS patient. Transport proteins are critical to microsporidian success because they compensate for the dramatic loss of metabolic pathways that is a hallmark of the group. Our data demonstrate that the use of plasma membrane-located nucleotide transport proteins (NTT) is a key strategy adopted by microsporidians to exploit host cells. Acquisition of an ancestral transporter gene at the base of the microsporidian radiation was followed by lineage-specific events of gene duplication, which in the case of T. hominis has generated four paralogous NTT transporters. All four T. hominis NTT proteins are located predominantly to the plasma membrane of replicating intracellular cells where they can mediate transport at the host-parasite interface. In contrast to published data for Encephalitozoon cuniculi, we found no evidence for the location for any of the T. hominis NTT transporters to its minimal mitochondria (mitosomes), consistent with lineage-specific differences in transporter and mitosome evolution. All of the T. hominis NTTs transported radiolabelled purine nucleotides (ATP, ADP, GTP and GDP) when expressed in Escherichia coli, but did not transport radiolabelled pyrimidine nucleotides. Genome analysis suggests that imported purine nucleotides could be used by T. hominis to make all of the critical purine-based building-blocks for DNA and RNA biosynthesis during parasite intracellular replication, as well as providing essential energy for parasite cellular metabolism and protein synthesis. PMID:25474405

Highly significant association between two common single nucleotide polymorphisms in CORIN gene and preeclampsia in Caucasian women.

Directory of Open Access Journals (Sweden)

Alain Stepanian

Full Text Available Preeclampsia is a frequent medical complication during pregnancy. Corin, a serine protease which activates pro-atrial natriuretic peptide, has recently been shown to be involved in the pathophysiology of preeclampsia. The aim of this study was to search for CORIN gene variations and their association to preeclampsia in Caucasian and African women. Our study population was composed of 571 pregnant women (295 with preeclampsia and 276 normotensive controls matched for maternal and gestational age, and ethnic origin. The 22 exons of the CORIN gene were sequenced in a discovery sample (n = 260, where 31 single nucleotide polymorphisms were identified. In a replication sample (n = 311, 4 single nucleotide polymorphisms were tested. Two minor alleles (C for rs2271036 and G for rs2271037 were significantly associated to preeclampsia. Adjusted odds ratios [95% confidence interval] were 2.5 [1.2-3.8] (p = 0.007 and 2.3 [1.5-3.5] (p = 1.3 × 10(-4, respectively. These associations were ethnic-specific, as only found in the Caucasian of subjects (odds ratio = 3.5 [1.8-6.6], p = 1.1 × 10(-4; odds ratio = 3.1 [1.7-5.8], p = 2.1 × 10(-4, for each single nucleotide polymorphism, respectively. The two single nucleotide polymorphisms are in almost perfect linkage disequilibrium (r(2 = 0.93. No specific association was found with severe preeclampsia, early-onset preeclampsia nor fetal growth retardation. In conclusion, this is the first report of a highly significant association between these two single nucleotide polymorphisms in CORIN gene and preeclampsia. Our findings further support the probability of a critical role of corin in preeclamspia pathophysiology at the uteroplacental interface.

Plasma membrane-located purine nucleotide transport proteins are key components for host exploitation by microsporidian intracellular parasites.

Directory of Open Access Journals (Sweden)

Eva Heinz

2014-12-01

Full Text Available Microsporidia are obligate intracellular parasites of most animal groups including humans, but despite their significant economic and medical importance there are major gaps in our understanding of how they exploit infected host cells. We have investigated the evolution, cellular locations and substrate specificities of a family of nucleotide transport (NTT proteins from Trachipleistophora hominis, a microsporidian isolated from an HIV/AIDS patient. Transport proteins are critical to microsporidian success because they compensate for the dramatic loss of metabolic pathways that is a hallmark of the group. Our data demonstrate that the use of plasma membrane-located nucleotide transport proteins (NTT is a key strategy adopted by microsporidians to exploit host cells. Acquisition of an ancestral transporter gene at the base of the microsporidian radiation was followed by lineage-specific events of gene duplication, which in the case of T. hominis has generated four paralogous NTT transporters. All four T. hominis NTT proteins are located predominantly to the plasma membrane of replicating intracellular cells where they can mediate transport at the host-parasite interface. In contrast to published data for Encephalitozoon cuniculi, we found no evidence for the location for any of the T. hominis NTT transporters to its minimal mitochondria (mitosomes, consistent with lineage-specific differences in transporter and mitosome evolution. All of the T. hominis NTTs transported radiolabelled purine nucleotides (ATP, ADP, GTP and GDP when expressed in Escherichia coli, but did not transport radiolabelled pyrimidine nucleotides. Genome analysis suggests that imported purine nucleotides could be used by T. hominis to make all of the critical purine-based building-blocks for DNA and RNA biosynthesis during parasite intracellular replication, as well as providing essential energy for parasite cellular metabolism and protein synthesis.

Myotonic Dystrophy Type 1 RNA Crystal Structures Reveal Heterogeneous 1 × 1 Nucleotide UU Internal Loop Conformations

Energy Technology Data Exchange (ETDEWEB)

Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D. (Scripps)

2012-03-27

RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.

Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

DEFF Research Database (Denmark)

Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas

2013-01-01

The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...

Nucleotide composition of the Zika virus RNA genome and its codon usage

NARCIS (Netherlands)

van Hemert, Formijn; Berkhout, Ben

2016-01-01

RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

Synthesis of Benzene and Pyridine 2-C-Methyl-C-ribonucleosides and -nucleotides

Czech Academy of Sciences Publication Activity Database

Tokarenko, Anna; Poštová Slavětínská, Lenka; Klepetářová, Blanka; Hocek, Michal

2015-01-01

Roč. 2015, č. 36 (2015), s. 7962-7983 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * glycosides * antiviral agents * cross - coupling Subject RIV: CC - Organic Chemistry Impact factor: 3.068, year: 2015

Effects of luminal flow and nucleotides on [Ca(2+)](i) in rabbit cortical collecting duct.

Science.gov (United States)

Woda, Craig B; Leite, Maurilo; Rohatgi, Rajeev; Satlin, Lisa M

2002-09-01

Nucleotide binding to purinergic P2 receptors contributes to the regulation of a variety of physiological functions in renal epithelial cells. Whereas P2 receptors have been functionally identified at the basolateral membrane of the cortical collecting duct (CCD), a final regulatory site of urinary Na(+), K(+), and acid-base excretion, controversy exists as to whether apical purinoceptors exist in this segment. Nor has the distribution of receptor subtypes present on the unique cell populations that constitute Ca(2+) the CCD been established. To examine this, we measured nucleotide-induced changes in intracellular Ca(2+) concentration ([Ca(2+)](i)) in fura 2-loaded rabbit CCDs microperfused in vitro. Resting [Ca(2+)](i) did not differ between principal and intercalated cells, averaging approximately 120 nM. An acute increase in tubular fluid flow rate, associated with a 20% increase in tubular diameter, led to increases in [Ca(2+)](i) in both cell types. Luminal perfusion of 100 microM UTP or ATP-gamma-S, in the absence of change in flow rate, caused a rapid and transient approximately fourfold increase in [Ca(2+)](i) in both cell types (P < 0.05). Luminal suramin, a nonspecific P2 receptor antagonist, blocked the nucleotide- but not flow-induced [Ca(2+)](i) transients. Luminal perfusion with a P2X (alpha,beta-methylene-ATP), P2X(7) (benzoyl-benzoyl-ATP), P2Y(1) (2-methylthio-ATP), or P2Y(4)/P2Y(6) (UDP) receptor agonist had no effect on [Ca(2+)](i). The nucleotide-induced [Ca(2+)](i) transients were inhibited by the inositol-1,4,5-triphosphate receptor blocker 2-aminoethoxydiphenyl borate, thapsigargin, which depletes internal Ca(2+) stores, luminal perfusion with a Ca(2+)-free perfusate, or the L-type Ca(2+) channel blocker nifedipine. These results suggest that luminal nucleotides activate apical P2Y(2) receptors in the CCD via pathways that require both internal Ca(2+) mobilization and extracellular Ca(2+) entry. The flow-induced rise in [Ca(2+)](i) is

Crystallization, diffraction data collection and preliminary crystallographic analysis of DING protein from Pseudomonas fluorescens

International Nuclear Information System (INIS)

Moniot, Sebastien; Elias, Mikael; Kim, Donghyo; Scott, Ken; Chabriere, Eric

2007-01-01

Crystallization of DING protein from P. fluorescens is reported. A complete data set was collected to 1.43 Å resolution. PfluDING is a phosphate-binding protein expressed in Pseudomonas fluorescens. This protein is clearly distinct from the bacterial ABC transporter soluble phosphate-binding protein PstS and is more homologous to eukaryotic DING proteins. Interestingly, bacterial DING proteins have only been detected in certain Pseudomonas species. Although DING proteins seem to be ubiquitous in eukaryotes, they are systematically absent from eukaryotic genomic databases and thus are still quite mysterious and poorly characterized. PfluDING displays mitogenic activity towards human cells and binds various ligands such as inorganic phosphate, pyrophosphate, nucleotide triphosphates and cotinine. Here, the crystallization of PfluDING is reported in a monoclinic space group (P2 1 ), with typical unit-cell parameters a = 36.7, b = 123.7, c = 40.8 Å, α = 90, β = 116.7, γ = 90°. Preliminary crystallographic analysis reveals good diffraction quality for these crystals and a 1.43 Å resolution data set has been collected

Yersinia Virulence Depends on Mimicry of Host Rho-Family Nucleotide Dissociation Inhibitors

Energy Technology Data Exchange (ETDEWEB)

Prehna,G.; Ivanov, M.; Blisha, J.; Stebbins, C.

2006-01-01

Yersinia spp. cause gastroenteritis and the plague, representing historically devastating pathogens that are currently an important biodefense and antibiotic resistance concern. A critical virulence determinant is the Yersinia protein kinase A, or YpkA, a multidomain protein that disrupts the eukaryotic actin cytoskeleton. Here we solve the crystal structure of a YpkA-Rac1 complex and find that YpkA possesses a Rac1 binding domain that mimics host guanidine nucleotide dissociation inhibitors (GDIs) of the Rho GTPases. YpkA inhibits nucleotide exchange in Rac1 and RhoA, and mutations that disrupt the YpkA-GTPase interface abolish this activity in vitro and impair in vivo YpkA-induced cytoskeletal disruption. In cell culture experiments, the kinase and the GDI domains of YpkA act synergistically to promote cytoskeletal disruption, and a Y. pseudotuberculosis mutant lacking YpkA GDI activity shows attenuated virulence in a mouse infection assay. We conclude that virulence in Yersinia depends strongly upon mimicry of host GDI proteins by YpkA.

Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

Science.gov (United States)

Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

2013-07-01

Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Stress-induced and cue-induced craving for alcohol in heavy drinkers: Preliminary evidence of genetic moderation by the OPRM1 and CRH-BP genes.

Science.gov (United States)

Ray, Lara A

2011-01-01

Neurobiological theories of addiction have highlighted disruption in stress pathways as a central feature of addictive disorders, and pharmacological treatments targeting stress mechanisms hold great promise. This study examines genetic determinants of stress-induced and cue-induced craving in heavy drinkers by testing single-nucleotide polymorphisms (SNPs) of the corticotrophin-releasing hormone binding protein (CRH-BP) gene and the mu-opioid receptor (OPRM1) gene. This study combines guided imagery stress exposure and in vivo alcohol cue exposure in a sample of 64 (23 women) non-treatment-seeking heavy drinkers. Analyses, uncorrected for multiple comparisons, revealed that a tag SNP of the CRH-BP gene (rs10055255) moderated stress-induced craving in this sample. The same SNP predicted greater affective responses to the stress manipulation, including greater levels of subjective tension and negative mood. The Asp40 allele of the OPRM1 was associated with greater cue-induced alcohol craving following the neutral imagery condition. These initial results extend recent preclinical and clinical findings implicating the CRH-BP in stress-related alcoholism and confirm the role of the Asp40 allele of the OPRM1 gene in reward-driven alcohol phenotypes. Human laboratory models of stress and cue-induced craving may be useful in pharmacotherapy development targeting dysregulation of stress systems. Larger studies are needed to validate these preliminary findings, which should also be extended to clinical samples. Copyright © 2010 by the Research Society on Alcoholism.

Exploratory shaft facility preliminary designs - Permian Basin

International Nuclear Information System (INIS)

1983-09-01

The purpose of the Preliminary Design Report, Permian Basin, is to provide a description of the preliminary design for an Exploratory Shaft Facility in the Permian Basin, Texas. This issue of the report describes the preliminary design for constructing the exploratory shaft using the Large Hole Drilling method of construction and outlines the preliminary design and estimates of probable construction cost. The Preliminary Design Report is prepared to complement and summarize other documents that comprise the design at the preliminary stage of completion, December 1982. Other design documents include drawings, cost estimates and schedules. The preliminary design drawing package, which includes the construction schedule drawing, depicts the descriptions in this report. For reference, a list of the drawing titles and corresponding numbers are included in the Appendix. The report is divided into three principal sections: Design Basis, Facility Description, and Construction Cost Estimate. 30 references, 13 tables

Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

Directory of Open Access Journals (Sweden)

Ahamad Salamian

2008-01-01

Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

Genome-wide DNA polymorphism analyses using VariScan

Directory of Open Access Journals (Sweden)

Vilella Albert J

2006-09-01

Full Text Available Abstract Background DNA sequence polymorphisms analysis can provide valuable information on the evolutionary forces shaping nucleotide variation, and provides an insight into the functional significance of genomic regions. The recent ongoing genome projects will radically improve our capabilities to detect specific genomic regions shaped by natural selection. Current available methods and software, however, are unsatisfactory for such genome-wide analysis. Results We have developed methods for the analysis of DNA sequence polymorphisms at the genome-wide scale. These methods, which have been tested on a coalescent-simulated and actual data files from mouse and human, have been implemented in the VariScan software package version 2.0. Additionally, we have also incorporated a graphical-user interface. The main features of this software are: i exhaustive population-genetic analyses including those based on the coalescent theory; ii analysis adapted to the shallow data generated by the high-throughput genome projects; iii use of genome annotations to conduct a comprehensive analyses separately for different functional regions; iv identification of relevant genomic regions by the sliding-window and wavelet-multiresolution approaches; v visualization of the results integrated with current genome annotations in commonly available genome browsers. Conclusion VariScan is a powerful and flexible suite of software for the analysis of DNA polymorphisms. The current version implements new algorithms, methods, and capabilities, providing an important tool for an exhaustive exploratory analysis of genome-wide DNA polymorphism data.

Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

DEFF Research Database (Denmark)

Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik

2003-01-01

The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

Prevalence of Tobacco mosaic virus in Iran and Evolutionary Analyses of the Coat Protein Gene

Directory of Open Access Journals (Sweden)

Athar Alishiri

2013-09-01

Full Text Available The incidence and distribution of Tobacco mosaic virus (TMV and related tobamoviruses was determined using an enzyme-linked immunosorbent assay on 1,926 symptomatic horticultural crops and 107 asymptomatic weed samples collected from 78 highly infected fields in the major horticultural crop-producing areas in 17 provinces throughout Iran. The results were confirmed by host range studies and reverse transcription-polymerase chain reaction. The overall incidence of infection by these viruses in symptomatic plants was 11.3%. The coat protein (CP gene sequences of a number of isolates were determined and disclosed to be a high identity (up to 100% among the Iranian isolates. Phylogenetic analysis of all known TMV CP genes showed three clades on the basis of nucleotide sequences with all Iranian isolates distinctly clustered in clade II. Analysis using the complete CP amino acid sequence showed one clade with two subgroups, IA and IB, with Iranian isolates in both subgroups. The nucleotide diversity within each sub-group was very low, but higher between the two clades. No correlation was found between genetic distance and geographical origin or host species of isolation. Statistical analyses suggested a negative selection and demonstrated the occurrence of gene flow from the isolates in other clades to the Iranian population.

The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

NARCIS (Netherlands)

Steenbergh, P.H.; Sussenbach, J.S.

The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

Turn-on fluorescence probes based on pyranine/viologen charge-transfer complexes for the determination of nucleotides

Energy Technology Data Exchange (ETDEWEB)

Schäferling, Michael, E-mail: Michael.schaeferling@utu.fi; Lang, Thomas; Schnettelker, Annette

2014-10-15

The formation of ground state charge-transfer complexes between pyranine (8-hydroxypyrene-1,3,6-trisulfonic acid) and viologen (paraquat) derivatives is utilized for the design of novel fluoroionophores for the determination of phosphate species, particularly of nucleotides. The strong quenching of the pyranine fluorescence by viologen-type charge transfer acceptors can be countermanded if these are functionalized with triethylammonium groups that serve as recognition elements for phosphate anions. We report on the fluorogenic responses of these water-soluble molecular probes in presence of different phosphates. Absorbance measurements give additional information on the charge transfer complex formation and the interaction with nucleotides. The experimental data show that these aggregates form attractive, simple and versatile fluorescence turn-on probes for nucleoside triphosphates. The reversibility of the fluorescence response is demonstrated by means of an enzymatic model assay using ATPase for the decomposition of adenosine triphosphate. - Highlights: • Pyranine/viologen charge-transfer complexes as molecular probe for ATP recognition. • Fluorescence turn on mechanism. • Selective compared to other nucleotides and phosphate anions. • Fast and reversible response applicable to monitor enzymatic reactions.

Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes

KAUST Repository

Qu, Hongzhu

2010-12-01

Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.

Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes

KAUST Repository

Qu, Hongzhu; Wu, Hao; Zhang, Tongwu; Zhang, Zhang; Hu, Songnian; Yu, Jun

2010-01-01

Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.

Approach for targeting Ras with small molecules that activate SOS-mediated nucleotide exchange.

Science.gov (United States)

Burns, Michael C; Sun, Qi; Daniels, R Nathan; Camper, DeMarco; Kennedy, J Phillip; Phan, Jason; Olejniczak, Edward T; Lee, Taekyu; Waterson, Alex G; Rossanese, Olivia W; Fesik, Stephen W

2014-03-04

Aberrant activation of the small GTPase Ras by oncogenic mutation or constitutively active upstream receptor tyrosine kinases results in the deregulation of cellular signals governing growth and survival in ∼30% of all human cancers. However, the discovery of potent inhibitors of Ras has been difficult to achieve. Here, we report the identification of small molecules that bind to a unique pocket on the Ras:Son of Sevenless (SOS):Ras complex, increase the rate of SOS-catalyzed nucleotide exchange in vitro, and modulate Ras signaling pathways in cells. X-ray crystallography of Ras:SOS:Ras in complex with these molecules reveals that the compounds bind in a hydrophobic pocket in the CDC25 domain of SOS adjacent to the Switch II region of Ras. The structure-activity relationships exhibited by these compounds can be rationalized on the basis of multiple X-ray cocrystal structures. Mutational analyses confirmed the functional relevance of this binding site and showed it to be essential for compound activity. These molecules increase Ras-GTP levels and disrupt MAPK and PI3K signaling in cells at low micromolar concentrations. These small molecules represent tools to study the acute activation of Ras and highlight a pocket on SOS that may be exploited to modulate Ras signaling.

Preliminary electrostatic and mechanical design of a SINGAP-MAMuG compatible accelerator

Energy Technology Data Exchange (ETDEWEB)

Grando, L. [Consorzio RFX, Associazione EURATOM-ENEA sulla Fusione, Corso Stati Uniti 4, I-35127 Padova (Italy)], E-mail: luca.grando@igi.cnr.it; Dal Bello, S.; De Lorenzi, A. [Consorzio RFX, Associazione EURATOM-ENEA sulla Fusione, Corso Stati Uniti 4, I-35127 Padova (Italy); Pilan, N. [DIE, Universita di Padova, Via Gradenigo 6A, I-35100 Padova (Italy); Rizzolo, A.; Zaccaria, P. [Consorzio RFX, Associazione EURATOM-ENEA sulla Fusione, Corso Stati Uniti 4, I-35127 Padova (Italy)

2009-06-15

Each ITER NB injector shall provide 16.5 MW auxiliary power by accelerating a deuterium beam across a voltage of -1 MV. At present two possible alternatives for the accelerator are considered: the reference design, based on MAMuG electrostatic accelerator, where the total voltage is graded using five grids at intermediate steps of 200 kV, and the alternative concept, the SINGAP accelerator, for which the total voltage is held by one single gap. This paper focuses a preliminary feasibility study of integration of SINGAP accelerator grids into the support structure of a MAMuG type accelerator; the review or design of new electrostatic shields to improve the voltage withstanding capability of the system and the preliminary design of electrical and hydraulic connections routing from the bushing to the accelerator are also discussed. Electrostatic and mechanical analyses carried out to support the design are described in detail.

Stuttering on function words in bilingual children who stutter: A preliminary study.

Science.gov (United States)

Gkalitsiou, Zoi; Byrd, Courtney T; Bedore, Lisa M; Taliancich-Klinger, Casey L

2017-01-01

Evidence suggests young monolingual children who stutter (CWS) are more disfluent on function than content words, particularly when produced in the initial utterance position. The purpose of the present preliminary study was to investigate whether young bilingual CWS present with this same pattern. The narrative and conversational samples of four bilingual Spanish- and English-speaking CWS were analysed. All four bilingual participants produced significantly more stuttering on function words compared to content words, irrespective of their position in the utterance, in their Spanish narrative and conversational speech samples. Three of the four participants also demonstrated more stuttering on function compared to content words in their narrative speech samples in English, but only one participant produced more stuttering on function than content words in her English conversational sample. These preliminary findings are discussed relative to linguistic planning and language proficiency and their potential contribution to stuttered speech.

Preliminary safety evaluation, based on initial site investigation data. Planning document

International Nuclear Information System (INIS)

Hedin, Allan

2002-12-01

This report is a planning document for the preliminary safety evaluations (PSE) to be carried out at the end of the initial stage of SKBs ongoing site investigations for a deep repository for spent nuclear fuel. The main purposes of the evaluations are to determine whether earlier judgements of the suitability of the candidate area for a deep repository with respect to long-term safety holds up in the light of borehole data and to provide feed-back to continued site investigations and site specific repository design. The preliminary safety evaluations will be carried out by a safety assessment group, based on a site model, being part of a site description, provided by a site modelling group and a repository layout within that model suggested by a repository engineering group. The site model contains the geometric features of the site as well as properties of the host rock. Several alternative interpretations of the site data will likely be suggested. Also the biosphere is included in the site model. A first task for the PSE will be to compare the rock properties described in the site model to previously established criteria for a suitable host rock. This report gives an example of such a comparison. In order to provide more detailed feedback, a number of thermal, hydrological, mechanical and chemical analyses of the site will also be included in the evaluation. The selection of analyses is derived from the set of geosphere and biosphere analyses preliminarily planned for the comprehensive safety assessment named SR-SITE, which will be based on a complete site investigation. The selection is dictated primarily by the expected feedback to continued site investigations and by the availability of data after the PSE. The repository engineering group will consider several safety related factors in suggesting a repository layout: Thermal calculations will be made to determine a minimum distance between canisters avoiding canister surface temperatures above 100 deg C

Preliminary study of the thermo-hydraulic behaviour of the binary breeder reactor

International Nuclear Information System (INIS)

Silveira Luz, M. da; Ferreira, W.J.

1984-06-01

Continuing the development of the Binary Breeder Reactor, its physical configuration and the advantages of differents types of spacers are analysed. In order to simulate the thermo-hydraulic behaviour and obtain data for a preliminary evaluation of the core geometry, the COBRA III C code was used to study the effects of the lenght and diameter of the fuel element, the coolant inlet temperature, the system pressure, helicoidal pitch and the pitch to diameter ratio. (Author) [pt

Prediction by graph theoretic measures of structural effects in proteins arising from non-synonymous single nucleotide polymorphisms.

Directory of Open Access Journals (Sweden)

Tammy M K Cheng

Full Text Available Recent analyses of human genome sequences have given rise to impressive advances in identifying non-synonymous single nucleotide polymorphisms (nsSNPs. By contrast, the annotation of nsSNPs and their links to diseases are progressing at a much slower pace. Many of the current approaches to analysing disease-associated nsSNPs use primarily sequence and evolutionary information, while structural information is relatively less exploited. In order to explore the potential of such information, we developed a structure-based approach, Bongo (Bonds ON Graph, to predict structural effects of nsSNPs. Bongo considers protein structures as residue-residue interaction networks and applies graph theoretical measures to identify the residues that are critical for maintaining structural stability by assessing the consequences on the interaction network of single point mutations. Our results show that Bongo is able to identify mutations that cause both local and global structural effects, with a remarkably low false positive rate. Application of the Bongo method to the prediction of 506 disease-associated nsSNPs resulted in a performance (positive predictive value, PPV, 78.5% similar to that of PolyPhen (PPV, 77.2% and PANTHER (PPV, 72.2%. As the Bongo method is solely structure-based, our results indicate that the structural changes resulting from nsSNPs are closely associated to their pathological consequences.

PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

Science.gov (United States)

Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li

2009-03-01

The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

Joint U.S./Russian Study on the Development of a Preliminary Cost Estimate of the SAFSTOR Decommissioning Alternative for the Leningrad Nuclear Power Plant Unit #1

Energy Technology Data Exchange (ETDEWEB)

SM Garrett

1998-09-28

The objectives of the two joint Russian/U.S. Leningrad Nuclear Power Plant (NPP) Unit #1 studies were the development of a safe, technically feasible, economically acceptable decom missioning strategy, and the preliminary cost evaluation of the developed strategy. The first study, resulting in the decommissioning strategy, was performed in 1996 and 1997. The preliminary cost estimation study, described in this report, was performed in 1997 and 1998. The decommissioning strategy study included the analyses of three basic RBM.K decommission- ing alternatives, refined for the Leningrad NPP Unit #1. The analyses included analysis of the requirements for the planning and preparation as well as the decommissioning phases.

Preliminary feasibility assessment for Earth-to-space electromagnetic (Railgun) launchers

Science.gov (United States)

Rice, E. E.; Miller, L. A.; Earhart, R. W.

1982-01-01

An Earth to space electromagnetic (railgun) launcher (ESRL) for launching material into space was studied. Potential ESRL applications were identified and initially assessed to formulate preliminary system requirements. The potential applications included nuclear waste disposal in space, Earth orbital applications, deep space probe launchers, atmospheric research, and boost of chemical rockets. The ESRL system concept consisted of two separate railgun launcher tubes (one at 20 deg from the horizontal for Earth orbital missions, the other vertical for solar system escape disposal missions) powered by a common power plant. Each 2040 m launcher tube is surrounded by 10,200 homopolar generator/inductor units to transmit the power to the walls. Projectile masses are 6500 kg for Earth orbital missions and 2055 kg for nuclear waste disposal missions. For the Earth orbital missions, the projectile requires a propulsion system, leaving an estimated payload mass of 650 kg. For the nuclear waste disposal in space mission, the high level waste mass was estimated at 250 kg. This preliminary assessment included technical, environmental, and economic analyses.

Steady-state and accident analyses of PBMR with the computer code SPECTRA

International Nuclear Information System (INIS)

Stempniewicz, Marek M.

2002-01-01

The SPECTRA code is an accident analysis code developed at NRG. It is designed for thermal-hydraulic analyses of nuclear or conventional power plants. The code is capable of analysing the whole power plant, including reactor vessel, primary system, various control and safety systems, containment and reactor building. The aim of the work presented in this paper was to prepare a preliminary thermal-hydraulic model of PBMR for SPECTRA, and perform steady state and accident analyses. In order to assess SPECTRA capability to model the PBMR reactors, a model of the INCOGEN system has been prepared first. Steady state and accident scenarios were analyzed for INCOGEN configuration. Results were compared to the results obtained earlier with INAS and OCTOPUS/PANTHERMIX. A good agreement was obtained. Results of accident analyses with PBMR model showed qualitatively good results. It is concluded that SPECTRA is a suitable tool for analyzing High Temperature Reactors, such as INCOGEN or for example PBMR (Pebble Bed Modular Reactor). Analyses of INCOGEN and PBMR systems showed that in all analyzed cases the fuel temperatures remained within the acceptable limits. Consequently there is no danger of release of radioactivity to the environment. It may be concluded that those are promising designs for future safe industrial reactors. (author)

The PurR regulon in Lactococcus lactis – transcriptional regulation of the purine nucleotide metabolism and translational machinery

DEFF Research Database (Denmark)

Jendresen, Christian Bille; Martinussen, Jan; Kilstrup, Mogens

2012-01-01

Purine nucleotides are either synthesized de novo from 5-phosphoribosyl-1-pyrophosphate (PRPP) or salvaged from the environment. In Lactococcus lactis, transcription of the de novo synthesis operons, purCSQLF and purDEK, has genetically been shown to be activated by the PurR protein when bound to......-related functions. Of special interest is the presence of PurBox motifs in rrn promoters, suggesting a novel connection between nucleotide availability and the translational machinery....

Probabilistic evaluation of scenarios in long-term safety analyses. Results of the project ISIBEL; Probabilistische Bewertung von Szenarien in Langzeitsicherheitsanalysen. Ergebnisse des Vorhabens ISIBEL

Energy Technology Data Exchange (ETDEWEB)

Buhmann, Dieter; Becker, Dirk-Alexander; Laggiard, Eduardo; Ruebel, Andre; Spiessl, Sabine; Wolf, Jens

2016-07-15

In the frame of the project ISIBEL deterministic analyses on the radiological consequences of several possible developments of the final repository were performed (VSG: preliminary safety analysis of the site Gorleben). The report describes the probabilistic evaluation of the VSG scenarios using uncertainty and sensitivity analyses. It was shown that probabilistic analyses are important to evaluate the influence of uncertainties. The transfer of the selected scenarios in computational cases and the used modeling parameters are discussed.

NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS

Directory of Open Access Journals (Sweden)

Lakshya Veer Singh

2013-06-01

Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

NARCIS (Netherlands)

Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

2017-01-01

Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

Oligodeoxynucleotides containing 2'-amino-LNA nucleotides as constrained morpholino phosphoramidate and phosphorodiamidate monomers

DEFF Research Database (Denmark)

Kristensen, Kim Vejlegaard; Paul, Sibasish; Kosbar, Tamer

2017-01-01

Incorporation in a 2'→5' direction of a phosphorodiamidite 2'-amino-LNA-T nucleotide as the morpholino phosphoramidate and N,N-dimethylamino phosphorodiamidate monomers into six oligonucleotides is reported. Thermal denaturation studies showed that the novel 2'-amino-LNA-based morpholino monomers...

Single nucleotide polymorphisms as susceptibility, prognostic, and therapeutic markers of nonsmall cell lung cancer

Directory of Open Access Journals (Sweden)

Zienolddiny S

2011-12-01

Full Text Available Shanbeh Zienolddiny, Vidar SkaugSection for Toxicology and Biological Work Environment, National Institute of Occupational Health, Oslo, NorwayAbstract: Lung cancer is a major public health problem throughout the world. Among the most frequent cancer types (prostate, breast, colorectal, stomach, lung, lung cancer is the leading cause of cancer-related deaths worldwide. Among the two major subtypes of small cell lung cancer and nonsmall cell lung cancer (NSCLC, 85% of tumors belong to the NSCLC histological types. Small cell lung cancer is associated with the shortest survival time. Although tobacco smoking has been recognized as the major risk factor for lung cancer, there is a great interindividual and interethnic difference in risk of developing lung cancer given exposure to similar environmental and lifestyle factors. This may indicate that in addition to chemical and environmental factors, genetic variations in the genome may contribute to risk modification. A common type of genetic variation in the genome, known as single nucleotide polymorphism, has been found to be associated with susceptibility to lung cancer. Interestingly, many of these polymorphisms are found in the genes that regulate major pathways of carcinogen metabolism (cytochrome P450 genes, detoxification (glutathione S-transferases, adduct removal (DNA repair genes, cell growth/apoptosis (TP53/MDM2, the immune system (cytokines/chemokines, and membrane receptors (nicotinic acetylcholine and dopaminergic receptors. Some of these polymorphisms have been shown to alter the level of mRNA, and protein structure and function. In addition to being susceptibility markers, several of these polymorphisms are emerging to be important for response to chemotherapy/radiotherapy and survival of patients. Therefore, it is hypothesized that single nucleotide polymorphisms will be valuable genetic markers in individual-based prognosis and therapy in future. Here we will review some of the most

Preliminary Concept of Operations for a Global Cylinder Identification and Monitoring System

Energy Technology Data Exchange (ETDEWEB)

Whitaker, J. M. [ORNL; White-Horton, J. L. [ORNL; Morgan, J. B. [InSolves Associates

2013-08-01

This report describes a preliminary concept of operations for a Global Cylinder Identification and Monitoring System that could improve the efficiency of the International Atomic Energy Agency (IAEA) in conducting its current inspection activities and could provide a capability to substantially increase its ability to detect credible diversion scenarios and undeclared production pathways involving UF6 cylinders. There exist concerns that a proliferant State with access to enrichment technology could obtain a cylinder containing natural or low-enriched uranium hexafluoride (UF6) and produce a significant quantity (SQ)1 of highly enriched uranium in as little as 30 days. The National Nuclear Security Administration (NNSA) through the Next Generation Safeguards Initiative sponsored a multi-laboratory team to develop an integrated system that provides for detecting scenarios involving 1) diverting an entire declared cylinder for enrichment at a clandestine facility, 2) misusing a declared cylinder at a safeguarded facility, and 3) using an undeclared cylinder at a safeguarded facility. An important objective in developing this integrated system was to improve the timeliness for detecting the cylinder diversion and undeclared production scenarios. Developing this preliminary concept required in-depth analyses of current operational and safeguards practices at conversion, enrichment, and fuel fabrication facilities. The analyses evaluated the processing, movement, and storage of cylinders at the facilities; the movement of cylinders between facilities (including cylinder fabrication); and the misuse of safeguarded facilities.

Preliminary Evaluation Of Commercial Supercapacitors For Space Applications

Science.gov (United States)

Gineste, Valery; Loup, Didier; Mattesco, Patrick; Neugnot, Nicolas

2011-10-01

Supercapacitors are identified since years as a new technology enabling energy storage together with high power delivery capability to the system. A recent ESA study [1] led by Astrium has demonstrated the interest of these devices for space application, providing that reliability and end of life performances are demonstrated. A realistic commercial on the shelf (COTS) approach (or with limited design modification approved by potential suppliers) has been favoured (as for batteries). This paper presents preliminary test results done by Astrium on COTS supercapacitors: accelerated life tests, calendar life tests, technology analyses. Based on these results, assessment and lessons learnt are drawn in view of future exhaustive supercapacitor validation and future qualification.

Substitution of Active Site Tyrosines with Tryptophan Alters the Free Energy for Nucleotide Flipping by Human Alkyladenine DNA Glycosylase†

Science.gov (United States)

Hendershot, Jenna M.; Wolfe, Abigail E.; O'Brien, Patrick J.

2011-01-01

Human alkyladenine DNA glycosylase (AAG) locates and excises a wide variety of structurally diverse alkylated and oxidized purine lesions from DNA to initiate the base excision repair pathway. Recognition of a base lesion requires flipping of the damaged nucleotide into a relatively open active site pocket between two conserved tyrosine residues, Y127 and Y159. We have mutated each of these amino acids to tryptophan and measured the kinetic effects on the nucleotide flipping and base excision steps. The Y127W and Y159W mutant proteins have robust glycosylase activity toward DNA containing 1,N6-ethenoadenine (εA), within 4-fold of that of the wildtype enzyme, raising the possibility that tryptophan fluorescence could be used to probe the DNA binding and nucleotide flipping steps. Stopped-flow fluorescence was used to compare the time-dependent changes in tryptophan fluorescence and εA fluorescence. For both mutants, the tryptophan fluorescence exhibited two-step binding with essentially identical rate constants as were observed for the εA fluorescence changes. These results provide evidence that AAG forms an initial recognition complex in which the active site pocket is perturbed and the stacking of the damaged base is disrupted. Upon complete nucleotide flipping, there is further quenching of the tryptophan fluorescence with coincident quenching of the εA fluorescence. Although these mutations do not have large effects on the rate constant for excision of εA, there are dramatic effects on the rate constants for nucleotide flipping that result in 40 to 100-fold decreases in the flipping equilibrium relative to wildtype. Most of this effect is due to an increased rate of unflipping, but surprisingly the Y159W mutation causes a 5-fold increase in the rate constant for flipping. The large effect on the equilibrium for nucleotide flipping explains the greater deleterious effects that these mutations have on the glycosylase activity toward base lesions that are in

Purine 3':5'-cyclic nucleotides with the nucleobase in a syn orientation: cAMP, cGMP and cIMP.

Science.gov (United States)

Řlepokura, Katarzyna Anna

2016-06-01

Purine 3':5'-cyclic nucleotides are very well known for their role as the secondary messengers in hormone action and cellular signal transduction. Nonetheless, their solid-state conformational details still require investigation. Five crystals containing purine 3':5'-cyclic nucleotides have been obtained and structurally characterized, namely adenosine 3':5'-cyclic phosphate dihydrate, C10H12N5O6P·2H2O or cAMP·2H2O, (I), adenosine 3':5'-cyclic phosphate 0.3-hydrate, C10H12N5O6P·0.3H2O or cAMP·0.3H2O, (II), guanosine 3':5'-cyclic phosphate pentahydrate, C10H12N5O7P·5H2O or cGMP·5H2O, (III), sodium guanosine 3':5'-cyclic phosphate tetrahydrate, Na(+)·C10H11N5O7P(-)·4H2O or Na(cGMP)·4H2O, (IV), and sodium inosine 3':5'-cyclic phosphate tetrahydrate, Na(+)·C10H10N4O7P(-)·4H2O or Na(cIMP)·4H2O, (V). Most of the cyclic nucleotide zwitterions/anions [two from four cAMP present in total in (I) and (II), cGMP in (III), cGMP(-) in (IV) and cIMP(-) in (V)] are syn conformers about the N-glycosidic bond, and this nucleobase arrangement is accompanied by Crib-H...Npur hydrogen bonds (rib = ribose and pur = purine). The base orientation is tuned by the ribose pucker. An analysis of data obtained from the Cambridge Structural Database made in the context of syn-anti conformational preferences has revealed that among the syn conformers of various purine nucleotides, cyclic nucleotides and dinucleotides predominate significantly. The interactions stabilizing the syn conformation have been indicated. The inter-nucleotide contacts in (I)-(V) have been systematized in terms of the chemical groups involved. All five structures display three-dimensional hydrogen-bonded networks.

Preliminary nuclear power reactor technology qualitative assessment for Malaysia

International Nuclear Information System (INIS)

Shamsul Amri Sulaiman

2011-01-01

Since the worlds first nuclear reactor major breakthrough in December 02, 1942, the nuclear power industry has undergone tremendous development and evolution for more than half a century. After surpassing moratorium of nuclear power plant construction caused by catastrophic accidents at Three-mile island (1979) and Chernobyl (1986), today, nuclear energy is back on the policy agendas of many countries, both developed and developing, signaling nuclear revival or nuclear renaissance. Selection of suitable nuclear power technology has thus been subjected to primary attention. This short paper attempts to draw preliminary technology assessment for the first nuclear power reactor technology for Malaysia. Methodology employed is qualitative analysis collating recent finding of tnb-kepco preliminary feasibility study for nuclear power program in peninsular malaysia and other published presentations and/or papers by multiple experts. The results suggested that pressurized water reactor (PWR) is the prevailing technology in terms of numbers and plant performances, and while the commercialization of generation IV reactors is remote (e.g. Not until 2030), generation III/ III+ NPP models are commercially available on the market today. Five (5) major steps involved in reactor technology selection were introduced with a focus on introducing important aspects of selection criteria. Three (3) categories for the of reactor technology selection were used for the cursory evaluation. The outcome of these analyses shall lead to deeper and full analyses of the recommended reactor technologies for a comprehensive feasibility study in the near future. Recommendations for reactor technology option were also provided for both strategic and technical recommendations. The paper shall also implore the best way to select systematically the first civilian nuclear power reactor. (Author)

Preliminary performance assessment for the Waste Isolation Pilot Plant, December 1992

International Nuclear Information System (INIS)

1992-12-01

Before disposing of transuranic radioactive waste in the Waste Isolation Pilot Plant (WIPP), the United States Department of Energy (DOE) must evaluate compliance with applicable long-term regulations of the United States Environmental Protection Agency (EPA). Sandia National Laboratories is conducting iterative performance assessments (PAs) of the WIPP for the DOE to provide interim guidance while preparing for a final compliance evaluation. This volume, Volume 2, contains the technical basis for the 1992 PA. Specifically, it describes the conceptual basis for consequence modeling and the PA methodology, including the selection of scenarios for analysis, the determination of scenario probabilities, and the estimation of scenario consequences using a Monte Carlo technique and a linked system of computational models. Additional information about the 1992 PA is provided in other volumes. Volume I contains an overview of WIPP PA and results of a preliminary comparison with the long-term requirements of the EPA's Environmental Protection Standards for Management and Disposal of Spent Nuclear Fuel, High-Level and Transuranic Radioactive Wastes (40 CFR 191, Subpart B). Volume 3 contains the reference data base and values for input parameters used in consequence and probability modeling. Volume 4 contains uncertainty and sensitivity analyses related to the preliminary comparison with 40 CFR 191B. Volume 5 contains uncertainty and sensitivity analyses of gas and brine migration for undisturbed performance. Finally, guidance derived from the entire 1992 PA is presented in Volume 6

Prolinol-based nucleoside phosphonic acids: new isosteric conformationally flexible nucleotide analogues

Czech Academy of Sciences Publication Activity Database

Vaněk, Václav; Buděšínský, Miloš; Rinnová, Markéta; Rosenberg, Ivan

2009-01-01

Roč. 65, č. 4 (2009), s. 862-876 ISSN 0040-4020 R&D Projects: GA ČR GA203/05/0827; GA MŠk(CZ) LC06077; GA MŠk LC512; GA MŠk(CZ) LC06061 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotide analogues * phosphonates * prolinol derivatives * N- alkylation Subject RIV: CC - Organic Chemistry Impact factor: 3.219, year: 2009

Structural basis for the binding and incorporation of nucleotide analogs with L-stereochemistry by human DNA polymerase λ

OpenAIRE

Vyas, Rajan; Zahurancik, Walter J.; Suo, Zucai

2014-01-01

DNA polymerases are known to select against L-nucleotides, the enantiomers of natural D-nucleotides. However, the structural basis for D-stereoselectivity of a DNA polymerase has not been established, although two L-nucleoside analogs, lamivudine and emtricitabine, have been widely used as anti-HIV and anti-hepatitis B drugs. Here, we report ternary crystal structures of human DNA polymerase λ in complex with DNA and L-deoxycytidine 5′-triphosphate, or its analogs (the triphosphates of lamivu...

Design update, thermal and fluid dynamic analyses of the EU-HCPB TBM in vertical arrangement

International Nuclear Information System (INIS)

Cismondi, F.; Kecskes, S.; Ilic, M.; Legradi, G.; Kiss, B.; Bitz, O.; Dolensky, B.; Neuberger, H.; Boccaccini, L.V.; Ihli, T.

2009-01-01

In the frame of the activities of the EU Breeder Blanket Programme and of the Test Blanket Working Group of ITER, the Helium Cooled Pebble Bed Test Blanket Module (HCPB TBM) is developed in Forschungszentrum Karlsruhe (FZK) to investigate DEMO relevant concepts for blanket modules. The three main functions of a blanket module (removing heat, breeding tritium and shielding sensitive components from radiation) will be tested in ITER using a series of four TBMs, which are irradiated successively during different test campaigns. Each HCPB TBM will be installed, with a vertical orientation, into the vacuum vessel connected to one equatorial port. As the studies performed up to 2006 in FZK concerned a horizontal orientation of the HCPB TBM, a global review of the design is necessary to match with the new ITER specifications. A preliminary version of the new vertical design is proposed extrapolating the neutronic analysis performed for the horizontal HCPB TBM. An overview of the new HCPB TBM vertical designs, as well as the preliminary thermal and fluid dynamic analyses performed for the validation of the design, are presented in this paper. A critical review of the results obtained allows us, in the conclusion, to prepare a plan for the future detailed analyses of the vertical HCPB TBM.

HPLC-based quantification of bacterial housekeeping nucleotides and alarmone messengers ppGpp and pppGpp.

Science.gov (United States)

Varik, Vallo; Oliveira, Sofia Raquel Alves; Hauryliuk, Vasili; Tenson, Tanel

2017-09-08

Here we describe an HPLC-based method to quantify bacterial housekeeping nucleotides and the signaling messengers ppGpp and pppGpp. We have replicated and tested several previously reported HPLC-based approaches and assembled a method that can process 50 samples in three days, thus making kinetically resolved experiments feasible. The method combines cell harvesting by rapid filtration, followed by acid extraction, freeze-drying with chromatographic separation. We use a combination of C18 IPRP-HPLC (GMP unresolved and co-migrating with IMP; GDP and GTP; AMP, ADP and ATP; CTP; UTP) and SAX-HPLC in isocratic mode (ppGpp and pppGpp) with UV detection. The approach is applicable to bacteria without the requirement of metabolic labelling with 32P-labelled radioactive precursors. We applied our method to quantify nucleotide pools in Escherichia coli BW25113 K12-strain both throughout the growth curve and during acute stringent response induced by mupirocin. While ppGpp and pppGpp levels vary drastically (40- and ≥8-fold, respectively) these changes are decoupled from the quotients of the housekeeping pool and guanosine and adenosine housekeeping nucleotides: NTP/NDP/NMP ratio remains stable at 6/1/0.3 during both normal batch culture growth and upon acute amino acid starvation.

Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

Directory of Open Access Journals (Sweden)

Erena A. Edae

2013-07-01

Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

Sirtuin1 single nucleotide polymorphism (A2191G is a diagnostic marker for vibration-induced white finger disease

Directory of Open Access Journals (Sweden)

Voelter-Mahlknecht Susanne

2012-10-01

Full Text Available Abstract Background Vibration-induced white finger disease (VWF, also known as hand-arm vibration syndrome, is a secondary form of Raynaud’s disease, affecting the blood vessels and nerves. So far, little is known about the pathogenesisof the disease. VWF is associated with an episodic reduction in peripheral blood flow. Sirtuin 1, a class III histone deacetylase, has been described to regulate the endothelium dependent vasodilation by targeting endothelial nitric oxide synthase. We assessed Sirt1single nucleotide polymorphisms in patients with VWF to further elucidate the role of sirtuin 1 in the pathogenesis of VWF. Methods Peripheral blood samples were obtained from 74 patients with VWF (male 93.2%, female 6.8%, median age 53 years and from 317 healthy volunteers (gender equally distributed, below 30 years of age. Genomic DNA was extracted from peripheral blood mononuclear cells and screened for potential Sirt1single nucleotide polymorphisms. Four putative genetic polymorphisms out of 113 within the Sirt1 genomic region (NCBI Gene Reference: NM_012238.3 were assessed. Allelic discrimination was performed by TaqMan-polymerasechainreaction-based allele-specific genotyping single nucleotide polymorphism assays. Results Sirt1single nucleotide polymorphism A2191G (Assay C_25611590_10, rs35224060 was identified within Sirt1 exon 9 (amino acid position 731, Ile → Val, with differing allelic frequencies in the VWF population (A/A: 70.5%, A/G: 29.5%, G/G: 0% and the control population (A/A: 99.7%, A/G: 0.3%, G/G: 0.5%, with significance levels of P U test (two-tailed P t-test and Chi-square test with Yates correction (all two-tailed: P Conclusion We identified theSirt1A2191Gsingle nucleotide polymorphism as a diagnostic marker for VWF.

[Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

Science.gov (United States)

Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

2014-04-01

Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

Modification of nucleotide metabolism in relationship with differentiation and in response to irradiation in human tumour cells

International Nuclear Information System (INIS)

Wei, Shuang

1998-01-01

This research thesis reports the study of the metabolism of nucleotides in human tumour cells. The first part addresses the modifications of nucleotide (more specifically purine) metabolism in relationship with human melanoma cell proliferation and differentiation. The second part addresses the modifications of this metabolism in response to an irradiation in human colon tumour cells. For each part, the author proposes a bibliographic synthesis, and a presentation of studied cells and of methods used to grow cells, and respectively to proliferate and differentiate them or to irradiate them, and then discusses the obtained results [fr

Preliminary hazards analysis -- vitrification process

International Nuclear Information System (INIS)

Coordes, D.; Ruggieri, M.; Russell, J.; TenBrook, W.; Yimbo, P.

1994-06-01

This paper presents a Preliminary Hazards Analysis (PHA) for mixed waste vitrification by joule heating. The purpose of performing a PHA is to establish an initial hazard categorization for a DOE nuclear facility and to identify those processes and structures which may have an impact on or be important to safety. The PHA is typically performed during and provides input to project conceptual design. The PHA is then followed by a Preliminary Safety Analysis Report (PSAR) performed during Title 1 and 2 design. The PSAR then leads to performance of the Final Safety Analysis Report performed during the facility's construction and testing. It should be completed before routine operation of the facility commences. This PHA addresses the first four chapters of the safety analysis process, in accordance with the requirements of DOE Safety Guidelines in SG 830.110. The hazards associated with vitrification processes are evaluated using standard safety analysis methods which include: identification of credible potential hazardous energy sources; identification of preventative features of the facility or system; identification of mitigative features; and analyses of credible hazards. Maximal facility inventories of radioactive and hazardous materials are postulated to evaluate worst case accident consequences. These inventories were based on DOE-STD-1027-92 guidance and the surrogate waste streams defined by Mayberry, et al. Radiological assessments indicate that a facility, depending on the radioactive material inventory, may be an exempt, Category 3, or Category 2 facility. The calculated impacts would result in no significant impact to offsite personnel or the environment. Hazardous materials assessment indicates that a Mixed Waste Vitrification facility will be a Low Hazard facility having minimal impacts to offsite personnel and the environment

Preliminary hazards analysis -- vitrification process

Energy Technology Data Exchange (ETDEWEB)

Coordes, D.; Ruggieri, M.; Russell, J.; TenBrook, W.; Yimbo, P. [Science Applications International Corp., Pleasanton, CA (United States)

1994-06-01

This paper presents a Preliminary Hazards Analysis (PHA) for mixed waste vitrification by joule heating. The purpose of performing a PHA is to establish an initial hazard categorization for a DOE nuclear facility and to identify those processes and structures which may have an impact on or be important to safety. The PHA is typically performed during and provides input to project conceptual design. The PHA is then followed by a Preliminary Safety Analysis Report (PSAR) performed during Title 1 and 2 design. The PSAR then leads to performance of the Final Safety Analysis Report performed during the facility`s construction and testing. It should be completed before routine operation of the facility commences. This PHA addresses the first four chapters of the safety analysis process, in accordance with the requirements of DOE Safety Guidelines in SG 830.110. The hazards associated with vitrification processes are evaluated using standard safety analysis methods which include: identification of credible potential hazardous energy sources; identification of preventative features of the facility or system; identification of mitigative features; and analyses of credible hazards. Maximal facility inventories of radioactive and hazardous materials are postulated to evaluate worst case accident consequences. These inventories were based on DOE-STD-1027-92 guidance and the surrogate waste streams defined by Mayberry, et al. Radiological assessments indicate that a facility, depending on the radioactive material inventory, may be an exempt, Category 3, or Category 2 facility. The calculated impacts would result in no significant impact to offsite personnel or the environment. Hazardous materials assessment indicates that a Mixed Waste Vitrification facility will be a Low Hazard facility having minimal impacts to offsite personnel and the environment.

Nucleotide transmitters ATP and ADP mediate intercellular calcium wave communication via P2Y12/13 receptors among BV-2 microglia.

Directory of Open Access Journals (Sweden)

Pengchong Jiang

Full Text Available Nerve injury is accompanied by a liberation of diverse nucleotides, some of which act as 'find/eat-me' signals in mediating neuron-glial interplay. Intercellular Ca2+ wave (ICW communication is the main approach by which glial cells interact and coordinate with each other to execute immune defense. However, the detailed mechanisms on how these nucleotides participate in ICW communication remain largely unclear. In the present work, we employed a mechanical stimulus to an individual BV-2 microglia to simulate localized injury. Remarkable ICW propagation was observed no matter whether calcium was in the environment or not. Apyrase (ATP/ADP-hydrolyzing enzyme, suramin (broad-spectrum P2 receptor antagonist, 2-APB (IP3 receptor blocker and thapsigargin (endoplasmic reticulum calcium pump inhibitor potently inhibited these ICWs, respectively, indicating the dependence of nucleotide signals and P2Y receptors. Then, we detected the involvement of five naturally occurring nucleotides (ATP, ADP, UTP, UDP and UDP-glucose by desensitizing receptors. Results showed that desensitization with ATP and ADP could block ICW propagation in a dose-dependent manner, whereas other nucleotides had little effect. Meanwhile, the expression of P2Y receptors in BV-2 microglia was identified and their contributions were analyzed, from which we suggested P2Y12/13 receptors activation mostly contributed to ICWs. Besides, we estimated that extracellular ATP and ADP concentration sensed by BV-2 microglia was about 0.3 μM during ICWs by analyzing calcium dynamic characteristics. Taken together, these results demonstrated that the nucleotides ATP and ADP were predominant signal transmitters in mechanical stimulation-induced ICW communication through acting on P2Y12/13 receptors in BV-2 microglia.

Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

Indian Academy of Sciences (India)

2017-03-02

Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

Production, crystallization and preliminary X-ray diffraction analysis of the allergen Can f 2 from Canis familiaris

International Nuclear Information System (INIS)

Madhurantakam, Chaithanya; Nilsson, Ola B.; Jönsson, Klas; Grönlund, Hans; Achour, Adnane

2009-01-01

The recombinant form of the allergen Can f 2 from C. familiaris was produced, isolated and crystallized in two different forms. Preliminary X-ray diffraction analyses are reported for the two crystal forms of Can f 2. The allergen Can f 2 from dog (Canis familiaris) present in saliva, dander and fur is an important cause of allergic sensitization worldwide. Here, the production, isolation, crystallization and preliminary X-ray diffraction analysis of two crystal forms of recombinant Can f 2 are reported. The first crystal form belonged to space group C222, with unit-cell parameters a = 68.7, b = 77.3, c = 65.1 Å, and diffracted to 1.55 Å resolution, while the second crystal form belonged to space group C2, with unit-cell parameters a = 75.7, b = 48.3, c = 68.7 Å, β = 126.5°, and diffracted to 2.1 Å resolution. Preliminary data analysis indicated the presence of a single molecule in the asymmetric unit for both crystal forms

R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

Science.gov (United States)

Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

2013-07-01

The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.

Intramolecular transfer of radiation damage in γ-irradiated nucleotides: 8,5'-cyclonucleotides

International Nuclear Information System (INIS)

Fuciarelli, A.F.; Raleigh, J.A.

1984-01-01

The transfer of radiation damage initiated in the sugar phosphate moiety to a nucleotide base as exemplified by 8,5'-cyclonucleotide formation may be important in double-stranded nucleic acids where the bases are shielded to direct hydroxyl attack. With this in mind the authors have renewed a study of the radiation chemistry of cyclonucleotides including further development of an in situ immunochemical assay for their formation in nucleic acids. 8,5'-cycloadenosine 5'-monophosphate has been prepared by radiation chemical synthesis for this purpose. The authors have discovered that the Erlanger and Bieser technique in which the cyclonucleotide hapten is attached to bovine serum albumin (BSA) through the sugar moiety may not be the best approach for preparing cyclonucleotide-containing immunogens as conformational changes may occur in the cyclonucleotide structure during this procedure. The authors are presently using an alternate approach in which the cyclonucleotide hapten is linked to BSA through the phosphate group of the nucleotide. The authors report on these experiments as well as on the basic radiation chemistry of 8,5'-cyclonucleotides

Production, purification, crystallization and preliminary X-ray diffraction studies of the nucleoside diphosphate kinase b from Leishmania major

International Nuclear Information System (INIS)

Tonoli, Celisa Caldana Costa; Vieira, Plinio Salmazo; Ward, Richard John; Arni, Raghuvir Krishnaswamy; Oliveira, Arthur Henrique Cavalcante de; Murakami, Mario Tyago

2009-01-01

Overexpression, purification, crystallization and preliminary X-ray diffraction analysis of the nucleoside diphosphate kinase b from Leishmania major are reported. The crystals belonged to the trigonal space group P3 2 21 and diffracted to 2.18 Å resolution. Nucleoside diphosphate kinases (NDKs; EC 2.7.4.6) play an essential role in the synthesis of nucleotides from intermediates in the salvage pathway in all parasitic trypanosomatids and their structural studies will be instrumental in shedding light on the biochemical machinery involved in the parasite life cycle and host–parasite interactions. In this work, NDKb from Leishmania major was overexpressed in Escherichia coli, purified to homogeneity and crystallized using the sitting-drop vapour-diffusion method. The NDK crystal diffracted to 2.2 Å resolution and belonged to the trigonal crystal system, with unit-cell parameters a = 114.2, c = 93.9 Å. Translation-function calculations yielded an unambiguous solution in the enantiomorphic space group P3 2 21

Preliminary Calculations of Bypass Flow Distribution in a Multi-Block Air Test

International Nuclear Information System (INIS)

Kim, Min Hwan; Tak, Nam Il

2011-01-01

The development of a methodology for the bypass flow assessment in a prismatic VHTR (Very High Temperature Reactor) core has been conducted at KAERI. A preliminary estimation of variation of local bypass flow gap size between graphite blocks in the NHDD core were carried out. With the predicted gap sizes, their influence on the bypass flow distribution and the core hot spot was assessed. Due to the complexity of gap distributions, a system thermo-fluid analysis code is suggested as a tool for the core thermo-fluid analysis, the model and correlations of which should be validated. In order to generate data for validating the bypass flow analysis model, an experimental facility for a multi-block air test was constructed at Seoul National University (SNU). This study is focused on the preliminary evaluation of flow distribution in the test section to understand how the flow is distributed and to help the selection of experimental case. A commercial CFD code, ANSYS CFX is used for the analyses

Preliminary structural assessment of DEMO vacuum vessel against a vertical displacement event

International Nuclear Information System (INIS)

Mozzillo, Rocco; Tarallo, Andrea; Marzullo, Domenico; Bachmann, Christian; Di Gironimo, Giuseppe; Mazzone, Giuseppe

2016-01-01

Highlights: • The paper focuses on a preliminary structural analysis of the current concept design of DEMO vacuum vessel. • The Vacuum Vessel was checked against the VDE in combinations with the weight force of all components that the vessel shall bear. • Different configurations for the vacuum vessel supports are considered, showing that the best solution is VV supported at the lower port. • The analyses evaluated the “P damage” according to RCC-MRx code. - Abstract: This paper focuses on a preliminary structural analysis of the current concept design of DEMO vacuum vessel (VV). The VV structure is checked against a vertical load due to a Vertical Displacement Event in combination with the weight force of all components that the main vessel shall bear. Different configurations for the supports are considered. Results show that the greatest safety margins are reached when the tokamak is supported through the lower ports rather than the equatorial ports, though all analyzed configurations are compliant with RCC-MRx design rules.

Preliminary structural assessment of DEMO vacuum vessel against a vertical displacement event

Energy Technology Data Exchange (ETDEWEB)

Mozzillo, Rocco, E-mail: rocco.mozzillo@unina.it [CREATE, University of Naples Federico II, DII, P.le Tecchio 80, 80125, Naples (Italy); Tarallo, Andrea; Marzullo, Domenico [CREATE, University of Naples Federico II, DII, P.le Tecchio 80, 80125, Naples (Italy); Bachmann, Christian [EUROfusion PMU, Boltzmannstraße 2, 85748 Garching (Germany); Di Gironimo, Giuseppe [CREATE, University of Naples Federico II, DII, P.le Tecchio 80, 80125, Naples (Italy); Mazzone, Giuseppe [Unità Tecnica Fusione - ENEA C.R. Frascati, Via E. Fermi 45, 00044 Frascati (Italy)

2016-11-15

Highlights: • The paper focuses on a preliminary structural analysis of the current concept design of DEMO vacuum vessel. • The Vacuum Vessel was checked against the VDE in combinations with the weight force of all components that the vessel shall bear. • Different configurations for the vacuum vessel supports are considered, showing that the best solution is VV supported at the lower port. • The analyses evaluated the “P damage” according to RCC-MRx code. - Abstract: This paper focuses on a preliminary structural analysis of the current concept design of DEMO vacuum vessel (VV). The VV structure is checked against a vertical load due to a Vertical Displacement Event in combination with the weight force of all components that the main vessel shall bear. Different configurations for the supports are considered. Results show that the greatest safety margins are reached when the tokamak is supported through the lower ports rather than the equatorial ports, though all analyzed configurations are compliant with RCC-MRx design rules.

Transumanesimo, enhancement ed evoluzione. Riflessioni preliminari per una ridefinizione critica

Directory of Open Access Journals (Sweden)

LO SAPIO, LUCA

2016-12-01

Full Text Available Transhumanism, enhancement and evolution. Preliminary reflections for a critical redefinition This paper aims at focusing some possible uses of evolutionary theory in transhumanist authors. In particular it is analysed the evolutionary heuristics discussed by Nick Bostrom and Anders Sandberg, the proposal of a moral bioenhancement in Julian Savulescu and Ingmar Persson and the idea itself of a self-direct evolution based on the assumption of a self-guided selection of men’s features. These ideas are discussed to bring out the critical elements which are present in some uses of a presumably Darwinian framework in transhumanist approach.

Identification of Diagnostic Mitochondrial DNA Single Nucleotide Polymorphisms Specific to Sumatran Orangutan (Pongo abelii Populations

Directory of Open Access Journals (Sweden)

Puji Rianti

2015-10-01

Full Text Available The hypervariable region I of mitochondrial DNA has frequently been used to distinguish among populations, in particular in species with strong female philopatry. In such cases, populations are expected to diverge rapidly for hypervariable region I markers because of the smaller effective population size and thus increased genetic drift. This rapid divergence leads to the accumulation of mutations exclusively found in one population, which may serve as diagnostic single nucleotide polymorphisms (SNPs. To date, diagnostic SNPs distinctive to Sumatran orangutan populations have not yet been described. However, given the continuously declining numbers of Sumatran orangutans, this information can be vital for effective conservation measures, especially regarding reintroductions of orangutans in rehabilitation centers. Phylogenetic analyses of 54 samples of Sumatran orangutans from nine sampling sites with good provenance, we found five major clades and a total of 20 haplotypes. We propose a total of 52 diagnostic SNPs that are specific to Sumatran orangutan populations. Data can be used to develop restriction fragment length polymorphism assays to carry out genetic assignments using basic laboratory equipment to assign Sumatran orangutan to their population of origin.

Comparative chloroplast genomics: Analyses including new sequencesfrom the angiosperms Nuphar advena and Ranunculus macranthus

Energy Technology Data Exchange (ETDEWEB)

Raubeso, Linda A.; Peery, Rhiannon; Chumley, Timothy W.; Dziubek,Chris; Fourcade, H. Matthew; Boore, Jeffrey L.; Jansen, Robert K.

2007-03-01

The number of completely sequenced plastid genomes available is growing rapidly. This new array of sequences presents new opportunities to perform comparative analyses. In comparative studies, it is most useful to compare across wide phylogenetic spans and, within angiosperms, to include representatives from basally diverging lineages such as the new genomes reported here: Nuphar advena (from a basal-most lineage) and Ranunculus macranthus (from the basal group of eudicots). We report these two new plastid genome sequences and make comparisons (within angiosperms, seed plants, or all photosynthetic lineages) to evaluate features such as the status of ycf15 and ycf68 as protein coding genes, the distribution of simple sequence repeats (SSRs) and longer dispersed repeats (SDR), and patterns of nucleotide composition.

Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

International Nuclear Information System (INIS)

Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

1994-01-01

The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

Preliminary environmental analysis of a geopressured-geothermal test well in Brazoria County, Texas

Energy Technology Data Exchange (ETDEWEB)

White, W.A.; McGraw, M.; Gustavson, T.C.; Meriwether, J.

1977-11-16

Preliminary environmental data, including current land use, substrate lithology, soils, natural hazards, water resources, biological assemblages, meteorological data, and regulatory considerations have been collected and analyzed for approximately 150 km/sup 2/ of land near Chocolate Bayou, Brazoria County, Texas, in which a geopressured-geothermal test well is to be drilled in the fall of 1977. The study was designed to establish an environmental data base and to determine, within spatial constraints set by subsurface reservoir conditions, environmentally suitable sites for the proposed well. Preliminary analyses of data revealed the eed for focusing on the following areas: potential for subsidence and fault activation, susceptibility of test well and support facilities to fresh- and salt-water flooding, possible effects of produced saline waters on biological assemblages and groundwaer resources, distribution of expansive soils, and effect of drilling and associated support activities on known archeological-cultural resources.

Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

Science.gov (United States)

Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro

2016-01-01

Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

Science.gov (United States)

de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

2015-01-01

The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Selected problems and results of the transient event and reliability analyses for the German safety study

International Nuclear Information System (INIS)

Hoertner, H.

1977-01-01

For the investigation of the risk of nuclear power plants loss-of-coolant accidents and transients have to be analyzed. The different functions of the engineered safety features installed to cope with transients are explained. The event tree analysis is carried out for the important transient 'loss of normal onsite power'. Preliminary results of the reliability analyses performed for quantitative evaluation of this event tree are shown. (orig.) [de

Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

DEFF Research Database (Denmark)

Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

2013-01-01

We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

Directory of Open Access Journals (Sweden)

Salem Mohamed

2009-11-01

Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

Science.gov (United States)

Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

2009-11-25

To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

Elements in nucleotide sensing and hydrolysis of the AAA+ disaggregation machine ClpB: a structure-based mechanistic dissection of a molecular motor

Energy Technology Data Exchange (ETDEWEB)

Zeymer, Cathleen, E-mail: cathleen.zeymer@mpimf-heidelberg.mpg.de; Barends, Thomas R. M.; Werbeck, Nicolas D.; Schlichting, Ilme; Reinstein, Jochen, E-mail: cathleen.zeymer@mpimf-heidelberg.mpg.de [Max Planck Institute for Medical Research, Jahnstrasse 29, 69120 Heidelberg (Germany)

2014-02-01

High-resolution crystal structures together with mutational analysis and transient kinetics experiments were utilized to understand nucleotide sensing and the regulation of the ATPase cycle in an AAA+ molecular motor. ATPases of the AAA+ superfamily are large oligomeric molecular machines that remodel their substrates by converting the energy from ATP hydrolysis into mechanical force. This study focuses on the molecular chaperone ClpB, the bacterial homologue of Hsp104, which reactivates aggregated proteins under cellular stress conditions. Based on high-resolution crystal structures in different nucleotide states, mutational analysis and nucleotide-binding kinetics experiments, the ATPase cycle of the C-terminal nucleotide-binding domain (NBD2), one of the motor subunits of this AAA+ disaggregation machine, is dissected mechanistically. The results provide insights into nucleotide sensing, explaining how the conserved sensor 2 motif contributes to the discrimination between ADP and ATP binding. Furthermore, the role of a conserved active-site arginine (Arg621), which controls binding of the essential Mg{sup 2+} ion, is described. Finally, a hypothesis is presented as to how the ATPase activity is regulated by a conformational switch that involves the essential Walker A lysine. In the proposed model, an unusual side-chain conformation of this highly conserved residue stabilizes a catalytically inactive state, thereby avoiding unnecessary ATP hydrolysis.

Elements in nucleotide sensing and hydrolysis of the AAA+ disaggregation machine ClpB: a structure-based mechanistic dissection of a molecular motor

International Nuclear Information System (INIS)

Zeymer, Cathleen; Barends, Thomas R. M.; Werbeck, Nicolas D.; Schlichting, Ilme; Reinstein, Jochen

2014-01-01

High-resolution crystal structures together with mutational analysis and transient kinetics experiments were utilized to understand nucleotide sensing and the regulation of the ATPase cycle in an AAA+ molecular motor. ATPases of the AAA+ superfamily are large oligomeric molecular machines that remodel their substrates by converting the energy from ATP hydrolysis into mechanical force. This study focuses on the molecular chaperone ClpB, the bacterial homologue of Hsp104, which reactivates aggregated proteins under cellular stress conditions. Based on high-resolution crystal structures in different nucleotide states, mutational analysis and nucleotide-binding kinetics experiments, the ATPase cycle of the C-terminal nucleotide-binding domain (NBD2), one of the motor subunits of this AAA+ disaggregation machine, is dissected mechanistically. The results provide insights into nucleotide sensing, explaining how the conserved sensor 2 motif contributes to the discrimination between ADP and ATP binding. Furthermore, the role of a conserved active-site arginine (Arg621), which controls binding of the essential Mg 2+ ion, is described. Finally, a hypothesis is presented as to how the ATPase activity is regulated by a conformational switch that involves the essential Walker A lysine. In the proposed model, an unusual side-chain conformation of this highly conserved residue stabilizes a catalytically inactive state, thereby avoiding unnecessary ATP hydrolysis

Nitrogen K-edge X-ray absorption near edge structure (XANES) spectra of purine-containing nucleotides in aqueous solution

Energy Technology Data Exchange (ETDEWEB)

Shimada, Hiroyuki; Fukao, Taishi; Minami, Hirotake; Ukai, Masatoshi [Department of Applied Physics, Tokyo University of Agriculture and Technology, Koganei-shi, Tokyo 184-8588 (Japan); Fujii, Kentaro; Yokoya, Akinari [Advanced Science Research Center, Japan Atomic Energy Agency, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Fukuda, Yoshihiro; Saitoh, Yuji [Synchrotron Radiation Research Center, Japan Atomic Energy Agency, Sayo-gun, Hyougo 679-5148 (Japan)

2014-08-07

The N K-edge X-ray absorption near edge structure (XANES) spectra of the purine-containing nucleotide, guanosine 5{sup ′}-monophosphate (GMP), in aqueous solution are measured under various pH conditions. The spectra show characteristic peaks, which originate from resonant excitations of N 1s electrons to π* orbitals inside the guanine moiety of GMP. The relative intensities of these peaks depend on the pH values of the solution. The pH dependence is explained by the core-level shift of N atoms at specific sites caused by protonation and deprotonation. The experimental spectra are compared with theoretical spectra calculated by using density functional theory for GMP and the other purine-containing nucleotides, adenosine 5{sup ′}-monophosphate, and adenosine 5{sup ′}-triphosphate. The N K-edge XANES spectra for all of these nucleotides are classified by the numbers of N atoms with particular chemical bonding characteristics in the purine moiety.

Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

Energy Technology Data Exchange (ETDEWEB)

Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

1988-03-25

Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

28 CFR 2.48 - Revocation: Preliminary interview.

Science.gov (United States)

2010-07-01

... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Revocation: Preliminary interview. 2.48....48 Revocation: Preliminary interview. (a) Interviewing officer. A parolee who is retaken on a warrant issued by a Commissioner shall be given a preliminary interview by an official designated by the Regional...

Whole-genome analyses of DS-1-like human G2P[4] and G8P[4] rotavirus strains from Eastern, Western and Southern Africa.

Science.gov (United States)

Nyaga, Martin M; Stucker, Karla M; Esona, Mathew D; Jere, Khuzwayo C; Mwinyi, Bakari; Shonhai, Annie; Tsolenyanu, Enyonam; Mulindwa, Augustine; Chibumbya, Julia N; Adolfine, Hokororo; Halpin, Rebecca A; Roy, Sunando; Stockwell, Timothy B; Berejena, Chipo; Seheri, Mapaseka L; Mwenda, Jason M; Steele, A Duncan; Wentworth, David E; Mphahlele, M Jeffrey

2014-10-01

Group A rotaviruses (RVAs) with distinct G and P genotype combinations have been reported globally. We report the genome composition and possible origin of seven G8P[4] and five G2P[4] human RVA strains based on the genetic evolution of all 11 genome segments at the nucleotide level. Twelve RVA ELISA positive stool samples collected in the representative countries of Eastern, Southern and West Africa during the 2007-2012 surveillance seasons were subjected to sequencing using the Ion Torrent PGM and Illumina MiSeq platforms. A reference-based assembly was performed using CLC Bio's clc_ref_assemble_long program, and full-genome consensus sequences were obtained. With the exception of the neutralising antigen, VP7, all study strains exhibited the DS-1-like genome constellation (P[4]-I2-R2-C2-M2-A2-N2-T2-E2-H2) and clustered phylogenetically with reference strains having a DS-1-like genetic backbone. Comparison of the nucleotide and amino acid sequences with selected global cognate genome segments revealed nucleotide and amino acid sequence identities of 81.7-100 % and 90.6-100 %, respectively, with NSP4 gene segment showing the most diversity among the strains. Bayesian analyses of all gene sequences to estimate the time of divergence of the lineage indicated that divergence times ranged from 16 to 44 years, except for the NSP4 gene where the lineage seemed to arise in the more distant past at an estimated 203 years ago. However, the long-term effects of changes found within the NSP4 genome segment should be further explored, and thus we recommend continued whole-genome analyses from larger sample sets to determine the evolutionary mechanisms of the DS-1-like strains collected in Africa.

[Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

Science.gov (United States)

Wu, Lei; He, Yao; Zhang, Di

2015-11-01

To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

Guanine nucleotide binding protein-like 3 is a potential prognosis indicator of gastric cancer.

Science.gov (United States)

Chen, Jing; Dong, Shuang; Hu, Jiangfeng; Duan, Bensong; Yao, Jian; Zhang, Ruiyun; Zhou, Hongmei; Sheng, Haihui; Gao, Hengjun; Li, Shunlong; Zhang, Xianwen

2015-01-01

Guanine nucleotide binding protein-like 3 (GNL3) is a GIP-binding nuclear protein that has been reported to be involved in various biological processes, including cell proliferation, cellular senescence and tumorigenesis. This study aimed to investigate the expression level of GNL3 in gastric cancer and to evaluate the relationship between its expression and clinical variables and overall survival of gastric cancer patients. The expression level of GNL3 was examined in 89 human gastric cancer samples using immunohistochemistry (IHC) staining. GNL3 in gastric cancer tissues was significantly upregulated compared with paracancerous tissues. GNL3 expression in adjacent non-cancerous tissues was associated with sex and tumor size. Survival analyses showed that GNL3 expression in both gastric cancer and adjacent non-cancerous tissues were not related to overall survival. However, in the subgroup of patients with larger tumor size (≥ 6 cm), a close association was found between GNL3 expression in gastric cancer tissues and overall survival. GNL3-positive patients had a shorter survival than GNL3-negative patients. Our study suggests that GNL3 might play an important role in the progression of gastric cancer and serve as a biomarker for poor prognosis in gastric cancer patients.

Preliminary Design Through Graphs: A Tool for Automatic Layout Distribution

Directory of Open Access Journals (Sweden)

Carlo Biagini

2015-02-01

Full Text Available Diagrams are essential in the preliminary stages of design for understanding distributive aspects and assisting the decision-making process. By drawing a schematic graph, designers can visualize in a synthetic way the relationships between many aspects: functions and spaces, distribution of layouts, space adjacency, influence of traffic flows within a facility layout, and so on. This process can be automated through the use of modern Information and Communication Technologies tools (ICT that allow the designers to manage a large quantity of information. The work that we will present is part of an on-going research project into how modern parametric software influences decision-making on the basis of automatic and optimized layout distribution. The method involves two phases: the first aims to define the ontological relation between spaces, with particular reference to a specific building typology (rules of aggregation of spaces; the second entails the implementation of these rules through the use of specialist software. The generation of ontological relations begins with the collection of data from historical manuals and analyses of case studies. These analyses aim to generate a “relationship matrix” based on preferences of space adjacency. The phase of implementing the previously defined rules is based on the use of Grasshopper to analyse and visualize different layout configurations. The layout is generated by simulating a process involving the collision of spheres, which represents specific functions of the design program. The spheres are attracted or rejected as a function of the relationships matrix, as defined above. The layout thus obtained will remain in a sort of abstract state independent of information about the exterior form, but will still provide a useful tool for the decision-making process. In addition, preliminary results gathered through the analysis of case studies will be presented. These results provide a good variety

Inhibitory effect of extracellular purine nucleotide and nucleoside concentrations on T cell proliferation

Energy Technology Data Exchange (ETDEWEB)

Weiler, Monica [Department of Medicine III and Transfusion Medicine, University Hospital Grosshadern, Ludwig-Maximilians-University, Munich (Germany); Schmetzer, Helga [Helmholtz Center Munich (Germany); German Research Center for Environmental Health, Munich (Germany); Braeu, Marion; Buhmann, Raymund [Helmholtz Center Munich (Germany); German Research Center for Environmental Health, Munich (Germany); Department of Medicine III and Transfusion Medicine, University Hospital Grosshadern, Ludwig-Maximilians-University, Munich (Germany)

2016-11-15

The release of nucleic acids and derivatives after tissue-injury may affect cellular immune-response. We studied the impact of extracellular ribo-, desoxyribonucleotides and nucleosides on T-cell immunity. Peripheral-blood-mononuclear-cells (PBMCs) or isolated CD3{sup +}T-cells obtained from 6 healthy donors were stimulated via CD3/CD28 Dynabeads or dendritic cells (DCs) in the presence or absence of pyrimidine-, purine-nucleotides and -nucleosides (range 2–200 µM). Addition of deoxy-, guanosine-triphosphate (dGTP, GTP) and guanosine resulted concentration dependent in a complete, adenosine-triphosphate (ATP) in a partial inhibition of the induced T-cell-proliferation. Deoxyadenosine-triphosphate (dATP), adenosine and the pyrimidine-ribo- and -deoxyribonucleotides displayed no inhibitory capacity. Inhibitory effects of dGTP and GTP, but not of guanosine and ATP were culture-media-dependent and could be almost abrogated by use of the serum-free lymphocyte-culture-media X-Vivo15 instead of RPMI1640 with standard-supplementation. In contrast to RPMI1640, X-Vivo15 resulted in a significant down-regulation of the cell-surface-located ectonucleotidases CD39 (Ecto-Apyrase) and CD73 (Ecto-5′-Nucleotidase), critical for the extracellular nucleotides-hydrolysis to nucleosides, explaining the loss of inhibition mediated by dGTP and GTP, but not Guanosine. In line with previous findings ATP was found to exert immunosuppressive effects on T-cell-proliferation. Purine-nucleotides, dGTP and GTP displayed a higher inhibitory capacity, but seem to be strictly dependent on the microenvironmental conditions modulating the responsiveness of the respective T-lymphocytes. Further evaluation of experimental and respective clinical settings should anticipate these findings.

Inhibitory effect of extracellular purine nucleotide and nucleoside concentrations on T cell proliferation

International Nuclear Information System (INIS)

Weiler, Monica; Schmetzer, Helga; Braeu, Marion; Buhmann, Raymund

2016-01-01

The release of nucleic acids and derivatives after tissue-injury may affect cellular immune-response. We studied the impact of extracellular ribo-, desoxyribonucleotides and nucleosides on T-cell immunity. Peripheral-blood-mononuclear-cells (PBMCs) or isolated CD3 + T-cells obtained from 6 healthy donors were stimulated via CD3/CD28 Dynabeads or dendritic cells (DCs) in the presence or absence of pyrimidine-, purine-nucleotides and -nucleosides (range 2–200 µM). Addition of deoxy-, guanosine-triphosphate (dGTP, GTP) and guanosine resulted concentration dependent in a complete, adenosine-triphosphate (ATP) in a partial inhibition of the induced T-cell-proliferation. Deoxyadenosine-triphosphate (dATP), adenosine and the pyrimidine-ribo- and -deoxyribonucleotides displayed no inhibitory capacity. Inhibitory effects of dGTP and GTP, but not of guanosine and ATP were culture-media-dependent and could be almost abrogated by use of the serum-free lymphocyte-culture-media X-Vivo15 instead of RPMI1640 with standard-supplementation. In contrast to RPMI1640, X-Vivo15 resulted in a significant down-regulation of the cell-surface-located ectonucleotidases CD39 (Ecto-Apyrase) and CD73 (Ecto-5′-Nucleotidase), critical for the extracellular nucleotides-hydrolysis to nucleosides, explaining the loss of inhibition mediated by dGTP and GTP, but not Guanosine. In line with previous findings ATP was found to exert immunosuppressive effects on T-cell-proliferation. Purine-nucleotides, dGTP and GTP displayed a higher inhibitory capacity, but seem to be strictly dependent on the microenvironmental conditions modulating the responsiveness of the respective T-lymphocytes. Further evaluation of experimental and respective clinical settings should anticipate these findings.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

Science.gov (United States)

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

A preliminary comparison between TOVS and GOME level 2 ozone data

Science.gov (United States)

Rathman, William; Monks, Paul S.; Llewellyn-Jones, David; Burrows, John P.

1997-09-01

A preliminary comparison between total column ozone concentration values derived from TIROS Operational Vertical Sounder (TOVS) and Global Ozone Monitoring Experiment (GOME) has been carried out. Two comparisons of ozone datasets have been made: a) TOVS ozone analysis maps vs. GOME level 2 data; b) TOVS data located at Northern Hemisphere Ground Ozone Stations (NHGOS) vs. GOME data. Both analyses consistently showed an offset in the value of the total column ozone between the datasets [for analyses a) 35 Dobson Units (DU); and for analyses b) 10 DU], despite a good correlation between the spatial and temporal features of the datasets. A noticeably poor correlation in the latitudinal bands 10°/20° North and 10°/20° South was observed—the reasons for which are discussed. The smallest region which was statistically representative of the ozone value correlation dataset of TOVS data at NHGOS and GOME level-2 data was determined to be a region that was enclosed by effective radius of 0.75 arc-degrees (83.5km).

Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

Science.gov (United States)

Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

2017-02-15

Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.

Science.gov (United States)

Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S

2012-11-10

We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

Mineralogical test as a preliminary step for metallurgical proses of Kalan ores

International Nuclear Information System (INIS)

Affandi, K.

1998-01-01

Mineralogical tests as a preliminary step for hydrometallurgy of Kalan ores, including Eko Remaja and Rirang have been carried out to identify the elements and minerals content which affect the metallurgical process, especially the leaching and purification of uranium. Mineralogical tests have been done by means of radioactive and radioluxugraph tests to identify radioactive minerals; thin specimen analysis, Scanning Electron Microscopy (SEM) to identify elements and morphology, EPMA to analyse qualitatively the elements, X-ray Diffractometer (XRD) to identify of minerals content; and X-ray Fluorescence (XRF) and chemical analyses to determine total elements qualitatively and quantitatively. The experimental results show that the Eko Remaja ores contain uraninite and brannerite, iron and titan oxides, sulfides, phosphates and silicates minerals, while the Rirang ores contain uraninite, monazite and molybdenite

Modeling single nucleotide polymorphisms in the human AKR1C1 and AKR1C2 genes: implications for functional and genotyping analyses.

Directory of Open Access Journals (Sweden)

Jonathan W Arthur

2010-12-01

Full Text Available Enzymes encoded by the AKR1C1 and AKR1C2 genes are responsible for the metabolism of progesterone and 5α-dihydrotestosterone (DHT, respectively. The effect of amino acid substitutions, resulting from single nucleotide polymorphisms (SNPs in the AKR1C2 gene, on the enzyme kinetics of the AKR1C2 gene product were determined experimentally by Takashi et al. In this paper, we used homology modeling to predict and analyze the structure of AKR1C1 and AKR1C2 genetic variants. The experimental reduction in enzyme activity in the AKR1C2 variants F46Y and L172Q, as determined by Takahashi et al., is predicted to be due to increased instability in cofactor binding, caused by disruptions to the hydrogen bonds between NADP and AKR1C2, resulting from the insertion of polar residues into largely non-polar environments near the site of cofactor binding. Other AKR1C2 variants were shown to involve either conservative substitutions or changes taking place on the surface of the molecule and distant from the active site, confirming the experimental finding of Takahashi et al. that these variants do not result in any statistically significant reduction in enzyme activity. The AKR1C1 R258C variant is predicted to have no effect on enzyme activity for similar reasons. Thus, we provide further insight into the molecular mechanism of the enzyme kinetics of these proteins. Our data also highlight previously reported difficulties with online databases.

On Preliminary Test Estimator for Median

OpenAIRE

Okazaki, Takeo; 岡崎, 威生

1990-01-01

The purpose of the present paper is to discuss about estimation of median with a preliminary test. Two procedures are presented, one uses Median test and the other uses Wilcoxon two-sample test for the preliminary test. Sections 3 and 4 give mathematical formulations of such properties, including mean square errors with one specified case. Section 5 discusses their optimal significance levels of the preliminary test and proposes their numerical values by Monte Carlo method. In addition to mea...

A Single Nucleotide Polymorphism in Human APOBEC3C Enhances Restriction of Lentiviruses.

Directory of Open Access Journals (Sweden)

Cristina J Wittkopp

2016-10-01

Full Text Available Humans express seven human APOBEC3 proteins, which can inhibit viruses and endogenous retroelements through cytidine deaminase activity. The seven paralogs differ in the potency of their antiviral effects, as well as in their antiviral targets. One APOBEC3, APOBEC3C, is exceptional as it has been found to only weakly block viruses and endogenous retroelements compared to other APOBEC3s. However, our positive selection analyses suggest that APOBEC3C has played a role in pathogen defense during primate evolution. Here, we describe a single nucleotide polymorphism in human APOBEC3C, a change from serine to isoleucine at position 188 (I188 that confers potent antiviral activity against HIV-1. The gain-of-function APOBEC3C SNP results in increased enzymatic activity and hypermutation of target sequences when tested in vitro, and correlates with increased dimerization of the protein. The I188 is widely distributed in human African populations, and is the ancestral primate allele, but is not found in chimpanzees or gorillas. Thus, while other hominids have lost activity of this antiviral gene, it has been maintained, or re-acquired, as a more active antiviral gene in a subset of humans. Taken together, our results suggest that APOBEC3C is in fact involved in protecting hosts from lentiviruses.

Lack of nucleotide variability in a beetle pest with extreme inbreeding

OpenAIRE

Andreev, D.; Breilid, H.; Kirkendall, L.; Brun, Luc-Olivier; French-Constant, R.H.

1998-01-01

The coffee berry borer beetle #Hypothenemus hampei$ (Ferrari) (#Curculionidae$ : #Scolytinae$) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an usual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occuring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation i...

Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

International Nuclear Information System (INIS)

Kincaid, R.L.; Manganiello, V.C.

1988-01-01

There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

Used Fuel Management System Interface Analyses - 13578

Energy Technology Data Exchange (ETDEWEB)

Howard, Robert; Busch, Ingrid [Oak Ridge National Laboratory, P.O. Box 2008, Bldg. 5700, MS-6170, Oak Ridge, TN 37831 (United States); Nutt, Mark; Morris, Edgar; Puig, Francesc [Argonne National Laboratory (United States); Carter, Joe; Delley, Alexcia; Rodwell, Phillip [Savannah River National Laboratory (United States); Hardin, Ernest; Kalinina, Elena [Sandia National Laboratories (United States); Clark, Robert [U.S. Department of Energy (United States); Cotton, Thomas [Complex Systems Group (United States)

2013-07-01

Preliminary system-level analyses of the interfaces between at-reactor used fuel management, consolidated storage facilities, and disposal facilities, along with the development of supporting logistics simulation tools, have been initiated to provide the U.S. Department of Energy (DOE) and other stakeholders with information regarding the various alternatives for managing used nuclear fuel (UNF) generated by the current fleet of light water reactors operating in the United States. An important UNF management system interface consideration is the need for ultimate disposal of UNF assemblies contained in waste packages that are sized to be compatible with different geologic media. Thermal analyses indicate that waste package sizes for the geologic media under consideration by the Used Fuel Disposition Campaign may be significantly smaller than the canisters being used for on-site dry storage by the nuclear utilities. Therefore, at some point along the UNF disposition pathway, there could be a need to repackage fuel assemblies already loaded and being loaded into the dry storage canisters currently in use. The implications of where and when the packaging or repackaging of commercial UNF will occur are key questions being addressed in this evaluation. The analysis demonstrated that thermal considerations will have a major impact on the operation of the system and that acceptance priority, rates, and facility start dates have significant system implications. (authors)

Review of recent ORNL specific-plant analyses

International Nuclear Information System (INIS)

Cheverton, R.D.; Dickson, T.L.

1991-01-01

The Oak Ridge National Laboratory (ORNL) has been helping the Nuclear Regulatory Commission (NRC) develop the pressurized thermal shock (PTS) evaluation methodology since the mid-1970s. During the early 1980s, ORNL developed the integrated PTS (IPTS) methodology, which is a probabilistic approach that includes postulation of PTS transients, estimation of their frequencies, thermal/hydraulic analyses to obtain the corresponding thermal and pressure loadings on the reactor pressure vessel, and probabilistic fracture mechanics analyses. The scope of the IPTS program included development of the probabilistic fracture mechanics code OCA-P and application of the IPTS methodology to three nuclear plants in the US (Oconee I, Calvert Cliffs I, and H. B. Robinson II). The results of this effort were used to help establish the PTS Rule (10CFR50.61) and Regulatory Guide 1.154, which pertains to the PTS issue. The IPTS Program was completed in 1985, and since that time the ORNL related effort has been associated with long-term programs aimed at improving/updating the probabilistic fracture mechanics methodology and input data. In 1990, the NRC requested that ORNL review a vessel-integrity evaluation report submitted to the NRC by the Yankee Atomic Electric Co. for the Yankee Rowe reactor and that ORNL also perform an independent probabilistic fracture mechanics analysis. Details of the methodology and preliminary results are the subject of this paper/presentation

A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

Science.gov (United States)

Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

2016-01-01

Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

Effect of ionizing radiation on calcium and cyclic nucleotides metabolism in rats of different age

International Nuclear Information System (INIS)

Efimova, N.I.; Libenson, S.V.

1982-01-01

Some features of mechanism of calcium homeostasis and cyclic nucleotide exchange breakage in case of acute radiation injury of rats of various age were studied. It is established that calcium level in blood in nonpuberal animals, calcium and cAMP excretion with urine are minimal and reach maximum at puberal age. cGMP excretion with urine and concentrational levels of cAMP and cGMP in blood do not change with age. It is shown that calcium excretion with urine decreases adaptively in conditions of acute radiation injury in rats of all age groups. Maximal shifts in cAMP/cGMP ratio were noted in nonpuberal animals, whereas maximal adaptive-compensatory abilities in the regulation system of calcium homeostasis and cyclic nucleotides are typical to adolescent puberal animals